WorldWideScience

Sample records for canine genomic dna

  1. Characterization of canine osteosarcoma by array comparative genomic hybridization and RT-qPCR: signatures of genomic imbalance in canine osteosarcoma parallel the human counterpart.

    Science.gov (United States)

    Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew

    2011-11-01

    Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.

  2. Genomic instability and telomere fusion of canine osteosarcoma cells.

    Directory of Open Access Journals (Sweden)

    Junko Maeda

    Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

  3. Canine adenovirus type 2 vector generation via I-Sce1-mediated intracellular genome release.

    Directory of Open Access Journals (Sweden)

    Sandy Ibanes

    Full Text Available When canine adenovirus type 2 (CAdV-2, or also commonly referred to as CAV-2 vectors are injected into the brain parenchyma they preferentially transduce neurons, are capable of efficient axonal transport to afferent regions, and allow transgene expression for at last >1 yr. Yet, translating these data into a user-friendly vector platform has been limited because CAV-2 vector generation is challenging. Generation of E1-deleted adenovirus vectors often requires transfection of linear DNA fragments of >30 kb containing the vector genome into an E1-transcomplementing cell line. In contrast to human adenovirus type 5 vector generation, CAV-2 vector generation is less efficient due, in part, to a reduced ability to initiate replication and poor transfectibility of canine cells with large, linear DNA fragments. To improve CAV-2 vector generation, we generated an E1-transcomplementing cell line expressing the estrogen receptor (ER fused to I-SceI, a yeast meganuclease, and plasmids containing the I-SceI recognition sites flanking the CAV-2 vector genome. Using transfection of supercoiled plasmid and intracellular genome release via 4-OH-tamoxifen-induced nuclear translocation of I-SceI, we improved CAV-2 vector titers 1,000 fold, and in turn increased the efficacy of CAV-2 vector generation.

  4. Canine Adenovirus Type 2 Vector Generation via I-Sce1-Mediated Intracellular Genome Release

    Science.gov (United States)

    Ibanes, Sandy; Kremer, Eric J.

    2013-01-01

    When canine adenovirus type 2 (CAdV-2, or also commonly referred to as CAV-2) vectors are injected into the brain parenchyma they preferentially transduce neurons, are capable of efficient axonal transport to afferent regions, and allow transgene expression for at last >1 yr. Yet, translating these data into a user-friendly vector platform has been limited because CAV-2 vector generation is challenging. Generation of E1-deleted adenovirus vectors often requires transfection of linear DNA fragments of >30 kb containing the vector genome into an E1-transcomplementing cell line. In contrast to human adenovirus type 5 vector generation, CAV-2 vector generation is less efficient due, in part, to a reduced ability to initiate replication and poor transfectibility of canine cells with large, linear DNA fragments. To improve CAV-2 vector generation, we generated an E1-transcomplementing cell line expressing the estrogen receptor (ER) fused to I-SceI, a yeast meganuclease, and plasmids containing the I-SceI recognition sites flanking the CAV-2 vector genome. Using transfection of supercoiled plasmid and intracellular genome release via 4-OH-tamoxifen-induced nuclear translocation of I-SceI, we improved CAV-2 vector titers 1,000 fold, and in turn increased the efficacy of CAV-2 vector generation. PMID:23936483

  5. Nuclear DNA-Content in Mesenchymal Lesions in Dogs: Its Value as Marker of Malignancy and Extent of Genomic Instability

    International Nuclear Information System (INIS)

    Boerkamp, Kim M.; Rutteman, Gerard R.; Kik, Marja J. L.; Kirpensteijn, Jolle; Schulze, Christoph; Grinwis, Guy C. M.

    2012-01-01

    DNA-aneuploidy may reflect the malignant nature of mesenchymal proliferations and herald gross genomic instability as a mechanistic factor in tumor genesis. DNA-ploidy and -index were determined by flow cytometry in canine inflammatory or neoplastic mesenchymal tissues and related to clinico-pathological features, biological behavior and p53 gene mutational status. Half of all sarcomas were aneuploid. Benign mesenchymal neoplasms were rarely aneuploid and inflammatory lesions not at all. The aneuploidy rate was comparable to that reported for human sarcomas with significant variation amongst subtypes. DNA-ploidy status in canines lacked a relation with histological grade of malignancy, in contrast to human sarcomas. While aneuploidy was related to the development of metastases in soft tissue sarcomas it was not in osteosarcomas. No relation amongst sarcomas was found between ploidy status and presence of P53 gene mutations. Heterogeneity of the DNA index between primary and metastatic sarcoma sites was present in half of the cases examined. Hypoploidy is more common in canine sarcomas and hyperploid cases have less deviation of the DNA index than human sarcomas. The variation in the presence and extent of aneuploidy amongst sarcoma subtypes indicates variation in genomic instability. This study strengthens the concept of interspecies variation in the evolution of gross chromosomal aberrations during cancer development

  6. Nuclear DNA-Content in Mesenchymal Lesions in Dogs: Its Value as Marker of Malignancy and Extent of Genomic Instability

    Science.gov (United States)

    Boerkamp, Kim M.; Rutteman, Gerard R.; Kik, Marja J. L.; Kirpensteijn, Jolle; Schulze, Christoph; Grinwis, Guy C. M.

    2012-01-01

    DNA-aneuploidy may reflect the malignant nature of mesenchymal proliferations and herald gross genomic instability as a mechanistic factor in tumor genesis. DNA-ploidy and -index were determined by flow cytometry in canine inflammatory or neoplastic mesenchymal tissues and related to clinico-pathological features, biological behavior and p53 gene mutational status. Half of all sarcomas were aneuploid. Benign mesenchymal neoplasms were rarely aneuploid and inflammatory lesions not at all. The aneuploidy rate was comparable to that reported for human sarcomas with significant variation amongst subtypes. DNA-ploidy status in canines lacked a relation with histological grade of malignancy, in contrast to human sarcomas. While aneuploidy was related to the development of metastases in soft tissue sarcomas it was not in osteosarcomas. No relation amongst sarcomas was found between ploidy status and presence of P53 gene mutations. Heterogeneity of the DNA index between primary and metastatic sarcoma sites was present in half of the cases examined. Hypoploidy is more common in canine sarcomas and hyperploid cases have less deviation of the DNA index than human sarcomas. The variation in the presence and extent of aneuploidy amongst sarcoma subtypes indicates variation in genomic instability. This study strengthens the concept of interspecies variation in the evolution of gross chromosomal aberrations during cancer development. PMID:24213507

  7. Nuclear DNA-Content in Mesenchymal Lesions in Dogs: Its Value as Marker of Malignancy and Extent of Genomic Instability

    Energy Technology Data Exchange (ETDEWEB)

    Boerkamp, Kim M., E-mail: K.M.Boerkamp@uu.nl; Rutteman, Gerard R. [Department of Clinical Science of Companion Animals, Faculty of Veterinary Medicine, UU, Yalelaan 104, 3584 CM, Utrecht (Netherlands); Kik, Marja J. L. [Department of Pathobiology, Faculty of Veterinary Medicine, UU, Yalelaan 1, 3508 TD, Utrecht (Netherlands); Kirpensteijn, Jolle [Department of Clinical Science of Companion Animals, Faculty of Veterinary Medicine, UU, Yalelaan 104, 3584 CM, Utrecht (Netherlands); Schulze, Christoph; Grinwis, Guy C. M. [Department of Pathobiology, Faculty of Veterinary Medicine, UU, Yalelaan 1, 3508 TD, Utrecht (Netherlands)

    2012-12-03

    DNA-aneuploidy may reflect the malignant nature of mesenchymal proliferations and herald gross genomic instability as a mechanistic factor in tumor genesis. DNA-ploidy and -index were determined by flow cytometry in canine inflammatory or neoplastic mesenchymal tissues and related to clinico-pathological features, biological behavior and p53 gene mutational status. Half of all sarcomas were aneuploid. Benign mesenchymal neoplasms were rarely aneuploid and inflammatory lesions not at all. The aneuploidy rate was comparable to that reported for human sarcomas with significant variation amongst subtypes. DNA-ploidy status in canines lacked a relation with histological grade of malignancy, in contrast to human sarcomas. While aneuploidy was related to the development of metastases in soft tissue sarcomas it was not in osteosarcomas. No relation amongst sarcomas was found between ploidy status and presence of P53 gene mutations. Heterogeneity of the DNA index between primary and metastatic sarcoma sites was present in half of the cases examined. Hypoploidy is more common in canine sarcomas and hyperploid cases have less deviation of the DNA index than human sarcomas. The variation in the presence and extent of aneuploidy amongst sarcoma subtypes indicates variation in genomic instability. This study strengthens the concept of interspecies variation in the evolution of gross chromosomal aberrations during cancer development.

  8. Nuclear DNA-Content in Mesenchymal Lesions in Dogs: Its Value as Marker of Malignancy and Extent of Genomic Instability

    Directory of Open Access Journals (Sweden)

    Christoph Schulze

    2012-12-01

    Full Text Available DNA-aneuploidy may reflect the malignant nature of mesenchymal proliferations and herald gross genomic instability as a mechanistic factor in tumor genesis. DNA-ploidy and -index were determined by flow cytometry in canine inflammatory or neoplastic mesenchymal tissues and related to clinico-pathological features, biological behavior and p53 gene mutational status. Half of all sarcomas were aneuploid. Benign mesenchymal neoplasms were rarely aneuploid and inflammatory lesions not at all. The aneuploidy rate was comparable to that reported for human sarcomas with significant variation amongst subtypes. DNA-ploidy status in canines lacked a relation with histological grade of malignancy, in contrast to human sarcomas. While aneuploidy was related to the development of metastases in soft tissue sarcomas it was not in osteosarcomas. No relation amongst sarcomas was found between ploidy status and presence of P53 gene mutations. Heterogeneity of the DNA index between primary and metastatic sarcoma sites was present in half of the cases examined. Hypoploidy is more common in canine sarcomas and hyperploid cases have less deviation of the DNA index than human sarcomas. The variation in the presence and extent of aneuploidy amongst sarcoma subtypes indicates variation in genomic instability. This study strengthens the concept of interspecies variation in the evolution of gross chromosomal aberrations during cancer development.

  9. 78 FR 29698 - Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA

    Science.gov (United States)

    2013-05-21

    ...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...

  10. Chromosomal mapping of canine-derived BAC clones to the red fox and American mink genomes.

    Science.gov (United States)

    Kukekova, Anna V; Vorobieva, Nadegda V; Beklemisheva, Violetta R; Johnson, Jennifer L; Temnykh, Svetlana V; Yudkin, Dmitry V; Trut, Lyudmila N; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D; Acland, Gregory M; Graphodatsky, Alexander S

    2009-01-01

    High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene-containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations.

  11. Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA.

    Science.gov (United States)

    Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb

    2017-07-01

    Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.

  12. Canine urothelial carcinoma: genomically aberrant and comparatively relevant.

    Science.gov (United States)

    Shapiro, S G; Raghunath, S; Williams, C; Motsinger-Reif, A A; Cullen, J M; Liu, T; Albertson, D; Ruvolo, M; Bergstrom Lucas, A; Jin, J; Knapp, D W; Schiffman, J D; Breen, M

    2015-06-01

    Urothelial carcinoma (UC), also referred to as transitional cell carcinoma (TCC), is the most common bladder malignancy in both human and canine populations. In human UC, numerous studies have demonstrated the prevalence of chromosomal imbalances. Although the histopathology of the disease is similar in both species, studies evaluating the genomic profile of canine UC are lacking, limiting the discovery of key comparative molecular markers associated with driving UC pathogenesis. In the present study, we evaluated 31 primary canine UC biopsies by oligonucleotide array comparative genomic hybridization (oaCGH). Results highlighted the presence of three highly recurrent numerical aberrations: gain of dog chromosome (CFA) 13 and 36 and loss of CFA 19. Regional gains of CFA 13 and 36 were present in 97 % and 84 % of cases, respectively, and losses on CFA 19 were present in 77 % of cases. Fluorescence in situ hybridization (FISH), using targeted bacterial artificial chromosome (BAC) clones and custom Agilent SureFISH probes, was performed to detect and quantify these regions in paraffin-embedded biopsy sections and urine-derived urothelial cells. The data indicate that these three aberrations are potentially diagnostic of UC. Comparison of our canine oaCGH data with that of 285 human cases identified a series of shared copy number aberrations. Using an informatics approach to interrogate the frequency of copy number aberrations across both species, we identified those that had the highest joint probability of association with UC. The most significant joint region contained the gene PABPC1, which should be considered further for its role in UC progression. In addition, cross-species filtering of genome-wide copy number data highlighted several genes as high-profile candidates for further analysis, including CDKN2A, S100A8/9, and LRP1B. We propose that these common aberrations are indicative of an evolutionarily conserved mechanism of pathogenesis and harbor genes

  13. Genomic prediction of traits related to canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    Enrique eSanchez-Molano

    2015-03-01

    Full Text Available Increased concern for the welfare of pedigree dogs has led to development of selection programs against inherited diseases. An example is canine hip dysplasia (CHD, which has a moderate heritability and a high prevalence in some large-sized breeds. To date, selection using phenotypes has led to only modest improvement, and alternative strategies such as genomic selection may prove more effective. The primary aims of this study were to compare the performance of pedigree- and genomic-based breeding against CHD in the UK Labrador retriever population and to evaluate the performance of different genomic selection methods. A sample of 1179 Labrador Retrievers evaluated for CHD according to the UK scoring method (hip score, HS was genotyped with the Illumina CanineHD BeadChip. Twelve functions of HS and its component traits were analyzed using different statistical methods (GBLUP, Bayes C and Single-Step methods, and results were compared with a pedigree-based approach (BLUP using cross-validation. Genomic methods resulted in similar or higher accuracies than pedigree-based methods with training sets of 944 individuals for all but the untransformed HS, suggesting that genomic selection is an effective strategy. GBLUP and Bayes C gave similar prediction accuracies for HS and related traits, indicating a polygenic architecture. This conclusion was also supported by the low accuracies obtained in additional GBLUP analyses performed using only the SNPs with highest test statistics, also indicating that marker-assisted selection would not be as effective as genomic selection. A Single-Step method that combines genomic and pedigree information also showed higher accuracy than GBLUP and Bayes C for the log-transformed HS, which is currently used for pedigree based evaluations in UK. In conclusion, genomic selection is a promising alternative to pedigree-based selection against CHD, requiring more phenotypes with genomic data to improve further the accuracy

  14. Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.

    OpenAIRE

    McMaster, G K; Tratschin, J D; Siegl, G

    1981-01-01

    The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.

  15. First complete genome sequence of canine bocavirus 2 in mainland China

    Directory of Open Access Journals (Sweden)

    S.-L. Zhai

    2017-07-01

    Full Text Available We obtained the first full-length genome sequence of canine bocavirus 2 (CBoV2 from the faeces of a healthy dog in Guangzhou city, Guangdong province, mainland China. The genome of GZHD15 consisted of 5059 nucleotides. Sequence analysis suggested that GZHD15 was close to a previously circulated Hong Kong isolate.

  16. Joint Genomic Prediction of Canine Hip Dysplasia in UK and US Labrador Retrievers

    Directory of Open Access Journals (Sweden)

    Stefan M. Edwards

    2018-03-01

    Full Text Available Canine hip dysplasia, a debilitating orthopedic disorder that leads to osteoarthritis and cartilage degeneration, is common in several large-sized dog breeds and shows moderate heritability suggesting that selection can reduce prevalence. Estimating genomic breeding values require large reference populations, which are expensive to genotype for development of genomic prediction tools. Combining datasets from different countries could be an option to help build larger reference datasets without incurring extra genotyping costs. Our objective was to evaluate genomic prediction based on a combination of UK and US datasets of genotyped dogs with records of Norberg angle scores, related to canine hip dysplasia. Prediction accuracies using a single population were 0.179 and 0.290 for 1,179 and 242 UK and US Labrador Retrievers, respectively. Prediction accuracies changed to 0.189 and 0.260, with an increased bias of genomic breeding values when using a joint training set (biased upwards for the US population and downwards for the UK population. Our results show that in this study of canine hip dysplasia, little or no benefit was gained from using a joint training set as compared to using a single population as training set. We attribute this to differences in the genetic background of the two populations as well as the small sample size of the US dataset.

  17. Complete Genomic Sequence of Canine Distemper Virus from an Ethiopian Wolf.

    Science.gov (United States)

    Marston, Denise A; Watson, Jemma; Wise, Emma L; Ellis, Richard J; Bedin, Eric; Ayalew, Girma; Abute, Muktar; de Lamballerie, Xavier; Fooks, Anthony R; Sillero-Zubiri, Claudio; Banyard, Ashley C

    2017-07-20

    Canine distemper virus (CDV) has been implicated in population declines of wildlife, including many threatened species. Here we present the full genome of CDV from an Ethiopian wolf, Canis simensis , the world's rarest and most endangered canid. © Crown copyright 2017.

  18. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.

    Science.gov (United States)

    Berger, C; Berger, B; Parson, W

    2012-01-01

    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  19. Genome-wide association study identifies a novel canine glaucoma locus.

    Directory of Open Access Journals (Sweden)

    Saija J Ahonen

    Full Text Available Glaucoma is an optic neuropathy and one of the leading causes of blindness. Its hereditary forms are classified into primary closed-angle (PCAG, primary open-angle (POAG and primary congenital glaucoma (PCG. Although many loci have been mapped in human, only a few genes have been identified that are associated with the development of glaucoma and the genetic basis of the disease remains poorly understood. Glaucoma has also been described in many dog breeds, including Dandie Dinmont Terriers (DDT in which it is a late-onset (>7 years disease. We designed clinical and genetic studies to better define the clinical features of glaucoma in the DDT and to identify the genetic cause. Clinical diagnosis was based on ophthalmic examinations of the affected dogs and 18 additionally investigated unaffected DDTs. We collected DNA from over 400 DTTs and a genome wide association study was performed in a cohort of 23 affected and 23 controls, followed by a fine mapping, a replication study and candidate gene sequencing. The clinical study suggested that ocular abnormalities including abnormal iridocorneal angles and pectinate ligament dysplasia are common (50% and 72%, respectively in the breed and the disease resembles human PCAG. The genetic study identified a novel 9.5 Mb locus on canine chromosome 8 including the 1.6 Mb best associated region (p = 1.63 × 10(-10, OR = 32 for homozygosity. Mutation screening in five candidate genes did not reveal any causative variants. This study indicates that although ocular abnormalities are common in DDTs, the genetic risk for glaucoma is conferred by a novel locus on CFA8. The canine locus shares synteny to a region in human chromosome 14q, which harbors several loci associated with POAG and PCG. Our study reveals a new locus for canine glaucoma and ongoing molecular studies will likely help to understand the genetic etiology of the disease.

  20. A meiotic linkage map of the silver fox, aligned and compared to the canine genome.

    Science.gov (United States)

    Kukekova, Anna V; Trut, Lyudmila N; Oskina, Irina N; Johnson, Jennifer L; Temnykh, Svetlana V; Kharlamova, Anastasiya V; Shepeleva, Darya V; Gulievich, Rimma G; Shikhevich, Svetlana G; Graphodatsky, Alexander S; Aguirre, Gustavo D; Acland, Gregory M

    2007-03-01

    A meiotic linkage map is essential for mapping traits of interest and is often the first step toward understanding a cryptic genome. Specific strains of silver fox (a variant of the red fox, Vulpes vulpes), which segregate behavioral and morphological phenotypes, create a need for such a map. One such strain, selected for docility, exhibits friendly dog-like responses to humans, in contrast to another strain selected for aggression. Development of a fox map is facilitated by the known cytogenetic homologies between the dog and fox, and by the availability of high resolution canine genome maps and sequence data. Furthermore, the high genomic sequence identity between dog and fox allows adaptation of canine microsatellites for genotyping and meiotic mapping in foxes. Using 320 such markers, we have constructed the first meiotic linkage map of the fox genome. The resulting sex-averaged map covers 16 fox autosomes and the X chromosome with an average inter-marker distance of 7.5 cM. The total map length corresponds to 1480.2 cM. From comparison of sex-averaged meiotic linkage maps of the fox and dog genomes, suppression of recombination in pericentromeric regions of the metacentric fox chromosomes was apparent, relative to the corresponding segments of acrocentric dog chromosomes. Alignment of the fox meiotic map against the 7.6x canine genome sequence revealed high conservation of marker order between homologous regions of the two species. The fox meiotic map provides a critical tool for genetic studies in foxes and identification of genetic loci and genes implicated in fox domestication.

  1. Genome Sequence of Canine Polyomavirus in Respiratory Secretions of Dogs with Pneumonia of Unknown Etiology.

    Science.gov (United States)

    Delwart, Eric; Kapusinszky, Beatrix; Pesavento, Patricia A; Estrada, Marko; Seguin, M Alexis; Leutenegger, Christian M

    2017-07-20

    We report here the first canine polyomavirus genome, identified by metagenomics in respiratory secretions of two dogs with severe pneumonia, which tested negative for all canine respiratory pathogens except Mycoplasma cynos The isolate, Canis familiaris polyomavirus 1 (DogPyV-1), is a beta polyomavirus whose closest known LT antigen relatives are primate polyomaviruses. Copyright © 2017 Delwart et al.

  2. Investigation of cell-free DNA in canine plasma and its relation to disease.

    Science.gov (United States)

    Burnett, Deborah L; Cave, Nicholas J; Gedye, Kristene R; Bridges, Janis P

    2016-09-01

    DNA is released from dying cells during apoptosis and necrosis. This cell-free DNA (cfDNA) diffuses into the plasma where it can be measured. In humans, an increase in cfDNA correlates with disease severity and prognosis. It was hypothesized that when DNA in canine plasma was measured by emission fluorometry without prior DNA extraction, the concentration of cfDNA would increase with disease severity. The diseased population consisted of 97 client-owned dogs. The clinically normal population consisted of nine client-owned dogs presenting for 'wellness screens', and 15 colony-owned Harrier Hounds. Plasma cfDNA was measured by fluorometry without prior DNA extraction. The effects of ex vivo storage conditions were evaluated in plasma from two clinically normal dogs. In all other dogs, plasma was separated within two hours of collection. The association between the cfDNA concentration in hospitalized dogs and a variety of clinical, clinicopathological and outcome variables was tested. The concentration of cfDNA was reliably measured when plasma was separated within two hours of blood collection. The diseased dogs had significantly higher cfDNA than clinically normal dogs (P Dogs that did not survive to discharge had significantly higher cfDNA concentrations than survivors (P = 0.02). Conclusions/Clinical Importance: The concentration of cfDNA in the plasma of diseased dogs is associated with disease severity and prognosis. Measurement of canine cfDNA could be a useful non-specific disease indicator and prognostic tool.

  3. Evaluation of assays for quantification of DNA in canine plasma as an indirect marker of NETosis.

    Science.gov (United States)

    Smith, Stephanie A; Lawson, Corinne M; McMichael, Maureen A; Jung, Katrina; O'Brien, Mauria; Achiel, Ron

    2017-06-01

    Neutrophil extracellular traps (NET), consisting of a filamentous DNA/chromatin-histone scaffold originating from neutrophils are part of the innate immune response, may be released under a variety of inflammatory conditions and are associated with an increased risk for thrombosis. The purpose of this study was to evaluate a SYTOX green fluorescence assay and a histone-DNA complex (hisDNA) ELISA for quantification of NET-related DNA in canine plasma. The influence of variations in blood sample handling on assay results was tested. Accuracy of the SYTOX green fluorescence and the hisDNA ELISA was evaluated with dilutional linearity using serial dilutions. Interference was assessed by addition of purified bilirubin or hemoglobin. Precision was determined by calculating the intra- and inter-assay CV. Preanalytic sample handling did not influence DNA measurements by either assay. Citrate and EDTA plasma samples were equivalent. For the DNA fluorescence assay, dilutional linearity was poor due to autofluorescence, which was corrected by addition of canine plasma to the diluent. The presence of bilirubin and hemoglobin also increased autofluorescence, and resulted in falsely low concentrations of DNA. On the hisDNA ELISA, pigmentemia had no effect. Both assays as modified in this study are suitable for measuring DNA in canine EDTA or citrate plasma. However, performance of the fluorescence assay was impacted by pigmentemia, and it was less sensitive than the ELISA in detecting the presence of nucleosome material in the plasma. © 2017 American Society for Veterinary Clinical Pathology.

  4. Short interspersed elements (SINEs) are a major source of canine genomic diversity.

    Science.gov (United States)

    Wang, Wei; Kirkness, Ewen F

    2005-12-01

    SINEs are retrotransposons that have enjoyed remarkable reproductive success during the course of mammalian evolution, and have played a major role in shaping mammalian genomes. Previously, an analysis of survey-sequence data from an individual dog (a poodle) indicated that canine genomes harbor a high frequency of alleles that differ only by the absence or presence of a SINEC_Cf repeat. Comparison of this survey-sequence data with a draft genome sequence of a distinct dog (a boxer) has confirmed this prediction, and revealed the chromosomal coordinates for >10,000 loci that are bimorphic for SINEC_Cf insertions. Analysis of SINE insertion sites from the genomes of nine additional dogs indicates that 3%-5% are absent from either the poodle or boxer genome sequences--suggesting that an additional 10,000 bimorphic loci could be readily identified in the general dog population. We describe a methodology that can be used to identify these loci, and could be adapted to exploit these bimorphic loci for genotyping purposes. Approximately half of all annotated canine genes contain SINEC_Cf repeats, and these elements are occasionally transcribed. When transcribed in the antisense orientation, they provide splice acceptor sites that can result in incorporation of novel exons. The high frequency of bimorphic SINE insertions in the dog population is predicted to provide numerous examples of allele-specific transcription patterns that will be valuable for the study of differential gene expression among multiple dog breeds.

  5. Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

    Science.gov (United States)

    Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

    2016-04-01

    A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.

  6. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    Science.gov (United States)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  7. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter

    2009-01-01

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...

  8. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  9. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  10. A novel bocavirus in canine liver

    Directory of Open Access Journals (Sweden)

    Li Linlin

    2013-02-01

    Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

  11. Genomic organization of the canine herpesvirus US region.

    Science.gov (United States)

    Haanes, E J; Tomlinson, C C

    1998-02-01

    Canine herpesvirus (CHV) is an alpha-herpesvirus of limited pathogenicity in healthy adult dogs and infectivity of the virus appears to be largely limited to cells of canine origin. CHV's low virulence and species specificity make it an attractive candidate for a recombinant vaccine vector to protect dogs against a variety of pathogens. As part of the analysis of the CHV genome, the authors determined the complete nucleotide sequence of the CHV US region as well as portions of the flanking inverted repeats. Seven full open reading frames (ORFs) encoding proteins larger than 100 amino acids were identified within, or partially within the CHV US: cUS2, cUS3, cUS4, cUS6, cUS7, cUS8 and cUS9; which are homologs of the herpes simplex virus type-1 US2; protein kinase; gG, gD, gI, gE; and US9 genes, respectively. An eighth ORF was identified in the inverted repeat region, cIR6, a homolog of the equine herpesvirus type-1 IR6 gene. The authors identified and mapped most of the major transcripts for the predicted CHV US ORFs by Northern analysis.

  12. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Science.gov (United States)

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  13. Genome-wide mapping of DNA strand breaks.

    Directory of Open Access Journals (Sweden)

    Frédéric Leduc

    Full Text Available Determination of cellular DNA damage has so far been limited to global assessment of genome integrity whereas nucleotide-level mapping has been restricted to specific loci by the use of specific primers. Therefore, only limited DNA sequences can be studied and novel regions of genomic instability can hardly be discovered. Using a well-characterized yeast model, we describe a straightforward strategy to map genome-wide DNA strand breaks without compromising nucleotide-level resolution. This technique, termed "damaged DNA immunoprecipitation" (dDIP, uses immunoprecipitation and the terminal deoxynucleotidyl transferase-mediated dUTP-biotin end-labeling (TUNEL to capture DNA at break sites. When used in combination with microarray or next-generation sequencing technologies, dDIP will allow researchers to map genome-wide DNA strand breaks as well as other types of DNA damage and to establish a clear profiling of altered genes and/or intergenic sequences in various experimental conditions. This mapping technique could find several applications for instance in the study of aging, genotoxic drug screening, cancer, meiosis, radiation and oxidative DNA damage.

  14. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  15. Genome instabilities arising from ribonucleotides in DNA.

    Science.gov (United States)

    Klein, Hannah L

    2017-08-01

    Genomic DNA is transiently contaminated with ribonucleotide residues during the process of DNA replication through misincorporation by the replicative DNA polymerases α, δ and ε, and by the normal replication process on the lagging strand, which uses RNA primers. These ribonucleotides are efficiently removed during replication by RNase H enzymes and the lagging strand synthesis machinery. However, when ribonucleotides remain in DNA they can distort the DNA helix, affect machineries for DNA replication, transcription and repair, and can stimulate genomic instabilities which are manifest as increased mutation, recombination and chromosome alterations. The genomic instabilities associated with embedded ribonucleotides are considered here, along with a discussion of the origin of the lesions that stimulate particular classes of instabilities. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.

    Science.gov (United States)

    Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D

    2000-12-01

    To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

  17. Human Genome Research: Decoding DNA

    Science.gov (United States)

    dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human

  18. Pharmacological targeting of valosin containing protein (VCP) induces DNA damage and selectively kills canine lymphoma cells

    International Nuclear Information System (INIS)

    Nadeau, Marie-Ève; Rico, Charlène; Tsoi, Mayra; Vivancos, Mélanie; Filimon, Sabin; Paquet, Marilène; Boerboom, Derek

    2015-01-01

    Valosin containing protein (VCP) is a critical mediator of protein homeostasis and may represent a valuable therapeutic target for several forms of cancer. Overexpression of VCP occurs in many cancers, and often in a manner correlating with malignancy and poor outcome. Here, we analyzed VCP expression in canine lymphoma and assessed its potential as a therapeutic target for this disease. VCP expression in canine lymphomas was evaluated by immunoblotting and immunohistochemistry. The canine lymphoma cell lines CLBL-1, 17–71 and CL-1 were treated with the VCP inhibitor Eeyarestatin 1 (EER-1) at varying concentrations and times and were assessed for viability by trypan blue exclusion, apoptosis by TUNEL and caspase activity assays, and proliferation by propidium iodide incorporation and FACS. The mechanism of EER-1 action was determined by immunoblotting and immunofluorescence analyses of Lys48 ubiquitin and markers of ER stress (DDIT3), autophagy (SQSTM1, MAP1LC3A) and DNA damage (γH2AFX). TRP53/ATM-dependent signaling pathway activity was assessed by immunoblotting for TRP53 and phospho-TRP53 and real-time RT-PCR measurement of Cdkn1a mRNA. VCP expression levels in canine B cell lymphomas were found to increase with grade. EER-1 treatment killed canine lymphoma cells preferentially over control peripheral blood mononuclear cells. EER-1 treatment of CLBL-1 cells was found to both induce apoptosis and cell cycle arrest in G1. Unexpectedly, EER-1 did not appear to act either by inducing ER stress or inhibiting the aggresome-autophagy pathway. Rather, a rapid and dramatic increase in γH2AFX expression was noted, indicating that EER-1 may act by promoting DNA damage accumulation. Increased TRP53 phosphorylation and Cdkn1a mRNA levels indicated an activation of the TRP53/ATM DNA damage response pathway in response to EER-1, likely contributing to the induction of apoptosis and cell cycle arrest. These results correlate VCP expression with malignancy in canine B cell

  19. Genome-wide DNA polymorphism analyses using VariScan

    Directory of Open Access Journals (Sweden)

    Vilella Albert J

    2006-09-01

    Full Text Available Abstract Background DNA sequence polymorphisms analysis can provide valuable information on the evolutionary forces shaping nucleotide variation, and provides an insight into the functional significance of genomic regions. The recent ongoing genome projects will radically improve our capabilities to detect specific genomic regions shaped by natural selection. Current available methods and software, however, are unsatisfactory for such genome-wide analysis. Results We have developed methods for the analysis of DNA sequence polymorphisms at the genome-wide scale. These methods, which have been tested on a coalescent-simulated and actual data files from mouse and human, have been implemented in the VariScan software package version 2.0. Additionally, we have also incorporated a graphical-user interface. The main features of this software are: i exhaustive population-genetic analyses including those based on the coalescent theory; ii analysis adapted to the shallow data generated by the high-throughput genome projects; iii use of genome annotations to conduct a comprehensive analyses separately for different functional regions; iv identification of relevant genomic regions by the sliding-window and wavelet-multiresolution approaches; v visualization of the results integrated with current genome annotations in commonly available genome browsers. Conclusion VariScan is a powerful and flexible suite of software for the analysis of DNA polymorphisms. The current version implements new algorithms, methods, and capabilities, providing an important tool for an exhaustive exploratory analysis of genome-wide DNA polymorphism data.

  20. [Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

    Science.gov (United States)

    Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

  1. Comparison of three methods for recovery of Brucella canis DNA from canine blood samples.

    Science.gov (United States)

    Batinga, Maria Cryskely A; Dos Santos, Jaíne C; Lima, Julia T R; Bigotto, Maria Fernanda D; Muner, Kerstin; Faita, Thalita; Soares, Rodrigo M; da Silva, David A V; Oliveira, Trícia M F S; Ferreira, Helena L; Diniz, Jaqueline A; Keid, Lara B

    2017-12-01

    Brucella canis, a gram-negative, facultative intracellular and zoonotic bacterium causes canine brucellosis. Direct methods are the most appropriate for the detection of canine brucellosis and bacterial isolation from blood samples has been employed as gold-standard method. However, due to the delay in obtaining results and the biological risk of the bacterial culturing, the polymerase chain reaction (PCR) has been successfully used as an alternative method for the diagnosis of the infection. Sample preparation is a key step for successful PCR and protocols that provide high DNA yield and purity are recommended to ensure high diagnostic sensitivity. The objective of this study was to evaluate the performance of PCR for the diagnosis of B. canis infection in 36 dogs by testing DNA of whole blood obtained through different extraction and purification protocols. Methods 1 and 2 were based on a commercial kit, using protocols recommended for DNA purification of whole blood and tissue samples, respectively. Method 3 was an in-house method based on enzymatic lysis and purification using organic solvents. The results of the PCR on samples obtained through three different DNA extraction protocols were compared to the blood culture. Of the 36 dogs, 13 (36.1%) were positive by blood culturing, while nine (25.0%), 14 (38.8%), and 15 (41.6%) were positive by PCR after DNA extraction using methods 1, 2 and 3, respectively. PCR performed on DNA purified by Method 2 was as efficient as blood culturing and PCR performed on DNA purified with in-house method, but had the advantage of being less laborious and, therefore, a suitable alternative for the direct B. canis detection in dogs. Copyright © 2017. Published by Elsevier B.V.

  2. Sequencing intractable DNA to close microbial genomes.

    Directory of Open Access Journals (Sweden)

    Richard A Hurt

    Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  3. Sequencing Intractable DNA to Close Microbial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL

    2012-01-01

    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  4. Construction of an infectious clone of canine herpesvirus genome as a bacterial artificial chromosome.

    Science.gov (United States)

    Arii, Jun; Hushur, Orkash; Kato, Kentaro; Kawaguchi, Yasushi; Tohya, Yukinobu; Akashi, Hiroomi

    2006-04-01

    Canine herpesvirus (CHV) is an attractive candidate not only for use as a recombinant vaccine to protect dogs from a variety of canine pathogens but also as a viral vector for gene therapy in domestic animals. However, developments in this area have been impeded by the complicated techniques used for eukaryotic homologous recombination. To overcome these problems, we used bacterial artificial chromosomes (BACs) to generate infectious BACs. Our findings may be summarized as follows: (i) the CHV genome (pCHV/BAC), in which a BAC flanked by loxP sites was inserted into the thymidine kinase gene, was maintained in Escherichia coli; (ii) transfection of pCHV/BAC into A-72 cells resulted in the production of infectious virus; (iii) the BAC vector sequence was almost perfectly excisable from the genome of the reconstituted virus CHV/BAC by co-infection with CHV/BAC and a recombinant adenovirus that expressed the Cre recombinase; and (iv) a recombinant virus in which the glycoprotein C gene was deleted was generated by lambda recombination followed by Flp recombination, which resulted in a reduction in viral titer compared with that of the wild-type virus. The infectious clone pCHV/BAC is useful for the modification of the CHV genome using bacterial genetics, and CHV/BAC should have multiple applications in the rapid generation of genetically engineered CHV recombinants and the development of CHV vectors for vaccination and gene therapy in domestic animals.

  5. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  6. TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

    Science.gov (United States)

    Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

    2016-01-01

    This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.

  7. Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain

    International Nuclear Information System (INIS)

    Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu

    2004-01-01

    In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis

  8. Differential DNA Methylation Analysis without a Reference Genome

    Directory of Open Access Journals (Sweden)

    Johanna Klughammer

    2015-12-01

    Full Text Available Genome-wide DNA methylation mapping uncovers epigenetic changes associated with animal development, environmental adaptation, and species evolution. To address the lack of high-throughput methods for DNA methylation analysis in non-model organisms, we developed an integrated approach for studying DNA methylation differences independent of a reference genome. Experimentally, our method relies on an optimized 96-well protocol for reduced representation bisulfite sequencing (RRBS, which we have validated in nine species (human, mouse, rat, cow, dog, chicken, carp, sea bass, and zebrafish. Bioinformatically, we developed the RefFreeDMA software to deduce ad hoc genomes directly from RRBS reads and to pinpoint differentially methylated regions between samples or groups of individuals (http://RefFreeDMA.computational-epigenetics.org. The identified regions are interpreted using motif enrichment analysis and/or cross-mapping to annotated genomes. We validated our method by reference-free analysis of cell-type-specific DNA methylation in the blood of human, cow, and carp. In summary, we present a cost-effective method for epigenome analysis in ecology and evolution, which enables epigenome-wide association studies in natural populations and species without a reference genome.

  9. Defining functional DNA elements in the human genome

    Science.gov (United States)

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

    2014-01-01

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  10. DNA Repair and Genome Maintenance in Bacillus subtilis

    Science.gov (United States)

    Lenhart, Justin S.; Schroeder, Jeremy W.; Walsh, Brian W.

    2012-01-01

    Summary: From microbes to multicellular eukaryotic organisms, all cells contain pathways responsible for genome maintenance. DNA replication allows for the faithful duplication of the genome, whereas DNA repair pathways preserve DNA integrity in response to damage originating from endogenous and exogenous sources. The basic pathways important for DNA replication and repair are often conserved throughout biology. In bacteria, high-fidelity repair is balanced with low-fidelity repair and mutagenesis. Such a balance is important for maintaining viability while providing an opportunity for the advantageous selection of mutations when faced with a changing environment. Over the last decade, studies of DNA repair pathways in bacteria have demonstrated considerable differences between Gram-positive and Gram-negative organisms. Here we review and discuss the DNA repair, genome maintenance, and DNA damage checkpoint pathways of the Gram-positive bacterium Bacillus subtilis. We present their molecular mechanisms and compare the functions and regulation of several pathways with known information on other organisms. We also discuss DNA repair during different growth phases and the developmental program of sporulation. In summary, we present a review of the function, regulation, and molecular mechanisms of DNA repair and mutagenesis in Gram-positive bacteria, with a strong emphasis on B. subtilis. PMID:22933559

  11. Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.

    Directory of Open Access Journals (Sweden)

    Nicola Decaro

    Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.

  12. Direct detection of chicken genomic DNA for gender determination by thymine-DNA glycosylase.

    Science.gov (United States)

    Porat, N; Bogdanov, K; Danielli, A; Arie, A; Samina, I; Hadani, A

    2011-02-01

    1. Birds, especially nestlings, are generally difficult to sex by morphology and early detection of chick gender in ovo in the hatchery would facilitate removal of unwanted chicks and diminish welfare objections regarding culling after hatch. 2. We describe a method to determine chicken gender without the need for PCR via use of Thymine-DNA Glycosylase (TDG). TDG restores thymine (T)/guanine (G) mismatches to cytosine (C)/G. We show here, that like DNA Polymerase, TDG can recognise, bind and function on a primer hybridised to chicken genomic DNA. 3. The primer contained a T to mismatch a G in a chicken genomic template and the T/G was cleaved with high fidelity by TDG. Thus, the chicken genomic DNA can be identified without PCR amplification via direct and linear detection. Sensitivity was increased using gender specific sequences from the chicken genome. 4. Currently, these are laboratory results, but we anticipate that further development will allow this method to be used in non-laboratory settings, where PCR cannot be employed.

  13. Full-length genomic characterization and molecular evolution of canine parvovirus in China.

    Science.gov (United States)

    Zhou, Ling; Tang, Qinghai; Shi, Lijun; Kong, Miaomiao; Liang, Lin; Mao, Qianqian; Bu, Bin; Yao, Lunguang; Zhao, Kai; Cui, Shangjin; Leal, Élcio

    2016-06-01

    Canine parvovirus type 2 (CPV-2) can cause acute haemorrhagic enteritis in dogs and myocarditis in puppies. This disease has become one of the most serious infectious diseases of dogs. During 2014 in China, there were many cases of acute infectious diarrhoea in dogs. Some faecal samples were negative for the CPV-2 antigen based on a colloidal gold test strip but were positive based on PCR, and a viral strain was isolated from one such sample. The cytopathic effect on susceptible cells and the results of the immunoperoxidase monolayer assay, PCR, and sequencing indicated that the pathogen was CPV-2. The strain was named CPV-NY-14, and the full-length genome was sequenced and analysed. A maximum likelihood tree was constructed using the full-length genome and all available CPV-2 genomes. New strains have replaced the original strain in Taiwan and Italy, although the CPV-2a strain is still predominant there. However, CPV-2a still causes many cases of acute infectious diarrhoea in dogs in China.

  14. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    Ashish

    2013-02-22

    Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...

  15. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    Science.gov (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  16. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  17. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  18. Safety of administering the canine melanoma DNA vaccine (Oncept) to cats with malignant melanoma - a retrospective study.

    Science.gov (United States)

    Sarbu, Luminita; Kitchell, Barbara E; Bergman, Philip J

    2017-02-01

    Objectives A xenogeneic human tyrosinase DNA vaccine was developed for treatment of dogs with oral malignant melanoma (Oncept; Merial). No studies have evaluated the safety or efficacy of this vaccine in cats. The purpose of this study was to evaluate the safety of the canine melanoma vaccine in cats diagnosed with melanoma. Methods Medical records were reviewed from cats diagnosed with malignant melanoma and treated with the canine melanoma DNA vaccine (Oncept). Data regarding signalment, melanoma location, treatments received, vaccine adverse effects and cause of death were collected. Results A total of 114 melanoma vaccines were administered to 24 cats. Seven cats (11.4%) had clinical adverse effects from a total of 13 vaccines classified as grade 1 or 2 based on the Veterinary Cooperative Oncology Group's common terminology criteria for adverse events v1.1. These included pain on vaccine administration, brief muscle fasciculation, transient inappetence, depression, nausea and mild increase in pigmentation at the injection site. Nineteen cats were deceased at study close. The most common cause of death was melanoma (14 cats). Hematological and biochemical changes were observed in six cats, five of which had concurrent disease or treatments that likely caused or greatly contributed to the laboratory abnormalities found. Therefore, these adverse events were considered unlikely to be caused by the melanoma vaccine. One cat had transient grade 1 hypoalbuminemia, which was possibly caused by the vaccination but not thoroughly evaluated. Conclusions and relevance The canine melanoma DNA vaccine can be safely administered to cats, with minimal risk of adverse effects.

  19. Combinatorial treatment of DNA and chromatin-modifying drugs cause cell death in human and canine osteosarcoma cell lines.

    Directory of Open Access Journals (Sweden)

    Venugopal Thayanithy

    Full Text Available Downregulation of microRNAs (miRNAs at the 14q32 locus stabilizes the expression of cMYC, thus significantly contributing to osteosarcoma (OS pathobiology. Here, we show that downregulation of 14q32 miRNAs is epigenetically regulated. The predicted promoter regions of miRNA clusters at 14q32 locus showed no recurrent patterns of differential methylation, but Saos2 cells showed elevated histone deacetylase (HDAC activity. Treatment with 4-phenylbutyrate increased acetylation of histones associated with 14q32 miRNAs, but interestingly, robust restoration of 14q32 miRNA expression, attenuation of cMYC expression, and induction of apoptosis required concomitant treatment with 5-Azacytidine, an inhibitor of DNA methylation. These events were associated with genome-wide gene expression changes including induction of pro-apoptotic genes and downregulation of cell cycle genes. Comparable effects were achieved in human and canine OS cells using the HDAC inhibitor suberoylanilide hydroxamic acid (SAHA/Vorinostat and the DNA methylation inhibitor Zebularine (Zeb, with significantly more pronounced cytotoxicity in cells whose molecular phenotypes were indicative of aggressive biological behavior. These results suggested that the combination of these chromatin-modifying drugs may be a useful adjuvant in the treatment of rapidly progressive OS.

  20. Early life DNA vaccination with the H gene of Canine distemper virus induces robust protection against distemper

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

    2009-01-01

    Young mink kits (n = 8)were vaccinated withDNA plasmids encoding the viral haemagglutinin protein (H) of a vaccine strain of Canine distemper virus (CDV). Virus neutralising (VN) antibodieswere induced after 2 immunisations and after the third immunisation all kits had high VN antibody titres...

  1. Comparative Genomics of the Genus Porphyromonas Identifies Adaptations for Heme Synthesis within the Prevalent Canine Oral Species Porphyromonas cangingivalis.

    Science.gov (United States)

    O'Flynn, Ciaran; Deusch, Oliver; Darling, Aaron E; Eisen, Jonathan A; Wallis, Corrin; Davis, Ian J; Harris, Stephen J

    2015-11-13

    Porphyromonads play an important role in human periodontal disease and recently have been shown to be highly prevalent in canine mouths. Porphyromonas cangingivalis is the most prevalent canine oral bacterial species in both plaque from healthy gingiva and plaque from dogs with early periodontitis. The ability of P. cangingivalis to flourish in the different environmental conditions characterized by these two states suggests a degree of metabolic flexibility. To characterize the genes responsible for this, the genomes of 32 isolates (including 18 newly sequenced and assembled) from 18 Porphyromonad species from dogs, humans, and other mammals were compared. Phylogenetic trees inferred using core genes largely matched previous findings; however, comparative genomic analysis identified several genes and pathways relating to heme synthesis that were present in P. cangingivalis but not in other Porphyromonads. Porphyromonas cangingivalis has a complete protoporphyrin IX synthesis pathway potentially allowing it to synthesize its own heme unlike pathogenic Porphyromonads such as Porphyromonas gingivalis that acquire heme predominantly from blood. Other pathway differences such as the ability to synthesize siroheme and vitamin B12 point to enhanced metabolic flexibility for P. cangingivalis, which may underlie its prevalence in the canine oral cavity. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Methyl-Analyzer--whole genome DNA methylation profiling.

    Science.gov (United States)

    Xin, Yurong; Ge, Yongchao; Haghighi, Fatemeh G

    2011-08-15

    Methyl-Analyzer is a python package that analyzes genome-wide DNA methylation data produced by the Methyl-MAPS (methylation mapping analysis by paired-end sequencing) method. Methyl-MAPS is an enzymatic-based method that uses both methylation-sensitive and -dependent enzymes covering >80% of CpG dinucleotides within mammalian genomes. It combines enzymatic-based approaches with high-throughput next-generation sequencing technology to provide whole genome DNA methylation profiles. Methyl-Analyzer processes and integrates sequencing reads from methylated and unmethylated compartments and estimates CpG methylation probabilities at single base resolution. Methyl-Analyzer is available at http://github.com/epigenomics/methylmaps. Sample dataset is available for download at http://epigenomicspub.columbia.edu/methylanalyzer_data.html. fgh3@columbia.edu Supplementary data are available at Bioinformatics online.

  3. Genomic signal processing for DNA sequence clustering.

    Science.gov (United States)

    Mendizabal-Ruiz, Gerardo; Román-Godínez, Israel; Torres-Ramos, Sulema; Salido-Ruiz, Ricardo A; Vélez-Pérez, Hugo; Morales, J Alejandro

    2018-01-01

    Genomic signal processing (GSP) methods which convert DNA data to numerical values have recently been proposed, which would offer the opportunity of employing existing digital signal processing methods for genomic data. One of the most used methods for exploring data is cluster analysis which refers to the unsupervised classification of patterns in data. In this paper, we propose a novel approach for performing cluster analysis of DNA sequences that is based on the use of GSP methods and the K-means algorithm. We also propose a visualization method that facilitates the easy inspection and analysis of the results and possible hidden behaviors. Our results support the feasibility of employing the proposed method to find and easily visualize interesting features of sets of DNA data.

  4. Radiation-induced DNA damage in canine hemopoietic cells and stromal cells as measured by the comet assay

    International Nuclear Information System (INIS)

    Kreja, L.; Selig, C.; Plappert, U.; Nothdurft, W.

    1996-01-01

    Stromal cell progenitors (fibroblastoid colony-forming unit; CFU-Fs) are representative of the progenitor cell population of the hemopoietic microenvironment in bone marrow (BM). Previous studies of the radiation dose-effect relationships for colony formation have shown that canine CFU-Fs are relatively radioresistant as characterized by a D 0 value of about 2.4 Gy. In contrast, hemopoietic progenitors are particularly radiosensitive (D 0 values = 0.12-0.60 Gy). In the present study, the alkaline single-cell gel electrophoresis technique for the in situ quantitation of DNA strand breaks and alkalilabile site was employed. Canine buffy coat cells from BM aspirates and cells harvested from CFU-F colonies or from mixed populations of adherent BM stromal cell (SC) layers were exposed to increasing doses of X-rays, embedded in agarose gel on slides, lysed with detergents, and placed in an electric field. DNA migrating from single cells in the gel was made visible as open-quotes cometsclose quotes by ethidium bromide staining. Immediate DNA damage was much less in cultured stromal cells than in hemopoietic cells in BM aspirates. These results suggest that the observed differences in clonogenic survival could be partly due to differences in the type of the initial DNA damage between stromal cells and hemopoietic cells. 37 refs., 2 figs., 1 tab

  5. Whole genome DNA methylation: beyond genes silencing

    OpenAIRE

    Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

    2016-01-01

    The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...

  6. A compendium of canine normal tissue gene expression.

    Directory of Open Access Journals (Sweden)

    Joseph Briggs

    Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

  7. Molecular characterization of the canine HMGB1.

    Science.gov (United States)

    Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I

    2003-01-01

    Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel

  8. Reciprocal Regulation between DNA-PKcs and Snail1 Conferring Genomic Instability

    International Nuclear Information System (INIS)

    Seo, Haeng Ran; Lee, Hae June; Jin, Yeung Bae; Bae, Sang Woo; Lee, Yun Sil; Kim, Nam Hee; Kim, Hyun Sil; Nam, Hyung Wook; Yook, Jong In

    2010-01-01

    Although the roles of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) involving non-homologous end joining (NHEJ) of DNA repair are well recognized, the biological mechanisms and regulators by which DNA-PKcs regulate genomic instability are not clearly defined. We show herein that DNA-PKcs activity resulting from DNA damage caused by ionizing radiation (IR) phosphorylates Snail1 at serine 100, which results in increased Snail1 expression and its function by inhibition of GSK-3-mediated phosphorylation. Furthermore, Snail1 phosphorylated at serine 100 can reciprocally inhibit kinase activity of DNA-PKcs, resulting in an inhibition to recruit DNA-PKcs or Ku70/80 to a DNA double-strand break site, and ultimately inhibition of DNA repair activity. The impairment of repair activity by a direct interaction between Snail1 and DNA-PKcs increases the resistance to DNA damaging agents, such as IR, and genomic instability. Our findings provide a novel cellular mechanism for induction of genomic instability by reciprocal regulation of DNA-PKcs and Snail1

  9. Selective Gene Delivery for Integrating Exogenous DNA into Plastid and Mitochondrial Genomes Using Peptide-DNA Complexes.

    Science.gov (United States)

    Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji

    2018-05-14

    Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.

  10. Genome Sequences of Three Vaccine Strains and Two Wild-Type Canine Distemper Virus Strains from a Recent Disease Outbreak in South Africa.

    Science.gov (United States)

    Loots, Angelika K; Du Plessis, Morné; Dalton, Desiré Lee; Mitchell, Emily; Venter, Estelle H

    2017-07-06

    Canine distemper virus causes global multihost infectious disease. This report details complete genome sequences of three vaccine and two new wild-type strains. The wild-type strains belong to the South African lineage, and all three vaccine strains to the America 1 lineage. This constitutes the first genomic sequences of this virus from South Africa. Copyright © 2017 Loots et al.

  11. Oxidative DNA damage causes mitochondrial genomic instability in Saccharomyces cerevisiae.

    Science.gov (United States)

    Doudican, Nicole A; Song, Binwei; Shadel, Gerald S; Doetsch, Paul W

    2005-06-01

    Mitochondria contain their own genome, the integrity of which is required for normal cellular energy metabolism. Reactive oxygen species (ROS) produced by normal mitochondrial respiration can damage cellular macromolecules, including mitochondrial DNA (mtDNA), and have been implicated in degenerative diseases, cancer, and aging. We developed strategies to elevate mitochondrial oxidative stress by exposure to antimycin and H(2)O(2) or utilizing mutants lacking mitochondrial superoxide dismutase (sod2Delta). Experiments were conducted with strains compromised in mitochondrial base excision repair (ntg1Delta) and oxidative damage resistance (pif1Delta) in order to delineate the relationship between these pathways. We observed enhanced ROS production, resulting in a direct increase in oxidative mtDNA damage and mutagenesis. Repair-deficient mutants exposed to oxidative stress conditions exhibited profound genomic instability. Elimination of Ntg1p and Pif1p resulted in a synergistic corruption of respiratory competency upon exposure to antimycin and H(2)O(2). Mitochondrial genomic integrity was substantially compromised in ntg1Delta pif1Delta sod2Delta strains, since these cells exhibit a total loss of mtDNA. A stable respiration-defective strain, possessing a normal complement of mtDNA damage resistance pathways, exhibited a complete loss of mtDNA upon exposure to antimycin and H(2)O(2). This loss was preventable by Sod2p overexpression. These results provide direct evidence that oxidative mtDNA damage can be a major contributor to mitochondrial genomic instability and demonstrate cooperation of Ntg1p and Pif1p to resist the introduction of lesions into the mitochondrial genome.

  12. Questing Dermacentor reticulatus harbouring Babesia canis DNA associated with outbreaks of canine babesiosis in the Swiss Midlands.

    Science.gov (United States)

    Schaarschmidt, Daniel; Gilli, Urs; Gottstein, Bruno; Marreros, Nelson; Kuhnert, Peter; Daeppen, Jérôme A; Rosenberg, Gertrud; Hirt, Didier; Frey, Caroline F

    2013-06-01

    In 2011 and 2012, outbreaks of clinical canine babesiosis were observed in 2 areas of the Swiss Midlands that had no history of this disease so far. In one area, cases of canine babesiosis occurred over 2 consecutive tick seasons. The outbreaks involved 29 dogs, 4 of which died. All dogs were infected with large Babesia sp. as diagnosed in Giemsa-stained blood smears and/or PCR. These were identified as B. canis (formerly known as B. canis canis) by subsequent partial sequencing of the 18S rRNA gene of Babesia sp. Interestingly, the sequence indicated either a genotype with heterogeneity in the ssrRNA gene copies or double infection with different B. canis isolates. None of the dogs had a recent travel history, but one had frequently travelled to Hungary and had suffered twice from clinical babesiosis 18 and 24 months prior to the outbreak in autumn 2011. Retrospective sequencing of a stored blood DNA sample of this dog revealed B. canis, with an identical sequence to the Babesia involved in the outbreaks. For the first time in Switzerland, the partial 18S rRNA gene of B. canis could be amplified from DNA isolated from 19 out of 23 adult Dermacentor reticulatus ticks flagged in the same area. The sequence was identical to that found in the dogs. Furthermore, one affected dog carried a female D. reticulatus tick harbouring B. canis DNA. Our findings illustrate that, under favourable biogeographic and climatic conditions, the life-cycle of B. canis can relatively rapidly establish itself in previously non-endemic areas. Canine babesiosis should therefore always be a differential diagnosis when dogs with typical clinical signs are presented, regardless of known endemic areas. Copyright © 2013 Elsevier GmbH. All rights reserved.

  13. Next Generation DNA Sequencing and the Future of Genomic Medicine

    OpenAIRE

    Anderson, Matthew W.; Schrijver, Iris

    2010-01-01

    In the years since the first complete human genome sequence was reported, there has been a rapid development of technologies to facilitate high-throughput sequence analysis of DNA (termed “next-generation” sequencing). These novel approaches to DNA sequencing offer the promise of complete genomic analysis at a cost feasible for routine clinical diagnostics. However, the ability to more thoroughly interrogate genomic sequence raises a number of important issues with regard to result interpreta...

  14. DNA damage response and DNA repair – dog as a model?

    International Nuclear Information System (INIS)

    Grosse, Nicole; Loon, Barbara van; Rohrer Bley, Carla

    2014-01-01

    Companion animals like dogs frequently develop tumors with age and similarly to human malignancies, display interpatient tumoral heterogeneity. Tumors are frequently characterized with regard to their mutation spectra, changes in gene expression or protein levels. Among others, these changes affect proteins involved in the DNA damage response (DDR), which served as a basis for the development of numerous clinically relevant cancer therapies. Even though the effects of different DNA damaging agents, as well as DDR kinetics, have been well characterized in mammalian cells in vitro, very little is so far known about the kinetics of DDR in tumor and normal tissues in vivo. Due to (i) the similarities between human and canine genomes, (ii) the course of spontaneous tumor development, as well as (iii) common exposure to environmental agents, canine tumors are potentially an excellent model to study DDR in vivo. This is further supported by the fact that dogs show approximately the same rate of tumor development with age as humans. Though similarities between human and dog osteosarcoma, as well as mammary tumors have been well established, only few studies using canine tumor samples addressed the importance of affected DDR pathways in tumor progression, thus leaving many questions unanswered. Studies in humans showed that misregulated DDR pathways play an important role during tumor development, as well as in treatment response. Since dogs are proposed to be a good tumor model in many aspects of cancer research, we herein critically investigate the current knowledge of canine DDR and discuss (i) its future potential for studies on the in vivo level, as well as (ii) its possible translation to veterinary and human medicine

  15. Transcription facilitated genome-wide recruitment of topoisomerase I and DNA gyrase.

    Science.gov (United States)

    Ahmed, Wareed; Sala, Claudia; Hegde, Shubhada R; Jha, Rajiv Kumar; Cole, Stewart T; Nagaraja, Valakunja

    2017-05-01

    Movement of the transcription machinery along a template alters DNA topology resulting in the accumulation of supercoils in DNA. The positive supercoils generated ahead of transcribing RNA polymerase (RNAP) and the negative supercoils accumulating behind impose severe topological constraints impeding transcription process. Previous studies have implied the role of topoisomerases in the removal of torsional stress and the maintenance of template topology but the in vivo interaction of functionally distinct topoisomerases with heterogeneous chromosomal territories is not deciphered. Moreover, how the transcription-induced supercoils influence the genome-wide recruitment of DNA topoisomerases remains to be explored in bacteria. Using ChIP-Seq, we show the genome-wide occupancy profile of both topoisomerase I and DNA gyrase in conjunction with RNAP in Mycobacterium tuberculosis taking advantage of minimal topoisomerase representation in the organism. The study unveils the first in vivo genome-wide interaction of both the topoisomerases with the genomic regions and establishes that transcription-induced supercoils govern their recruitment at genomic sites. Distribution profiles revealed co-localization of RNAP and the two topoisomerases on the active transcriptional units (TUs). At a given locus, topoisomerase I and DNA gyrase were localized behind and ahead of RNAP, respectively, correlating with the twin-supercoiled domains generated. The recruitment of topoisomerases was higher at the genomic loci with higher transcriptional activity and/or at regions under high torsional stress compared to silent genomic loci. Importantly, the occupancy of DNA gyrase, sole type II topoisomerase in Mtb, near the Ter domain of the Mtb chromosome validates its function as a decatenase.

  16. ATM signaling and genomic stability in response to DNA damage

    International Nuclear Information System (INIS)

    Lavin, Martin F.; Birrell, Geoff; Chen, Philip; Kozlov, Sergei; Scott, Shaun; Gueven, Nuri

    2005-01-01

    DNA double strand breaks represent the most threatening lesion to the integrity of the genome in cells exposed to ionizing radiation and radiomimetic chemicals. Those breaks are recognized, signaled to cell cycle checkpoints and repaired by protein complexes. The product of the gene (ATM) mutated in the human genetic disorder ataxia-telangiectasia (A-T) plays a central role in the recognition and signaling of DNA damage. ATM is one of an ever growing number of proteins which when mutated compromise the stability of the genome and predispose to tumour development. Mechanisms for recognising double strand breaks in DNA, maintaining genome stability and minimizing risk of cancer are discussed

  17. Genomic gigantism: DNA loss is slow in mountain grasshoppers.

    Science.gov (United States)

    Bensasson, D; Petrov, D A; Zhang, D X; Hartl, D L; Hewitt, G M

    2001-02-01

    Several studies have shown DNA loss to be inversely correlated with genome size in animals. These studies include a comparison between Drosophila and the cricket, Laupala, but there has been no assessment of DNA loss in insects with very large genomes. Podisma pedestris, the brown mountain grasshopper, has a genome over 100 times as large as that of Drosophila and 10 times as large as that of Laupala. We used 58 paralogous nuclear pseudogenes of mitochondrial origin to study the characteristics of insertion, deletion, and point substitution in P. pedestris and Italopodisma. In animals, these pseudogenes are "dead on arrival"; they are abundant in many different eukaryotes, and their mitochondrial origin simplifies the identification of point substitutions accumulated in nuclear pseudogene lineages. There appears to be a mononucleotide repeat within the 643-bp pseudogene sequence studied that acts as a strong hot spot for insertions or deletions (indels). Because the data for other insect species did not contain such an unusual region, hot spots were excluded from species comparisons. The rate of DNA loss relative to point substitution appears to be considerably and significantly lower in the grasshoppers studied than in Drosophila or Laupala. This suggests that the inverse correlation between genome size and the rate of DNA loss can be extended to comparisons between insects with large or gigantic genomes (i.e., Laupala and Podisma). The low rate of DNA loss implies that in grasshoppers, the accumulation of point mutations is a more potent force for obscuring ancient pseudogenes than their loss through indel accumulation, whereas the reverse is true for Drosophila. The main factor contributing to the difference in the rates of DNA loss estimated for grasshoppers, crickets, and Drosophila appears to be deletion size. Large deletions are relatively rare in Podisma and Italopodisma.

  18. DNA vaccine encoding nucleocapsid and surface proteins of wild type canine distemper virus protects its natural host against distemper.

    Science.gov (United States)

    Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A

    2000-07-01

    Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.

  19. Genomic analysis of murine DNA-dependent protein kinase

    International Nuclear Information System (INIS)

    Fujimori, A.; Abe, M.

    2003-01-01

    Full text: The gene of catalytic subunit of DNA dependent protein kinase is responsible gene for SCID mice. The molecules play a critical role in non-homologous end joining including the V(D)J recombination. Contribution of the molecules to the difference of radiosensitivity and the susceptibility to cancer has been suggested. Here we show the entire nucleotide sequence of approximately 193 kbp and 84 kbp genomic regions encoding the entire DNA-PKcs gene in the mouse and chicken respectively. Retroposon was found in the intron 51 of mouse genomic DNA-PKcs gene but in human and chicken. Comparative analysis of these two species strongly suggested that only two genes, DNA-PKcs and MCM4, exist in the region of both species. Several conserved sequences and cis elements, however, were predicted. Recently, the orthologous region for the human DNA-PKcs locus was completed. The results of further comparative study will be discussed

  20. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  1. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

    Directory of Open Access Journals (Sweden)

    Zdepski Anna

    2011-05-01

    Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

  2. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  3. TALENs: customizable molecular DNA scissors for genome engineering of plants.

    Science.gov (United States)

    Chen, Kunling; Gao, Caixia

    2013-06-20

    Precise genome modification with engineered nucleases is a powerful tool for studying basic biology and applied biotechnology. Transcription activator-like effector nucleases (TALENs), consisting of an engineered specific (TALE) DNA binding domain and a Fok I cleavage domain, are newly developed versatile reagents for genome engineering in different organisms. Because of the simplicity of the DNA recognition code and their modular assembly, TALENs can act as customizable molecular DNA scissors inducing double-strand breaks (DSBs) at given genomic location. Thus, they provide a valuable approach to targeted genome modifications such as mutations, insertions, replacements or chromosome rearrangements. In this article, we review the development of TALENs, and summarize the principles and tools for TALEN-mediated gene targeting in plant cells, as well as current and potential strategies for use in plant research and crop improvement. Copyright © 2013. Published by Elsevier Ltd.

  4. Genome-wide DNA Methylation Profiling of Cell-Free Serum DNA in Esophageal Adenocarcinoma and Barrett Esophagus

    Directory of Open Access Journals (Sweden)

    Rihong Zhai

    2012-01-01

    Full Text Available Aberrant DNA methylation (DNAm is a feature of most types of cancers. Genome-wide DNAm profiling has been performed successfully on tumor tissue DNA samples. However, the invasive procedure limits the utility of tumor tissue for epidemiological studies. While recent data indicate that cell-free circulating DNAm (cfDNAm profiles reflect DNAm status in corresponding tumor tissues, no studies have examined the association of cfDNAm with cancer or precursors on a genome-wide scale. The objective of this pilot study was to evaluate the putative significance of genome-wide cfDNAm profiles in esophageal adenocarcinoma (EA and Barrett esophagus (BE, EA precursor. We performed genome-wide DNAm profiling in EA tissue DNA (n = 8 and matched serum DNA (n = 8, in serum DNA of BE (n = 10, and in healthy controls (n = 10 using the Infinium HumanMethylation27 BeadChip that covers 27,578 CpG loci in 14,495 genes. We found that cfDNAm profiles were highly correlated to DNAm profiles in matched tumor tissue DNA (r = 0.92 in patients with EA. We selected the most differentially methylated loci to perform hierarchical clustering analysis. We found that 911 loci can discriminate perfectly between EA and control samples, 554 loci can separate EA from BE samples, and 46 loci can distinguish BE from control samples. These results suggest that genome-wide cfDNAm profiles are highly consistent with DNAm profiles detected in corresponding tumor tissues. Differential cfDNAm profiling may be a useful approach for the noninvasive screening of EA and EA premalignant lesions.

  5. Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

    Science.gov (United States)

    Cao, Yinhe; Tung, Wen-Wen; Gao, J B

    2004-01-01

    With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

  6. Detecting single DNA copy number variations in complex genomes using one nanogram of starting DNA and BAC-array CGH.

    Science.gov (United States)

    Guillaud-Bataille, Marine; Valent, Alexander; Soularue, Pascal; Perot, Christine; Inda, Maria Mar; Receveur, Aline; Smaïli, Sadek; Roest Crollius, Hugues; Bénard, Jean; Bernheim, Alain; Gidrol, Xavier; Danglot, Gisèle

    2004-07-29

    Comparative genomic hybridization to bacterial artificial chromosome (BAC)-arrays (array-CGH) is a highly efficient technique, allowing the simultaneous measurement of genomic DNA copy number at hundreds or thousands of loci, and the reliable detection of local one-copy-level variations. We report a genome-wide amplification method allowing the same measurement sensitivity, using 1 ng of starting genomic DNA, instead of the classical 1 microg usually necessary. Using a discrete series of DNA fragments, we defined the parameters adapted to the most faithful ligation-mediated PCR amplification and the limits of the technique. The optimized protocol allows a 3000-fold DNA amplification, retaining the quantitative characteristics of the initial genome. Validation of the amplification procedure, using DNA from 10 tumour cell lines hybridized to BAC-arrays of 1500 spots, showed almost perfectly superimposed ratios for the non-amplified and amplified DNAs. Correlation coefficients of 0.96 and 0.99 were observed for regions of low-copy-level variations and all regions, respectively (including in vivo amplified oncogenes). Finally, labelling DNA using two nucleotides bearing the same fluorophore led to a significant increase in reproducibility and to the correct detection of one-copy gain or loss in >90% of the analysed data, even for pseudotriploid tumour genomes.

  7. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong

    2012-01-01

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  8. Mutagenic repair of double-stranded DNA breaks in vaccinia virus genomes requires cellular DNA ligase IV activity in the cytosol.

    Science.gov (United States)

    Luteijn, Rutger David; Drexler, Ingo; Smith, Geoffrey L; Lebbink, Robert Jan; Wiertz, Emmanuel J H J

    2018-04-20

    Poxviruses comprise a group of large dsDNA viruses that include members relevant to human and animal health, such as variola virus, monkeypox virus, cowpox virus and vaccinia virus (VACV). Poxviruses are remarkable for their unique replication cycle, which is restricted to the cytoplasm of infected cells. The independence from the host nucleus requires poxviruses to encode most of the enzymes involved in DNA replication, transcription and processing. Here, we use the CRISPR/Cas9 genome engineering system to induce DNA damage to VACV (strain Western Reserve) genomes. We show that targeting CRISPR/Cas9 to essential viral genes limits virus replication efficiently. Although VACV is a strictly cytoplasmic pathogen, we observed extensive viral genome editing at the target site; this is reminiscent of a non-homologous end-joining DNA repair mechanism. This pathway was not dependent on the viral DNA ligase, but critically involved the cellular DNA ligase IV. Our data show that DNA ligase IV can act outside of the nucleus to allow repair of dsDNA breaks in poxvirus genomes. This pathway might contribute to the introduction of mutations within the genome of poxviruses and may thereby promote the evolution of these viruses.

  9. Molecular analysis and genomic organization of major DNA satellites in banana (Musa spp.).

    Science.gov (United States)

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa.

  10. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing.

    Science.gov (United States)

    Feehan, Joanna M; Scheibel, Katherine E; Bourras, Salim; Underwood, William; Keller, Beat; Somerville, Shauna C

    2017-03-31

    The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics of these pathogens, in part due to a lack of well-developed genetic and genomic resources. These organisms have large, repetitive genomes, which have made genome sequencing and assembly prohibitively difficult. Here, we describe methods for the collection, extraction, purification and quality control assessment of high molecular weight genomic DNA from one powdery mildew species, Golovinomyces cichoracearum. The protocol described includes mechanical disruption of spores followed by an optimized phenol/chloroform genomic DNA extraction. A typical yield was 7 µg DNA per 150 mg conidia. The genomic DNA that is isolated using this procedure is suitable for long-read sequencing (i.e., > 48.5 kbp). Quality control measures to ensure the size, yield, and purity of the genomic DNA are also described in this method. Sequencing of the genomic DNA of the quality described here will allow for the assembly and comparison of multiple powdery mildew genomes, which in turn will lead to a better understanding and improved control of this agricultural pathogen.

  11. Genomic and Molecular Landscape of DNA Damage Repair Deficiency across The Cancer Genome Atlas

    Directory of Open Access Journals (Sweden)

    Theo A. Knijnenburg

    2018-04-01

    Full Text Available Summary: DNA damage repair (DDR pathways modulate cancer risk, progression, and therapeutic response. We systematically analyzed somatic alterations to provide a comprehensive view of DDR deficiency across 33 cancer types. Mutations with accompanying loss of heterozygosity were observed in over 1/3 of DDR genes, including TP53 and BRCA1/2. Other prevalent alterations included epigenetic silencing of the direct repair genes EXO5, MGMT, and ALKBH3 in ∼20% of samples. Homologous recombination deficiency (HRD was present at varying frequency in many cancer types, most notably ovarian cancer. However, in contrast to ovarian cancer, HRD was associated with worse outcomes in several other cancers. Protein structure-based analyses allowed us to predict functional consequences of rare, recurrent DDR mutations. A new machine-learning-based classifier developed from gene expression data allowed us to identify alterations that phenocopy deleterious TP53 mutations. These frequent DDR gene alterations in many human cancers have functional consequences that may determine cancer progression and guide therapy. : Knijnenburg et al. present The Cancer Genome Atlas (TCGA Pan-Cancer analysis of DNA damage repair (DDR deficiency in cancer. They use integrative genomic and molecular analyses to identify frequent DDR alterations across 33 cancer types, correlate gene- and pathway-level alterations with genome-wide measures of genome instability and impaired function, and demonstrate the prognostic utility of DDR deficiency scores. Keywords: The Cancer Genome Atlas PanCanAtlas project, DNA damage repair, somatic mutations, somatic copy-number alterations, epigenetic silencing, DNA damage footprints, mutational signatures, integrative statistical analysis, protein structure analysis

  12. Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs

    Directory of Open Access Journals (Sweden)

    Touihri Leila

    2012-12-01

    Full Text Available Abstract Background During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV or distemper virus (CDV after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. Methods We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an “Internal Ribosome Entry Site” (IRES domain. Results The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The

  13. Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs.

    Science.gov (United States)

    Touihri, Leila; Ahmed, Sami Belhaj; Chtourou, Yacine; Daoud, Rahma; Bahloul, Chokri

    2012-12-27

    During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV) or distemper virus (CDV) after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV) 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an "Internal Ribosome Entry Site" (IRES) domain. The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The FMDV 2A was also efficient in the design of multivalent

  14. An Adenovirus DNA Replication Factor, but Not Incoming Genome Complexes, Targets PML Nuclear Bodies.

    Science.gov (United States)

    Komatsu, Tetsuro; Nagata, Kyosuke; Wodrich, Harald

    2016-02-01

    Promyelocytic leukemia protein nuclear bodies (PML-NBs) are subnuclear domains implicated in cellular antiviral responses. Despite the antiviral activity, several nuclear replicating DNA viruses use the domains as deposition sites for the incoming viral genomes and/or as sites for viral DNA replication, suggesting that PML-NBs are functionally relevant during early viral infection to establish productive replication. Although PML-NBs and their components have also been implicated in the adenoviral life cycle, it remains unclear whether incoming adenoviral genome complexes target PML-NBs. Here we show using immunofluorescence and live-cell imaging analyses that incoming adenovirus genome complexes neither localize at nor recruit components of PML-NBs during early phases of infection. We further show that the viral DNA binding protein (DBP), an early expressed viral gene and essential DNA replication factor, independently targets PML-NBs. We show that DBP oligomerization is required to selectively recruit the PML-NB components Sp100 and USP7. Depletion experiments suggest that the absence of one PML-NB component might not affect the recruitment of other components toward DBP oligomers. Thus, our findings suggest a model in which an adenoviral DNA replication factor, but not incoming viral genome complexes, targets and modulates PML-NBs to support a conducive state for viral DNA replication and argue against a generalized concept that PML-NBs target incoming viral genomes. The immediate fate upon nuclear delivery of genomes of incoming DNA viruses is largely unclear. Early reports suggested that incoming genomes of herpesviruses are targeted and repressed by PML-NBs immediately upon nuclear import. Genome localization and/or viral DNA replication has also been observed at PML-NBs for other DNA viruses. Thus, it was suggested that PML-NBs may immediately sense and target nuclear viral genomes and hence serve as sites for deposition of incoming viral genomes and

  15. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies.

    Science.gov (United States)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent; Pertoldi, Cino; Blixenkrone-Møller, Merete

    2015-03-10

    Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits with CDV DNA vaccines. Virus neutralising (VN) antibody responses were induced in mink kits vaccinated with a plasmid encoding the haemaglutinin protein (H) of CDV (n=5, pCDV-H) or a combination of the H, fusion (F) and nucleoprotein (N) of CDV (n=5, pCDV-HFN). These DNA vaccinated kits were protected against virulent experimental infection with field strains of CDV. The pCDV-H was more efficient in inducing protective immunity in the presence of maternal antibodies compared to the pCDV-HFN. The results show that DNA vaccination with the pCDV-H or pCDV-HFN (n=4) only given once at 5 days of age induces virus specific immune response in neonatal mink and protection against virulent CDV exposure later in life. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Canine spontaneous head and neck squamous cell carcinomas represent their human counterparts at the molecular level.

    Directory of Open Access Journals (Sweden)

    Deli Liu

    2015-06-01

    Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.

  17. Whole-genome methylation caller designed for methyl- DNA ...

    African Journals Online (AJOL)

    etchie

    2013-02-20

    Feb 20, 2013 ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, Hidden ... its response to environmental cues. .... have a great potential to become the most cost-effective ... hg18 reference genome (set to 0 if not present in retrieved reads). ..... DNA methylation patterns and epigenetic memory.

  18. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

  19. Molecular characterization of complete genome of a canine distemper virus associated with fatal infection in dogs in Gabon, Central Africa.

    Science.gov (United States)

    Maganga, Gael D; Labouba, Ingrid; Ngoubangoye, Barthélémy; Nkili-Meyong, Andriniaina A; Obame Ondo, Daniel; Leroy, Eric M; Berthet, Nicolas

    2018-03-02

    Canine distemper (CD) is the most deadly disease in dogs with mortality rates reaching 50%. The pathological agent, the CD virus (CDV), generally causes a severe systemic disease, although the nervous form can coexist with the acute catarrhal form in the same individual. In this study, we describe an outbreak of 18 cases of CD that occurred in 2015 in a German Shepherd dog population in northwestern Gabon. In addition, we determined the sequence of the CDV genotype associated with this fatal distemper infection in Gabon and compared it with other published CDV sequences. The CDV was detected using RT-PCR on cDNA from RNA of harvested brains and other organs. The identification was confirmed by sequencing amplicons. Moreover, we obtained the whole genome sequence using high-throughput sequencing. Phylogenetic analysis revealed that Gabonese CDV strain clustered with European strains belonging to the Europe genotype. This study provided the first molecular detection of the CDV strain associated with this fatal distemper infection in Central Africa region. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Evaluation of different sources of DNA for use in genome wide studies and forensic application.

    Science.gov (United States)

    Al Safar, Habiba S; Abidi, Fatima H; Khazanehdari, Kamal A; Dadour, Ian R; Tay, Guan K

    2011-02-01

    In the field of epidemiology, Genome-Wide Association Studies (GWAS) are commonly used to identify genetic predispositions of many human diseases. Large repositories housing biological specimens for clinical and genetic investigations have been established to store material and data for these studies. The logistics of specimen collection and sample storage can be onerous, and new strategies have to be explored. This study examines three different DNA sources (namely, degraded genomic DNA, amplified degraded genomic DNA and amplified extracted DNA from FTA card) for GWAS using the Illumina platform. No significant difference in call rate was detected between amplified degraded genomic DNA extracted from whole blood and amplified DNA retrieved from FTA™ cards. However, using unamplified-degraded genomic DNA reduced the call rate to a mean of 42.6% compared to amplified DNA extracted from FTA card (mean of 96.6%). This study establishes the utility of FTA™ cards as a viable storage matrix for cells from which DNA can be extracted to perform GWAS analysis.

  1. A protocol for large scale genomic DNA isolation for cacao genetics ...

    African Journals Online (AJOL)

    Advances in DNA technology, such as marker assisted selection, detection of quantitative trait loci and genomic selection also require the isolation of DNA from a large number of samples and the preservation of tissue samples for future use in cacao genome studies. The present study proposes a method for the ...

  2. Current state of knowledge: the canine gastrointestinal microbiome.

    Science.gov (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S

    2012-06-01

    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.

  3. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

  4. Isolating silkworm genomic DNA without liquid nitrogen suitable for ...

    African Journals Online (AJOL)

    Genomic DNA was isolated from posterior silk gland of silkworms, Antheraea assama. Absolute alcohol was used as tissue fixing solution instead of grinding in liquid nitrogen, which yielded high molecular weight DNA (>40 kb). Samples yielded similar amount of DNA when fixed in absolute alcohol (400 μmg/g of silk gland ...

  5. Analysis of the giant genomes of Fritillaria (Liliaceae) indicates that a lack of DNA removal characterizes extreme expansions in genome size.

    Science.gov (United States)

    Kelly, Laura J; Renny-Byfield, Simon; Pellicer, Jaume; Macas, Jiří; Novák, Petr; Neumann, Pavel; Lysak, Martin A; Day, Peter D; Berger, Madeleine; Fay, Michael F; Nichols, Richard A; Leitch, Andrew R; Leitch, Ilia J

    2015-10-01

    Plants exhibit an extraordinary range of genome sizes, varying by > 2000-fold between the smallest and largest recorded values. In the absence of polyploidy, changes in the amount of repetitive DNA (transposable elements and tandem repeats) are primarily responsible for genome size differences between species. However, there is ongoing debate regarding the relative importance of amplification of repetitive DNA versus its deletion in governing genome size. Using data from 454 sequencing, we analysed the most repetitive fraction of some of the largest known genomes for diploid plant species, from members of Fritillaria. We revealed that genomic expansion has not resulted from the recent massive amplification of just a handful of repeat families, as shown in species with smaller genomes. Instead, the bulk of these immense genomes is composed of highly heterogeneous, relatively low-abundance repeat-derived DNA, supporting a scenario where amplified repeats continually accumulate due to infrequent DNA removal. Our results indicate that a lack of deletion and low turnover of repetitive DNA are major contributors to the evolution of extremely large genomes and show that their size cannot simply be accounted for by the activity of a small number of high-abundance repeat families. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  6. Functional interrogation of non-coding DNA through CRISPR genome editing.

    Science.gov (United States)

    Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H

    2017-05-15

    Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Quantification of trace-level DNA by real-time whole genome amplification.

    Science.gov (United States)

    Kang, Min-Jung; Yu, Hannah; Kim, Sook-Kyung; Park, Sang-Ryoul; Yang, Inchul

    2011-01-01

    Quantification of trace amounts of DNA is a challenge in analytical applications where the concentration of a target DNA is very low or only limited amounts of samples are available for analysis. PCR-based methods including real-time PCR are highly sensitive and widely used for quantification of low-level DNA samples. However, ordinary PCR methods require at least one copy of a specific gene sequence for amplification and may not work for a sub-genomic amount of DNA. We suggest a real-time whole genome amplification method adopting the degenerate oligonucleotide primed PCR (DOP-PCR) for quantification of sub-genomic amounts of DNA. This approach enabled quantification of sub-picogram amounts of DNA independently of their sequences. When the method was applied to the human placental DNA of which amount was accurately determined by inductively coupled plasma-optical emission spectroscopy (ICP-OES), an accurate and stable quantification capability for DNA samples ranging from 80 fg to 8 ng was obtained. In blind tests of laboratory-prepared DNA samples, measurement accuracies of 7.4%, -2.1%, and -13.9% with analytical precisions around 15% were achieved for 400-pg, 4-pg, and 400-fg DNA samples, respectively. A similar quantification capability was also observed for other DNA species from calf, E. coli, and lambda phage. Therefore, when provided with an appropriate standard DNA, the suggested real-time DOP-PCR method can be used as a universal method for quantification of trace amounts of DNA.

  8. Detection of Alicyclobacillus species in fruit juice using a random genomic DNA microarray chip.

    Science.gov (United States)

    Jang, Jun Hyeong; Kim, Sun-Joong; Yoon, Bo Hyun; Ryu, Jee-Hoon; Gu, Man Bock; Chang, Hyo-Ihl

    2011-06-01

    This study describes a method using a DNA microarray chip to rapidly and simultaneously detect Alicyclobacillus species in orange juice based on the hybridization of genomic DNA with random probes. Three food spoilage bacteria were used in this study: Alicyclobacillus acidocaldarius, Alicyclobacillus acidoterrestris, and Alicyclobacillus cycloheptanicus. The three Alicyclobacillus species were adjusted to 2 × 10(3) CFU/ml and inoculated into pasteurized 100% pure orange juice. Cy5-dCTP labeling was used for reference signals, and Cy3-dCTP was labeled for target genomic DNA. The molar ratio of 1:1 of Cy3-dCTP and Cy5-dCTP was used. DNA microarray chips were fabricated using randomly fragmented DNA of Alicyclobacillus spp. and were hybridized with genomic DNA extracted from Bacillus spp. Genomic DNA extracted from Alicyclobacillus spp. showed a significantly higher hybridization rate compared with DNA of Bacillus spp., thereby distinguishing Alicyclobacillus spp. from Bacillus spp. The results showed that the microarray DNA chip containing randomly fragmented genomic DNA was specific and clearly identified specific food spoilage bacteria. This microarray system is a good tool for rapid and specific detection of thermophilic spoilage bacteria, mainly Alicyclobacillus spp., and is useful and applicable to the fruit juice industry.

  9. Sequencing of chloroplast genome using whole cellular DNA and Solexa sequencing technology

    Directory of Open Access Journals (Sweden)

    Jian eWu

    2012-11-01

    Full Text Available Sequencing of the chloroplast genome using traditional sequencing methods has been difficult because of its size (>120 kb and the complicated procedures required to prepare templates. To explore the feasibility of sequencing the chloroplast genome using DNA extracted from whole cells and Solexa sequencing technology, we sequenced whole cellular DNA isolated from leaves of three Brassica rapa accessions with one lane per accession. In total, 246 Mb, 362Mb, 361 Mb sequence data were generated for the three accessions Chiifu-401-42, Z16 and FT, respectively. Microreads were assembled by reference-guided assembly using the cpDNA sequences of B. rapa, Arabidopsis thaliana, and Nicotiana tabacum. We achieved coverage of more than 99.96% of the cp genome in the three tested accessions using the B. rapa sequence as the reference. When A. thaliana or N. tabacum sequences were used as references, 99.7–99.8% or 95.5–99.7% of the B. rapa chloroplast genome was covered, respectively. These results demonstrated that sequencing of whole cellular DNA isolated from young leaves using the Illumina Genome Analyzer is an efficient method for high-throughput sequencing of chloroplast genome.

  10. Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale

    Science.gov (United States)

    Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li

    2015-01-01

    The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143

  11. A novel rat genomic simple repeat DNA with RNA-homology shows triplex (H-DNA)-like structure and tissue-specific RNA expression

    International Nuclear Information System (INIS)

    Dey, Indranil; Rath, Pramod C.

    2005-01-01

    Mammalian genome contains a wide variety of repetitive DNA sequences of relatively unknown function. We report a novel 227 bp simple repeat DNA (3.3 DNA) with a d {(GA) 7 A (AG) 7 } dinucleotide mirror repeat from the rat (Rattus norvegicus) genome. 3.3 DNA showed 75-85% homology with several eukaryotic mRNAs due to (GA/CU) n dinucleotide repeats by nBlast search and a dispersed distribution in the rat genome by Southern blot hybridization with [ 32 P]3.3 DNA. The d {(GA) 7 A (AG) 7 } mirror repeat formed a triplex (H-DNA)-like structure in vitro. Two large RNAs of 9.1 and 7.5 kb were detected by [ 32 P]3.3 DNA in rat brain by Northern blot hybridization indicating expression of such simple sequence repeats at RNA level in vivo. Further, several cDNAs were isolated from a rat cDNA library by [ 32 P]3.3 DNA probe. Three such cDNAs showed tissue-specific RNA expression in rat. pRT 4.1 cDNA showed strong expression of a 2.39 kb RNA in brain and spleen, pRT 5.5 cDNA showed strong expression of a 2.8 kb RNA in brain and a 3.9 kb RNA in lungs, and pRT 11.4 cDNA showed weak expression of a 2.4 kb RNA in lungs. Thus, genomic simple sequence repeats containing d (GA/CT) n dinucleotides are transcriptionally expressed and regulated in rat tissues. Such d (GA/CT) n dinucleotide repeats may form structural elements (e.g., triplex) which may be sites for functional regulation of genomic coding sequences as well as RNAs. This may be a general function of such transcriptionally active simple sequence repeats widely dispersed in mammalian genome

  12. DNA Breaks and End Resection Measured Genome-wide by End Sequencing.

    Science.gov (United States)

    Canela, Andres; Sridharan, Sriram; Sciascia, Nicholas; Tubbs, Anthony; Meltzer, Paul; Sleckman, Barry P; Nussenzweig, André

    2016-09-01

    DNA double-strand breaks (DSBs) arise during physiological transcription, DNA replication, and antigen receptor diversification. Mistargeting or misprocessing of DSBs can result in pathological structural variation and mutation. Here we describe a sensitive method (END-seq) to monitor DNA end resection and DSBs genome-wide at base-pair resolution in vivo. We utilized END-seq to determine the frequency and spectrum of restriction-enzyme-, zinc-finger-nuclease-, and RAG-induced DSBs. Beyond sequence preference, chromatin features dictate the repertoire of these genome-modifying enzymes. END-seq can detect at least one DSB per cell among 10,000 cells not harboring DSBs, and we estimate that up to one out of 60 cells contains off-target RAG cleavage. In addition to site-specific cleavage, we detect DSBs distributed over extended regions during immunoglobulin class-switch recombination. Thus, END-seq provides a snapshot of DNA ends genome-wide, which can be utilized for understanding genome-editing specificities and the influence of chromatin on DSB pathway choice. Published by Elsevier Inc.

  13. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David R.; Lee, Robert W.; Cushman, John C.; Magnuson, Jon K.; Tran, Duc; Polle, Juergen E.

    2010-05-07

    Abstract Background: Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results: The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA) sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions: These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the development of a viable

  14. The Dunaliella salina organelle genomes: large sequences, inflated with intronic and intergenic DNA

    Directory of Open Access Journals (Sweden)

    Tran Duc

    2010-05-01

    Full Text Available Abstract Background Dunaliella salina Teodoresco, a unicellular, halophilic green alga belonging to the Chlorophyceae, is among the most industrially important microalgae. This is because D. salina can produce massive amounts of β-carotene, which can be collected for commercial purposes, and because of its potential as a feedstock for biofuels production. Although the biochemistry and physiology of D. salina have been studied in great detail, virtually nothing is known about the genomes it carries, especially those within its mitochondrion and plastid. This study presents the complete mitochondrial and plastid genome sequences of D. salina and compares them with those of the model green algae Chlamydomonas reinhardtii and Volvox carteri. Results The D. salina organelle genomes are large, circular-mapping molecules with ~60% noncoding DNA, placing them among the most inflated organelle DNAs sampled from the Chlorophyta. In fact, the D. salina plastid genome, at 269 kb, is the largest complete plastid DNA (ptDNA sequence currently deposited in GenBank, and both the mitochondrial and plastid genomes have unprecedentedly high intron densities for organelle DNA: ~1.5 and ~0.4 introns per gene, respectively. Moreover, what appear to be the relics of genes, introns, and intronic open reading frames are found scattered throughout the intergenic ptDNA regions -- a trait without parallel in other characterized organelle genomes and one that gives insight into the mechanisms and modes of expansion of the D. salina ptDNA. Conclusions These findings confirm the notion that chlamydomonadalean algae have some of the most extreme organelle genomes of all eukaryotes. They also suggest that the events giving rise to the expanded ptDNA architecture of D. salina and other Chlamydomonadales may have occurred early in the evolution of this lineage. Although interesting from a genome evolution standpoint, the D. salina organelle DNA sequences will aid in the

  15. Genome Sequence of Canine Parvovirus Strain SC02/2011, Isolated from a Puppy with Severe Diarrhea in South China

    Science.gov (United States)

    Cheng, Yi; Ji, Yikuan; Wang, Yu; Sun, Leilei; Huang, Jiaxin

    2012-01-01

    A widespread hemorrhagic gastroenteritis in young dogs occurred in South China. A virulent field canine parvovirus (CPV) strain, SC02/2011, was isolated from a puppy showing enteric signs in Guangdong, China. The genome of CPV strain SC02/2011 was sequenced and analyzed, which will promote a better understanding of the molecular epidemiology and genetic diversity of CPV field isolates in South China. PMID:23166228

  16. High-throughput sequencing of three Lemnoideae (duckweeds chloroplast genomes from total DNA.

    Directory of Open Access Journals (Sweden)

    Wenqin Wang

    Full Text Available BACKGROUND: Chloroplast genomes provide a wealth of information for evolutionary and population genetic studies. Chloroplasts play a particularly important role in the adaption for aquatic plants because they float on water and their major surface is exposed continuously to sunlight. The subfamily of Lemnoideae represents such a collection of aquatic species that because of photosynthesis represents one of the fastest growing plant species on earth. METHODS: We sequenced the chloroplast genomes from three different genera of Lemnoideae, Spirodela polyrhiza, Wolffiella lingulata and Wolffia australiana by high-throughput DNA sequencing of genomic DNA using the SOLiD platform. Unfractionated total DNA contains high copies of plastid DNA so that sequences from the nucleus and mitochondria can easily be filtered computationally. Remaining sequence reads were assembled into contiguous sequences (contigs using SOLiD software tools. Contigs were mapped to a reference genome of Lemna minor and gaps, selected by PCR, were sequenced on the ABI3730xl platform. CONCLUSIONS: This combinatorial approach yielded whole genomic contiguous sequences in a cost-effective manner. Over 1,000-time coverage of chloroplast from total DNA were reached by the SOLiD platform in a single spot on a quadrant slide without purification. Comparative analysis indicated that the chloroplast genome was conserved in gene number and organization with respect to the reference genome of L. minor. However, higher nucleotide substitution, abundant deletions and insertions occurred in non-coding regions of these genomes, indicating a greater genomic dynamics than expected from the comparison of other related species in the Pooideae. Noticeably, there was no transition bias over transversion in Lemnoideae. The data should have immediate applications in evolutionary biology and plant taxonomy with increased resolution and statistical power.

  17. Functional role of a highly repetitive DNA sequence in anchorage of the mouse genome.

    Science.gov (United States)

    Neuer-Nitsche, B; Lu, X N; Werner, D

    1988-09-12

    The major portion of the eukaryotic genome consists of various categories of repetitive DNA sequences which have been studied with respect to their base compositions, organizations, copy numbers, transcription and species specificities; their biological roles, however, are still unclear. A novel quality of a highly repetitive mouse DNA sequence is described which points to a functional role: All copies (approximately 50,000 per haploid genome) of this DNA sequence reside on genomic Alu I DNA fragments each associated with nuclear polypeptides that are not released from DNA by proteinase K, SDS and phenol extraction. By this quality the repetitive DNA sequence is classified as a member of the sub-set of DNA sequences involved in tight DNA-polypeptide complexes which have been previously shown to be components of the subnuclear structure termed 'nuclear matrix'. From these results it has to be concluded that the repetitive DNA sequence characterized in this report represents or comprises a signal for a large number of site specific attachment points of the mouse genome in the nuclear matrix.

  18. A Comparison of Fresh Frozen vs. Formalin-Fixed, Paraffin-Embedded Specimens of Canine Mammary Tumors via Branched-DNA Assay

    Directory of Open Access Journals (Sweden)

    Florenza Lüder Ripoli

    2016-05-01

    Full Text Available Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE tissues are an invaluable source of archived biological material. Fresh frozen (FF tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when analyzing certain gene expression patterns between FF and FFPE samples in canine mammary tumors. RNA was isolated from 109 FFPE samples and from 93 FF samples of different canine mammary tissues. Sixteen (16 target genes (Tp53; Myc; HMGA1; Pik3ca; Mcl1; MAPK3; FOXO3; PTEN; GATA4; PFDN5; HMGB1; MAPK1; BRCA2; BRCA1; HMGA2; and Her2 were analyzed via branched-DNA assay (b-DNA. ACTB, GAPDH, and HPRT1 were used as data normalizers. Overall, the relative gene expression of the two different origins of samples showed an agreement of 63%. Still, care should be taken, as FFPE specimens showed lower expression of the analyzed targets when compared to FF samples. The fact that the gene expression in FFPE proved to be lower than in FF specimens is likely to have been caused by the effect of storage time. ACTB had the best performance as a data normalizer.

  19. Evaluation of FTA ® paper for storage of oral meta-genomic DNA.

    Science.gov (United States)

    Foitzik, Magdalena; Stumpp, Sascha N; Grischke, Jasmin; Eberhard, Jörg; Stiesch, Meike

    2014-10-01

    The purpose of the present study was to evaluate the short-term storage of meta-genomic DNA from native oral biofilms on FTA(®) paper. Thirteen volunteers of both sexes received an acrylic splint for intraoral biofilm formation over a period of 48 hours. The biofilms were collected, resuspended in phosphate-buffered saline, and either stored on FTA(®) paper or directly processed by standard laboratory DNA extraction. The nucleic acid extraction efficiencies were evaluated by 16S rDNA targeted SSCP fingerprinting. The acquired banding pattern of FTA-derived meta-genomic DNA was compared to a standard DNA preparation protocol. Sensitivity and positive predictive values were calculated. The volunteers showed inter-individual differences in their bacterial species composition. A total of 200 bands were found for both methods and 85% of the banding patterns were equal, representing a sensitivity of 0.941 and a false-negative predictive value of 0.059. Meta-genomic DNA sampling, extraction, and adhesion using FTA(®) paper is a reliable method for storage of microbial DNA for a short period of time.

  20. Genome-wide association between DNA methylation and alternative splicing in an invertebrate

    Directory of Open Access Journals (Sweden)

    Flores Kevin

    2012-09-01

    Full Text Available Abstract Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee and Nasonia vitripennis (jewel wasp analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice

  1. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

    Science.gov (United States)

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

    2017-08-01

    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  2. Study on the relationship between DNA-PKcs and genomic instability and hyper-radiosensitivity

    International Nuclear Information System (INIS)

    Yang Kang; Zhu Jiayun; Ding Nan; Li Junhong; Hu Wentao; Su Fengtao; He Jinpeng; Li Sha

    2010-01-01

    To investigate the relationship between DNA-PKcs and genome instability and hyper-radiosensitivity, human glioma cell lines M059K and M059J, as a model expressing wild-type DNA-PKcs and a model defective in DNA-PKcs activity, were exposed to low doses of X-rays. Cells survival fractions were assessed by colony-forming assay and Cytochalasin-B micronucleus assay was employed to detect the genomic instability happening in each single irradiated colony. It has been found that as the post-incubation time increased, M059K cells expressing wild-type DNA-PKcs exhibited low-dose hyper-radiosensitivity and showed a similar genomic instability after 0.2 Gy and 0.6 Gy irradiations, but the M059J cells lacking in DNA-PKcs didn't present low-dose hyper-radiosensitivity and showed a higher genomic instability of 0.6 Gy than that of 0.2 Gy. The results indicate that DNA-PKcs may act as one of the key factors that lead to low-dose hyper-radiosensitivity. (authors)

  3. Isolation of Retroelement from Plant Genomic DNA

    OpenAIRE

    sprotocols

    2014-01-01

    Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...

  4. Comparison of protocols for genomic DNA extraction from 'velame ...

    African Journals Online (AJOL)

    usuario

    2013-07-24

    Jul 24, 2013 ... involving C. linearifolius, we compared the efficiency of six protocols for genomic DNA extraction previously ... phytic, with diverse aspect and floristics, average rainfall between ..... The variation observed for DNA concentrations estimated with .... performed with protocol 1 (data not shown), or still, bands.

  5. DNA-PKcs, ATM, and ATR Interplay Maintains Genome Integrity during Neurogenesis.

    Science.gov (United States)

    Enriquez-Rios, Vanessa; Dumitrache, Lavinia C; Downing, Susanna M; Li, Yang; Brown, Eric J; Russell, Helen R; McKinnon, Peter J

    2017-01-25

    The DNA damage response (DDR) orchestrates a network of cellular processes that integrates cell-cycle control and DNA repair or apoptosis, which serves to maintain genome stability. DNA-PKcs (the catalytic subunit of the DNA-dependent kinase, encoded by PRKDC), ATM (ataxia telangiectasia, mutated), and ATR (ATM and Rad3-related) are related PI3K-like protein kinases and central regulators of the DDR. Defects in these kinases have been linked to neurodegenerative or neurodevelopmental syndromes. In all cases, the key neuroprotective function of these kinases is uncertain. It also remains unclear how interactions between the three DNA damage-responsive kinases coordinate genome stability, particularly in a physiological context. Here, we used a genetic approach to identify the neural function of DNA-PKcs and the interplay between ATM and ATR during neurogenesis. We found that DNA-PKcs loss in the mouse sensitized neuronal progenitors to apoptosis after ionizing radiation because of excessive DNA damage. DNA-PKcs was also required to prevent endogenous DNA damage accumulation throughout the adult brain. In contrast, ATR coordinated the DDR during neurogenesis to direct apoptosis in cycling neural progenitors, whereas ATM regulated apoptosis in both proliferative and noncycling cells. We also found that ATR controls a DNA damage-induced G 2 /M checkpoint in cortical progenitors, independent of ATM and DNA-PKcs. These nonoverlapping roles were further confirmed via sustained murine embryonic or cortical development after all three kinases were simultaneously inactivated. Thus, our results illustrate how DNA-PKcs, ATM, and ATR have unique and essential roles during the DDR, collectively ensuring comprehensive genome maintenance in the nervous system. The DNA damage response (DDR) is essential for prevention of a broad spectrum of different human neurologic diseases. However, a detailed understanding of the DDR at a physiological level is lacking. In contrast to many in

  6. Studies on the effects of persistent RNA priming on DNA replication and genomic stability

    OpenAIRE

    Stuckey, Ruth

    2014-01-01

    [EN]: DNA replication and transcription take place on the same DNA template, and the correct interplay between these processes ensures faithful genome duplication. DNA replication must be highly coordinated with other cell cycle events, such as segregation of fully replicated DNA in order to maintain genomic integrity. Transcription generates RNA:DNA hybrids, transient intermediate structures that are degraded by the ribonuclease H (RNaseH) class of enzymes. RNA:DNA hybrids can form R-loops, ...

  7. Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner

    DEFF Research Database (Denmark)

    Lu, David V; Brown, Randall H; Arumugam, Manimozhiyan

    2009-01-01

    MOTIVATION: The most accurate way to determine the intron-exon structures in a genome is to align spliced cDNA sequences to the genome. Thus, cDNA-to-genome alignment programs are a key component of most annotation pipelines. The scoring system used to choose the best alignment is a primary...... determinant of alignment accuracy, while heuristics that prevent consideration of certain alignments are a primary determinant of runtime and memory usage. Both accuracy and speed are important considerations in choosing an alignment algorithm, but scoring systems have received much less attention than...

  8. DNA Oncogenic Virus-Induced Oxidative Stress, Genomic Damage, and Aberrant Epigenetic Alterations

    Directory of Open Access Journals (Sweden)

    Mankgopo Magdeline Kgatle

    2017-01-01

    Full Text Available Approximately 20% of human cancers is attributable to DNA oncogenic viruses such as human papillomavirus (HPV, hepatitis B virus (HBV, and Epstein-Barr virus (EBV. Unrepaired DNA damage is the most common and overlapping feature of these DNA oncogenic viruses and a source of genomic instability and tumour development. Sustained DNA damage results from unceasing production of reactive oxygen species and activation of inflammasome cascades that trigger genomic changes and increased propensity of epigenetic alterations. Accumulation of epigenetic alterations may interfere with genome-wide cellular signalling machineries and promote malignant transformation leading to cancer development. Untangling and understanding the underlying mechanisms that promote these detrimental effects remain the major objectives for ongoing research and hope for effective virus-induced cancer therapy. Here, we review current literature with an emphasis on how DNA damage influences HPV, HVB, and EBV replication and epigenetic alterations that are associated with carcinogenesis.

  9. An automated annotation tool for genomic DNA sequences using

    Indian Academy of Sciences (India)

    Genomic sequence data are often available well before the annotated sequence is published. We present a method for analysis of genomic DNA to identify coding sequences using the GeneScan algorithm and characterize these resultant sequences by BLAST. The routines are used to develop a system for automated ...

  10. The DNA-encoded nucleosome organization of a eukaryotic genome.

    Science.gov (United States)

    Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

    2009-03-19

    Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

  11. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Okamura, K; Hisada, T; Takata, K; Hiraishi, A

    2013-01-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  12. Resurrection of DNA function in vivo from an extinct genome.

    Directory of Open Access Journals (Sweden)

    Andrew J Pask

    2008-05-01

    Full Text Available There is a burgeoning repository of information available from ancient DNA that can be used to understand how genomes have evolved and to determine the genetic features that defined a particular species. To assess the functional consequences of changes to a genome, a variety of methods are needed to examine extinct DNA function. We isolated a transcriptional enhancer element from the genome of an extinct marsupial, the Tasmanian tiger (Thylacinus cynocephalus or thylacine, obtained from 100 year-old ethanol-fixed tissues from museum collections. We then examined the function of the enhancer in vivo. Using a transgenic approach, it was possible to resurrect DNA function in transgenic mice. The results demonstrate that the thylacine Col2A1 enhancer directed chondrocyte-specific expression in this extinct mammalian species in the same way as its orthologue does in mice. While other studies have examined extinct coding DNA function in vitro, this is the first example of the restoration of extinct non-coding DNA and examination of its function in vivo. Our method using transgenesis can be used to explore the function of regulatory and protein-coding sequences obtained from any extinct species in an in vivo model system, providing important insights into gene evolution and diversity.

  13. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

    Science.gov (United States)

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

    2011-08-01

    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  14. Suicidal function of DNA methylation in age-related genome disintegration.

    Science.gov (United States)

    Mazin, Alexander L

    2009-10-01

    This article is dedicated to the 60th anniversary of 5-methylcytosine discovery in DNA. Cytosine methylation can affect genetic and epigenetic processes, works as a part of the genome-defense system and has mutagenic activity; however, the biological functions of this enzymatic modification are not well understood. This review will put forward the hypothesis that the host-defense role of DNA methylation in silencing and mutational destroying of retroviruses and other intragenomic parasites was extended during evolution to most host genes that have to be inactivated in differentiated somatic cells, where it acquired a new function in age-related self-destruction of the genome. The proposed model considers DNA methylation as the generator of 5mC>T transitions that induce 40-70% of all spontaneous somatic mutations of the multiple classes at CpG and CpNpG sites and flanking nucleotides in the p53, FIX, hprt, gpt human genes and some transgenes. The accumulation of 5mC-dependent mutations explains: global changes in the structure of the vertebrate genome throughout evolution; the loss of most 5mC from the DNA of various species over their lifespan and the Hayflick limit of normal cells; the polymorphism of methylation sites, including asymmetric mCpNpN sites; cyclical changes of methylation and demethylation in genes. The suicidal function of methylation may be a special genetic mechanism for increasing DNA damage and the programmed genome disintegration responsible for cell apoptosis and organism aging and death.

  15. Critical threshold levels of DNA methyltransferase 1 are required to maintain DNA methylation across the genome in human cancer cells.

    Science.gov (United States)

    Cai, Yi; Tsai, Hsing-Chen; Yen, Ray-Whay Chiu; Zhang, Yang W; Kong, Xiangqian; Wang, Wei; Xia, Limin; Baylin, Stephen B

    2017-04-01

    Reversing DNA methylation abnormalities and associated gene silencing, through inhibiting DNA methyltransferases (DNMTs) is an important potential cancer therapy paradigm. Maximizing this potential requires defining precisely how these enzymes maintain genome-wide, cancer-specific DNA methylation. To date, there is incomplete understanding of precisely how the three DNMTs, 1, 3A, and 3B, interact for maintaining DNA methylation abnormalities in cancer. By combining genetic and shRNA depletion strategies, we define not only a dominant role for DNA methyltransferase 1 (DNMT1) but also distinct roles of 3A and 3B in genome-wide DNA methylation maintenance. Lowering DNMT1 below a threshold level is required for maximal loss of DNA methylation at all genomic regions, including gene body and enhancer regions, and for maximally reversing abnormal promoter DNA hypermethylation and associated gene silencing to reexpress key genes. It is difficult to reach this threshold with patient-tolerable doses of current DNMT inhibitors (DNMTIs). We show that new approaches, like decreasing the DNMT targeting protein, UHRF1, can augment the DNA demethylation capacities of existing DNA methylation inhibitors for fully realizing their therapeutic potential. © 2017 Cai et al.; Published by Cold Spring Harbor Laboratory Press.

  16. Detection of the Canine Parvovirus 2c Subtype in Australian Dogs.

    Science.gov (United States)

    Woolford, Lucy; Crocker, Paul; Bobrowski, Hannah; Baker, Trevor; Hemmatzadeh, Farhid

    2017-06-01

    Canine parvovirus (CPV-2) is an important cause of hemorrhagic enteritis in dogs. In Australia the disease has been associated with CPV-2a and CPV-2b variants. A third more recently emerged variant overseas, CPV-2c, has not been detected in surveys of the Australian dog population. In this study, we report three cases of canine parvoviral enteritis associated with CPV-2c infection; case 1 occurred in an 8-week-old puppy that died following acute hemorrhagic enteritis. Cases 2 and 3 were an 11-month-old female entire Saint Bernard and a 9-month-old male entire Siberian husky, respectively, both which had completed vaccination schedules and presented with vomiting or mild diarrhea only. Full genomic sequencing of parvoviral DNA from cases 1, 2, and 3 revealed greater than 99% homology to known CPV-2c variants and predicted protein sequences from the VP2 region of viral DNA from all three cases identified; glutamic acid residues at the 426 amino acid residue, characteristic of the CPV-2c variant. Veterinary professionals should be aware that CPV-2c is now present in Australia, detected in a puppy and vaccinated young adult dogs in this study. Further characterization of CPV-2c-associated disease and its prevalence in Australian dogs requires additional research.

  17. Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

    Science.gov (United States)

    Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

    2018-05-14

    Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

  18. Evaluating Digital PCR for the Quantification of Human Genomic DNA: Accessible Amplifiable Targets.

    Science.gov (United States)

    Kline, Margaret C; Romsos, Erica L; Duewer, David L

    2016-02-16

    Polymerase chain reaction (PCR) multiplexed assays perform best when the input quantity of template DNA is controlled to within about a factor of √2. To help ensure that PCR assays yield consistent results over time and place, results from methods used to determine DNA quantity need to be metrologically traceable to a common reference. Many DNA quantitation systems can be accurately calibrated with solutions of DNA in aqueous buffer. Since they do not require external calibration, end-point limiting dilution technologies, collectively termed "digital PCR (dPCR)", have been proposed as suitable for value assigning such DNA calibrants. The performance characteristics of several commercially available dPCR systems have recently been documented using plasmid, viral, or fragmented genomic DNA; dPCR performance with more complex materials, such as human genomic DNA, has been less studied. With the goal of providing a human genomic reference material traceably certified for mass concentration, we are investigating the measurement characteristics of several dPCR systems. We here report results of measurements from multiple PCR assays, on four human genomic DNAs treated with four endonuclease restriction enzymes using both chamber and droplet dPCR platforms. We conclude that dPCR does not estimate the absolute number of PCR targets in a given volume but rather the number of accessible and amplifiable targets. While enzymatic restriction of human genomic DNA increases accessibility for some assays, in well-optimized PCR assays it can reduce the number of amplifiable targets and increase assay variability relative to uncut sample.

  19. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    Directory of Open Access Journals (Sweden)

    Zhongai Li

    2015-01-01

    Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.

  20. cDNA structure, genomic organization and expression patterns of ...

    African Journals Online (AJOL)

    Visfatin was a newly identified adipocytokine, which was involved in various physiologic and pathologic processes of organisms. The cDNA structure, genomic organization and expression patterns of silver Prussian carp visfatin were described in this report. The silver Prussian carp visfatin cDNA cloned from the liver was ...

  1. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    Science.gov (United States)

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  2. Whole-genome methylation caller designed for methyl- DNA ...

    African Journals Online (AJOL)

    etchie

    2013-02-20

    Feb 20, 2013 ... Our method uses a single-CpG-resolution, whole-genome methylation ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, ...... methylation is prevalent in embryonic stem cells andmaybe mediated.

  3. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  4. Continued colonization of the human genome by mitochondrial DNA.

    Directory of Open Access Journals (Sweden)

    Miria Ricchetti

    2004-09-01

    Full Text Available Integration of mitochondrial DNA fragments into nuclear chromosomes (giving rise to nuclear DNA sequences of mitochondrial origin, or NUMTs is an ongoing process that shapes nuclear genomes. In yeast this process depends on double-strand-break repair. Since NUMTs lack amplification and specific integration mechanisms, they represent the prototype of exogenous insertions in the nucleus. From sequence analysis of the genome of Homo sapiens, followed by sampling humans from different ethnic backgrounds, and chimpanzees, we have identified 27 NUMTs that are specific to humans and must have colonized human chromosomes in the last 4-6 million years. Thus, we measured the fixation rate of NUMTs in the human genome. Six such NUMTs show insertion polymorphism and provide a useful set of DNA markers for human population genetics. We also found that during recent human evolution, Chromosomes 18 and Y have been more susceptible to colonization by NUMTs. Surprisingly, 23 out of 27 human-specific NUMTs are inserted in known or predicted genes, mainly in introns. Some individuals carry a NUMT insertion in a tumor-suppressor gene and in a putative angiogenesis inhibitor. Therefore in humans, but not in yeast, NUMT integrations preferentially target coding or regulatory sequences. This is indeed the case for novel insertions associated with human diseases and those driven by environmental insults. We thus propose a mutagenic phenomenon that may be responsible for a variety of genetic diseases in humans and suggest that genetic or environmental factors that increase the frequency of chromosome breaks provide the impetus for the continued colonization of the human genome by mitochondrial DNA.

  5. Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

  6. Genetic characterization of the complete genome of a mutant canine parvovirus isolated in China.

    Science.gov (United States)

    Li, Chuanfeng; Tang, Jingyu; Chen, Zongyan; Li, Qi; Huang, Zhenhua; Wang, Quan; Meng, Chunchun; Wang, Yong; Liu, Guangqing

    2018-02-01

    A field canine parvovirus (CPV) strain, CPV-SH14, was previously isolated from an outbreak of severe gastroenteritis in Shanghai in 2014. The complete genome of CPV-SH14 was determined by using PCR with modified primers. When compared to other CPV-2 strains, several insertions, deletions, and point mutations were identified in the 5' and 3' UTR, with key amino acid (aa) mutations (K19R, E572K in NS1 and F267Y, Y324I and T440A in VP2) also being observed in the coding regions of CPV-SH14. These results indicated that significant and unique genetic variations have occurred at key sites or residues in the genome of CPV-SH14, suggesting the presence of a novel genetic variant of new CPV-2a. Phylogenetic analysis of the VP2 gene revealed that CPV-SH14 may have the potential to spread worldwide. In conclusion, CPV-SH14 may be a novel genetic variant of new CPV-2a, potentially with a selective advantage over other strains.

  7. Genome Partitioner: A web tool for multi-level partitioning of large-scale DNA constructs for synthetic biology applications.

    Science.gov (United States)

    Christen, Matthias; Del Medico, Luca; Christen, Heinz; Christen, Beat

    2017-01-01

    Recent advances in lower-cost DNA synthesis techniques have enabled new innovations in the field of synthetic biology. Still, efficient design and higher-order assembly of genome-scale DNA constructs remains a labor-intensive process. Given the complexity, computer assisted design tools that fragment large DNA sequences into fabricable DNA blocks are needed to pave the way towards streamlined assembly of biological systems. Here, we present the Genome Partitioner software implemented as a web-based interface that permits multi-level partitioning of genome-scale DNA designs. Without the need for specialized computing skills, biologists can submit their DNA designs to a fully automated pipeline that generates the optimal retrosynthetic route for higher-order DNA assembly. To test the algorithm, we partitioned a 783 kb Caulobacter crescentus genome design. We validated the partitioning strategy by assembling a 20 kb test segment encompassing a difficult to synthesize DNA sequence. Successful assembly from 1 kb subblocks into the 20 kb segment highlights the effectiveness of the Genome Partitioner for reducing synthesis costs and timelines for higher-order DNA assembly. The Genome Partitioner is broadly applicable to translate DNA designs into ready to order sequences that can be assembled with standardized protocols, thus offering new opportunities to harness the diversity of microbial genomes for synthetic biology applications. The Genome Partitioner web tool can be accessed at https://christenlab.ethz.ch/GenomePartitioner.

  8. Genome Partitioner: A web tool for multi-level partitioning of large-scale DNA constructs for synthetic biology applications.

    Directory of Open Access Journals (Sweden)

    Matthias Christen

    Full Text Available Recent advances in lower-cost DNA synthesis techniques have enabled new innovations in the field of synthetic biology. Still, efficient design and higher-order assembly of genome-scale DNA constructs remains a labor-intensive process. Given the complexity, computer assisted design tools that fragment large DNA sequences into fabricable DNA blocks are needed to pave the way towards streamlined assembly of biological systems. Here, we present the Genome Partitioner software implemented as a web-based interface that permits multi-level partitioning of genome-scale DNA designs. Without the need for specialized computing skills, biologists can submit their DNA designs to a fully automated pipeline that generates the optimal retrosynthetic route for higher-order DNA assembly. To test the algorithm, we partitioned a 783 kb Caulobacter crescentus genome design. We validated the partitioning strategy by assembling a 20 kb test segment encompassing a difficult to synthesize DNA sequence. Successful assembly from 1 kb subblocks into the 20 kb segment highlights the effectiveness of the Genome Partitioner for reducing synthesis costs and timelines for higher-order DNA assembly. The Genome Partitioner is broadly applicable to translate DNA designs into ready to order sequences that can be assembled with standardized protocols, thus offering new opportunities to harness the diversity of microbial genomes for synthetic biology applications. The Genome Partitioner web tool can be accessed at https://christenlab.ethz.ch/GenomePartitioner.

  9. Genome-wide alterations of the DNA replication program during tumor progression

    Science.gov (United States)

    Arneodo, A.; Goldar, A.; Argoul, F.; Hyrien, O.; Audit, B.

    2016-08-01

    Oncogenic stress is a major driving force in the early stages of cancer development. Recent experimental findings reveal that, in precancerous lesions and cancers, activated oncogenes may induce stalling and dissociation of DNA replication forks resulting in DNA damage. Replication timing is emerging as an important epigenetic feature that recapitulates several genomic, epigenetic and functional specificities of even closely related cell types. There is increasing evidence that chromosome rearrangements, the hallmark of many cancer genomes, are intimately associated with the DNA replication program and that epigenetic replication timing changes often precede chromosomic rearrangements. The recent development of a novel methodology to map replication fork polarity using deep sequencing of Okazaki fragments has provided new and complementary genome-wide replication profiling data. We review the results of a wavelet-based multi-scale analysis of genomic and epigenetic data including replication profiles along human chromosomes. These results provide new insight into the spatio-temporal replication program and its dynamics during differentiation. Here our goal is to bring to cancer research, the experimental protocols and computational methodologies for replication program profiling, and also the modeling of the spatio-temporal replication program. To illustrate our purpose, we report very preliminary results obtained for the chronic myelogeneous leukemia, the archetype model of cancer. Finally, we discuss promising perspectives on using genome-wide DNA replication profiling as a novel efficient tool for cancer diagnosis, prognosis and personalized treatment.

  10. Global DNA Methylation in the Chestnut Blight Fungus Cryphonectria parasitica and Genome-Wide Changes in DNA Methylation Accompanied with Sectorization

    Directory of Open Access Journals (Sweden)

    Kum-Kang So

    2018-02-01

    Full Text Available Mutation in CpBck1, an ortholog of the cell wall integrity mitogen-activated protein kinase kinase kinase (MAPKKK of Saccharomyces cerevisiae, in the chestnut blight fungus Cryphonectria parasitica resulted in a sporadic sectorization as culture proceeded. The progeny from the sectored area maintained the characteristics of the sector, showing a massive morphogenetic change, including robust mycelial growth without differentiation. Epigenetic changes were investigated as the genetic mechanism underlying this sectorization. Quantification of DNA methylation and whole-genome bisulfite sequencing revealed genome-wide DNA methylation of the wild-type at each nucleotide level and changes in DNA methylation of the sectored progeny. Compared to the wild-type, the sectored progeny exhibited marked genome-wide DNA hypomethylation but increased methylation sites. Expression analysis of two DNA methyltransferases, including two representative types of DNA methyltransferase (DNMTase, demonstrated that both were significantly down-regulated in the sectored progeny. However, functional analysis using mutant phenotypes of corresponding DNMTases demonstrated that a mutant of CpDmt1, an ortholog of RID of Neurospora crassa, resulted in the sectored phenotype but the CpDmt2 mutant did not, suggesting that the genetic basis of fungal sectorization is more complex. The present study revealed that a mutation in a signaling pathway component resulted in sectorization accompanied with changes in genome-wide DNA methylation, which suggests that this signal transduction pathway is important for epigenetic control of sectorization via regulation of genes involved in DNA methylation.

  11. Chromosomal Localization of DNA Amplifications in Neuroblastoma Tumors Using cDNA Microarray Comparative Genomic Hybridization

    Directory of Open Access Journals (Sweden)

    Ben Beheshti

    2003-01-01

    Full Text Available Conventional comparative genomic hybridization (CGH profiling of neuroblastomas has identified many genomic aberrations, although the limited resolution has precluded a precise localization of sequences of interest within amplicons. To map high copy number genomic gains in clinically matched stage IV neuroblastomas, CGH analysis using a 19,200-feature cDNA microarray was used. A dedicated (freely available algorithm was developed for rapid in silico determination of chromosomal localizations of microarray cDNA targets, and for generation of an ideogram-type profile of copy number changes. Using these methodologies, novel gene amplifications undetectable by chromosome CGH were identified, and larger MYCN amplicon sizes (in one tumor up to 6 Mb than those previously reported in neuroblastoma were identified. The genes HPCAL1, LPIN1/KIAA0188, NAG, and NSE1/LOC151354 were found to be coamplified with MYCN. To determine whether stage IV primary tumors could be further subclassified based on their genomic copy number profiles, hierarchical clustering was performed. Cluster analysis of microarray CGH data identified three groups: 1 no amplifications evident, 2 a small MYCN amplicon as the only detectable imbalance, and 3 a large MYCN amplicon with additional gene amplifications. Application of CGH to cDNA microarray targets will help to determine both the variation of amplicon size and help better define amplification-dependent and independent pathways of progression in neuroblastoma.

  12. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  13. Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner.

    Science.gov (United States)

    Lu, David V; Brown, Randall H; Arumugam, Manimozhiyan; Brent, Michael R

    2009-07-01

    The most accurate way to determine the intron-exon structures in a genome is to align spliced cDNA sequences to the genome. Thus, cDNA-to-genome alignment programs are a key component of most annotation pipelines. The scoring system used to choose the best alignment is a primary determinant of alignment accuracy, while heuristics that prevent consideration of certain alignments are a primary determinant of runtime and memory usage. Both accuracy and speed are important considerations in choosing an alignment algorithm, but scoring systems have received much less attention than heuristics. We present Pairagon, a pair hidden Markov model based cDNA-to-genome alignment program, as the most accurate aligner for sequences with high- and low-identity levels. We conducted a series of experiments testing alignment accuracy with varying sequence identity. We first created 'perfect' simulated cDNA sequences by splicing the sequences of exons in the reference genome sequences of fly and human. The complete reference genome sequences were then mutated to various degrees using a realistic mutation simulator and the perfect cDNAs were aligned to them using Pairagon and 12 other aligners. To validate these results with natural sequences, we performed cross-species alignment using orthologous transcripts from human, mouse and rat. We found that aligner accuracy is heavily dependent on sequence identity. For sequences with 100% identity, Pairagon achieved accuracy levels of >99.6%, with one quarter of the errors of any other aligner. Furthermore, for human/mouse alignments, which are only 85% identical, Pairagon achieved 87% accuracy, higher than any other aligner. Pairagon source and executables are freely available at http://mblab.wustl.edu/software/pairagon/

  14. Epigenetic control of mobile DNA as an interface between experience and genome change

    Directory of Open Access Journals (Sweden)

    James A. Shapiro

    2014-04-01

    Full Text Available Mobile DNA in the genome is subject to RNA-targeted epigenetic control. This control regulates the activity of transposons, retrotransposons and genomic proviruses. Many different life history experiences alter the activities of mobile DNA and the expression of genetic loci regulated by nearby insertions. The same experiences induce alterations in epigenetic formatting and lead to trans-generational modifications of genome expression and stability. These observations lead to the hypothesis that epigenetic formatting directed by non-coding RNA provides a molecular interface between life history events and genome alteration.

  15. BuD, a helix–loop–helix DNA-binding domain for genome modification

    Energy Technology Data Exchange (ETDEWEB)

    Stella, Stefano [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Molina, Rafael; López-Méndez, Blanca [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Campos-Olivas, Ramon [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Duchateau, Phillippe [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Montoya, Guillermo, E-mail: guillermo.montoya@cpr.ku.dk [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark)

    2014-07-01

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.

  16. Genome-wide DNA methylation patterns and transcription analysis in sheep muscle.

    Directory of Open Access Journals (Sweden)

    Christine Couldrey

    Full Text Available DNA methylation plays a central role in regulating many aspects of growth and development in mammals through regulating gene expression. The development of next generation sequencing technologies have paved the way for genome-wide, high resolution analysis of DNA methylation landscapes using methodology known as reduced representation bisulfite sequencing (RRBS. While RRBS has proven to be effective in understanding DNA methylation landscapes in humans, mice, and rats, to date, few studies have utilised this powerful method for investigating DNA methylation in agricultural animals. Here we describe the utilisation of RRBS to investigate DNA methylation in sheep Longissimus dorsi muscles. RRBS analysis of ∼1% of the genome from Longissimus dorsi muscles provided data of suitably high precision and accuracy for DNA methylation analysis, at all levels of resolution from genome-wide to individual nucleotides. Combining RRBS data with mRNAseq data allowed the sheep Longissimus dorsi muscle methylome to be compared with methylomes from other species. While some species differences were identified, many similarities were observed between DNA methylation patterns in sheep and other more commonly studied species. The RRBS data presented here highlights the complexity of epigenetic regulation of genes. However, the similarities observed across species are promising, in that knowledge gained from epigenetic studies in human and mice may be applied, with caution, to agricultural species. The ability to accurately measure DNA methylation in agricultural animals will contribute an additional layer of information to the genetic analyses currently being used to maximise production gains in these species.

  17. Antibody study in canine distemper virus nucleocapsid protein gene-immunized mice.

    Science.gov (United States)

    Yuan, B; Li, X Y; Zhu, T; Yuan, L; Hu, J P; Chen, J; Gao, W; Ren, W Z

    2015-04-10

    The gene for the nucleocapsid (N) protein of canine distemper virus was cloned into the pMD-18T vector, and positive recombinant plasmids were obtained by enzyme digestion and sequencing. After digestion by both EcoRI and KpnI, the plasmid was directionally cloned into the eukaryotic expression vector pcDNA; the positive clone pcDNA-N was screened by electrophoresis and then transfected into COS-7 cells. Immunofluorescence analysis results showed that the canine distemper virus N protein was expressed in the cytoplasm of transfected COS-7 cells. After emulsification in Freund's adjuvant, the recombinant plasmid pcDNA-N was injected into the abdominal cavity of 8-week-old BABL/c mice, with the pcDNA original vector used as a negative control. Mice were immunized 3 times every 2 weeks. The blood of immunized mice was drawn 2 weeks after completing the immunizations to measure titer levels. The antibody titer in the pcDNA-N test was 10(1.62 ± 0.164), while in the control group this value was 10(0.52 ± 0.56), indicating that specific humoral immunity was induced in canine distemper virus nucleocapsid protein-immunized mice.

  18. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes.

    Science.gov (United States)

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas

    2016-06-02

    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Multiple displacement amplification of whole genomic DNA from urediospores of Puccinia striiformis f. sp. tritici.

    Science.gov (United States)

    Zhang, R; Ma, Z H; Wu, B M

    2015-05-01

    Biotrophic fungi, such as Puccinia striiformis f. sp. tritici, because they cannot be cultured on nutrient media, to obtain adequate quantity of DNA for molecular genetic analysis, are usually propagated on living hosts, wheat plants in case of P. striiformis f. sp. tritici. The propagation process is time-, space- and labor-consuming and has been a bottleneck to molecular genetic analysis of this pathogen. In this study we evaluated multiple displacement amplification (MDA) of pathogen genomic DNA from urediospores as an alternative approach to traditional propagation of urediospores followed by DNA extraction. The quantities of pathogen genomic DNA in the products were further determined via real-time PCR with a pair of primers specific for the β-tubulin gene of P. striiformis f. sp. tritici. The amplified fragment length polymorphism (AFLP) fingerprints were also compared between the DNA products. The results demonstrated that adequate genomic DNA at fragment size larger than 23 Kb could be amplified from 20 to 30 urediospores via MDA method. The real-time PCR results suggested that although fresh urediospores collected from diseased leaves were the best, spores picked from diseased leaves stored for a prolonged period could also be used for amplification. AFLP fingerprints exhibited no significant differences between amplified DNA and DNA extracted with CTAB method, suggesting amplified DNA can represent the pathogen's genomic DNA very well. Therefore, MDA could be used to obtain genomic DNA from small precious samples (dozens of spores) for molecular genetic analysis of wheat stripe rust pathogen, and other fungi that are difficult to propagate.

  20. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    Directory of Open Access Journals (Sweden)

    Abadie Jerome

    2011-05-01

    Full Text Available Abstract Background Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Methods Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Results Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. Conclusions The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model

  1. Molecular cytogenetic characterization of canine histiocytic sarcoma: A spontaneous model for human histiocytic cancer identifies deletion of tumor suppressor genes and highlights influence of genetic background on tumor behavior

    International Nuclear Information System (INIS)

    Hedan, Benoit; Thomas, Rachael; Motsinger-Reif, Alison; Abadie, Jerome; Andre, Catherine; Cullen, John; Breen, Matthew

    2011-01-01

    Histiocytic malignancies in both humans and dogs are rare and poorly understood. While canine histiocytic sarcoma (HS) is uncommon in the general domestic dog population, there is a strikingly high incidence in a subset of breeds, suggesting heritable predisposition. Molecular cytogenetic profiling of canine HS in these breeds would serve to reveal recurrent DNA copy number aberrations (CNAs) that are breed and/or tumor associated, as well as defining those shared with human HS. This process would identify evolutionarily conserved cytogenetic changes to highlight regions of particular importance to HS biology. Using genome wide array comparative genomic hybridization we assessed CNAs in 104 spontaneously occurring HS from two breeds of dog exhibiting a particularly elevated incidence of this tumor, the Bernese Mountain Dog and Flat-Coated Retriever. Recurrent CNAs were evaluated further by multicolor fluorescence in situ hybridization and loss of heterozygosity analyses. Statistical analyses were performed to identify CNAs associated with tumor location and breed. Almost all recurrent CNAs identified in this study were shared between the two breeds, suggesting that they are associated more with the cancer phenotype than with breed. A subset of recurrent genomic imbalances suggested involvement of known cancer associated genes in HS pathogenesis, including deletions of the tumor suppressor genes CDKN2A/B, RB1 and PTEN. A small number of aberrations were unique to each breed, implying that they may contribute to the major differences in tumor location evident in these two breeds. The most highly recurrent canine CNAs revealed in this study are evolutionarily conserved with those reported in human histiocytic proliferations, suggesting that human and dog HS share a conserved pathogenesis. The breed associated clinical features and DNA copy number aberrations exhibited by canine HS offer a valuable model for the human counterpart, providing additional evidence towards

  2. Concentrating and labeling genomic DNA in a nanofluidic array

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.

    2018-01-01

    , however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...

  3. Instability of plastid DNA in the nuclear genome.

    Directory of Open Access Journals (Sweden)

    Anna E Sheppard

    2009-01-01

    Full Text Available Functional gene transfer from the plastid (chloroplast and mitochondrial genomes to the nucleus has been an important driving force in eukaryotic evolution. Non-functional DNA transfer is far more frequent, and the frequency of such transfers from the plastid to the nucleus has been determined experimentally in tobacco using transplastomic lines containing, in their plastid genome, a kanamycin resistance gene (neo readymade for nuclear expression. Contrary to expectations, non-Mendelian segregation of the kanamycin resistance phenotype is seen in progeny of some lines in which neo has been transferred to the nuclear genome. Here, we provide a detailed analysis of the instability of kanamycin resistance in nine of these lines, and we show that it is due to deletion of neo. Four lines showed instability with variation between progeny derived from different areas of the same plant, suggesting a loss of neo during somatic cell division. One line showed a consistent reduction in the proportion of kanamycin-resistant progeny, suggesting a loss of neo during meiosis, and the remaining four lines were relatively stable. To avoid genomic enlargement, the high frequency of plastid DNA integration into the nuclear genome necessitates a counterbalancing removal process. This is the first demonstration of such loss involving a high proportion of recent nuclear integrants. We propose that insertion, deletion, and rearrangement of plastid sequences in the nuclear genome are important evolutionary processes in the generation of novel nuclear genes. This work is also relevant in the context of transgenic plant research and crop production, because similar processes to those described here may be involved in the loss of plant transgenes.

  4. Measuring the Levels of Ribonucleotides Embedded in Genomic DNA.

    Science.gov (United States)

    Meroni, Alice; Nava, Giulia M; Sertic, Sarah; Plevani, Paolo; Muzi-Falconi, Marco; Lazzaro, Federico

    2018-01-01

    Ribonucleotides (rNTPs) are incorporated into genomic DNA at a relatively high frequency during replication. They have beneficial effects but, if not removed from the chromosomes, increase genomic instability. Here, we describe a fast method to easily estimate the amounts of embedded ribonucleotides into the genome. The protocol described is performed in Saccharomyces cerevisiae and allows us to quantify altered levels of rNMPs due to different mutations in the replicative polymerase ε. However, this protocol can be easily applied to cells derived from any organism.

  5. Detecting DNA double-stranded breaks in mammalian genomes by linear amplification-mediated high-throughput genome-wide translocation sequencing.

    Science.gov (United States)

    Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L

    2016-05-01

    Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.

  6. Alignment of Escherichia coli K12 DNA sequences to a genomic restriction map.

    Science.gov (United States)

    Rudd, K E; Miller, W; Ostell, J; Benson, D A

    1990-01-25

    We use the extensive published information describing the genome of Escherichia coli and new restriction map alignment software to align DNA sequence, genetic, and physical maps. Restriction map alignment software is used which considers restriction maps as strings analogous to DNA or protein sequences except that two values, enzyme name and DNA base address, are associated with each position on the string. The resulting alignments reveal a nearly linear relationship between the physical and genetic maps of the E. coli chromosome. Physical map comparisons with the 1976, 1980, and 1983 genetic maps demonstrate a better fit with the more recent maps. The results of these alignments are genomic kilobase coordinates, orientation and rank of the alignment that best fits the genetic data. A statistical measure based on extreme value distribution is applied to the alignments. Additional computer analyses allow us to estimate the accuracy of the published E. coli genomic restriction map, simulate rearrangements of the bacterial chromosome, and search for repetitive DNA. The procedures we used are general enough to be applicable to other genome mapping projects.

  7. In Vitro Whole Genome DNA Binding Analysis of the Bacterial Replication Initiator and Transcription Factor DnaA.

    Directory of Open Access Journals (Sweden)

    Janet L Smith

    2015-05-01

    Full Text Available DnaA, the replication initiation protein in bacteria, is an AAA+ ATPase that binds and hydrolyzes ATP and exists in a heterogeneous population of ATP-DnaA and ADP-DnaA. DnaA binds cooperatively to the origin of replication and several other chromosomal regions, and functions as a transcription factor at some of these regions. We determined the binding properties of Bacillus subtilis DnaA to genomic DNA in vitro at single nucleotide resolution using in vitro DNA affinity purification and deep sequencing (IDAP-Seq. We used these data to identify 269 binding regions, refine the consensus sequence of the DnaA binding site, and compare the relative affinity of binding regions for ATP-DnaA and ADP-DnaA. Most sites had a slightly higher affinity for ATP-DnaA than ADP-DnaA, but a few had a strong preference for binding ATP-DnaA. Of the 269 sites, only the eight strongest binding ones have been observed to bind DnaA in vivo, suggesting that other cellular factors or the amount of available DnaA in vivo restricts DnaA binding to these additional sites. Conversely, we found several chromosomal regions that were bound by DnaA in vivo but not in vitro, and that the nucleoid-associated protein Rok was required for binding in vivo. Our in vitro characterization of the inherent ability of DnaA to bind the genome at single nucleotide resolution provides a backdrop for interpreting data on in vivo binding and regulation of DnaA, and is an approach that should be adaptable to many other DNA binding proteins.

  8. Whole-genome amplified DNA from stored dried blood spots is reliable in high resolution melting curve and sequencing analysis

    DEFF Research Database (Denmark)

    Winkel, Bo G; Hollegaard, Mads V; Olesen, Morten S

    2011-01-01

    BACKGROUND: The use of dried blood spots (DBS) samples in genomic workup has been limited by the relative low amounts of genomic DNA (gDNA) they contain. It remains to be proven that whole genome amplified DNA (wgaDNA) from stored DBS samples, constitutes a reliable alternative to gDNA.We wanted...

  9. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human.

    Science.gov (United States)

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai

    2017-02-16

    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation.

  10. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    Directory of Open Access Journals (Sweden)

    Padmavathy

    2012-02-01

    Full Text Available Abstract Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to

  11. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  12. Impact of Sample Type and DNA Isolation Procedure on Genomic Inference of Microbiome Composition

    DEFF Research Database (Denmark)

    Knudsen, Berith Elkær; Bergmark, Lasse; Munk, Patrick

    2016-01-01

    that in standard protocols. Based on this insight, we designed an improved DNA isolation procedure optimized for microbiome genomics that can be used for the three examined specimen types and potentially also for other biological specimens. A standard operating procedure is available from https://dx.doi.org/10......Explorations of complex microbiomes using genomics greatly enhance our understanding about their diversity, biogeography, and function. The isolation of DNA from microbiome specimens is a key prerequisite for such examinations, but challenges remain in obtaining sufficient DNA quantities required...... for certain sequencing approaches, achieving accurate genomic inference of microbiome composition, and facilitating comparability of findings across specimen types and sequencing projects. These aspects are particularly relevant for the genomics-based global surveillance of infectious agents and antimicrobial...

  13. Identification of quantitative trait loci (QTL for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs.

    Directory of Open Access Journals (Sweden)

    Sophia Pfahler

    Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.

  14. G-Quadruplexes Involving Both Strands of Genomic DNA Are Highly Abundant and Colocalize with Functional Sites in the Human Genome.

    Directory of Open Access Journals (Sweden)

    Andrzej S Kudlicki

    Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.

  15. Accurate DNA assembly and genome engineering with optimized uracil excision cloning

    DEFF Research Database (Denmark)

    Cavaleiro, Mafalda; Kim, Se Hyeuk; Seppala, Susanna

    2015-01-01

    Simple and reliable DNA editing by uracil excision (a.k.a. USER cloning) has been described by several research groups, but the optimal design of cohesive DNA ends for multigene assembly remains elusive. Here, we use two model constructs based on expression of gfp and a four-gene pathway that pro......Simple and reliable DNA editing by uracil excision (a.k.a. USER cloning) has been described by several research groups, but the optimal design of cohesive DNA ends for multigene assembly remains elusive. Here, we use two model constructs based on expression of gfp and a four-gene pathway...... that produces β-carotene to optimize assembly junctions and the uracil excision protocol. By combining uracil excision cloning with a genomic integration technology, we demonstrate that up to six DNA fragments can be assembled in a one-tube reaction for direct genome integration with high accuracy, greatly...... facilitating the advanced engineering of robust cell factories....

  16. Studies on the Interaction between Zinc-Hydroxybenzoite Complex and Genomic DNA

    Directory of Open Access Journals (Sweden)

    Hacali Necefoglu

    2006-04-01

    Full Text Available Zinc-Hydroxybenzoite ([Zn (H206] (p-HO-C6H4COO22H20 complex which wassynthesized and characterized by instrumental methods and the DNA samples which hadbeen isolated from cattle were allowed to interact at 37 oC for different time periods. Theinteraction of genomic DNA with this complex has been followed by agarose gelelectrophoresis at 50 V for 2 h. When DNA samples were allowed to interact with this metalcomplex, it was found that band intensities changed with the concentrations of the complex.In the result of interaction between this complex and genomic DNA samples, it wasdetermined that the intensities of bands were changed at the different concentrations of thecomplex. The brightness of the bands was increased and mobility of the bands wasdecreased, indicating the occurrence of increased covalent binding of the metal complexwith DNA. In this study it was concluded that the damage effect of ascorbate was reducedby Zinc-Hydroxybenzoite.

  17. Links between DNA methylation and nucleosome occupancy in the human genome.

    Science.gov (United States)

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  18. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Development of canine herpesvirus based antifertility vaccines for foxes using bacterial artificial chromosomes.

    Science.gov (United States)

    Strive, Tanja; Hardy, Christopher M; French, Nigel; Wright, John D; Nagaraja, Nitin; Reubel, Gerhard H

    2006-02-13

    Using bacterial artificial chromosome (BAC) technology, a canine herpesvirus (CHV)-based recombinant vaccine vector was produced for the development of an antifertility vaccine for foxes. Infectious viruses were recovered following transfection of canid cells with a BAC plasmid carrying the complete CHV genome. In vitro growth characteristics of BAC-derived viruses were similar to that of wildtype (wt)-CHV. Two recombinant antigens, fox zona pellucida protein subunit 3 (fZPC) and enhanced green fluorescent protein (EGFP) as control antigen, were inserted into thymidine kinase (TK) locus of the CHV genome and shown to be efficiently expressed in vitro. Inoculation of foxes with transgenic CHVs induced CHV specific antibodies, but was innocuous and failed to elicit transgene-specific antibody responses. Infectious virus or viral DNA was not detected in mucosal secretions or tissues of vaccinated foxes. The CHV-BAC system proved to be a quick and reliable method to manipulate the CHV genome. It will help to readily apply changes in the vector design in order to improve virus replication in vivo.

  20. Virus neutralizing antibody response in mice and dogs with a bicistronic DNA vaccine encoding rabies virus glycoprotein and canine parvovirus VP2.

    Science.gov (United States)

    Patial, Sonika; Chaturvedi, V K; Rai, A; Saini, M; Chandra, Rajesh; Saini, Y; Gupta, Praveen K

    2007-05-16

    A bicistronic DNA vaccine against rabies and parvovirus infection of dogs was developed by subcloning rabies glycoprotein and canine parvovirus (CPV) VP2 genes into a bicistronic vector. After characterizing the expression of both the proteins in vitro, the bicistronic DNA vaccine was injected in mice and induced immune response was compared with monocistronic DNA vaccines. There was no significant difference in ELISA and virus neutralizing (VN) antibody responses against rabies and CPV in mice immunized with either bicistronic or monocistronic DNA vaccine. Further, there was significantly similar protection in mice immunized with either bicistronic or monocistronic rabies DNA vaccine on rabies virus challenge. Similarly, dogs immunized with monocistronic and bicistronic DNA vaccines developed comparable VN antibodies against rabies and CPV. This study indicated that bicistronic DNA vaccine can be used in dogs to induce virus neutralizing immune responses against both rabies and CPV.

  1. Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

    Science.gov (United States)

    Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

    2014-12-15

    A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Evaluating droplet digital PCR for the quantification of human genomic DNA: converting copies per nanoliter to nanograms nuclear DNA per microliter.

    Science.gov (United States)

    Duewer, David L; Kline, Margaret C; Romsos, Erica L; Toman, Blaza

    2018-05-01

    The highly multiplexed polymerase chain reaction (PCR) assays used for forensic human identification perform best when used with an accurately determined quantity of input DNA. To help ensure the reliable performance of these assays, we are developing a certified reference material (CRM) for calibrating human genomic DNA working standards. To enable sharing information over time and place, CRMs must provide accurate and stable values that are metrologically traceable to a common reference. We have shown that droplet digital PCR (ddPCR) limiting dilution end-point measurements of the concentration of DNA copies per volume of sample can be traceably linked to the International System of Units (SI). Unlike values assigned using conventional relationships between ultraviolet absorbance and DNA mass concentration, entity-based ddPCR measurements are expected to be stable over time. However, the forensic community expects DNA quantity to be stated in terms of mass concentration rather than entity concentration. The transformation can be accomplished given SI-traceable values and uncertainties for the number of nucleotide bases per human haploid genome equivalent (HHGE) and the average molar mass of a nucleotide monomer in the DNA polymer. This report presents the considerations required to establish the metrological traceability of ddPCR-based mass concentration estimates of human nuclear DNA. Graphical abstract The roots of metrological traceability for human nuclear DNA mass concentration results. Values for the factors in blue must be established experimentally. Values for the factors in red have been established from authoritative source materials. HHGE stands for "haploid human genome equivalent"; there are two HHGE per diploid human genome.

  3. Comparative Genomics of DNA Recombination and Repair in Cyanobacteria: Biotechnological Implications

    Science.gov (United States)

    Cassier-Chauvat, Corinne; Veaudor, Théo; Chauvat, Franck

    2016-01-01

    Cyanobacteria are fascinating photosynthetic prokaryotes that are regarded as the ancestors of the plant chloroplast; the purveyors of oxygen and biomass for the food chain; and promising cell factories for an environmentally friendly production of chemicals. In colonizing most waters and soils of our planet, cyanobacteria are inevitably challenged by environmental stresses that generate DNA damages. Furthermore, many strains engineered for biotechnological purposes can use DNA recombination to stop synthesizing the biotechnological product. Hence, it is important to study DNA recombination and repair in cyanobacteria for both basic and applied research. This review reports what is known in a few widely studied model cyanobacteria and what can be inferred by mining the sequenced genomes of morphologically and physiologically diverse strains. We show that cyanobacteria possess many E. coli-like DNA recombination and repair genes, and possibly other genes not yet identified. E. coli-homolog genes are unevenly distributed in cyanobacteria, in agreement with their wide genome diversity. Many genes are extremely well conserved in cyanobacteria (mutMS, radA, recA, recFO, recG, recN, ruvABC, ssb, and uvrABCD), even in small genomes, suggesting that they encode the core DNA repair process. In addition to these core genes, the marine Prochlorococcus and Synechococcus strains harbor recBCD (DNA recombination), umuCD (mutational DNA replication), as well as the key SOS genes lexA (regulation of the SOS system) and sulA (postponing of cell division until completion of DNA reparation). Hence, these strains could possess an E. coli-type SOS system. In contrast, several cyanobacteria endowed with larger genomes lack typical SOS genes. For examples, the two studied Gloeobacter strains lack alkB, lexA, and sulA; and Synechococcus PCC7942 has neither lexA nor recCD. Furthermore, the Synechocystis PCC6803 lexA product does not regulate DNA repair genes. Collectively, these findings

  4. DNA vaccines encoding proteins from wild-type and attenuated canine distemper virus protect equally well against wild-type virus challenge.

    Science.gov (United States)

    Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete

    2012-10-01

    Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.

  5. Role of oxidative DNA damage in genome instability and cancer

    International Nuclear Information System (INIS)

    Bignami, M.; Kunkel, T.

    2009-01-01

    Inactivation of mismatch repair (MMR) is associated with a dramatic genomic instability that is observed experimentally as a mutator phenotype and micro satellite instability (MSI). It has been implicit that the massive genetic instability in MMR defective cells simply reflects the accumulation of spontaneous DNA polymerase errors during DNA replication. We recently identified oxidation damage, a common threat to DNA integrity to which purines are very susceptible, as an important cofactor in this genetic instability

  6. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com

    2009-07-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  7. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    International Nuclear Information System (INIS)

    Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.

    2009-01-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  8. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  9. Comprehensive evaluation of genome-wide 5-hydroxymethylcytosine profiling approaches in human DNA.

    Science.gov (United States)

    Skvortsova, Ksenia; Zotenko, Elena; Luu, Phuc-Loi; Gould, Cathryn M; Nair, Shalima S; Clark, Susan J; Stirzaker, Clare

    2017-01-01

    The discovery that 5-methylcytosine (5mC) can be oxidized to 5-hydroxymethylcytosine (5hmC) by the ten-eleven translocation (TET) proteins has prompted wide interest in the potential role of 5hmC in reshaping the mammalian DNA methylation landscape. The gold-standard bisulphite conversion technologies to study DNA methylation do not distinguish between 5mC and 5hmC. However, new approaches to mapping 5hmC genome-wide have advanced rapidly, although it is unclear how the different methods compare in accurately calling 5hmC. In this study, we provide a comparative analysis on brain DNA using three 5hmC genome-wide approaches, namely whole-genome bisulphite/oxidative bisulphite sequencing (WG Bis/OxBis-seq), Infinium HumanMethylation450 BeadChip arrays coupled with oxidative bisulphite (HM450K Bis/OxBis) and antibody-based immunoprecipitation and sequencing of hydroxymethylated DNA (hMeDIP-seq). We also perform loci-specific TET-assisted bisulphite sequencing (TAB-seq) for validation of candidate regions. We show that whole-genome single-base resolution approaches are advantaged in providing precise 5hmC values but require high sequencing depth to accurately measure 5hmC, as this modification is commonly in low abundance in mammalian cells. HM450K arrays coupled with oxidative bisulphite provide a cost-effective representation of 5hmC distribution, at CpG sites with 5hmC levels >~10%. However, 5hmC analysis is restricted to the genomic location of the probes, which is an important consideration as 5hmC modification is commonly enriched at enhancer elements. Finally, we show that the widely used hMeDIP-seq method provides an efficient genome-wide profile of 5hmC and shows high correlation with WG Bis/OxBis-seq 5hmC distribution in brain DNA. However, in cell line DNA with low levels of 5hmC, hMeDIP-seq-enriched regions are not detected by WG Bis/OxBis or HM450K, either suggesting misinterpretation of 5hmC calls by hMeDIP or lack of sensitivity of the latter methods. We

  10. Comparative Analysis of the Genomic DNA Isolation Methods on Inula sp. (Asteraceae

    Directory of Open Access Journals (Sweden)

    Emre SEVİNDİK

    2016-12-01

    Full Text Available Simple, fast, low-cost and high throughput protocols are required for DNA isolation of plant species. In this study, phenol chloroform isoamyl alcohol and commercial (Sigma DNA isolation kit methods were applied on some Inula species that belong to Asteraceae family. Genomic DNA amounts, A260, A280, A260/A230 and purity degrees (A260/A280 that were obtained through both methods were measured through electrophoresis and spectrophotometer. Additionally, PCR amplification was realized by primer pairs specific to nrDNA ITS, cpDNA ndhF (972F-1603R and trnL-F regions. Results showed that maximum genomic DNA in nanograms obtained by phenol chloroform isoamyl alcohol method. The study also revealed that I. macrocephala had the maximum DNA and I. heterolepis had the minimum DNA amount. A260/A280 purity degrees showed that the highest and lowest purity in gDNAs obtained through phenol-choloform isoamyl alcohol method were in I.aucheriana and I. salicina, respectively. The highest and lowest purity degrees of gDNAs obtained through commercial kit was observed in I. fragilis and I. macrocephala samples, respectively. PCR amplification results showed that while band profiles of each three regions (ITS, trnL-F and ndhF did not yield positive results in PCR amplifications using phenol-choloform isoamyl alcohol method; PCR band profiles obtained through commercial kit yielded positive results. As a result, it is fair to say that the relation of genomic DNA with PCR was found to be more efficient although the maximum amount of genomic DNA was obtained through phenol chloroform isoamyl alcohol method.

  11. Quantification and genome-wide mapping of DNA double-strand breaks.

    Science.gov (United States)

    Grégoire, Marie-Chantal; Massonneau, Julien; Leduc, Frédéric; Arguin, Mélina; Brazeau, Marc-André; Boissonneault, Guylain

    2016-12-01

    DNA double-strand breaks (DSBs) represent a major threat to the genetic integrity of the cell. Knowing both their genome-wide distribution and number is important for a better assessment of genotoxicity at a molecular level. Available methods may have underestimated the extent of DSBs as they are based on markers specific to those undergoing active repair or may not be adapted for the large diversity of naturally occurring DNA ends. We have established conditions for an efficient first step of DNA nick and gap repair (NGR) allowing specific determination of DSBs by end labeling with terminal transferase. We used DNA extracted from HeLa cells harboring an I-SceI cassette to induce a targeted nick or DSB and demonstrated by immunocapture of 3'-OH that a prior step of NGR allows specific determination of loci-specific or genome wide DSBs. This method can be applied to the global determination of DSBs using radioactive end labeling and can find several applications aimed at understanding the distribution and kinetics of DSBs formation and repair. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Genome-wide survey of repetitive DNA elements in the button mushroom Agaricus bisporus

    NARCIS (Netherlands)

    Foulongne-Oriol, M.; Murat, C.; Castanera, R.; Ramírez, L.; Sonnenberg, A.S.M.

    2013-01-01

    Repetitive DNA elements are ubiquitous constituents of eukaryotic genomes. The biological roles of these repetitive elements, supposed to impact genome organization and evolution, are not completely elucidated yet. The availability of whole genome sequence offers the opportunity to draw a picture of

  13. Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms.

    Science.gov (United States)

    Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H

    2012-07-01

    The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.

  14. DNA repair efficiency in germ cells and early mouse embryos and consequences for radiation-induced transgenerational genomic damage

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Wyrobek, Andrew J.

    2009-01-18

    Exposure to ionizing radiation and other environmental agents can affect the genomic integrity of germ cells and induce adverse health effects in the progeny. Efficient DNA repair during gametogenesis and the early embryonic cycles after fertilization is critical for preventing transmission of DNA damage to the progeny and relies on maternal factors stored in the egg before fertilization. The ability of the maternal repair machinery to repair DNA damage in both parental genomes in the fertilizing egg is especially crucial for the fertilizing male genome that has not experienced a DNA repair-competent cellular environment for several weeks prior to fertilization. During the DNA repair-deficient period of spermatogenesis, DNA lesions may accumulate in sperm and be carried into the egg where, if not properly repaired, could result in the formation of heritable chromosomal aberrations or mutations and associated birth defects. Studies with female mice deficient in specific DNA repair genes have shown that: (i) cell cycle checkpoints are activated in the fertilized egg by DNA damage carried by the sperm; and (ii) the maternal genotype plays a major role in determining the efficiency of repairing genomic lesions in the fertilizing sperm and directly affect the risk for abnormal reproductive outcomes. There is also growing evidence that implicates DNA damage carried by the fertilizing gamete as a mediator of postfertilization processes that contribute to genomic instability in subsequent generations. Transgenerational genomic instability most likely involves epigenetic mechanisms or error-prone DNA repair processes in the early embryo. Maternal and embryonic DNA repair processes during the early phases of mammalian embryonic development can have far reaching consequences for the genomic integrity and health of subsequent generations.

  15. Crucial optimization steps in getting premier quality of Aquilaria malaccensis genomic DNA for molecular activities

    International Nuclear Information System (INIS)

    Muhammad Hanif Azhari; Azhar Mohamad

    2013-01-01

    Gaharu resin is derived from Aquilaria sp. or Agar wood tree in a tropical ecosystem. In Malaysia the Aquilaria species especially A. malaccensis in danger of extinction in the wild due to illegal logging as its resin is highly used for the production of greatly valued incense throughout Asia. A significant tool in fingerprinting the species is through molecular activities of Polymerase Chain Reaction (PCR) application on which requires total genomic DNA as a starting material. This paper, described optimizations of both fresh and dried samples derived from A. malaccensis for genomic DNA. Three main parameters for the optimization were temperature (60, 65, and 70 degree Celsius), incubation period (30, 60, 90 minutes) and concentration of CTAB (1 %, 3 %, 5 %). The experimental design in these work resulted a total of 46 combinations of the parameters in which 0.5 g samples was used in each combination. Nano-drop spectrometer was used in detecting the quantitative genomic DNA at ng/ μl. In fresh samples, incubation temperatures at 65 degree Celsius for 60 minutes in 3 % were yielded 723.2 ng/ μl genomic DNA. Whereas, for dried samples, incubation temperature at 70 degree Celsius for 90 minutes in 5 % CTAB were yielded 70.2 ng/ μl of genomic DNA. Spectrometer reading at OD280/ 260 was 1.9 for both type of samples. The isolated genomic DNA is useful for the molecular activities to identify specific plants between the same species or among the Aquilaria species. (author)

  16. Early DNA vaccination of puppies against canine distemper in the presence of maternally derived immunity.

    Science.gov (United States)

    Griot, Christian; Moser, Christian; Cherpillod, Pascal; Bruckner, Lukas; Wittek, Riccardo; Zurbriggen, Andreas; Zurbriggen, Rinaldo

    2004-01-26

    Canine distemper (CD) is a disease in carnivores caused by CD virus (CDV), a member of the morbillivirus genus. It still is a threat to the carnivore and ferret population. The currently used modified attenuated live vaccines have several drawbacks of which lack of appropriate protection from severe infection is the most outstanding one. In addition, puppies up to the age of 6-8 weeks cannot be immunized efficiently due to the presence of maternal antibodies. In this study, a DNA prime modified live vaccine boost strategy was investigated in puppies in order to determine if vaccinated neonatal dogs induce a neutralizing immune response which is supposed to protect animals from a CDV challenge. Furthermore, a single DNA vaccination of puppies, 14 days after birth and in the presence of high titers of CDV neutralizing maternal antibodies, induced a clear and significant priming effect observed as early as 3 days after the subsequent booster with a conventional CDV vaccine. It was shown that the priming effect develops faster and to higher titers in puppies preimmunized with DNA 14 days after birth than in those vaccinated 28 days after birth. Our results demonstrate that despite the presence of maternal antibodies puppies can be vaccinated using the CDV DNA vaccine, and that this vaccination has a clear priming effect leading to a solid immune response after a booster with a conventional CDV vaccine.

  17. G-quadruplex DNA sequences are evolutionarily conserved and associated with distinct genomic features in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    John A Capra

    2010-07-01

    Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.

  18. Biased distribution of DNA uptake sequences towards genome maintenance genes

    DEFF Research Database (Denmark)

    Davidsen, T.; Rodland, E.A.; Lagesen, K.

    2004-01-01

    Repeated sequence signatures are characteristic features of all genomic DNA. We have made a rigorous search for repeat genomic sequences in the human pathogens Neisseria meningitidis, Neisseria gonorrhoeae and Haemophilus influenzae and found that by far the most frequent 9-10mers residing within...... in these organisms. Pasteurella multocida also displayed high frequencies of a putative DUS identical to that previously identified in H. influenzae and with a skewed distribution towards genome maintenance genes, indicating that this bacterium might be transformation competent under certain conditions....

  19. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    Science.gov (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  20. Highly efficient PCR assay to discriminate allelic DNA methylation status using whole genome amplification

    Directory of Open Access Journals (Sweden)

    Ito Takashi

    2011-06-01

    Full Text Available Abstract Background We previously developed a simple method termed HpaII-McrBC PCR (HM-PCR to discriminate allelic methylation status of the genomic sites of interest, and successfully applied it to a comprehensive analysis of CpG islands (CGIs on human chromosome 21q. However, HM-PCR requires 200 ng of genomic DNA to examine one target site, thereby precluding its application to such samples that are limited in quantity. Findings We developed HpaII-McrBC whole-genome-amplification PCR (HM-WGA-PCR that uses whole-genome-amplified DNA as the template. HM-WGA-PCR uses only 1/100th the genomic template material required for HM-PCR. Indeed, we successfully analyzed 147 CGIs by HM-WGA-PCR using only ~300 ng of DNA, whereas previous HM-PCR study had required ~30 μg. Furthermore, we confirmed that allelic methylation status revealed by HM-WGA-PCR is identical to that by HM-PCR in every case of the 147 CGIs tested, proving high consistency between the two methods. Conclusions HM-WGA-PCR would serve as a reliable alternative to HM-PCR in the analysis of allelic methylation status when the quantity of DNA available is limited.

  1. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    Science.gov (United States)

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  2. Enhancing Targeted Genomic DNA Editing in Chicken Cells Using the CRISPR/Cas9 System

    Science.gov (United States)

    Wang, Ling; Yang, Likai; Guo, Yijie; Du, Weili; Yin, Yajun; Zhang, Tao; Lu, Hongzhao

    2017-01-01

    The CRISPR/Cas9 system has enabled highly efficient genome targeted editing for various organisms. However, few studies have focused on CRISPR/Cas9 nuclease-mediated chicken genome editing compared with mammalian genomes. The current study combined CRISPR with yeast Rad52 (yRad52) to enhance targeted genomic DNA editing in chicken DF-1 cells. The efficiency of CRISPR/Cas9 nuclease-induced targeted mutations in the chicken genome was increased to 41.9% via the enrichment of the dual-reporter surrogate system. In addition, the combined effect of CRISPR nuclease and yRad52 dramatically increased the efficiency of the targeted substitution in the myostatin gene using 50-mer oligodeoxynucleotides (ssODN) as the donor DNA, resulting in a 36.7% editing efficiency after puromycin selection. Furthermore, based on the effect of yRad52, the frequency of exogenous gene integration in the chicken genome was more than 3-fold higher than that without yRad52. Collectively, these results suggest that ssODN is an ideal donor DNA for targeted substitution and that CRISPR/Cas9 combined with yRad52 significantly enhances chicken genome editing. These findings could be extensively applied in other organisms. PMID:28068387

  3. In Depth Characterization of Repetitive DNA in 23 Plant Genomes Reveals Sources of Genome Size Variation in the Legume Tribe Fabeae.

    Science.gov (United States)

    Macas, Jiří; Novák, Petr; Pellicer, Jaume; Čížková, Jana; Koblížková, Andrea; Neumann, Pavel; Fuková, Iva; Doležel, Jaroslav; Kelly, Laura J; Leitch, Ilia J

    2015-01-01

    The differential accumulation and elimination of repetitive DNA are key drivers of genome size variation in flowering plants, yet there have been few studies which have analysed how different types of repeats in related species contribute to genome size evolution within a phylogenetic context. This question is addressed here by conducting large-scale comparative analysis of repeats in 23 species from four genera of the monophyletic legume tribe Fabeae, representing a 7.6-fold variation in genome size. Phylogenetic analysis and genome size reconstruction revealed that this diversity arose from genome size expansions and contractions in different lineages during the evolution of Fabeae. Employing a combination of low-pass genome sequencing with novel bioinformatic approaches resulted in identification and quantification of repeats making up 55-83% of the investigated genomes. In turn, this enabled an analysis of how each major repeat type contributed to the genome size variation encountered. Differential accumulation of repetitive DNA was found to account for 85% of the genome size differences between the species, and most (57%) of this variation was found to be driven by a single lineage of Ty3/gypsy LTR-retrotransposons, the Ogre elements. Although the amounts of several other lineages of LTR-retrotransposons and the total amount of satellite DNA were also positively correlated with genome size, their contributions to genome size variation were much smaller (up to 6%). Repeat analysis within a phylogenetic framework also revealed profound differences in the extent of sequence conservation between different repeat types across Fabeae. In addition to these findings, the study has provided a proof of concept for the approach combining recent developments in sequencing and bioinformatics to perform comparative analyses of repetitive DNAs in a large number of non-model species without the need to assemble their genomes.

  4. In Depth Characterization of Repetitive DNA in 23 Plant Genomes Reveals Sources of Genome Size Variation in the Legume Tribe Fabeae.

    Directory of Open Access Journals (Sweden)

    Jiří Macas

    Full Text Available The differential accumulation and elimination of repetitive DNA are key drivers of genome size variation in flowering plants, yet there have been few studies which have analysed how different types of repeats in related species contribute to genome size evolution within a phylogenetic context. This question is addressed here by conducting large-scale comparative analysis of repeats in 23 species from four genera of the monophyletic legume tribe Fabeae, representing a 7.6-fold variation in genome size. Phylogenetic analysis and genome size reconstruction revealed that this diversity arose from genome size expansions and contractions in different lineages during the evolution of Fabeae. Employing a combination of low-pass genome sequencing with novel bioinformatic approaches resulted in identification and quantification of repeats making up 55-83% of the investigated genomes. In turn, this enabled an analysis of how each major repeat type contributed to the genome size variation encountered. Differential accumulation of repetitive DNA was found to account for 85% of the genome size differences between the species, and most (57% of this variation was found to be driven by a single lineage of Ty3/gypsy LTR-retrotransposons, the Ogre elements. Although the amounts of several other lineages of LTR-retrotransposons and the total amount of satellite DNA were also positively correlated with genome size, their contributions to genome size variation were much smaller (up to 6%. Repeat analysis within a phylogenetic framework also revealed profound differences in the extent of sequence conservation between different repeat types across Fabeae. In addition to these findings, the study has provided a proof of concept for the approach combining recent developments in sequencing and bioinformatics to perform comparative analyses of repetitive DNAs in a large number of non-model species without the need to assemble their genomes.

  5. Hormone Receptor Expression Analyses in Neoplastic and Non-Neoplastic Canine Mammary Tissue by a Bead Based Multiplex Branched DNA Assay: A Gene Expression Study in Fresh Frozen and Formalin-Fixed, Paraffin-Embedded Samples.

    Directory of Open Access Journals (Sweden)

    Annika Mohr

    Full Text Available Immunohistochemistry (IHC is currently considered the method of choice for steroid hormone receptor status evaluation in human breast cancer and, therefore, it is commonly utilized for assessing canine mammary tumors. In case of low hormone receptor expression, IHC is limited and thus is complemented by molecular analyses. In the present study, a multiplex bDNA assay was evaluated as a method for hormone receptor gene expression detection in canine mammary tissues. Estrogen receptor (ESR1, progesterone receptor (PGR, prolactin receptor (PRLR and growth hormone receptor (GHR gene expressions were evaluated in neoplastic and non-neoplastic canine mammary tissues. A set of 119 fresh frozen and 180 formalin-fixed, paraffin-embedded (FFPE was comparatively analyzed and used for assay evaluation. Furthermore, a possible association between the hormone receptor expression in different histological subtypes of canine malignant mammary tumors and the castration status, breed and invasive growth of the tumor were analyzed. The multiplex bDNA assay proved to be more sensitive for fresh frozen specimens. Hormone receptor expression found was significantly decreased in malignant mammary tumors in comparison to non-neoplastic tissue and benign mammary tumors. Among the histological subtypes the lowest gene expression levels of ESR1, PGR and PRLR were found in solid, anaplastic and ductal carcinomas. In summary, the evaluation showed that the measurement of hormone receptors with the multiplex bDNA assay represents a practicable method for obtaining detailed quantitative information about gene expression in canine mammary tissue for future studies. Still, comparison with IHC or quantitative real-time PCR is needed for further validation of the present method.

  6. Local chromatin structure of heterochromatin regulates repeated DNA stability, nucleolus structure, and genome integrity

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Jamy C. [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    Heterochromatin constitutes a significant portion of the genome in higher eukaryotes; approximately 30% in Drosophila and human. Heterochromatin contains a high repeat DNA content and a low density of protein-encoding genes. In contrast, euchromatin is composed mostly of unique sequences and contains the majority of single-copy genes. Genetic and cytological studies demonstrated that heterochromatin exhibits regulatory roles in chromosome organization, centromere function and telomere protection. As an epigenetically regulated structure, heterochromatin formation is not defined by any DNA sequence consensus. Heterochromatin is characterized by its association with nucleosomes containing methylated-lysine 9 of histone H3 (H3K9me), heterochromatin protein 1 (HP1) that binds H3K9me, and Su(var)3-9, which methylates H3K9 and binds HP1. Heterochromatin formation and functions are influenced by HP1, Su(var)3-9, and the RNA interference (RNAi) pathway. My thesis project investigates how heterochromatin formation and function impact nuclear architecture, repeated DNA organization, and genome stability in Drosophila melanogaster. H3K9me-based chromatin reduces extrachromosomal DNA formation; most likely by restricting the access of repair machineries to repeated DNAs. Reducing extrachromosomal ribosomal DNA stabilizes rDNA repeats and the nucleolus structure. H3K9me-based chromatin also inhibits DNA damage in heterochromatin. Cells with compromised heterochromatin structure, due to Su(var)3-9 or dcr-2 (a component of the RNAi pathway) mutations, display severe DNA damage in heterochromatin compared to wild type. In these mutant cells, accumulated DNA damage leads to chromosomal defects such as translocations, defective DNA repair response, and activation of the G2-M DNA repair and mitotic checkpoints that ensure cellular and animal viability. My thesis research suggests that DNA replication, repair, and recombination mechanisms in heterochromatin differ from those in

  7. Specific detection of Neospora caninum oocysts in fecal samples from experimentally-infected dogs using the polymerase chain reaction.

    Science.gov (United States)

    Hill, D E; Liddell, S; Jenkins, M C; Dubey, J P

    2001-04-01

    Neospora caninum oocysts, passed in the feces of a definitive host (dog), were isolated, and genomic DNA was extracted. A polymerase cahin reaction (PCR) targeting the N. caninum-specific Nc 5 genomic sequence was performed using the isolated DNA. A synthesized competitor molecule containing part of the Nc 5 sequence was included in the assay as a check against false-negative PCR results and to quantify N. caninum oocyst DNA in fecal samples. A standard curve of the ratio of fluorescence intensity of PCR-amplified competitor to that of oocyst DNA was constructed to compare oocyst equivalents from fecal samples containing unknown numbers of N. caninum oocysts and to assess the sensitivity of the assay. The specificity of the assay was determined using the Nc 5-specific primers in PCR assays against other parasites likely to be found in canine feces. Genomic DNA sequences from the canine coccidians Hammondia heydorni, Cryptosporidium parvum, Sarcocystis cruzi, S. tenella, and Isospora ohioensis and the canine helminth parasites Strongyloides stercoralis, Toxocara canis, Dipylidium caninum, and Ancylostoma caninum were not amplified. In addition, genomic DNA sequences from oocysts of coccidian parasites that might contaminate dog feces, such as Hammondia hammondi, Toxoplasma gondii, or Eimeria tenella, were not amplified in the PCR assay. The assay should be useful in epidemiological surveys of both domestic and wild canine hosts and in investigations of oocyst biology in experimental infections.

  8. Effects of DNA mass on multiple displacement whole genome amplification and genotyping performance

    Directory of Open Access Journals (Sweden)

    Haque Kashif A

    2005-09-01

    Full Text Available Abstract Background Whole genome amplification (WGA promises to eliminate practical molecular genetic analysis limitations associated with genomic DNA (gDNA quantity. We evaluated the performance of multiple displacement amplification (MDA WGA using gDNA extracted from lymphoblastoid cell lines (N = 27 with a range of starting gDNA input of 1–200 ng into the WGA reaction. Yield and composition analysis of whole genome amplified DNA (wgaDNA was performed using three DNA quantification methods (OD, PicoGreen® and RT-PCR. Two panels of N = 15 STR (using the AmpFlSTR® Identifiler® panel and N = 49 SNP (TaqMan® genotyping assays were performed on each gDNA and wgaDNA sample in duplicate. gDNA and wgaDNA masses of 1, 4 and 20 ng were used in the SNP assays to evaluate the effects of DNA mass on SNP genotyping assay performance. A total of N = 6,880 STR and N = 56,448 SNP genotype attempts provided adequate power to detect differences in STR and SNP genotyping performance between gDNA and wgaDNA, and among wgaDNA produced from a range of gDNA templates inputs. Results The proportion of double-stranded wgaDNA and human-specific PCR amplifiable wgaDNA increased with increased gDNA input into the WGA reaction. Increased amounts of gDNA input into the WGA reaction improved wgaDNA genotyping performance. Genotype completion or genotype concordance rates of wgaDNA produced from all gDNA input levels were observed to be reduced compared to gDNA, although the reduction was not always statistically significant. Reduced wgaDNA genotyping performance was primarily due to the increased variance of allelic amplification, resulting in loss of heterozygosity or increased undetermined genotypes. MDA WGA produces wgaDNA from no template control samples; such samples exhibited substantial false-positive genotyping rates. Conclusion The amount of gDNA input into the MDA WGA reaction is a critical determinant of genotyping performance of wgaDNA. At least 10 ng of

  9. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparisons with Other Methods

    International Nuclear Information System (INIS)

    Wu, Liyou; Yi, T.Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-01-01

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site (Hanford Reach of the Columbia River (HRCR), 11 strains), Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  10. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  11. Transcription Restores DNA Repair to Heterochromatin, Determining Regional Mutation Rates in Cancer Genomes

    Directory of Open Access Journals (Sweden)

    Christina L. Zheng

    2014-11-01

    Full Text Available Somatic mutations in cancer are more frequent in heterochromatic and late-replicating regions of the genome. We report that regional disparities in mutation density are virtually abolished within transcriptionally silent genomic regions of cutaneous squamous cell carcinomas (cSCCs arising in an XPC−/− background. XPC−/− cells lack global genome nucleotide excision repair (GG-NER, thus establishing differential access of DNA repair machinery within chromatin-rich regions of the genome as the primary cause for the regional disparity. Strikingly, we find that increasing levels of transcription reduce mutation prevalence on both strands of gene bodies embedded within H3K9me3-dense regions, and only to those levels observed in H3K9me3-sparse regions, also in an XPC-dependent manner. Therefore, transcription appears to reduce mutation prevalence specifically by relieving the constraints imposed by chromatin structure on DNA repair. We model this relationship among transcription, chromatin state, and DNA repair, revealing a new, personalized determinant of cancer risk.

  12. Genomic signal processing methods for computation of alignment-free distances from DNA sequences.

    Science.gov (United States)

    Borrayo, Ernesto; Mendizabal-Ruiz, E Gerardo; Vélez-Pérez, Hugo; Romo-Vázquez, Rebeca; Mendizabal, Adriana P; Morales, J Alejandro

    2014-01-01

    Genomic signal processing (GSP) refers to the use of digital signal processing (DSP) tools for analyzing genomic data such as DNA sequences. A possible application of GSP that has not been fully explored is the computation of the distance between a pair of sequences. In this work we present GAFD, a novel GSP alignment-free distance computation method. We introduce a DNA sequence-to-signal mapping function based on the employment of doublet values, which increases the number of possible amplitude values for the generated signal. Additionally, we explore the use of three DSP distance metrics as descriptors for categorizing DNA signal fragments. Our results indicate the feasibility of employing GAFD for computing sequence distances and the use of descriptors for characterizing DNA fragments.

  13. AID to overcome the limitations of genomic information by introducing somatic DNA alterations.

    Science.gov (United States)

    Honjo, Tasuku; Muramatsu, Masamichi; Nagaoka, Hitoshi; Kinoshita, Kazuo; Shinkura, Reiko

    2006-05-01

    The immune system has adopted somatic DNA alterations to overcome the limitations of the genomic information. Activation induced cytidine deaminase (AID) is an essential enzyme to regulate class switch recombination (CSR), somatic hypermutation (SHM) and gene conversion (GC) of the immunoglobulin gene. AID is known to be required for DNA cleavage of S regions in CSR and V regions in SHM. However, its molecular mechanism is a focus of extensive debate. RNA editing hypothesis postulates that AID edits yet unknown mRNA, to generate specific endonucleases for CSR and SHM. By contrast, DNA deamination hypothesis assumes that AID deaminates cytosine in DNA, followed by DNA cleavage by base excision repair enzymes. We summarize the basic knowledge for molecular mechanisms for CSR and SHM and then discuss the importance of AID not only in the immune regulation but also in the genome instability.

  14. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    gels, containing 7% glycerol, and 1×TBE buffer. The gels were run under 200 .... Inc. Germany, GeneaidTM DNA Isolation Kit, Geneaid. Biotech., New Taipei City, .... C. L. and Arsenos G. 2015 Comparison of eleven methods for genomic DNA ...

  15. The structures of bovine herpesvirus 1 virion and concatemeric DNA: implications for cleavage and packaging of herpesvirus genomes

    International Nuclear Information System (INIS)

    Schynts, Frederic; McVoy, Michael A.; Meurens, Francois; Detry, Bruno; Epstein, Alberto L.; Thiry, Etienne

    2003-01-01

    Herpesvirus genomes are often characterized by the presence of direct and inverted repeats that delineate their grouping into six structural classes. Class D genomes consist of a long (L) segment and a short (S) segment. The latter is flanked by large inverted repeats. DNA replication produces concatemers of head-to-tail linked genomes that are cleaved into unit genomes during the process of packaging DNA into capsids. Packaged class D genomes are an equimolar mixture of two isomers in which S is in either of two orientations, presumably a consequence of homologous recombination between the inverted repeats. The L segment remains predominantly fixed in a prototype (P) orientation; however, low levels of genomes having inverted L (I L ) segments have been reported for some class D herpesviruses. Inefficient formation of class D I L genomes has been attributed to infrequent L segment inversion, but recent detection of frequent inverted L segments in equine herpesvirus 1 concatemers [Virology 229 (1997) 415-420] suggests that the defect may be at the level of cleavage and packaging rather than inversion. In this study, the structures of virion and concatemeric DNA of another class D herpesvirus, bovine herpesvirus 1, were determined. Virion DNA contained low levels of I L genomes, whereas concatemeric DNA contained significant amounts of L segments in both P and I L orientations. However, concatemeric termini exhibited a preponderance of L termini derived from P isomers which was comparable to the preponderance of P genomes found in virion DNA. Thus, the defect in formation of I L genomes appears to lie at the level of concatemer cleavage. These results have important implications for the mechanisms by which herpesvirus DNA cleavage and packaging occur

  16. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase

    Directory of Open Access Journals (Sweden)

    Roozbeh Hushiarian

    2015-12-01

    This technique was found to be reliably repeatable. The indirect detection of genomic DNA using this method is significantly improved and showed high efficiency in small amounts of samples with the detection limit of 5.37 × 10−14 M.

  17. Improved reproducibility in genome-wide DNA methylation analysis for PAXgene® fixed samples compared to restored FFPE DNA

    DEFF Research Database (Denmark)

    Andersen, Gitte Brinch; Hager, Henrik; Hansen, Lise Lotte

    2014-01-01

    Chip. Quantitative DNA methylation analysis demonstrated that the methylation profile in PAXgene-fixed tissues showed, in comparison with restored FFPE samples, a higher concordance with the profile detected in frozen samples. We demonstrate, for the first time, that DNA from PAXgene conserved tissue performs better......Formalin fixation has been the standard method for conservation of clinical specimens for decades. However, a major drawback is the high degradation of nucleic acids, which complicates its use in genome-wide analyses. Unbiased identification of biomarkers, however, requires genome-wide studies......, precluding the use of the valuable archives of specimens with long-term follow-up data. Therefore, restoration protocols for DNA from formalin-fixed and paraffin-embedded (FFPE) samples have been developed, although they are cost-intensive and time-consuming. An alternative to FFPE and snap...

  18. Homologous recombination is a force in the evolution of canine distemper virus.

    Science.gov (United States)

    Yuan, Chaowen; Liu, Wenxin; Wang, Yingbo; Hou, Jinlong; Zhang, Liguo; Wang, Guoqing

    2017-01-01

    Canine distemper virus (CDV) is the causative agent of canine distemper (CD) that is a highly contagious, lethal, multisystemic viral disease of receptive carnivores. The prevalence of CDV is a major concern in susceptible animals. Presently, it is unclear whether intragenic recombination can contribute to gene mutations and segment reassortment in the virus. In this study, 25 full-length CDV genome sequences were subjected to phylogenetic and recombinational analyses. The results of phylogenetic analysis, intragenic recombination, and nucleotide selection pressure indicated that mutation and recombination occurred in the six individual genes segment (H, F, P, N, L, M) of the CDV genome. The analysis also revealed pronounced genetic diversity in the CDV genome according to the geographically distinct lineages (genotypes), namely Asia-1, Asia-2, Asia-3, Europe, America-1, and America-2. The six recombination events were detected using SimPlot and RDP programs. The analysis of selection pressure demonstrated that a majority of the nucleotides in the CDV individual gene were under negative selection. Collectively, these data suggested that homologous recombination acts as a key force driving the genetic diversity and evolution of canine distemper virus.

  19. Gross genomic damage measured by DNA image cytometry independently predicts gastric cancer patient survival

    NARCIS (Netherlands)

    Belien, J.A.M.; Buffart, T.E.; Gill, A.; Broeckaert, M.A.M.; Quirke, P.; Meijer, G.A.; Grabsch, H.

    2009-01-01

    BACKGROUND: DNA aneuploidy reflects gross genomic changes. It can be measured by flow cytometry (FCM-DNA) or image cytometry (ICM-DNA). In gastric cancer, the prevalence of DNA aneuploidy has been reported to range from 27 to 100%, with conflicting associations with clinicopathological variables.

  20. Genome-Wide DNA Methylation Profiles of Phlegm-Dampness Constitution

    Directory of Open Access Journals (Sweden)

    Haiqiang Yao

    2018-03-01

    Full Text Available Background/Aims: Metabolic diseases are leading health concerns in today’s global society. In traditional Chinese medicine (TCM, one body type studied is the phlegm-dampness constitution (PC, which predisposes individuals to complex metabolic disorders. Genomic studies have revealed the potential metabolic disorders and the molecular features of PC. The role of epigenetics in the regulation of PC, however, is unknown. Methods: We analyzed a genome-wide DNA methylation in 12 volunteers using Illumina Infinium Human Methylation450 BeadChip on peripheral blood mononuclear cells (PBMCs. Eight volunteers had PC and 4 had balanced constitutions. Results: Methylation data indicated a genome-scale hyper-methylation pattern in PC. We located 288 differentially methylated probes (DMPs. A total of 256 genes were mapped, and some of these were metabolic-related. SQSTM1, DLGAP2 and DAB1 indicated diabetes mellitus; HOXC4 and SMPD3, obesity; and GRWD1 and ATP10A, insulin resistance. According to Ingenuity Pathway Analysis (IPA, differentially methylated genes were abundant in multiple metabolic pathways. Conclusion: Our results suggest the potential risk for metabolic disorders in individuals with PC. We also explain the clinical characteristics of PC with DNA methylation features.

  1. Human β satellite DNA: Genomic organization and sequence definition of a class of highly repetitive tandem DNA

    International Nuclear Information System (INIS)

    Waye, J.S.; Willard, H.F.

    1989-01-01

    The authors describe a class of human repetitive DNA, called β satellite, that, at a most fundamental level, exists as tandem arrays of diverged ∼68-base-pair monomer repeat units. The monomer units are organized as distinct subsets, each characterized by a multimeric higher-order repeat unit that is tandemly reiterated and represents a recent unit of amplification. They have cloned, characterized, and determined the sequence of two β satellite higher-order repeat units: one located on chromosome 9, the other on the acrocentric chromosomes (13, 14, 15, 21, and 22) and perhaps other sites in the genome. Analysis by pulsed-field gel electrophoresis reveals that these tandem arrays are localized in large domains that are marked by restriction fragment length polymorphisms. In total, β-satellite sequences comprise several million base pairs of DNA in the human genome. Analysis of this DNA family should permit insights into the nature of chromosome-specific and nonspecific modes of satellite DNA evolution and provide useful tools for probing the molecular organization and concerted evolution of the acrocentric chromosomes

  2. A Network of Multi-Tasking Proteins at the DNA Replication Fork Preserves Genome Stability.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available To elucidate the network that maintains high fidelity genome replication, we have introduced two conditional mutant alleles of DNA2, an essential DNA replication gene, into each of the approximately 4,700 viable yeast deletion mutants and determined the fitness of the double mutants. Fifty-six DNA2-interacting genes were identified. Clustering analysis of genomic synthetic lethality profiles of each of 43 of the DNA2-interacting genes defines a network (consisting of 322 genes and 876 interactions whose topology provides clues as to how replication proteins coordinate regulation and repair to protect genome integrity. The results also shed new light on the functions of the query gene DNA2, which, despite many years of study, remain controversial, especially its proposed role in Okazaki fragment processing and the nature of its in vivo substrates. Because of the multifunctional nature of virtually all proteins at the replication fork, the meaning of any single genetic interaction is inherently ambiguous. The multiplexing nature of the current studies, however, combined with follow-up supporting experiments, reveals most if not all of the unique pathways requiring Dna2p. These include not only Okazaki fragment processing and DNA repair but also chromatin dynamics.

  3. Effect of specific enzyme inhibitors on replication, total genome DNA repair and on gene-specific DNA repair after UV irradiation in CHO cells

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.C.; Stevsner, Tinna; Bohr, Vilhelm A. (National Cancer Institute, NIH, Bethesda, MD (USA). Division of Cancer Treatment, Laboratory of Molecular Pharmacology); Mattern, M.R. (Smith Kline Beecham Pharmaceuticals, King of Prussia, PA (USA). Department of Biomolecular Discovery)

    1991-09-01

    The effects were studied of some specific enzyme inhibitors on DNA repair and replication after UV damage in Chinese hamster ovary cells. The DNA repair was studied at the level of the average, overall genome and also in the active dihydrofolate reductase gene. Replication was measured in the overall genome. The inhibitors were tested of DNA poly-merase {alpha} and {delta} (aphidicolin), of poly(ADPr) polymerase (3-aminobenzamide), of ribonucleotide reductase (hydroxyurea), of topo-isomerase I (camptothecin), and of topoisomerase II (merbarone, VP-16). In addition, the effects were tested of the potential topoisomerase I activator, {beta}-lapachone. All of these compounds inhibited genome replication and all topoisomerase inhibitors affected the overall genome repair; {beta}-lapachone stimulated it. None of these compounds had any effect on the gene-specific repair. (author). 36 refs.; 3 figs.; 2 tabs.

  4. Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

    Science.gov (United States)

    Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

    2015-11-01

    Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

  5. Canine scent detection and microbial source tracking of human waste contamination in storm drains.

    Science.gov (United States)

    Van De Werfhorst, Laurie C; Murray, Jill L S; Reynolds, Scott; Reynolds, Karen; Holden, Patricia A

    2014-06-01

    Human fecal contamination of surface waters and drains is difficult to diagnose. DNA-based and chemical analyses of water samples can be used to specifically quantify human waste contamination, but their expense precludes routine use. We evaluated canine scent tracking, using two dogs trained to respond to the scent of municipal wastewater, as a field approach for surveying human fecal contamination. Fecal indicator bacteria, as well as DNA-based and chemical markers of human waste, were analyzed in waters sampled from canine scent-evaluated sites (urban storm drains and creeks). In the field, the dogs responded positively (70% and 100%) at sites for which sampled waters were then confirmed as contaminated with human waste. When both dogs indicated a negative response, human waste markers were absent. Overall, canine scent tracking appears useful for prioritizing sampling sites for which DNA-based and similarly expensive assays can confirm and quantify human waste contamination.

  6. Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

    Science.gov (United States)

    Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

    2013-01-01

    The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

  7. Extensive variation in the density and distribution of DNA polymorphism in sorghum genomes.

    Directory of Open Access Journals (Sweden)

    Joseph Evans

    Full Text Available Sorghum genotypes currently used for grain production in the United States were developed from African landraces that were imported starting in the mid-to-late 19(th century. Farmers and plant breeders selected genotypes for grain production with reduced plant height, early flowering, increased grain yield, adaptation to drought, and improved resistance to lodging, diseases and pests. DNA polymorphisms that distinguish three historically important grain sorghum genotypes, BTx623, BTx642 and Tx7000, were characterized by genome sequencing, genotyping by sequencing, genetic mapping, and pedigree-based haplotype analysis. The distribution and density of DNA polymorphisms in the sequenced genomes varied widely, in part because the lines were derived through breeding and selection from diverse Kafir, Durra, and Caudatum race accessions. Genomic DNA spanning dw1 (SBI-09 and dw3 (SBI-07 had identical haplotypes due to selection for reduced height. Lower SNP density in genes located in pericentromeric regions compared with genes located in euchromatic regions is consistent with background selection in these regions of low recombination. SNP density was higher in euchromatic DNA and varied >100-fold in contiguous intervals that spanned up to 300 Kbp. The localized variation in DNA polymorphism density occurred throughout euchromatic regions where recombination is elevated, however, polymorphism density was not correlated with gene density or DNA methylation. Overall, sorghum chromosomes contain distal euchromatic regions characterized by extensive, localized variation in DNA polymorphism density, and large pericentromeric regions of low gene density, diversity, and recombination.

  8. Genome-Wide Analysis of Transposon and Retroviral Insertions Reveals Preferential Integrations in Regions of DNA Flexibility.

    Science.gov (United States)

    Vrljicak, Pavle; Tao, Shijie; Varshney, Gaurav K; Quach, Helen Ngoc Bao; Joshi, Adita; LaFave, Matthew C; Burgess, Shawn M; Sampath, Karuna

    2016-04-07

    DNA transposons and retroviruses are important transgenic tools for genome engineering. An important consideration affecting the choice of transgenic vector is their insertion site preferences. Previous large-scale analyses of Ds transposon integration sites in plants were done on the basis of reporter gene expression or germ-line transmission, making it difficult to discern vertebrate integration preferences. Here, we compare over 1300 Ds transposon integration sites in zebrafish with Tol2 transposon and retroviral integration sites. Genome-wide analysis shows that Ds integration sites in the presence or absence of marker selection are remarkably similar and distributed throughout the genome. No strict motif was found, but a preference for structural features in the target DNA associated with DNA flexibility (Twist, Tilt, Rise, Roll, Shift, and Slide) was observed. Remarkably, this feature is also found in transposon and retroviral integrations in maize and mouse cells. Our findings show that structural features influence the integration of heterologous DNA in genomes, and have implications for targeted genome engineering. Copyright © 2016 Vrljicak et al.

  9. Downregulation of ATM Gene and Protein Expression in Canine Mammary Tumors.

    Science.gov (United States)

    Raposo-Ferreira, T M M; Bueno, R C; Terra, E M; Avante, M L; Tinucci-Costa, M; Carvalho, M; Cassali, G D; Linde, S D; Rogatto, S R; Laufer-Amorim, R

    2016-11-01

    The ataxia telangiectasia mutated (ATM) gene encodes a protein associated with DNA damage repair and maintenance of genomic integrity. In women, ATM transcript and protein downregulation have been reported in sporadic breast carcinomas, and the absence of ATM protein expression has been associated with poor prognosis. The aim of this study was to evaluate ATM gene and protein expression in canine mammary tumors and their association with clinical outcome. ATM gene and protein expression was evaluated by reverse transcription-quantitative polymerase chain reaction and immunohistochemistry, respectively, in normal mammary gland samples (n = 10), benign mammary tumors (n = 11), nonmetastatic mammary carcinomas (n = 19), and metastatic mammary carcinomas (n = 11). Lower ATM transcript levels were detected in benign mammary tumors and carcinomas compared with normal mammary glands (P = .011). Similarly, lower ATM protein expression was observed in benign tumors (P = .0003), nonmetastatic mammary carcinomas (P ATM gene or protein levels were detected among benign tumors and nonmetastatic and metastatic mammary carcinomas (P > .05). The levels of ATM gene or protein expression were not significantly associated with clinical and pathological features or with survival. Similar to human breast cancer, the data in this study suggest that ATM gene and protein downregulation is involved in canine mammary gland tumorigenesis. © The Author(s) 2016.

  10. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

    Science.gov (United States)

    Hazkani-Covo, Einat; Martin, William F

    2017-05-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Development of a novel real-time qPCR assay for the dual detection of canine and phocine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Linette Buxbom; Hjulsager, Charlotte Kristiane; Larsen, Helene

    conventional PCR assays with real-time PCR assays to obtain a uniform assay palette. The present work describes the development of a novel real-time RT-qPCR assay for the dual detection of canine and phocine distemper virus. The assay is relevant for the future detection of outbreaks of canine distemper virus...... in e.g. in farmed mink and wildlife and phocine distemper in seals. A set of primers and dual labelled probe was designed based on an alignment of distemper sequences in GenBank from various species and in-house sequences from recent outbreaks in Danish farmed mink. The assay amplifies a segment of 151...... bp in the Phosphoprotein (P) gene of the distemper virus genome. The dynamic range and PCR efficiency (E) was experimentally determined using 10-fold dilutions of a specially designed distemper DNA-oligo in addition to extracted RNA from clinical samples. E of the real-time assay was shown to range...

  12. "Isogaba Maware": quality control of genome DNA by checkpoints.

    Science.gov (United States)

    Kitazono, A; Matsumoto, T

    1998-05-01

    Checkpoints maintain the interdependency of cell cycle events by permitting the onset of an event only after the completion of the preceding event. The DNA replication checkpoint induces a cell cycle arrest until the completion of the DNA replication. Similarly, the DNA damage checkpoint arrests cell cycle progression if DNA repair is incomplete. A number of genes that play a role in the two checkpoints have been identified through genetic studies in yeasts, and their homologues have been found in fly, mouse, and human. They form signaling cascades activated by a DNA replication block or DNA damage and subsequently generate the negative constraints on cell cycle regulators. The failure of these signaling cascades results in producing offspring that carry mutations or that lack a portion of the genome. In humans, defects in the checkpoints are often associated with cancer-prone diseases. Focusing mainly on the studies in budding and fission yeasts, we summarize the recent progress.

  13. Characterization of noncoding regulatory DNA in the human genome.

    Science.gov (United States)

    Elkon, Ran; Agami, Reuven

    2017-08-08

    Genetic variants associated with common diseases are usually located in noncoding parts of the human genome. Delineation of the full repertoire of functional noncoding elements, together with efficient methods for probing their biological roles, is therefore of crucial importance. Over the past decade, DNA accessibility and various epigenetic modifications have been associated with regulatory functions. Mapping these features across the genome has enabled researchers to begin to document the full complement of putative regulatory elements. High-throughput reporter assays to probe the functions of regulatory regions have also been developed but these methods separate putative regulatory elements from the chromosome so that any effects of chromatin context and long-range regulatory interactions are lost. Definitive assignment of function(s) to putative cis-regulatory elements requires perturbation of these elements. Genome-editing technologies are now transforming our ability to perturb regulatory elements across entire genomes. Interpretation of high-throughput genetic screens that incorporate genome editors might enable the construction of an unbiased map of functional noncoding elements in the human genome.

  14. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    Science.gov (United States)

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Organization and evolution of primate centromeric DNA from whole-genome shotgun sequence data.

    Directory of Open Access Journals (Sweden)

    Can Alkan

    2007-09-01

    Full Text Available The major DNA constituent of primate centromeres is alpha satellite DNA. As much as 2%-5% of sequence generated as part of primate genome sequencing projects consists of this material, which is fragmented or not assembled as part of published genome sequences due to its highly repetitive nature. Here, we develop computational methods to rapidly recover and categorize alpha-satellite sequences from previously uncharacterized whole-genome shotgun sequence data. We present an algorithm to computationally predict potential higher-order array structure based on paired-end sequence data and then experimentally validate its organization and distribution by experimental analyses. Using whole-genome shotgun data from the human, chimpanzee, and macaque genomes, we examine the phylogenetic relationship of these sequences and provide further support for a model for their evolution and mutation over the last 25 million years. Our results confirm fundamental differences in the dispersal and evolution of centromeric satellites in the Old World monkey and ape lineages of evolution.

  16. Organization and evolution of primate centromeric DNA from whole-genome shotgun sequence data.

    Science.gov (United States)

    Alkan, Can; Ventura, Mario; Archidiacono, Nicoletta; Rocchi, Mariano; Sahinalp, S Cenk; Eichler, Evan E

    2007-09-01

    The major DNA constituent of primate centromeres is alpha satellite DNA. As much as 2%-5% of sequence generated as part of primate genome sequencing projects consists of this material, which is fragmented or not assembled as part of published genome sequences due to its highly repetitive nature. Here, we develop computational methods to rapidly recover and categorize alpha-satellite sequences from previously uncharacterized whole-genome shotgun sequence data. We present an algorithm to computationally predict potential higher-order array structure based on paired-end sequence data and then experimentally validate its organization and distribution by experimental analyses. Using whole-genome shotgun data from the human, chimpanzee, and macaque genomes, we examine the phylogenetic relationship of these sequences and provide further support for a model for their evolution and mutation over the last 25 million years. Our results confirm fundamental differences in the dispersal and evolution of centromeric satellites in the Old World monkey and ape lineages of evolution.

  17. In vitro analysis of integrated global high-resolution DNA methylation profiling with genomic imbalance and gene expression in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Bekim Sadikovic

    Full Text Available Genetic and epigenetic changes contribute to deregulation of gene expression and development of human cancer. Changes in DNA methylation are key epigenetic factors regulating gene expression and genomic stability. Recent progress in microarray technologies resulted in developments of high resolution platforms for profiling of genetic, epigenetic and gene expression changes. OS is a pediatric bone tumor with characteristically high level of numerical and structural chromosomal changes. Furthermore, little is known about DNA methylation changes in OS. Our objective was to develop an integrative approach for analysis of high-resolution epigenomic, genomic, and gene expression profiles in order to identify functional epi/genomic differences between OS cell lines and normal human osteoblasts. A combination of Affymetrix Promoter Tilling Arrays for DNA methylation, Agilent array-CGH platform for genomic imbalance and Affymetrix Gene 1.0 platform for gene expression analysis was used. As a result, an integrative high-resolution approach for interrogation of genome-wide tumour-specific changes in DNA methylation was developed. This approach was used to provide the first genomic DNA methylation maps, and to identify and validate genes with aberrant DNA methylation in OS cell lines. This first integrative analysis of global cancer-related changes in DNA methylation, genomic imbalance, and gene expression has provided comprehensive evidence of the cumulative roles of epigenetic and genetic mechanisms in deregulation of gene expression networks.

  18. DNA dynamics is likely to be a factor in the genomic nucleotide repeats expansions related to diseases.

    Directory of Open Access Journals (Sweden)

    Boian S Alexandrov

    Full Text Available Trinucleotide repeats sequences (TRS represent a common type of genomic DNA motif whose expansion is associated with a large number of human diseases. The driving molecular mechanisms of the TRS ongoing dynamic expansion across generations and within tissues and its influence on genomic DNA functions are not well understood. Here we report results for a novel and notable collective breathing behavior of genomic DNA of tandem TRS, leading to propensity for large local DNA transient openings at physiological temperature. Our Langevin molecular dynamics (LMD and Markov Chain Monte Carlo (MCMC simulations demonstrate that the patterns of openings of various TRSs depend specifically on their length. The collective propensity for DNA strand separation of repeated sequences serves as a precursor for outsized intermediate bubble states independently of the G/C-content. We report that repeats have the potential to interfere with the binding of transcription factors to their consensus sequence by altered DNA breathing dynamics in proximity of the binding sites. These observations might influence ongoing attempts to use LMD and MCMC simulations for TRS-related modeling of genomic DNA functionality in elucidating the common denominators of the dynamic TRS expansion mutation with potential therapeutic applications.

  19. Study in mutation of alfalfa genome DNA due to low energy N+ implantation using RAPD

    International Nuclear Information System (INIS)

    Chen Roulei; Song Daojun; Yu Zengliang; Li Yufeng; Liang Yunzhang

    2001-01-01

    After implanted by various dosage N + beams, germination rate of alfalfa seeds appears to be saddle line with dosage increasing. The authors have studied in mutation of genome DNA due to low energy N + implantation, and concluded that 30 differential DNA fragments have been amplified by 8 primers (S 41 , S 42 , S 45 , S 46 , S 50 , S 52 , S 56 , S 58 ) in 100 primers, moreover, number of differential DNA fragments between CK and treatments increases with dosage. Consequently, low energy ion implantation can cause mutation of alfalfa genome DNA. The more dosage it is, the more mutation alfalfa will be

  20. An oral Sindbis virus replicon-based DNA vaccine containing VP2 gene of canine parvovirus delivered by Escherichia coli elicits immune responses in dogs.

    Science.gov (United States)

    Dahiya, S S; Saini, M; Kumar, P; Gupta, P K

    2011-01-01

    A Sindbis virus replicon-based DNA vaccine containing VP2 gene of canine parvovirus (CPV) was delivered by Escherichia coli to elicit immune responses. The orally immunized dogs developed CPV-specific serum IgG and virus neutralizing antibody responses. The cellular immune responses analyzed using lymphocyte proliferation test and flow cytometry indicated CPV-specific sensitization of both CD3+CD4+ and CD3+CD8+ lymphocytes. This study demonstrated that the oral CPV DNA vaccine delivered by E. coli can be considered as a promising approach for vaccination of dogs against CPV.

  1. Undermethylated DNA as a source of microsatellites from a conifer genome.

    Science.gov (United States)

    Zhou, Y; Bui, T; Auckland, L D; Williams, C G

    2002-02-01

    Developing microsatellites from the large, highly duplicated conifer genome requires special tools. To improve the efficiency of developing Pinus taeda L. microsatellites, undermethylated (UM) DNA fragments were used to construct a microsatellite-enriched copy library. A methylation-sensitive restriction enzyme, McrBC, was used to enrich for UM DNA before library construction. Digested DNA fragments larger than 9 kb were then excised and digested with RsaI and used to construct nine dinucleotide and trinucleotide libraries. A total of 1016 microsatellite-positive clones were detected among 11 904 clones and 620 of these were unique. Of 245 primer sets that produced a PCR product, 113 could be developed as UM microsatellite markers and 70 were polymorphic. Inheritance and marker informativeness were tested for a random sample of 36 polymorphic markers using a three-generation outbred pedigree. Thirty-one microsatellites (86%) had single-locus inheritance despite the highly duplicated nature of the P. taeda genome. Nineteen UM microsatellites had highly informative intercross mating type configurations. Allele number and frequency were estimated for eleven UM microsatellites using a population survey. Allele numbers for these UM microsatellites ranged from 3 to 12 with an average of 5.7 alleles/locus. Frequencies for the 63 alleles were mostly in the low-common range; only 14 of the 63 were in the rare allele (q < 0.05) class. Enriching for UM DNA was an efficient method for developing polymorphic microsatellites from a large plant genome.

  2. Archaeal Genome Guardians Give Insights into Eukaryotic DNA Replication and Damage Response Proteins

    Directory of Open Access Journals (Sweden)

    David S. Shin

    2014-01-01

    Full Text Available As the third domain of life, archaea, like the eukarya and bacteria, must have robust DNA replication and repair complexes to ensure genome fidelity. Archaea moreover display a breadth of unique habitats and characteristics, and structural biologists increasingly appreciate these features. As archaea include extremophiles that can withstand diverse environmental stresses, they provide fundamental systems for understanding enzymes and pathways critical to genome integrity and stress responses. Such archaeal extremophiles provide critical data on the periodic table for life as well as on the biochemical, geochemical, and physical limitations to adaptive strategies allowing organisms to thrive under environmental stress relevant to determining the boundaries for life as we know it. Specifically, archaeal enzyme structures have informed the architecture and mechanisms of key DNA repair proteins and complexes. With added abilities to temperature-trap flexible complexes and reveal core domains of transient and dynamic complexes, these structures provide insights into mechanisms of maintaining genome integrity despite extreme environmental stress. The DNA damage response protein structures noted in this review therefore inform the basis for genome integrity in the face of environmental stress, with implications for all domains of life as well as for biomanufacturing, astrobiology, and medicine.

  3. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    International Nuclear Information System (INIS)

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong

    2012-01-01

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  4. Epigenetic changes of Arabidopsis genome associated with altered DNA methyltransferase and demethylase expressions after gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ji Eun; Cho, Eun Ju; Kim, Ji Hong; Chung, Byung Yeoup; Kim, Jin Hong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    DNA methylation at carbon 5 of cytosines is a hall mark of epigenetic inactivation and heterochromatin in both plants and mammals. In Arabidopsis, DNA methylation has two roles that protect the genome from selfish DNA elements and regulate gene expression. Plant genome has three types of DNA methyltransferase, METHYLTRANSFERASE 1 (MET1), DOMAINREARRANGED METHYLASE (DRM) and CHROMOMETHYLASE 3 (CMT3) that are capable of methylating CG, CHG (where H is A, T, or C) and CHH sites, respectively. MET1 is a maintenance DNA methyltransferase that controls CG methylation. Two members of the DRM family, DRM1 and DRM2, are responsible for de novo methylation of CG, CHG, and CHH sites but show a preference for CHH sites. Finally, CMT3 principally carries out CHG methylation and is involved in both de novo methylation and maintenance. Alternatively, active DNA demethylation may occur through the glycosylase activity by removing the methylcytosines from DNA. It may have essential roles in preventing transcriptional silencing of transgenes and endogenous genes and in activating the expression of imprinted genes. DNA demetylation in Arabidopsis is mediated by the DEMETER (DME) family of bifunctional DNA glycosylase. Three targets of DME are MEA (MEDEA), FWA (FLOWERING WAGENINGEN), and FIS2 (FERTILIZATION INDEPENDENT SEED 2). The DME family contains DEMETER-LIKE 2 (DML2), DML3, and REPRESSOR OF SILENING 1 (ROS1). DNA demetylation by ROS1, DML2, and DML3 protect the hypermethylation of specific genome loci. ROS1 is necessary to suppress the promoter methylation and the silencing of endogenous genes. In contrast, the function of DML2 and DML3 has not been reported. Several recent studies have suggested that epigenetic alterations such as change in DNA methylation and histone modification should be caused in plant genomes upon exposure to ionizing radiation. However, there is a lack of data exploring the underlying mechanisms. Therefore, the present study aims to characterize and

  5. Sampling the genomic pool of protein tyrosine kinase genes using the polymerase chain reaction with genomic DNA.

    Science.gov (United States)

    Oates, A C; Wollberg, P; Achen, M G; Wilks, A F

    1998-08-28

    The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.

  6. Genome stability: recent insights in the topoisomerase reverse gyrase and thermophilic DNA alkyltransferase.

    Science.gov (United States)

    Vettone, Antonella; Perugino, Giuseppe; Rossi, Mosè; Valenti, Anna; Ciaramella, Maria

    2014-09-01

    Repair and defence of genome integrity from endogenous and environmental hazard is a primary need for all organisms. Natural selection has driven the evolution of multiple cell pathways to deal with different DNA damaging agents. Failure of such processes can hamper cell functions and induce inheritable mutations, which in humans may cause cancerogenicity or certain genetic syndromes, and ultimately cell death. A special case is that of hyperthermophilic bacteria and archaea, flourishing at temperatures higher than 80 °C, conditions that favor genome instability and thus call for specific, highly efficient or peculiar mechanisms to keep their genome intact and functional. Over the last few years, numerous studies have been performed on the activity, function, regulation, physical and functional interaction of enzymes and proteins from hyperthermophilic microorganisms that are able to bind, repair, bypass damaged DNA, or modify its structure or conformation. The present review is focused on two enzymes that act on DNA catalyzing unique reactions: reverse gyrase and DNA alkyltransferase. Although both enzymes belong to evolutionary highly conserved protein families present in organisms of the three domains (Eucarya, Bacteria and Archaea), recently characterized members from hyperthermophilic archaea show both common and peculiar features.

  7. Recent advances in the genome-wide study of DNA replication origins in yeast

    Directory of Open Access Journals (Sweden)

    Chong ePeng

    2015-02-01

    Full Text Available DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs. Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genome. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some nonconventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve the replication origins prediction.

  8. Recent advances in the genome-wide study of DNA replication origins in yeast

    Science.gov (United States)

    Peng, Chong; Luo, Hao; Zhang, Xi; Gao, Feng

    2015-01-01

    DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs). Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genomes. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some non-conventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve yeast replication origins prediction. PMID:25745419

  9. Comparison of microbial DNA enrichment tools for metagenomic whole genome sequencing.

    Science.gov (United States)

    Thoendel, Matthew; Jeraldo, Patricio R; Greenwood-Quaintance, Kerryl E; Yao, Janet Z; Chia, Nicholas; Hanssen, Arlen D; Abdel, Matthew P; Patel, Robin

    2016-08-01

    Metagenomic whole genome sequencing for detection of pathogens in clinical samples is an exciting new area for discovery and clinical testing. A major barrier to this approach is the overwhelming ratio of human to pathogen DNA in samples with low pathogen abundance, which is typical of most clinical specimens. Microbial DNA enrichment methods offer the potential to relieve this limitation by improving this ratio. Two commercially available enrichment kits, the NEBNext Microbiome DNA Enrichment Kit and the Molzym MolYsis Basic kit, were tested for their ability to enrich for microbial DNA from resected arthroplasty component sonicate fluids from prosthetic joint infections or uninfected sonicate fluids spiked with Staphylococcus aureus. Using spiked uninfected sonicate fluid there was a 6-fold enrichment of bacterial DNA with the NEBNext kit and 76-fold enrichment with the MolYsis kit. Metagenomic whole genome sequencing of sonicate fluid revealed 13- to 85-fold enrichment of bacterial DNA using the NEBNext enrichment kit. The MolYsis approach achieved 481- to 9580-fold enrichment, resulting in 7 to 59% of sequencing reads being from the pathogens known to be present in the samples. These results demonstrate the usefulness of these tools when testing clinical samples with low microbial burden using next generation sequencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Two efficient methods for isolation of high-quality genomic DNA from entomopathogenic fungi.

    Science.gov (United States)

    Serna-Domínguez, María G; Andrade-Michel, Gilda Y; Arredondo-Bernal, Hugo C; Gallou, Adrien

    2018-03-27

    Conventional and commercial methods for isolation of nucleic acids are available for fungal samples including entomopathogenic fungi (EPF). However, there is not a unique optimal method for all organisms. The cell wall structure and the wide range of secondary metabolites of EPF can broadly interfere with the efficiency of the DNA extraction protocol. This study compares three commercial protocols: DNeasy® Plant Mini Kit (Qiagen), Wizard® Genomic DNA Purification Kit (Promega), and Axygen™ Multisource Genomic DNA Miniprep Kit (Axygen) and three conventional methods based on different buffers: SDS, CTAB/PVPP, and CTAB/β-mercaptoethanol versus three cell lysis procedures: liquid nitrogen homogenization and two bead-beating materials (i.e., tungsten-carbide and stainless-steel) for four representative species of EPF (i.e., Beauveria bassiana, Hirsutella citriformis, Isaria javanica, and Metarhizium anisopliae). Liquid nitrogen homogenization combined with DNeasy® Plant Mini Kit (i.e., QN) or SDS buffer (i.e., SN) significantly improved the yield with a good purity (~1.8) and high integrity (>20,000 bp) of genomic DNA in contrast with other methods, also, these results were better when compared with the two bead-beating materials. The purified DNA was evaluated by PCR-based techniques: amplification of translation elongation factor 1-α (TEF) and two highly sensitive molecular markers (i.e., ISSR and AFLP) with reliable and reproducible results. Despite a variation in yield, purity, and integrity of extracted DNA across the four species of EPF with the different DNA extraction methods, the SN and QN protocols maintained a high-quality of DNA which is required for downstream molecular applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Solution-based targeted genomic enrichment for precious DNA samples

    Directory of Open Access Journals (Sweden)

    Shearer Aiden

    2012-05-01

    Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.

  12. Long span DNA paired-end-tag (DNA-PET sequencing strategy for the interrogation of genomic structural mutations and fusion-point-guided reconstruction of amplicons.

    Directory of Open Access Journals (Sweden)

    Fei Yao

    Full Text Available Structural variations (SVs contribute significantly to the variability of the human genome and extensive genomic rearrangements are a hallmark of cancer. While genomic DNA paired-end-tag (DNA-PET sequencing is an attractive approach to identify genomic SVs, the current application of PET sequencing with short insert size DNA can be insufficient for the comprehensive mapping of SVs in low complexity and repeat-rich genomic regions. We employed a recently developed procedure to generate PET sequencing data using large DNA inserts of 10-20 kb and compared their characteristics with short insert (1 kb libraries for their ability to identify SVs. Our results suggest that although short insert libraries bear an advantage in identifying small deletions, they do not provide significantly better breakpoint resolution. In contrast, large inserts are superior to short inserts in providing higher physical genome coverage for the same sequencing cost and achieve greater sensitivity, in practice, for the identification of several classes of SVs, such as copy number neutral and complex events. Furthermore, our results confirm that large insert libraries allow for the identification of SVs within repetitive sequences, which cannot be spanned by short inserts. This provides a key advantage in studying rearrangements in cancer, and we show how it can be used in a fusion-point-guided-concatenation algorithm to study focally amplified regions in cancer.

  13. Genome-wide DNA methylation analysis of the porcine hypothalamus-pituitary-ovary axis

    DEFF Research Database (Denmark)

    Yuan, Xiao Long; Zhang, Zhe; Li, Bin

    2017-01-01

    Previous studies have suggested that DNA methylation in both CpG and CpH (where H = C, T or A) contexts plays a critical role in biological functions of different tissues. However, the genome-wide DNA methylation patterns of porcine hypothalamus-pituitary-ovary (HPO) tissues remain virtually unex...

  14. Alu Mobile Elements: From Junk DNA to Genomic Gems

    Directory of Open Access Journals (Sweden)

    Sami Dridi

    2012-01-01

    Full Text Available Alus, the short interspersed repeated sequences (SINEs, are retrotransposons that litter the human genomes and have long been considered junk DNA. However, recent findings that these mobile elements are transcribed, both as distinct RNA polymerase III transcripts and as a part of RNA polymerase II transcripts, suggest biological functions and refute the notion that Alus are biologically unimportant. Indeed, Alu RNAs have been shown to control mRNA processing at several levels, to have complex regulatory functions such as transcriptional repression and modulating alternative splicing and to cause a host of human genetic diseases. Alu RNAs embedded in Pol II transcripts can promote evolution and proteome diversity, which further indicates that these mobile retroelements are in fact genomic gems rather than genomic junks.

  15. Identification of Poxvirus Genome Uncoating and DNA Replication Factors with Mutually Redundant Roles.

    Science.gov (United States)

    Liu, Baoming; Panda, Debasis; Mendez-Rios, Jorge D; Ganesan, Sundar; Wyatt, Linda S; Moss, Bernard

    2018-04-01

    Genome uncoating is essential for replication of most viruses. For poxviruses, the process is divided into two stages: removal of the envelope, allowing early gene expression, and breaching of the core wall, allowing DNA release, replication, and late gene expression. Subsequent studies showed that the host proteasome and the viral D5 protein, which has an essential role in DNA replication, are required for vaccinia virus (VACV) genome uncoating. In a search for additional VACV uncoating proteins, we noted a report that described a defect in DNA replication and late expression when the gene encoding a 68-kDa ankyrin repeat/F-box protein (68k-ank), associated with the cellular SCF (Skp1, cullin1, F-box-containing complex) ubiquitin ligase complex, was deleted from the attenuated modified vaccinia virus Ankara (MVA). Here we showed that the 68k-ank deletion mutant exhibited diminished genome uncoating, formation of DNA prereplication sites, and degradation of viral cores as well as an additional, independent defect in DNA synthesis. Deletion of the 68k-ank homolog of VACV strain WR, however, was without effect, suggesting the existence of compensating genes. By inserting VACV genes into an MVA 68k-ank deletion mutant, we discovered that M2, a member of the poxvirus immune evasion (PIE) domain superfamily and a regulator of NF-κB, and C5, a member of the BTB/Kelch superfamily associated with cullin-3-based ligase complexes, independently rescued the 68k-ank deletion phenotype. Thus, poxvirus uncoating and DNA replication are intertwined processes involving at least three viral proteins with mutually redundant functions in addition to D5. IMPORTANCE Poxviruses comprise a family of large DNA viruses that infect vertebrates and invertebrates and cause diseases of medical and zoological importance. Poxviruses, unlike most other DNA viruses, replicate in the cytoplasm, and their large genomes usually encode 200 or more proteins with diverse functions. About 90 genes may

  16. The pathological consequences of impaired genome integrity in humans; disorders of the DNA replication machinery.

    Science.gov (United States)

    O'Driscoll, Mark

    2017-01-01

    Accurate and efficient replication of the human genome occurs in the context of an array of constitutional barriers, including regional topological constraints imposed by chromatin architecture and processes such as transcription, catenation of the helical polymer and spontaneously generated DNA lesions, including base modifications and strand breaks. DNA replication is fundamentally important for tissue development and homeostasis; differentiation programmes are intimately linked with stem cell division. Unsurprisingly, impairments of the DNA replication machinery can have catastrophic consequences for genome stability and cell division. Functional impacts on DNA replication and genome stability have long been known to play roles in malignant transformation through a variety of complex mechanisms, and significant further insights have been gained from studying model organisms in this context. Congenital hypomorphic defects in components of the DNA replication machinery have been and continue to be identified in humans. These disorders present with a wide range of clinical features. Indeed, in some instances, different mutations in the same gene underlie different clinical presentations. Understanding the origin and molecular basis of these features opens a window onto the range of developmental impacts of suboptimal DNA replication and genome instability in humans. Here, I will briefly overview the basic steps involved in DNA replication and the key concepts that have emerged from this area of research, before switching emphasis to the pathological consequences of defects within the DNA replication network; the human disorders. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  17. Comprehensive analysis of genome-wide DNA methylation across human polycystic ovary syndrome ovary granulosa cell.

    Science.gov (United States)

    Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu

    2016-05-10

    Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.

  18. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  19. Quality assessment of buccal versus blood genomic DNA using the Affymetrix 500 K GeneChip

    Directory of Open Access Journals (Sweden)

    Martin Lisa J

    2007-11-01

    Full Text Available Abstract Background With the advent of genome-wide genotyping, the utility of stored buccal brushes for DNA extraction and genotyping has been questioned. We sought to describe the genomic DNA yield and concordance between stored buccal brushes and blood samples from the same individuals in the context of Affymetrix 500 K Human GeneChip genotyping. Results Buccal cytobrushes stored for ~7 years at -80°C prior to extraction yielded sufficient double stranded DNA (dsDNA to be successfully genotyped on the Affymetrix ~262 K NspI chip, with yields between 536 and 1047 ng dsDNA. Using the BRLMM algorithm, genotyping call rates for blood samples averaged 98.4%, and for buccal samples averaged 97.8%. Matched blood samples exhibited 99.2% concordance, while matched blood and buccal samples exhibited 98.8% concordance. Conclusion Buccal cytobrushes stored long-term result in sufficient dsDNA concentrations to achieve high genotyping call rates and concordance with stored blood samples in the context of Affymetrix 500 K SNP genotyping. Thus, given high-quality collection and storage protocols, it is possible to use stored buccal cytobrush samples for genome-wide association studies.

  20. Digital Droplet Multiple Displacement Amplification (ddMDA for Whole Genome Sequencing of Limited DNA Samples.

    Directory of Open Access Journals (Sweden)

    Minsoung Rhee

    Full Text Available Multiple displacement amplification (MDA is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently, the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet, ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.

  1. Visualization of Genome Diversity in German Shepherd Dogs

    OpenAIRE

    Sally-Anne Mortlock; Rachel Booth; Hamutal Mazrier; Mehar S. Khatkar; Peter Williamson

    2016-01-01

    A loss of genetic diversity may lead to increased disease risks in subpopulations of dogs. The canine breed structure has contributed to relatively small effective population size in many breeds and can limit the options for selective breeding strategies to maintain diversity. With the completion of the canine genome sequencing project, and the subsequent reduction in the cost of genotyping on a genomic scale, evaluating diversity in dogs has become much more accurate and accessible. This pro...

  2. Evaluation of three methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA by means of the PCR technique

    Directory of Open Access Journals (Sweden)

    MESQUITA Ricardo Alves

    2001-01-01

    Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

  3. Shotgun Bisulfite Sequencing of the Betula platyphylla Genome Reveals the Tree’s DNA Methylation Patterning

    Directory of Open Access Journals (Sweden)

    Chang Su

    2014-12-01

    Full Text Available DNA methylation plays a critical role in the regulation of gene expression. Most studies of DNA methylation have been performed in herbaceous plants, and little is known about the methylation patterns in tree genomes. In the present study, we generated a map of methylated cytosines at single base pair resolution for Betula platyphylla (white birch by bisulfite sequencing combined with transcriptomics to analyze DNA methylation and its effects on gene expression. We obtained a detailed view of the function of DNA methylation sequence composition and distribution in the genome of B. platyphylla. There are 34,460 genes in the whole genome of birch, and 31,297 genes are methylated. Conservatively, we estimated that 14.29% of genomic cytosines are methylcytosines in birch. Among the methylation sites, the CHH context accounts for 48.86%, and is the largest proportion. Combined transcriptome and methylation analysis showed that the genes with moderate methylation levels had higher expression levels than genes with high and low methylation. In addition, methylated genes are highly enriched for the GO subcategories of binding activities, catalytic activities, cellular processes, response to stimulus and cell death, suggesting that methylation mediates these pathways in birch trees.

  4. Higher-Density Culture in Human Embryonic Stem Cells Results in DNA Damage and Genome Instability

    Directory of Open Access Journals (Sweden)

    Kurt Jacobs

    2016-03-01

    Full Text Available Human embryonic stem cells (hESC show great promise for clinical and research applications, but their well-known proneness to genomic instability hampers the development to their full potential. Here, we demonstrate that medium acidification linked to culture density is the main cause of DNA damage and genomic alterations in hESC grown on feeder layers, and this even in the short time span of a single passage. In line with this, we show that increasing the frequency of the medium refreshments minimizes the levels of DNA damage and genetic instability. Also, we show that cells cultured on laminin-521 do not present this increase in DNA damage when grown at high density, although the (long-term impact on their genomic stability remains to be elucidated. Our results explain the high levels of genome instability observed over the years by many laboratories worldwide, and show that the development of optimal culture conditions is key to solving this problem.

  5. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa

    2012-04-01

    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  6. Retrotransposon silencing by DNA methylation can drive mammalian genomic imprinting.

    Directory of Open Access Journals (Sweden)

    Shunsuke Suzuki

    2007-04-01

    Full Text Available Among mammals, only eutherians and marsupials are viviparous and have genomic imprinting that leads to parent-of-origin-specific differential gene expression. We used comparative analysis to investigate the origin of genomic imprinting in mammals. PEG10 (paternally expressed 10 is a retrotransposon-derived imprinted gene that has an essential role for the formation of the placenta of the mouse. Here, we show that an orthologue of PEG10 exists in another therian mammal, the marsupial tammar wallaby (Macropus eugenii, but not in a prototherian mammal, the egg-laying platypus (Ornithorhynchus anatinus, suggesting its close relationship to the origin of placentation in therian mammals. We have discovered a hitherto missing link of the imprinting mechanism between eutherians and marsupials because tammar PEG10 is the first example of a differentially methylated region (DMR associated with genomic imprinting in marsupials. Surprisingly, the marsupial DMR was strictly limited to the 5' region of PEG10, unlike the eutherian DMR, which covers the promoter regions of both PEG10 and the adjacent imprinted gene SGCE. These results not only demonstrate a common origin of the DMR-associated imprinting mechanism in therian mammals but provide the first demonstration that DMR-associated genomic imprinting in eutherians can originate from the repression of exogenous DNA sequences and/or retrotransposons by DNA methylation.

  7. Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression

    Science.gov (United States)

    2009-01-01

    Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8) and solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively). Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies. PMID:20028558

  8. Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression

    Directory of Open Access Journals (Sweden)

    Triche Timothy

    2009-12-01

    Full Text Available Abstract Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8 and solute carrier family 1 (glial high affinity glutamate transporter, member 3 (SLC1A3, which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively. Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies.

  9. Microsatellite DNA in genomic survey sequences and UniGenes of loblolly pine

    Science.gov (United States)

    Craig S Echt; Surya Saha; Dennis L Deemer; C Dana Nelson

    2011-01-01

    Genomic DNA sequence databases are a potential and growing resource for simple sequence repeat (SSR) marker development in loblolly pine (Pinus taeda L.). Loblolly pine also has many expressed sequence tags (ESTs) available for microsatellite (SSR) marker development. We compared loblolly pine SSR densities in genome survey sequences (GSSs) to those in non-redundant...

  10. Spectral entropy criteria for structural segmentation in genomic DNA sequences

    International Nuclear Information System (INIS)

    Chechetkin, V.R.; Lobzin, V.V.

    2004-01-01

    The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions

  11. Guardians of the mycobacterial genome: A review on DNA repair systems in Mycobacterium tuberculosis.

    Science.gov (United States)

    Singh, Amandeep

    2017-12-01

    The genomic integrity of Mycobacterium tuberculosis is continuously threatened by the harsh survival conditions inside host macrophages, due to immune and antibiotic stresses. Faithful genome maintenance and repair must be accomplished under stress for the bacillus to survive in the host, necessitating a robust DNA repair system. The importance of DNA repair systems in pathogenesis is well established. Previous examination of the M. tuberculosis genome revealed homologues of almost all the major DNA repair systems, i.e. nucleotide excision repair (NER), base excision repair (BER), homologous recombination (HR) and non-homologous end joining (NHEJ). However, recent developments in the field have pointed to the presence of novel proteins and pathways in mycobacteria. Homologues of archeal mismatch repair proteins were recently reported in mycobacteria, a pathway previously thought to be absent. RecBCD, the major nuclease-helicase enzymes involved in HR in E. coli, were implicated in the single-strand annealing (SSA) pathway. Novel roles of archeo-eukaryotic primase (AEP) polymerases, previously thought to be exclusive to NHEJ, have been reported in BER. Many new proteins with a probable role in DNA repair have also been discovered. It is now realized that the DNA repair systems in M. tuberculosis are highly evolved and have redundant backup mechanisms to mend the damage. This review is an attempt to summarize our current understanding of the DNA repair systems in M. tuberculosis.

  12. Multi-scale coding of genomic information: From DNA sequence to genome structure and function

    International Nuclear Information System (INIS)

    Arneodo, Alain; Vaillant, Cedric; Audit, Benjamin; Argoul, Francoise; D'Aubenton-Carafa, Yves; Thermes, Claude

    2011-01-01

    Understanding how chromatin is spatially and dynamically organized in the nucleus of eukaryotic cells and how this affects genome functions is one of the main challenges of cell biology. Since the different orders of packaging in the hierarchical organization of DNA condition the accessibility of DNA sequence elements to trans-acting factors that control the transcription and replication processes, there is actually a wealth of structural and dynamical information to learn in the primary DNA sequence. In this review, we show that when using concepts, methodologies, numerical and experimental techniques coming from statistical mechanics and nonlinear physics combined with wavelet-based multi-scale signal processing, we are able to decipher the multi-scale sequence encoding of chromatin condensation-decondensation mechanisms that play a fundamental role in regulating many molecular processes involved in nuclear functions.

  13. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  14. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  15. Evidence of pervasive biologically functional secondary structures within the genomes of eukaryotic single-stranded DNA viruses.

    Science.gov (United States)

    Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick

    2014-02-01

    Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.

  16. Crystal Structures of DNA-Whirly Complexes and Their Role in Arabidopsis Organelle Genome Repair

    Energy Technology Data Exchange (ETDEWEB)

    Cappadocia, Laurent; Maréchal, Alexandre; Parent, Jean-Sébastien; Lepage, Étienne; Sygusch, Jurgen; Brisson, Normand (Montreal)

    2010-09-07

    DNA double-strand breaks are highly detrimental to all organisms and need to be quickly and accurately repaired. Although several proteins are known to maintain plastid and mitochondrial genome stability in plants, little is known about the mechanisms of DNA repair in these organelles and the roles of specific proteins. Here, using ciprofloxacin as a DNA damaging agent specific to the organelles, we show that plastids and mitochondria can repair DNA double-strand breaks through an error-prone pathway similar to the microhomology-mediated break-induced replication observed in humans, yeast, and bacteria. This pathway is negatively regulated by the single-stranded DNA (ssDNA) binding proteins from the Whirly family, thus indicating that these proteins could contribute to the accurate repair of plant organelle genomes. To understand the role of Whirly proteins in this process, we solved the crystal structures of several Whirly-DNA complexes. These reveal a nonsequence-specific ssDNA binding mechanism in which DNA is stabilized between domains of adjacent subunits and rendered unavailable for duplex formation and/or protein interactions. Our results suggest a model in which the binding of Whirly proteins to ssDNA would favor accurate repair of DNA double-strand breaks over an error-prone microhomology-mediated break-induced replication repair pathway.

  17. DNA Data Bank of Japan at work on genome sequence data.

    Science.gov (United States)

    Tateno, Y; Fukami-Kobayashi, K; Miyazaki, S; Sugawara, H; Gojobori, T

    1998-01-01

    We at the DNA Data Bank of Japan (DDBJ) (http://www.ddbj.nig.ac.jp) have recently begun receiving, processing and releasing EST and genome sequence data submitted by various Japanese genome projects. The data include those for human, Arabidopsis thaliana, rice, nematode, Synechocystis sp. and Escherichia coli. Since the quantity of data is very large, we organized teams to conduct preliminary discussions with project teams about data submission and handling for release to the public. We also developed a mass submission tool to cope with a large quantity of data. In addition, to provide genome data on WWW, we developed a genome information system using Java. This system (http://mol.genes.nig.ac.jp/ecoli/) can in theory be used for any genome sequence data. These activities will facilitate processing of large quantities of EST and genome data.

  18. The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome.

    Science.gov (United States)

    González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred; Llosa, Matxalen

    2017-06-15

    Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site

  19. Comparative chloroplast genomes of eleven Schima (Theaceae) species: Insights into DNA barcoding and phylogeny.

    Science.gov (United States)

    Yu, Xiang-Qin; Drew, Bryan T; Yang, Jun-Bo; Gao, Lian-Ming; Li, De-Zhu

    2017-01-01

    Schima is an ecologically and economically important woody genus in tea family (Theaceae). Unresolved species delimitations and phylogenetic relationships within Schima limit our understanding of the genus and hinder utilization of the genus for economic purposes. In the present study, we conducted comparative analysis among the complete chloroplast (cp) genomes of 11 Schima species. Our results indicate that Schima cp genomes possess a typical quadripartite structure, with conserved genomic structure and gene order. The size of the Schima cp genome is about 157 kilo base pairs (kb). They consistently encode 114 unique genes, including 80 protein-coding genes, 30 tRNAs, and 4 rRNAs, with 17 duplicated in the inverted repeat (IR). These cp genomes are highly conserved and do not show obvious expansion or contraction of the IR region. The percent variability of the 68 coding and 93 noncoding (>150 bp) fragments is consistently less than 3%. The seven most widely touted DNA barcode regions as well as one promising barcode candidate showed low sequence divergence. Eight mutational hotspots were identified from the 11 cp genomes. These hotspots may potentially be useful as specific DNA barcodes for species identification of Schima. The 58 cpSSR loci reported here are complementary to the microsatellite markers identified from the nuclear genome, and will be leveraged for further population-level studies. Phylogenetic relationships among the 11 Schima species were resolved with strong support based on the cp genome data set, which corresponds well with the species distribution pattern. The data presented here will serve as a foundation to facilitate species identification, DNA barcoding and phylogenetic reconstructions for future exploration of Schima.

  20. A DNA minor groove electronegative potential genome map based on photo-chemical probing

    DEFF Research Database (Denmark)

    Lindemose, Søren; Nielsen, Peter Eigil; Hansen, Morten

    2011-01-01

    The double-stranded DNA of the genome contains both sequence information directly relating to the protein and RNA coding as well as functional and structural information relating to protein recognition. Only recently is the importance of DNA shape in this recognition process being fully appreciat...

  1. Evaluating genome-wide DNA methylation changes in mice by Methylation Specific Digital Karyotyping

    Directory of Open Access Journals (Sweden)

    Maruoka Shuichiro

    2008-12-01

    Full Text Available Abstract Background The study of genome-wide DNA methylation changes has become more accessible with the development of various array-based technologies though when studying species other than human the choice of applications are limited and not always within reach. In this study, we adapted and tested the applicability of Methylation Specific Digital Karyotyping (MSDK, a non-array based method, for the prospective analysis of epigenetic changes after perinatal nutritional modifications in a mouse model of allergic airway disease. MSDK is a sequenced based method that allows a comprehensive and unbiased methylation profiling. The method generates 21 base pairs long sequence tags derived from specific locations in the genome. The resulting tag frequencies determine in a quantitative manner the methylation level of the corresponding loci. Results Genomic DNA from whole lung was isolated and subjected to MSDK analysis using the methylation-sensitive enzyme Not I as the mapping enzyme and Nla III as the fragmenting enzyme. In a pair wise comparison of the generated mouse MSDK libraries we identified 158 loci that are significantly differentially methylated (P-value = 0.05 after perinatal dietary changes in our mouse model. Quantitative methylation specific PCR and sequence analysis of bisulfate modified genomic DNA confirmed changes in methylation at specific loci. Differences in genomic MSDK tag counts for a selected set of genes, correlated well with changes in transcription levels as measured by real-time PCR. Furthermore serial analysis of gene expression profiling demonstrated a dramatic difference in expressed transcripts in mice exposed to perinatal nutritional changes. Conclusion The genome-wide methylation survey applied in this study allowed for an unbiased methylation profiling revealing subtle changes in DNA methylation in mice maternally exposed to dietary changes in methyl-donor content. The MSDK method is applicable for mouse models

  2. Characterization of Actinomyces with genomic DNA fingerprints and rRNA gene probes.

    Science.gov (United States)

    Bowden, G; Johnson, J; Schachtele, C

    1993-08-01

    Cellular DNA from 25 Actinomyces naeslundii and Actinomyces viscosus strains belonging to the 7 taxonomic clusters of Fillery et al. (1978) and several unclustered strains was obtained by enzymatic and N-lauroylsarcosine/guanidine isothiocyanate treatment of whole cells, followed by extraction of the nucleic acid. The DNA samples were digested with restriction endonucleases BamHI or PvuII, and agarose gel electrophoresis was used to obtain DNA fingerprints. The DNA fragments were subjected to Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from Escherichia coli 16S and 23S rRNA. The patterns of bands from genomic (DNA fingerprints) and rDNA fingerprints (ribotypes) were used for comparison between the taxonomic cluster strains and strains within clusters. Representative strains from each taxonomic cluster provided different BamHI DNA fingerprints and ribotype patterns with 3 to 9 distinct bands. Some strains within a cluster showed identical ribotype patterns with both endonucleases (A. naeslundii B120 and A. naeslundii B102 from cluster 3), while others showed the same pattern with BamHI but a different pattern with PvuII (A. naeslundii ATCC 12104 and 398A from cluster 5). A viscosus ATCC 15987 (cluster 7) and its parent strain T6 yielded identical fingerprint and ribotype patterns. The genomic diversity revealed by DNA fingerprinting and ribotyping demonstrates that these techniques, which do not require phenotypic expression, are suited for study of the oral ecology of the Actinomyces, and for epidemiological tracking of specific Actinomyces strains associated with caries lesions and sites of periodontal destruction.

  3. DHX9 helicase is involved in preventing genomic instability induced by alternatively structured DNA in human cells.

    Science.gov (United States)

    Jain, Aklank; Bacolla, Albino; Del Mundo, Imee M; Zhao, Junhua; Wang, Guliang; Vasquez, Karen M

    2013-12-01

    Sequences that have the capacity to adopt alternative (i.e. non-B) DNA structures in the human genome have been implicated in stimulating genomic instability. Previously, we found that a naturally occurring intra-molecular triplex (H-DNA) caused genetic instability in mammals largely in the form of DNA double-strand breaks. Thus, it is of interest to determine the mechanism(s) involved in processing H-DNA. Recently, we demonstrated that human DHX9 helicase preferentially unwinds inter-molecular triplex DNA in vitro. Herein, we used a mutation-reporter system containing H-DNA to examine the relevance of DHX9 activity on naturally occurring H-DNA structures in human cells. We found that H-DNA significantly increased mutagenesis in small-interfering siRNA-treated, DHX9-depleted cells, affecting mostly deletions. Moreover, DHX9 associated with H-DNA in the context of supercoiled plasmids. To further investigate the role of DHX9 in the recognition/processing of H-DNA, we performed binding assays in vitro and chromatin immunoprecipitation assays in U2OS cells. DHX9 recognized H-DNA, as evidenced by its binding to the H-DNA structure and enrichment at the H-DNA region compared with a control region in human cells. These composite data implicate DHX9 in processing H-DNA structures in vivo and support its role in the overall maintenance of genomic stability at sites of alternatively structured DNA.

  4. Automated Processing of 2-D Gel Electrophoretograms of Genomic DNA for Hunting Pathogenic DNA Molecular Changes.

    Science.gov (United States)

    Takahashi; Nakazawa; Watanabe; Konagaya

    1999-01-01

    We have developed the automated processing algorithms for 2-dimensional (2-D) electrophoretograms of genomic DNA based on RLGS (Restriction Landmark Genomic Scanning) method, which scans the restriction enzyme recognition sites as the landmark and maps them onto a 2-D electrophoresis gel. Our powerful processing algorithms realize the automated spot recognition from RLGS electrophoretograms and the automated comparison of a huge number of such images. In the final stage of the automated processing, a master spot pattern, on which all the spots in the RLGS images are mapped at once, can be obtained. The spot pattern variations which seemed to be specific to the pathogenic DNA molecular changes can be easily detected by simply looking over the master spot pattern. When we applied our algorithms to the analysis of 33 RLGS images derived from human colon tissues, we successfully detected several colon tumor specific spot pattern changes.

  5. Short interspersed CAN SINE elements as prognostic markers in canine mammary neoplasia.

    Science.gov (United States)

    Gelaleti, Gabriela B; Granzotto, Adriana; Leonel, Camila; Jardim, Bruna V; Moschetta, Marina G; Carareto, Claudia M A; Zuccari, Debora Ap P C

    2014-01-01

    The genome of mammals is characterized by a large number of non-LTR retrotransposons, and among them, the CAN SINEs are characteristics of the canine species. Small amounts of DNA freely circulate in normal blood serum and high amounts are found in human patients with cancer, characterizing it as a candidate tumor-biomarker. The aim of this study was to estimate, through its absolute expression, the number of copies of CAN SINE sequences present in free circulating DNA of female dogs with mammary cancer, in order to correlate with the clinical and pathological characteristics and the follow-up period. The copy number of CAN SINE sequences was estimated by qPCR in 28 female dogs with mammary neoplasia. The univariate analysis showed an increased number of copies in female dogs with mammary tumor in female dogs >10 years old (p=0.02) and tumor time >18 months (pSINE fragments can be good markers for the detection of tumor DNA in blood and may characterize it as a marker of poor prognosis, being related to female dogs with shorter survival times. This estimate can be used as a prognostic marker in non-invasive breast cancer research and is useful in predicting tumor progression and patient monitoring.

  6. DNA methylation alteration is a major consequence of genome doubling in autotetraploid Brassica rapa

    Directory of Open Access Journals (Sweden)

    Xu Yanhao

    2017-01-01

    Full Text Available Polyploids are typically classified as autopolyploids or allopolyploids based on the origin of their chromosome sets. Autopolyploidy is much more common than traditionally believed. Allopolyploidization, accompanied by genomic and transcriptomic changes, has been well investigated. In this study, genetic, DNA methylation and gene expression changes in autotetraploid Brassica rapa were investigated. No genetic alteration was detected using an amplified fragment length polymorphism (AFLP approach. Using a cDNA-AFLP approach, approximately 0.58% of fragments showed changes in gene expression in autotetraploid B. rapa. The methylation-sensitive amplification polymorphism (MSAP analysis showed that approximately 1.7% of the fragments underwent DNA methylation changes upon genome doubling, with hypermethylation and demethylation changes equally affected. Fragments displaying changes in gene expression and methylation status were isolated and then sequenced and characterized, respectively. This study showed that variation in cytosine methylation is a major consequence of genome doubling in autotetraploid Brassica rapa.

  7. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  8. Myeloperoxidase-produced Genomic DNA-centered Radicals and Protection by Resveratrol

    Science.gov (United States)

    Myeloperoxidase (MPO) released by activated neutrophils, production of hypochlorous acid (HOCI) and oxidation of the genomic DNA in epithelial cells is thought to initiate and promote carcinogenesis. In this study we applied the 5,5-dimethyl-l-pyrroline N-oxide (DMPO)-based i;nmu...

  9. Rhipicephalus microplus dataset of nonredundant raw sequence reads from 454 GS FLX sequencing of Cot-selected (Cot = 660) genomic DNA

    Science.gov (United States)

    A reassociation kinetics-based approach was used to reduce the complexity of genomic DNA from the Deutsch laboratory strain of the cattle tick, Rhipicephalus microplus, to facilitate genome sequencing. Selected genomic DNA (Cot value = 660) was sequenced using 454 GS FLX technology, resulting in 356...

  10. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Deep Investigation of Arabidopsis thaliana Junk DNA Reveals a Continuum between Repetitive Elements and Genomic Dark Matter

    Science.gov (United States)

    Maumus, Florian; Quesneville, Hadi

    2014-01-01

    Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant. PMID:24709859

  12. A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains.

    Science.gov (United States)

    Zhang, Y J; Zhang, S; Liu, X Z; Wen, H A; Wang, M

    2010-07-01

    A simple and rapid method (designated thermolysis) for extracting genomic DNA from bulk fungal strains was described. In the thermolysis method, a few mycelia or yeast cells were first rinsed with pure water to remove potential PCR inhibitors and then incubated in a lysis buffer at 85 degrees C to break down cell walls and membranes. This method was used to extract genomic DNA from large numbers of fungal strains (more than 92 species, 35 genera of three phyla) isolated from different sections of natural Ophiocordyceps sinensis specimens. Regions of interest from high as well as single-copy number genes were successfully amplified from the extracted DNA samples. The DNA samples obtained by this method can be stored at -20 degrees C for over 1 year. The method was effective, easy and fast and allowed batch DNA extraction from multiple fungal isolates. Use of the thermolysis method will allow researchers to obtain DNA from fungi quickly for use in molecular assays. This method requires only minute quantities of starting material and is suitable for diverse fungal species.

  13. The Role of DNA Methylation Changes in Radiation-Induced Transgenerational Genomic Instability and Bystander Effects in cranial irradiated Mice

    Science.gov (United States)

    Zhang, Meng; Sun, Yeqing; Gao, Yinglong; Zhang, Baodong

    Heavy-ion radiation could lead to genome instability in the germline, and therefore to transgenerational genome and epigenome instability in offspring of exposed males. The exact mechanisms of radiation-induced genome instability in directly exposed and in bystander organ remain obscure, yet accumulating evidence points to the role of DNA methylation changes in genome instability development. The potential of localized body-part exposures to affect the germline and thus induce genome and epigenome changes in the progeny has not been studied. To investigate whether or not the paternal cranial irradiation can exert deleterious changes in the protected germline and the offsprings, we studied the alteration of DNA methylation in the shielded testes tissue. Here we report that the localized paternal cranial irradiation results in a significant altered DNA methylation in sperm cells and leads to a profound epigenetic dysregulation in the unexposed progeny conceived 3 months after paternal exposure. The possible molecular mechanisms and biological consequences of the observed changes are discussed. Keywords: Heavy-ion radiation; Transgenerational effect; Genomic Instability Bystander Effects; DNA methylation.

  14. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  15. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...

  16. Reconstitution of wild type viral DNA in simian cells transfected with early and late SV40 defective genomes.

    Science.gov (United States)

    O'Neill, F J; Gao, Y; Xu, X

    1993-11-01

    The DNAs of polyomaviruses ordinarily exist as a single circular molecule of approximately 5000 base pairs. Variants of SV40, BKV and JCV have been described which contain two complementing defective DNA molecules. These defectives, which form a bipartite genome structure, contain either the viral early region or the late region. The defectives have the unique property of being able to tolerate variable sized reiterations of regulatory and terminus region sequences, and portions of the coding region. They can also exchange coding region sequences with other polyomaviruses. It has been suggested that the bipartite genome structure might be a stage in the evolution of polyomaviruses which can uniquely sustain genome and sequence diversity. However, it is not known if the regulatory and terminus region sequences are highly mutable. Also, it is not known if the bipartite genome structure is reversible and what the conditions might be which would favor restoration of the monomolecular genome structure. We addressed the first question by sequencing the reiterated regulatory and terminus regions of E- and L-SV40 DNAs. This revealed a large number of mutations in the regulatory regions of the defective genomes, including deletions, insertions, rearrangements and base substitutions. We also detected insertions and base substitutions in the T-antigen gene. We addressed the second question by introducing into permissive simian cells, E- and L-SV40 genomes which had been engineered to contain only a single regulatory region. Analysis of viral DNA from transfected cells demonstrated recombined genomes containing a wild type monomolecular DNA structure. However, the complete defectives, containing reiterated regulatory regions, could often compete away the wild type genomes. The recombinant monomolecular genomes were isolated, cloned and found to be infectious. All of the DNA alterations identified in one of the regulatory regions of E-SV40 DNA were present in the recombinant

  17. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  18. EG-13GENOME-WIDE METHYLATION ANALYSIS IDENTIFIES GENOMIC DNA DEMETHYLATION DURING MALIGNANT PROGRESSION OF GLIOMAS

    Science.gov (United States)

    Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito

    2014-01-01

    Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In

  19. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    Science.gov (United States)

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  20. Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.

    Directory of Open Access Journals (Sweden)

    Michelle E White

    Full Text Available Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests. After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13 was evident between a region of canine chromosome 13 (CFA13 and alanine aminotransferase (ALT, explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.

  1. Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.

    Science.gov (United States)

    White, Michelle E; Hayward, Jessica J; Stokol, Tracy; Boyko, Adam R

    2015-01-01

    Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS) at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests). After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13) was evident between a region of canine chromosome 13 (CFA13) and alanine aminotransferase (ALT), explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.

  2. Genomics and radical mediated DNA damage: major differences between ionizing radiation and DNA-cleaving enediynes

    International Nuclear Information System (INIS)

    Cosgrove, J.P.; Begley, T.J.; Samson, L.D.; Dedon, P.C.

    2003-01-01

    While the evidence is strong for radical-mediated oxidative processes in the pathophysiology of cancer and aging, the mechanisms by which cells respond to oxidative stress have eluded definition. To this end, we have undertaken genomic studies comparing the response of S. cerevisiae to DNA-specific oxidizing agents, the enediynes calicheamicin (CAL), esperamicin (ESP), and neocarzinostatin (NCS), and the non-specific gamma-radiation (RAD). While RAD results in relatively indiscriminate oxidation of cellular molecules, the enediynes are highly specific to DNA and produce damage by a common mechanism involving radical-mediated oxidation of deoxyribose. Transcriptional profiling in response to these agents (80% survival; 15 min exposure; Affymetrix) revealed unexpected differences between RAD and the enediynes and among the three enediynes. Only 2 genes responded in common to all agents, while 9 genes were regulated in common for the 3 enediynes (no DNA repair genes altered in common). The limited common gene expression changes for the 3 enediynes may result from differences in deoxyribose oxidation chemistry, DNA and chromatin targets or the proportions of single- and double-strand DNA lesions. RAD produced a more robust response than the enediynes, altering expression of 195 and 52 genes by more than 2- and 5-fold, respectively, compared to 16-44 and *2 genes, respectively, for the enediynes. This suggests that the transcriptional response varies in intensity according to the number of cellular features affected by the toxin. Genes showing the strongest up-regulation with RAD: ribonucleotide reductase, multidrug resistance, DS break repair/RAD51, GSH transferase; strongly reduced gene expression: TEL1 (damage signaling), NAT2 (acetyltransferase). Genomic phenotyping studies, using a subset of the Research Genetics deletion library, revealed that loss of apn1, the major AP endonuclease, caused resistance to NCS, possibly due to reduced formation of protein-DNA cross

  3. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis

    DEFF Research Database (Denmark)

    Nosek, J.; Novotna, M.; Hlavatovicova, Z.

    2004-01-01

    The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined. The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit. The number of repeats varies, thus generating a population...

  4. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    Science.gov (United States)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  5. Identification of DNA repair genes in the human genome

    International Nuclear Information System (INIS)

    Hoeijmakers, J.H.J.; van Duin, M.; Westerveld, A.; Yasui, A.; Bootsma, D.

    1986-01-01

    To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table

  6. Incidence of genome structure, DNA asymmetry, and cell physiology on T-DNA integration in chromosomes of the phytopathogenic fungus Leptosphaeria maculans.

    Science.gov (United States)

    Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry

    2012-08-01

    The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.

  7. Criminal Genomic Pragmatism: Prisoners' Representations of DNA Technology and Biosecurity

    Science.gov (United States)

    Machado, Helena; Silva, Susana

    2012-01-01

    Background. Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners' perceptions and assessments of the uses of DNA technology in solving crime. Aim. To propose a conceptual model that serves to analyse and interpret prisoners' representations of DNA technology and biosecurity. Methods. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. Results. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. Conclusions. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity. PMID:22791960

  8. Criminal Genomic Pragmatism: Prisoners' Representations of DNA Technology and Biosecurity

    Directory of Open Access Journals (Sweden)

    Helena Machado

    2012-01-01

    Full Text Available Background. Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners’ perceptions and assessments of the uses of DNA technology in solving crime. Aim. To propose a conceptual model that serves to analyse and interpret prisoners’ representations of DNA technology and biosecurity. Methods. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. Results. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. Conclusions. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity.

  9. Criminal genomic pragmatism: prisoners' representations of DNA technology and biosecurity.

    Science.gov (United States)

    Machado, Helena; Silva, Susana

    2012-01-01

    Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners' perceptions and assessments of the uses of DNA technology in solving crime. To propose a conceptual model that serves to analyse and interpret prisoners' representations of DNA technology and biosecurity. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity.

  10. Reverse gyrase functions in genome integrity maintenance by protecting DNA breaks in vivo

    DEFF Research Database (Denmark)

    Han, Wenyuan; Feng, Xu; She, Qunxin

    2017-01-01

    Reverse gyrase introduces positive supercoils to circular DNA and is implicated in genome stability maintenance in thermophiles. The extremely thermophilic crenarchaeon Sulfolobus encodes two reverse gyrase proteins, TopR1 (topoisomerase reverse gyrase 1) and TopR2, whose functions in thermophilic...... and subsequent DNA degradation. The former occurred immediately after drug treatment, leading to chromosomal DNA degradation that concurred with TopR1 degradation, followed by chromatin protein degradation and DNA-less cell formation. To gain a further insight into TopR1 function, the expression of the enzyme...

  11. TopBP1/Dpb11 binds DNA anaphase bridges to prevent genome instability.

    Science.gov (United States)

    Germann, Susanne M; Schramke, Vera; Pedersen, Rune Troelsgaard; Gallina, Irene; Eckert-Boulet, Nadine; Oestergaard, Vibe H; Lisby, Michael

    2014-01-06

    DNA anaphase bridges are a potential source of genome instability that may lead to chromosome breakage or nondisjunction during mitosis. Two classes of anaphase bridges can be distinguished: DAPI-positive chromatin bridges and DAPI-negative ultrafine DNA bridges (UFBs). Here, we establish budding yeast Saccharomyces cerevisiae and the avian DT40 cell line as model systems for studying DNA anaphase bridges and show that TopBP1/Dpb11 plays an evolutionarily conserved role in their metabolism. Together with the single-stranded DNA binding protein RPA, TopBP1/Dpb11 binds to UFBs, and depletion of TopBP1/Dpb11 led to an accumulation of chromatin bridges. Importantly, the NoCut checkpoint that delays progression from anaphase to abscission in yeast was activated by both UFBs and chromatin bridges independently of Dpb11, and disruption of the NoCut checkpoint in Dpb11-depleted cells led to genome instability. In conclusion, we propose that TopBP1/Dpb11 prevents accumulation of anaphase bridges via stimulation of the Mec1/ATR kinase and suppression of homologous recombination.

  12. Universal internucleotide statistics in full genomes: a footprint of the DNA structure and packaging?

    Directory of Open Access Journals (Sweden)

    Mikhail I Bogachev

    Full Text Available Uncovering the fundamental laws that govern the complex DNA structural organization remains challenging and is largely based upon reconstructions from the primary nucleotide sequences. Here we investigate the distributions of the internucleotide intervals and their persistence properties in complete genomes of various organisms from Archaea and Bacteria to H. Sapiens aiming to reveal the manifestation of the universal DNA architecture. We find that in all considered organisms the internucleotide interval distributions exhibit the same [Formula: see text]-exponential form. While in prokaryotes a single [Formula: see text]-exponential function makes the best fit, in eukaryotes the PDF contains additionally a second [Formula: see text]-exponential, which in the human genome makes a perfect approximation over nearly 10 decades. We suggest that this functional form is a footprint of the heterogeneous DNA structure, where the first [Formula: see text]-exponential reflects the universal helical pitch that appears both in pro- and eukaryotic DNA, while the second [Formula: see text]-exponential is a specific marker of the large-scale eukaryotic DNA organization.

  13. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  14. Inter-Fork Strand Annealing causes genomic deletions during the termination of DNA replication.

    Science.gov (United States)

    Morrow, Carl A; Nguyen, Michael O; Fower, Andrew; Wong, Io Nam; Osman, Fekret; Bryer, Claire; Whitby, Matthew C

    2017-06-06

    Problems that arise during DNA replication can drive genomic alterations that are instrumental in the development of cancers and many human genetic disorders. Replication fork barriers are a commonly encountered problem, which can cause fork collapse and act as hotspots for replication termination. Collapsed forks can be rescued by homologous recombination, which restarts replication. However, replication restart is relatively slow and, therefore, replication termination may frequently occur by an active fork converging on a collapsed fork. We find that this type of non-canonical fork convergence in fission yeast is prone to trigger deletions between repetitive DNA sequences via a mechanism we call Inter-Fork Strand Annealing (IFSA) that depends on the recombination proteins Rad52, Exo1 and Mus81, and is countered by the FANCM-related DNA helicase Fml1. Based on our findings, we propose that IFSA is a potential threat to genomic stability in eukaryotes.

  15. Genomic relations among 31 species of Mammillaria haworth (Cactaceae) using random amplified polymorphic DNA.

    Science.gov (United States)

    Mattagajasingh, Ilwola; Mukherjee, Arup Kumar; Das, Premananda

    2006-01-01

    Thirty-one species of Mammillaria were selected to study the molecular phylogeny using random amplified polymorphic DNA (RAPD) markers. High amount of mucilage (gelling polysaccharides) present in Mammillaria was a major obstacle in isolating good quality genomic DNA. The CTAB (cetyl trimethyl ammonium bromide) method was modified to obtain good quality genomic DNA. Twenty-two random decamer primers resulted in 621 bands, all of which were polymorphic. The similarity matrix value varied from 0.109 to 0.622 indicating wide variability among the studied species. The dendrogram obtained from the unweighted pair group method using arithmetic averages (UPGMA) analysis revealed that some of the species did not follow the conventional classification. The present work shows the usefulness of RAPD markers for genetic characterization to establish phylogenetic relations among Mammillaria species.

  16. Emerging perspectives on hereditary glomerulopathies in canines

    Directory of Open Access Journals (Sweden)

    Littman MP

    2015-04-01

    Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

  17. Re-exploration of U's Triangle Brassica Species Based on Chloroplast Genomes and 45S nrDNA Sequences.

    Science.gov (United States)

    Kim, Chang-Kug; Seol, Young-Joo; Perumal, Sampath; Lee, Jonghoon; Waminal, Nomar Espinosa; Jayakodi, Murukarthick; Lee, Sang-Choon; Jin, Seungwoo; Choi, Beom-Soon; Yu, Yeisoo; Ko, Ho-Cheol; Choi, Ji-Weon; Ryu, Kyoung-Yul; Sohn, Seong-Han; Parkin, Isobel; Yang, Tae-Jin

    2018-05-09

    The concept of U's triangle, which revealed the importance of polyploidization in plant genome evolution, described natural allopolyploidization events in Brassica using three diploids [B. rapa (A genome), B. nigra (B), and B. oleracea (C)] and derived allotetraploids [B. juncea (AB genome), B. napus (AC), and B. carinata (BC)]. However, comprehensive understanding of Brassica genome evolution has not been fully achieved. Here, we performed low-coverage (2-6×) whole-genome sequencing of 28 accessions of Brassica as well as of Raphanus sativus [R genome] to explore the evolution of six Brassica species based on chloroplast genome and ribosomal DNA variations. Our phylogenomic analyses led to two main conclusions. (1) Intra-species-level chloroplast genome variations are low in the three allotetraploids (2~7 SNPs), but rich and variable in each diploid species (7~193 SNPs). (2) Three allotetraploids maintain two 45SnrDNA types derived from both ancestral species with maternal dominance. Furthermore, this study sheds light on the maternal origin of the AC chloroplast genome. Overall, this study clarifies the genetic relationships of U's triangle species based on a comprehensive genomics approach and provides important genomic resources for correlative and evolutionary studies.

  18. Spectroscopic quantification of 5-hydroxymethylcytosine in genomic DNA.

    Science.gov (United States)

    Shahal, Tamar; Gilat, Noa; Michaeli, Yael; Redy-Keisar, Orit; Shabat, Doron; Ebenstein, Yuval

    2014-08-19

    5-Hydroxymethylcytosine (5hmC), a modified form of the DNA base cytosine, is an important epigenetic mark linked to regulation of gene expression in development, and tumorigenesis. We have developed a spectroscopic method for a global quantification of 5hmC in genomic DNA. The assay is performed within a multiwell plate, which allows simultaneous recording of up to 350 samples. Our quantification procedure of 5hmC is direct, simple, and rapid. It relies on a two-step protocol that consists of enzymatic glucosylation of 5hmC with an azide-modified glucose, followed by a "click reaction" with an alkyne-fluorescent tag. The fluorescence intensity recorded from the DNA sample is proportional to its 5hmC content and can be quantified by a simple plate reader measurement. This labeling technique is specific and highly sensitive, allowing detection of 5hmC down to 0.002% of the total nucleotides. Our results reveal significant variations in the 5hmC content obtained from different mouse tissues, in agreement with previously reported data.

  19. Single-tube linear DNA amplification for genome-wide studies using a few thousand cells

    NARCIS (Netherlands)

    Shankaranarayanan, P.; Mendoza-Parra, M.A.; Gool, van W.; Trindade, L.M.; Gronemeyer, H.

    2012-01-01

    Linear amplification of DNA (LinDA) by T7 polymerase is a versatile and robust method for generating sufficient amounts of DNA for genome-wide studies with minute amounts of cells. LinDA can be coupled to a great number of global profiling technologies. Indeed, chromatin immunoprecipitation coupled

  20. Inactivating UBE2M impacts the DNA damage response and genome integrity involving multiple cullin ligases.

    Directory of Open Access Journals (Sweden)

    Scott Cukras

    Full Text Available Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.

  1. Inactivating UBE2M impacts the DNA damage response and genome integrity involving multiple cullin ligases.

    Science.gov (United States)

    Cukras, Scott; Morffy, Nicholas; Ohn, Takbum; Kee, Younghoon

    2014-01-01

    Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.

  2. The architecture of ArgR-DNA complexes at the genome-scale in Escherichia coli

    DEFF Research Database (Denmark)

    Cho, Suhyung; Cho, Yoo-Bok; Kang, Taek Jin

    2015-01-01

    DNA-binding motifs that are recognized by transcription factors (TFs) have been well studied; however, challenges remain in determining the in vivo architecture of TF-DNA complexes on a genome-scale. Here, we determined the in vivo architecture of Escherichia coli arginine repressor (ArgR)-DNA co...

  3. Large-scale chromosome folding versus genomic DNA sequences: A discrete double Fourier transform technique.

    Science.gov (United States)

    Chechetkin, V R; Lobzin, V V

    2017-08-07

    Using state-of-the-art techniques combining imaging methods and high-throughput genomic mapping tools leaded to the significant progress in detailing chromosome architecture of various organisms. However, a gap still remains between the rapidly growing structural data on the chromosome folding and the large-scale genome organization. Could a part of information on the chromosome folding be obtained directly from underlying genomic DNA sequences abundantly stored in the databanks? To answer this question, we developed an original discrete double Fourier transform (DDFT). DDFT serves for the detection of large-scale genome regularities associated with domains/units at the different levels of hierarchical chromosome folding. The method is versatile and can be applied to both genomic DNA sequences and corresponding physico-chemical parameters such as base-pairing free energy. The latter characteristic is closely related to the replication and transcription and can also be used for the assessment of temperature or supercoiling effects on the chromosome folding. We tested the method on the genome of E. coli K-12 and found good correspondence with the annotated domains/units established experimentally. As a brief illustration of further abilities of DDFT, the study of large-scale genome organization for bacteriophage PHIX174 and bacterium Caulobacter crescentus was also added. The combined experimental, modeling, and bioinformatic DDFT analysis should yield more complete knowledge on the chromosome architecture and genome organization. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Nuclear alpha spectrin: Critical roles in DNA interstrand cross-link repair and genomic stability

    OpenAIRE

    Lambert, Muriel W

    2016-01-01

    Non-erythroid alpha spectrin (?IISp) is a structural protein which we have shown is present in the nucleus of human cells. It interacts with a number of nuclear proteins such as actin, lamin, emerin, chromatin remodeling factors, and DNA repair proteins. ?IISp?s interaction with DNA repair proteins has been extensively studied. We have demonstrated that nuclear ?IISp is critical in DNA interstrand cross-link (ICL) repair in S phase, in both genomic (non-telomeric) and telomeric DNA, and in ma...

  5. A DNA-based pattern classifier with in vitro learning and associative recall for genomic characterization and biosensing without explicit sequence knowledge.

    Science.gov (United States)

    Lee, Ju Seok; Chen, Junghuei; Deaton, Russell; Kim, Jin-Woo

    2014-01-01

    Genetic material extracted from in situ microbial communities has high promise as an indicator of biological system status. However, the challenge is to access genomic information from all organisms at the population or community scale to monitor the biosystem's state. Hence, there is a need for a better diagnostic tool that provides a holistic view of a biosystem's genomic status. Here, we introduce an in vitro methodology for genomic pattern classification of biological samples that taps large amounts of genetic information from all genes present and uses that information to detect changes in genomic patterns and classify them. We developed a biosensing protocol, termed Biological Memory, that has in vitro computational capabilities to "learn" and "store" genomic sequence information directly from genomic samples without knowledge of their explicit sequences, and that discovers differences in vitro between previously unknown inputs and learned memory molecules. The Memory protocol was designed and optimized based upon (1) common in vitro recombinant DNA operations using 20-base random probes, including polymerization, nuclease digestion, and magnetic bead separation, to capture a snapshot of the genomic state of a biological sample as a DNA memory and (2) the thermal stability of DNA duplexes between new input and the memory to detect similarities and differences. For efficient read out, a microarray was used as an output method. When the microarray-based Memory protocol was implemented to test its capability and sensitivity using genomic DNA from two model bacterial strains, i.e., Escherichia coli K12 and Bacillus subtilis, results indicate that the Memory protocol can "learn" input DNA, "recall" similar DNA, differentiate between dissimilar DNA, and detect relatively small concentration differences in samples. This study demonstrated not only the in vitro information processing capabilities of DNA, but also its promise as a genomic pattern classifier that could

  6. The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

    Science.gov (United States)

    Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

    2012-01-01

    Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the

  7. The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

    Directory of Open Access Journals (Sweden)

    Olivier Arnaiz

    Full Text Available Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a

  8. Excised radicle tips as a source of genomic DNA for PCR-based ...

    Indian Academy of Sciences (India)

    2012-12-13

    Dec 13, 2012 ... Cotton; cry1Ac; genomic DNA isolation; high-resolution melting curve analysis; radicle tip; seed purity testing .... cooled to 40°C. Fluorescence data for melting curves were ... greatly increased by introducing automation.

  9. Elg1 forms an alternative RFC complex important for DNA replication and genome integrity

    NARCIS (Netherlands)

    Bellaoui, Mohammed; Chang, Michael; Ou, Jiongwen; Xu, Hong; Boone, Charles; Brown, Grant W

    2003-01-01

    Genome-wide synthetic genetic interaction screens with mutants in the mus81 and mms4 replication fork-processing genes identified a novel replication factor C (RFC) homolog, Elg1, which forms an alternative RFC complex with Rfc2-5. This complex is distinct from the DNA replication RFC, the DNA

  10. Canine parvovirus: current perspective.

    Science.gov (United States)

    Nandi, S; Kumar, Manoj

    2010-06-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

  11. Gene expression profiling identifies inflammation and angiogenesis as distinguishing features of canine hemangiosarcoma

    International Nuclear Information System (INIS)

    Tamburini, Beth A; Cutter, Gary R; Wojcieszyn, John W; Bellgrau, Donald; Gemmill, Robert M; Hunter, Lawrence E; Modiano, Jaime F; Phang, Tzu L; Fosmire, Susan P; Scott, Milcah C; Trapp, Susan C; Duckett, Megan M; Robinson, Sally R; Slansky, Jill E; Sharkey, Leslie C

    2010-01-01

    The etiology of hemangiosarcoma remains incompletely understood. Its common occurrence in dogs suggests predisposing factors favor its development in this species. These factors could represent a constellation of heritable characteristics that promote transformation events and/or facilitate the establishment of a microenvironment that is conducive for survival of malignant blood vessel-forming cells. The hypothesis for this study was that characteristic molecular features distinguish hemangiosarcoma from non-malignant endothelial cells, and that such features are informative for the etiology of this disease. We first investigated mutations of VHL and Ras family genes that might drive hemangiosarcoma by sequencing tumor DNA and mRNA (cDNA). Protein expression was examined using immunostaining. Next, we evaluated genome-wide gene expression profiling using the Affymetrix Canine 2.0 platform as a global approach to test the hypothesis. Data were evaluated using routine bioinformatics and validation was done using quantitative real time RT-PCR. Each of 10 tumor and four non-tumor samples analyzed had wild type sequences for these genes. At the genome wide level, hemangiosarcoma cells clustered separately from non-malignant endothelial cells based on a robust signature that included genes involved in inflammation, angiogenesis, adhesion, invasion, metabolism, cell cycle, signaling, and patterning. This signature did not simply reflect a cancer-associated angiogenic phenotype, as it also distinguished hemangiosarcoma from non-endothelial, moderately to highly angiogenic bone marrow-derived tumors (lymphoma, leukemia, osteosarcoma). The data show that inflammation and angiogenesis are important processes in the pathogenesis of vascular tumors, but a definitive ontogeny of the cells that give rise to these tumors remains to be established. The data do not yet distinguish whether functional or ontogenetic plasticity creates this phenotype, although they suggest that cells

  12. Gene expression profiling identifies inflammation and angiogenesis as distinguishing features of canine hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Slansky Jill E

    2010-11-01

    Full Text Available Abstract Background The etiology of hemangiosarcoma remains incompletely understood. Its common occurrence in dogs suggests predisposing factors favor its development in this species. These factors could represent a constellation of heritable characteristics that promote transformation events and/or facilitate the establishment of a microenvironment that is conducive for survival of malignant blood vessel-forming cells. The hypothesis for this study was that characteristic molecular features distinguish hemangiosarcoma from non-malignant endothelial cells, and that such features are informative for the etiology of this disease. Methods We first investigated mutations of VHL and Ras family genes that might drive hemangiosarcoma by sequencing tumor DNA and mRNA (cDNA. Protein expression was examined using immunostaining. Next, we evaluated genome-wide gene expression profiling using the Affymetrix Canine 2.0 platform as a global approach to test the hypothesis. Data were evaluated using routine bioinformatics and validation was done using quantitative real time RT-PCR. Results Each of 10 tumor and four non-tumor samples analyzed had wild type sequences for these genes. At the genome wide level, hemangiosarcoma cells clustered separately from non-malignant endothelial cells based on a robust signature that included genes involved in inflammation, angiogenesis, adhesion, invasion, metabolism, cell cycle, signaling, and patterning. This signature did not simply reflect a cancer-associated angiogenic phenotype, as it also distinguished hemangiosarcoma from non-endothelial, moderately to highly angiogenic bone marrow-derived tumors (lymphoma, leukemia, osteosarcoma. Conclusions The data show that inflammation and angiogenesis are important processes in the pathogenesis of vascular tumors, but a definitive ontogeny of the cells that give rise to these tumors remains to be established. The data do not yet distinguish whether functional or ontogenetic

  13. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  14. A novel method of genomic DNA extraction for Cactaceae1

    Science.gov (United States)

    Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

    2013-01-01

    • Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

  15. Extensive and biased intergenomic nonreciprocal DNA exchanges shaped a nascent polyploid genome, Gossypium (cotton).

    Science.gov (United States)

    Guo, Hui; Wang, Xiyin; Gundlach, Heidrun; Mayer, Klaus F X; Peterson, Daniel G; Scheffler, Brian E; Chee, Peng W; Paterson, Andrew H

    2014-08-01

    Genome duplication is thought to be central to the evolution of morphological complexity, and some polyploids enjoy a variety of capabilities that transgress those of their diploid progenitors. Comparison of genomic sequences from several tetraploid (AtDt) Gossypium species and genotypes with putative diploid A- and D-genome progenitor species revealed that unidirectional DNA exchanges between homeologous chromosomes were the predominant mechanism responsible for allelic differences between the Gossypium tetraploids and their diploid progenitors. Homeologous gene conversion events (HeGCEs) gradually subsided, declining to rates similar to random mutation during radiation of the polyploid into multiple clades and species. Despite occurring in a common nucleus, preservation of HeGCE is asymmetric in the two tetraploid subgenomes. At-to-Dt conversion is far more abundant than the reciprocal, is enriched in heterochromatin, is highly correlated with GC content and transposon distribution, and may silence abundant A-genome-derived retrotransposons. Dt-to-At conversion is abundant in euchromatin and genes, frequently reversing losses of gene function. The long-standing observation that the nonspinnable-fibered D-genome contributes to the superior yield and quality of tetraploid cotton fibers may be explained by accelerated Dt to At conversion during cotton domestication and improvement, increasing dosage of alleles from the spinnable-fibered A-genome. HeGCE may provide an alternative to (rare) reciprocal DNA exchanges between chromosomes in heterochromatin, where genes have approximately five times greater abundance of Dt-to-At conversion than does adjacent intergenic DNA. Spanning exon-to-gene-sized regions, HeGCE is a natural noninvasive means of gene transfer with the precision of transformation, potentially important in genetic improvement of many crop plants. Copyright © 2014 by the Genetics Society of America.

  16. Norgal: extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data.

    Science.gov (United States)

    Al-Nakeeb, Kosai; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas

    2017-11-21

    Whole-genome sequencing (WGS) projects provide short read nucleotide sequences from nuclear and possibly organelle DNA depending on the source of origin. Mitochondrial DNA is present in animals and fungi, while plants contain DNA from both mitochondria and chloroplasts. Current techniques for separating organelle reads from nuclear reads in WGS data require full reference or partial seed sequences for assembling. Norgal (de Novo ORGAneLle extractor) avoids this requirement by identifying a high frequency subset of k-mers that are predominantly of mitochondrial origin and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences in the range from 98.5 to 99.5%. We also assembled the chloroplasts of grape vines and cucumbers using Norgal together with seed-based de novo assemblers. Norgal is a pipeline that can extract and assemble full or partial mitochondrial and chloroplast genomes from WGS short reads without prior knowledge. The program is available at: https://bitbucket.org/kosaidtu/norgal .

  17. Uracil DNA glycosylase counteracts APOBEC3G-induced hypermutation of hepatitis B viral genomes: excision repair of covalently closed circular DNA.

    Directory of Open Access Journals (Sweden)

    Kouichi Kitamura

    Full Text Available The covalently closed circular DNA (cccDNA of the hepatitis B virus (HBV plays an essential role in chronic hepatitis. The cellular repair system is proposed to convert cytoplasmic nucleocapsid (NC DNA (partially double-stranded DNA into cccDNA in the nucleus. Recently, antiviral cytidine deaminases, AID/APOBEC proteins, were shown to generate uracil residues in the NC-DNA through deamination, resulting in cytidine-to-uracil (C-to-U hypermutation of the viral genome. We investigated whether uracil residues in hepadnavirus DNA were excised by uracil-DNA glycosylase (UNG, a host factor for base excision repair (BER. When UNG activity was inhibited by the expression of the UNG inhibitory protein (UGI, hypermutation of NC-DNA induced by either APOBEC3G or interferon treatment was enhanced in a human hepatocyte cell line. To assess the effect of UNG on the cccDNA viral intermediate, we used the duck HBV (DHBV replication model. Sequence analyses of DHBV DNAs showed that cccDNA accumulated G-to-A or C-to-T mutations in APOBEC3G-expressing cells, and this was extensively enhanced by UNG inhibition. The cccDNA hypermutation generated many premature stop codons in the P gene. UNG inhibition also enhanced the APOBEC3G-mediated suppression of viral replication, including reduction of NC-DNA, pre-C mRNA, and secreted viral particle-associated DNA in prolonged culture. Enhancement of APOBEC3G-mediated suppression by UNG inhibition was not observed when the catalytic site of APOBEC3G was mutated. Transfection experiments of recloned cccDNAs revealed that the combination of UNG inhibition and APOBEC3G expression reduced the replication ability of cccDNA. Taken together, these data indicate that UNG excises uracil residues from the viral genome during or after cccDNA formation in the nucleus and imply that BER pathway activities decrease the antiviral effect of APOBEC3-mediated hypermutation.

  18. Genome-wide identification and comparative analysis of cytosine-5 DNA methyltransferases and demethylase families in wild and cultivated peanut

    Directory of Open Access Journals (Sweden)

    Pengfei eWang

    2016-02-01

    Full Text Available AbstractDNA methylation plays important roles in genome protection, regulation of gene expression and was associated with plants development. Plant DNA methylation pattern was mediated by cytosine-5 DNA methyltransferases and demethylase. Although the genomes of AA and BB wild peanuts have been fully sequence, these two gene families have not been studied. In this study we report the identification and analysis of putative cytosine-5 DNA methyltransferases (C5-MTases and demethylase in AA and BB wild peanuts. Cytosine-5 DNA methyltransferases in AA and BB wild peanuts could be classified in known MET, CMT and DRM2 groups based on their domain organization. This result was supported by the gene and protein structural characteristics and phylogenetic analysis. We found that some wild peanut DRM2 numbers didn’t contain UBA domain which was different from other plants such as Arabidopsis, maize, soybean. Five DNA demethylase were found in AA genome and five in BB genome. The selective pressure analysis showed that wild peanut C5-MTases gene mainly underwent purifying selection but many positive selection sites can be detected. Conversely, DNA demethylase genes mainly underwent positive selection during evolution. Additionally, the expression dynamic of cytosine-5 DNA methyltransferases and demethylase genes in different cultivated peanut tissues were analyzed. Expression result showed that cold, heat or drought stress could influence the expression level of C5-MTases and DNA demethylase genes in cultivated peanut. These results are useful for better understanding the complexity of these two gene families, and will facilitate epigenetic studies in peanut.

  19. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    Science.gov (United States)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  20. Impact of nuclear organization and chromatin structure on DNA repair and genome stability

    International Nuclear Information System (INIS)

    Batte, Amandine

    2016-01-01

    The non-random organization of the eukaryotic cell nucleus and the folding of genome in chromatin more or less condensed can influence many functions related to DNA metabolism, including genome stability. Double-strand breaks (DSBs) are the most deleterious DNA damages for the cells. To preserve genome integrity, eukaryotic cells thus developed DSB repair mechanisms conserved from yeast to human, among which homologous recombination (HR) that uses an intact homologous sequence to repair a broken chromosome. HR can be separated in two sub-pathways: Gene Conversion (GC) transfers genetic information from one molecule to its homologous and Break Induced Replication (BIR) establishes a replication fork than can proceed until the chromosome end. My doctorate work was focused on the contribution of the chromatin context and 3D genome organization on DSB repair. In S. cerevisiae, nuclear organization and heterochromatin spreading at sub-telomeres can be modified through the overexpression of the Sir3 or sir3A2Q mutant proteins. We demonstrated that reducing the physical distance between homologous sequences increased GC rates, reinforcing the notion that homology search is a limiting step for recombination. We also showed that hetero-chromatinization of DSB site fine-tunes DSB resection, limiting the loss of the DSB ends required to perform homology search and complete HR. Finally, we noticed that the presence of heterochromatin at the donor locus decreased both GC and BIR efficiencies, probably by affecting strand invasion. This work highlights new regulatory pathways of DNA repair. (author) [fr

  1. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    Directory of Open Access Journals (Sweden)

    Luis E. Rojas

    2014-07-01

    Full Text Available The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol. In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR. From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend different regions of the genome through PCR. Furthermore, it was possible to amplify a fragment of avr-4 gene DNA purified from lyophilized mycelium of Mycosphaerella fijiensis. Additionally, it was possible to amplify the region ap24 transgene inserted into the genome of banana cv. `Grande naine' (Musa AAA. Key words: alkaline lysis, Carica papaya L., Digitalis purpurea L., Musa, Saccharum officinarum L.

  2. Sequencing of whole plastid genomes and nuclear ribosomal DNA of Diospyros species (Ebenaceae) endemic to New Caledonia: many species, little divergence.

    Science.gov (United States)

    Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W; Samuel, Rosabelle

    2016-06-01

    Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with plastid DNA did not help to resolve the phylogenetic tree

  3. Evolutionary analyses of entire genomes do not support the association of mtDNA mutations with Ras/MAPK pathway syndromes.

    Directory of Open Access Journals (Sweden)

    Alberto Gómez-Carballa

    Full Text Available BACKGROUND: There are several known autosomal genes responsible for Ras/MAPK pathway syndromes, including Noonan syndrome (NS and related disorders (such as LEOPARD, neurofibromatosis type 1, although mutations of these genes do not explain all cases. Due to the important role played by the mitochondrion in the energetic metabolism of cardiac muscle, it was recently proposed that variation in the mitochondrial DNA (mtDNA genome could be a risk factor in the Noonan phenotype and in hypertrophic cardiomyopathy (HCM, which is a common clinical feature in Ras/MAPK pathway syndromes. In order to test these hypotheses, we sequenced entire mtDNA genomes in the largest series of patients suffering from Ras/MAPK pathway syndromes analyzed to date (n = 45, most of them classified as NS patients (n = 42. METHODS/PRINCIPAL FINDINGS: The results indicate that the observed mtDNA lineages were mostly of European ancestry, reproducing in a nutshell the expected haplogroup (hg patterns of a typical Iberian dataset (including hgs H, T, J, and U. Three new branches of the mtDNA phylogeny (H1j1, U5b1e, and L2a5 are described for the first time, but none of these are likely to be related to NS or Ras/MAPK pathway syndromes when observed under an evolutionary perspective. Patterns of variation in tRNA and protein genes, as well as redundant, private and heteroplasmic variants, in the mtDNA genomes of patients were as expected when compared with the patterns inferred from a worldwide mtDNA phylogeny based on more than 8700 entire genomes. Moreover, most of the mtDNA variants found in patients had already been reported in healthy individuals and constitute common polymorphisms in human population groups. CONCLUSIONS/SIGNIFICANCE: As a whole, the observed mtDNA genome variation in the NS patients was difficult to reconcile with previous findings that indicated a pathogenic role of mtDNA variants in NS.

  4. Evolutionary Analyses of Entire Genomes Do Not Support the Association of mtDNA Mutations with Ras/MAPK Pathway Syndromes

    Science.gov (United States)

    Cerezo, María; Balboa, Emilia; Heredia, Claudia; Castro-Feijóo, Lidia; Rica, Itxaso; Barreiro, Jesús; Eirís, Jesús; Cabanas, Paloma; Martínez-Soto, Isabel; Fernández-Toral, Joaquín; Castro-Gago, Manuel; Pombo, Manuel; Carracedo, Ángel; Barros, Francisco

    2011-01-01

    Background There are several known autosomal genes responsible for Ras/MAPK pathway syndromes, including Noonan syndrome (NS) and related disorders (such as LEOPARD, neurofibromatosis type 1), although mutations of these genes do not explain all cases. Due to the important role played by the mitochondrion in the energetic metabolism of cardiac muscle, it was recently proposed that variation in the mitochondrial DNA (mtDNA) genome could be a risk factor in the Noonan phenotype and in hypertrophic cardiomyopathy (HCM), which is a common clinical feature in Ras/MAPK pathway syndromes. In order to test these hypotheses, we sequenced entire mtDNA genomes in the largest series of patients suffering from Ras/MAPK pathway syndromes analyzed to date (n = 45), most of them classified as NS patients (n = 42). Methods/Principal Findings The results indicate that the observed mtDNA lineages were mostly of European ancestry, reproducing in a nutshell the expected haplogroup (hg) patterns of a typical Iberian dataset (including hgs H, T, J, and U). Three new branches of the mtDNA phylogeny (H1j1, U5b1e, and L2a5) are described for the first time, but none of these are likely to be related to NS or Ras/MAPK pathway syndromes when observed under an evolutionary perspective. Patterns of variation in tRNA and protein genes, as well as redundant, private and heteroplasmic variants, in the mtDNA genomes of patients were as expected when compared with the patterns inferred from a worldwide mtDNA phylogeny based on more than 8700 entire genomes. Moreover, most of the mtDNA variants found in patients had already been reported in healthy individuals and constitute common polymorphisms in human population groups. Conclusions/Significance As a whole, the observed mtDNA genome variation in the NS patients was difficult to reconcile with previous findings that indicated a pathogenic role of mtDNA variants in NS. PMID:21526175

  5. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

    2011-01-01

    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  6. Annotating the genome by DNA methylation.

    Science.gov (United States)

    Cedar, Howard; Razin, Aharon

    2017-01-01

    DNA methylation plays a prominent role in setting up and stabilizing the molecular design of gene regulation and by understanding this process one gains profound insight into the underlying biology of mammals. In this article, we trace the discoveries that provided the foundations of this field, starting with the mapping of methyl groups in the genome and the experiments that helped clarify how methylation patterns are maintained through cell division. We then address the basic relationship between methyl groups and gene repression, as well as the molecular rules involved in controlling this process during development in vivo. Finally, we describe ongoing work aimed at defining the role of this modification in disease and deciphering how it may serve as a mechanism for sensing the environment.

  7. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  8. DNA end resection by CtIP and exonuclease 1 prevents genomic instability

    DEFF Research Database (Denmark)

    Eid, Wassim; Steger, Martin; El-Shemerly, Mahmoud

    2010-01-01

    End resection of DNA-which is essential for the repair of DNA double-strand breaks (DSBs) by homologous recombination-relies first on the partnership between MRE11-RAD50-NBS1 (MRN) and CtIP, followed by a processive step involving helicases and exonucleases such as exonuclease 1 (EXO1). In this s......End resection of DNA-which is essential for the repair of DNA double-strand breaks (DSBs) by homologous recombination-relies first on the partnership between MRE11-RAD50-NBS1 (MRN) and CtIP, followed by a processive step involving helicases and exonucleases such as exonuclease 1 (EXO1...... of DNA-PK-dependent radial chromosome formation. Thus, our study identifies new functions of CtIP and EXO1 in DNA end resection and provides new information on the regulation of DSB repair pathways, which is a key factor in the maintenance of genome integrity....

  9. DNA immunoprecipitation semiconductor sequencing (DIP-SC-seq) as a rapid method to generate genome wide epigenetic signatures

    OpenAIRE

    Thomson, John P.; Fawkes, Angie; Ottaviano, Raffaele; Hunter, Jennifer M.; Shukla, Ruchi; Mjoseng, Heidi K.; Clark, Richard; Coutts, Audrey; Murphy, Lee; Meehan, Richard R.

    2015-01-01

    Modification of DNA resulting in 5-methylcytosine (5 mC) or 5-hydroxymethylcytosine (5hmC) has been shown to influence the local chromatin environment and affect transcription. Although recent advances in next generation sequencing technology allow researchers to map epigenetic modifications across the genome, such experiments are often time-consuming and cost prohibitive. Here we present a rapid and cost effective method of generating genome wide DNA modification maps utilising commercially ...

  10. Epigenetic Variation in Monozygotic Twins: A Genome-Wide Analysis of DNA Methylation in Buccal Cells

    Directory of Open Access Journals (Sweden)

    Jenny van Dongen

    2014-05-01

    Full Text Available DNA methylation is one of the most extensively studied epigenetic marks in humans. Yet, it is largely unknown what causes variation in DNA methylation between individuals. The comparison of DNA methylation profiles of monozygotic (MZ twins offers a unique experimental design to examine the extent to which such variation is related to individual-specific environmental influences and stochastic events or to familial factors (DNA sequence and shared environment. We measured genome-wide DNA methylation in buccal samples from ten MZ pairs (age 8–19 using the Illumina 450k array and examined twin correlations for methylation level at 420,921 CpGs after QC. After selecting CpGs showing the most variation in the methylation level between subjects, the mean genome-wide correlation (rho was 0.54. The correlation was higher, on average, for CpGs within CpG islands (CGIs, compared to CGI shores, shelves and non-CGI regions, particularly at hypomethylated CpGs. This finding suggests that individual-specific environmental and stochastic influences account for more variation in DNA methylation in CpG-poor regions. Our findings also indicate that it is worthwhile to examine heritable and shared environmental influences on buccal DNA methylation in larger studies that also include dizygotic twins.

  11. Using a commercially available DNA extraction kit to obtain high quality human genomic DNA suitable for PCR and genotyping from 11-year-old saliva saturated cotton spit wads

    Directory of Open Access Journals (Sweden)

    Hudziak James J

    2008-12-01

    Full Text Available Abstract Background We sought to describe the integrity of human genomic DNA extracted from saliva saturated cotton spit wads stored at -20°C for approximately 11 years. 783 spit wad samples were collected from an ADHD sample population (Vermont Family Study during 1996–2000. Human genomic DNA was extracted from the spit wads using a commercially available kit; QIAamp DNA Blood Midi Kit (Qiagen, Inc., Valencia, CA. with a few modifications. Results The resulting DNA yield was more than adequate for genetic analysis and ranged from approximately 1 μg to a total of 80 μg (mean 17.3 μgs ± 11.9 μgs. A260/A280 ratios for the human genomic DNA extracted from the spit wads was consistently within the generally acceptable values of 1.7–2.0, with the lowest purity being 1.70, and a mean value of 1.937 ± 0.226 for the 783 samples. The DNA also was suitable for PCR reactions as evidenced by the amplification of the serotonin-transporter-linked polymorphic region, 5HTTLPR. 5HTTLPR is a functional polymorphism in the promoter region of the serotonin transporter gene (HTT, SLC6A4, or SERT, consisting of two intensively studied alleles. 770 of the 783 samples (98.3% produced fragments after PCR of the expected size with primers specific for 5HTTLPR. Conclusion High quality and abundant genomic DNA can be successfully retrieved from saliva saturated cotton spit wads using the commercially available kit, QIAamp DNA Blood Midi Kit from Qiagen, Inc. Furthermore, the DNA can be extracted in less than 3 hours and multiple samples can be processed simultaneously thus reducing processing time.

  12. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Science.gov (United States)

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  13. DNA rearrangements from γ-irradiated normal human fibroblasts preferentially occur in transcribed regions of the genome

    International Nuclear Information System (INIS)

    Forrester, H.B.; Radford, I.R.

    2003-01-01

    Full text: DNA rearrangement events leading to chromosomal aberrations are central to ionizing radiation-induced cell death. Although DNA double-strand breaks are probably the lesion that initiates formation of chromosomal aberrations, little is understood about the molecular mechanisms that generate and modulate DNA rearrangement. Examination of the sequences that flank sites of DNA rearrangement may provide information regarding the processes and enzymes involved in rearrangement events. Accordingly, we developed a method using inverse PCR that allows the detection and sequencing of putative radiation-induced DNA rearrangements in defined regions of the human genome. The method can detect single copies of a rearrangement event that has occurred in a particular region of the genome and, therefore, DNA rearrangement detection does not require survival and continued multiplication of the affected cell. Ionizing radiation-induced DNA rearrangements were detected in several different regions of the genome of human fibroblast cells that were exposed to 30 Gy of γ-irradiation and then incubated for 24 hours at 37 deg C. There was a 3- to 5-fold increase in the number of products amplified from irradiated as compared with control cells in the target regions 5' to the C-MYC, CDKN1A, RB1, and FGFR2 genes. Sequences were examined from 121 DNA rearrangements. Approximately half of the PCR products were derived from possible inter-chromosomal rearrangements and the remainder were from intra-chromosomal events. A high proportion of the sequences that rearranged with target regions were located in genes, suggesting that rearrangements may occur preferentially in transcribed regions. Eighty-four percent of the sequences examined by reverse transcriptase PCR were from transcribed sequences in IMR-90 cells. The distribution of DNA rearrangements within the target regions is non-random and homology occurs between the sequences involved in rearrangements in some cases but is not

  14. Repair of DNA in replicated and unreplicated portions of the human genome

    International Nuclear Information System (INIS)

    Waters, R.

    1979-01-01

    Portions of the human genome that have replicated after ultraviolet light irradiation and those that remain unreplicated have both been examined for the distribution of pyrimidine dimers and the extent of repair replication following their removal. The data indicate that the number of unrepaired dimers and the extent of repair replication seen after their excision are equal in the replicated and unreplicated DNA. Furthermore, the daughter strand of replicated DNA is larger than the average interdimer distance found in the parental strand. Hence, DNA replication in normal human fibroblasts is clearly capable of getting past pyrimidine dimers, and a preferential repair of such lesions in DNA that is about to be or has been replicated does not operate to any visible extent in these cells. (author)

  15. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  16. Inter-genomic DNA Exchanges and Homeologous Gene Silencing Shaped the Nascent Allopolyploid Coffee Genome (Coffea arabica L.

    Directory of Open Access Journals (Sweden)

    Philippe Lashermes

    2016-09-01

    Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.

  17. Partial digestion with restriction enzymes of ultraviolet-irradiated human genomic DNA: a method for identifying restriction site polymorphisms

    International Nuclear Information System (INIS)

    Nobile, C.; Romeo, G.

    1988-01-01

    A method for partial digestion of total human DNA with restriction enzymes has been developed on the basis of a principle already utilized by P.A. Whittaker and E. Southern for the analysis of phage lambda recombinants. Total human DNA irradiated with uv light of 254 nm is partially digested by restriction enzymes that recognize sequences containing adjacent thymidines because of TT dimer formation. The products resulting from partial digestion of specific genomic regions are detected in Southern blots by genomic-unique DNA probes with high reproducibility. This procedure is rapid and simple to perform because the same conditions of uv irradiation are used for different enzymes and probes. It is shown that restriction site polymorphisms occurring in the genomic regions analyzed are recognized by the allelic partial digest patterns they determine

  18. DNA is structured as a linear "jigsaw puzzle" in the genomes of Arabidopsis, rice, and budding yeast.

    Science.gov (United States)

    Liu, Yun-Hua; Zhang, Meiping; Wu, Chengcang; Huang, James J; Zhang, Hong-Bin

    2014-01-01

    Knowledge of how a genome is structured and organized from its constituent elements is crucial to understanding its biology and evolution. Here, we report the genome structuring and organization pattern as revealed by systems analysis of the sequences of three model species, Arabidopsis, rice and yeast, at the whole-genome and chromosome levels. We found that all fundamental function elements (FFE) constituting the genomes, including genes (GEN), DNA transposable elements (DTE), retrotransposable elements (RTE), simple sequence repeats (SSR), and (or) low complexity repeats (LCR), are structured in a nonrandom and correlative manner, thus leading to a hypothesis that the DNA of the species is structured as a linear "jigsaw puzzle". Furthermore, we showed that different FFE differ in their importance in the formation and evolution of the DNA jigsaw puzzle structure between species. DTE and RTE play more important roles than GEN, LCR, and SSR in Arabidopsis, whereas GEN and RTE play more important roles than LCR, SSR, and DTE in rice. The genes having multiple recognized functions play more important roles than those having single functions. These results provide useful knowledge necessary for better understanding genome biology and evolution of the species and for effective molecular breeding of rice.

  19. Exploring repetitive DNA landscapes using REPCLASS, a tool that automates the classification of transposable elements in eukaryotic genomes.

    Science.gov (United States)

    Feschotte, Cédric; Keswani, Umeshkumar; Ranganathan, Nirmal; Guibotsy, Marcel L; Levine, David

    2009-07-23

    Eukaryotic genomes contain large amount of repetitive DNA, most of which is derived from transposable elements (TEs). Progress has been made to develop computational tools for ab initio identification of repeat families, but there is an urgent need to develop tools to automate the annotation of TEs in genome sequences. Here we introduce REPCLASS, a tool that automates the classification of TE sequences. Using control repeat libraries, we show that the program can classify accurately virtually any known TE types. Combining REPCLASS to ab initio repeat finding in the genomes of Caenorhabditis elegans and Drosophila melanogaster allowed us to recover the contrasting TE landscape characteristic of these species. Unexpectedly, REPCLASS also uncovered several novel TE families in both genomes, augmenting the TE repertoire of these model species. When applied to the genomes of distant Caenorhabditis and Drosophila species, the approach revealed a remarkable conservation of TE composition profile within each genus, despite substantial interspecific covariations in genome size and in the number of TEs and TE families. Lastly, we applied REPCLASS to analyze 10 fungal genomes from a wide taxonomic range, most of which have not been analyzed for TE content previously. The results showed that TE diversity varies widely across the fungi "kingdom" and appears to positively correlate with genome size, in particular for DNA transposons. Together, these data validate REPCLASS as a powerful tool to explore the repetitive DNA landscapes of eukaryotes and to shed light onto the evolutionary forces shaping TE diversity and genome architecture.

  20. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

    2010-01-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  1. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  2. Predicting DNA Methylation State of CpG Dinucleotide Using Genome Topological Features and Deep Networks.

    Science.gov (United States)

    Wang, Yiheng; Liu, Tong; Xu, Dong; Shi, Huidong; Zhang, Chaoyang; Mo, Yin-Yuan; Wang, Zheng

    2016-01-22

    The hypo- or hyper-methylation of the human genome is one of the epigenetic features of leukemia. However, experimental approaches have only determined the methylation state of a small portion of the human genome. We developed deep learning based (stacked denoising autoencoders, or SdAs) software named "DeepMethyl" to predict the methylation state of DNA CpG dinucleotides using features inferred from three-dimensional genome topology (based on Hi-C) and DNA sequence patterns. We used the experimental data from immortalised myelogenous leukemia (K562) and healthy lymphoblastoid (GM12878) cell lines to train the learning models and assess prediction performance. We have tested various SdA architectures with different configurations of hidden layer(s) and amount of pre-training data and compared the performance of deep networks relative to support vector machines (SVMs). Using the methylation states of sequentially neighboring regions as one of the learning features, an SdA achieved a blind test accuracy of 89.7% for GM12878 and 88.6% for K562. When the methylation states of sequentially neighboring regions are unknown, the accuracies are 84.82% for GM12878 and 72.01% for K562. We also analyzed the contribution of genome topological features inferred from Hi-C. DeepMethyl can be accessed at http://dna.cs.usm.edu/deepmethyl/.

  3. Nuclear routing networks span between nuclear pore complexes and genomic DNA to guide nucleoplasmic trafficking of biomolecules

    Science.gov (United States)

    Malecki, Marek; Malecki, Bianca

    2012-01-01

    In health and disease, biomolecules, which are involved in gene expression, recombination, or reprogramming have to traffic through the nucleoplasm, between nuclear pore complexes (NPCs) and genomic DNA (gDNA). This trafficking is guided by the recently revealed nuclear routing networks (NRNs). In this study, we aimed to investigate, if the NRNs have established associations with the genomic DNA in situ and if the NRNs have capabilities to bind the DNA de novo. Moreover, we aimed to study further, if nucleoplasmic trafficking of the histones, rRNA, and transgenes’ vectors, between the NPCs and gDNA, is guided by the NRNs. We used Xenopus laevis oocytes as the model system. We engineered the transgenes’ DNA vectors equipped with the SV40 LTA nuclear localization signals (NLS) and/or HIV Rev nuclear export signals (NES). We purified histones, 5S rRNA, and gDNA. We rendered all these molecules superparamagnetic and fluorescent for detection with nuclear magnetic resonance (NMR), total reflection x-ray fluorescence (TXRF), energy dispersive x-ray spectroscopy (EDXS), and electron energy loss spectroscopy (EELS). The NRNs span between the NPCs and genomic DNA. They form firm bonds with the gDNA in situ. After complete digestion of the nucleic acids with the RNases and DNases, the newly added DNA - modified with the dNTP analogs, bonds firmly to the NRNs. Moreover, the NRNs guide the trafficking of the DNA transgenes’ vectors - modified with the SV40 LTA NLS, following their import into the nuclei through the NPCs. The pathway is identical to that of histones. The NRNs also guide the trafficking of the DNA transgenes’ vectors, modified with the HIV Rev NES, to the NPCs, followed by their export out of the nuclei. Ribosomal RNAs follow the same pathway. To summarize, the NRNs are the structures connecting the NPCs and the gDNA. They guide the trafficking of the biomolecules between the NPCs and the gDNA. PMID:23275893

  4. Genome-scale analysis of aberrant DNA methylation in colorectal cancer

    Science.gov (United States)

    Hinoue, Toshinori; Weisenberger, Daniel J.; Lange, Christopher P.E.; Shen, Hui; Byun, Hyang-Min; Van Den Berg, David; Malik, Simeen; Pan, Fei; Noushmehr, Houtan; van Dijk, Cornelis M.; Tollenaar, Rob A.E.M.; Laird, Peter W.

    2012-01-01

    Colorectal cancer (CRC) is a heterogeneous disease in which unique subtypes are characterized by distinct genetic and epigenetic alterations. Here we performed comprehensive genome-scale DNA methylation profiling of 125 colorectal tumors and 29 adjacent normal tissues. We identified four DNA methylation–based subgroups of CRC using model-based cluster analyses. Each subtype shows characteristic genetic and clinical features, indicating that they represent biologically distinct subgroups. A CIMP-high (CIMP-H) subgroup, which exhibits an exceptionally high frequency of cancer-specific DNA hypermethylation, is strongly associated with MLH1 DNA hypermethylation and the BRAFV600E mutation. A CIMP-low (CIMP-L) subgroup is enriched for KRAS mutations and characterized by DNA hypermethylation of a subset of CIMP-H-associated markers rather than a unique group of CpG islands. Non-CIMP tumors are separated into two distinct clusters. One non-CIMP subgroup is distinguished by a significantly higher frequency of TP53 mutations and frequent occurrence in the distal colon, while the tumors that belong to the fourth group exhibit a low frequency of both cancer-specific DNA hypermethylation and gene mutations and are significantly enriched for rectal tumors. Furthermore, we identified 112 genes that were down-regulated more than twofold in CIMP-H tumors together with promoter DNA hypermethylation. These represent ∼7% of genes that acquired promoter DNA methylation in CIMP-H tumors. Intriguingly, 48/112 genes were also transcriptionally down-regulated in non-CIMP subgroups, but this was not attributable to promoter DNA hypermethylation. Together, we identified four distinct DNA methylation subgroups of CRC and provided novel insight regarding the role of CIMP-specific DNA hypermethylation in gene silencing. PMID:21659424

  5. Next-Generation Sequencing Reveals the Impact of Repetitive DNA Across Phylogenetically Closely Related Genomes of Orobanchaceae

    Science.gov (United States)

    Piednoël, Mathieu; Aberer, Andre J.; Schneeweiss, Gerald M.; Macas, Jiri; Novak, Petr; Gundlach, Heidrun; Temsch, Eva M.; Renner, Susanne S.

    2013-01-01

    We used next-generation sequencing to characterize the genomes of nine species of Orobanchaceae of known phylogenetic relationships, different life forms, and including a polyploid species. The study species are the autotrophic, nonparasitic Lindenbergia philippensis, the hemiparasitic Schwalbea americana, and seven nonphotosynthetic parasitic species of Orobanche (Orobanche crenata, Orobanche cumana, Orobanche gracilis (tetraploid), and Orobanche pancicii) and Phelipanche (Phelipanche lavandulacea, Phelipanche purpurea, and Phelipanche ramosa). Ty3/Gypsy elements comprise 1.93%–28.34% of the nine genomes and Ty1/Copia elements comprise 8.09%–22.83%. When compared with L. philippensis and S. americana, the nonphotosynthetic species contain higher proportions of repetitive DNA sequences, perhaps reflecting relaxed selection on genome size in parasitic organisms. Among the parasitic species, those in the genus Orobanche have smaller genomes but higher proportions of repetitive DNA than those in Phelipanche, mostly due to a diversification of repeats and an accumulation of Ty3/Gypsy elements. Genome downsizing in the tetraploid O. gracilis probably led to sequence loss across most repeat types. PMID:22723303

  6. FLT3 mutations in canine acute lymphocytic leukemia

    International Nuclear Information System (INIS)

    Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L

    2011-01-01

    FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

  7. DNA microarrays of baculovirus genomes: differential expression of viral genes in two susceptible insect cell lines.

    Science.gov (United States)

    Yamagishi, J; Isobe, R; Takebuchi, T; Bando, H

    2003-03-01

    We describe, for the first time, the generation of a viral DNA chip for simultaneous expression measurements of nearly all known open reading frames (ORFs) in the best-studied members of the family Baculoviridae, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In this study, a viral DNA chip (Ac-BmNPV chip) was fabricated and used to characterize the viral gene expression profile for AcMNPV in different cell types. The viral chip is composed of microarrays of viral DNA prepared by robotic deposition of PCR-amplified viral DNA fragments on glass for ORFs in the NPV genome. Viral gene expression was monitored by hybridization to the DNA fragment microarrays with fluorescently labeled cDNAs prepared from infected Spodoptera frugiperda, Sf9 cells and Trichoplusia ni, TnHigh-Five cells, the latter a major producer of baculovirus and recombinant proteins. A comparison of expression profiles of known ORFs in AcMNPV elucidated six genes (ORF150, p10, pk2, and three late gene expression factor genes lef-3, p35 and lef- 6) the expression of each of which was regulated differently in the two cell lines. Most of these genes are known to be closely involved in the viral life cycle such as in DNA replication, late gene expression and the release of polyhedra from infected cells. These results imply that the differential expression of these viral genes accounts for the differences in viral replication between these two cell lines. Thus, these fabricated microarrays of NPV DNA which allow a rapid analysis of gene expression at the viral genome level should greatly speed the functional analysis of large genomes of NPV.

  8. NSD1 mutations generate a genome-wide DNA methylation signature.

    LENUS (Irish Health Repository)

    Choufani, S

    2015-12-22

    Sotos syndrome (SS) represents an important human model system for the study of epigenetic regulation; it is an overgrowth\\/intellectual disability syndrome caused by mutations in a histone methyltransferase, NSD1. As layered epigenetic modifications are often interdependent, we propose that pathogenic NSD1 mutations have a genome-wide impact on the most stable epigenetic mark, DNA methylation (DNAm). By interrogating DNAm in SS patients, we identify a genome-wide, highly significant NSD1(+\\/-)-specific signature that differentiates pathogenic NSD1 mutations from controls, benign NSD1 variants and the clinically overlapping Weaver syndrome. Validation studies of independent cohorts of SS and controls assigned 100% of these samples correctly. This highly specific and sensitive NSD1(+\\/-) signature encompasses genes that function in cellular morphogenesis and neuronal differentiation, reflecting cardinal features of the SS phenotype. The identification of SS-specific genome-wide DNAm alterations will facilitate both the elucidation of the molecular pathophysiology of SS and the development of improved diagnostic testing.

  9. SMC1-Mediated Intra-S-Phase Arrest Facilitates Bocavirus DNA Replication

    Science.gov (United States)

    Luo, Yong; Deng, Xuefeng; Cheng, Fang; Li, Yi

    2013-01-01

    Activation of a host DNA damage response (DDR) is essential for DNA replication of minute virus of canines (MVC), a member of the genus Bocavirus of the Parvoviridae family; however, the mechanism by which DDR contributes to viral DNA replication is unknown. In the current study, we demonstrate that MVC infection triggers the intra-S-phase arrest to slow down host cellular DNA replication and to recruit cellular DNA replication factors for viral DNA replication. The intra-S-phase arrest is regulated by ATM (ataxia telangiectasia-mutated kinase) signaling in a p53-independent manner. Moreover, we demonstrate that SMC1 (structural maintenance of chromosomes 1) is the key regulator of the intra-S-phase arrest induced during infection. Either knockdown of SMC1 or complementation with a dominant negative SMC1 mutant blocks both the intra-S-phase arrest and viral DNA replication. Finally, we show that the intra-S-phase arrest induced during MVC infection was caused neither by damaged host cellular DNA nor by viral proteins but by replicating viral genomes physically associated with the DNA damage sensor, the Mre11-Rad50-Nbs1 (MRN) complex. In conclusion, the feedback loop between MVC DNA replication and the intra-S-phase arrest is mediated by ATM-SMC1 signaling and plays a critical role in MVC DNA replication. Thus, our findings unravel the mechanism underlying DDR signaling-facilitated MVC DNA replication and demonstrate a novel strategy of DNA virus-host interaction. PMID:23365434

  10. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    Directory of Open Access Journals (Sweden)

    Mostfa Shahabi

    2017-09-01

    Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

  11. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    OpenAIRE

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    2012-01-01

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it possible to map SCEs at orders-of-magnitude greater resolution than was previously possible. On average, murine embryonic stem (mES) cells exhibit eight SCEs, which are detected at a resolution of up...

  12. A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status

    Science.gov (United States)

    Friso, Simonetta; Choi, Sang-Woon; Girelli, Domenico; Mason, Joel B.; Dolnikowski, Gregory G.; Bagley, Pamela J.; Olivieri, Oliviero; Jacques, Paul F.; Rosenberg, Irwin H.; Corrocher, Roberto; Selhub, Jacob

    2002-01-01

    DNA methylation, an essential epigenetic feature of DNA that modulates gene expression and genomic integrity, is catalyzed by methyltransferases that use the universal methyl donor S-adenosyl-l-methionine. Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolate (5-methylTHF), the methyl donor for synthesis of methionine from homocysteine and precursor of S-adenosyl-l-methionine. In the present study we sought to determine the effect of folate status on genomic DNA methylation with an emphasis on the interaction with the common C677T mutation in the MTHFR gene. A liquid chromatography/MS method for the analysis of nucleotide bases was used to assess genomic DNA methylation in peripheral blood mononuclear cell DNA from 105 subjects homozygous for this mutation (T/T) and 187 homozygous for the wild-type (C/C) MTHFR genotype. The results show that genomic DNA methylation directly correlates with folate status and inversely with plasma homocysteine (tHcy) levels (P < 0.01). T/T genotypes had a diminished level of DNA methylation compared with those with the C/C wild-type (32.23 vs.62.24 ng 5-methylcytosine/μg DNA, P < 0.0001). When analyzed according to folate status, however, only the T/T subjects with low levels of folate accounted for the diminished DNA methylation (P < 0.0001). Moreover, in T/T subjects DNA methylation status correlated with the methylated proportion of red blood cell folate and was inversely related to the formylated proportion of red blood cell folates (P < 0.03) that is known to be solely represented in those individuals. These results indicate that the MTHFR C677T polymorphism influences DNA methylation status through an interaction with folate status. PMID:11929966

  13. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  14. Genome-wide DNA methylation patterns in wild samples of two morphotypes of threespine stickleback (Gasterosteus aculeatus).

    Science.gov (United States)

    Smith, Gilbert; Smith, Carl; Kenny, John G; Chaudhuri, Roy R; Ritchie, Michael G

    2015-04-01

    Epigenetic marks such as DNA methylation play important biological roles in gene expression regulation and cellular differentiation during development. To examine whether DNA methylation patterns are potentially associated with naturally occurring phenotypic differences, we examined genome-wide DNA methylation within Gasterosteus aculeatus, using reduced representation bisulfite sequencing. First, we identified highly methylated regions of the stickleback genome, finding such regions to be located predominantly within genes, and associated with genes functioning in metabolism and biosynthetic processes, cell adhesion, signaling pathways, and blood vessel development. Next, we identified putative differentially methylated regions (DMRs) of the genome between complete and low lateral plate morphs of G. aculeatus. We detected 77 DMRs that were mainly located in intergenic regions. Annotations of genes associated with these DMRs revealed potential functions in a number of known divergent adaptive phenotypes between G. aculeatus ecotypes, including cardiovascular development, growth, and neuromuscular development. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. DMS-Seq for In Vivo Genome-wide Mapping of Protein-DNA Interactions and Nucleosome Centers.

    Science.gov (United States)

    Umeyama, Taichi; Ito, Takashi

    2017-10-03

    Protein-DNA interactions provide the basis for chromatin structure and gene regulation. Comprehensive identification of protein-occupied sites is thus vital to an in-depth understanding of genome function. Dimethyl sulfate (DMS) is a chemical probe that has long been used to detect footprints of DNA-bound proteins in vitro and in vivo. Here, we describe a genomic footprinting method, dimethyl sulfate sequencing (DMS-seq), which exploits the cell-permeable nature of DMS to obviate the need for nuclear isolation. This feature makes DMS-seq simple in practice and removes the potential risk of protein re-localization during nuclear isolation. DMS-seq successfully detects transcription factors bound to cis-regulatory elements and non-canonical chromatin particles in nucleosome-free regions. Furthermore, an unexpected preference of DMS confers on DMS-seq a unique potential to directly detect nucleosome centers without using genetic manipulation. We expect that DMS-seq will serve as a characteristic method for genome-wide interrogation of in vivo protein-DNA interactions. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  16. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    Energy Technology Data Exchange (ETDEWEB)

    Heilbronn, R.; zur Hausen, H. (Deutsches Krebsforschungszentrum, Heidelberg (West Germany))

    1989-09-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  17. The levels of yield and purity of genomic DNA from five tomato ...

    African Journals Online (AJOL)

    Isolation of good quality genomic DNA from different plant materials is an important prerequisite for many molecular techniques related to both basic and applied research in the areas of plant molecular biology, crop improvement, biodiversity studies and conservation of genetic materials. Therefore, the need to extract ...

  18. Modified protocol for genomic DNA extraction from newly plucked feathers of lophura leucomelana hamiltoni (Galliformes) for genetic studies and its endo-restriction analysis

    International Nuclear Information System (INIS)

    Andleeb, S.; Shamim, S.; Minhas, R.A.

    2012-01-01

    A rapid and accurate protocol was used first time to isolate the high-quality genomic DNA from newly plucked feathers of Lophura leucomelana. Two different lysis protocols were used depending on the feather size and it was observed that 55 deg. C for 3 to 4 days showed better results of feathers lysis as compared with the 37 deg. C for overnight with gentle shaking. Purification of genomic DNA was also performed with phenol: chloroform: isoamyl alcohol and 100% absolute ethanol precipitation methods. By using this protocol, a significant amount of high-quality genomic DNA was obtained and the purity of DNA was analyzed through endo-restriction analysis. Genomic DNA isolated with this modified method will be used for Southern blotting and also in several polymerase chain reaction systems devoted to sex determination and paternity testing and the evolutionary relationships among the other pheasants. (author)

  19. Genome-Wide Requirements for Resistance to Functionally Distinct DNA-Damaging Agents.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available The mechanistic and therapeutic differences in the cellular response to DNA-damaging compounds are not completely understood, despite intense study. To expand our knowledge of DNA damage, we assayed the effects of 12 closely related DNA-damaging agents on the complete pool of ~4,700 barcoded homozygous deletion strains of Saccharomyces cerevisiae. In our protocol, deletion strains are pooled together and grown competitively in the presence of compound. Relative strain sensitivity is determined by hybridization of PCR-amplified barcodes to an oligonucleotide array carrying the barcode complements. These screens identified genes in well-characterized DNA-damage-response pathways as well as genes whose role in the DNA-damage response had not been previously established. High-throughput individual growth analysis was used to independently confirm microarray results. Each compound produced a unique genome-wide profile. Analysis of these data allowed us to determine the relative importance of DNA-repair modules for resistance to each of the 12 profiled compounds. Clustering the data for 12 distinct compounds uncovered both known and novel functional interactions that comprise the DNA-damage response and allowed us to define the genetic determinants required for repair of interstrand cross-links. Further genetic analysis allowed determination of epistasis for one of these functional groups.

  20. Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

    Science.gov (United States)

    Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

    2016-12-01

    Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. The study of genomic DNA adsorption and subsequent interactions using total internal reflection ellipsometry.

    Science.gov (United States)

    Nabok, Alexei; Tsargorodskaya, Anna; Davis, Frank; Higson, Séamus P J

    2007-10-31

    The adsorption of genomic DNA and subsequent interactions between adsorbed and solvated DNA was studied using a novel sensitive optical method of total internal reflection ellipsometry (TIRE), which combines spectroscopic ellipsometry with surface plasmon resonance (SPR). Single strands of DNA of two species of fish (herring and salmon) were electrostatically adsorbed on top of polyethylenimine films deposited upon gold coated glass slides. The ellipsometric spectra were recorded and data fitting utilized to extract optical parameters (thickness and refractive index) of adsorbed DNA layers. The further adsorption of single stranded DNA from an identical source, i.e. herring ss-DNA on herring ss-DNA or salmon ss-DNA on salmon ss-DNA, on the surface was observed to give rise to substantial film thickness increases at the surface of about 20-21 nm. Conversely adsorption of DNA from alternate species, i.e. salmon ss-DNA on herring ss-DNA or herring ss-DNA on salmon ss-DNA, yielded much smaller changes in thickness of 3-5 nm. AFM studies of the surface roughness of adsorbed layers were in line with the TIRE data.

  2. High-Quality Exome Sequencing of Whole-Genome Amplified Neonatal Dried Blood Spot DNA

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave; Lescai, Francesco; Grove, Jakob

    2016-01-01

    Stored neonatal dried blood spot (DBS) samples from neonatal screening programmes are a valuable diagnostic and research resource. Combined with information from national health registries they can be used in population-based studies of genetic diseases. DNA extracted from neonatal DBSs can...... be amplified to obtain micrograms of an otherwise limited resource, referred to as whole-genome amplified DNA (wgaDNA). Here we investigate the robustness of exome sequencing of wgaDNA of neonatal DBS samples. We conducted three pilot studies of seven, eight and seven subjects, respectively. For each subject...... we analysed a neonatal DBS sample and corresponding adult whole-blood (WB) reference sample. Different DNA sample types were prepared for each of the subjects. Pilot 1: wgaDNA of 2x3.2mm neonatal DBSs (DBS_2x3.2) and raw DNA extract of the WB reference sample (WB_ref). Pilot 2: DBS_2x3.2, WB...

  3. Genome-wide Differences in DNA Methylation Changes in Two Contrasting Rice Genotypes in Response to Drought Conditions

    Directory of Open Access Journals (Sweden)

    Wensheng Wang

    2016-11-01

    Full Text Available Differences in drought stress tolerance within diverse rice genotypes have been attributed to genetic diversity and epigenetic alterations. DNA methylation is an important epigenetic modification that influences diverse biological processes, but its effects on rice drought stress tolerance are poorly understood. In this study, methylated DNA immunoprecipitation sequencing and an Affymetrix GeneChip rice genome array were used to profile the DNA methylation patterns and transcriptomes of the drought-tolerant introgression line DK151 and its drought-sensitive recurrent parent IR64 under drought and control conditions. The introgression of donor genomic DNA induced genome-wide DNA methylation changes in DK151 plants. A total of 1190 differentially methylated regions (DMRs were detected between the two genotypes under normal growth conditions, and the DMR-associated genes in DK151 plants were mainly related to stress response, programmed cell death, and nutrient reservoir activity, which are implicated to constitutive drought stress tolerance. A comparison of the DNA methylation changes in the two genotypes under drought conditions indicated that DK151 plants have a more stable methylome, with only 92 drought-induced DMRs, than IR64 plants with 506 DMRs. Gene ontology analyses of the DMR-associated genes in drought-stressed plants revealed that changes to the DNA methylation status of genotype-specific genes are associated with the epigenetic regulation of drought stress responses. Transcriptome analysis further helped to identify a set of 12 and 23 DMR-associated genes that were differentially expressed in DK151 and IR64, respectively, under drought stress compared with respective controls. Correlation analysis indicated that DNA methylation has various effects on gene expression, implying that it affects gene expression directly or indirectly through diverse regulatory pathways. Our results indicate that drought-induced alterations to DNA

  4. Comparison of strategies for the isolation of PCR-compatible, genomic DNA from a municipal biogas plants.

    Science.gov (United States)

    Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth

    2007-06-15

    The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.

  5. Chromatin dynamics in genome stability

    DEFF Research Database (Denmark)

    Nair, Nidhi; Shoaib, Muhammad; Sørensen, Claus Storgaard

    2017-01-01

    Genomic DNA is compacted into chromatin through packaging with histone and non-histone proteins. Importantly, DNA accessibility is dynamically regulated to ensure genome stability. This is exemplified in the response to DNA damage where chromatin relaxation near genomic lesions serves to promote...... access of relevant enzymes to specific DNA regions for signaling and repair. Furthermore, recent data highlight genome maintenance roles of chromatin through the regulation of endogenous DNA-templated processes including transcription and replication. Here, we review research that shows the importance...... of chromatin structure regulation in maintaining genome integrity by multiple mechanisms including facilitating DNA repair and directly suppressing endogenous DNA damage....

  6. Novel genomes and genome constitutions identified by GISH and 5S rDNA and knotted1 genomic sequences in the genus Setaria.

    Science.gov (United States)

    Zhao, Meicheng; Zhi, Hui; Doust, Andrew N; Li, Wei; Wang, Yongfang; Li, Haiquan; Jia, Guanqing; Wang, Yongqiang; Zhang, Ning; Diao, Xianmin

    2013-04-11

    The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC'C'. Qing 9 is a B genome species indigenous to China and is hypothesized to be a newly identified species. The

  7. Comparative cytogenetic characterization of primary canine melanocytic lesions using array CGH and fluorescence in situ hybridization.

    Science.gov (United States)

    Poorman, Kelsey; Borst, Luke; Moroff, Scott; Roy, Siddharth; Labelle, Philippe; Motsinger-Reif, Alison; Breen, Matthew

    2015-06-01

    Melanocytic lesions originating from the oral mucosa or cutaneous epithelium are common in the general dog population, with up to 100,000 diagnoses each year in the USA. Oral melanoma is the most frequent canine neoplasm of the oral cavity, exhibiting a highly aggressive course. Cutaneous melanocytomas occur frequently, but rarely develop into a malignant form. Despite the differential prognosis, it has been assumed that subtypes of melanocytic lesions represent the same disease. To address the relative paucity of information about their genomic status, molecular cytogenetic analysis was performed on the three recognized subtypes of canine melanocytic lesions. Using array comparative genomic hybridization (aCGH) analysis, highly aberrant distinct copy number status across the tumor genome for both of the malignant melanoma subtypes was revealed. The most frequent aberrations included gain of dog chromosome (CFA) 13 and 17 and loss of CFA 22. Melanocytomas possessed fewer genome wide aberrations, yet showed a recurrent gain of CFA 20q15.3-17. A distinctive copy number profile, evident only in oral melanomas, displayed a sigmoidal pattern of copy number loss followed immediately by a gain, around CFA 30q14. Moreover, when assessed by fluorescence in situ hybridization (FISH), copy number aberrations of targeted genes, such as gain of c-MYC (80 % of cases) and loss of CDKN2A (68 % of cases), were observed. This study suggests that in concordance with what is known for human melanomas, canine melanomas of the oral mucosa and cutaneous epithelium are discrete and initiated by different molecular pathways.

  8. Order and correlations in genomic DNA sequences. The spectral approach

    International Nuclear Information System (INIS)

    Lobzin, Vasilii V; Chechetkin, Vladimir R

    2000-01-01

    The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)

  9. Automated genomic DNA purification options in agricultural applications using MagneSil paramagnetic particles

    Science.gov (United States)

    Bitner, Rex M.; Koller, Susan C.

    2002-06-01

    The automated high throughput purification of genomic DNA form plant materials can be performed using MagneSil paramagnetic particles on the Beckman-Coulter FX, BioMek 2000, and the Tecan Genesis robot. Similar automated methods are available for DNA purifications from animal blood. These methods eliminate organic extractions, lengthy incubations and cumbersome filter plates. The DNA is suitable for applications such as PCR and RAPD analysis. Methods are described for processing traditionally difficult samples such as those containing large amounts of polyphenolics or oils, while still maintaining a high level of DNA purity. The robotic protocols have ben optimized for agricultural applications such as marker assisted breeding, seed-quality testing, and SNP discovery and scoring. In addition to high yield purification of DNA from plant samples or animal blood, the use of Promega's DNA-IQ purification system is also described. This method allows for the purification of a narrow range of DNA regardless of the amount of additional DNA that is present in the initial sample. This simultaneous Isolation and Quantification of DNA allows the DNA to be used directly in applications such as PCR, SNP analysis, and RAPD, without the need for separate quantitation of the DNA.

  10. Genomic Knockout of Endogenous Canine P-Glycoprotein in Wild-Type, Human P-Glycoprotein and Human BCRP Transfected MDCKII Cell Lines by Zinc Finger Nucleases.

    Science.gov (United States)

    Gartzke, Dominik; Delzer, Jürgen; Laplanche, Loic; Uchida, Yasuo; Hoshi, Yutaro; Tachikawa, Masanori; Terasaki, Tetsuya; Sydor, Jens; Fricker, Gert

    2015-06-01

    To investigate whether it is possible to specifically suppress the expression and function of endogenous canine P-glycoprotein (cPgp) in Madin-Darby canine kidney type II cells (MDCKII) transfected with hPGP and breast cancer resistance protein (hBCRP) by zinc finger nuclease (ZFN) producing sequence specific DNA double strand breaks. Wild-type, hPGP-transfected, and hBCRP-transfected MDCKII cells were transfected with ZFN targeting for cPgp. Net efflux ratios (NER) of Pgp and Bcrp substrates were determined by dividing efflux ratios (basal-to-apical / apical-to-basal) in over-expressing cell monolayers by those in wild-type ones. From ZFN-transfected cells, cell populations (ko-cells) showing knockout of cPgp were selected based on genotyping by PCR. qRT-PCR analysis showed the significant knock-downs of cPgp and interestingly also cMrp2 expressions. Specific knock-downs of protein expression for cPgp were shown by western blotting and quantitative targeted absolute proteomics. Endogenous canine Bcrp proteins were not detected. For PGP-transfected cells, NERs of 5 Pgp substrates in ko-cells were significantly greater than those in parental cells not transfected with ZFN. Similar result was obtained for BCRP-transfected cells with a dual Pgp and Bcrp substrate. Specific efflux mediated by hPGP or hBCRP can be determined with MDCKII cells where cPgp has been knocked out by ZFN.

  11. Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

    Science.gov (United States)

    Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

    2004-10-13

    Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

  12. USE OF COMPETITIVE DNA HYBRIDIZATION TO IDENTIFY DIFFERENCES IN THE GENOMES OF TWO CLOSELY RELATED FECAL INDICATOR BACTERIA

    Science.gov (United States)

    Although recent technological advances in DNA sequencing and computational biology now allow scientists to compare entire microbial genomes, comparisons of closely related bacterial species and individual isolates by whole-genome sequencing approaches remains prohibitively expens...

  13. Genome-wide DNA methylation profiling in cultured eutopic and ectopic endometrial stromal cells.

    Directory of Open Access Journals (Sweden)

    Yoshiaki Yamagata

    Full Text Available The objective of this study was to characterize the genome-wide DNA methylation profiles of isolated endometrial stromal cells obtained from eutopic endometria with (euESCa and without endometriosis (euESCb and ovarian endometrial cysts (choESC. Three samples were analyzed in each group. The infinium methylation array identified more hypermethylated and hypomethylated CpGs in choESC than in euESCa, and only a few genes were methylated differently in euESCa and euESCb. A functional analysis revealed that signal transduction, developmental processes, immunity, etc. were different in choESC and euESCa. A clustering analysis and a principal component analysis performed based on the methylation levels segregated choESC from euESC, while euESCa and euESCb were identical. A transcriptome analysis was then conducted and the results were compared with those of the DNA methylation analysis. Interestingly, the hierarchical clustering and principal component analyses showed that choESC were segregated from euESCa and euESCb in the DNA methylation analysis, while no segregation was recognized in the transcriptome analysis. The mRNA expression levels of the epigenetic modification enzymes, including DNA methyltransferases, obtained from the specimens were not significantly different between the groups. Some of the differentially methylated and/or expressed genes (NR5A1, STAR, STRA6 and HSD17B2, which are related with steroidogenesis, were validated by independent methods in a larger number of samples. Our findings indicate that different DNA methylation profiles exist in ectopic ESC, highlighting the benefits of genome wide DNA methylation analyses over transcriptome analyses in clarifying the development and characterization of endometriosis.

  14. The complete mitochondrial genome of the enigmatic bigheadedturtle (Platysternon): description of unusual genomic features and thereconciliation of phylogenetic hypotheses based on mitochondrial andnuclear DNA

    Energy Technology Data Exchange (ETDEWEB)

    Parham, James F.; Feldman, Chris R.; Boore, Jeffrey L.

    2005-12-28

    The big-headed turtle (Platysternon megacephalum) from east Asia is the sole living representative of a poorly-studied turtle lineage (Platysternidae). It has no close living relatives, and its phylogenetic position within turtles is one of the outstanding controversies in turtle systematics. Platysternon was traditionally considered to be close to snapping turtles (Chelydridae) based on some studies of its morphology and mitochondrial (mt) DNA, however, other studies of morphology and nuclear (nu) DNA do not support that hypothesis. We sequenced the complete mt genome of Platysternon and the nearly complete mt genomes of two other relevant turtles and compared them to turtle mt genomes from the literature to form the largest molecular dataset used to date to address this issue. The resulting phylogeny robustly rejects the placement of Platysternon with Chelydridae, but instead shows that it is a member of the Testudinoidea, a diverse, nearly globally-distributed group that includes pond turtles and tortoises. We also discovered that Platysternon mtDNA has large-scale gene rearrangements and possesses two, nearly identical, control regions, features that distinguish it from all other studied turtles. Our study robustly determines the phylogenetic placement of Platysternon and provides a well-resolved outline of major turtle lineages, while demonstrating the significantly greater resolving power of comparing large amounts of mt sequence over that of short fragments. Earlier phylogenies placing Platysternon with chelydrids required a temporal gap in the fossil record that is now unnecessary. The duplicated control regions and gene rearrangements of the Platysternon mt DNA probably resulted from the duplication of part of the genome and then the subsequent loss of redundant genes. Although it is possible that having two control regions may provide some advantage, explaining why the control regions would be maintained while some of the duplicated genes were eroded

  15. Identity of zinc finger nucleases with specificity to herpes simplex virus type II genomic DNA: novel HSV-2 vaccine/therapy precursors

    Directory of Open Access Journals (Sweden)

    Wayengera Misaki

    2011-06-01

    Full Text Available Abstract Background Herpes simplex type II (HSV-2 is a member of the family herpesviridae. Human infection with this double stranded linear DNA virus causes genital ulcerative disease and existing treatment options only serve to resolve the symptomatology (ulcers associated with active HSV-2 infection but do not eliminate latent virus. As a result, infection with HSV-2 follows a life-long relapsing (active versus latent course. On the basis of a primitive bacterium anti-phage DNA defense, the restriction modification (R-M system, we previously identified the Escherichia coli restriction enzyme (REase EcoRII as a novel peptide to excise or irreversibly disrupt latent HSV-2 DNA from infected cells. However, sequences of the site specificity palindrome of EcoRII 5'-CCWGG-3' (W = A or T are equally present within the human genome and are a potential source of host-genome toxicity. This feature has limited previous HSV-2 EcoRII based therapeutic models to microbicides only, and highlights the need to engineer artificial REases (zinc finger nucleases-ZFNs with specificity to HSV-2 genomic-DNA only. Herein, the therapeutic-potential of zinc finger arrays (ZFAs and ZFNs is identified and modeled, with unique specificity to the HSV-2 genome. Methods and results Using the whole genome of HSV-2 strain HG52 (Dolan A et al.,, and with the ZFN-consortium's CoDA-ZiFiT software pre-set at default, more than 28,000 ZFAs with specificity to HSV-2 DNA were identified. Using computational assembly (through in-silico linkage to the Flavobacterium okeanokoites endonuclease Fok I of the type IIS class, 684 ZFNs with specificity to the HSV-2 genome, were constructed. Graphic-analysis of the HSV-2 genome-cleavage pattern using the afore-identified ZFNs revealed that the highest cleavage-incidence occurred within the 30,950 base-pairs (~between the genomic context coordinates 0.80 and 1.00 at the 3' end of the HSV-2 genome. At approximately 3,095 bp before and after the

  16. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  17. Canine adiponectin: cDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity.

    Science.gov (United States)

    Ishioka, K; Omachi, A; Sagawa, M; Shibata, H; Honjoh, T; Kimura, K; Saito, M

    2006-04-01

    Adiponectin is a protein synthesized and secreted by adipocytes. Decreased adiponectin is responsible for insulin resistance and atherosclerosis associated with human obesity. We obtained a cDNA clone corresponding to canine adiponectin, whose nucleotide and deduced amino acid sequences were highly identical to those of other species. Adiponectin mRNA was detected in adipose tissues, but not in other tissues, of dogs. When 22 adult beagles were given a high-energy diet for 14 weeks, they became obese, showing heavier body weights, higher plasma leptin concentrations, but lower plasma adiponectin concentrations. The adiponectin concentrations of plasma samples collected from 71 dogs visiting veterinary practices were negatively correlated to plasma leptin concentrations, being lower in obese than non-obese dogs. These results are compatible with those reported in other species, and suggest that adiponectin is an index of adiposity and a target molecule for studies on diseases associated with obesity in dogs.

  18. Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.

    Science.gov (United States)

    Raghav, Sunil Kumar; Deplancke, Bart

    2012-01-01

    Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.

  19. Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

    Science.gov (United States)

    Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

    2012-01-01

    Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

  20. Distinct Mechanisms of Nuclease-Directed DNA-Structure-Induced Genetic Instability in Cancer Genomes.

    Science.gov (United States)

    Zhao, Junhua; Wang, Guliang; Del Mundo, Imee M; McKinney, Jennifer A; Lu, Xiuli; Bacolla, Albino; Boulware, Stephen B; Zhang, Changsheng; Zhang, Haihua; Ren, Pengyu; Freudenreich, Catherine H; Vasquez, Karen M

    2018-01-30

    Sequences with the capacity to adopt alternative DNA structures have been implicated in cancer etiology; however, the mechanisms are unclear. For example, H-DNA-forming sequences within oncogenes have been shown to stimulate genetic instability in mammals. Here, we report that H-DNA-forming sequences are enriched at translocation breakpoints in human cancer genomes, further implicating them in cancer etiology. H-DNA-induced mutations were suppressed in human cells deficient in the nucleotide excision repair nucleases, ERCC1-XPF and XPG, but were stimulated in cells deficient in FEN1, a replication-related endonuclease. Further, we found that these nucleases cleaved H-DNA conformations, and the interactions of modeled H-DNA with ERCC1-XPF, XPG, and FEN1 proteins were explored at the sub-molecular level. The results suggest mechanisms of genetic instability triggered by H-DNA through distinct structure-specific, cleavage-based replication-independent and replication-dependent pathways, providing critical evidence for a role of the DNA structure itself in the etiology of cancer and other human diseases. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Dragon polya spotter: Predictor of poly(A) motifs within human genomic DNA sequences

    KAUST Repository

    Kalkatawi, Manal M.

    2011-11-15

    Motivation: Recognition of poly(A) signals in mRNA is relatively straightforward due to the presence of easily recognizable polyadenylic acid tail. However, the task of identifying poly(A) motifs in the primary genomic DNA sequence that correspond to poly(A) signals in mRNA is a far more challenging problem. Recognition of poly(A) signals is important for better gene annotation and understanding of the gene regulation mechanisms. In this work, we present one such poly(A) motif prediction method based on properties of human genomic DNA sequence surrounding a poly(A) motif. These properties include thermodynamic, physico-chemical and statistical characteristics. For predictions, we developed Artificial Neural Network and Random Forest models. These models are trained to recognize 12 most common poly(A) motifs in human DNA. Our predictors are available as a free web-based tool accessible at http://cbrc.kaust.edu.sa/dps. Compared with other reported predictors, our models achieve higher sensitivity and specificity and furthermore provide a consistent level of accuracy for 12 poly(A) motif variants. The Author(s) 2011. Published by Oxford University Press. All rights reserved.

  2. TRAIP promotes DNA damage response during genome replication and is mutated in primordial dwarfism.

    Science.gov (United States)

    Harley, Margaret E; Murina, Olga; Leitch, Andrea; Higgs, Martin R; Bicknell, Louise S; Yigit, Gökhan; Blackford, Andrew N; Zlatanou, Anastasia; Mackenzie, Karen J; Reddy, Kaalak; Halachev, Mihail; McGlasson, Sarah; Reijns, Martin A M; Fluteau, Adeline; Martin, Carol-Anne; Sabbioneda, Simone; Elcioglu, Nursel H; Altmüller, Janine; Thiele, Holger; Greenhalgh, Lynn; Chessa, Luciana; Maghnie, Mohamad; Salim, Mahmoud; Bober, Michael B; Nürnberg, Peter; Jackson, Stephen P; Hurles, Matthew E; Wollnik, Bernd; Stewart, Grant S; Jackson, Andrew P

    2016-01-01

    DNA lesions encountered by replicative polymerases threaten genome stability and cell cycle progression. Here we report the identification of mutations in TRAIP, encoding an E3 RING ubiquitin ligase, in patients with microcephalic primordial dwarfism. We establish that TRAIP relocalizes to sites of DNA damage, where it is required for optimal phosphorylation of H2AX and RPA2 during S-phase in response to ultraviolet (UV) irradiation, as well as fork progression through UV-induced DNA lesions. TRAIP is necessary for efficient cell cycle progression and mutations in TRAIP therefore limit cellular proliferation, providing a potential mechanism for microcephaly and dwarfism phenotypes. Human genetics thus identifies TRAIP as a component of the DNA damage response to replication-blocking DNA lesions.

  3. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  4. Universal Internucleotide Statistics in Full Genomes: A Footprint of the DNA Structure and Packaging?

    OpenAIRE

    Bogachev, Mikhail I.; Kayumov, Airat R.; Bunde, Armin

    2014-01-01

    Uncovering the fundamental laws that govern the complex DNA structural organization remains challenging and is largely based upon reconstructions from the primary nucleotide sequences. Here we investigate the distributions of the internucleotide intervals and their persistence properties in complete genomes of various organisms from Archaea and Bacteria to H. Sapiens aiming to reveal the manifestation of the universal DNA architecture. We find that in all considered organisms the internucleot...

  5. Identification of the ``a'' Genome of Finger Millet Using Chloroplast DNA

    Science.gov (United States)

    Hilu, K. W.

    1988-01-01

    Finger millet (Eleusine corocana subsp. coracana), an important cereal in East Africa and India, is a tetraploid species with unknown genomic components. A recent cytogenetic study confirmed the direct origin of this millet from the tetraploid E. coracana subsp. africana but questioned Eleusine indica as a genomic donor. Chloroplast (ct) DNA sequence analysis using restriction fragment pattern was used to examine the phylogenetic relationships between E. coracana subsp. coracana (domesticated finger millet), E. coracana subspecies africana (wild finger millet), and E. indica. Eleusine tristachya was included since it is the only other annual diploid species in the genus with a basic chromosome number of x = 9 like finger millet. Eight of the ten restriction endonucleases used had 16 to over 30 restriction sites per genome and were informative. E. coracana subsp. coracana and subsp. africana and E. indica were identical in all the restriction sites surveyed, while the ct genome of E. tristachya differed consistently by at least one mutational event for each restriction enzyme surveyed. This random survey of the ct genomes of these species points out E. indica as one of the genome donors (maternal genome donor) of domesticated finger millet contrary to a previous cytogenetic study. The data also substantiate E. coracana subsp. africana as the progenitor of domesticated finger millet. The disparity between the cytogenetic and the molecular approaches is discussed in light of the problems associated with chromosome pairing and polyploidy. PMID:8608927

  6. Identification of the "A" genome of finger millet using chloroplast DNA.

    Science.gov (United States)

    Hilu, K W

    1988-01-01

    Finger millet (Eleusine corocana subsp. coracana), an important cereal in East Africa and India, is a tetraploid species with unknown genomic components. A recent cytogenetic study confirmed the direct origin of this millet from the tetraploid E. coracana subsp. africana but questioned Eleusine indica as a genomic donor. Chloroplast (ct) DNA sequence analysis using restriction fragment pattern was used to examine the phylogenetic relationships between E. coracana subsp. coracana (domesticated finger millet), E. coracana subspecies africana (wild finger millet), and E. indica. Eleusine tristachya was included since it is the only other annual diploid species in the genus with a basic chromosome number of x = 9 like finger millet. Eight of the ten restriction endonucleases used had 16 to over 30 restriction sites per genome and were informative. E. coracana subsp. coracana and subsp. africana and E. indica were identical in all the restriction sites surveyed, while the ct genome of E, tristachya differed consistently by at least one mutational event for each restriction enzyme surveyed. This random survey of the ct genomes of these species points out E. indica as one of the genome donors (maternal genome donor) of domesticated finger millet contrary to a previous cytogenetic study. The data also substantiate E. coracana subsp. africana as the progenitor of domesticated finger millet. The disparity between the cytogenetic and the molecular approaches is discussed in light of the problems associated with chromosome pairing and polyploidy.

  7. ATM Deficiency Generating Genomic Instability Sensitizes Pancreatic Ductal Adenocarcinoma Cells to Therapy-Induced DNA Damage.

    Science.gov (United States)

    Perkhofer, Lukas; Schmitt, Anna; Romero Carrasco, Maria Carolina; Ihle, Michaela; Hampp, Stephanie; Ruess, Dietrich Alexander; Hessmann, Elisabeth; Russell, Ronan; Lechel, André; Azoitei, Ninel; Lin, Qiong; Liebau, Stefan; Hohwieler, Meike; Bohnenberger, Hanibal; Lesina, Marina; Algül, Hana; Gieldon, Laura; Schröck, Evelin; Gaedcke, Jochen; Wagner, Martin; Wiesmüller, Lisa; Sipos, Bence; Seufferlein, Thomas; Reinhardt, Hans Christian; Frappart, Pierre-Olivier; Kleger, Alexander

    2017-10-15

    Pancreatic ductal adenocarcinomas (PDAC) harbor recurrent functional mutations of the master DNA damage response kinase ATM, which has been shown to accelerate tumorigenesis and epithelial-mesenchymal transition. To study how ATM deficiency affects genome integrity in this setting, we evaluated the molecular and functional effects of conditional Atm deletion in a mouse model of PDAC. ATM deficiency was associated with increased mitotic defects, recurrent genomic rearrangements, and deregulated DNA integrity checkpoints, reminiscent of human PDAC. We hypothesized that altered genome integrity might allow synthetic lethality-based options for targeted therapeutic intervention. Supporting this possibility, we found that the PARP inhibitor olaparib or ATR inhibitors reduced the viability of PDAC cells in vitro and in vivo associated with a genotype-selective increase in apoptosis. Overall, our results offered a preclinical mechanistic rationale for the use of PARP and ATR inhibitors to improve treatment of ATM-mutant PDAC. Cancer Res; 77(20); 5576-90. ©2017 AACR . ©2017 American Association for Cancer Research.

  8. Ku-mediated coupling of DNA cleavage and repair during programmed genome rearrangements in the ciliate Paramecium tetraurelia.

    Directory of Open Access Journals (Sweden)

    Antoine Marmignon

    2014-08-01

    Full Text Available During somatic differentiation, physiological DNA double-strand breaks (DSB can drive programmed genome rearrangements (PGR, during which DSB repair pathways are mobilized to safeguard genome integrity. Because of their unique nuclear dimorphism, ciliates are powerful unicellular eukaryotic models to study the mechanisms involved in PGR. At each sexual cycle, the germline nucleus is transmitted to the progeny, but the somatic nucleus, essential for gene expression, is destroyed and a new somatic nucleus differentiates from a copy of the germline nucleus. In Paramecium tetraurelia, the development of the somatic nucleus involves massive PGR, including the precise elimination of at least 45,000 germline sequences (Internal Eliminated Sequences, IES. IES excision proceeds through a cut-and-close mechanism: a domesticated transposase, PiggyMac, is essential for DNA cleavage, and DSB repair at excision sites involves the Ligase IV, a specific component of the non-homologous end-joining (NHEJ pathway. At the genome-wide level, a huge number of programmed DSBs must be repaired during this process to allow the assembly of functional somatic chromosomes. To understand how DNA cleavage and DSB repair are coordinated during PGR, we have focused on Ku, the earliest actor of NHEJ-mediated repair. Two Ku70 and three Ku80 paralogs are encoded in the genome of P. tetraurelia: Ku70a and Ku80c are produced during sexual processes and localize specifically in the developing new somatic nucleus. Using RNA interference, we show that the development-specific Ku70/Ku80c heterodimer is essential for the recovery of a functional somatic nucleus. Strikingly, at the molecular level, PiggyMac-dependent DNA cleavage is abolished at IES boundaries in cells depleted for Ku80c, resulting in IES retention in the somatic genome. PiggyMac and Ku70a/Ku80c co-purify as a complex when overproduced in a heterologous system. We conclude that Ku has been integrated in the Paramecium

  9. New sequence-based data on the relative DNA contents of chromosomes in the normal male and female human diploid genomes for radiation molecular cytogenetics

    Directory of Open Access Journals (Sweden)

    Repin Mikhail V

    2009-06-01

    Full Text Available Abstract Background The objective of this work is to obtain the correct relative DNA contents of chromosomes in the normal male and female human diploid genomes for the use at FISH analysis of radiation-induced chromosome aberrations. Results The relative DNA contents of chromosomes in the male and female human diploid genomes have been calculated from the publicly available international Human Genome Project data. New sequence-based data on the relative DNA contents of human chromosomes were compared with the data recommended by the International Atomic Energy Agency in 2001. The differences in the values of the relative DNA contents of chromosomes obtained by using different approaches for 15 human chromosomes, mainly for large chromosomes, were below 2%. For the chromosomes 13, 17, 20 and 22 the differences were above 5%. Conclusion New sequence-based data on the relative DNA contents of chromosomes in the normal male and female human diploid genomes were obtained. This approach, based on the genome sequence, can be recommended for the use in radiation molecular cytogenetics.

  10. Novel Single-Stranded DNA Virus Genomes Recovered from Chimpanzee Feces Sampled from the Mambilla Plateau in Nigeria

    Science.gov (United States)

    Walters, Matthew; Bawuro, Musa; Christopher, Alfred; Knight, Alexander; Kraberger, Simona; Stainton, Daisy; Chapman, Hazel

    2017-01-01

    ABSTRACT Metagenomic approaches are rapidly expanding our knowledge of the diversity of viruses. In the fecal matter of Nigerian chimpanzees we recovered three gokushovirus genomes, one circular replication-associated protein encoding single-stranded DNA virus (CRESS), and a CRESS DNA molecule. PMID:28254982

  11. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Science.gov (United States)

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  12. Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.

    Science.gov (United States)

    Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L

    2016-02-19

    Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.

  13. DNA damage checkpoint kinase ATM regulates germination and maintains genome stability in seeds.

    Science.gov (United States)

    Waterworth, Wanda M; Footitt, Steven; Bray, Clifford M; Finch-Savage, William E; West, Christopher E

    2016-08-23

    Genome integrity is crucial for cellular survival and the faithful transmission of genetic information. The eukaryotic cellular response to DNA damage is orchestrated by the DNA damage checkpoint kinases ATAXIA TELANGIECTASIA MUTATED (ATM) and ATM AND RAD3-RELATED (ATR). Here we identify important physiological roles for these sensor kinases in control of seed germination. We demonstrate that double-strand breaks (DSBs) are rate-limiting for germination. We identify that desiccation tolerant seeds exhibit a striking transcriptional DSB damage response during germination, indicative of high levels of genotoxic stress, which is induced following maturation drying and quiescence. Mutant atr and atm seeds are highly resistant to aging, establishing ATM and ATR as determinants of seed viability. In response to aging, ATM delays germination, whereas atm mutant seeds germinate with extensive chromosomal abnormalities. This identifies ATM as a major factor that controls germination in aged seeds, integrating progression through germination with surveillance of genome integrity. Mechanistically, ATM functions through control of DNA replication in imbibing seeds. ATM signaling is mediated by transcriptional control of the cell cycle inhibitor SIAMESE-RELATED 5, an essential factor required for the aging-induced delay to germination. In the soil seed bank, seeds exhibit increased transcript levels of ATM and ATR, with changes in dormancy and germination potential modulated by environmental signals, including temperature and soil moisture. Collectively, our findings reveal physiological functions for these sensor kinases in linking genome integrity to germination, thereby influencing seed quality, crucial for plant survival in the natural environment and sustainable crop production.

  14. Genomic mapping of single-stranded DNA in hydroxyurea-challenged yeasts identifies origins of replication.

    Science.gov (United States)

    Feng, Wenyi; Collingwood, David; Boeck, Max E; Fox, Lindsay A; Alvino, Gina M; Fangman, Walton L; Raghuraman, Mosur K; Brewer, Bonita J

    2006-02-01

    During DNA replication one or both strands transiently become single stranded: first at the sites where initiation of DNA synthesis occurs (known as origins of replication) and subsequently on the lagging strands of replication forks as discontinuous Okazaki fragments are generated. We report a genome-wide analysis of single-stranded DNA (ssDNA) formation in the presence of hydroxyurea during DNA replication in wild-type and checkpoint-deficient rad53 Saccharomyces cerevisiae cells. In wild-type cells, ssDNA was first observed at a subset of replication origins and later 'migrated' bi-directionally, suggesting that ssDNA formation is associated with continuously moving replication forks. In rad53 cells, ssDNA was observed at virtually every known origin, but remained there over time, suggesting that replication forks stall. Telomeric regions seemed to be particularly sensitive to the loss of Rad53 checkpoint function. Replication origins in Schizosaccharomyces pombe were also mapped using our method.

  15. Global DNA methylation synergistically regulates the nuclear and mitochondrial genomes in glioblastoma cells.

    Science.gov (United States)

    Sun, Xin; Johnson, Jacqueline; St John, Justin C

    2018-05-02

    Replication of mitochondrial DNA is strictly regulated during differentiation and development allowing each cell type to acquire its required mtDNA copy number to meet its specific needs for energy. Undifferentiated cells establish the mtDNA set point, which provides low numbers of mtDNA copy but sufficient template for replication once cells commit to specific lineages. However, cancer cells, such as those from the human glioblastoma multiforme cell line, HSR-GBM1, cannot complete differentiation as they fail to enforce the mtDNA set point and are trapped in a 'pseudo-differentiated' state. Global DNA methylation is likely to be a major contributing factor, as DNA demethylation treatments promote differentiation of HSR-GBM1 cells. To determine the relationship between DNA methylation and mtDNA copy number in cancer cells, we applied whole genome MeDIP-Seq and RNA-Seq to HSR-GBM1 cells and following their treatment with the DNA demethylation agents 5-azacytidine and vitamin C. We identified key methylated regions modulated by the DNA demethylation agents that also induced synchronous changes to mtDNA copy number and nuclear gene expression. Our findings highlight the control exerted by DNA methylation on the expression of key genes, the regulation of mtDNA copy number and establishment of the mtDNA set point, which collectively contribute to tumorigenesis.

  16. DNA Replication in Engineered Escherichia coli Genomes with Extra Replication Origins.

    Science.gov (United States)

    Milbredt, Sarah; Farmani, Neda; Sobetzko, Patrick; Waldminghaus, Torsten

    2016-10-21

    The standard outline of bacterial genomes is a single circular chromosome with a single replication origin. From the bioengineering perspective, it appears attractive to extend this basic setup. Bacteria with split chromosomes or multiple replication origins have been successfully constructed in the last few years. The characteristics of these engineered strains will largely depend on the respective DNA replication patterns. However, the DNA replication has not been investigated systematically in engineered bacteria with multiple origins or split replicons. Here we fill this gap by studying a set of strains consisting of (i) E. coli strains with an extra copy of the native replication origin (oriC), (ii) E. coli strains with an extra copy of the replication origin from the secondary chromosome of Vibrio cholerae (oriII), and (iii) a strain in which the E. coli chromosome is split into two linear replicons. A combination of flow cytometry, microarray-based comparative genomic hybridization (CGH), and modeling revealed silencing of extra oriC copies and differential timing of ectopic oriII copies compared to the native oriC. The results were used to derive construction rules for future multiorigin and multireplicon projects.

  17. Horizontal transfer of DNA from the mitochondrial to the plastid genome and its subsequent evolution in milkweeds (Apocynaceae)

    Science.gov (United States)

    Shannon C.K. Straub; Richard C. Cronn; Christopher Edwards; Mark Fishbein; Aaron. Liston

    2013-01-01

    Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae...

  18. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

    Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  19. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

    2011-01-01

    INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  20. A Domain of Herpes Simplex Virus pUL33 Required To Release Monomeric Viral Genomes from Cleaved Concatemeric DNA.

    Science.gov (United States)

    Yang, Kui; Dang, Xiaoqun; Baines, Joel D

    2017-10-15

    Monomeric herpesvirus DNA is cleaved from concatemers and inserted into preformed capsids through the actions of the viral terminase. The terminase of herpes simplex virus (HSV) is composed of three subunits encoded by U L 15, U L 28, and U L 33. The U L 33-encoded protein (pU L 33) interacts with pU L 28, but its precise role in the DNA cleavage and packaging reaction is unclear. To investigate the function of pU L 33, we generated a panel of recombinant viruses with either deletions or substitutions in the most conserved regions of U L 33 using a bacterial artificial chromosome system. Deletion of 11 amino acids (residues 50 to 60 or residues 110 to 120) precluded viral replication, whereas the truncation of the last 10 amino acids from the pU L 33 C terminus did not affect viral replication or the interaction of pU L 33 with pU L 28. Mutations that replaced the lysine at codon 110 and the arginine at codon 111 with alanine codons failed to replicate, and the pU L 33 mutant interacted with pU L 28 less efficiently. Interestingly, genomic termini of the large (L) and small (S) components were detected readily in cells infected with these mutants, indicating that concatemeric DNA was cleaved efficiently. However, the release of monomeric genomes as assessed by pulsed-field gel electrophoresis was greatly diminished, and DNA-containing capsids were not observed. These results suggest that pU L 33 is necessary for one of the two viral DNA cleavage events required to release individual genomes from concatemeric viral DNA. IMPORTANCE This paper shows a role for pU L 33 in one of the two DNA cleavage events required to release monomeric genomes from concatemeric viral DNA. This is the first time that such a phenotype has been observed and is the first identification of a function of this protein relevant to DNA packaging other than its interaction with other terminase components. Copyright © 2017 Yang et al.

  1. Development of a Method to Implement Whole-Genome Bisulfite Sequencing of cfDNA from Cancer Patients and a Mouse Tumor Model

    Directory of Open Access Journals (Sweden)

    Elaine C. Maggi

    2018-01-01

    Full Text Available The goal of this study was to develop a method for whole genome cell-free DNA (cfDNA methylation analysis in humans and mice with the ultimate goal to facilitate the identification of tumor derived DNA methylation changes in the blood. Plasma or serum from patients with pancreatic neuroendocrine tumors or lung cancer, and plasma from a murine model of pancreatic adenocarcinoma was used to develop a protocol for cfDNA isolation, library preparation and whole-genome bisulfite sequencing of ultra low quantities of cfDNA, including tumor-specific DNA. The protocol developed produced high quality libraries consistently generating a conversion rate >98% that will be applicable for the analysis of human and mouse plasma or serum to detect tumor-derived changes in DNA methylation.

  2. Mutations in Cytosine-5 tRNA Methyltransferases Impact Mobile Element Expression and Genome Stability at Specific DNA Repeats

    Directory of Open Access Journals (Sweden)

    Bianca Genenncher

    2018-02-01

    Full Text Available The maintenance of eukaryotic genome stability is ensured by the interplay of transcriptional as well as post-transcriptional mechanisms that control recombination of repeat regions and the expression and mobility of transposable elements. We report here that mutations in two (cytosine-5 RNA methyltransferases, Dnmt2 and NSun2, impact the accumulation of mobile element-derived sequences and DNA repeat integrity in Drosophila. Loss of Dnmt2 function caused moderate effects under standard conditions, while heat shock exacerbated these effects. In contrast, NSun2 function affected mobile element expression and genome integrity in a heat shock-independent fashion. Reduced tRNA stability in both RCMT mutants indicated that tRNA-dependent processes affected mobile element expression and DNA repeat stability. Importantly, further experiments indicated that complex formation with RNA could also contribute to the impact of RCMT function on gene expression control. These results thus uncover a link between tRNA modification enzymes, the expression of repeat DNA, and genomic integrity.

  3. Acinetobacter phage genome is similar to Sphinx 2.36, the circular DNA copurified with TSE infected particles.

    Science.gov (United States)

    Longkumer, Toshisangba; Kamireddy, Swetha; Muthyala, Venkateswar Reddy; Akbarpasha, Shaikh; Pitchika, Gopi Krishna; Kodetham, Gopinath; Ayaluru, Murali; Siddavattam, Dayananda

    2013-01-01

    While analyzing plasmids of Acinetobacter sp. DS002 we have detected a circular DNA molecule pTS236, which upon further investigation is identified as the genome of a phage. The phage genome has shown sequence similarity to the recently discovered Sphinx 2.36 DNA sequence co-purified with the Transmissible Spongiform Encephalopathy (TSE) particles isolated from infected brain samples collected from diverse geographical regions. As in Sphinx 2.36, the phage genome also codes for three proteins. One of them codes for RepA and is shown to be involved in replication of pTS236 through rolling circle (RC) mode. The other two translationally coupled ORFs, orf106 and orf96, code for coat proteins of the phage. Although an orf96 homologue was not previously reported in Sphinx 2.36, a closer examination of DNA sequence of Sphinx 2.36 revealed its presence downstream of orf106 homologue. TEM images and infection assays revealed existence of phage AbDs1 in Acinetobacter sp. DS002.

  4. DNA to DNA transcription might exist in eukaryotic cells

    OpenAIRE

    Li, Gao-De

    2016-01-01

    Till now, in biological sciences, the term, transcription, mainly refers to DNA to RNA transcription. But our recently published experimental findings obtained from Plasmodium falciparum strongly suggest the existence of DNA to DNA transcription in the genome of eukaryotic cells, which could shed some light on the functions of certain noncoding DNA in the human and other eukaryotic genomes.

  5. [Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

    Science.gov (United States)

    Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin

    2011-01-01

    To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P vaccine in mice.

  6. Genome-wide DNA methylation maps in follicular lymphoma cells determined by methylation-enriched bisulfite sequencing.

    Directory of Open Access Journals (Sweden)

    Jeong-Hyeon Choi

    Full Text Available BACKGROUND: Follicular lymphoma (FL is a form of non-Hodgkin's lymphoma (NHL that arises from germinal center (GC B-cells. Despite the significant advances in immunotherapy, FL is still not curable. Beyond transcriptional profiling and genomics datasets, there currently is no epigenome-scale dataset or integrative biology approach that can adequately model this disease and therefore identify novel mechanisms and targets for successful prevention and treatment of FL. METHODOLOGY/PRINCIPAL FINDINGS: We performed methylation-enriched genome-wide bisulfite sequencing of FL cells and normal CD19(+ B-cells using 454 sequencing technology. The methylated DNA fragments were enriched with methyl-binding proteins, treated with bisulfite, and sequenced using the Roche-454 GS FLX sequencer. The total number of bases covered in the human genome was 18.2 and 49.3 million including 726,003 and 1.3 million CpGs in FL and CD19(+ B-cells, respectively. 11,971 and 7,882 methylated regions of interest (MRIs were identified respectively. The genome-wide distribution of these MRIs displayed significant differences between FL and normal B-cells. A reverse trend in the distribution of MRIs between the promoter and the gene body was observed in FL and CD19(+ B-cells. The MRIs identified in FL cells also correlated well with transcriptomic data and ChIP-on-Chip analyses of genome-wide histone modifications such as tri-methyl-H3K27, and tri-methyl-H3K4, indicating a concerted epigenetic alteration in FL cells. CONCLUSIONS/SIGNIFICANCE: This study is the first to provide a large scale and comprehensive analysis of the DNA methylation sequence composition and distribution in the FL epigenome. These integrated approaches have led to the discovery of novel and frequent targets of aberrant epigenetic alterations. The genome-wide bisulfite sequencing approach developed here can be a useful tool for profiling DNA methylation in clinical samples.

  7. Effects of As2O3 on DNA methylation, genomic instability, and LTR retrotransposon polymorphism in Zea mays.

    Science.gov (United States)

    Erturk, Filiz Aygun; Aydin, Murat; Sigmaz, Burcu; Taspinar, M Sinan; Arslan, Esra; Agar, Guleray; Yagci, Semra

    2015-12-01

    Arsenic is a well-known toxic substance on the living organisms. However, limited efforts have been made to study its DNA methylation, genomic instability, and long terminal repeat (LTR) retrotransposon polymorphism causing properties in different crops. In the present study, effects of As2O3 (arsenic trioxide) on LTR retrotransposon polymorphism and DNA methylation as well as DNA damage in Zea mays seedlings were investigated. The results showed that all of arsenic doses caused a decreasing genomic template stability (GTS) and an increasing Random Amplified Polymorphic DNAs (RAPDs) profile changes (DNA damage). In addition, increasing DNA methylation and LTR retrotransposon polymorphism characterized a model to explain the epigenetically changes in the gene expression were also found. The results of this experiment have clearly shown that arsenic has epigenetic effect as well as its genotoxic effect. Especially, the increasing of polymorphism of some LTR retrotransposon under arsenic stress may be a part of the defense system against the stress.

  8. Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

    Energy Technology Data Exchange (ETDEWEB)

    McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

    2005-08-26

    Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

  9. Characterization of STAT3 activation and expression in canine and human osteosarcoma

    Directory of Open Access Journals (Sweden)

    Li Pui-Kai

    2009-03-01

    Full Text Available Abstract Background Dysregulation of signal transducer and activator of transcription 3 (STAT3 has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. Methods To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656 or STAT3 (LLL3 inhibitors and cell proliferation (CyQUANT, caspase 3/7 activity (ELISA, apoptosis (Western blotting for PARP cleavage and/or viability (Wst-1 were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Results Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known

  10. Characterization of STAT3 activation and expression in canine and human osteosarcoma

    International Nuclear Information System (INIS)

    Fossey, Stacey L; Liao, Albert T; McCleese, Jennifer K; Bear, Misty D; Lin, Jiayuh; Li, Pui-Kai; Kisseberth, William C; London, Cheryl A

    2009-01-01

    Dysregulation of signal transducer and activator of transcription 3 (STAT3) has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA) tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656) or STAT3 (LLL3) inhibitors and cell proliferation (CyQUANT), caspase 3/7 activity (ELISA), apoptosis (Western blotting for PARP cleavage) and/or viability (Wst-1) were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known transcriptional targets of STAT3. These data

  11. Role of transposon-derived small RNAs in the interplay between genomes and parasitic DNA in rice.

    Directory of Open Access Journals (Sweden)

    Misuzu Nosaka

    2012-09-01

    Full Text Available RNA silencing is a defense system against "genomic parasites" such as transposable elements (TE, which are potentially harmful to host genomes. In plants, transcripts from TEs induce production of double-stranded RNAs (dsRNAs and are processed into small RNAs (small interfering RNAs, siRNAs that suppress TEs by RNA-directed DNA methylation. Thus, the majority of TEs are epigenetically silenced. On the other hand, most of the eukaryotic genome is composed of TEs and their remnants, suggesting that TEs have evolved countermeasures against host-mediated silencing. Under some circumstances, TEs can become active and increase in copy number. Knowledge is accumulating on the mechanisms of TE silencing by the host; however, the mechanisms by which TEs counteract silencing are poorly understood. Here, we show that a class of TEs in rice produces a microRNA (miRNA to suppress host silencing. Members of the microRNA820 (miR820 gene family are located within CACTA DNA transposons in rice and target a de novo DNA methyltransferase gene, OsDRM2, one of the components of epigenetic silencing. We confirmed that miR820 negatively regulates the expression of OsDRM2. In addition, we found that expression levels of various TEs are increased quite sensitively in response to decreased OsDRM2 expression and DNA methylation at TE loci. Furthermore, we found that the nucleotide sequence of miR820 and its recognition site within the target gene in some Oryza species have co-evolved to maintain their base-pairing ability. The co-evolution of these sequences provides evidence for the functionality of this regulation. Our results demonstrate how parasitic elements in the genome escape the host's defense machinery. Furthermore, our analysis of the regulation of OsDRM2 by miR820 sheds light on the action of transposon-derived small RNAs, not only as a defense mechanism for host genomes but also as a regulator of interactions between hosts and their parasitic elements.

  12. Interspecies hybridization on DNA resequencing microarrays: efficiency of sequence recovery and accuracy of SNP detection in human, ape, and codfish mitochondrial DNA genomes sequenced on a human-specific MitoChip

    Directory of Open Access Journals (Sweden)

    Carr Steven M

    2007-09-01

    Full Text Available Abstract Background Iterative DNA "resequencing" on oligonucleotide microarrays offers a high-throughput method to measure intraspecific biodiversity, one that is especially suited to SNP-dense gene regions such as vertebrate mitochondrial (mtDNA genomes. However, costs of single-species design and microarray fabrication are prohibitive. A cost-effective, multi-species strategy is to hybridize experimental DNAs from diverse species to a common microarray that is tiled with oligonucleotide sets from multiple, homologous reference genomes. Such a strategy requires that cross-hybridization between the experimental DNAs and reference oligos from the different species not interfere with the accurate recovery of species-specific data. To determine the pattern and limits of such interspecific hybridization, we compared the efficiency of sequence recovery and accuracy of SNP identification by a 15,452-base human-specific microarray challenged with human, chimpanzee, gorilla, and codfish mtDNA genomes. Results In the human genome, 99.67% of the sequence was recovered with 100.0% accuracy. Accuracy of SNP identification declines log-linearly with sequence divergence from the reference, from 0.067 to 0.247 errors per SNP in the chimpanzee and gorilla genomes, respectively. Efficiency of sequence recovery declines with the increase of the number of interspecific SNPs in the 25b interval tiled by the reference oligonucleotides. In the gorilla genome, which differs from the human reference by 10%, and in which 46% of these 25b regions contain 3 or more SNP differences from the reference, only 88% of the sequence is recoverable. In the codfish genome, which differs from the reference by > 30%, less than 4% of the sequence is recoverable, in short islands ≥ 12b that are conserved between primates and fish. Conclusion Experimental DNAs bind inefficiently to homologous reference oligonucleotide sets on a re-sequencing microarray when their sequences differ by

  13. Surface-enhanced Raman spectroscopy of genomic DNA from in vitro grown tomato (Lycopersicon esculentum Mill.) cultivars before and after plant cryopreservation.

    Science.gov (United States)

    Muntean, Cristina M; Leopold, Nicolae; Tripon, Carmen; Coste, Ana; Halmagyi, Adela

    2015-06-05

    In this work the surface-enhanced Raman scattering (SERS) spectra of five genomic DNAs from non-cryopreserved control tomato plants (Lycopersicon esculentum Mill. cultivars Siriana, Darsirius, Kristin, Pontica and Capriciu) respectively, have been analyzed in the wavenumber range 400-1800 cm(-1). Structural changes induced in genomic DNAs upon cryopreservation were discussed in detail for four of the above mentioned tomato cultivars. The surface-enhanced Raman vibrational modes for each of these cases, spectroscopic band assignments and structural interpretations of genomic DNAs are reported. We have found, that DNA isolated from Siriana cultivar leaf tissues suffers the weakest structural changes upon cryogenic storage of tomato shoot apices. On the contrary, genomic DNA extracted from Pontica cultivar is the most responsive system to cryopreservation process. Particularly, both C2'-endo-anti and C3'-endo-anti conformations have been detected. As a general observation, the wavenumber range 1511-1652 cm(-1), being due to dA, dG and dT residues seems to be influenced by cryopreservation process. These changes could reflect unstacking of DNA bases. However, not significant structural changes of genomic DNAs from Siriana, Darsirius and Kristin have been found upon cryopreservation process of tomato cultivars. Based on this work, specific plant DNA-ligand interactions or accurate local structure of DNA in the proximity of a metallic surface, might be further investigated using surface-enhanced Raman spectroscopy. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Survey of canine tick-borne diseases in Lábrea, Brazilian Amazon: ‘accidental’ findings of Dirofilaria immitis infection

    Directory of Open Access Journals (Sweden)

    Herbert Sousa Soares

    2014-12-01

    Full Text Available Blood samples were collected from 99 domestic dogs from the urban and rural areas of the Lábrea municipality, state of Amazonas, Brazil. Canine serum samples were tested by immunofluorescence assay against Rickettsia spp., which revealed that only 3.0% (1/33 and 7.6% (5/66 of the dogs from urban and rural areas, respectively, reacted positively to at least one Rickettsia species. DNA was extracted from canine blood and tested by a battery of PCR assays targeting protozoa of the genera Babesia and Hepatozoon, and bacteria of the genera Rickettsia and Ehrlichia and family Anaplasmataceae. All samples were negative in the PCR assays targeting the genera Babesia, Hepatozoon, Ehrlichia and Rickettsia. For Anaplasmataceae, 3% (1/33 and 39.4% (26/66 of the urban and rural dogs, respectively, yielded amplicons that generated DNA sequences 100% identical to the corresponding sequence of Wolbachia endosymbiont of Dirofilaria immitis. Because of these results, all canine DNA samples were further tested in a PCR assay targeting filarial nematodes, which was positive for 18.2% (6/33 and 57.6% (38/66 urban and rural dogs, respectively. Filarial-PCR products generated DNA sequences 100% identical to D. immitis. While tick-borne infections were rare in Lábrea, D. immitis infection rates were among the highest reported in South America.

  15. Molecular detection of canine parvovirus in flies (Diptera) at open and closed canine facilities in the eastern United States.

    Science.gov (United States)

    Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan

    2014-06-01

    More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year

  16. DNA Checkpoint and Repair Factors Are Nuclear Sensors for Intracellular Organelle Stresses—Inflammations and Cancers Can Have High Genomic Risks

    Directory of Open Access Journals (Sweden)

    Huihong Zeng

    2018-05-01

    Full Text Available Under inflammatory conditions, inflammatory cells release reactive oxygen species (ROS and reactive nitrogen species (RNS which cause DNA damage. If not appropriately repaired, DNA damage leads to gene mutations and genomic instability. DNA damage checkpoint factors (DDCF and DNA damage repair factors (DDRF play a vital role in maintaining genomic integrity. However, how DDCFs and DDRFs are modulated under physiological and pathological conditions are not fully known. We took an experimental database analysis to determine the expression of 26 DNA DDCFs and 42 DNA DDRFs in 21 human and 20 mouse tissues in physiological/pathological conditions. We made the following significant findings: (1 Few DDCFs and DDRFs are ubiquitously expressed in tissues while many are differentially regulated.; (2 the expression of DDCFs and DDRFs are modulated not only in cancers but also in sterile inflammatory disorders and metabolic diseases; (3 tissue methylation status, pro-inflammatory cytokines, hypoxia regulating factors and tissue angiogenic potential can determine the expression of DDCFs and DDRFs; (4 intracellular organelles can transmit the stress signals to the nucleus, which may modulate the cell death by regulating the DDCF and DDRF expression. Our results shows that sterile inflammatory disorders and cancers increase genomic instability, therefore can be classified as pathologies with a high genomic risk. We also propose a new concept that as parts of cellular sensor cross-talking network, DNA checkpoint and repair factors serve as nuclear sensors for intracellular organelle stresses. Further, this work would lead to identification of novel therapeutic targets and new biomarkers for diagnosis and prognosis of metabolic diseases, inflammation, tissue damage and cancers.

  17. Draft genome sequence of an elite Dura palm and whole-genome patterns of DNA variation in oil palm.

    Science.gov (United States)

    Jin, Jingjing; Lee, May; Bai, Bin; Sun, Yanwei; Qu, Jing; Rahmadsyah; Alfiko, Yuzer; Lim, Chin Huat; Suwanto, Antonius; Sugiharti, Maria; Wong, Limsoon; Ye, Jian; Chua, Nam-Hai; Yue, Gen Hua

    2016-12-01

    Oil palm is the world's leading source of vegetable oil and fat. Dura, Pisifera and Tenera are three forms of oil palm. The genome sequence of Pisifera is available whereas the Dura form has not been sequenced yet. We sequenced the genome of one elite Dura palm, and re-sequenced 17 palm genomes. The assemble genome sequence of the elite Dura tree contained 10,971 scaffolds and was 1.701 Gb in length, covering 94.49% of the oil palm genome. 36,105 genes were predicted. Re-sequencing of 17 additional palm trees identified 18.1 million SNPs. We found high genetic variation among palms from different geographical regions, but lower variation among Southeast Asian Dura and Pisifera palms. We mapped 10,000 SNPs on the linkage map of oil palm. In addition, high linkage disequilibrium (LD) was detected in the oil palms used in breeding populations of Southeast Asia, suggesting that LD mapping is likely to be practical in this important oil crop. Our data provide a valuable resource for accelerating genetic improvement and studying the mechanism underlying phenotypic variations of important oil palm traits. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. Genome-wide signatures of differential DNA methylation in pediatric acute lymphoblastic leukemia

    DEFF Research Database (Denmark)

    Nordlund, Jessica; Bäcklin, Christofer L; Wahlberg, Per

    2013-01-01

    BACKGROUND: Although aberrant DNA methylation has been observed previously in acute lymphoblastic leukemia (ALL), the patterns of differential methylation have not been comprehensively determined in all subtypes of ALL on a genome-wide scale. The relationship between DNA methylation, cytogenetic...... background, drug resistance and relapse in ALL is poorly understood. RESULTS: We surveyed the DNA methylation levels of 435,941 CpG sites in samples from 764 children at diagnosis of ALL and from 27 children at relapse. This survey uncovered four characteristic methylation signatures. First, compared...... cells at relapse, compared with matched samples at diagnosis. Analysis of relapse-free survival identified CpG sites with subtype-specific differential methylation that divided the patients into different risk groups, depending on their methylation status. CONCLUSIONS: Our results suggest an important...

  19. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  20. Cluster analysis of Helicobacter pylori genomic DNA fingerprints suggests gastroduodenal disease-specific associations.

    Science.gov (United States)

    Go, M F; Chan, K Y; Versalovic, J; Koeuth, T; Graham, D Y; Lupski, J R

    1995-07-01

    Helicobacter pylori infection is now accepted as the most common cause of chronic active gastritis and peptic ulcer disease. The etiologies of many infectious diseases have been attributed to specific or clonal strains of bacterial pathogens. Polymerase chain reaction (PCR) amplification of DNA between repetitive DNA sequences, REP elements (REP-PCR), has been utilized to generate DNA fingerprints to examine similarity among strains within a bacterial species. Genomic DNA from H. pylori isolates obtained from 70 individuals (39 duodenal ulcers and 31 simple gastritis) was PCR-amplified using consensus probes to repetitive DNA elements. The H. pylori DNA fingerprints were analyzed for similarity and correlated with disease presentation using the NTSYS-pc computer program. Each H. pylori strain had a distinct DNA fingerprint except for two pairs. Single-colony DNA fingerprints of H. pylori from the same patient were identical, suggesting that each patient harbors a single strain. Computer-assisted cluster analysis of the REP-PCR DNA fingerprints showed two large clusters of isolates, one associated with simple gastritis and the other with duodenal ulcer disease. Cluster analysis of REP-PCR DNA fingerprints of H. pylori strains suggests that duodenal ulcer isolates, as a group, are more similar to one another and different from gastritis isolates. These results suggest that disease-specific strains may exist.

  1. A structural model of the genome packaging process in a membrane-containing double stranded DNA virus.

    Directory of Open Access Journals (Sweden)

    Chuan Hong

    2014-12-01

    Full Text Available Two crucial steps in the virus life cycle are genome encapsidation to form an infective virion and genome exit to infect the next host cell. In most icosahedral double-stranded (ds DNA viruses, the viral genome enters and exits the capsid through a unique vertex. Internal membrane-containing viruses possess additional complexity as the genome must be translocated through the viral membrane bilayer. Here, we report the structure of the genome packaging complex with a membrane conduit essential for viral genome encapsidation in the tailless icosahedral membrane-containing bacteriophage PRD1. We utilize single particle electron cryo-microscopy (cryo-EM and symmetry-free image reconstruction to determine structures of PRD1 virion, procapsid, and packaging deficient mutant particles. At the unique vertex of PRD1, the packaging complex replaces the regular 5-fold structure and crosses the lipid bilayer. These structures reveal that the packaging ATPase P9 and the packaging efficiency factor P6 form a dodecameric portal complex external to the membrane moiety, surrounded by ten major capsid protein P3 trimers. The viral transmembrane density at the special vertex is assigned to be a hexamer of heterodimer of proteins P20 and P22. The hexamer functions as a membrane conduit for the DNA and as a nucleating site for the unique vertex assembly. Our structures show a conformational alteration in the lipid membrane after the P9 and P6 are recruited to the virion. The P8-genome complex is then packaged into the procapsid through the unique vertex while the genome terminal protein P8 functions as a valve that closes the channel once the genome is inside. Comparing mature virion, procapsid, and mutant particle structures led us to propose an assembly pathway for the genome packaging apparatus in the PRD1 virion.

  2. A structural model of the genome packaging process in a membrane-containing double stranded DNA virus.

    Science.gov (United States)

    Hong, Chuan; Oksanen, Hanna M; Liu, Xiangan; Jakana, Joanita; Bamford, Dennis H; Chiu, Wah

    2014-12-01

    Two crucial steps in the virus life cycle are genome encapsidation to form an infective virion and genome exit to infect the next host cell. In most icosahedral double-stranded (ds) DNA viruses, the viral genome enters and exits the capsid through a unique vertex. Internal membrane-containing viruses possess additional complexity as the genome must be translocated through the viral membrane bilayer. Here, we report the structure of the genome packaging complex with a membrane conduit essential for viral genome encapsidation in the tailless icosahedral membrane-containing bacteriophage PRD1. We utilize single particle electron cryo-microscopy (cryo-EM) and symmetry-free image reconstruction to determine structures of PRD1 virion, procapsid, and packaging deficient mutant particles. At the unique vertex of PRD1, the packaging complex replaces the regular 5-fold structure and crosses the lipid bilayer. These structures reveal that the packaging ATPase P9 and the packaging efficiency factor P6 form a dodecameric portal complex external to the membrane moiety, surrounded by ten major capsid protein P3 trimers. The viral transmembrane density at the special vertex is assigned to be a hexamer of heterodimer of proteins P20 and P22. The hexamer functions as a membrane conduit for the DNA and as a nucleating site for the unique vertex assembly. Our structures show a conformational alteration in the lipid membrane after the P9 and P6 are recruited to the virion. The P8-genome complex is then packaged into the procapsid through the unique vertex while the genome terminal protein P8 functions as a valve that closes the channel once the genome is inside. Comparing mature virion, procapsid, and mutant particle structures led us to propose an assembly pathway for the genome packaging apparatus in the PRD1 virion.

  3. Correction of the lack of commutability between plasmid DNA and genomic DNA for quantification of genetically modified organisms using pBSTopas as a model.

    Science.gov (United States)

    Zhang, Li; Wu, Yuhua; Wu, Gang; Cao, Yinglong; Lu, Changming

    2014-10-01

    Plasmid calibrators are increasingly applied for polymerase chain reaction (PCR) analysis of genetically modified organisms (GMOs). To evaluate the commutability between plasmid DNA (pDNA) and genomic DNA (gDNA) as calibrators, a plasmid molecule, pBSTopas, was constructed, harboring a Topas 19/2 event-specific sequence and a partial sequence of the rapeseed reference gene CruA. Assays of the pDNA showed similar limits of detection (five copies for Topas 19/2 and CruA) and quantification (40 copies for Topas 19/2 and 20 for CruA) as those for the gDNA. Comparisons of plasmid and genomic standard curves indicated that the slopes, intercepts, and PCR efficiency for pBSTopas were significantly different from CRM Topas 19/2 gDNA for quantitative analysis of GMOs. Three correction methods were used to calibrate the quantitative analysis of control samples using pDNA as calibrators: model a, or coefficient value a (Cva); model b, or coefficient value b (Cvb); and the novel model c or coefficient formula (Cf). Cva and Cvb gave similar estimated values for the control samples, and the quantitative bias of the low concentration sample exceeded the acceptable range within ±25% in two of the four repeats. Using Cfs to normalize the Ct values of test samples, the estimated values were very close to the reference values (bias -13.27 to 13.05%). In the validation of control samples, model c was more appropriate than Cva or Cvb. The application of Cf allowed pBSTopas to substitute for Topas 19/2 gDNA as a calibrator to accurately quantify the GMO.

  4. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  5. Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

    Science.gov (United States)

    Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

    2005-12-01

    Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

  6. Kinetics of carboplatin-DNA binding in genomic DNA and bladder cancer cells as determined by accelerator mass spectrometry

    International Nuclear Information System (INIS)

    Hah, S S; Stivers, K M; Vere White, R; Henderson, P T

    2005-01-01

    Cisplatin and carboplatin are platinum-based drugs that are widely used in cancer chemotherapy. The cytotoxicity of these drugs is mediated by platinum-DNA monoadducts and intra- and interstrand diadducts, which are formed following uptake of the drug into the nucleus of cells. The pharmacodynamics of carboplatin display fewer side effects than for cisplatin, albeit with less potency, which may be due to differences in rates of DNA adduct formation. We report the use of accelerator mass spectrometry (AMS), a sensitive detection method often used for radiocarbon quantitation, to measure both the kinetics of [ 14 C]carboplatin-DNA adduct formation with genomic DNA and drug uptake and DNA binding in T24 human bladder cancer cells. Only carboplatin-DNA monoadducts contain radiocarbon in the platinated DNA, which allowed for calculation of kinetic rates and concentrations within the system. The percent of radiocarbon bound to salmon sperm DNA in the form of monoadducts was measured by AMS over 24 h. Knowledge of both the starting concentration of the parent carboplatin and the concentration of radiocarbon in the DNA at a variety of time points allowed calculation of the rates of Pt-DNA monoadduct formation and conversion to toxic cross-links. Importantly, the rate of carboplatin-DNA monoadduct formation was approximately 100-fold slower than that reported for the more potent cisplatin analogue, which may explain the lower toxicity of carboplatin. T24 human bladder cancer cells were incubated with a subpharmacological dose of [ 14 C]carboplatin, and the rate of accumulation of radiocarbon in the cells and nuclear DNA was measured by AMS. The lowest concentration of radiocarbon measured was approximately 1 amol/10 (micro)g of DNA. This sensitivity may allow the method to be used for clinical applications

  7. Kinetics of carboplatin-DNA binding in genomic DNA and bladder cancer cells as determined by accelerator mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Hah, S S; Stivers, K M; Vere White, R; Henderson, P T

    2005-12-29

    Cisplatin and carboplatin are platinum-based drugs that are widely used in cancer chemotherapy. The cytotoxicity of these drugs is mediated by platinum-DNA monoadducts and intra- and interstrand diadducts, which are formed following uptake of the drug into the nucleus of cells. The pharmacodynamics of carboplatin display fewer side effects than for cisplatin, albeit with less potency, which may be due to differences in rates of DNA adduct formation. We report the use of accelerator mass spectrometry (AMS), a sensitive detection method often used for radiocarbon quantitation, to measure both the kinetics of [{sup 14}C]carboplatin-DNA adduct formation with genomic DNA and drug uptake and DNA binding in T24 human bladder cancer cells. Only carboplatin-DNA monoadducts contain radiocarbon in the platinated DNA, which allowed for calculation of kinetic rates and concentrations within the system. The percent of radiocarbon bound to salmon sperm DNA in the form of monoadducts was measured by AMS over 24 h. Knowledge of both the starting concentration of the parent carboplatin and the concentration of radiocarbon in the DNA at a variety of time points allowed calculation of the rates of Pt-DNA monoadduct formation and conversion to toxic cross-links. Importantly, the rate of carboplatin-DNA monoadduct formation was approximately 100-fold slower than that reported for the more potent cisplatin analogue, which may explain the lower toxicity of carboplatin. T24 human bladder cancer cells were incubated with a subpharmacological dose of [{sup 14}C]carboplatin, and the rate of accumulation of radiocarbon in the cells and nuclear DNA was measured by AMS. The lowest concentration of radiocarbon measured was approximately 1 amol/10 {micro}g of DNA. This sensitivity may allow the method to be used for clinical applications.

  8. Genome-Wide Expression of MicroRNAs Is Regulated by DNA Methylation in Hepatocarcinogenesis

    Directory of Open Access Journals (Sweden)

    Jing Shen

    2015-01-01

    Full Text Available Background. Previous studies, including ours, have examined the regulation of microRNAs (miRNAs by DNA methylation, but whether this regulation occurs at a genome-wide level in hepatocellular carcinoma (HCC is unclear. Subjects/Methods. Using a two-phase study design, we conducted genome-wide screening for DNA methylation and miRNA expression to explore the potential role of methylation alterations in miRNAs regulation. Results. We found that expressions of 25 miRNAs were statistically significantly different between tumor and nontumor tissues and perfectly differentiated HCC tumor from nontumor. Six miRNAs were overexpressed, and 19 were repressed in tumors. Among 133 miRNAs with inverse correlations between methylation and expression, 8 miRNAs (6% showed statistically significant differences in expression between tumor and nontumor tissues. Six miRNAs were validated in 56 additional paired HCC tissues, and significant inverse correlations were observed for miR-125b and miR-199a, which is consistent with the inactive chromatin pattern found in HepG2 cells. Conclusion. These data suggest that the expressions of miR-125b and miR-199a are dramatically regulated by DNA hypermethylation that plays a key role in hepatocarcinogenesis.

  9. Purification and partial characterization of canine S100A12.

    Science.gov (United States)

    Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M

    2010-12-01

    Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the

  10. The caretakers of the genome. Repair of DNA lesions induced by ultraviolet-light and ionizing radiation

    International Nuclear Information System (INIS)

    Boiteux, S.; Radicella, J.P.

    2000-01-01

    The DNA contained in the nucleus of each of our cells daily suffers of thousand damages caused by solar ultraviolet radiations or ionizing radiations, with a natural or not origin, agents able to modify the genetic information. This information stays stable. True caretakers of the genome repair the DNA, provided that the cell is not over-taken by the level of the attack. Alterations of the repair mechanism are at the origin of extremely severe syndromes. The failure of one of these caretakers of the genome, the O.G.G.1 gene, seems implicated in the cancer development. It can be a lead to discover a predisposition to radioinduced or caused by other toxic agents cancers. (N.C.)

  11. Analysis of Single Nucleotide Polymorphism (SNP rs22114085 Associated with Canine Atopic Dermatitis by PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    Martina Miluchová

    2012-05-01

    Full Text Available Canine atopic dermatitis (cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The aim of the paper was to identify of the SNP rs22114085 in different dog breeds. The material involved 52 dogs from 5 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs22114085 SNP genotypes by PCR-RFLP method. The PCR products were digested with DdeI restriction enzyme. The C allele was distributed in Czech Pointer, Chihuahua, German Wirehaired Pointer with an allele frequency ranging from 0.4545 to 1.00. In the population of Czech Pointer we detected all genotypes CC, CT and TT with frequency in male 0.25, 0.5833 and 0.1667, and in female 0.2728, 0.3636 and 0.3636, subsequently. In German Wirehaired Pointer was detected homozygote genotype CC in male and heterozygote genotype CT in female with frequency 1 and 1. In Chihuahua was observed homozygote genotype CC and heterozygote genotype CT with frequency 0.3333 and 0.6667, subsequently. In Golden retriever and Pincher we detected genotype TT with frequency 1.

  12. Analysis of single nucleotide polymorphism (SNP RS23472497 associated with canine atopic dermatitis by ACRS-PCR method

    Directory of Open Access Journals (Sweden)

    Martina Miluchová

    2014-05-01

    Full Text Available The aim of the paper was to identify of the SNP rs23472497 associated with canine atopic dermatitis (cAD. cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The material involved 60 dogs from 6 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs23472497 SNP genotypes by ACRS-PCR method. The PCR products were digested with NlaIII restriction enzyme. In the population of Czech Pointer and Slovak Wirehaired Pointer we detected all genotypes AA, AG and GG with frequency 0.0732, 0.5122 and 0.4146 for Czech Pointer and 0.1818, 0.5455 and 0.2727 for Slovak Wirehaired Pointer. In Border Collie was observed heterozygote genotype AG and homozygote genotype GG with frequency 0.6667 and 0.3333, subsequently. In German Wirehaired Pointer, Australian Shepherd dog and American Staffordshire terrier we detected only genotype AG with frequency 1. The A allele was distributed with an allele frequency ranging from 0.3293 to 0.5. The G allele was distributed with an allele frequency ranging from 0.5 to 0.6707.

  13. Genome-Derived Cytosolic DNA Mediates Type I Interferon-Dependent Rejection of B Cell Lymphoma Cells

    Directory of Open Access Journals (Sweden)

    Yu J. Shen

    2015-04-01

    Full Text Available The DNA damage response (DDR induces the expression of type I interferons (IFNs, but the underlying mechanisms are poorly understood. Here, we show the presence of cytosolic DNA in different mouse and human tumor cells. Treatment of cells with genotoxic agents increased the levels of cytosolic DNA in a DDR-dependent manner. Cloning of cytosolic DNA molecules from mouse lymphoma cells suggests that cytosolic DNA is derived from unique genomic loci and has the potential to form non-B DNA structures, including R-loops. Overexpression of Rnaseh1, which resolves R-loops, reduced the levels of cytosolic DNA, type I Ifn transcripts, and type I IFN-dependent rejection of lymphoma cells. Live-cell imaging showed a dynamic contact of cytosolic DNA with mitochondria, an important organelle for innate immune recognition of cytosolic nucleotides. In summary, we found that cytosolic DNA is present in many tumor cells and contributes to the immunogenicity of tumor cells.

  14. Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde.

    Science.gov (United States)

    Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis

    2014-04-23

    Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

  15. Direct DNA Extraction from Mycobacterium tuberculosis Frozen Stocks as a Reculture-Independent Approach to Whole-Genome Sequencing

    DEFF Research Database (Denmark)

    Bjorn-Mortensen, K; Zallet, J; Lillebaek, T

    2015-01-01

    Culturing before DNA extraction represents a major time-consuming step in whole-genome sequencing of slow-growing bacteria, such as Mycobacterium tuberculosis. We report a workflow to extract DNA from frozen isolates without reculturing. Prepared libraries and sequence data were comparable...... with results from recultured aliquots of the same stocks....

  16. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.

    Science.gov (United States)

    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko

    2014-04-01

    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  17. DNA damage response and spindle assembly checkpoint function throughout the cell cycle to ensure genomic integrity.

    Directory of Open Access Journals (Sweden)

    Katherine S Lawrence

    2015-04-01

    Full Text Available Errors in replication or segregation lead to DNA damage, mutations, and aneuploidies. Consequently, cells monitor these events and delay progression through the cell cycle so repair precedes division. The DNA damage response (DDR, which monitors DNA integrity, and the spindle assembly checkpoint (SAC, which responds to defects in spindle attachment/tension during metaphase of mitosis and meiosis, are critical for preventing genome instability. Here we show that the DDR and SAC function together throughout the cell cycle to ensure genome integrity in C. elegans germ cells. Metaphase defects result in enrichment of SAC and DDR components to chromatin, and both SAC and DDR are required for metaphase delays. During persistent metaphase arrest following establishment of bi-oriented chromosomes, stability of the metaphase plate is compromised in the absence of DDR kinases ATR or CHK1 or SAC components, MAD1/MAD2, suggesting SAC functions in metaphase beyond its interactions with APC activator CDC20. In response to DNA damage, MAD2 and the histone variant CENPA become enriched at the nuclear periphery in a DDR-dependent manner. Further, depletion of either MAD1 or CENPA results in loss of peripherally associated damaged DNA. In contrast to a SAC-insensitive CDC20 mutant, germ cells deficient for SAC or CENPA cannot efficiently repair DNA damage, suggesting that SAC mediates DNA repair through CENPA interactions with the nuclear periphery. We also show that replication perturbations result in relocalization of MAD1/MAD2 in human cells, suggesting that the role of SAC in DNA repair is conserved.

  18. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Science.gov (United States)

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  19. Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators.

    Science.gov (United States)

    Polstein, Lauren R; Perez-Pinera, Pablo; Kocak, D Dewran; Vockley, Christopher M; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A

    2015-08-01

    Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. © 2015 Polstein et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Genome-wide tracking of unmethylated DNA Alu repeats in normal and cancer cells

    DEFF Research Database (Denmark)

    Rodriguez, Jairo; Vives, Laura; Jordà, Mireia

    2008-01-01

    Methylation of the cytosine is the most frequent epigenetic modification of DNA in mammalian cells. In humans, most of the methylated cytosines are found in CpG-rich sequences within tandem and interspersed repeats that make up to 45% of the human genome, being Alu repeats the most common family....

  1. DNA double-strand break response in stem cells: mechanisms to maintain genomic integrity.

    Science.gov (United States)

    Nagaria, Pratik; Robert, Carine; Rassool, Feyruz V

    2013-02-01

    Embryonic stem cells (ESCs) represent the point of origin of all cells in a given organism and must protect their genomes from both endogenous and exogenous genotoxic stress. DNA double-strand breaks (DSBs) are one of the most lethal forms of damage, and failure to adequately repair DSBs would not only compromise the ability of SCs to self-renew and differentiate, but will also lead to genomic instability and disease. Herein, we describe the mechanisms by which ESCs respond to DSB-inducing agents such as reactive oxygen species (ROS) and ionizing radiation, compared to somatic cells. We will also discuss whether the DSB response is fully reprogrammed in induced pluripotent stem cells (iPSCs) and the role of the DNA damage response (DDR) in the reprogramming of these cells. ESCs have distinct mechanisms to protect themselves against DSBs and oxidative stress compared to somatic cells. The response to damage and stress is crucial for the maintenance of self-renewal and differentiation capacity in SCs. iPSCs appear to reprogram some of the responses to genotoxic stress. However, it remains to be determined if iPSCs also retain some DDR characteristics of the somatic cells of origin. The mechanisms regulating the genomic integrity in ESCs and iPSCs are critical for its safe use in regenerative medicine and may shed light on the pathways and factors that maintain genomic stability, preventing diseases such as cancer. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Whole genome DNA copy number changes identified by high density oligonucleotide arrays

    Directory of Open Access Journals (Sweden)

    Huang Jing

    2004-05-01

    Full Text Available Abstract Changes in DNA copy number are one of the hallmarks of the genetic instability common to most human cancers. Previous micro-array-based methods have been used to identify chromosomal gains and losses; however, they are unable to genotype alleles at the level of single nucleotide polymorphisms (SNPs. Here we describe a novel algorithm that uses a recently developed high-density oligonucleotide array-based SNP genotyping method, whole genome sampling analysis (WGSA, to identify genome-wide chromosomal gains and losses at high resolution. WGSA simultaneously genotypes over 10,000 SNPs by allele-specific hybridisation to perfect match (PM and mismatch (MM probes synthesised on a single array. The copy number algorithm jointly uses PM intensity and discrimination ratios between paired PM and MM intensity values to identify and estimate genetic copy number changes. Values from an experimental sample are compared with SNP-specific distributions derived from a reference set containing over 100 normal individuals to gain statistical power. Genomic regions with statistically significant copy number changes can be identified using both single point analysis and contiguous point analysis of SNP intensities. We identified multiple regions of amplification and deletion using a panel of human breast cancer cell lines. We verified these results using an independent method based on quantitative polymerase chain reaction and found that our approach is both sensitive and specific and can tolerate samples which contain a mixture of both tumour and normal DNA. In addition, by using known allele frequencies from the reference set, statistically significant genomic intervals can be identified containing contiguous stretches of homozygous markers, potentially allowing the detection of regions undergoing loss of heterozygosity (LOH without the need for a matched normal control sample. The coupling of LOH analysis, via SNP genotyping, with copy number

  3. Disruption of chromosome 11 in canine fibrosarcomas highlights an unusual variability of CDKN2B in dogs

    Directory of Open Access Journals (Sweden)

    Haugland Sean

    2009-07-01

    Full Text Available Abstract Background In dogs in the western world neoplasia constitutes the most frequently diagnosed cause of death. Although there appear to be similarities between canine and human cancers, rather little is known about the cytogenetic and molecular alterations in canine tumours. Different dog breeds are susceptible to different types of cancer, but the genetic basis of the great majority of these predispositions has yet to be discovered. In some retriever breeds there is a high incidence of soft tissue sarcomas and we have previously reported alterations of chromosomes 11 and 30 in two poorly differentiated fibrosarcomas. Here we extend our observations and present a case report on detail rearrangements on chromosome 11 as well as genetic variations in a tumour suppressor gene in normal dogs. Results BAC hybridisations on metaphases of two fibrosarcomas showed complex rearrangements on chromosome 11, and loss of parts of this chromosome. Microsatellite markers on a paired tumour and blood DNA pointed to loss of heterozygosity on chromosome 11 in the CDKN2B-CDKN2A tumour suppressor gene cluster region. PCR and sequencing revealed the homozygous loss of coding sequences for these genes, except for exon 1β of CDKN2A, which codes for the N-terminus of p14ARF. For CDKN2B exon 1, two alleles were observed in DNA from blood; one of them identical to the sequence in the dog reference genome and containing 4 copies of a 12 bp repeat found only in the canine gene amongst all species so far sequenced; the other allele was shorter due to a missing copy of the repeat. Sequencing of this exon in 141 dogs from 18 different breeds revealed a polymorphic region involving a GGC triplet repeat and a GGGGACGGCGGC repeat. Seven alleles were recorded and sixteen of the eighteen breeds showed heterozygosity. Conclusion Complex chromosome rearrangements were observed on chromosome 11 in two Labrador retriever fibrosarcomas. The chromosome alterations were reflected

  4. Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae) provide evidence for pervasive mitochondrial DNA recombination.

    Science.gov (United States)

    Sammler, Svenja; Bleidorn, Christoph; Tiedemann, Ralph

    2011-01-14

    Although nowaday it is broadly accepted that mitochondrial DNA (mtDNA) may undergo recombination, the frequency of such recombination remains controversial. Its estimation is not straightforward, as recombination under homoplasmy (i.e., among identical mt genomes) is likely to be overlooked. In species with tandem duplications of large mtDNA fragments the detection of recombination can be facilitated, as it can lead to gene conversion among duplicates. Although the mechanisms for concerted evolution in mtDNA are not fully understood yet, recombination rates have been estimated from "one per speciation event" down to 850 years or even "during every replication cycle". Here we present the first complete mt genome of the avian family Bucerotidae, i.e., that of two Philippine hornbills, Aceros waldeni and Penelopides panini. The mt genomes are characterized by a tandemly duplicated region encompassing part of cytochrome b, 3 tRNAs, NADH6, and the control region. The duplicated fragments are identical to each other except for a short section in domain I and for the length of repeat motifs in domain III of the control region. Due to the heteroplasmy with regard to the number of these repeat motifs, there is some size variation in both genomes; with around 21,657 bp (A. waldeni) and 22,737 bp (P. panini), they significantly exceed the hitherto longest known avian mt genomes, that of the albatrosses. We discovered concerted evolution between the duplicated fragments within individuals. The existence of differences between individuals in coding genes as well as in the control region, which are maintained between duplicates, indicates that recombination apparently occurs frequently, i.e., in every generation. The homogenised duplicates are interspersed by a short fragment which shows no sign of recombination. We hypothesize that this region corresponds to the so-called Replication Fork Barrier (RFB), which has been described from the chicken mitochondrial genome. As this RFB

  5. Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae provide evidence for pervasive mitochondrial DNA recombination

    Directory of Open Access Journals (Sweden)

    Bleidorn Christoph

    2011-01-01

    Full Text Available Abstract Background Although nowaday it is broadly accepted that mitochondrial DNA (mtDNA may undergo recombination, the frequency of such recombination remains controversial. Its estimation is not straightforward, as recombination under homoplasmy (i.e., among identical mt genomes is likely to be overlooked. In species with tandem duplications of large mtDNA fragments the detection of recombination can be facilitated, as it can lead to gene conversion among duplicates. Although the mechanisms for concerted evolution in mtDNA are not fully understood yet, recombination rates have been estimated from "one per speciation event" down to 850 years or even "during every replication cycle". Results Here we present the first complete mt genome of the avian family Bucerotidae, i.e., that of two Philippine hornbills, Aceros waldeni and Penelopides panini. The mt genomes are characterized by a tandemly duplicated region encompassing part of cytochrome b, 3 tRNAs, NADH6, and the control region. The duplicated fragments are identical to each other except for a short section in domain I and for the length of repeat motifs in domain III of the control region. Due to the heteroplasmy with regard to the number of these repeat motifs, there is some size variation in both genomes; with around 21,657 bp (A. waldeni and 22,737 bp (P. panini, they significantly exceed the hitherto longest known avian mt genomes, that of the albatrosses. We discovered concerted evolution between the duplicated fragments within individuals. The existence of differences between individuals in coding genes as well as in the control region, which are maintained between duplicates, indicates that recombination apparently occurs frequently, i.e., in every generation. Conclusions The homogenised duplicates are interspersed by a short fragment which shows no sign of recombination. We hypothesize that this region corresponds to the so-called Replication Fork Barrier (RFB, which has been

  6. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    Energy Technology Data Exchange (ETDEWEB)

    Kiran, Shashi; Oddi, Vineesha [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Laboratory of Cancer Cell Biology, Department of Research, Institute of Liver and Biliary Sciences, Delhi 110070 (India)

    2015-02-01

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  7. Genome-wide, Single-Cell DNA Methylomics Reveals Increased Non-CpG Methylation during Human Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Bo Yu

    2017-07-01

    Full Text Available The establishment of DNA methylation patterns in oocytes is a highly dynamic process marking gene-regulatory events during fertilization, embryonic development, and adulthood. However, after epigenetic reprogramming in primordial germ cells, how and when DNA methylation is re-established in developing human oocytes remains to be characterized. Here, using single-cell whole-genome bisulfite sequencing, we describe DNA methylation patterns in three different maturation stages of human oocytes. We found that while broad-scale patterns of CpG methylation have been largely established by the immature germinal vesicle stage, localized changes continue into later development. Non-CpG methylation, on the other hand, undergoes a large-scale, generalized remodeling through the final stage of maturation, with the net overall result being the accumulation of methylation as oocytes mature. The role of the genome-wide, non-CpG methylation remodeling in the final stage of oocyte maturation deserves further investigation.

  8. Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

    Science.gov (United States)

    Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

    2017-10-06

    Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

  9. Analysis of the giant genomes of Fritillaria (Liliaceae) indicates that a lack of DNA removal characterizes extreme expansions in genome size

    Czech Academy of Sciences Publication Activity Database

    Kelly, L.J.; Renny-Byfield, S.; Macas, Jiří; Novák, Petr; Neumann, Pavel; Lysák, M.; Day, P.D.; Berger, M.; Fay, M. F.; Nichols, R. A.; Leitch, A. R.; Leitch, I. J.

    2015-01-01

    Roč. 208, č. 2 (2015), s. 596-607 ISSN 0028-646X R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : DNA deletion * Fritillaria * Liliaceae * genome size evolution Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.210, year: 2015

  10. Ornithine decarboxylase antizyme induces hypomethylation of genome DNA and histone H3 lysine 9 dimethylation (H3K9me2 in human oral cancer cell line.

    Directory of Open Access Journals (Sweden)

    Daisuke Yamamoto

    2010-09-01

    Full Text Available Methylation of CpG islands of genome DNA and lysine residues of histone H3 and H4 tails regulates gene transcription. Inhibition of polyamine synthesis by ornithine decarboxylase antizyme-1 (OAZ in human oral cancer cell line resulted in accumulation of decarboxylated S-adenosylmethionine (dcSAM, which acts as a competitive inhibitor of methylation reactions. We anticipated that accumulation of dcSAM impaired methylation reactions and resulted in hypomethylation of genome DNA and histone tails.Global methylation state of genome DNA and lysine residues of histone H3 and H4 tails were assayed by Methylation by Isoschizomers (MIAMI method and western blotting, respectively, in the presence or absence of OAZ expression. Ectopic expression of OAZ mediated hypomethylation of CpG islands of genome DNA and histone H3 lysine 9 dimethylation (H3K9me2. Protein level of DNA methyltransferase 3B (DNMT3B and histone H3K9me specific methyltransferase G9a were down-regulated in OAZ transfectant.OAZ induced hypomethylation of CpG islands of global genome DNA and H3K9me2 by down-regulating DNMT3B and G9a protein level. Hypomethylation of CpG islands of genome DNA and histone H3K9me2 is a potent mechanism of induction of the genes related to tumor suppression and DNA double strand break repair.

  11. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  12. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Directory of Open Access Journals (Sweden)

    Cui Shang-jin

    2010-05-01

    Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  13. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Science.gov (United States)

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  14. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  15. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    OpenAIRE

    Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

    2017-01-01

    Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

  16. Interspersion of highly repetitive DNA with single copy DNA in the genome of the red crab, Geryon quinquedens

    Energy Technology Data Exchange (ETDEWEB)

    Christie, N.T. (Univ. of Tennessee, Oak Ridge); Skinner, D.M.

    1979-02-01

    Kinetic analysis of the reassociation of 420 nucleotide (NT) long fragments has shown that essentially all of the repetitive sequences of the DNA of the red crab Geryon quinquedens are highly repetitive. There are negligible amounts of low and intermediate repetitive DNAs. Though atypical of most eukaryotes, this pattern has been observed in al other brachyurans (true crabs) studied. The major repetitive component is subdivided into short runs of 300 NT and longer runs of greater than 1200 NT while the minor component has an average sequence length of 400 NT. Both components reassociate at rates commonly observed for satellite DNAs. Unique among eukaryotes the organization of the genome includes single copy DNA contiguous to short runs (300 NT) of both repetitive components. Although patent satellites are not present, subsets of the repetitive DNA have been isolated by either restriction endonuclease digestion or by centrifugation in Ag/sup +/ or Hg/sup 2 +//Cs/sub 2/SO/sub 4/ density gradients.

  17. Functional Characterization of Canine Interferon-Lambda

    Science.gov (United States)

    Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun

    2014-01-01

    In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142

  18. DNA fingerprinting of Mycobacterium tuberculosis: from phage typing to whole-genome sequencing.

    Science.gov (United States)

    Schürch, Anita C; van Soolingen, Dick

    2012-06-01

    Current typing methods for Mycobacterium tuberculosis complex evolved from simple phenotypic approaches like phage typing and drug susceptibility profiling to DNA-based strain typing methods, such as IS6110-restriction fragment length polymorphisms (RFLP) and variable number of tandem repeats (VNTR) typing. Examples of the usefulness of molecular typing are source case finding and epidemiological linkage of tuberculosis (TB) cases, international transmission of MDR/XDR-TB, the discrimination between endogenous reactivation and exogenous re-infection as a cause of relapses after curative treatment of tuberculosis, the evidence of multiple M. tuberculosis infections, and the disclosure of laboratory cross-contaminations. Simultaneously, phylogenetic analyses were developed based on single nucleotide polymorphisms (SNPs), genomic deletions usually referred to as regions of difference (RDs) and spoligotyping which served both strain typing and phylogenetic analysis. National and international initiatives that rely on the application of these typing methods have brought significant insight into the molecular epidemiology of tuberculosis. However, current DNA fingerprinting methods have important limitations. They can often not distinguish between genetically closely related strains and the turn-over of these markers is variable. Moreover, the suitability of most DNA typing methods for phylogenetic reconstruction is limited as they show a high propensity of convergent evolution or misinfer genetic distances. In order to fully explore the possibilities of genotyping in the molecular epidemiology of tuberculosis and to study the phylogeny of the causative bacteria reliably, the application of whole-genome sequencing (WGS) analysis for all M. tuberculosis isolates is the optimal, although currently still a costly solution. In the last years WGS for typing of pathogens has been explored and yielded important additional information on strain diversity in comparison to the

  19. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    Science.gov (United States)

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Genomic and functional integrity of the hematopoietic system requires tolerance of oxidative DNA lesions

    DEFF Research Database (Denmark)

    Martín-Pardillos, Ana; Tsaalbi-Shtylik, Anastasia; Chen, Si

    2017-01-01

    -distorting nucleotide lesions, resulted in the perinatal loss of hematopoietic stem cells, progressive loss of bone marrow, and fatal aplastic anemia between 3 and 4 months of age. This was associated with replication stress, genomic breaks, DNA damage signaling, senescence, and apoptosis in bone marrow. Surprisingly...

  1. Inspecting Targeted Deep Sequencing of Whole Genome Amplified DNA Versus Fresh DNA for Somatic Mutation Detection: A Genetic Study in Myelodysplastic Syndrome Patients.

    Science.gov (United States)

    Palomo, Laura; Fuster-Tormo, Francisco; Alvira, Daniel; Ademà, Vera; Armengol, María Pilar; Gómez-Marzo, Paula; de Haro, Nuri; Mallo, Mar; Xicoy, Blanca; Zamora, Lurdes; Solé, Francesc

    2017-08-01

    Whole genome amplification (WGA) has become an invaluable method for preserving limited samples of precious stock material and has been used during the past years as an alternative tool to increase the amount of DNA before library preparation for next-generation sequencing. Myelodysplastic syndromes (MDS) are a group of clonal hematopoietic stem cell disorders characterized by presenting somatic mutations in several myeloid-related genes. In this work, targeted deep sequencing has been performed on four paired fresh DNA and WGA DNA samples from bone marrow of MDS patients, to assess the feasibility of using WGA DNA for detecting somatic mutations. The results of this study highlighted that, in general, the sequencing and alignment statistics of fresh DNA and WGA DNA samples were similar. However, after variant calling and when considering variants detected at all frequencies, there was a high level of discordance between fresh DNA and WGA DNA (overall, a higher number of variants was detected in WGA DNA). After proper filtering, a total of three somatic mutations were detected in the cohort. All somatic mutations detected in fresh DNA were also identified in WGA DNA and validated by whole exome sequencing.

  2. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  3. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2016-09-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  4. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  5. Insights into the Pathogenesis of Anaplastic Large-Cell Lymphoma through Genome-wide DNA Methylation Profiling

    Directory of Open Access Journals (Sweden)

    Melanie R. Hassler

    2016-10-01

    Full Text Available Aberrant DNA methylation patterns in malignant cells allow insight into tumor evolution and development and can be used for disease classification. Here, we describe the genome-wide DNA methylation signatures of NPM-ALK-positive (ALK+ and NPM-ALK-negative (ALK− anaplastic large-cell lymphoma (ALCL. We find that ALK+ and ALK− ALCL share common DNA methylation changes for genes involved in T cell differentiation and immune response, including TCR and CTLA-4, without an ALK-specific impact on tumor DNA methylation in gene promoters. Furthermore, we uncover a close relationship between global ALCL DNA methylation patterns and those in distinct thymic developmental stages and observe tumor-specific DNA hypomethylation in regulatory regions that are enriched for conserved transcription factor binding motifs such as AP1. Our results indicate similarity between ALCL tumor cells and thymic T cell subsets and a direct relationship between ALCL oncogenic signaling and DNA methylation through transcription factor induction and occupancy.

  6. Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance.

    Science.gov (United States)

    Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

    2014-12-01

    Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Ligation bias in illumina next-generation DNA libraries: implications for sequencing ancient genomes.

    Directory of Open Access Journals (Sweden)

    Andaine Seguin-Orlando

    Full Text Available Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate that library preparation based on adapter ligation at AT-overhangs are biased against DNA templates starting with thymine residues, contrarily to blunt-end adapter ligation. We observe the same bias on fresh DNA extracts sheared on Bioruptor, Covaris and nebulizers. This contradicts previous reports suggesting that this bias could originate from the methods used for shearing DNA. This also suggests that AT-overhang adapter ligation efficiency is affected in a sequence-dependent manner and results in an uneven representation of different genomic contexts. We then show how this bias could affect the base composition of ancient DNA libraries prepared following AT-overhang ligation, mainly by limiting the ability to ligate DNA templates starting with thymines and therefore deaminated cytosines. This results in particular nucleotide misincorporation damage patterns, deviating from the signature generally expected for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries.

  8. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome

    Science.gov (United States)

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo. PMID:26559182

  9. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome.

    Science.gov (United States)

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo.

  10. Genome Sizes in Hepatica Mill: (Ranunculaceae Show a Loss of DNA, Not a Gain, in Polyploids

    Directory of Open Access Journals (Sweden)

    B. J. M. Zonneveld

    2010-01-01

    , and a possible pentaploid. The somatic nuclear DNA contents (2C-value, as measured by flow cytometry with propidium iodide, were shown to range from 33 to 80 pg. The Asiatic and American species, often considered subspecies of H. nobilis, could be clearly distinguished from European H. nobilis. DNA content confirmed the close relationships in the Asiatic species, and these are here considered as subspecies of H. asiatica. Parents for the allotetraploid species could be suggested based on their nuclear DNA content. Contrary to the increase in genome size suggested earlier for Hepatica, a significant (6%–14% loss of nuclear DNA in the natural allopolyploids was found.

  11. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    Science.gov (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  12. Brief Guide to Genomics: DNA, Genes and Genomes

    Science.gov (United States)

    ... clinic. Most new drugs based on genome-based research are estimated to be at least 10 to 15 years away, though recent genome-driven efforts in lipid-lowering therapy have considerably shortened that interval. According ...

  13. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein

  14. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    Science.gov (United States)

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  15. Advanced Whole-Genome Sequencing and Analysis of Fetal Genomes from Amniotic Fluid.

    Science.gov (United States)

    Mao, Qing; Chin, Robert; Xie, Weiwei; Deng, Yuqing; Zhang, Wenwei; Xu, Huixin; Zhang, Rebecca Yu; Shi, Quan; Peters, Erin E; Gulbahce, Natali; Li, Zhenyu; Chen, Fang; Drmanac, Radoje; Peters, Brock A

    2018-04-01

    Amniocentesis is a common procedure, the primary purpose of which is to collect cells from the fetus to allow testing for abnormal chromosomes, altered chromosomal copy number, or a small number of genes that have small single- to multibase defects. Here we demonstrate the feasibility of generating an accurate whole-genome sequence of a fetus from either the cellular or cell-free DNA (cfDNA) of an amniotic sample. cfDNA and DNA isolated from the cell pellet of 31 amniocenteses were sequenced to approximately 50× genome coverage by use of the Complete Genomics nanoarray platform. In a subset of the samples, long fragment read libraries were generated from DNA isolated from cells and sequenced to approximately 100× genome coverage. Concordance of variant calls between the 2 DNA sources and with parental libraries was >96%. Two fetal genomes were found to harbor potentially detrimental variants in chromodomain helicase DNA binding protein 8 ( CHD8 ) and LDL receptor-related protein 1 ( LRP1 ), variations of which have been associated with autism spectrum disorder and keratosis pilaris atrophicans, respectively. We also discovered drug sensitivities and carrier information of fetuses for a variety of diseases. We were able to elucidate the complete genome sequence of 31 fetuses from amniotic fluid and demonstrate that the cfDNA or DNA from the cell pellet can be analyzed with little difference in quality. We believe that current technologies could analyze this material in a highly accurate and complete manner and that analyses like these should be considered for addition to current amniocentesis procedures. © 2018 American Association for Clinical Chemistry.

  16. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

    2015-01-01

    Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...

  17. [Effects of canine IL-2 and IL-7 genes on enhancing immunogenicity of canine parvovirus VP2 gene vaccine in mice].

    Science.gov (United States)

    Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P vaccine.

  18. Genome-Wide DNA Methylation in Mixed Ancestry Individuals with Diabetes and Prediabetes from South Africa

    Science.gov (United States)

    Pheiffer, Carmen; Humphries, Stephen E.; Gamieldien, Junaid; Erasmus, Rajiv T.

    2016-01-01

    Aims. To conduct a genome-wide DNA methylation in individuals with type 2 diabetes, individuals with prediabetes, and control mixed ancestry individuals from South Africa. Methods. We used peripheral blood to perform genome-wide DNA methylation analysis in 3 individuals with screen detected diabetes, 3 individuals with prediabetes, and 3 individuals with normoglycaemia from the Bellville South Community, Cape Town, South Africa, who were age-, gender-, body mass index-, and duration of residency-matched. Methylated DNA immunoprecipitation (MeDIP) was performed by Arraystar Inc. (Rockville, MD, USA). Results. Hypermethylated DMRs were 1160 (81.97%) and 124 (43.20%), respectively, in individuals with diabetes and prediabetes when both were compared to subjects with normoglycaemia. Our data shows that genes related to the immune system, signal transduction, glucose transport, and pancreas development have altered DNA methylation in subjects with prediabetes and diabetes. Pathway analysis based on the functional analysis mapping of genes to KEGG pathways suggested that the linoleic acid metabolism and arachidonic acid metabolism pathways are hypomethylated in prediabetes and diabetes. Conclusions. Our study suggests that epigenetic changes are likely to be an early process that occurs before the onset of overt diabetes. Detailed analysis of DMRs that shows gradual methylation differences from control versus prediabetes to prediabetes versus diabetes in a larger sample size is required to confirm these findings. PMID:27555869

  19. Chemical biology on the genome.

    Science.gov (United States)

    Balasubramanian, Shankar

    2014-08-15

    In this article I discuss studies towards understanding the structure and function of DNA in the context of genomes from the perspective of a chemist. The first area I describe concerns the studies that led to the invention and subsequent development of a method for sequencing DNA on a genome scale at high speed and low cost, now known as Solexa/Illumina sequencing. The second theme will feature the four-stranded DNA structure known as a G-quadruplex with a focus on its fundamental properties, its presence in cellular genomic DNA and the prospects for targeting such a structure in cels with small molecules. The final topic for discussion is naturally occurring chemically modified DNA bases with an emphasis on chemistry for decoding (or sequencing) such modifications in genomic DNA. The genome is a fruitful topic to be further elucidated by the creation and application of chemical approaches. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Genome-Wide Analysis of DNA Methylation During Ovule Development of Female-Sterile Rice fsv1

    Directory of Open Access Journals (Sweden)

    Helian Liu

    2017-11-01

    Full Text Available The regulation of female fertility is an important field of rice sexual reproduction research. DNA methylation is an essential epigenetic modification that dynamically regulates gene expression during development processes. However, few reports have described the methylation profiles of female-sterile rice during ovule development. In this study, ovules were continuously acquired from the beginning of megaspore mother cell meiosis until the mature female gametophyte formation period, and global DNA methylation patterns were compared in the ovules of a high-frequency female-sterile line (fsv1 and a wild-type rice line (Gui99 using whole-genome bisulfite sequencing (WGBS. Profiling of the global DNA methylation revealed hypo-methylation, and 3471 significantly differentially methylated regions (DMRs were observed in fsv1 ovules compared with Gui99. Based on functional annotation and Kyoto encyclopedia of genes and genomes (KEGG pathway analysis of differentially methylated genes (DMGs, we observed more DMGs enriched in cellular component, reproduction regulation, metabolic pathway, and other pathways. In particular, many ovule development genes and plant hormone-related genes showed significantly different methylation patterns in the two rice lines, and these differences may provide important clues for revealing the mechanism of female gametophyte abortion.