Survey on the Ability of Wolbachia to Control Human Viral, Protozoan, and Filarial Disease Pathogens
Directory of Open Access Journals (Sweden)
Garedaghi Yagoob
2014-04-01
Full Text Available Objective: Most human filarial nematode parasites and arthropods are hosts for a bacterial endosymbiont, Wolbachia. In filariasis, Wolbachia are required for normal development, fertility, and survival. However, in arthropods, Wolbachia are largely parasitic and can influence development and reproduction, but are generally not required for host survival. Materials and Methods: Due to their obligate nature in filarial parasites, Wolbachia have been a target for drug discovery initiatives using several approaches including diversity and focused library screening and genomic sequence analysis. Results: In vitro and in vivo anti-Wolbachia antibiotic treatments have been shown to have adulticidal activity, a long sought goal of filarial parasite drug discovery. In mosquitoes, it has been shown that the presence of Wolbachia can inhibit the transmission of certain viruses, such as dengue, chikungunya, yellow fever, West Nile, as well as the infectivity of the malaria-causing protozoan, Plasmodium and filarial nematodes. Conclusion: Wolbachia can cause a form of conditional sterility that can be used to suppress populations of mosquitoes and additional medically important insects. Thus, Wolbachia, a pandemic endosymbiont, offers great potential for elimination of a wide-variety of devastating human diseases.
Human innate lymphoid cells (ILCs) in filarial infections.
Bonne-Année, S; Nutman, T B
2018-02-01
Filarial infections are characteristically chronic and can cause debilitating diseases governed by parasite-induced innate and adaptive immune responses. Filarial parasites traverse or establish niches in the skin (migrating infective larvae), in nonmucosal tissues (adult parasite niche) and in the blood or skin (circulating microfilariae) where they intersect with the host immune response. While several studies have demonstrated that filarial parasites and their antigens can modulate myeloid cells (monocyte, macrophage and dendritic cell subsets), T- and B-lymphocytes and skin resident cell populations, the role of innate lymphoid cells during filarial infections has only recently emerged. Despite the identification and characterization of innate lymphoid cells (ILCs) in murine helminth infections, little is actually known about the role of human ILCs during parasitic infections. The focus of this review will be to highlight the composition of ILCs in the skin, lymphatics and blood; where the host-parasite interaction is well-defined and to examine the role of ILCs during filarial infections. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
Directory of Open Access Journals (Sweden)
R Anuradha
Full Text Available Lymphatic filariasis can be associated with development of serious pathology in the form of lymphedema, hydrocele, and elephantiasis in a subset of infected patients. Dysregulated host inflammatory responses leading to systemic immune activation are thought to play a central role in filarial disease pathogenesis. We measured the plasma levels of microbial translocation markers, acute phase proteins, and inflammatory cytokines in individuals with chronic filarial pathology with (CP Ag+ or without (CP Ag- active infection; with clinically asymptomatic infections (INF; and in those without infection (endemic normal [EN]. Comparisons between the two actively infected groups (CP Ag+ compared to INF and those without active infection (CP Ag- compared to EN were used preliminarily to identify markers of pathogenesis. Thereafter, we tested for group effects among all the four groups using linear models on the log transformed responses of the markers. Our data suggest that circulating levels of microbial translocation products (lipopolysaccharide and LPS-binding protein, acute phase proteins (haptoglobin and serum amyloid protein-A, and inflammatory cytokines (IL-1β, IL-12, and TNF-α are associated with pathogenesis of disease in lymphatic filarial infection and implicate an important role for circulating microbial products and acute phase proteins.
Directory of Open Access Journals (Sweden)
Herbert Sousa Soares
2014-12-01
Full Text Available Blood samples were collected from 99 domestic dogs from the urban and rural areas of the Lábrea municipality, state of Amazonas, Brazil. Canine serum samples were tested by immunofluorescence assay against Rickettsia spp., which revealed that only 3.0% (1/33 and 7.6% (5/66 of the dogs from urban and rural areas, respectively, reacted positively to at least one Rickettsia species. DNA was extracted from canine blood and tested by a battery of PCR assays targeting protozoa of the genera Babesia and Hepatozoon, and bacteria of the genera Rickettsia and Ehrlichia and family Anaplasmataceae. All samples were negative in the PCR assays targeting the genera Babesia, Hepatozoon, Ehrlichia and Rickettsia. For Anaplasmataceae, 3% (1/33 and 39.4% (26/66 of the urban and rural dogs, respectively, yielded amplicons that generated DNA sequences 100% identical to the corresponding sequence of Wolbachia endosymbiont of Dirofilaria immitis. Because of these results, all canine DNA samples were further tested in a PCR assay targeting filarial nematodes, which was positive for 18.2% (6/33 and 57.6% (38/66 urban and rural dogs, respectively. Filarial-PCR products generated DNA sequences 100% identical to D. immitis. While tick-borne infections were rare in Lábrea, D. immitis infection rates were among the highest reported in South America.
Babayan, Simon A; Read, Andrew F; Lawrence, Rachel A; Bain, Odile; Allen, Judith E
2010-10-19
Humans and other mammals mount vigorous immune assaults against helminth parasites, yet there are intriguing reports that the immune response can enhance rather than impair parasite development. It has been hypothesized that helminths, like many free-living organisms, should optimize their development and reproduction in response to cues predicting future life expectancy. However, immune-dependent development by helminth parasites has so far eluded such evolutionary explanation. By manipulating various arms of the immune response of experimental hosts, we show that filarial nematodes, the parasites responsible for debilitating diseases in humans like river blindness and elephantiasis, accelerate their development in response to the IL-5 driven eosinophilia they encounter when infecting a host. Consequently they produce microfilariae, their transmission stages, earlier and in greater numbers. Eosinophilia is a primary host determinant of filarial life expectancy, operating both at larval and at late adult stages in anatomically and temporally separate locations, and is implicated in vaccine-mediated protection. Filarial nematodes are therefore able to adjust their reproductive schedules in response to an environmental predictor of their probability of survival, as proposed by evolutionary theory, thereby mitigating the effects of the immune attack to which helminths are most susceptible. Enhancing protective immunity against filarial nematodes, for example through vaccination, may be less effective at reducing transmission than would be expected and may, at worst, lead to increased transmission and, hence, pathology.
Directory of Open Access Journals (Sweden)
Simon A Babayan
Full Text Available Humans and other mammals mount vigorous immune assaults against helminth parasites, yet there are intriguing reports that the immune response can enhance rather than impair parasite development. It has been hypothesized that helminths, like many free-living organisms, should optimize their development and reproduction in response to cues predicting future life expectancy. However, immune-dependent development by helminth parasites has so far eluded such evolutionary explanation. By manipulating various arms of the immune response of experimental hosts, we show that filarial nematodes, the parasites responsible for debilitating diseases in humans like river blindness and elephantiasis, accelerate their development in response to the IL-5 driven eosinophilia they encounter when infecting a host. Consequently they produce microfilariae, their transmission stages, earlier and in greater numbers. Eosinophilia is a primary host determinant of filarial life expectancy, operating both at larval and at late adult stages in anatomically and temporally separate locations, and is implicated in vaccine-mediated protection. Filarial nematodes are therefore able to adjust their reproductive schedules in response to an environmental predictor of their probability of survival, as proposed by evolutionary theory, thereby mitigating the effects of the immune attack to which helminths are most susceptible. Enhancing protective immunity against filarial nematodes, for example through vaccination, may be less effective at reducing transmission than would be expected and may, at worst, lead to increased transmission and, hence, pathology.
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
Adejolu, Margaret; Sidhu, Paul S
2011-08-01
The objective of this series was to show that the sonographic appearance described as the "filarial dance" is not characteristic of filariasis but occurs in nonendemic areas as a manifestation of epididymal obstruction. An experienced observer documented cases after initial observation of the filarial dance in routine clinical practice using high-frequency linear array transducers. The filarial dance was described as excessive to-and-fro movement of echogenic particles within a prominent epididymis and graded 1 to 4 according to the extent and distribution of the abnormality. The country of birth, exposure to filarial infection or travel to a filarial-endemic area, previous scrotal surgery including vasectomy, any previous or current scrotal inflammatory disease, and any congenital testicular abnormalities were recorded. Over a 10-year period, sonographic appearances consistent with the filarial dance were observed in 18 patients (bilateral in 6). The mean patient age was 47.7 (range, 28-91) years. The abnormality was graded in the 24 affected testes as follows: grade 1, n = 3; grade 2, n = 8; grade 3, n = 8; and grade 4, n = 5. No patient had a history of filariasis or travel to an endemic area. Six of 18 patients (33.3%) had bilateral vasectomies; 5 (27.8%) had a history of epididymo-orchitis in the ipsilateral testis; 3 (16.7%) had previous scrotal surgery; and 4 (22.2%) had no relevant urologic history. We have described a sonographic appearance identical to the filarial dance in men with no history of filarial infection. Most had previous scrotal surgery or infection, suggesting that the filarial dance may not always be due to movement of filarial worms. The unifying condition in patients with filariasis and our patients is lymphatic obstruction, likely the underlying cause of the appearance in both groups.
Filarial worms reduce Plasmodium infectivity in mosquitoes.
Directory of Open Access Journals (Sweden)
Matthew T Aliota
2011-02-01
Full Text Available Co-occurrence of malaria and filarial worm parasites has been reported, but little is known about the interaction between filarial worm and malaria parasites with the same Anopheles vector. Herein, we present data evaluating the interaction between Wuchereria bancrofti and Anopheles punctulatus in Papua New Guinea (PNG. Our field studies in PNG demonstrated that An. punctulatus utilizes the melanization immune response as a natural mechanism of filarial worm resistance against invading W. bancrofti microfilariae. We then conducted laboratory studies utilizing the mosquitoes Armigeres subalbatus and Aedes aegypti and the parasites Brugia malayi, Brugia pahangi, Dirofilaria immitis, and Plasmodium gallinaceum to evaluate the hypothesis that immune activation and/or development by filarial worms negatively impact Plasmodium development in co-infected mosquitoes. Ar. subalbatus used in this study are natural vectors of P. gallinaceum and B. pahangi and they are naturally refractory to B. malayi (melanization-based refractoriness.Mosquitoes were dissected and Plasmodium development was analyzed six days after blood feeding on either P. gallinaceum alone or after taking a bloodmeal containing both P. gallinaceum and B. malayi or a bloodmeal containing both P. gallinaceum and B. pahangi. There was a significant reduction in the prevalence and mean intensity of Plasmodium infections in two species of mosquito that had dual infections as compared to those mosquitoes that were infected with Plasmodium alone, and was independent of whether the mosquito had a melanization immune response to the filarial worm or not. However, there was no reduction in Plasmodium development when filarial worms were present in the bloodmeal (D. immitis but midgut penetration was absent, suggesting that factors associated with penetration of the midgut by filarial worms likely are responsible for the observed reduction in malaria parasite infections.These results could have an
DEFF Research Database (Denmark)
Jaoko, Walter G; Simonsen, Paul E; Meyrowitsch, Dan W
2006-01-01
bancrofti endemicity. In the high endemicity community, intensities of the measured antibodies were significantly associated with infection status. IgG1, IgG2, and IgE were negatively associated with microfilaria (MF) status, IgG3 was negatively associated with circulating filarial antigen (CFA) status......, and IgG4 was positively associated with CFA status. None of the associations were significantly influenced by chronic lymphatic disease status. In contrast, IgG1, IgG2, and IgG4 responses were less vigorous in the low endemicity community and, except for IgG4, did not show any significant associations...... with MF or CFA status. The IgG3 responses were considerably more vigorous in the low endemicity community than in the high endemicity one. Only IgG4 responses exhibited a rather similar pattern in the two communities, being significantly positively associated with CFA status in both communities. The IgG4...
A Clinico- Epidemiological Study Of Filarial Related Orthopaedic Manifestations
Directory of Open Access Journals (Sweden)
Patond K.R
1992-01-01
Full Text Available An epidemiological study was undertaken to study the incidence and distribution of orthopaedic manifestations of filariasis in an endemic area. A total of 207 cases were clinically examined and investigated. Patients were divided into three groups , viz., Group A: Orthopaedic manifestations with no history of filariasis . Group B: Orthopaedic manifestations with history of filariasis such as microfilaraemia or filarial fevers etc., Group C: Orthopaedic manifestations with chronic manifestations such as elephantiasis, hydrocele etc. To confirm filarial etiology, all the cases were examined for the presence of filarial antibody by indirect ELISA using wuchereda bancrofti microfilarial excretory- secretary antigen (wd Mf ESAg . A total of 61 of 102 patients of Group A, 14 of 21 patients of group B, and 73 of 84 patients of Group C were positive for filarial antibody. This study showed the prevalence of filarial antibody in about 71.4% of various orthopaedic manifestations.
Polyanhydride Nanoparticle Delivery Platform Dramatically Enhances Killing of Filarial Worms.
Directory of Open Access Journals (Sweden)
Andrea M Binnebose
Full Text Available Filarial diseases represent a significant social and economic burden to over 120 million people worldwide and are caused by endoparasites that require the presence of symbiotic bacteria of the genus Wolbachia for fertility and viability of the host parasite. Targeting Wolbachia for elimination is a therapeutic approach that shows promise in the treatment of onchocerciasis and lymphatic filariasis. Here we demonstrate the use of a biodegradable polyanhydride nanoparticle-based platform for the co-delivery of the antibiotic doxycycline with the antiparasitic drug, ivermectin, to reduce microfilarial burden and rapidly kill adult worms. When doxycycline and ivermectin were co-delivered within polyanhydride nanoparticles, effective killing of adult female Brugia malayi filarial worms was achieved with approximately 4,000-fold reduction in the amount of drug used. Additionally the time to death of the macrofilaria was also significantly reduced (five-fold when the anti-filarial drug cocktail was delivered within polyanhydride nanoparticles. We hypothesize that the mechanism behind this dramatically enhanced killing of the macrofilaria is the ability of the polyanhydride nanoparticles to behave as a Trojan horse and penetrate the cuticle, bypassing excretory pumps of B. malayi, and effectively deliver drug directly to both the worm and Wolbachia at high enough microenvironmental concentrations to cause death. These provocative findings may have significant consequences for the reduction in the amount of drug and the length of treatment required for filarial infections in terms of patient compliance and reduced cost of treatment.
Filarial excretory-secretory products induce human monocytes to produce lymphangiogenic mediators.
Directory of Open Access Journals (Sweden)
Tiffany Weinkopff
2014-07-01
Full Text Available The nematodes Wuchereria bancrofti and Brugia spp. infect over 120 million people worldwide, causing lymphedema, elephantiasis and hydrocele, collectively known as lymphatic filariasis. Most infected individuals appear to be asymptomatic, but many exhibit sub-clinical manifestations including the lymphangiectasia that likely contributes to the development of lymphedema and elephantiasis. As adult worm excretory-secretory products (ES do not directly activate lymphatic endothelial cells (LEC, we investigated the role of monocyte/macrophage-derived soluble factors in the development of filarial lymphatic pathology. We analyzed the production of IL-8, IL-6 and VEGF-A by peripheral blood mononuclear cells (PBMC from naïve donors following stimulation with filarial ES products. ES-stimulated PBMCs produced significantly more IL-8, IL-6 and VEGF-A compared to cells cultured in medium alone; CD14(+ monocytes appear to be the primary producers of IL-8 and VEGF-A, but not IL-6. Furthermore, IL-8, IL-6 and VEGF-A induced in vitro tubule formation in LEC Matrigel cultures. Matrigel plugs supplemented with IL-8, IL-6, VEGF-A, or with supernatants from ES-stimulated PBMCs and implanted in vivo stimulated lymphangiogenesis. Collectively, these data support the hypothesis that monocytes/macrophages exposed to filarial ES products may modulate lymphatic function through the secretion of soluble factors that stimulate the vessel growth associated with the pathogenesis of filarial disease.
Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David
2011-12-15
Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.
The burden of non-filarial elephantiasis in Ethiopia.
Animut, Abebe
2007-12-01
Although known for many years, non-filarial elephantiasis remains a public health problem in tropical Africa, including the farming community of Ethiopia. The problem may be exacerbated in women who shoulder most of the burden of agricultural labour in the countryside. The intention of this brief review is to emphasise the burden of the disease and to alert researchers and organisations concerned with health care and prevention.
Directory of Open Access Journals (Sweden)
Sasisekhar Bennuru
2009-12-01
Full Text Available Even in the absence of an adaptive immune system in murine models, lymphatic dilatation and dysfunction occur in filarial infections, although severe irreversible lymphedema and elephantiasis appears to require an intact adaptive immune response in human infections. To address how filarial parasites and their antigens influence the lymphatics directly, human lymphatic endothelial cells were exposed to filarial antigens, live parasites, or infected patient serum. Live filarial parasites or filarial antigens induced both significant LEC proliferation and differentiation into tube-like structures in vitro. Moreover, serum from patently infected (microfilaria positive patients and those with longstanding chronic lymphatic obstruction induced significantly increased LEC proliferation compared to sera from uninfected individuals. Differentiation of LEC into tube-like networks was found to be associated with significantly increased levels of matrix metalloproteases and inhibition of their TIMP inhibitors (Tissue inhibitors of matrix metalloproteases. Comparison of global gene expression induced by live parasites in LEC to parasite-unexposed LEC demonstrated that filarial parasites altered the expression of those genes involved in cellular organization and development as well as those associated with junction adherence pathways that in turn decreased trans-endothelial transport as assessed by FITC-Dextran. The data suggest that filarial parasites directly induce lymphangiogenesis and lymphatic differentiation and provide insight into the mechanisms underlying the pathology seen in lymphatic filariasis.
Detection of canine pneumovirus in dogs with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe
2013-12-01
Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.
Considerations for using minocycline vs doxycycline for treatment of canine heartworm disease.
Papich, Mark G
2017-11-09
Doxycycline has been considered the first drug of choice for treating Wolbachia, a member of the Rickettsiaceae, which has a symbiotic relationship with filarial worms, including heartworms. Wolbachia, is susceptible to tetracyclines, which have been used as adjunctive treatments for heartworm disease. Treatment with doxycycline reduces Wolbachia numbers in all stages of heartworms and improves outcomes and decreased microfilaremia in dogs treated for heartworm disease. The American Heartworm Society recommends treatment with doxycycline in dogs diagnosed with heartworm disease at a dose of 10 mg/kg twice daily for 28 days. If doxycycline is not available, minocycline can be considered as a substitute. However, minocycline has not undergone an evaluation in dogs with heartworm disease, nor has an effective dose been established. Minocycline is an attractive option because of the higher cost of doxycycline and new pharmacokinetic information for dogs that provides guidance for appropriate dosage regimens to achieve pharmacokinetic-pharmacodynamic (PK-PD) targets. Published reports from the Anti-Wolbachia Consortium (A-WOL) indicate superior in vitro activity of minocycline over doxycycline. Studies performed in mouse models to measure anti-Wolbachia activity showed that minocycline was 1.7 times more effective than doxycycline, despite a 3-fold lower pharmacokinetic exposure. To achieve the same exposure as achieved in the mouse infection model, a pharmacokinetic-pharmacodynamic (PK-PD) analysis was conducted to determine optimal dosages for dogs. The analysis showed that an oral minocycline dose of 3.75 to 5 mg/kg administered twice daily would attain similar targets as observed in mice and predicted for human infections. There are potentially several advantages for use of minocycline in animals. It is well absorbed from oral administration, it has less protein binding than doxycycline (65% vs 92%) allowing for better distribution into tissue, and it is
European surveillance of emerging pathogens associated with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe
2017-12-01
Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.
Podoconiosis - non-filarial geochemical elephantiasis - a neglected tropical disease?
Nenoff, Pietro; Simon, Jan Christoph; Muylowa, Grace K; Davey, Gail
2010-01-01
Podoconiosis or mossy foot is a form of non-filarial lymphedema. This geochemical elephantiasis is a disabling condition caused by the passage of microparticles of silica and aluminum silicates through the skin of people walking barefoot in areas with a high content of soil of volcanic origin. Podoconiosis is widespread in tropical Africa, Central America and North India, yet it remains a neglected and under-researched condition. The disabling effects of podoconiosis cause great hardship to patients. It adversely affects the economic (reduced productivity and absenteeism), social (marriage, education, etc.) and psychological (social stigma) well-being of those affected. Podoconiosis can be prevented; the main primary preventive measure is protective footwear. Secondary measures include a strict hygiene regimen and compression therapy, which can reverse initial lesions. Tertiary approaches include surgical management, such as shaving operations to reduce hyperplastic and verrucous elephantiasis.
Ramasindrazana, Beza; Dellagi, Koussay; Lagadec, Erwan; Randrianarivelojosia, Milijaona; Goodman, Steven M; Tortosa, Pablo
2016-01-01
We investigated filarial infection in Malagasy bats to gain insights into the diversity of these parasites and explore the factors shaping their distribution. Samples were obtained from 947 individual bats collected from 52 sites on Madagascar and representing 31 of the 44 species currently recognized on the island. Samples were screened for the presence of micro- and macro-parasites through both molecular and morphological approaches. Phylogenetic analyses showed that filarial diversity in Malagasy bats formed three main groups, the most common represented by Litomosa spp. infecting Miniopterus spp. (Miniopteridae); a second group infecting Pipistrellus cf. hesperidus (Vespertilionidae) embedded within the Litomosoides cluster, which is recognized herein for the first time from Madagascar; and a third group composed of lineages with no clear genetic relationship to both previously described filarial nematodes and found in M. griveaudi, Myotis goudoti, Neoromicia matroka (Vespertilionidae), Otomops madagascariensis (Molossidae), and Paratriaenops furculus (Hipposideridae). We further analyzed the infection rates and distribution pattern of Litomosa spp., which was the most diverse and prevalent filarial taxon in our sample. Filarial infection was disproportionally more common in males than females in Miniopterus spp., which might be explained by some aspect of roosting behavior of these cave-dwelling bats. We also found marked geographic structure in the three Litomosa clades, mainly linked to bioclimatic conditions rather than host-parasite associations. While this study demonstrates distinct patterns of filarial nematode infection in Malagasy bats and highlights potential drivers of associated geographic distributions, future work should focus on their alpha taxonomy and characterize arthropod vectors.
Directory of Open Access Journals (Sweden)
Beza Ramasindrazana
Full Text Available We investigated filarial infection in Malagasy bats to gain insights into the diversity of these parasites and explore the factors shaping their distribution. Samples were obtained from 947 individual bats collected from 52 sites on Madagascar and representing 31 of the 44 species currently recognized on the island. Samples were screened for the presence of micro- and macro-parasites through both molecular and morphological approaches. Phylogenetic analyses showed that filarial diversity in Malagasy bats formed three main groups, the most common represented by Litomosa spp. infecting Miniopterus spp. (Miniopteridae; a second group infecting Pipistrellus cf. hesperidus (Vespertilionidae embedded within the Litomosoides cluster, which is recognized herein for the first time from Madagascar; and a third group composed of lineages with no clear genetic relationship to both previously described filarial nematodes and found in M. griveaudi, Myotis goudoti, Neoromicia matroka (Vespertilionidae, Otomops madagascariensis (Molossidae, and Paratriaenops furculus (Hipposideridae. We further analyzed the infection rates and distribution pattern of Litomosa spp., which was the most diverse and prevalent filarial taxon in our sample. Filarial infection was disproportionally more common in males than females in Miniopterus spp., which might be explained by some aspect of roosting behavior of these cave-dwelling bats. We also found marked geographic structure in the three Litomosa clades, mainly linked to bioclimatic conditions rather than host-parasite associations. While this study demonstrates distinct patterns of filarial nematode infection in Malagasy bats and highlights potential drivers of associated geographic distributions, future work should focus on their alpha taxonomy and characterize arthropod vectors.
APPLICATION OF BIOTECHNOLOGY TO THE STUDY OF FILARIAL PARASITES AND THEIR VECTORS
Directory of Open Access Journals (Sweden)
A. C. Vickery
2012-09-01
Full Text Available Over 200 species of filarial parasites have been described, although the life cycle and nature of their obligate intermediate arthropod vectors have been identified for only about a quarter of them. Traditional methods of studying phylogenetic relationships between closely related parasite species have utilized morphologic, biochemical and biologic characteristics, usually of the microfilarial stage. Identification of competent vectors from among complexes of sibling species, has employed similar techniques, despite the fact that differences between geographical isolates may reflect environmental rather than genetically controlled factors. Studies of the prevalence and transmission of animal, human and zoonotic filarids, so important for vector identification and control, has lead to the examination of filarial parasites at the genetic level. Genomic DNA libraries are being constructed and screened for clones which are species specific. From this work, DNA probes which can accurately enumerate larval stages in vector squash preparations, and monoclonal antibodies specific for defined filarial antigens, are being prepared. The nucleotide sequences of rRNA are also being defined. The application of these technologies to the study of filarial parasites and their vectors, promises to not only allow the construction of accurate phylogenetic trees, but also to provide the data necessary for the identification and control of the vectors of filarial pathogens of animals and man.
Directory of Open Access Journals (Sweden)
Hiruni Harischandra
2018-04-01
Full Text Available The filarial nematode Brugia malayi is an etiological agent of Lymphatic Filariasis. The capability of B. malayi and other parasitic nematodes to modulate host biology is recognized but the mechanisms by which such manipulation occurs are obscure. An emerging paradigm is the release of parasite-derived extracellular vesicles (EV containing bioactive proteins and small RNA species that allow secretion of parasite effector molecules and their potential trafficking to host tissues. We have previously described EV release from the infectious L3 stage B. malayi and here we profile vesicle release across all intra-mammalian life cycle stages (microfilariae, L3, L4, adult male and female worms. Nanoparticle Tracking Analysis was used to quantify and size EVs revealing discrete vesicle populations and indicating a secretory process that is conserved across the life cycle. Brugia EVs are internalized by murine macrophages with no preference for life stage suggesting a uniform mechanism for effector molecule trafficking. Further, the use of chemical uptake inhibitors suggests all life stage EVs are internalized by phagocytosis. Proteomic profiling of adult male and female EVs using nano-scale LC-MS/MS described quantitative and qualitative differences in the adult EV proteome, helping define the biogenesis of Brugia EVs and revealing sexual dimorphic characteristics in immunomodulatory cargo. Finally, ivermectin was found to rapidly inhibit EV release by all Brugia life stages. Further this drug effect was also observed in the related filarial nematode, the canine heartworm Dirofilaria immitis but not in an ivermectin-unresponsive field isolate of that parasite, highlighting a potential mechanism of action for this drug and suggesting new screening platforms for anti-filarial drug development.
Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology.
Fenger, Joelle M; London, Cheryl A; Kisseberth, William C
2014-01-01
Osteosarcoma (OSA) is the most common form of malignant bone cancer in children and dogs, although the disease occurs in dogs approximately 10 times more frequently than in people. Multidrug chemotherapy and aggressive surgical techniques have improved survival; however, new therapies for OSA are critical, as little improvement in survival times has been achieved in either dogs or people over the past 15 years, even with significant efforts directed at the incorporation of novel therapeutic approaches. Both clinical and molecular evidence suggests that human and canine OSA share many key features, including tumor location, presence of microscopic metastatic disease at diagnosis, development of chemotherapy-resistant metastases, and altered expression/activation of several proteins (e.g. Met, ezrin, phosphatase and tensin homolog, signal transducer and activator of transcription 3), and p53 mutations, among others. Additionally, canine and pediatric OSA exhibit overlapping transcriptional profiles and shared DNA copy number aberrations, supporting the notion that these diseases are similar at the molecular level. This review will discuss the similarities between pediatric and canine OSA with regard to histology, biologic behavior, and molecular genetic alterations that indicate canine OSA is a relevant, spontaneous, large animal model of the pediatric disease and outline how the study of naturally occurring OSA in dogs will offer additional insights into the biology and future treatment of this disease in both children and dogs. © The Author 2014. Published by Oxford University Press on behalf of the Institute for Laboratory Animal Research. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Glycogen storage disease type Ia in canines: a model for human metabolic and genetic liver disease.
Specht, Andrew; Fiske, Laurie; Erger, Kirsten; Cossette, Travis; Verstegen, John; Campbell-Thompson, Martha; Struck, Maggie B; Lee, Young Mok; Chou, Janice Y; Byrne, Barry J; Correia, Catherine E; Mah, Cathryn S; Weinstein, David A; Conlon, Thomas J
2011-01-01
A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including "lactic acidosis", larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.
Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease
Directory of Open Access Journals (Sweden)
Andrew Specht
2011-01-01
Full Text Available A canine model of Glycogen storage disease type Ia (GSDIa is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.
Study on clinical symptoms in canine cardiac diseases
Directory of Open Access Journals (Sweden)
F. Karlette Anne
Full Text Available Cardiac diseases in canines are an extensively studied phenomenon all over the world but meagre information has been reported in India. Certain problems, including historical, physical, and laboratory abnormalities, are associated with cardiovascular or pulmonary disease. In India however, the recognition of canine cardiac diseases has been delayed, and ignored on account of lack of awareness and knowledge by the owner and inadequate diagnostic facility to a field veterinarian. Considering the above facts, the present study was undertaken in Gujarat to survey the prevalence of common cardiac diseases in hospital population of dogs along with the clinical symptoms which often goes undetected due to lack of proper diagnostic techniques to be implied and the most forms of heart disease may be present for many years before any evidence of failure develops. In the present study most of the clinical cases of cardiac diseases were presented with a history of nocturnal coughing (seven cases; 2.55%, exercise intolerance (five cases; 1.82%, partial or complete anorexia (five cases; 1.82%, swelling in abdominal area (four cases; 1.45%, dullness and depression (two cases; 0.72%, cachexia and hepatojugular pulsation (one case each; 0.36% each at times. [Vet World 2009; 2(8.000: 307-309
Disease Modeling and Gene Therapy of Copper Storage Disease in Canine Hepatic Organoids
Directory of Open Access Journals (Sweden)
Sathidpak Nantasanti
2015-11-01
Full Text Available The recent development of 3D-liver stem cell cultures (hepatic organoids opens up new avenues for gene and/or stem cell therapy to treat liver disease. To test safety and efficacy, a relevant large animal model is essential but not yet established. Because of its shared pathologies and disease pathways, the dog is considered the best model for human liver disease. Here we report the establishment of a long-term canine hepatic organoid culture allowing undifferentiated expansion of progenitor cells that can be differentiated toward functional hepatocytes. We show that cultures can be initiated from fresh and frozen liver tissues using Tru-Cut or fine-needle biopsies. The use of Wnt agonists proved important for canine organoid proliferation and inhibition of differentiation. Finally, we demonstrate that successful gene supplementation in hepatic organoids of COMMD1-deficient dogs restores function and can be an effective means to cure copper storage disease.
Interspecies dynamics among bacteria associated with canine periodontal disease.
Sanguansermsri, P; Nobbs, A H; Jenkinson, H F; Surarit, R
2018-02-01
The etiology and pathogenic mechanisms associated with canine periodontal disease are less well understood than the disease in humans. In this study we have reconstructed defined consortia biofilms in vitro of microorganisms identified as prevalent in a same-breed cohort of dogs with or without periodontal disease. Frederiksenia canicola and Neisseria canis were selected as potential early colonizers of salivary pellicle, and Fusobacterium nucleatum and Porphyromonas gulae were included as high incidence canine oral bacteria. N. canis formed a biofilm substratum under aerobic conditions, but was unable to tolerate anaerobic conditions. Fr. canicola exhibited synergistic biofilm growth with Po. gulae under anaerobic conditions, but displayed an antagonistic relationship with Fu. nucleatum. However, strong co-adhesion between Fu. nucleatum and Po. gulae was able to overcome the inhibitory effects of Fr. canicola to facilitate three-species biofilm formation. Parvimonas micra, an anaerobic, asaccharolytic Gram-positive coccus found only under disease conditions in vivo, was able to form biofilms in conjunction with Fr. canicola and Po. gulae. Furthermore, the specific proteolytic activities of biofilms containing Fr. canicola and Po. gulae or Fu. nucleatum and Po. gulae were increased several-fold upon the addition of Pa. micra. This suggests that anaerobic cocci such as Pa. micra might provide a catalyst for progressive tissue destruction, inflammation and alveolar bone loss in canine periodontal disease, in keeping with the keystone-pathogen hypothesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio
2016-08-30
A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.
ANTIGENAEMIA AS AN INDICATOR OF FILARIAL ENDEMICITY
Directory of Open Access Journals (Sweden)
F. Partono
2012-09-01
Full Text Available This is a report of 1 -year evaluation of chemotherapeutic intervention in an area of Indonesia endemic for lymphatic filariasis. Control measures were initiated in 1977 by parasite control, informal health education, and community participation at the village level, well in accord with the WHO-concept of health for all. Diethylcarbamazine (DEC was mass distributed in 1977 and 1988, and selectively distributed in 1978, 1979, 1981, and 1982 to those who were micro-filaraemic prior to DEC treatments, those with a history of adenoly mphangitis over the previous one year period, and to all new comers. In addition, each villager with acute symptoms of adenolymphangitis was immediately treated with a single course of 300 mg DEC for 10 days. No intervention measures were taken between 1982 to 1988, and no attempt was taken to control the vector or to restrict movement between controlled and uncontrolled areas during the whole studies. With these measures, the microfilaria (mf rate decreased from 30% to 0%, the adenolymphangitis rate from 46% to 11%, and the elephantiasis rate from 35% to 3%. The abatement of acute and chronic filarial symptoms over the study period and the disappearance of microfilaremia in the community are pointing towards the possibility of eradicating the partasite from the community. To test this hypothesis, serum samples were tested for circulating filarial antigen by a two-site antigen capture assay employing anti-phosphorylcholine monoclonal antibodies. There was a sharp fall in circulating antigenaemia, demonstrating that infection has either been eliminated from nearly all villagers, or that intensity of infection is now undetectably low. We feel that antigenaemia can be used as an indicator of filarial endemicity.
Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease
International Nuclear Information System (INIS)
Erles, Kerstin; Toomey, Crista; Brooks, Harriet W.; Brownlie, Joe
2003-01-01
An investigation into the causes of canine infectious respiratory disease was carried out in a large rehoming kennel. Tissue samples taken from the respiratory tract of diseased dogs were tested for the presence of coronaviruses using RT-PCR with conserved primers for the polymerase gene. Sequence analysis of four positive samples showed the presence of a coronavirus with high similarity to both bovine and human coronavirus (strain OC43) in their polymerase and spike genes, whereas there was a low similarity to comparable genes in the enteric canine coronavirus. This canine respiratory coronavirus (CRCV) was detected by RT-PCR in 32/119 tracheal and 20/119 lung samples, with the highest prevalence being detected in dogs with mild clinical symptoms. Serological analysis showed that the presence of antibodies against CRCV on the day of entry into the kennel decreased the risk of developing respiratory disease
A survey of canine tick-borne diseases in India
Directory of Open Access Journals (Sweden)
Coleman Glen T
2011-07-01
Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.
Ecology of genus Porphyromonas in canine periodontal disease.
Isogai, H; Kosako, Y; Benno, Y; Isogai, E
1999-09-01
Asaccharolytic pigmented Porphyromonas species, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were isolated from the plaque of adult dogs, but not from any oral sites of puppies and adolescent dogs. With age-dependency, the proportion of Porphyromonas species in the flora of plaque increased. Isolation of the genus Porphyromonas was clearly associated with the progress of periodontol disease. We suggested that Porphyromonas is the exogenous organism and obligate pathogen for canine periodontal diseases.
Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease
Specht, Andrew; Fiske, Laurie; Erger, Kirsten; Cossette, Travis; Verstegen, John; Campbell-Thompson, Martha; Struck, Maggie B.; Lee, Young Mok; Chou, Janice Y.; Byrne, Barry J.; Correia, Catherine E.; Mah, Cathryn S.; Weinstein, David A.; Conlon, Thomas J.
2011-01-01
A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size,...
Canine vector-borne diseases in Brazil
Dantas-Torres, Filipe
2008-01-01
Canine vector-borne diseases (CVBDs) are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi), bacteria (e.g., Anaplasma platys and Ehrlichia canis), and helminths (e.g., Dirofilaria immitis and Dipylidium caninum) that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance) of CVBDs in Brazil and discusses research gaps to be addressed in future studies. PMID:18691408
Canine vector-borne diseases in Brazil
Directory of Open Access Journals (Sweden)
Dantas-Torres Filipe
2008-08-01
Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.
Detection of circulating parasite-derived microRNAs in filarial infections.
Directory of Open Access Journals (Sweden)
Lucienne Tritten
2014-07-01
Full Text Available Filarial nematodes cause chronic and profoundly debilitating diseases in both humans and animals. Applications of novel technology are providing unprecedented opportunities to improve diagnosis and our understanding of the molecular basis for host-parasite interactions. As a first step, we investigated the presence of circulating miRNAs released by filarial nematodes into the host bloodstream. miRNA deep-sequencing combined with bioinformatics revealed over 200 mature miRNA sequences of potential nematode origin in Dirofilaria immitis-infected dog plasma in two independent analyses, and 21 in Onchocerca volvulus-infected human serum. Total RNA obtained from D. immitis-infected dog plasma was subjected to stem-loop RT-qPCR assays targeting two detected miRNA candidates, miR-71 and miR-34. Additionally, Brugia pahangi-infected dog samples were included in the analysis, as these miRNAs were previously detected in extracts prepared from this species. The presence of miR-71 and miR-34 discriminated infected samples (both species from uninfected samples, in which no specific miRNA amplification occurred. However, absolute miRNA copy numbers were not significantly correlated with microfilaraemia for either parasite. This may be due to the imprecision of mf counts to estimate infection intensity or to miRNA contributions from the unknown number of adult worms present. Nonetheless, parasite-derived circulating miRNAs are found in plasma or serum even for those species that do not live in the bloodstream.
Directory of Open Access Journals (Sweden)
Bo Wu
2009-07-01
Full Text Available Filarial parasites (e.g., Brugia malayi, Onchocerca volvulus, and Wuchereria bancrofti are causative agents of lymphatic filariasis and onchocerciasis, which are among the most disabling of neglected tropical diseases. There is an urgent need to develop macro-filaricidal drugs, as current anti-filarial chemotherapy (e.g., diethylcarbamazine [DEC], ivermectin and albendazole can interrupt transmission predominantly by killing microfilariae (mf larvae, but is less effective on adult worms, which can live for decades in the human host. All medically relevant human filarial parasites appear to contain an obligate endosymbiotic bacterium, Wolbachia. This alpha-proteobacterial mutualist has been recognized as a potential target for filarial nematode life cycle intervention, as antibiotic treatments of filarial worms harboring Wolbachia result in the loss of worm fertility and viability upon antibiotic treatments both in vitro and in vivo. Human trials have confirmed this approach, although the length of treatments, high doses required and medical counter-indications for young children and pregnant women warrant the identification of additional anti-Wolbachia drugs.Genome sequence analysis indicated that enzymes involved in heme biosynthesis might constitute a potential anti-Wolbachia target set. We tested different heme biosynthetic pathway inhibitors in ex vivo B. malayi viability assays and report a specific effect of N-methyl mesoporphyrin (NMMP, which targets ferrochelatase (FC, the last step. Our phylogenetic analysis indicates evolutionarily significant divergence between Wolbachia heme genes and their human homologues. We therefore undertook the cloning, overexpression and analysis of several enzymes of this pathway alongside their human homologues, and prepared proteins for drug targeting. In vitro enzyme assays revealed a approximately 600-fold difference in drug sensitivities to succinyl acetone (SA between Wolbachia and human 5
Amala, Mathimaran; Rajamanikandan, Sundaraj; Prabhu, Dhamodharan; Surekha, Kanagarajan; Jeyakanthan, Jeyaraman
2018-02-06
Lymphatic filariasis is a debilitating vector borne parasitic disease that infects human lymphatic system by nematode Brugia malayi. Currently available anti-filarial drugs are effective only on the larval stages of parasite. So far, no effective drugs are available for humans to treat filarial infections. In this regard, aspartate semialdehyde dehydrogenase (ASDase) in lysine biosynthetic pathway from Wolbachia endosymbiont Brugia malayi represents an attractive therapeutic target for the development of novel anti-filarial agents. In this present study, molecular modeling combined with molecular dynamics simulations and structure-based virtual screening were performed to identify potent lead molecules against ASDase. Based on Glide score, toxicity profile, binding affinity and mode of interactions with the ASDase, five potent lead molecules were selected. The molecular docking and dynamics results revealed that the amino acid residues Arg103, Asn133, Cys134, Gln161, Ser164, Lys218, Arg239, His246, and Asn321 plays a crucial role in effective binding of Top leads into the active site of ASDase. The stability of the ASDase-lead complexes was confirmed by running the 30 ns molecular dynamics simulations. The pharmacokinetic properties of the identified lead molecules are in the acceptable range. Furthermore, density functional theory and binding free energy calculations were performed to rank the lead molecules. Thus, the identified lead molecules can be used for the development of anti-filarial agents to combat the pathogenecity of Brugia malayi.
Geshere Oli, Geleta; Tekola Ayele, Fasil; Petros, Beyene
2012-06-01
To determine whether the elephantiasis in Midakegn district, central Ethiopia, is filarial or non-filarial (podoconiosis) using serological, parasitological and clinical examinations, and to estimate its prevalence. At house-to-house visits in 330 randomly selected households, all household members who had elephantiasis were interviewed and clinically examined at the nearby health centre to confirm the presence of elephantiasis, check the presence of scrotal swelling and rule out the other causes of lymphoedema. A midnight blood sample was obtained from each participant with elephantiasis for microscopic examination of Wuchereria bancrofti microfilaria. A daytime blood sample was obtained from half of the participants for serological confirmation using the immuno-chromatographic test card. Consistent with the features of podoconiosis, none of the elephantiasis cases had consistently worn shoes since childhood; 94.3% had bilateral swelling limited below the level of the knees; no individual had thigh or scrotal elephantiasis; parasitological test for microfilariae and serological tests for W. bancrofti antigen were negative in all samples. The prevalence of the disease was 7.4% and it peaked in the third decade of life, the most economically active age. Midakegn District has a high prevalence of podoconiosis and no filarial elephantiasis. Prevention, treatment and control of podoconiosis must be among the top priorities of public health programmes. © 2012 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Elephantiasis of non-filarial origin (podoconiosis) in the highlands of north-western Cameroon.
Wanji, S; Tendongfor, N; Esum, M; Che, J N; Mand, S; Tanga Mbi, C; Enyong, P; Hoerauf, A
2008-09-01
Lymphoedema, a condition of localized fluid retention, results from a compromised lymphatic system. Although one common cause in the tropics is infection with filarial worms, non-filarial lymphoedema, also known as podoconiosis, has been reported among barefoot farmers in volcanic highland zones of Africa, Central and South America and north-western India. There are conflicting reports on the causes of lymphoedema in the highland regions of Cameroon, where the condition is of great public-health importance. To characterise the focus of lymphoedema in the highlands of the North West province of Cameroon and investigate its real causes, a cross-sectional study was carried out on the adults (aged > or =15 years) living in the communities that fall within the Ndop and Tubah health districts. The subjects, who had to have lived in the study area for at least 10 years, were interviewed, examined clinically, and, when possible, checked for microfilaraemia. The cases of lymphoedema confirmed by ultrasonography and a random sample of the other subjects were also tested for filarial antigenaemia. The interviews, which explored knowledge, attitudes and perceptions (KAP) relating to lymphoedema, revealed that the condition was well known, with each study community having a local name for it. Of the 834 individuals examined clinically, 66 (8.1%) had lymphoedema of the lower limb, with all the clinical stages of this condition represented. None of the 792 individuals examined parasitologically, however, had microfilariae of W. bancrofti (or any other filarial parasite) in their peripheral blood, and only one (0.25%) of the 399 individuals tested for the circulating antigens of W. bancrofti gave a positive result. In addition, none of the 504 mosquitoes caught landing on human bait in the study area and dissected was found to harbour any stage of W. bancrofti. These findings indicate that the elephantiasis seen in the North West province of Cameroon is of non-filarial origin.
Magnetic resonance imaging of canine degenerative lumbar spine diseases
International Nuclear Information System (INIS)
Karkkainen, M.; Punto, L.U.; Tulamo, R.M.
1993-01-01
Degenerative lumbar spine diseases, i.e., sacrolumbar stenosis, intervertebral disk degeneration and protrusion and spondylosis deformans of the canine lumbar spine were studied in eleven canine patients and three healthy controls using radiography and 0.02 T and 0.04 T low field magnetic resonance imaging. The T1 and T2 weighted images were obtained in sagittal and transverse planes. The loss of hydration of nucleus pulposus, taken as a sign of degeneration in the intervertebral disks, could be evaluated in both T1 and T2 weighted images. As a noninvasive method magnetic resonance imaging gave more exact information about the condition of intervertebral disks than did radiography. Sacrolumbar stenosis and compression of the spinal cord or cauda equina and surrounding tissue could be evaluated without contrast medium
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Molecular identification of bacteria associated with canine periodontal disease.
Riggio, Marcello P; Lennon, Alan; Taylor, David J; Bennett, David
2011-06-02
Periodontal disease is one of the most common diseases of adult dogs, with up to 80% of animals affected. The aetiology of the disease is poorly studied, although bacteria are known to play a major role. The purpose of this study was to identify the bacteria associated with canine gingivitis and periodontitis and to compare this with the normal oral flora. Swabs were obtained from the gingival margin of three dogs with gingivitis and three orally healthy controls, and subgingival plaque was collected from three dogs with periodontitis. Samples were subjected to routine bacterial culture. The prevalent species identified in the normal, gingivitis and periodontitis groups were uncultured bacterium (12.5% of isolates), Bacteroides heparinolyticus/Pasteurella dagmatis (10.0%) and Actinomyces canis (19.4%), respectively. Bacteria were also identified using culture-independent methods (16S rRNA gene sequencing) and the predominant species identified were Pseudomonas sp. (30.9% of clones analysed), Porphyromonas cangingivalis (16.1%) and Desulfomicrobium orale (12.0%) in the normal, gingivitis and periodontitis groups, respectively. Uncultured species accounted for 13.2%, 2.0% and 10.5%, and potentially novel species for 38.2%, 38.3% and 35.3%, of clones in the normal, gingivitis and periodontitis groups, respectively. This is the first study to use utilise culture-independent methods for the identification of bacteria associated with this disease. It is concluded that the canine oral flora in health and disease is highly diverse and also contains a high proportion of uncultured and, in particular, potentially novel species. Copyright © 2011 Elsevier B.V. All rights reserved.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
A novel method for objective vision testing in canine models of inherited retinal disease.
Gearhart, Patricia M; Gearhart, Chris C; Petersen-Jones, Simon M
2008-08-01
The use of canine models of retinal disease in the development of therapeutic strategies for inherited retinal disorders is a growing area of research. To evaluate accurately the success of potential vision-enhancing treatments, reliable methods for objectively assessing visual function in canine models is necessary. A simple vision-testing device was constructed that consisted of a junction box with four exit tunnels. Dogs were placed in the junction box and given one vision-based choice for exit. The first-choice tunnel and time to exit were recorded and analyzed. Two canine models of retinal disease with distinct molecular defects, a null mutation in the gene encoding the alpha subunit of rod cyclic GMP phosphodiesterase (PDE6A), and a null mutation in the gene encoding a retinal pigment epithelium-specific protein (RPE65) were tested and compared to those in unaffected dogs. With the use of bright light versus dim red light, the test differentiated between unaffected dogs and dogs affected with either mutation with a high degree of certainty. The white-light intensity series showed a significantly different performance between the unaffected and affected dogs. A significant difference in performance was detected between the dogs with each mutation. The results indicate that this novel canine vision-testing method is an accurate and sensitive means of distinguishing between unaffected dogs and dogs affected with two different forms of inherited retinal disease and should be useful as a means of assessing response to therapy in future studies.
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Directory of Open Access Journals (Sweden)
Coleman Glen T
2010-04-01
Full Text Available Abstract Despite the combination of favourable climate for parasites and vectors, and large populations of stray dogs, information concerning the epidemiology, diagnosis and management of canine vector-borne diseases in India is limited. However, with the country's expanding economy and adaptation to western culture, higher expectations and demands are being placed on veterinary surgeons for improved knowledge of diseases and control. This review aims to provide an overview of the current state of knowledge of these diseases in India and identify existing knowledge gaps in the literature which need to be addressed. The available literature on this subject, although limited, suggests that a number of canine vector-borne diseases such as filariasis, babesiosis and ehrlichiosis are endemic throughout India, as diagnosed mostly by morphological methods. Detailed investigations of the epidemiology and zoonotic potential of these pathogens has been neglected. Further study is essential to develop a better understanding of the diversity of canine vector-borne diseases in India, and their significance for veterinary and public health.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Directory of Open Access Journals (Sweden)
Madhusmita Bal
2016-11-01
Full Text Available Children born from filarial infected mothers are comparatively more susceptible to filarial infection than the children born to uninfected mothers. But the mechanism of such increased susceptibility to infection in early childhood is not exactly known. Several studies have shown the association of active filarial infection with T cell hypo-responsiveness which is mediated by regulatory T cells (Tregs. Since the Tregs develop in the thymus from CD4+ CD25hi thymocytes at an early stage of the human fetus, it can be hypothesized that the maternal infection during pregnancy affects the development of Tregs in children at birth as well as early childhood. Hence the present study was designed to test the hypothesis by selecting a cohort of pregnant mothers and children born to them subsequently in a filarial endemic area of Odisha, India.A total number of 49 pregnant mothers and children born to them subsequently have been followed up (mean duration 4.4 years in an area where the microfilariae (Mf rate has come down to <1% after institution of 10 rounds of annual mass drug administration (MDA. The infection status of mother, cord and children were assessed through detection of microfilariae (Mf and circulating filarial antigen (CFA. Expression of Tregs cells were measured by flow cytometry. The levels of IL-10 were evaluated by using commercially available ELISA kit. A significantly high level of IL-10 and Tregs have been observed in children born to infected mother compared to children of uninfected mother at the time of birth as well as during early childhood. Moreover a positive correlation between Tregs and IL-10 has been observed among the children born to infected mother.From these observations we predict that early priming of the fetal immune system by filarial antigens modulate the development of Tregs, which ultimately scale up the production of IL-10 in neonates and creates a milieu for high rate of acquisition of infection in children born
Sreenivas, Kirthika; Kalyanaraman, Haripriya; Babu, Subash; Narayanan, Rangarajan Badri
2017-11-01
Prolonged existence of filarial parasites and their molecules within the host modulate the host immune system to instigate their survival and induce inflammatory responses that contribute to disease progression. Recombinant Brugia malayi pepsin inhibitor (rBm33) modulates the host immune responses by skewing towards Th1 responses characterized by secretion of inflammatory molecules such as TNF-α, IL-6, nitric oxide (NO). Here we also specified the molecular signaling events triggered by rBm33 in peripheral blood mononuclear cells (PBMCs) of filarial endemic normals (EN). rBm33 predominantly enhanced the levels of nitric oxide in cultured PBMCs but did not result in oxidative stress to the host cells. Further, rBm33 treatment of human PBMCs resulted in higher GSH/GSSG levels. MYD88 dependent activation was found to be associated with rBm33 specific inflammatory cytokine production. rBm33 triggered intracellular signaling events also involved JNK activation in host PBMCs. In addition, c-Fos and not NF-κB was identified as the transcription factor regulating the expression of inflammatory cytokines in rBm33 stimulated PBMCs. rBm33 marked its role in filarial pathology by altered levels of growth factors but did not have a significant impact on matrix metalloproteinases (MMPs), tissue inhibitors of matrix metalloproteinases (TIMPs) activity of host PBMCs. Thus, the study outlines the signaling network of rBm33 induced inflammatory responses within the host immune cells. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
Wang, Zhu; Yang, Zheng; Lei, Yang-Yang; Zhang, Ya-Dong; Chen, Li-Da; Xie, Xiao-Yan; Lu, Ming-De; Wang, Wei
2015-08-01
The aim of this study was to explore the principle of moblile echogenicities in epididymis in patients with a history of postvasectomy or infertility, which were reported as the characteristic sonographic sign of filarial infection.We reported a 38-year-old man presented with a 3-year history of infertility after marriage. Ultrasound imaging revealed an enlarged body in the inner left epididymis along with innumerable punctate mobile echogenicities, which showed random to-and-fro movements in the left epididymis. This had previously been recognized as the sonographic filarial dance sign of live filarial worms or microfilaria. The patient subsequently underwent needle aspiration of the left epididymis.Histopathological examination confirmed that the mobile echogenicities were a large number of macrophages with phagocytized sperm or clumps of agglutinated sperm. Our report includes a video clip that will help familiarize readers with this phenomenon.Our case highlighted that moblile echogenicities should be an important sign for epididymal obstruction to initiate corresponding treatment.
Effect of Japanese Green Tea Extract on Canine Periodontal Diseases
Isogai, E.; Isogai, H.; Kimura, K.; Nishikawa, T.; Fujii, N.; Benno, Y.
2011-01-01
Asaccharolytic pigmented Porphyromonas strains were isolated from the plaque of dogs with gingivitis and periodontitis. Various species of Porphyromonas, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were detectable. Canine Porphyromonas were sensitive to Japanese green tea extract (JGTE). We examined the effects of dietary JGTE on periodontal diseases. A special diet was prepared on the basis of the minimum inhibitory concentration (MIC: 0.8 mg/ml) of ...
International Nuclear Information System (INIS)
Hamilton, R.G.; Alexander, E.; Adkinson, N.F.
1984-01-01
The performance of the radioimmunoprecipitation polyethylene glycol assay (RIPEGA) was examined for quantitation of filarial antigens (Brugia malayi and Dirofilaria immitis) in serum from infected human and animal hosts and non-infected controls. Multiple PEG concentrations were employed to determine the level of non-specific binding (NSB) in non-exposed human sera (NEHS) containing no filarial antigen. The NSB observed when 3 different 125 I-labelled IgG antibodies were added to 26 NEHS varied 3-fold and was correlated significantly with total serum IgM (r = 0.80, P 2 fragment of the 125 I-labelled antibody was used, but the correlation of NSB with total serum IgM remained significant (r = 0.57, P < 0.01). The presence of rheumatoid factor in NEHS sera also significantly increased NSB by an average of 3-fold. These effects eliminated the assay's ability to detect in sera from infected hosts filarial antigen the presence of which could be readily demonstrated by an immunoradiometric assay. The RIPEGA's precision (intra-assay coefficient of variation (CV) = 21% at 35% Bsub(max)) and reproducibility (inter-assay CV = 29% at 35% Bsub(max)) are less satisfactory than many alternative immunoassays. (Auth.)
A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.
Directory of Open Access Journals (Sweden)
Sandra J Laney
2008-06-01
Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.
Magnetic resonance findings of the corpus callosum in canine and feline lysosomal storage diseases.
Hasegawa, Daisuke; Tamura, Shinji; Nakamoto, Yuya; Matsuki, Naoaki; Takahashi, Kimimasa; Fujita, Michio; Uchida, Kazuyuki; Yamato, Osamu
2013-01-01
Several reports have described magnetic resonance (MR) findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats) and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment) of the corpus callosum in juvenile-onset gangliosidoses.
Magnetic resonance findings of the corpus callosum in canine and feline lysosomal storage diseases.
Directory of Open Access Journals (Sweden)
Daisuke Hasegawa
Full Text Available Several reports have described magnetic resonance (MR findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment of the corpus callosum in juvenile-onset gangliosidoses.
Magnetic Resonance Findings of the Corpus Callosum in Canine and Feline Lysosomal Storage Diseases
Hasegawa, Daisuke; Tamura, Shinji; Nakamoto, Yuya; Matsuki, Naoaki; Takahashi, Kimimasa; Fujita, Michio; Uchida, Kazuyuki; Yamato, Osamu
2013-01-01
Several reports have described magnetic resonance (MR) findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats) and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment) of the corpus callosum in juvenile-onset gangliosidoses. PMID:24386203
Directory of Open Access Journals (Sweden)
John A. Herrmann
2014-01-01
Full Text Available Four tick-borne diseases (TBDs, anaplasmosis, ehrlichiosis, Lyme disease (LD, and Rocky Mountain spotted fever (RMSF, are endemic in Illinois. The prevalence of human and canine cases of all four TBDs rose over the study period with significant differences in geographic distribution within the state. Among human cases, there were associations between cases of RMSF and LD and total forest cover, seasonal precipitation, average mean temperature, racial-ethnic groups, and gender. Estimated annual prevalence of three canine TBDs exceeded human TBD cases significantly in each region. There was concordance in the number of human and canine cases by county of residence, in annual prevalence trends, and in time of year at which they were diagnosed. To account for multiple environmental risk factors and to facilitate early diagnosis of cases, integrated surveillance systems must be developed and communication between veterinarians, physicians, and public health agencies must be improved.
Directory of Open Access Journals (Sweden)
Cathy Steel
2011-04-01
Full Text Available Chronic lymphatic filarial (LF infection is associated with suppression of parasite-specific T cell responses that persist even following elimination of infection. While several mechanisms have been implicated in mediating this T cell specific downregulation, a role for alterations in the homeostasis of T effector and memory cell populations has not been explored. Using multiparameter flow cytometry, we investigated the role of persistent filarial infection on the maintenance of T cell memory in patients from the filarial-endemic Cook Islands. Compared to filarial-uninfected endemic normals (EN, microfilaria (mf positive infected patients (Inf had a reduced CD4 central memory (T(CM compartment. In addition, Inf patients tended to have more effector memory cells (T(EM and fewer effector cells (T(EFF than did ENs giving significantly smaller T(EFF:T(EM ratios. These contracted T(CM and T(EFF populations were still evident in patients previously mf+ who had cleared their infection (CLInf. Moreover, the density of IL-7Rα, necessary for T memory cell maintenance (but decreased in T effector cells, was significantly higher on memory cells of Inf and CLInf patients, although there was no evidence for decreased IL-7 or increased soluble IL7-Rα, both possible mechanisms for signaling defects in memory cells. However, effector cells that were present in Inf and CLInf patients had lower percentages of HLA-DR suggesting impaired function. These changes in T cell populations appear to reflect chronicity of infection, as filarial-infected children, despite the presence of active infection, did not show alterations in the frequencies of these T cell phenotypes. These data indicate that filarial-infected patients have contracted T(CM compartments and a defect in effector cell development, defects that persist even following clearance of infection. The fact that these global changes in memory and effector cell compartments do not yet occur in infected children
Exoemission of Ethiopian soils and the endemicity of non-filarial elephantiasis
Energy Technology Data Exchange (ETDEWEB)
Davies, J.E. (Birmingham Univ. (UK). Dept. of Anatomy); Townsend, P.D. (Sussex Univ., Brighton (UK))
1983-01-01
Non-filarial elephantiasis is an endemic disease in the bare-footed population of Ethiopia. The distribution of this condition is linked with that of local red clay soil. Recently, thermoluminescence has been successfully used to distinguish between endemic and non-endemic soils. Instrinsic lattice defects, frozen in during cooling of volcanic material, are considered to be responsible for characteristic thermoluminescence signals. However, the biological reactivity of the absorbed soil particles will depend upon their surface properties. Exoemission has therefore been studied in samples from both endemic (5 samples) and non-endemic (4 samples) areas. All samples from endemic areas, on first heating, demonstrate an emission peak at 75/sup 0/C. Post-irradiation storage of samples in a moist atmosphere tends to decrease emissivity while wetting irreversibly reduces the response to irradiation. In an hydrated biological environment, this surface reactivity may be linked to the pathogenicity of the soil particles.
Exoemission of Ethiopian soils and the endemicity of non-filarial elephantiasis
International Nuclear Information System (INIS)
Davies, J.E.
1983-01-01
Non-filarial elephantiasis is an endemic disease in the bare-footed population of Ethiopia. The distribution of this condition is linked with that of local red clay soil. Recently, thermoluminescence has been successfully used to distinguish between endemic and non-endemic soils. Instrinsic lattice defects, frozen in during cooling of volcanic material, are considered to be responsible for characteristic thermoluminescence signals. However, the biological reactivity of the absorbed soil particles will depend upon their surface properties. Exoemission has therefore been studied in samples from both endemic (5 samples) and non-endemic (4 samples) areas. All samples from endemic areas, on first heating, demonstrate an emission peak at 75 0 C. Post-irradiation storage of samples in a moist atmosphere tends to decrease emissivity while wetting irreversibly reduces the response to irradiation. In an hydrated biological environement, this surface reactivity may be linked to the pathogenicity of the soil particles. (author)
Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.
Directory of Open Access Journals (Sweden)
Nicola Decaro
Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.
Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E
2016-05-23
Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms.
The Prevalence of Canine Oral Protozoa and Their Association with Periodontal Disease.
Patel, Niran; Colyer, Alison; Harris, Steve; Holcombe, Lucy; Andrew, Peter
2017-05-01
Periodontal disease is one of the most important health concerns for companion animals. Research into canine forms of periodontitis has focused on the identification and characterization of the bacterial communities present. However, other microorganisms are known to inhabit the oral cavity and could also influence the disease process. A novel, broad spectrum 18S PCR was developed and used, in conjunction with next-generation sequencing analyses to target the identification of protists. Trichomonas sp. and Entamoeba sp. were identified from 92 samples of canine plaque. The overall prevalence of trichomonads was 56.52% (52/92) and entamoebae was 4.34% (4/92). Next-generation sequencing of pooled healthy, gingivitis, early-stage periodontitis, and severe periodontitis samples revealed the proportion of trichomonad sequences to be 3.51% (health), 2.84% (gingivitis), 6.07% (early periodontitis), and 35.04% (severe periodontitis), respectively, and entamoebae to be 0.01% (health), 0.01% (gingivitis), 0.80% (early-stage periodontitis), and 7.91% (severe periodontitis) respectively. Both genera of protists were statistically associated with plaque from dogs with periodontal disease. These findings provide the first conclusive evidence for the presence of oral protozoa in dog plaque and suggest a possible role for protozoa in the periodontal disease process. © 2016 The Author(s) The Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.
Investigation of cell-free DNA in canine plasma and its relation to disease.
Burnett, Deborah L; Cave, Nicholas J; Gedye, Kristene R; Bridges, Janis P
2016-09-01
DNA is released from dying cells during apoptosis and necrosis. This cell-free DNA (cfDNA) diffuses into the plasma where it can be measured. In humans, an increase in cfDNA correlates with disease severity and prognosis. It was hypothesized that when DNA in canine plasma was measured by emission fluorometry without prior DNA extraction, the concentration of cfDNA would increase with disease severity. The diseased population consisted of 97 client-owned dogs. The clinically normal population consisted of nine client-owned dogs presenting for 'wellness screens', and 15 colony-owned Harrier Hounds. Plasma cfDNA was measured by fluorometry without prior DNA extraction. The effects of ex vivo storage conditions were evaluated in plasma from two clinically normal dogs. In all other dogs, plasma was separated within two hours of collection. The association between the cfDNA concentration in hospitalized dogs and a variety of clinical, clinicopathological and outcome variables was tested. The concentration of cfDNA was reliably measured when plasma was separated within two hours of blood collection. The diseased dogs had significantly higher cfDNA than clinically normal dogs (P Dogs that did not survive to discharge had significantly higher cfDNA concentrations than survivors (P = 0.02). Conclusions/Clinical Importance: The concentration of cfDNA in the plasma of diseased dogs is associated with disease severity and prognosis. Measurement of canine cfDNA could be a useful non-specific disease indicator and prognostic tool.
In vitro, in silico and in vivo studies of ursolic acid as an anti-filarial agent.
Directory of Open Access Journals (Sweden)
Komal Kalani
Full Text Available As part of our drug discovery program for anti-filarial agents from Indian medicinal plants, leaves of Eucalyptus tereticornis were chemically investigated, which resulted in the isolation and characterization of an anti-filarial agent, ursolic acid (UA as a major constituent. Antifilarial activity of UA against the human lymphatic filarial parasite Brugia malayi using in vitro and in vivo assays, and in silico docking search on glutathione-s-transferase (GST parasitic enzyme were carried out. The UA was lethal to microfilariae (mf; LC100: 50; IC50: 8.84 µM and female adult worms (LC100: 100; IC50: 35.36 µM as observed by motility assay; it exerted 86% inhibition in MTT reduction potential of the adult parasites. The selectivity index (SI of UA for the parasites was found safe. This was supported by the molecular docking studies, which showed adequate docking (LibDock scores for UA (-8.6 with respect to the standard antifilarial drugs, ivermectin (IVM -8.4 and diethylcarbamazine (DEC-C -4.6 on glutathione-s-transferase enzyme. Further, in silico pharmacokinetic and drug-likeness studies showed that UA possesses drug-like properties. Furthermore, UA was evaluated in vivo in B. malayi-M. coucha model (natural infection, which showed 54% macrofilaricidal activity, 56% female worm sterility and almost unchanged microfilaraemia maintained throughout observation period with no adverse effect on the host. Thus, in conclusion in vitro, in silico and in vivo results indicate that UA is a promising, inexpensive, widely available natural lead, which can be designed and developed into a macrofilaricidal drug. To the best of our knowledge this is the first ever report on the anti-filarial potential of UA from E. tereticornis, which is in full agreement with the Thomson Reuter's 'Metadrug' tool screening predictions.
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Genetics of Human and Canine Dilated Cardiomyopathy
Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
Vaccine-induced canine distemper in a lesser panda.
Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J
1976-11-01
A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.
Histopathological retrospective study of canine renal disease in Korea, 2003~2008
Yhee, Ji-Young; Yu, Chi-Ho; Kim, Jong-Hyuk; Im, Keum-Soon; Chon, Seung-Ki
2010-01-01
Renal disease includes conditions affecting the glomeruli, tubules, interstitium, pelvis, and vasculature. Diseases of the kidney include glomerular diseases, diseases of the tubules and interstitium, diseases of renal pelvis, and developmental abnormalities. Renal tissue samples (n = 70) submitted to the Department of Veterinary Pathology of Konkuk University from 2003 to 2008 were included in this study. Tissue histopathology was performed using light microscopy with hematoxylin and eosin stains. Masson's trichrome, Congo Red, and Warthin starry silver staining were applied in several individual cases. Glomerular diseases (22.9%), tubulointerstitial diseases (8.6%), neoplastic diseases (8.6%), conditions secondary to urinary obstruction (24.3%), and other diseases (35.7%) were identified. Glomerulonephritis (GN) cases were classified as acute proliferative GN (5.7%), membranous GN (4.3%), membranoproliferative GN (4.3%), focal segmental GN (2.9%), and other GN (4.2%). The proportion of canine GN cases presently identified was not as high as the proportions identified in human studies. Conversely, urinary obstruction and end-stage renal disease cases were relatively higher in dogs than in human populations. PMID:21113095
Directory of Open Access Journals (Sweden)
Adélaïde Nieguitsila
2013-01-01
Full Text Available Filariae are a leading cause of infections which are responsible for serious dermatological, ocular, and vascular lesions. Infective third stage larvae (L3 are transmitted through the bite of a haematophagous vector. Litomosoides sigmodontis is a well-established model of filariasis in the mouse, with the vector being the mite Ornithonyssus bacoti. The aim of the study was to analyse the filarial infection in mites to determine the consequences of filarial infection in the blood-feeding and the reproduction of mites as well as in the regulation of vector-induced inflammation in the mouse skin. Firstly, L3 are unevenly distributed throughout the host population and the majority of the population harbours a moderate infection (1 to 6 L3. Filarial infection does not significantly affect the probing delay for blood feeding. The number of released protonymphs is lower in infected mites but is not correlated with the L3 burden. Finally, induced excreted proteins from infected mites but not from uninfected mites stimulate TNF-α and the neutrophil-chemoattractant KC production by antigen-presenting cells (APCs. Altogether, these results describe the modification of the mite behavior under filarial infection and suggest that the immunomodulatory capacity of the mite may be modified by the presence of the parasite, hindering its defensive ability towards the vertebrate host.
Canine visceral leishmaniasis as a systemic fibrotic disease
Silva, Lucelia C; Castro, Rodrigo S; Figueiredo, Maria M; Michalick, Marilene S M; Tafuri, Washington L; Tafuri, Wagner L
2013-01-01
We propose that canine visceral leishmaniasis (CVL) is a systemic fibrotic disease, as evidenced by the wide distribution of fibrosis that we have found in the dogs suffering from chronic condition. The inflammatory cells apparently direct fibrosis formation. Twenty-four cases (symptomatic dogs) were identified from a total of one hundred and five cases that had been naturally infected with Leishmania chagasi and had been documented during an epidemiological survey of CVL carried out by the metropolitan area of the municipality of Belo Horizonte, MG, Brazil. The histological criterion was intralobular liver fibrosis, as has been described previously in dogs with visceral leishmaniasis. In addition to the findings in the liver, here we describe and quantify conspicuous and systemic deposition of collagen in other organs, including spleen, cervical lymph nodes, lung and kidney of all the infected symptomatic dogs. Thus we report that there is a systematic fibrotic picture in these animals, where inflammatory cells appear to direct fibrosis in all organs that have been studied. Therefore we propose that CVL is a systemic fibrotic disease. PMID:23419132
Hirose, Naoki; Uchida, Kazuyuki; Kanemoto, Hideyuki; Ohno, Koichi; Chambers, James K; Nakayama, Hiroyuki
2014-07-01
To determine the incidence of hepatic diseases in dogs and cats in Japan, a retrospective study was performed using data of 463 canine and 71 feline liver biopsies at the Veterinary Medical Center of the University of Tokyo. The most common canine hepatic disease was microvascular dysplasia (MVD) and occupied 29.4% of all diagnoses. This terminology might contain "real" MVD and primary portal vein hypoplasia, because these two conditions were difficult to be clearly distinguished histopathologically. Parenchymal and interstitial hepatitis and primary hepatic tumors accounted for 23.5% and 21.0% of the diagnoses, respectively. Parenchymal and interstitial hepatitis occupied 34.1% of non-proliferative canine hepatic diseases, while hepatocellular adenoma and carcinoma were 26.6% and 24.5% of proliferative hepatic diseases, respectively. Breed-specificity was seen in MVD for Yorkshire terrier, Papillon and Toy poodle, in hepatitis for Doberman pinscher and Labrador retriever, in cholangiohepatitis for American cocker spaniel, Miniature schnauzer and Pomeranian, in hepatocellular adenoma for Golden retriever and Shiba and in hepatocellular carcinoma for Shih Tzu. The most common feline liver disease was parenchymal and interstitial hepatitis (45.1% of all diagnoses). Among feline hepatitis, neutrophilic cholangiohepatitis (23.9%), lymphocytic cholangiohepatitis (14.1%) and chronic hepatitis (5.6%) were recorded. Adult polycystic liver disease was 5.6%. Among proliferative diseases in the feline liver (11.3% of the all), lymphoma (4.2%) and primary epithelial tumors (4.2%) including hepatocellular carcinoma, cholangiocellular adenoma and cholangiocellular carcinoma were observed. Hepatic degeneration was 14.1%, and MVD was 12.7%, respectively.
Economic costs of endemic non-filarial elephantiasis in Wolaita Zone, Ethiopia.
Tekola, Fasil; Mariam, Damen H; Davey, Gail
2006-07-01
Endemic non-filarial elephantiasis or podoconiosis is a chronic and debilitating geochemical disease occurring in individuals exposed to red clay soil derived from alkalic volcanic rock. It is a major public health problem in countries in tropical Africa, Central America and North India. To estimate the direct and the average productivity cost attributable to podoconiosis, and to compare the average productivity time of podoconiosis patients with non-patients. Matched comparative cross sectional survey involving 702 study subjects (patients and non-patients) supplemented by interviews with key informants in Wolaita Zone, southern Ethiopia. Total direct costs of podoconiosis amounted to the equivalent of US$ 143 per patient per year. The total productivity loss for a patient amounted to 45% of the total working days per year, causing a monetary loss equivalent to US$ 63. In Wolaita zone, the overall cost of podoconiosis exceeds US$ 16 million per year. Podoconiosis has enormous economic impact in affected areas. Simple preventive measures (such as use of robust footwear) must be promoted by health policy makers.
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Directory of Open Access Journals (Sweden)
Otávio Valério Carvalho
2012-01-01
Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo
2012-01-01
Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403
Canine babesiosis: from molecular taxonomy to control
Directory of Open Access Journals (Sweden)
Irwin Peter J
2009-03-01
Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.
DEFF Research Database (Denmark)
Enemark, Heidi Larsen; Oksanen, Antti; Chriél, Mariann
2017-01-01
Setaria tundra is a mosquito-borne filarial nematode of cervids in Europe. It has recently been associated with an emerging epidemic disease causing severe morbidity and mortality in reindeer and moose in Finland. Here, we present the first report of S. tundra in six roe deer (Capreolus capreolus...... Europe. Roe deer are generally considered as asymptomatic carriers and their numbers in Denmark have increased significantly in recent decades. In light of climatic changes which result in warmer, more humid weather in Scandinavia greater numbers of mosquitoes and, especially, improved conditions...... for development of parasite larvae in the mosquito vectors are expected, which may lead to increasing prevalence of S. tundra. Monitoring of this vector-borne parasite may thus be needed in order to enhance the knowledge of factors promoting its expansion and prevalence as well as predicting disease outbreaks. (C...
Sakthidevi, Moorthy; Murugan, Vadivel; Hoti, Sugeerappa Laxmanappa; Kaliraj, Perumal
2010-05-01
Polymerase chain reaction based methods are promising tools for the monitoring and evaluation of the Global Program for the Elimination of Lymphatic Filariasis. The currently available PCR methods do not differentiate the DNA of Wuchereria bancrofti or Brugia malayi by a single PCR and hence are cumbersome. Therefore, we designed a single step PCR strategy for differentiating Bancroftian infection from Brugian infection based on a newly identified gene from the W. bancrofti genome, abundant larval transcript-2 (alt-2), which is abundantly expressed. The difference in PCR product sizes generated from the presence or absence of evolutionarily altered tandem repeats in alt-2 intron-3 differentiated W. bancrofti from B. malayi. The analysis was performed on the genomic DNA of microfilariae from a number of patient blood samples or microfilariae positive slides from different Indian geographical regions. The assay gave consistent results, differentiating the two filarial parasite species accurately. This alt-2 intron-3 based PCR assay can be a potential tool for the diagnosis and differentiation of co-infections by lymphatic filarial parasites. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Quintana, J F; Babayan, S A; Buck, A H
2017-02-01
Parasitic nematodes have evolved sophisticated mechanisms to communicate with their hosts in order to survive and successfully establish an infection. The transfer of RNA within extracellular vesicles (EVs) has recently been described as a mechanism that could contribute to this communication in filarial nematodes. It has been shown that these EVs are loaded with several types of RNAs, including microRNAs, leading to the hypothesis that parasites could actively use these molecules to manipulate host gene expression and to the exciting prospect that these pathways could result in new diagnostic and therapeutic strategies. Here, we review the literature on the diverse RNAi pathways that operate in nematodes and more specifically our current knowledge of extracellular RNA (exRNA) and EVs derived from filarial nematodes in vitro and within their hosts. We further detail some of the issues and questions related to the capacity of RNA-mediated communication to function in parasite-host interactions and the ability of exRNA to enable us to distinguish and detect different nematode parasites in their hosts. © 2016 The Authors. Parasite Immunology published by John Wiley & Sons Ltd.
American Canine Hepatozoonosis
Ewing, S. A.; Panciera, R. J.
2003-01-01
American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294
Prevention approaches in a preclinical canine model of Alzheimer’s disease: Benefits and challenges
Directory of Open Access Journals (Sweden)
Paulina R. Davis
2014-03-01
Full Text Available Aged dogs spontaneously develop many features of human aging and Alzheimer’s disease (AD including cognitive decline and neuropathology. In this review, we discuss age-dependent learning tasks, memory tasks, and functional measures that can be used in aged dogs for sensitive treatment outcome measures. Neuropathology that is linked to cognitive decline is described along with examples of treatment studies that show reduced neuropathology in aging dogs (dietary manipulations, behavioral enrichment, immunotherapy, and statins. Studies in canine show that multi-targeted approaches may be more beneficial than single pathway manipulations (e.g. antioxidants combined with behavioral enrichment. Aging canine studies show good predictive validity for human clinical trials outcomes (e.g. immunotherapy and several interventions tested in dogs strongly support a prevention approach (e.g. immunotherapy and statins. Further, dogs are ideally suited for prevention studies as they the age because onset of cognitive decline and neuropathology strongly support longitudinal interventions that can be completed within a 3-5 year period. Disadvantages to using the canine model are that they lengthy, use labor-intensive comprehensive cognitive testing, and involve costly housing (almost as high as that of nonhuman primates. However overall, using the dog as a preclinical model for testing preventive approaches for AD may complement work in rodents and nonhuman primates.
Characterization of a novel Canine distemper virus causing disease in wildlife.
Pope, Jenny P; Miller, Debra L; Riley, Matthew C; Anis, Eman; Wilkes, Rebecca P
2016-09-01
Canine distemper virus (CDV) is a common cause of a multisystemic disease in both domestic dogs and wildlife species, including raccoons and foxes. Outbreaks of CDV in domestic dogs in eastern Tennessee have occurred since 2012, and it was determined that these outbreaks resulted from a novel genotype of CDV. We hypothesized that this virus is also infecting area wildlife and may be a source of the virus for these outbreaks in dogs. From 2013 to 2014, autopsies were performed and tissues collected from raccoons (Procyon lotor; n = 50) and gray foxes (Urocyon cinereoargenteus; n = 8) for CDV testing. A real-time reverse transcription PCR was used to document the presence of CDV in tissue samples, and a portion of the virus was subsequently sequenced for phylogenetic analysis. A high percentage of wildlife, both with (86%) and without (55%) clinical signs, tested positive for CDV, with the majority (77%) testing positive for the novel genotype. Microscopic findings, including syncytia in the lungs and viral inclusion bodies in urothelium, astrocytes, neurons, and bronchiolar epithelium, were also consistent with canine distemper. Minimal inflammation in the central nervous system of affected animals was indicative of the acute neurologic form of the disease. Pneumonia and parasitism were also commonly found in CDV-infected animals. Based on these results, CDV appears to be prevalent in eastern Tennessee wildlife. Subclinical or clinically recovered shedders are a potential source of this novel genotype for domestic dogs, and this genotype is genetically distinct from vaccine strains. © 2016 The Author(s).
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Electroencephalography as a diagnostic technique for canine neurological diseases
Directory of Open Access Journals (Sweden)
Wrzosek Marcin
2016-06-01
Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.
Directory of Open Access Journals (Sweden)
Ishii Y.
2008-06-01
Full Text Available Seasonal and daily biting activity patterns, and natural filarial infections of adult black flies attracted to human bait were investigated at Ban Pang Faen, a rural area in Chiang Mai Province in northern Thailand. Collections were carried out twice a month from 06-00 to 18-00 hours from January 2005 to February 2006. Among ten Simulium species collected, S. nodosum and S. asakoae were predominant occupying 57.3% and 37.2% of the total 16, 553 females, respectively. These two predominant species showed different patterns in seasonal abundance: majority of S. nodosum (86.7% were collected in hot season (from mid February to mid May, while most of S. asakoae (74.5% were collected in rainy season (from mid May to mid October. For the daily biting activity, S. nodosum had two patterns: the main one was unimodal with a peak from 17-00 to 18-00, and the other was bimodal and had the major peak from 16-00 to 18-00 and the minor one from 07-00 to 09-00. The pattern of S. asakoae was mostly unimodal with a peak from 06-00 to 10-00. The filarial larvae found in S. nodosum and S. asakoae were morphologically different from each other. The short and thick infective larvae found in S. asakoae differed from all known filarial larvae; it is suggested that they might be a bird parasite, Splendidofilariinae or Lemdaninae. The infection of the mammophilic S. nodosum with large Onchocerca type infective larvae was confirmed in this area. Natural filarial infections were found in each month (except December in either S. nodosum or S. asakoae or in both. Monthly infection rates with all stages of larvae were 0.6-5.0% for S. nodosum, and 1.0-4.0% for S. asakoae. It is suggested that people in this village are exposed to the risk of infection with zoonotic filariae throughout the year.
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
A mechanism for chronic filarial hydrocele with implications for its surgical repair.
Directory of Open Access Journals (Sweden)
Joaquim Norões
Full Text Available BACKGROUND: Chronic hydrocele is the most common manifestation of bancroftian filariasis, an endemic disease in 80 countries. In a prospective study, we evaluated the occurrence of intrascrotal lymphangiectasia, gross appearance/consistency of the testis, and the efficacy of complete excision of hydrocele sac in patients living in a bancroftian filariasis endemic area who underwent hydrocelectomy at the Center for Teaching, Research and Tertiary Referral for Bancroftian Filariasis (NEPAF. METHODOLOGY/PRINCIPAL FINDINGS: A total of 968 patients with uni- or bilateral filarial hydrocele (Group-1 and a Comparison Group (CG of 218 patients from the same area who already had undergone hydrocele-sac-sparing hydrocelectomy elsewhere were enrolled at NEPAF. Twenty-eight patients from the Comparison Group with hydrocele recurrence were re-operated on at NEPAF and constitute Group-2. In Group-1 a total of 1,128 hydrocelectomies were performed (mean patient age of 30.3 yr and mean follow-up of 8.6 yr [range 5.3-12]. The hydrocele recurrence rates in Group-1 and in the Comparison Group (mean age of 31.5 yr were 0.3%, and 19.3%, respectively (p<0,001. There was no hydrocele recurrence in Group-2 (mean patient age of 25.1 yr and mean follow-up of 6 yr [range 5-6.9]. Per surgically leaking or leak-prone dilated lymphatic vessels were seen in the inner or outer surface of the hydrocele sac wall or in surrounding tissue, particularly in the retrotesticular area, in 30.9% and in 46.3% of patients in Group-1 and Group-2, respectively (p = 0.081. The testicles were abnormal in shape, volume, and consistency in 203/1,128 (18% and 10/28 (35.7% of patients from Group-1 and Group-2, respectively (p = 0,025. CONCLUSIONS/SIGNIFICANCE: Lymph fluid from ruptured dilated lymphatic vessels is an important component of chronic filarial hydrocele fluid that threatens the integrity of the testis in an adult population living in bancroftian filariasis endemic areas. To avoid
Recent literature has touted the use of canine olfaction as a diagnostic tool for identifying pre-clinical disease status, especially cancer and infection from biological media samples. Studies have shown a wide range of outcomes, ranging from almost perfect discrimination, all t...
Tekola, Fasil; Ayele, Zewdu; Mariam, Dereje Haile; Fuller, Claire; Davey, Gail
2008-10-01
To develop and test a robust clinical staging system for podoconiosis, a geochemical disease in individuals exposed to red clay soil. We adapted the Dreyer system for staging filarial lymphoedema and tested it in four re-iterative field tests conducted in an area of high-podoconiosis prevalence in Southern Ethiopia. The system has five stages according to proximal spread of disease and presence of dermal nodules, ridges and bands. We measured the 1-week repeatability and the inter-observer agreement of the final staging system. The five-stage system is readily understood by community workers with little health training. Kappa for 1-week repeatability was 0.88 (95% CI 0.80-0.96), for agreement between health professionals was 0.71 (95% CI 0.60-0.82), while that between health professionals and community podoconiosis agents without formal health training averaged 0.64 (95% CI 0.52-0.78). This simple staging system with good inter-observer agreement and repeatability can assist in the management and further study of podoconiosis.
Glucosamine and chondroitin use in canines for osteoarthritis: A ...
African Journals Online (AJOL)
Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...
Directory of Open Access Journals (Sweden)
Czajka Christina
2012-01-01
Full Text Available Abstract Background Knowledge of the potential vector role of Culicidae mosquitoes in Germany is very scanty, and until recently it was generally assumed that they are not involved in the transmission of anthroponotic or zoonotic pathogens in this country. However, anticipated changes in the course of global warming and globalization may alter their status. Methods We conducted a molecular mass screening of mosquitoes for filarial parasites using mitochondrial 12S rRNA-based real-time PCR. Results No parasites causing disease in humans such as Dirofilaria spp. were detected in about 83,000 mosquitoes tested, which had been collected in 2009 and 2010 in 16 locations throughout Germany. However, minimum infection rates of up to 24 per 1000 mosquitoes were revealed, which could be attributed to mosquito infection with Setaria tundra and a yet unidentified second parasite. Setaria tundra was found to be widespread in southern Germany in various mosquito species, except Culex spp. In contrast, the unidentified filarial species was exclusively found in Culex spp. in northern Baden-Württemberg, and is likely to be a bird parasite. Conclusions Although dirofilariasis appears to be emerging and spreading in Europe, the absence of Dirofilaria spp. or other zoonotic filariae in our sample allows the conclusion that the risk of autochthonous infection in Germany is still very low. Potential vectors of S. tundra in Germany are Ochlerotatus sticticus, Oc. cantans, Aedes vexans and Anopheles claviger. Technically, the synergism between entomologists, virologists and parasitologists, combined with state-of-the-art methods allows a very efficient near-real-time monitoring of a wide spectrum of both human and veterinary pathogens, including new distribution records of parasite species and the incrimination of their potential vectors.
Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.
Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D
2014-12-01
Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Current state of knowledge: the canine gastrointestinal microbiome.
Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S
2012-06-01
Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.
Feline and canine coronaviruses: common genetic and pathobiological features.
Le Poder, Sophie
2011-01-01
A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
Electrocardiography may be a useful tool in the diagnosis of early mild canine heartworm disease
Directory of Open Access Journals (Sweden)
Edward M. Onyango
2011-01-01
Full Text Available This study was carried out to determine the usefulness of standard electrocardiography for the diagnosis of early canine heartworm disease. Baseline electrocardiograms were recorded in 12 dogs. Thirty artificial Dirofilaria immitis worms were inserted in the pulmonary artery of each dog. New electrocardiograms were recorded on days 1-4, 7, 14, 21, 28 and 35 after insertion of worms. A significant attenuation of amplitude of Q wave in lead I was recorded on days 1-4, 7, 14, 21, 28 and 35; of R wave in lead II on days 21, 28 and 35; and of S wave in lead aVR on days 7, 14, 21, 28 and 35. Duration of the QRS complex in lead AVF was significantly prolonged on day 14. In 41.6% of the dogs, right axis deviation was recorded. These results suggest that for a dog whose normal baseline standard electrocardiogram is known, a comparison of the QRS complex of the baseline with those of subsequent standard electrocardiograms may suggest early canine heartworm disease when there is an attenuation of amplitude of Q wave in lead I, R wave in lead II and S wave in lead aVR. An additional indication can be right axis deviation.
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
[Climate change - a pioneer for the expansion of canine vector-borne diseases?].
Krämer, F; Mencke, N
2011-01-01
Vector-transmitted diseases are one of the major contributors to the global burden of disease in humans and animals. Climate change is consistently held responsible for the spread of parasitic acarid and insect vectors such as ticks, fleas, sand flies and mosquitoes, and their transmitted pathogens (in the case of the dog the so-called canine vector-borne diseases [CVBD]). Currently, there is only insufficient data available to prove whether climate change is a major driving force for vector and disease expansion, but the evidence is growing. Other reasons, such as ecological, demographic and socio-economic factors, e.g. pet travel into and pet import from endemic areas, also play a role in this development. Apart from all the controversial discussion of the factors leading to vector and disease expansion, preventative measures should include dog owners' education as they are responsible for individual parasite protection as well as for the minimisation of adverse risk behaviour, e.g. regarding pet travel. Broad-spectrum vector control should be practised by using parasiticides that repel and kill blood feeders in order to minimize the risk of CVBD-pathogen transmission.
Adeno-Associated Virus-Mediated Correction of a Canine Model of Glycogen Storage Disease Type Ia
Weinstein, David A.; Correia, Catherine E.; Conlon, Thomas; Specht, Andrew; Verstegen, John; Onclin-Verstegen, Karine; Campbell-Thompson, Martha; Dhaliwal, Gurmeet; Mirian, Layla; Cossette, Holly; Falk, Darin J.; Germain, Sean; Clement, Nathalie; Porvasnik, Stacy; Fiske, Laurie; Struck, Maggie; Ramirez, Harvey E.; Jordan, Juan; Andrutis, Karl; Chou, Janice Y.; Byrne, Barry J.
2010-01-01
Abstract Glycogen storage disease type Ia (GSDIa; von Gierke disease; MIM 232200) is caused by a deficiency in glucose-6-phosphatase-α. Patients with GSDIa are unable to maintain glucose homeostasis and suffer from severe hypoglycemia, hepatomegaly, hyperlipidemia, hyperuricemia, and lactic acidosis. The canine model of GSDIa is naturally occurring and recapitulates almost all aspects of the human form of disease. We investigated the potential of recombinant adeno-associated virus (rAAV) vector-based therapy to treat the canine model of GSDIa. After delivery of a therapeutic rAAV2/8 vector to a 1-day-old GSDIa dog, improvement was noted as early as 2 weeks posttreatment. Correction was transient, however, and by 2 months posttreatment the rAAV2/8-treated dog could no longer sustain normal blood glucose levels after 1 hr of fasting. The same animal was then dosed with a therapeutic rAAV2/1 vector delivered via the portal vein. Two months after rAAV2/1 dosing, both blood glucose and lactate levels were normal at 4 hr postfasting. With more prolonged fasting, the dog still maintained near-normal glucose concentrations, but lactate levels were elevated by 9 hr, indicating that partial correction was achieved. Dietary glucose supplementation was discontinued starting 1 month after rAAV2/1 delivery and the dog continues to thrive with minimal laboratory abnormalities at 23 months of age (18 months after rAAV2/1 treatment). These results demonstrate that delivery of rAAV vectors can mediate significant correction of the GSDIa phenotype and that gene transfer may be a promising alternative therapy for this disease and other genetic diseases of the liver. PMID:20163245
Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features
Directory of Open Access Journals (Sweden)
Sophie Le Poder
2011-01-01
Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
Podoconiosis, a neglected tropical disease
Korevaar, D. A.; Visser, B. J.
2012-01-01
Podoconiosis or 'endemic non-filarial elephantiasis' is a tropical disease caused by exposure of bare feet to irritant alkaline clay soils. This causes an asymmetrical swelling of the feet and lower limbs due to lymphoedema. Podoconiosis has a curable pre-elephantiasic phase. However, once
Directory of Open Access Journals (Sweden)
Bechan Sharma
2011-01-01
Full Text Available Phosphofructokinase (PFK, a regulatory enzyme in glycolytic pathway, has been purified to electrophoretic homogeneity from adult female Setaria cervi and partially characterized. For this enzyme, the Lineweaver-Burk's double reciprocal plots of initial rates and D-fructose-6-phosphate (F-6-P or Mg-ATP concentrations for varying values of cosubstrate concentration gave intersecting lines indicating that Km values for F-6-P (1.05 mM and ATP (3 μM were independent of each other. S. cervi PFK, when assayed at inhibitory concentration of ATP (>0.1 mM, exhibited sigmoidal behavior towards binding with F-6-P with a Hill coefficient (n value equal to 1.8 and 1.7 at 1.0 and 0.33 mM ATP, respectively. D-fructose-1,6-diphosphate (FDP competitively inhibited the filarial enzyme: Ki and Hill coefficient values being 0.18 μM and 2.0, respectively. Phosphoenolpyruvate (PEP also inhibited the enzyme competitively with the Ki value equal to 0.8 mM. The Hill coefficient values (>1.5 for F-6-P (at inhibitory concentration of ATP and FDP suggested its positive cooperative kinetics towards F-6-P and FDP, showing presence of more than one binding sites for these molecules in enzyme protein and allosteric nature of the filarial enzyme. The product inhibition studies gave us the only compatible mechanism of random addition process with a probable orientation of substrates and products on the enzyme surface.
International Nuclear Information System (INIS)
Bancroft, A.J.; Devaney, E.; Grencis, R.K.; Else, K.J.
1993-01-01
BALB/c mice immunized with radiation-attenuated third stage larvae of the filarial nematode Brugia pahangi are strongly immune to challenge infection. Investigation of the profile of cytokines secreted by spleen cells from immune mice stimulated in vitro with either parasite Ag or with Con A revealed high levels of IL-5 and IL-9 and moderate levels of IL-4. In contrast, secretion of IFN-γ by spleen cells from immune animals was negligible. Spleen cells from control mice secreted low levels of all cytokines assayed. Levels of parasite-specific IgE were significantly elevated in immune animals and a peripheral blood eosinophilia was observed, which exhibited a biphasic distribution. Our results are consistent with the preferential expansion of Th2 cells in immune animals and provide the basis for dissecting the means by which radiation-attenuated larvae of filarial nematodes stimulate immunity. 5l refs., 3 figs., 3 tabs
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Adeno-Associated Virus-Mediated Correction of a Canine Model of Glycogen Storage Disease Type Ia
Weinstein, David A.; Correia, Catherine E.; Conlon, Thomas; Specht, Andrew; Verstegen, John; Onclin-Verstegen, Karine; Campbell-Thompson, Martha; Dhaliwal, Gurmeet; Mirian, Layla; Cossette, Holly; Falk, Darin J.; Germain, Sean; Clement, Nathalie; Porvasnik, Stacy; Fiske, Laurie
2010-01-01
This study by the groups of Drs. Barry Byrne and Cathryn Mah at the University of Florida examines the safety and efficacy of AAV-mediated gene delivery in a canine model of glycogen storage disease type Ia (GSDIa). The authors find that intraportal delivery of AAV8 encoding glucose-6-phosphatase-α (G6Pase) followed 20 weeks later by intraportal administration of AAV1 encoding G6Pase led to significant correction of the GSDIa phenotype.
Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei
2013-01-01
Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666
Directory of Open Access Journals (Sweden)
Jiexia Wen
2013-01-01
Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.
Pathophysiology, diagnosis, and treatment of canine hip dysplasia
International Nuclear Information System (INIS)
Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.
1996-01-01
Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education
Severe canine distemper outbreak in unvaccinated dogs in Mozambique
Directory of Open Access Journals (Sweden)
Julieta Zacarias
2016-07-01
Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique
Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines
Directory of Open Access Journals (Sweden)
Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman
2011-01-01
Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.
Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia
Directory of Open Access Journals (Sweden)
Víctor Acero P
2015-09-01
Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
Does canine inflammatory bowel disease influence gut microbial profile and host metabolism?
Xu, Jia; Verbrugghe, Adronie; Lourenço, Marta; Janssens, Geert P J; Liu, Daisy J X; Van de Wiele, Tom; Eeckhaut, Venessa; Van Immerseel, Filip; Van de Maele, Isabel; Niu, Yufeng; Bosch, Guido; Junius, Greet; Wuyts, Brigitte; Hesta, Myriam
2016-06-16
Inflammatory bowel disease (IBD) refers to a diverse group of chronic gastrointestinal diseases, and gut microbial dysbiosis has been proposed as a modulating factor in its pathogenesis. Several studies have investigated the gut microbial ecology of dogs with IBD but it is yet unclear if this microbial profile can alter the nutrient metabolism of the host. The aim of the present study was to characterize the faecal bacterial profile and functionality as well as to determine host metabolic changes in IBD dogs. Twenty-three dogs diagnosed with IBD and ten healthy control dogs were included. Dogs with IBD were given a clinical score using the canine chronic enteropathy clinical activity index (CCECAI). Faecal short-chain fatty acids (SCFA) and ammonia concentrations were measured and quantitative PCR was performed. The concentration of plasma amino acids, acylcarnitines, serum folate, cobalamin, and indoxyl sulfate was determined. No significant differences in the abundance of a selection of bacterial groups and fermentation metabolites were observed between the IBD and control groups. However, significant negative correlations were found between CCECAI and the faecal proportion of Lactobacillus as well as between CCECAI and total SCFA concentration. Serum folate and plasma citrulline were decreased and plasma valine was increased in IBD compared to control dogs. Increased plasma free carnitine and total acylcarnitines were observed in IBD compared with control dogs, whereas short-chain acylcarnitines (butyrylcarnitine + isobutyrylcarnitine and, methylmalonylcarnitine) to free carnitine ratios decreased. Dogs with IBD had a higher 3-hydroxyisovalerylcarnitine + isovalerylcarnitine to leucine ratio compared to control dogs. Canine IBD induced a wide range of changes in metabolic profile, especially for the plasma concentrations of short-chain acylcarnitines and amino acids, which could have evolved from tissue damage and alteration in host metabolism. In
Directory of Open Access Journals (Sweden)
Jobin Thomas
2014-11-01
Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.
Expression and function of survivin in canine osteosarcoma.
Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H
2012-01-01
Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.
Antiviral effect of lithium chloride on infection of cells by canine parvovirus.
Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun
2015-11-01
Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.
Lipoprotein biosynthesis as a target for anti-Wolbachia treatment of filarial nematodes
Directory of Open Access Journals (Sweden)
Slatko Barton E
2010-10-01
Full Text Available Abstract Background Lymphatic filariasis and onchocerciasis are debilitating diseases caused by filarial nematodes. Disease pathogenesis is induced by inflammatory responses following the death of the parasite. Wolbachia endosymbionts of filariae are potent inducers of innate and adaptive inflammation and bacterial lipoproteins have been identified as the ligands that bind toll-like receptors (TLR 2 and TLR6. Lipoproteins are important structural and functional components of bacteria and therefore enzymes involved in Wolbachia lipoprotein biosynthesis are potential chemotherapeutic targets. Results Globomycin, a signal peptidase II (LspA inhibitor, has activity against Gram-negative bacteria and a putative lspA gene has been identified from the Wolbachia genome of Brugia malayi (wBm. The amino acids required for function are strictly conserved and functionality was verified by complementation tests in a temperature-sensitive Escherichia coli lspA mutant. Also, transformation of wild type E. coli with Wolbachia lspA conferred significant globomycin resistance. A cell-based screen has been developed utilizing a Wolbachia-containing Aedes albopictus cell line to assay novel compounds active against Wolbachia. Globomycin was screened using this assay, which resulted in a dose-dependent reduction in Wolbachia load. Furthermore, globomycin was also effective in reducing the motility and viability of adult B. malayi in vitro. Conclusions These studies validate lipoprotein biosynthesis as a target in an organism for which no genetic tools are available. Further studies to evaluate drugs targeting this pathway are underway as part of the A-WOL drug discovery and development program.
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
Human and Animal Dirofilariasis: the Emergence of a Zoonotic Mosaic
Siles-Lucas, Mar; Morchón, Rodrigo; González-Miguel, Javier; Mellado, Isabel; Carretón, Elena; Montoya-Alonso, Jose Alberto
2012-01-01
Summary: Dirofilariasis represents a zoonotic mosaic, which includes two main filarial species (Dirofilaria immitis and D. repens) that have adapted to canine, feline, and human hosts with distinct biological and clinical implications. At the same time, both D. immitis and D. repens are themselves hosts to symbiotic bacteria of the genus Wolbachia, the study of which has resulted in a profound shift in the understanding of filarial biology, the mechanisms of the pathologies that they produce in their hosts, and issues related to dirofilariasis treatment. Moreover, because dirofilariasis is a vector-borne transmitted disease, their distribution and infection rates have undergone significant modifications influenced by global climate change. Despite advances in our knowledge of D. immitis and D. repens and the pathologies that they inflict on different hosts, there are still many unknown aspects of dirofilariasis. This review is focused on human and animal dirofilariasis, including the basic morphology, biology, protein composition, and metabolism of Dirofilaria species; the climate and human behavioral factors that influence distribution dynamics; the disease pathology; the host-parasite relationship; the mechanisms involved in parasite survival; the immune response and pathogenesis; and the clinical management of human and animal infections. PMID:22763636
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Identification of a new genotype of canine distemper virus circulating in America.
Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón
2011-08-01
Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
How soil scientists help combat podoconiosis, a neglected tropical disease
Visser, Benjamin Jelle
2014-01-01
Podoconiosis or "endemic non-filarial elephantiasis" is a tropical disease caused by prolonged exposure of bare feet to irritant alkaline clay soils of volcanic origin [1]. The name of the disease is derived from the Greek words for foot: podos, and dust: konos. Small mineral particles from irritant
Neglected tropical diseases, neglected data sources, and neglected issues.
Directory of Open Access Journals (Sweden)
Burton H Singer
Full Text Available BACKGROUND: Lymphatic filariasis (LF is a so-called neglected tropical disease, currently overshadowed by higher-profile efforts to address malaria, tuberculosis, and HIV/AIDS. Despite recent successes in arresting transmission, some 40 million people who already have the disease have been largely neglected. This study aims to increase understanding of how this vulnerable, neglected group can be helped. METHODS: We used purposive sampling to select 60 men and women with filarial lymphoedema (45 with filarial elephantiasis and 15 men with filarial hydrocoele from the south of Sri Lanka in 2004-2005. Participants were selected to give a balance of men and women and poor and nonpoor, and a range of stages of the disease. Participants' experiences and the consequences of their disease for the household were explored with in-depth qualitative, semistructured interviews. FINDINGS: LF was extremely debilitating to participants over long periods of time. The stigma attached to the condition caused social isolation and emotional distress, and delayed diagnosis and treatment, resulting in undue advancement of the disease. Free treatment services at government clinics were avoided because the participants' condition would be identifiable in public. Loss of income due to the condition was reported by all households in the sample, not just the poorest. Households that were already on low incomes were pushed into near destitution, from which it was almost impossible to escape. Affected members of low-income households also had less opportunity to obtain appropriate treatment from distant clinics, and had living and working conditions that made hygiene and compliance difficult. SIGNIFICANCE: This highly vulnerable category of patients has low visibility, thus becoming marginalized and forgotten. With an estimated 300,000 total cases of elephantiasis and/or oedema in Sri Lanka, and around 300,000 men with filarial hydrocoele, the affected households will need
Tooth fractures in canine clinical practice
International Nuclear Information System (INIS)
Capik, I.; Ledecky, V.; Sevcik, A.
2001-01-01
Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Ariani, Cristina V; Juneja, Punita; Smith, Sophia; Tinsley, Matthew C; Jiggins, Francis M
2015-01-01
Mosquitoes are one of the most important vectors of human disease. The ability of mosquitoes to transmit disease is dependent on the age structure of the population, as mosquitoes must survive long enough for the parasites to complete their development and infect another human. Age could have additional effects due to mortality rates and vector competence changing as mosquitoes senesce, but these are comparatively poorly understood. We have investigated these factors using the mosquito Aedes aegypti and the filarial nematode Brugia malayi. Rather than observing any effects of immune senescence, we found that older mosquitoes were more resistant, but this only occurred if they had previously been maintained on a nutrient-poor diet of fructose. Constant blood feeding reversed this decline in vector competence, meaning that the number of parasites remained relatively unchanged as mosquitoes aged. Old females that had been maintained on fructose also experienced a sharp spike in mortality after an infected blood meal ("refeeding syndrome") and few survived long enough for the parasite to develop. Again, this effect was prevented by frequent blood meals. Our results indicate that old mosquitoes may be inefficient vectors due to low vector competence and high mortality, but that frequent blood meals can prevent these effects of age. Copyright © 2014 Elsevier Inc. All rights reserved.
Expression Profiling of Circulating MicroRNAs in Canine Myxomatous Mitral Valve Disease
Directory of Open Access Journals (Sweden)
Qinghong Li
2015-06-01
Full Text Available MicroRNAs (miRNAs are small non-coding RNAs that have shown promise as noninvasive biomarkers in cardiac disease. This study was undertaken to investigate the miRNA expression profile in dogs with myxomatous mitral valve disease (MMVD. 277 miRNAs were quantified using RT-qPCR from six normal dogs (American College of Veterinary Internal Medicine Stage A, six dogs with MMVD mild to moderate cardiac enlargement (ACVIM Stage B1/B2 and six dogs with MMVD and congestive heart failure (ACVIM Stage C/D. Eleven miRNAs were differentially expressed (False Discovery Rate < 0.05. Dogs in Stage B1/B2 or C/D had four upregulated miRNAs, including three cfa-let-7/cfa-miR-98 family members, while seven others were downregulated, compared to Stage A. Expression of six of the 11 miRNAs also were significantly different between dogs in Stage C/D and those in Stage B1/B2. The expression changes were greater as disease severity increased. These miRNAs may be candidates for novel biomarkers and may provide insights into genetic regulatory pathways in canine MMVD.
Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells
Directory of Open Access Journals (Sweden)
Michelle G. Ritt
2015-04-01
Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.
Cardiac involvement in canine babesiosis : review article
Directory of Open Access Journals (Sweden)
R.G. Lobetti
2005-06-01
Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.
The Comparative Diagnostic Features of Canine and Human Lymphoma
Directory of Open Access Journals (Sweden)
Davis M. Seelig
2016-06-01
Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
The Comparative Diagnostic Features of Canine and Human Lymphoma.
Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A
2016-06-01
The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
Increasing Incidence of Canine Leptospirosis in Switzerland
Directory of Open Access Journals (Sweden)
Andrea Major
2014-07-01
Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.
Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management
Directory of Open Access Journals (Sweden)
Loftus JP
2014-12-01
Full Text Available John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is associated with dermatological issues, diabetes mellitus, neoplasia, and urolithiasis. The health issues appear to be slightly different across the two species, which may be due to some inherent differences in the hormonal milieu involved in obesity that differs between the dog and the cat. In this review, we discuss the complicated nature of the pathogenesis of obesity, the hormonal stimulus for orexigenic and anorexigenic behavior, adipose tissue as an endocrine organ, and most importantly, clinical management of the number one disease in canine and feline medicine.Keywords: obesity, canine, feline, veterinary
Recent advances in canine leptospirosis: focus on vaccine development
Directory of Open Access Journals (Sweden)
Klaasen HLBM
2015-06-01
Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis
Severe canine distemper outbreak in unvaccinated dogs in Mozambique.
Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G
2016-07-15
Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.
Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis
Directory of Open Access Journals (Sweden)
Jill Narak
2015-01-01
Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.
Seimon, Tracie A; Miquelle, Dale G; Chang, Tylis Y; Newton, Alisa L; Korotkova, Irina; Ivanchuk, Galina; Lyubchenko, Elena; Tupikov, Andre; Slabe, Evgeny; McAloose, Denise
2013-08-13
Fewer than 500 Amur tigers (Panthera tigris altaica) remain in the wild. Due to low numbers and their solitary and reclusive nature, tiger sightings across their range in the Russian Far East and China are rare; sightings of sick tigers are rarer still. Serious neurologic disease observed in several wild tigers since 2001 suggested disease emergence in this endangered species. To investigate this possibility, histology, immunohistochemistry (IHC), in situ hybridization (ISH), and reverse transcription-PCR (RT-PCR) were performed on tissues from 5 affected tigers that died or were destroyed in 2001, 2004, or 2010. Our results reveal canine distemper virus (CDV) infection as the cause of neurologic disease in two tigers and definitively establish infection in a third. Nonsuppurative encephalitis with demyelination, eosinophilic nuclear viral inclusions, and positive immunolabeling for CDV by IHC and ISH were present in the two tigers with available brain tissue. CDV phosphoprotein (P) and hemagglutinin (H) gene products were obtained from brains of these two tigers by RT-PCR, and a short fragment of CDV P gene sequence was detected in lymph node tissue of a third tiger. Phylogenetically, Amur tiger CDV groups with an Arctic-like strain in Baikal seals (Phoca siberica). Our results, which include mapping the location of positive tigers and recognition of a cluster of cases in 2010, coupled with a lack of reported CDV antibodies in Amur tigers prior to 2000 suggest wide geographic distribution of CDV across the tiger range and recent emergence of CDV as a significant infectious disease threat to endangered Amur tigers in the Russian Far East. Recognition of disease emergence in wildlife is a rare occurrence. Here, for the first time, we identify and characterize a canine distemper virus (CDV), the second most common cause of infectious disease death in domestic dogs and a viral disease of global importance in common and endangered carnivores, as the etiology of
Canine leishmaniosis in the Old and New Worlds: unveiled similarities and differences.
Dantas-Torres, Filipe; Solano-Gallego, Laia; Baneth, Gad; Ribeiro, Vitor Marcio; de Paiva-Cavalcanti, Milena; Otranto, Domenico
2012-12-01
Canine leishmaniosis is a potentially life-threatening disease which is spreading geographically in the Old and New Worlds, where different diagnostic procedures, treatments, and control strategies are currently in place. This Opinion article outlines the similarities and differences between canine leishmaniosis in the Old and New Worlds, with emphasis on South America and Europe. Finally, it calls the attention of veterinary and public health authorities to standardize and improve practices for diagnosing, treating, and preventing the disease. Copyright © 2012 Elsevier Ltd. All rights reserved.
An Update on Therapeutic Management of Canine Demodicosis
Directory of Open Access Journals (Sweden)
S. K. Singh
2011-02-01
Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44
Expression, Purification and Characterization of Recombinant Canine FGF21 in Escherichia coli.
Zheng, Zhong; Yang, Chengjun; Yin, Ruofeng; Jiang, Jinxi; He, Haiting; Wang, Xinxin; Kan, Mujie; Xiao, Yechen
2016-01-01
The canine metabolic diseases, such as obesity and diabetes, have become a worldwide problem. Fibroblast growth factor 21 (FGF21) is a potent regulator which has many biological functions relative to metabolism regulation. It suggests that FGF21 plays important roles in regulating canine metabolic diseases. To acquire the recombinant canine FGF21 (rcFGF21) in Escherichia coli, the recombinant bacteria were induced by 0.5 mM IPTG for 16 hours at 16 °C, and the rcFGF21 protein was purified by Ni-NTA. 8 mg rcFGF21 was acquired from one liter bacteria. The rcFGF21 protein has specific immunoblot reactivity against anti-FGF21 and anti-His antibody. The in vivo experimental result showed that rcFGF21 can significantly reduce plasma glucose of STZ-induced diabetic mice.
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Canine brucellosis: Epizootiological characteristics, therapy and control of the disease
Directory of Open Access Journals (Sweden)
Radojičić Sonja
2006-01-01
Full Text Available The paper describes different aspects of canine brucellosis caused by Brucella canis. The disease is present in a large number of countries all over the world, where it inflicts severe economic damages, in particular in the commercial breeding and major dog breeding facilities. The disease was discovered in 1966 in the United States of America, but there were no data about its presence or distribution in our country until 1999. It was established, following the initial investigations, that the prevalence of the disease is extremely high, and that it amounted to 4.27% among pet dogs in the territory of Belgrade. Investigations of stray dogs in the territory of Podgorica showed that the seroprevalence (an equal titer or higher than 1/200 was 9.37%, while the prevalence among stray dogs in the territory of Belgrade was 10.87%. Data for other parts of Serbia are mostly lacking, and the seroprevalence for stray dogs in the Municipality of Pozarevac amounted to over 15%, while not a single serologically positive case was found among pet dogs. In addition to the epizootiological specificities of the disease established in our country, isolates of B. canis from the territory of Serbia also indicate digressions in the test of resistance to colors with respect to the referent strain RM6/66. All isolates (SR1-SR-7 are resistant to base fuchsine, and it is probable that this characteristic could also be an important epizootiological marker. Even though the isolation of the cause is the most reliable diagnostic method, it is not possible to achieve this in most cases. That is why one of the most important tasks is to define the most ideal tests for the serological diagnostics of the disease, and the obligation of reporting the disease makes it imperative that wider-scale investigations are conducted and that measures are taken toward reducing the number of positive cases in our country. .
Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola
2014-07-01
An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.
Adhikari, Ram Kumar; Sherchand, Jeevan Bahadur; Mishra, Shiva Raj; Ranabhat, Kamal; Pokharel, Amrit; Devkota, Pramila; Mishra, Durga; Ghimire, Yadu Chandra; Gelal, Khageshwor; Paudel, Rajan; Wagle, Rajendra Raj
2015-01-01
Background. Lymphatic filariasis is endemic in Nepal. This study aimed to investigate health-seeking behaviors and self-care practices of people with filarial Lymphoedema in Nepal. Methods. A cross-sectional study was conducted using qualitative methods in three endemic districts. Twenty-three patients with current Lymphoedema were recruited in the study. Results. Hydrocele was found to be a well-known condition and a major health problem in the studied communities. People with Lymphoedema primarily sought health care from traditional healers, whereas sometimes home-based care was their first treatment. Later Ayurvedic and allopathic hospital-based care were sought. Respondents reported various psychological problems such as difficulty in engaging in sexual intercourse, anxiety, worry and stress, depression, low self-esteem, feeling weak, fear of being abandoned, and fear of transmitting disease to the children. Standard foot care practices except washing were largely absent. Conclusions. Lymphoedema in the limbs and hydrocele were found to be major health problems. The traditional health care providers were the first contact of care for the majority of respondents. Only a few patients had been practicing standard foot care practices.
IQGAP1 is an oncogenic target in canine melanoma.
Directory of Open Access Journals (Sweden)
Becky H Lee
Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.
Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.
Directory of Open Access Journals (Sweden)
Emily J Shields
Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.
Current practices and research updates on diabetes mellitus in canine
Directory of Open Access Journals (Sweden)
Pankaj Kumar
2014-11-01
Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
FLT3 mutations in canine acute lymphocytic leukemia
International Nuclear Information System (INIS)
Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L
2011-01-01
FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias
Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.
von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H
2008-05-01
Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.
Canine distemper spillover in domestic dogs from urban wildlife.
Kapil, Sanjay; Yeary, Teresa J
2011-11-01
Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.
Radioresistant canine hematopoietic cells
International Nuclear Information System (INIS)
Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.
1987-01-01
Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells
Canine distemper outbreak in rhesus monkeys, China.
Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang
2011-08-01
Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People's Republic of China. Approximately 10,000 animals were infected (25%-60% disease incidence); 5%-30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.
Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection.
Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas
2016-01-01
The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target.
Molecular characterization of canine distemper vi- rus circulating in ...
African Journals Online (AJOL)
2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.
Chon, E.; Thompson, V.; Schmid, S.; Stein, T. J.
2012-01-01
Summary Canine malignant melanoma is a highly aggressive tumour associated with a poor overall survival rate due to both local disease recurrence and its highly metastatic nature. Similar to advanced melanoma in man, canine oral melanoma is poorly responsive to conventional anti-cancer therapies. The lack of sustainable disease control warrants investigation of novel therapies, preferably targeting features specific to the tumour and different from normal cells. The Wnt signalling pathway is known to contribute to melanocytic lineage development in vertebrates and perturbation of the Wnt/β-catenin pathway has been implicated in numerous cancer types. Alterations of the Wnt/β-catenin pathway are suggested to occur in a subset of human melanomas, although the precise role of the Wnt/β-catenin pathway in melanoma is yet to be defined. This study investigates the activation status of the canonical Wnt/β-catenin pathway in canine malignant melanoma and its potential as a therapeutic target for treating this disease. The data indicate canonical Wnt/β-catenin pathway activation is a rare event in canine oral malignant melanoma tissue and canine malignant melanoma cell lines. PMID:22901430
DEFF Research Database (Denmark)
Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter
2009-01-01
The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...
Clinical manifestations of canine distemper in Nigerian dogs ...
African Journals Online (AJOL)
Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...
Canine distemper associated with generalized oedema in Nigerian ...
African Journals Online (AJOL)
Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.
Directory of Open Access Journals (Sweden)
David Kovacevic
Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.
Data base management system for lymphatic filariasis--a neglected tropical disease.
Upadhyayula, Suryanaryana Murty; Mutheneni, Srinivasa Rao; Kadiri, Madhusudhan Rao; Kumaraswamy, Sriram; Nelaturu, Sarat Chandra Babu
2012-01-01
Researchers working in the area of Public Health are being confronted with large volumes of data on various aspects of entomology and epidemiology. To obtain the relevant information out of these data requires particular database management system. In this paper, we have described about the usages of our developed database on lymphatic filariasis. This database application is developed using Model View Controller (MVC) architecture, with MySQL as database and a web based interface. We have collected and incorporated the data on filariasis in the database from Karimnagar, Chittoor, East and West Godavari districts of Andhra Pradesh, India. The importance of this database is to store the collected data, retrieve the information and produce various combinational reports on filarial aspects which in turn will help the public health officials to understand the burden of disease in a particular locality. This information is likely to have an imperative role on decision making for effective control of filarial disease and integrated vector management operations.
Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.
Directory of Open Access Journals (Sweden)
Michelle E White
Full Text Available Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests. After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13 was evident between a region of canine chromosome 13 (CFA13 and alanine aminotransferase (ALT, explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.
Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.
White, Michelle E; Hayward, Jessica J; Stokol, Tracy; Boyko, Adam R
2015-01-01
Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS) at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests). After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13) was evident between a region of canine chromosome 13 (CFA13) and alanine aminotransferase (ALT), explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.
Directory of Open Access Journals (Sweden)
Adina Coșarcă
2014-02-01
Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Loots, Angelika K; Du Plessis, Morné; Dalton, Desiré Lee; Mitchell, Emily; Venter, Estelle H
2017-07-06
Canine distemper virus causes global multihost infectious disease. This report details complete genome sequences of three vaccine and two new wild-type strains. The wild-type strains belong to the South African lineage, and all three vaccine strains to the America 1 lineage. This constitutes the first genomic sequences of this virus from South Africa. Copyright © 2017 Loots et al.
Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.
Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F
2015-03-01
We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
Directory of Open Access Journals (Sweden)
Ram Kumar Adhikari
2015-01-01
Full Text Available Background. Lymphatic filariasis is endemic in Nepal. This study aimed to investigate health-seeking behaviors and self-care practices of people with filarial Lymphoedema in Nepal. Methods. A cross-sectional study was conducted using qualitative methods in three endemic districts. Twenty-three patients with current Lymphoedema were recruited in the study. Results. Hydrocele was found to be a well-known condition and a major health problem in the studied communities. People with Lymphoedema primarily sought health care from traditional healers, whereas sometimes home-based care was their first treatment. Later Ayurvedic and allopathic hospital-based care were sought. Respondents reported various psychological problems such as difficulty in engaging in sexual intercourse, anxiety, worry and stress, depression, low self-esteem, feeling weak, fear of being abandoned, and fear of transmitting disease to the children. Standard foot care practices except washing were largely absent. Conclusions. Lymphoedema in the limbs and hydrocele were found to be major health problems. The traditional health care providers were the first contact of care for the majority of respondents. Only a few patients had been practicing standard foot care practices.
Canine Distemper Outbreak in Rhesus Monkeys, China
Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang
2011-01-01
Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain. PMID:21801646
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
A predictive model for canine dilated cardiomyopathy-a meta-analysis of Doberman Pinscher data.
Simpson, Siobhan; Edwards, Jennifer; Emes, Richard D; Cobb, Malcolm A; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Dilated cardiomyopathy is a prevalent and often fatal disease in humans and dogs. Indeed dilated cardiomyopathy is the third most common form of cardiac disease in humans, reported to affect approximately 36 individuals per 100,000 individuals. In dogs, dilated cardiomyopathy is the second most common cardiac disease and is most prevalent in the Irish Wolfhound, Doberman Pinscher and Newfoundland breeds. Dilated cardiomyopathy is characterised by ventricular chamber enlargement and systolic dysfunction which often leads to congestive heart failure. Although multiple human loci have been implicated in the pathogenesis of dilated cardiomyopathy, the identified variants are typically associated with rare monogenic forms of dilated cardiomyopathy. The potential for multigenic interactions contributing to human dilated cardiomyopathy remains poorly understood. Consistent with this, several known human dilated cardiomyopathy loci have been excluded as common causes of canine dilated cardiomyopathy, although canine dilated cardiomyopathy resembles the human disease functionally. This suggests additional genetic factors contribute to the dilated cardiomyopathy phenotype.This study represents a meta-analysis of available canine dilated cardiomyopathy genetic datasets with the goal of determining potential multigenic interactions relating the sex chromosome genotype (XX vs. XY) with known dilated cardiomyopathy associated loci on chromosome 5 and the PDK4 gene in the incidence and progression of dilated cardiomyopathy. The results show an interaction between known canine dilated cardiomyopathy loci and an unknown X-linked locus. Our study is the first to test a multigenic contribution to dilated cardiomyopathy and suggest a genetic basis for the known sex-disparity in dilated cardiomyopathy outcomes.
A predictive model for canine dilated cardiomyopathy—a meta-analysis of Doberman Pinscher data
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-03-01
Full Text Available Dilated cardiomyopathy is a prevalent and often fatal disease in humans and dogs. Indeed dilated cardiomyopathy is the third most common form of cardiac disease in humans, reported to affect approximately 36 individuals per 100,000 individuals. In dogs, dilated cardiomyopathy is the second most common cardiac disease and is most prevalent in the Irish Wolfhound, Doberman Pinscher and Newfoundland breeds. Dilated cardiomyopathy is characterised by ventricular chamber enlargement and systolic dysfunction which often leads to congestive heart failure. Although multiple human loci have been implicated in the pathogenesis of dilated cardiomyopathy, the identified variants are typically associated with rare monogenic forms of dilated cardiomyopathy. The potential for multigenic interactions contributing to human dilated cardiomyopathy remains poorly understood. Consistent with this, several known human dilated cardiomyopathy loci have been excluded as common causes of canine dilated cardiomyopathy, although canine dilated cardiomyopathy resembles the human disease functionally. This suggests additional genetic factors contribute to the dilated cardiomyopathy phenotype.This study represents a meta-analysis of available canine dilated cardiomyopathy genetic datasets with the goal of determining potential multigenic interactions relating the sex chromosome genotype (XX vs. XY with known dilated cardiomyopathy associated loci on chromosome 5 and the PDK4 gene in the incidence and progression of dilated cardiomyopathy. The results show an interaction between known canine dilated cardiomyopathy loci and an unknown X-linked locus. Our study is the first to test a multigenic contribution to dilated cardiomyopathy and suggest a genetic basis for the known sex-disparity in dilated cardiomyopathy outcomes.
Emerging perspectives on hereditary glomerulopathies in canines
Directory of Open Access Journals (Sweden)
Littman MP
2015-04-01
Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic
Prognosis in canine idiopathic immune-mediated haemolytic anaemia
Piek, C.J.
2011-01-01
Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and
Apoptotic intrinsic pathway proteins predict survival in canine cutaneous mast cell tumours.
Barra, C N; Macedo, B M; Cadrobbi, K G; Pulz, L H; Huete, G C; Kleeb, S R; Xavier, J G; Catão-Dias, J L; Nishiya, A T; Fukumasu, H; Strefezzi, R F
2018-03-01
Mast cell tumours (MCTs) are the most frequent canine round cell neoplasms and show variable biological behaviours with high metastatic and recurrence rates. The disease is treated surgically and wide margins are recommended. Adjuvant chemotherapy and radiotherapy used in this disease cause DNA damage in neoplastic cells, which is aimed to induce apoptotic cell death. Resisting cell death is a hallmark of cancer, which contributes to the development and progression of tumours. The aim of this study was to investigate the expression of the proteins involved in the apoptotic intrinsic pathway and to evaluate their potential use as prognostic markers for canine cutaneous MCTs. Immunohistochemistry for BAX, BCL2, APAF1, Caspase-9, and Caspase-3 was performed in 50 canine cases of MCTs. High BAX expression was associated with higher mortality rate and shorter survival. BCL2 and APAF1 expressions offered additional prognostic information to the histopathological grading systems. The present results indicate that variations in the expression of apoptotic proteins are related to malignancy of cutaneous MCTs in dogs. © 2017 John Wiley & Sons Ltd.
Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A
2004-10-13
Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Elmarie Myburgh
Full Text Available Helminth parasites remain a major constraint upon human health and well-being in many parts of the world. Treatment of these infections relies upon a very small number of therapeutics, most of which were originally developed for use in animal health. A lack of high throughput screening systems, together with limitations of available animal models, has restricted the development of novel chemotherapeutics. This is particularly so for filarial nematodes, which are long-lived parasites with a complex cycle of development. In this paper, we describe attempts to visualise the immune response elicited by filarial parasites in infected mice using a non-invasive bioluminescence imaging reagent, luminol, our aim being to determine whether such a model could be developed to discriminate between live and dead worms for in vivo compound screening. We show that while imaging can detect the immune response elicited by early stages of infection with L3, it was unable to detect the presence of adult worms or, indeed, later stages of infection with L3, despite the presence of worms within the lymphatic system of infected animals. In the future, more specific reagents that detect secreted products of adult worms may be required for developing screens based upon live imaging of infected animals.
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Sashidhara, Koneni V; Singh, Suriya P; Misra, Sweta; Gupta, Jyoti; Misra-Bhattacharya, Shailja
2012-04-01
Bioassay guided fractionation of ethanolic extract of the leaves of Bauhinia racemosa led to the isolation of galactolipid and catechin class of the compounds (1-7) from the most active n-butanol fraction (F4). Among the active galactolipids, 1 emerged as the lead molecule which was active on both forms of lymphatic filarial parasite, Brugia malayi. It was found to be better than the standard drug ivermectin and diethylcarbamazine (DEC) in terms of dose and efficacy. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Canine distemper virus - a morbillivirus in search of new hosts?
T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)
1997-01-01
textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
DEFF Research Database (Denmark)
Martella, V.; Cirone, F.; Elia, G.
2006-01-01
Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
First autochthonous case of canine visceral leishmaniasis in Volta Redonda, Rio de Janeiro, Brazil
Directory of Open Access Journals (Sweden)
Monique Paiva de Campos
Full Text Available In Brazil, American visceral leishmaniasis (AVL is caused byLeishmania (Leishmania chagasi and its main vector isLutzomyia longipalpis. Cases of canine visceral leishmaniasis (CVL in non-endemic areas have been reported over the last few years throughout the country. The objective of this research note is to describe an autochthonous case of CVL that occurred in the municipality of Volta Redonda, state of Rio de Janeiro, an area where the disease is not endemic, alerting veterinarians and the scientific community to the expansion of this important zoonosis and advising veterinary practitioners on how to deal with a suspicion of CVL. Canine visceral leishmaniasis can be misdiagnosed within a broad spectrum of canine diseases based on clinical and laboratory findings. Therefore, knowledge of its clinical manifestations, specific and sensitive laboratory diagnostic tests and parasitological procedures are of the utmost importance for rapid confirmation and notification of a case, thus contributing directly to the control of a focus.
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production
Nuno Carinhas; Daniel A. M. Pais; Alexey Koshkin; Paulo Fernandes; Ana S. Coroadinha; Manuel J. T. Carrondo; Paula M. Alves; Ana P. Teixeira
2016-01-01
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-13C]glucose and [U-13C]glutamine, we apply for the first time 13C-Metabolic flux analysis (13C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells meta...
Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis
2014-04-23
Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Berentsen, Are R; Dunbar, Mike R; Becker, Matthew S; M'soka, Jassiel; Droge, Egil; Sakuya, Nicholas M; Matandiko, Wigganson; McRobb, Rachel; Hanlon, Cathleen A
2013-09-01
Disease transmission within and among wild and domestic carnivores can have significant impacts on populations, particularly for threatened and endangered species. We used serology to evaluate potential exposure to rabies virus, canine distemper virus (CDV), and canine parvovirus (CPV) for populations of African lions (Panthera leo), African wild dogs (Lycaon pictus), and spotted hyenas (Crocuta crocuta) in Zambia's South Luangwa National Park (SLNP) and Liuwa Plain National Park (LPNP) as well as community lands bordering these areas. In addition, domestic dogs in the study region were evaluated for exposure to CDV and rabies. We provide the first comprehensive disease exposure data for these species in these ecosystems. Twenty-one lions, 20 hyenas, 13 wild dogs, and 38 domestic dogs were sampled across both regions from 2009 to 2011. Laboratory results show 10.5% of domestic dogs, 5.0% of hyenas, and 7.7% of wild dogs sampled were positive for CDV exposure. All lions were negative. Exposure to CPV was 10.0% and 4.8% for hyenas and lions, respectively. All wild dogs were negative, and domestic dogs were not tested due to insufficient serum samples. All species sampled were negative for rabies virus neutralizing antibodies except lions. Forty percent of lions tested positive for rabies virus neutralizing antibodies. Because these lions appeared clinically healthy, this finding is consistent with seroconversion following exposure to rabies antigen. To our knowledge, this finding represents the first ever documentation of rabies virus neutralizing antibodies consistent with rabies exposure that did not lead to clinical disease in free-ranging African lions from this region. With ever-increasing human pressure on these ecosystems, understanding disease transmission dynamics is essential for proper management and conservation of these carnivore species.
Lack of Ubiquitin Specific Protease 8 (USP8) Mutations in Canine Corticotroph Pituitary Adenomas
Sbiera, Silviu; Tryfonidou, Marianna A; Weigand, Isabel; Grinwis, Guy C M; Broeckx, Bart; Herterich, Sabine; Allolio, Bruno; Deutschbein, Timo; Fassnacht, Martin; Meij, Björn P
2016-01-01
PURPOSE: Cushing's disease (CD), also known as pituitary-dependent hyperadrenocorticism, is caused by adrenocorticotropic hormone (ACTH)-secreting pituitary tumours. Affected humans and dogs have similar clinical manifestations, however, the incidence of the canine disease is thousand-fold higher.
Does contemporary canine diet cause cancer? ; A review
Directory of Open Access Journals (Sweden)
Joseph B Gentzel
2013-07-01
Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M
2018-01-01
Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Directory of Open Access Journals (Sweden)
Cecilia M Lopez
Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
Rojas, Alicia; Rojas, Diana; Montenegro, Víctor M; Baneth, Gad
2015-03-23
Canine filarioids are important nematodes transmitted to dogs by arthropods. Diagnosis of canine filariosis is accomplished by the microscopic identification of microfilariae, serology or PCR for filarial-DNA. The aim of this study was to evaluate a molecular assay for the detection of canine filariae in dog blood, to compare its performance to other diagnostic techniques, and to determine the relationship between microfilarial concentration and infection with other vector-borne pathogens. Blood samples from 146 dogs from Costa Rica were subjected to the detection of canine filarioids by four different methods: the microhematocrit tube test (MCT), Knott's modified test, serology and a high resolution melt and quantitative real-time PCR (HRM-qPCR). Co-infection with other vector-borne pathogens was also evaluated. Fifteen percent of the dogs were positive to Dirofilaria immitis by at least one of the methods. The HRM-qPCR produced distinctive melting plots for the different filarial worms and revealed that 11.6% of dogs were infected with Acanthocheilonema reconditum. The latter assay had a limit of detection of 2.4x10⁻⁴ mf/μl and detected infections with lower microfilarial concentrations in comparison to the microscopic techniques and the serological assay. The MCT and Knott's test only detected dogs with D. immitis microfilaremias above 0.7 mf/μl. Nevertheless, there was a strong correlation between the microfilarial concentration obtained by the Knott's modified test and the HRM-qPCR (r = 0.906, p HRM-qPCR showed the most sensitive and reliable performance in the detection of blood filaroids in comparison to the Knott's modified test, the MCT test and a serological assay.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
T.C. Harder (Timm); M.J.H. Kenter (Marcel); H. Vos; C.H.J. Siebelink (Kees); W. Huisman (Willem); C. Örvell; T. Barrett (Thomas); M.J.G. Appel (Max); A.D.M.E. Osterhaus (Albert); G. van Amerongen (Geert)
1996-01-01
textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated
A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article
Directory of Open Access Journals (Sweden)
S. Gur
2009-05-01
Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.
Canine and feline vector-borne diseases in Italy: current situation and perspectives
Directory of Open Access Journals (Sweden)
Dantas-Torres Filipe
2010-01-01
Full Text Available Abstract In Italy, dogs and cats are at risk of becoming infected by different vector-borne pathogens, including protozoa, bacteria, and helminths. Ticks, fleas, phlebotomine sand flies, and mosquitoes are recognized vectors of pathogens affecting cats and dogs, some of which (e.g., Anaplasma phagocytophilum, Borrelia burgdorferi, Dipylidium caninum, Leishmania infantum, Dirofilaria immitis, and Dirofilaria repens are of zoonotic concern. Recent studies have highlighted the potential of fleas as vectors of pathogens of zoonotic relevance (e.g., Rickettsia felis in this country. While some arthropod vectors (e.g., ticks and fleas are present in certain Italian regions throughout the year, others (e.g., phlebotomine sand flies are most active during the summer season. Accordingly, control strategies, such as those relying on the systematic use of acaricides and insecticides, should be planned on the basis of the ecology of both vectors and pathogens in different geographical areas in order to improve their effectiveness in reducing the risk of infection by vector-borne pathogens. This article reviews the current situation and perspectives of canine and feline vector-borne diseases in Italy.
Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew
2011-11-01
Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Directory of Open Access Journals (Sweden)
John Kuchtey
2011-02-01
Full Text Available Primary open angle glaucoma (POAG is a leading cause of blindness worldwide, with elevated intraocular pressure as an important risk factor. Increased resistance to outflow of aqueous humor through the trabecular meshwork causes elevated intraocular pressure, but the specific mechanisms are unknown. In this study, we used genome-wide SNP arrays to map the disease gene in a colony of Beagle dogs with inherited POAG to within a single 4 Mb locus on canine chromosome 20. The Beagle POAG locus is syntenic to a previously mapped human quantitative trait locus for intraocular pressure on human chromosome 19. Sequence capture and next-generation sequencing of the entire canine POAG locus revealed a total of 2,692 SNPs segregating with disease. Of the disease-segregating SNPs, 54 were within exons, 8 of which result in amino acid substitutions. The strongest candidate variant causes a glycine to arginine substitution in a highly conserved region of the metalloproteinase ADAMTS10. Western blotting revealed ADAMTS10 protein is preferentially expressed in the trabecular meshwork, supporting an effect of the variant specific to aqueous humor outflow. The Gly661Arg variant in ADAMTS10 found in the POAG Beagles suggests that altered processing of extracellular matrix and/or defects in microfibril structure or function may be involved in raising intraocular pressure, offering specific biochemical targets for future research and treatment strategies.
Association of canine juvenile generalized demodicosis with the dog leukocyte antigen system.
It, V; Barrientos, L; López Gappa, J; Posik, D; Díaz, S; Golijow, C; Giovambattista, G
2010-07-01
Demodectic mange is a well-known parasitic skin disease characterized by the presence of a larger than normal number of Demodex mites (Demodex canis) in the skin of dogs. Recent research has suggested that major histocompatibility complex (MHC) class II expression is higher in the skin of dogs suffering from demodicosis than in normal ones. We have investigated whether canine Dog Leukocyte Antigen (DLA) class II alleles are associated with canine juvenile generalized demodicosis (JGD). In the present study, the analysis of microsatellite markers (FH2202, FH2975 and FH2054) linked to DLA was made in Boxer, Argentinean Mastiff and mixed breed dogs. DNA samples from 56 dogs affected with the disease and 60 breed-matched controls collected in Argentina were analysed. A highly significant association, in some of the analysed markers, in all breeds with the presence of demodicosis was observed with P or =5. The results of this study suggest that an underlying DLA association exists with demodicosis in dogs and that this may represent an important immunological risk factor in the aetiology of this condition. This information could be used in the future to develop diagnostic tests to prevent canine JGD.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Data base management system for lymphatic filariasis--a neglected tropical disease.
Directory of Open Access Journals (Sweden)
Suryanaryana Murty Upadhyayula
Full Text Available BACKGROUND: Researchers working in the area of Public Health are being confronted with large volumes of data on various aspects of entomology and epidemiology. To obtain the relevant information out of these data requires particular database management system. In this paper, we have described about the usages of our developed database on lymphatic filariasis. METHODS: This database application is developed using Model View Controller (MVC architecture, with MySQL as database and a web based interface. We have collected and incorporated the data on filariasis in the database from Karimnagar, Chittoor, East and West Godavari districts of Andhra Pradesh, India. CONCLUSION: The importance of this database is to store the collected data, retrieve the information and produce various combinational reports on filarial aspects which in turn will help the public health officials to understand the burden of disease in a particular locality. This information is likely to have an imperative role on decision making for effective control of filarial disease and integrated vector management operations.
The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.
Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng
2017-05-01
Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.
Reference genes for reverse transcription quantitative PCR in canine brain tissue
Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C
2015-01-01
BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and
Canine faecal contamination and parasitic risk in the city of Naples (southern Italy
Directory of Open Access Journals (Sweden)
Veneziano Vincenzo
2006-09-01
Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between
Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts
Van Den Bossche, Lindsay; Schoonenberg, Vivien A.C.; Burgener, Iwan A.; Penning, Louis C.; Schrall, Ingrid M.; Kruitwagen, Hedwig S.; Van Wolferen, Monique E.; Grinwis, Guy C.M.; Kummeling, Anne; Rothuizen, Jan; Van Velzen, Jeroen F.; Stathonikos, Nikolas; Molenaar, Martijn R.; Helms, Bernd J.; Brouwers, Jos F.H.M.; Spee, Bart; Van Steenbeek, Frank G.
2017-01-01
Non-alcoholic fatty liver disease (NAFLD) is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in
Prevalence of canine hepatozoonosis in Areia, Paraíba, Brazil
Directory of Open Access Journals (Sweden)
Maria das Graças da Silva Bernardino
2016-02-01
Full Text Available Canine hepatozoonosis is a parasitic disease of debilitating nature. Also, it is immunosuppressive and difficult to diagnose clinically. The prevalence of the disease in dogs has been described in several Brazilian states, but studies are still scarce in the Northeast region. Accordingly, this study aimed to determine the prevalence of canine hepatozoonosis in Areia, Paraíba, Brazil. The dogs were clinically examined, and peripheral blood samples were obtained from the tip of the ear. Of the 151 dogs analyzed, 9.3% were positive for Hepatozoon canis by the demonstration of gamonts parasitizing neutrophils. The degree of parasitemia ranged from mild to intense. The observed hematological changes were different between animals and showed no pattern of response to infection. The subclinical form was observed in 50% of dogs and the others had nonspecific clinical signs. We conclude that hepatozoonosis occurs in dogs in the urban area of the city studied and that dogs infected with H. canis show hematological changes and nonspecific clinical signs.
Directory of Open Access Journals (Sweden)
Anuluck Junkum
2003-06-01
Full Text Available Blood-feeding and autogenous sub-colonies were selected from a laboratory, stock colony of Aedes togoi, which was originally collected from Koh Nom Sao, Chanthaburi province, Southeast Thailand. Comparative biology and filarial susceptibility between the two sub-colonies (blood-feeding: F11, F13; autogeny: F38, F40 were investigated to evaluate their viability and vectorial capacity. The results of comparison on biology revealed intraspecific differences, i.e., the average egg deposition/gravid female (F11/F38; F13/F40, embryonation rate (F13/F40, hatchability rate (F11/F38; F13/F40, egg width (F11/F38, wing length of females (F13/F40, and wing length and width of males (F11/F38 in the blood-feeding sub-colony were significantly greater than that in the autogenous sub-colony; and egg length (F11/F38 and width (F13/F40, and mean longevity of adult females (F11/F38 and males (F13/F40 in the blood-feeding sub-colony were significantly less than that in the autogenous sub-colony. The results of comparison on filarial susceptibility demonstrated that both sub-colonies yielded similar susceptibilities to Brugia malayi [blood-feeding/autogeny = 56.7% (F11/53.3%(F38, 60%(F13/83.3%(F40] and Dirofilaria immitis [blood-feeding/autogeny = 85.7%(F11/75%(F38, 45%(F13/29.4%(F40], suggesting autogenous Ae. togoi sub-colony was an efficient laboratory vector in study of filariasis.
Morello, Emanuela; Martano, Marina; Buracco, Paolo
2011-09-01
Osteosarcoma (OSA) is the most common primary bone tumour in dogs. The appendicular locations are most frequently involved and large to giant breed dogs are commonly affected, with a median age of 7-8 years. OSA is a locally invasive neoplasm with a high rate of metastasis, mostly to the lungs. Due to similarities in biology and treatment of OSA in dogs and humans, canine OSA represents a valid and important tumour model. Differences between canine and human OSAs include the age of occurrence (OSA is most commonly an adolescent disease in humans), localisation (the stifle is the most common site of localisation in humans) and limited use of neoadjuvant chemotherapy in canine OSA. Copyright © 2010 Elsevier Ltd. All rights reserved.
Effects of Carbenoxolone on the Canine Pituitary-Adrenal Axis.
Teshima, Takahiro; Matsumoto, Hirotaka; Okusa, Tomoko; Nakamura, Yumi; Koyama, Hidekazu
2015-01-01
Cushing's disease caused by pituitary corticotroph adenoma is a common endocrine disease in dogs. A characteristic biochemical feature of corticotroph adenomas is their relative resistance to suppressive negative feedback by glucocorticoids. The abnormal expression of 11beta-hydroxysteroid dehydrogenase (11HSD), which is a cortisol metabolic enzyme, is found in human and murine corticotroph adenomas. Our recent studies demonstrated that canine corticotroph adenomas also have abnormal expression of 11HSD. 11HSD has two isoforms in dogs, 11HSD type1 (HSD11B1), which converts cortisone into active cortisol, and 11HSD type2 (HSD11B2), which converts cortisol into inactive cortisone. It has been suggested that glucocorticoid resistance in corticotroph tumors is related to the overexpression of HSD11B2. Therefore it was our aim to investigate the effects of carbenoxolone (CBX), an 11HSD inhibitor, on the healthy dog's pituitary-adrenal axis. Dogs were administered 50 mg/kg of CBX twice each day for 15 days. During CBX administration, no adverse effects were observed in any dogs. The plasma adrenocorticotropic hormone (ACTH), and serum cortisol and cortisone concentrations were significantly lower at day 7 and 15 following corticotropin releasing hormone stimulation. After completion of CBX administration, the HSD11B1 mRNA expression was higher, and HSD11B2 mRNA expression was significantly lower in the pituitaries. Moreover, proopiomelanocortin mRNA expression was lower, and the ratio of ACTH-positive cells in the anterior pituitary was also significantly lower after CBX treatment. In adrenal glands treated with CBX, HSD11B1 and HSD11B2 mRNA expression were both lower compared to normal canine adrenal glands. The results of this study suggested that CBX inhibits ACTH secretion from pituitary due to altered 11HSD expressions, and is potentially useful for the treatment of canine Cushing's disease.
Nasolacrimal obstruction caused by root abscess of the upper canine in a cat.
Anthony, James M G; Sandmeyer, Lynne S; Laycock, Amanda R
2010-03-01
A 10-year-old, castrated male domestic short hair cat was presented to the Small Animal Clinic at the Western College of Veterinary Medicine with a presenting complaint of chronic, ocular discharge from the left eye. Ocular examination confirmed epiphora and mucopurulent discharge but there were no apparent reasons for the ocular discharge, and nasolacrimal obstruction was suspected. The cat had swelling of the left side of the face, severe periodontal disease and a fractured upper left canine tooth with pulpal exposure. Dacryocystorhinography revealed narrowing of the nasolacrimal duct above the root of the fractured upper left canine and dental radiographs showed a severe periapical lucency at the apex of the upper left canine tooth. The fractured canine tooth was removed. Subsequently, the ocular discharge and facial swelling resolved. After 2 years, the epiphora has never reoccurred. This is a noteworthy case because a suspected root abscess resulted in extralumenal compression of the nasolacrimal duct, which shows the importance of a thorough oral examination when nasolacrimal obstruction is evident.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Crisp, Matthew J; Beckett, Jeffrey; Coates, Joan R; Miller, Timothy M
2013-10-01
Mutations in canine superoxide dismutase 1 (SOD1) have recently been shown to cause canine degenerative myelopathy, a disabling neurodegenerative disorder affecting specific breeds of dogs characterized by progressive motor neuron loss and paralysis until death, or more common, euthanasia. This discovery makes canine degenerative myelopathy the first and only naturally occurring non-human model of amyotrophic lateral sclerosis (ALS), closely paralleling the clinical, pathological, and genetic presentation of its human counterpart, SOD1-mediated familial ALS. To further understand the biochemical role that canine SOD1 plays in this disease and how it may be similar to human SOD1, we characterized the only two SOD1 mutations described in affected dogs to date, E40K and T18S. We show that a detergent-insoluble species of mutant SOD1 is present in spinal cords of affected dogs that increases with disease progression. Our in vitro results indicate that both canine SOD1 mutants form enzymatically active dimers, arguing against a loss of function in affected homozygous animals. Further studies show that these mutants, like most human SOD1 mutants, have an increased propensity to form aggregates in cell culture, with 10-20% of cells possessing visible aggregates. Creation of the E40K mutation in human SOD1 recapitulates the normal enzymatic activity but not the aggregation propensity seen with the canine mutant. Our findings lend strong biochemical support to the toxic role of SOD1 in canine degenerative myelopathy and establish close parallels for the role mutant SOD1 plays in both canine and human disorders. Copyright © 2013 Elsevier Inc. All rights reserved.
Penetration of ASM 981 in canine skin: a comparative study.
Gutzwiller, Meret E Ricklin; Reist, Martin; Persohn, Elke; Peel, John E; Roosje, Petra J
2006-01-01
ASM 981 has been developed for topical treatment of inflammatory skin diseases. It specifically inhibits the production and release of pro-inflammatory cytokines. We measured the skin penetration of ASM 981 in canine skin and compared penetration in living and frozen skin. To make penetration of ASM 981 visible in dog skin, tritium labelled ASM 981 was applied to a living dog and to defrosted skin of the same dog. Using qualitative autoradiography the radioactive molecules were detected in the lumen of the hair follicles until the infundibulum, around the superficial parts of the hair follicles and into a depth of the dermis of 200 to 500 microm. Activity could not be found in deeper parts of the hair follicles, the dermis or in the sebaceous glands. Penetration of ASM 981 is low in canine skin and is only equally spread in the upper third of the dermis 24 hours after application. Penetration in frozen skin takes even longer than in living canine skin but shows the same distribution.
Adjuvant therapy with carboplatin and pamidronate for canine appendicular osteosarcoma.
Kozicki, A R; Robat, C; Chun, R; Kurzman, I D
2015-09-01
Amputation and chemotherapy are the mainstay of treatment for canine appendicular osteosarcoma (OSA). In vitro studies have demonstrated anti-tumour activity of pamidronate against canine OSA. The purpose of this study was to assess the safety of adding pamidronate to standard post-operative carboplatin chemotherapy in 17 dogs with appendicular OSA treated with limb amputation. Median disease-free interval (DFI) and median survival time (MST) were evaluated as secondary endpoints. Incidence of side effects and treatment outcomes were compared to 14 contemporary control patients treated with carboplatin alone. There were no identified side effects to the pamidronate treatment. The median DFI for the study group was 185 days compared to 172 days for the control group (P = 0.90). The MST of the study group was 311 days compared to 294 days for the control group (P = 0.89). Addition of pamidronate to carboplatin chemotherapy for the treatment of canine appendicular OSA is safe and does not impair efficacy of standard carboplatin treatment. © 2013 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
Directory of Open Access Journals (Sweden)
Danielle N C C Costa
Full Text Available BACKGROUND: Visceral leishmaniasis belongs to the list of neglected tropical diseases and is considered a public health problem worldwide. Spatial correlation between the occurrence of the disease in humans and high rates of canine infection suggests that in the presence of the vector, canine visceral leishmaniasis is the key factor for triggering transmission to humans. Despite the control strategies implemented, such as the sacrifice of infected dogs being put down, the incidence of American visceral leishmaniasis remains high in many Latin American countries. METHODOLOGY/PRINCIPAL FINDINGS: Mathematical models were developed to describe the transmission dynamics of canine leishmaniasis and its control by culling. Using these models, imperfect control scenarios were implemented to verify the possible factors which alter the effectiveness of controlling this disease in practice. CONCLUSIONS/SIGNIFICANCE: A long-term continuous program targeting both asymptomatic and symptomatic dogs should be effective in controlling canine leishmaniasis in areas of low to moderate transmission (R0 up to 1.4. However, the indiscriminate sacrifice of asymptomatic dogs with positive diagnosis may jeopardize the effectiveness of the control program, if tests with low specificity are used, increasing the chance of generating outrage in the population, and leading to lower adherence to the program. Therefore, culling must be planned accurately and implemented responsibly and never as a mechanical measure in large scale. In areas with higher transmission, culling alone is not an effective control strategy.
In-vitro antiviral efficacy of ribavirin and interferon-alpha against canine distemper virus.
Carvalho, Otávio V; Saraiva, Giuliana L; Ferreira, Caroline G T; Felix, Daniele M; Fietto, Juliana L R; Bressan, Gustavo C; Almeida, Márcia R; Silva Júnior, Abelardo
2014-10-01
Canine distemper is a highly contagious disease with high incidence and lethality in the canine population. The objective of this study was to evaluate the efficacy of antiviral action with ribavirin (RBV), interferon-alpha (IFNα), and combinations of RBV and IFNα against canine distemper virus (CDV). Vero cells inoculated with CDV were treated with RBV, IFNα, and combinations of these drugs. The efficacy to inhibit viral replication was evaluated by adding the compounds at different times to determine which step of the viral replicative process was affected. Both drugs were effective against CDV in vitro. The IFNα was the most active compound, with an average IC50 (50% inhibitory concentration) value lower than the IC50 of the RBV. Ribavirin (RBV) was more selective than IFNα, however, and neither drug showed extracellular antiviral activity. The combination of RBV and IFNα exhibited antiviral activity for the intra- and extracellular stages of the replicative cycle of CDV, although the intracellular viral inhibition was higher. Both RBV and IFNα showed high antiviral efficacy against CDV, and furthermore, RBV + IFNα combinations have shown greater interference range in viral infectivity. These compounds could potentially be used to treat clinical disease associated with CDV infection.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Canine babesiosis: a perspective on clinical complications, biomarkers, and treatment
Directory of Open Access Journals (Sweden)
Köster LS
2015-04-01
Full Text Available Liza S Köster,1 Remo G Lobetti,2 Patrick Kelly1 1Department of Clinical Sciences, One Health Center for Zoonoses and Tropical Veterinary Medicine, Ross University School of Veterinary Medicine, St Kitts, West Indies; 2Bryanston Veterinary Hospital, Bryanston, South Africa Abstract: Canine babesiosis is a common tick transmitted disease of dogs worldwide. A number of Babesia sp. can infect dogs and the spectrum is increasing as molecular methods are developed to differentiate organisms. Clinical signs are generally attributed to hemolysis caused by the organisms in the erythrocytes but in some animals with some Babesia spp. there can be an immune mediated component to the anemia and/or a severe inflammatory reaction associated. This complicated form of canine babesiosis is associated with high morbidity and mortality. A variety of clinical markers has been investigated to enable clinicians to provide more accurate prognoses and adapt their treatments which vary according to the infecting species. In this review, we discuss the taxonomy, clinical signs, diagnostic imaging, clinical biomarkers, treatment, and prophylaxis of one of the most common and important diseases of dogs worldwide. Keywords: babesiosis, vector-borne disease, dog
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
[Podoconiosis, a society and medical community neglected disease].
Prieto-Pérez, Laura; Soriano Cea, Juan José; Górgolas Hernández-Mora, Miguel
2015-11-20
Podoconiosis, mossy foot or endemic non-filarial elephantiasis, is a geochemical disease that causes lower limb lymphedema; it is directly related to walking barefoot over soils of volcanic origin, in areas with a high pluviometric annual index. It has a specific geographical distribution, affecting around 5% population in areas where it is endemic. It is debilitating and disfiguring disease, which frequently leads to social margination. Podoconiosis is totally preventable and, once a diagnosis is established, it may improve with simple therapeutic measures. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.
Cortina, María E; Novak, Analía; Melli, Luciano J; Elena, Sebastián; Corbera, Natalia; Romero, Juan E; Nicola, Ana M; Ugalde, Juan E; Comerci, Diego J; Ciocchini, Andrés E
2017-09-01
Brucellosis is a widespread zoonotic disease caused by Brucella spp. Brucella canis is the etiological agent of canine brucellosis, a disease that can lead to sterility in bitches and dogs causing important economic losses in breeding kennels. Early and accurate diagnosis of canine brucellosis is central to control the disease and lower the risk of transmission to humans. Here, we develop and validate enzyme and lateral flow immunoassays for improved serodiagnosis of canine brucellosis using as antigen the B. canis rough lipopolysaccharide (rLPS). The method used to obtain the rLPS allowed us to produce more homogeneous batches of the antigen that facilitated the standardization of the assays. To validate the assays, 284 serum samples obtained from naturally infected dogs and healthy animals were analyzed. For the B. canis-iELISA and B. canis-LFIA the diagnostic sensitivity was of 98.6%, and the specificity 99.5% and 100%, respectively. We propose the implementation of the B. canis-LFIA as a screening test in combination with the highly accurate laboratory g-iELISA. The B. canis-LFIA is a rapid, accurate and easy to use test, characteristics that make it ideal for the serological surveillance of canine brucellosis in the field or veterinary laboratories. Finally, a blind study including 1040 serum samples obtained from urban dogs showed a prevalence higher than 5% highlighting the need of new diagnostic tools for a more effective control of the disease in dogs and therefore to reduce the risk of transmission of this zoonotic pathogen to humans. Copyright © 2017 Elsevier B.V. All rights reserved.
Genetic variant of canine distemper virus from clinical cases in ...
African Journals Online (AJOL)
Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete
2009-07-30
The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.
Margarethe Hoenig
2014-01-01
Obesity and diabetes mellitus are common diseases in humans, dogs and cats and their prevalence is increasing. Obesity has been clearly identified as a risk factor for type 2 diabetes in humans and cats but recent data are missing in dogs, although there is evidence that the unprecedented rise in canine obesity in the last decade has led to a rise in canine diabetes of similar magnitude. The insulin resistance of obesity has often been portrayed as major culprit in the loss of glucose control...
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe
2017-08-15
Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.
The role of osteonecrosis in canine coronoid dysplasia: Arthroscopic and histopathological findings
Mariee, I.C.; Gröne, A.; Theyse, L.F.H.
2014-01-01
Coronoid dysplasia (CD) or medial coronoid disease is part of canine elbowdysplasia and eventually results in osteoarthrosis. Although CDwas originally attributed to disturbed endochondral ossification,more recent data point to the subchondral bone. The objective of this study was to assess
Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K
2011-04-09
Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
Decaro, Nicola; Desario, Costantina; Elia, Gabriella; Campolo, Marco; Lorusso, Alessio; Mari, Viviana; Martella, Vito; Buonavoglia, Canio
2007-01-26
A total of 29 faecal samples collected from dogs with diarrhoea following canine parvovirus (CPV) vaccination were tested by minor groove binder (MGB) probe assays for discrimination between CPV vaccine and field strains and by diagnostic tests for detection of other canine pathogens. Fifteen samples tested positive only for CPV field strains; however, both vaccine and field strains were detected in three samples. Eleven samples were found to contain only the vaccine strain, although eight of them tested positive for other pathogens of dogs. Only three samples were found to contain the vaccine strain without evidence of canine pathogens. The present study confirms that most cases of parvovirus-like disease occurring shortly after vaccination are related to infection with field strains of canine parvovirus type 2 (CPV-2) rather than to reversion to virulence of the modified live virus contained in the vaccine.
Definition, Classification, and Pathophysiology of Canine Glaucoma.
Pizzirani, Stefano
2015-11-01
Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. Copyright © 2015 Elsevier Inc. All rights reserved.
Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa
Directory of Open Access Journals (Sweden)
Nozyechi Ngulube Chidumayo
2018-02-01
Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Agnetti, Lucrecia; Fondello, Chiara; Villaverde, Marcela S.; Glikin, Gerardo C.; Finocchiaro, Liliana M. E.
2017-01-01
We originated and characterized melanoma cell lines derived from tumors of two feline and two canine veterinary patients. These lines reestablished the morphology, physiology and cell heterogeneity of their respective parental tumors. We evaluated the cytotoxicity of bleomycin (BLM) alone, or combined with interferon-β (IFN-β) or HSVtk/GCV suicide gene (SG) lipofection on these cells. Although the four animals presented stage III disease (WHO system), SG treated feline tumors displayed stable disease in vivo, while the canine ones exhibited partial response. Their derived cell lines reflected this behavior. Feline were significantly more sensitive than canine cells to IFN-β gene transfer. BLM improved the antitumor effects of both genes. The higher levels of reactive oxygen species (ROS) significantly correlated with membrane and DNA damages, emphasizing ROS intervention in apoptotic and necrotic cell death. After 3 days of BLM alone or combined with gene treatments, the colony forming capacity of two canine and one feline treatments survivor cells almost disappeared. Taken together, these results suggest that the treatments eradicated tumor initiating cells and support the clinical potential of the tested combinations. PMID:29344558
Simpson, Siobhan; Dunning, Mark David; de Brot, Simone; Grau-Roma, Llorenç; Mongan, Nigel Patrick; Rutland, Catrin Sian
2017-10-24
Osteosarcoma (OSA) is a rare cancer in people. However OSA incidence rates in dogs are 27 times higher than in people. Prognosis in both species is relatively poor, with 5 year OSA survival rates in people not having improved in decades. For dogs, 1 year survival rates are only around ~ 45%. Improved and novel treatment regimens are urgently required to improve survival in both humans and dogs with OSA. Utilising information from genetic studies could assist in this in both species, with the higher incidence rates in dogs contributing to the dog population being a good model of human disease. This review compares the clinical characteristics, gross morphology and histopathology, aetiology, epidemiology, and genetics of canine and human OSA. Finally, the current position of canine OSA genetic research is discussed and areas for additional work within the canine population are identified.
Long-term effects of canine parvovirus infection in dogs.
Kilian, Elena; Suchodolski, Jan S; Hartmann, Katrin; Mueller, Ralf S; Wess, Gerhard; Unterer, Stefan
2018-01-01
Canine parvovirus (CPV) is the most important viral cause of acute canine enteritis leading to severe damage of the intestinal barrier. It has been speculated that dogs might develop chronic disorders after surviving CPV infection. However, no studies regarding the long-term implications of CPV infection have been published to date. The aim of this study was to evaluate whether dogs that have survived CPV infection will have an increased risk for developing chronic gastroenteritis, atopic dermatitis, or cardiac disease. Dogs that had been treated at the Clinic of Small Animal Medicine, LMU Munich, for CPV infection for which a follow-up of at least 12 months was available, were included in the study. Owners completed a questionnaire on the presence of chronic gastrointestinal and cutaneous signs, cardiac disease, and other potential disorders. An identical questionnaire was sent to owners of matched control dogs during the same time period. Seventy-one questionnaires of dogs with CPV infection and 67 of control dogs were analyzed. Significantly more CPV-infected dogs (30/71) compared to control dogs (8/67) had developed chronic gastrointestinal signs later in their lives (P < 0.001). No significant differences were observed regarding skin diseases (P = 1), cardiac problems (P = 0.160), or any other diseases (P = 0.173) later in life. Results of this study suggest that dogs that survive CPV infection have a significantly higher risk (odds ratio = 5.33) for developing a chronic gastrointestinal disease. Further prospective studies to identify the trigger for the development of chronic diarrhoea and possible targeted treatment strategies are needed.
Genome-wide association study identifies a novel canine glaucoma locus.
Directory of Open Access Journals (Sweden)
Saija J Ahonen
Full Text Available Glaucoma is an optic neuropathy and one of the leading causes of blindness. Its hereditary forms are classified into primary closed-angle (PCAG, primary open-angle (POAG and primary congenital glaucoma (PCG. Although many loci have been mapped in human, only a few genes have been identified that are associated with the development of glaucoma and the genetic basis of the disease remains poorly understood. Glaucoma has also been described in many dog breeds, including Dandie Dinmont Terriers (DDT in which it is a late-onset (>7 years disease. We designed clinical and genetic studies to better define the clinical features of glaucoma in the DDT and to identify the genetic cause. Clinical diagnosis was based on ophthalmic examinations of the affected dogs and 18 additionally investigated unaffected DDTs. We collected DNA from over 400 DTTs and a genome wide association study was performed in a cohort of 23 affected and 23 controls, followed by a fine mapping, a replication study and candidate gene sequencing. The clinical study suggested that ocular abnormalities including abnormal iridocorneal angles and pectinate ligament dysplasia are common (50% and 72%, respectively in the breed and the disease resembles human PCAG. The genetic study identified a novel 9.5 Mb locus on canine chromosome 8 including the 1.6 Mb best associated region (p = 1.63 × 10(-10, OR = 32 for homozygosity. Mutation screening in five candidate genes did not reveal any causative variants. This study indicates that although ocular abnormalities are common in DDTs, the genetic risk for glaucoma is conferred by a novel locus on CFA8. The canine locus shares synteny to a region in human chromosome 14q, which harbors several loci associated with POAG and PCG. Our study reveals a new locus for canine glaucoma and ongoing molecular studies will likely help to understand the genetic etiology of the disease.
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
Canine sterile nodular panniculitis: a retrospective study of 39 dogs.
Contreary, Caitlin L; Outerbridge, Catherine A; Affolter, Verena K; Kass, Philip H; White, Stephen D
2015-12-01
Canine sterile nodular panniculitis (SNP) is an inflammatory disease of the panniculus that is typically managed with immunomodulatory or immunosuppressive treatments. It has been reported to be a cutaneous marker of an underlying systemic disease. To assess the presence or absence of concurrent systemic diseases associated with canine SNP and to document breed predispositions. Thirty nine dogs presented to a veterinary teaching hospital from 1990 to 2012 which met inclusion criteria. Inclusion in this retrospective study required a diagnosis of SNP via histopathological analysis and negative special stains for infectious organisms. Breed distributions of affected dogs were compared to all other dogs examined at this hospital during the study period. Correlations between the histological pattern of panniculitis and the histological presence of dermatitis, clinical presentation of lesions, dog breed and therapeutic outcomes were assessed. Australian shepherd dogs, Brittany spaniels, Dalmatians, Pomeranians and Chihuahuas were significantly over-represented, but correlations between inflammatory patterns of panniculitis and other histological and clinical factors were not identified. Based on the information available in medical records, 32 dogs (82.1%) had no concurrent systemic diseases identified. Four dogs had concurrent polyarthritis, which may be related to SNP through unknown mechanisms. This study identified several novel breed predilections for SNP; it failed to find any clear correlations with associated systemic diseases other than polyarthritis. The histological inflammatory pattern of SNP does not predict therapeutic outcome. © 2015 ESVD and ACVD.
T cell cytokine gene polymorphisms in canine diabetes mellitus.
Short, Andrea D; Catchpole, Brian; Kennedy, Lorna J; Barnes, Annette; Lee, Andy C; Jones, Chris A; Fretwell, Neale; Ollier, William E R
2009-03-15
Insulin-deficiency diabetes in dogs shares some similarities with human latent autoimmune diabetes of adults (LADA). Canine diabetes is likely to have a complex pathogenesis with multiple genes contributing to overall susceptibility and/or disease progression. An association has previously been shown between canine diabetes and MHC class II genes, although other genes are also likely to contribute to the genetic risk. Potential diabetes susceptibility genes include immuno-regulatory TH1/TH2 cytokines such as IFNgamma, IL-12, IL-4 and IL-10. We screened these candidate genes for single nucleotide polymorphisms (SNPs) in a range of different dog breeds using dHPLC analysis and DNA sequencing. Thirty-eight of the SNPs were genotyped in crossbreed dogs and seven other breed groups (Labrador Retriever, West Highland White Terrier, Collie, Schnauzer, Cairn Terrier, Samoyed and Cavalier King Charles Spaniel), which demonstrated substantial intra-breed differences in allele frequencies. When SNPs were examined for an association with diabetes by case:control analysis significant associations were observed for IL-4 in three breeds, the Collie, Cairn Terrier and Schnauzer and for IL-10 in the Cavalier King Charles Spaniel. These results suggest that canine cytokine genes regulating the TH1/TH2 immune balance might play a contributory role in determining susceptibility to diabetes in some breeds.
Prognostic factors in canine appendicular osteosarcoma - a meta-analysis.
Boerman, Ilse; Selvarajah, Gayathri T; Nielen, Mirjam; Kirpensteijn, Jolle
2012-05-15
Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST) do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP), bone alkaline phosphatase (BALP), infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location), looking at both survival time (ST) and disease free interval (DFI). The third factor (age) was studied in a qualitative manner. Both elevated SALP level and the (proximal) humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma.
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
Radiation, chemotherapy and surgery for canine osteosarcoma
International Nuclear Information System (INIS)
Powers, B.E.; Withrow, S.J.; La Rue, S.M.; Straw, R.C.; Gillette, E.L.
1987-01-01
Spontaneous canine osteosarcomas is an excellent model for of human osterosarcoma. Twenty dogs with obsteorsarcoma were treated with intravenous or intraarterial cisplatin with or without radiation therapy. This treatment was given 3 weeks prior to limb sparing surgery involving excision of the tumor and allograft replacement. The excised tumor specimen was examined for complete removal and percentage of necrotic tumor measured by planimetry. Intraveneous and intraarterial cisplatin and radiation methods were compared. Data discussing rate of disease development and recurrences is given
Canine hepatozoonosis in Brazil: description of eight naturally occurring cases.
Gondim, L F; Kohayagawa, A; Alencar, N X; Biondo, A W; Takahira, R K; Franco, S R
1998-01-31
Eight cases of canine hepatozoonosis were diagnosed at the Veterinary Hospital (Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista, Campus de Botucatu), between October 1993 and April 1994. Clinical signs included anorexia, pale mucous membranes, weight loss, pain, diarrhoea, vomit, gait abnormalities, fever, polyuria and polydipsia. Haematologic findings revealed anaemia in seven cases, leucocytosis with neutrophilia in three cases, lymphopenia in three cases and monocytosis in four cases. Serum biochemistries included alterations in many parameters. The micrometry of Hepatozoon canis gametocytes ranged from 6.8 x 4.0 microns to 7.5 x 4.5 microns. Parasitaemia ranged from less than 0.5% to 2%. In all the cases reported other concurrent diseases were present. Diagnosis of canine hepatozoonosis was made by identifying H. canis gametocytes within leucocytes in stained blood smears.
Directory of Open Access Journals (Sweden)
Weigeng Shao
2017-11-01
Full Text Available Giant panda is the world-class precious endangered species, facing the canine distemper and other important infectious diseases on its wild and captive population of a serious threat. In this study, we used MaxEnt model and combined with ArcGIS analysis to predict the potential risk of canine distemper to giant panda habitat in Sichuan, Gansu and Shaanxi Provinces, China. The results showed that 35.05% and 19.47% of the distribution areas of the giant pandas were in the high risk and medium risk of canine distemper, respectively. The canine distemper pose a great risk to the healthy survival of giant pandas in China. In future, epidemic prevention, vaccine development and application of wild animals should be enhanced so as to effectively protect the giant panda.
Ge, Jinying; Wang, Xijun; Tian, Meijie; Gao, Yuwei; Wen, Zhiyuan; Yu, Guimei; Zhou, Weiwei; Zu, Shulong; Bu, Zhigao
2015-05-15
Canine Distemper Virus (CDV) infects many carnivores and cause several high-mortality disease outbreaks. The current CDV live vaccine cannot be safely used in some exotic species, such as mink and ferret. Here, we generated recombinant lentogenic Newcastle disease virus (NDV) LaSota expressing either envelope glycoproyein, heamagglutinine (H) or fusion protein (F), named as rLa-CDVH and rLa-CDVF, respectively. The feasibility of these recombinant NDVs to serve as live virus-vectored CD vaccine was evaluated in minks. rLa-CDVH induced significant neutralization antibodies (NA) to CDV and provided solid protection against virulent CDV challenge. On the contrast, rLa-CDVF induced much lower NA to CDV and fail to protected mink from virulent CDV challenge. Results suggest that recombinant NDV expressing CDV H is safe and efficient candidate vaccine against CDV in mink, and maybe other host species. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Subash Babu
Full Text Available Lymphatic filariasis can be associated with development of serious pathology in the form of lymphedema, hydrocele, and elephantiasis in a subset of infected patients.To elucidate the role of CD4(+ T cell subsets in the development of lymphatic pathology, we examined specific sets of cytokines in individuals with filarial lymphedema in response to parasite antigen (BmA and compared them with responses from asymptomatic infected individuals. We also examined expression patterns of Toll-like receptors (TLR1-10 and Nod-like receptors (Nod1, Nod2, and NALP3 in response to BmA. BmA induced significantly higher production of Th1-type cytokines-IFN-gamma and TNF-alpha-in patients with lymphedema compared with asymptomatic individuals. Notably, expression of the Th17 family of cytokines-IL-17A, IL-17F, IL-21, and IL-23-was also significantly upregulated by BmA stimulation in lymphedema patients. In contrast, expression of Foxp3, GITR, TGFbeta, and CTLA-4, known to be expressed by regulatory T cells, was significantly impaired in patients with lymphedema. BmA also induced significantly higher expression of TLR2, 4, 7, and 9 as well Nod1 and 2 mRNA in patients with lymphedema compared with asymptomatic controls.Our findings implicate increased Th1/Th17 responses and decreased regulatory T cells as well as regulation of Toll- and Nod-like receptors in pathogenesis of filarial lymphedema.
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
Campos, Roseane; Santos, Márcio; Tunon, Gabriel; Cunha, Luana; Magalhães, Lucas; Moraes, Juliana; Ramalho, Danielle; Lima, Sanmy; Pacheco, José Antônio; Lipscomb, Michael; Ribeiro de Jesus, Amélia; Pacheco de Almeida, Roque
2017-05-11
Visceral leishmaniasis (VL) is a systemic disease endemic in tropical countries and transmitted through sand flies. In particular, Canis familiaris (or domesticated dogs) are believed to be a major urban reservoir for the parasite causing the disease Leishmania. The average number of human VL cases was 58 per year in the state of Sergipe. The city of Aracaju, capital of Sergipe in Northeastern Brazil, had 159 cases of VL in humans. Correlatively, the percentage of serologically positive dogs for leishmaniasis increased from 4.73% in 2008 to 12.69% in 2014. Thus, these studies aimed to delineate the spatial distribution and epidemiological aspects of human and canine VL as mutually supportive for increased incidence. The number of human cases of VL and the frequency of canine positive serology for VL both increased between 2008 and 2014. Spatial distribution analyses mapped areas of the city with the highest concentration of human and canine VL cases. The neighbourhoods that showed the highest disease frequency were located on the outskirts of the city and in urbanised areas or subjected to development. Exponential increase in VL-positive dogs further suggests that the disease is expanding in urban areas, where it can serve as a reservoir for transmission of dogs to humans via the sand fly vector.
Directory of Open Access Journals (Sweden)
Roseane Campos
2017-05-01
Full Text Available Visceral leishmaniasis (VL is a systemic disease endemic in tropical countries and transmitted through sand flies. In particular, Canis familiaris (or domesticated dogs are believed to be a major urban reservoir for the parasite causing the disease Leishmania. The average number of human VL cases was 58 per year in the state of Sergipe. The city of Aracaju, capital of Sergipe in Northeastern Brazil, had 159 cases of VL in humans. Correlatively, the percentage of serologically positive dogs for leishmaniasis increased from 4.73% in 2008 to 12.69% in 2014. Thus, these studies aimed to delineate the spatial distribution and epidemiological aspects of human and canine VL as mutually supportive for increased incidence. The number of human cases of VL and the frequency of canine positive serology for VL both increased between 2008 and 2014. Spatial distribution analyses mapped areas of the city with the highest concentration of human and canine VL cases. The neighbourhoods that showed the highest disease frequency were located on the outskirts of the city and in urbanised areas or subjected to development. Exponential increase in VL-positive dogs further suggests that the disease is expanding in urban areas, where it can serve as a reservoir for transmission of dogs to humans via the sand fly vector.
Anderson, Kadie; Case, Allison; Woodie, Kathleen; Waddell, William; Reed, Holly H
2014-09-01
There is growing information available regarding duration of immunity for core vaccines in both domestic and nondomestic species. Vaccination protocols in nondomestic canids have frequently followed guidelines developed for the domestic dog; however, these protocols can be inappropriate for nondomestic canids such as the African wild dog (Lycaon pictus), leaving some animals susceptible to infectious disease and others at risk for contracting vaccine-induced disease. In this study, red wolves (Canis rufus) were vaccinated against canine distemper virus (CDV) and canine parvovirus (CPV) and vaccination titers were followed annually for 3 yr. One hundred percent of wolves developed and maintained a positive titer to CDV for 3 yr and 96.9% of wolves developed and maintained a positive titer to CPV for 3 yr. Seroconversion for canine adenovirus was sporadic. The results of this study support decreasing the frequency of vaccine administration in the red wolf population to a triennial basis.
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Behling-Kelly, Erica
2016-03-01
The evaluation of lipoprotein metabolism in small animal medicine is hindered by the lack of a gold standard method and paucity of validation data to support the use of automated chemistry methods available in the typical veterinary clinical pathology laboratory. The physical and chemical differences between canine and human lipoproteins draw into question whether the transference of some of these human methodologies for the study of canine lipoproteins is valid. Validation of methodology must go hand in hand with exploratory studies into the diagnostic or prognostic utility of measuring specific lipoproteins in veterinary medicine. The goal of this study was to compare one commercially available wet-chemistry method to manual and automated lipoprotein electrophoresis in the analysis of canine lipoproteins. Canine lipoproteins from 50 dogs were prospectively analyzed by 2 electrophoretic methods, one automated and one manual method, and one wet-chemistry method. Electrophoretic methods identified a higher proportion of low-density lipoproteins than the wet-chemistry method. Automated electrophoresis occasionally failed to identify very low-density lipoproteins. Wet-chemistry methods designed for evaluation of human lipoproteins are insensitive to canine low-density lipoproteins and may not be applicable to the study of canine lipoproteins. Automated electrophoretic methods will likely require significant modifications if they are to be used in the analysis of canine lipoproteins. Studies aimed at determining the impact of a disease state on lipoproteins should thoroughly investigate the selected methodology prior to the onset of the study. © 2016 American Society for Veterinary Clinical Pathology.
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B
2017-09-01
Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.
Milk C-reactive protein in canine mastitis.
Vasiu, Iosif; Dąbrowski, Roman; Martinez-Subiela, Silvia; Ceron, Jose J; Wdowiak, Anna; Pop, Raul Alexandru; Brudaşcă, Florinel Gheorghe; Pastor, Josep; Tvarijonaviciute, Asta
2017-04-01
Presence of mastitis in lactating bitches can become life threatening for both the bitch and pups. The aim of the present study was to evaluate a possible utility of C-reactive protein (CRP) in both milk and serum for canine mastitis diagnosis. Our study showed that milk CRP levels ranged between 0.1 and 4.9μg/mL and from 0.3 to 40.0μg/mL in healthy and diseased bitches (Pcanine mastitis. Copyright © 2017 Elsevier B.V. All rights reserved.
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
Why is Southern African canine babesiosis so virulent? An evolutionary perspective
Directory of Open Access Journals (Sweden)
Penzhorn Barend L
2011-04-01
Full Text Available Abstract Canine babesiosis is a common, highly virulent disease in Southern Africa with even pups and juveniles being severely affected. This contrasts with bovine babesiosis, for example, where host, parasite and vector co-evolved and young animals develop immunity after infection without showing clinical signs. Babesia rossi, the main causative organism of canine babesiosis in sub-Saharan Africa, was first described from a side-striped jackal (Canis adustus in Kenya. Although data are meagre, there is evidence that indigenous African canids, such as jackals and wild dogs (Lycaon pictus, can harbour the parasite without showing untoward effects. Dogs are not indigenous to Africa. The vast majority of dogs presented at veterinary facilities in South Africa represent recently introduced European, Asian or American breeds. The contention is that B. rossi is a new challenge to which these dogs have not adapted. With intensive treatment of clinical cases, natural selection is effectively negated and the status quo will probably be maintained indefinitely. It is postulated that Babesia vogeli, which frequently results in unapparent infections or mild manifestations in dogs, represents or is closely related to the ancestral form of the canine parasite, possibly originating from wolves (Canis lupus.
Mast cells in Canine parvovirus-2-associated enteritis with crypt abscess.
Woldemeskel, M W; Saliki, J T; Blas-Machado, U; Whittington, L
2013-11-01
The role of mast cells (MCs) in allergic reactions and parasitic infections is well established. Their involvement in host immune response against bacterial and viral infections is reported. In this study, investigation is made to determine if MCs are associated with Canine parvovirus-2 (CPV-2)-induced enteritis with crypt abscess (ECA). Mast cell count (MCC) was made on toluidine blue-stained intestinal sections from a total of 34 dogs. These included 16 dogs exhibiting ECA positive for CPV-2 and negative for Canine distemper virus and Canine coronavirus by immunohistochemistry and fluorescent antibody test, 12 dogs with inflammatory bowel disease (IBD), and 6 non-ECA/non-IBD (control) dogs. The average total MCC per high-power field in ECA (40.8 ± 2.2) and IBD (24.7 ± 2.1) was significantly higher (P .05), MCC was also higher in ECA than in IBD. The present study for the first time has documented significantly increased MCs in CPV-2-associated ECA as was previously reported for IBD, showing that MCs may also play an important role in CPV-2-associated ECA. Further studies involving more CPV-infected dogs are recommended to substantiate the findings.
The immuno-pathological conversions of canine demodicosis.
Singh, Shanker K; Dimri, Umesh
2014-06-16
Canine demodicosis is a common but exigent noncontagious parasitic dermatosis caused by overpopulation of the host-specific follicular mites of various Demodex species. Receptivity of dogs to demodicosis and progression of the clinical disease are influenced by numerous factors including; genetic defect, alteration of skin's structure and biochemistry, immunological disorders, hormonal status, breed, age, nutritional status, oxidative stress, length of hair coat, stage of oestrus cycle, parturition, endoparasitism and debilitating diseases. Of these, the immune status is thought to be the most significant. Thus, in the present review we intended to edify the immuno-pathological conversions of canine demodicosis. Generalized demodicosis requires a cutaneous environment that is ecologically and immunologically favorable for extreme colonization of demodectic mites. Demodex canis mites can down regulate the CD4+ T cells; possibly by an increased rate of apoptosis or immunological exhaustion of CD4+ T cells. An increased apoptosis of peripheral leukocytes confers progression of the clinical manifestations. Mites induced elevation of TGF-β and inhibition of TNF-α mRNA expression might be a key factor for revealing the difference in the mechanism of onset between localized and generalized demodicosis. Moreover, an elevated serum level of IL-10 could be accountable for the recurrence as well as occurrence of demodicosis in dogs. Over production of reactive oxygen species can corroborate immunological discrepancies in dogs with demodicosis. Copyright © 2014 Elsevier B.V. All rights reserved.
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management
Wakshlag, Joseph J; Loftus,John
2014-01-01
John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is...
Directory of Open Access Journals (Sweden)
Takaoka H.
2003-03-01
Full Text Available Several Simulium species were investigated as to their biting habits and natural infections with filarial larvae at Ban Pan Fan, Chiang Mai Province, in northern Thailand. Female adults flies landing on or flighting around a human and a water buffalo were collected during the daytime from 06.00 to 19.00 hours on 22 June 2001. As a result, 217 S. nodosum, 86 S. asakoae and two S. nigrogilvum were obtained from a human attractant, and 416 S. nodosum, 25 S. nakhonense, 16 S. asakoae, four 5. fenestratum and two S. nigrogilvum, from a water buffalo. The blood-feeding was confirmed only for S. nodosum and S. nigrogilvum on humans, and for S. nodosum and S. nakhonense on water buffalos. Dissections of these simuliids showed that S. nodosum was naturally infected with developing filarial larvae. Two types of microfilariae were distinguished but only one type of infective larvae. These larvae resembled Onchocerca suzukii, a parasite from a wild Japanese bovid, suggesting that an unknown Onchocerca species from ruminants was transmitted in Thailand. Infection rates with all stages of larvae and third-stage larvae were 2.3 % (14/608 and 1 .0 % (6/608, respectively. This is the first report of natural infections of black flies with Onchocerca larvae in Southeast Asia, and the involved black fly species is shown to be not only anthropophilic but also zoophilic in this region.
Jenkins, Eileen K.; DeChant, Mallory T.; Perry, Erin B.
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines. PMID:29651421
Directory of Open Access Journals (Sweden)
Eileen K. Jenkins
2018-03-01
Full Text Available The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.
Jenkins, Eileen K; DeChant, Mallory T; Perry, Erin B
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.
Identification of the rostral migratory stream in the canine and feline brain.
Directory of Open Access Journals (Sweden)
Saafan Z Malik
Full Text Available In the adult rodent brain, neural progenitor cells migrate from the subventricular zone of the lateral ventricle towards the olfactory bulb in a track known as the rostral migratory stream (RMS. To facilitate the study of neural progenitor cells and stem cell therapy in large animal models of CNS disease, we now report the location and characteristics of the normal canine and feline RMS. The RMS was found in Nissl-stained sagittal sections of adult canine and feline brains as a prominent, dense, continuous cellular track beginning at the base of the anterior horn of the lateral ventricle, curving around the head of the caudate nucleus and continuing laterally and ventrally to the olfactory peduncle before entering the olfactory tract and bulb. To determine if cells in the RMS were proliferating, the thymidine analog 5-bromo-2-deoxyuridine (BrdU was administered and detected by immunostaining. BrdU-immunoreactive cells were present throughout this track. The RMS was also immunoreactive for markers of proliferating cells, progenitor cells and immature neurons (Ki-67 and doublecortin, but not for NeuN, a marker of mature neurons. Luxol fast blue and CNPase staining indicated that myelin is closely apposed to the RMS along much of its length and may provide guidance cues for the migrating cells. Identification and characterization of the RMS in canine and feline brain will facilitate studies of neural progenitor cell biology and migration in large animal models of neurologic disease.
Canine nodal marginal zone lymphoma: Descriptive insight into the biological behaviour.
Cozzi, M; Marconato, L; Martini, V; Aresu, L; Riondato, F; Rossi, F; Stefanello, D; Comazzi, S
2018-06-01
Canine nodal marginal zone lymphoma (nMZL) is classified as an indolent lymphoma. Such lymphomas are typified by low mitotic rate and slow clinical progression. While the clinical behaviour of canine splenic MZL has been described, characterized by an indolent course and a good prognosis following splenectomy, there are no studies specifically describing nMZL. The aim of this study was to describe the clinical features of and outcome for canine nMZL. Dogs with histologically confirmed nMZL undergoing a complete staging work-up (including blood analysis, flow cytometry [FC] on lymph node [LN], peripheral blood and bone marrow, imaging, histology and immunohistochemistry on a surgically removed peripheral LN) were retrospectively enrolled. Treatment consisted of chemotherapy or chemo-immunotherapy. Endpoints were response rate (RR), time to progression (TTP) and lymphoma-specific survival (LSS). A total of 35 cases were enrolled. At diagnosis, all dogs showed generalized lymphadenopathy. One-third was systemically unwell. All dogs had stage V disease; one-third also had extranodal involvement. The LN population was mainly composed of medium-sized CD21+ cells with scant resident normal lymphocytes. Histology revealed diffuse LN involvement, referring to "late-stage" MZL. Median TTP and LSS were 149 and 259 days, respectively. Increased LDH activity and substage b were significantly associated with a shorter LSS. Dogs with nMZL may show generalized lymphadenopathy and an advanced disease stage. Overall, the outcome is poor, despite the "indolent" designation. The best treatment option still needs to be defined. © 2017 John Wiley & Sons Ltd.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies
DEFF Research Database (Denmark)
Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent
2015-01-01
Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
Seroepidemiology of Canine parvovirus infection in dogs
Directory of Open Access Journals (Sweden)
Indrawati Sendow
2004-10-01
Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
Finding Cardiovascular Disease Genes in the Dog
Parker, Heidi G.; Meurs, Kathryn M.; Ostrander, Elaine A.
2013-01-01
Recent advances in canine genomics are changing the landscape of veterinary biology, and by default, veterinary medicine. No longer are clinicians locked into traditional methods of diagnoses and therapy. Rather major advances in canine genetics and genomics from the past five years are now changing the way the veterinarian of the 21st century practices medicine. First, the availability of a dense genome map gives canine genetics a much needed foothold in comparative medicine, allowing advances made in human and mouse genetics to be applied to companion animals. Second, the recently released 7.5x whole genome sequence of the dog is facilitating the identification of hereditary disease genes. Finally, development of genetic tools for rapid screening of families and populations at risk for inherited disease means that the cost of identifying and testing for disease loci will significantly decrease in coming years. Out of these advances will come major changes in companion animal diagnostics and therapy. Clinicians will be able to offer their clients genetic testing and counseling for a myriad of disorders. Such advances are certain to generate healthier and more long lived dogs, improving quality of life for owner and pet alike. The clinician of the 21st century, therefore, faces incredible opportunities as well as challenges in the management of genetic disease. In this review we summarize recent findings in canine genomics and discuss their application to the study of canine cardiac health. PMID:19083345
Energy Technology Data Exchange (ETDEWEB)
Boretti, Felicitos; Reusch, C.E. [Klinik fuer Kleintiermedizin, Vetsuisse Fakultaet Zuerich, Univ. Zuerich (Switzerland)
2010-03-15
Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen {sup registered}) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
Mata, Melinda; Vera, Juan; Gerken, Claudia; Rooney, Cliona M.; Miller, Tasha; Pfent, Catherine; Wang, Lisa L.; Wilson-Robles, Heather M.; Gottschalk, Stephen
2014-01-01
Adoptive transfer of T cells expressing chimeric antigen receptors (CARs) has shown promising anti-tumor activity in early phase clinical studies, especially for hematological malignancies. However, most preclinical models do not reliably mimic human disease. We reasoned that developing an adoptive T-cell therapy approach for spontaneous osteosarcoma (OS) occurring in dogs would more closely reproduce the condition in human cancer. To generate CAR-expressing canine T cells we developed expansion and transduction protocols that allow for the generation of sufficient numbers of CAR-expressing canine T cells for future clinical studies in dogs within 2 weeks of ex vivo culture. To evaluate the functionality of CAR-expressing canine T cells we targeted HER2-positive OS. We demonstrate that canine OS is positive for HER2, and that canine T cells expressing a HER2-specific CAR with human-derived transmembrane and CD28.ζ signaling domains recognize and kill HER2-positive canine OS cell lines in an antigen-dependent manner. To reduce the potential immunogenicity of the CAR we evaluated a CAR with canine-derived transmembrane and signaling domains, and found no functional difference between human and canine CARs. Hence, we have successfully developed a strategy to generate CAR-expressing canine T cells for future preclinical studies in dogs. Testing T-cell therapies in an immunocompetent, outbred animal model may improve our ability to predict their safety and efficacy prior to conducting studies in humans. PMID:25198528
Canine urothelial carcinoma: genomically aberrant and comparatively relevant.
Shapiro, S G; Raghunath, S; Williams, C; Motsinger-Reif, A A; Cullen, J M; Liu, T; Albertson, D; Ruvolo, M; Bergstrom Lucas, A; Jin, J; Knapp, D W; Schiffman, J D; Breen, M
2015-06-01
Urothelial carcinoma (UC), also referred to as transitional cell carcinoma (TCC), is the most common bladder malignancy in both human and canine populations. In human UC, numerous studies have demonstrated the prevalence of chromosomal imbalances. Although the histopathology of the disease is similar in both species, studies evaluating the genomic profile of canine UC are lacking, limiting the discovery of key comparative molecular markers associated with driving UC pathogenesis. In the present study, we evaluated 31 primary canine UC biopsies by oligonucleotide array comparative genomic hybridization (oaCGH). Results highlighted the presence of three highly recurrent numerical aberrations: gain of dog chromosome (CFA) 13 and 36 and loss of CFA 19. Regional gains of CFA 13 and 36 were present in 97 % and 84 % of cases, respectively, and losses on CFA 19 were present in 77 % of cases. Fluorescence in situ hybridization (FISH), using targeted bacterial artificial chromosome (BAC) clones and custom Agilent SureFISH probes, was performed to detect and quantify these regions in paraffin-embedded biopsy sections and urine-derived urothelial cells. The data indicate that these three aberrations are potentially diagnostic of UC. Comparison of our canine oaCGH data with that of 285 human cases identified a series of shared copy number aberrations. Using an informatics approach to interrogate the frequency of copy number aberrations across both species, we identified those that had the highest joint probability of association with UC. The most significant joint region contained the gene PABPC1, which should be considered further for its role in UC progression. In addition, cross-species filtering of genome-wide copy number data highlighted several genes as high-profile candidates for further analysis, including CDKN2A, S100A8/9, and LRP1B. We propose that these common aberrations are indicative of an evolutionarily conserved mechanism of pathogenesis and harbor genes
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
Energy Technology Data Exchange (ETDEWEB)
Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)
2014-04-15
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.
2014-01-01
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Glucosamine and chondroitin use in canines for osteoarthritis: A review
Directory of Open Access Journals (Sweden)
Angel Bhathal
2017-02-01
Full Text Available Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine’s quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and conflicting evidence, the natural products glucosamine hydrochloride (HCl and chondroitin sulfate are commonly recommended by veterinarians for treating osteoarthritis in dogs. There is a paucity of well-designed clinical veterinary studies investigating the true treatment effect of glucosamine and chondroitin. The purposes of this review article are to provide a brief background on glucosamine and chondroitin use in canine osteoarthritis and to critically review the available literature on the role of these products for improving clinical outcomes. Based on critical review, recommendations for practice are suggested and a future study design is proposed.
Segmentation of the Canine Corpus Callosum using Diffusion Tensor Imaging Tractography
Pierce, T.T.; Calabrese, E.; White, L.E.; Chen, S.D.; Platt, S.R.; Provenzale, J.M.
2014-01-01
Background We set out to determine functional white matter (WM) connections passing through the canine corpus callosum useful for subsequent studies of canine brains that serve as models for human WM pathway disease. Based on prior studies, we anticipated that the anterior corpus callosum would send projections to the anterior cerebral cortex while progressively posterior segments would send projections to more posterior cortex. Methods A post mortem canine brain was imaged using a 7T MRI producing 100 micron isotropic resolution DTI analyzed by tractography. Using ROIs within cortical locations, which were confirmed by a Nissl stain that identified distinct cortical architecture, we successfully identified 6 important WM pathways. We also compared fractional anisotropy (FA), apparent diffusion coefficient (ADC), radial diffusivity (RD), and axial diffusivity (AD) in tracts passing through the genu and splenium. Results Callosal fibers were organized based upon cortical destination, i.e. fibers from the genu project to the frontal cortex. Histologic results identified the motor cortex based on cytoarchitectonic criteria that allowed placement of ROIs to discriminate between frontal and parietal lobes. We also identified cytoarchitecture typical of the orbital frontal, anterior frontal, and occipital regions and placed ROIs accordingly. FA, ADC, RD and AD values were all higher in posterior corpus callosum fiber tracts. Conclusions Using 6 cortical ROIs, we identified 6 major white matter tracts that reflect major functional divisions of the cerebral hemispheres and we derived quantitative values that can be used for study of canine models of human WM pathological states. PMID:24370161
Segmentation of the canine corpus callosum using diffusion-tensor imaging tractography.
Pierce, Theodore T; Calabrese, Evan; White, Leonard E; Chen, Steven D; Platt, Simon R; Provenzale, James M
2014-01-01
We set out to determine functional white matter (WM) connections passing through the canine corpus callosum; these WM connections would be useful for subsequent studies of canine brains that serve as models for human WM pathway disease. Based on prior studies, we anticipated that the anterior corpus callosum would send projections to the anterior cerebral cortex whereas progressively posterior segments would send projections to more posterior cortex. A postmortem canine brain was imaged using a 7-T MRI system producing 100-μm-isotropic-resolution diffusion-tensor imaging analyzed by tractography. Using regions of interest (ROIs) within cortical locations, which were confirmed by a Nissl stain that identified distinct cortical architecture, we successfully identified six important WM pathways. We also compared fractional anisotropy (FA), apparent diffusion coefficient (ADC), radial diffusivity, and axial diffusivity in tracts passing through the genu and splenium. Callosal fibers were organized on the basis of cortical destination (e.g., fibers from the genu project to the frontal cortex). Histologic results identified the motor cortex on the basis of cytoarchitectonic criteria that allowed placement of ROIs to discriminate between frontal and parietal lobes. We also identified cytoarchitecture typical of the orbital frontal, anterior frontal, and occipital regions and placed ROIs accordingly. FA, ADC, radial diffusivity, and axial diffusivity values were all higher in posterior corpus callosum fiber tracts. Using six cortical ROIs, we identified six major WM tracts that reflect major functional divisions of the cerebral hemispheres, and we derived quantitative values that can be used for study of canine models of human WM pathologic states.
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
Total disc replacement using tissue-engineered intervertebral discs in the canine cervical spine.
Directory of Open Access Journals (Sweden)
Yu Moriguchi
Full Text Available The most common reason that adults in the United States see their physician is lower back or neck pain secondary to degenerative disc disease. To date, approaches to treat degenerative disc disease are confined to purely mechanical devices designed to either eliminate or enable flexibility of the diseased motion segment. Tissue engineered intervertebral discs (TE-IVDs have been proposed as an alternative approach and have shown promise in replacing native IVD in the rodent tail spine. Here we demonstrate the efficacy of our TE-IVDs in the canine cervical spine. TE-IVD components were constructed using adult canine annulus fibrosis and nucleus pulposus cells seeded into collagen and alginate hydrogels, respectively. Seeded gels were formed into a single disc unit using molds designed from the geometry of the canine spine. Skeletally mature beagles underwent discectomy with whole IVD resection at levels between C3/4 and C6/7, and were then divided into two groups that received only discectomy or discectomy followed by implantation of TE-IVD. Stably implanted TE-IVDs demonstrated significant retention of disc height and physiological hydration compared to discectomy control. Both 4-week and 16-week histological assessments demonstrated chondrocytic cells surrounded by proteoglycan-rich matrices in the NP and by fibrocartilaginous matrices in the AF portions of implanted TE-IVDs. Integration into host tissue was confirmed over 16 weeks without any signs of immune reaction. Despite the significant biomechanical demands of the beagle cervical spine, our stably implanted TE-IVDs maintained their position, structure and hydration as well as disc height over 16 weeks in vivo.
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
Evaluation of protective efficacy of three novel H3N2 canine influenza vaccines.
Tu, Liqing; Zhou, Pei; Li, Lutao; Li, Xiuzhen; Hu, Renjun; Jia, Kun; Sun, Lingshuang; Yuan, Ziguo; Li, Shoujun
2017-11-17
Canine influenza virus (CIV) has the potential risk to spread in different areas and dog types. Thus, there is a growing need to develop an effective vaccine to control CIV disease. Here, we developed three vaccine candidates: 1) a recombinant pVAX1 vector expressing H3N2 CIV hemagglutinin (pVAX1-HA); 2) a live attenuated canine adenovirus type 2 expressing H3N2 CIV hemagglutinin (rCAV2-HA); and 3) an inactivated H3N2 CIV (A/canine/Guangdong/01/2006 (H3N2)). Mice received an initial intramuscular immunization that followed two booster injections at 2 and 4 weeks post-vaccination (wpv). The splenic lymphocytes were collected to assess the immune responses at 6 wpv. The protective efficacy was evaluated by challenging H3N2 CIV after vaccination (at 6 wpv). Our results demonstrated that all three vaccine candidates elicited cytokine and antibody responses in mice. The rCAV2-HA vaccine and the inactivated vaccine generated efficient protective efficacy in mice, whereas limited protection was provided by the pVAX1-HA DNA vaccine. Therefore, both the rCAV2-HA live recombinant virus and the inactivated CIV could be used as potential novel vaccines against H3N2CIV. This study provides guidance for choosing the most appropriate vaccine for the prevention and control of CIV disease.
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
Homologous recombination is a force in the evolution of canine distemper virus.
Yuan, Chaowen; Liu, Wenxin; Wang, Yingbo; Hou, Jinlong; Zhang, Liguo; Wang, Guoqing
2017-01-01
Canine distemper virus (CDV) is the causative agent of canine distemper (CD) that is a highly contagious, lethal, multisystemic viral disease of receptive carnivores. The prevalence of CDV is a major concern in susceptible animals. Presently, it is unclear whether intragenic recombination can contribute to gene mutations and segment reassortment in the virus. In this study, 25 full-length CDV genome sequences were subjected to phylogenetic and recombinational analyses. The results of phylogenetic analysis, intragenic recombination, and nucleotide selection pressure indicated that mutation and recombination occurred in the six individual genes segment (H, F, P, N, L, M) of the CDV genome. The analysis also revealed pronounced genetic diversity in the CDV genome according to the geographically distinct lineages (genotypes), namely Asia-1, Asia-2, Asia-3, Europe, America-1, and America-2. The six recombination events were detected using SimPlot and RDP programs. The analysis of selection pressure demonstrated that a majority of the nucleotides in the CDV individual gene were under negative selection. Collectively, these data suggested that homologous recombination acts as a key force driving the genetic diversity and evolution of canine distemper virus.
Guard, B C; Suchodolski, J S
2016-06-01
Recent molecular studies have revealed a complex microbiota in the dog intestine. Convincing evidence has been reported linking changes in microbial communities to acute and chronic gastrointestinal inflammation, especially in canine inflammatory bowel disease (IBD). The most common microbial changes observed in intestinal inflammation are decreases in the bacterial phyla Firmicutes (i.e., Lachnospiraceae, Ruminococcaceae, and ) and Bacteroidetes, with concurrent increases in Proteobacteria (i.e., ). Due to the important role of microbial-derived metabolites for host health, it is important to elucidate the metabolic consequences of gastrointestinal dysbiosis and physiological pathways implicated in specific disease phenotypes. Metagenomic studies have used shotgun sequencing of DNA as well as phylogenetic investigation of communities by reconstruction of unobserved states (PICRUSt) to characterize functional changes in the bacterial metagenome in gastrointestinal disease. Furthermore, wide-scale and untargeted measurements of metabolic products derived by the host and the microbiota in intestinal samples allow a better understanding of the functional alterations that occur in gastrointestinal disease. For example, changes in bile acid metabolism and tryptophan catabolism recently have been reported in humans and dogs. Also, metabolites associated with the pentose phosphate pathway were significantly altered in chronic gastrointestinal inflammation and indicate the presence of oxidative stress in dogs with IBD. This review focuses on the advancements made in canine metagenomics and metabolomics and their implications in understanding gastrointestinal disease as well as the development of better treatment approaches.
Prognostic factors in canine appendicular osteosarcoma – a meta-analysis
2012-01-01
Background Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST) do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP), bone alkaline phosphatase (BALP), infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. Results A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location), looking at both survival time (ST) and disease free interval (DFI). The third factor (age) was studied in a qualitative manner. Both elevated SALP level and the (proximal) humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Conclusions Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma. PMID:22587466
Prognostic factors in canine appendicular osteosarcoma – a meta-analysis
Directory of Open Access Journals (Sweden)
Boerman Ilse
2012-05-01
Full Text Available Abstract Background Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP, bone alkaline phosphatase (BALP, infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. Results A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location, looking at both survival time (ST and disease free interval (DFI. The third factor (age was studied in a qualitative manner. Both elevated SALP level and the (proximal humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Conclusions Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma.
A modified live canine parvovirus vaccine. II. Immune response.
Carmichael, L E; Joubert, J C; Pollock, R V
1983-01-01
The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
A serosurvey of diseases of free-ranging gray wolves (Canis lupus) in Minnesota
Carstensen, Michelle; Giudice, John H.; Hildebrand, Erik C.; Dubey, J. P.; Erb, John; Stark, Dan; Hart, John; Barber-Meyer, Shannon M.; Mech, L. David; Windels, Steve K.; Edwards, Andrew J.
2017-01-01
We tested serum samples from 387 free-ranging wolves (Canis lupus) from 2007 to 2013 for exposure to eight canid pathogens to establish baseline data on disease prevalence and spatial distribution in Minnesota's wolf population. We found high exposure to canine adenoviruses 1 and 2 (88% adults, 45% pups), canine parvovirus (82% adults, 24% pups), and Lyme disease (76% adults, 39% pups). Sixty-six percent of adults and 36% of pups exhibited exposure to the protozoan parasite Neospora caninum. Exposure to arboviruses was confirmed, including West Nile virus (37% adults, 18% pups) and eastern equine encephalitis (3% adults). Exposure rates were lower for canine distemper (19% adults, 5% pups) and heartworm (7% adults, 3% pups). Significant spatial trends were observed in wolves exposed to canine parvovirus and Lyme disease. Serologic data do not confirm clinical disease, but better understanding of disease ecology of wolves can provide valuable insight into wildlife population dynamics and improve management of these species.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
[A case report: elephantiasis].
Karagöz, Ergenekon; Karaahmetoğlu, Gökhan; Acar, Ali; Turhan, Vedat; Oncül, Oral; Görenek, Levent
2012-01-01
Klippel-Trenaunay syndrome (KTS) is a rare disease and a syndrome that is characterized by the triad of congenital port wine stains,venous malformations with or without varicose veins, bone or soft tissue hypertrophy. Lymphatic filariasis is a filarial disease which usually occurs with genital anomalies, pathologies associated with lymphedema or elephantiasis caused by a filarial infectious agent. In this case report, a 20-year-old male patient admitted to our clinic for diagnosis and treatment with right leg edema and lesions compatible with dermatological manifestations. In the list of differential diagnosis, filarial elephantiasis was also thought, consequently KTS was diagnosed. (Turkiye Parazitol Derg 2012; 36: 188-90).
Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny
Directory of Open Access Journals (Sweden)
Jane Megid
2013-02-01
Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.
Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts.
Van den Bossche, Lindsay; Schoonenberg, Vivien A C; Burgener, Iwan A; Penning, Louis C; Schrall, Ingrid M; Kruitwagen, Hedwig S; van Wolferen, Monique E; Grinwis, Guy C M; Kummeling, Anne; Rothuizen, Jan; van Velzen, Jeroen F; Stathonikos, Nikolas; Molenaar, Martijn R; Helms, Bernd J; Brouwers, Jos F H M; Spee, Bart; van Steenbeek, Frank G
2017-01-01
Non-alcoholic fatty liver disease (NAFLD) is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in this large animal model. Hepatic lipid accumulation, gene-expression analysis and HPLC-MS of neutral lipids and phospholipids in extrahepatic (EHPSS) and intrahepatic portosystemic shunts (IHPSS) was compared to healthy control dogs. Liver organoids of diseased dogs and healthy control dogs were incubated with palmitic- and oleic-acid, and lipid accumulation was quantified using LD540. In histological slides of shunt livers, a 12-fold increase of lipid content was detected compared to the control dogs (EHPSS Plipid-related genes to steatosis in portosystemic shunting was corroborated using gene-expression profiling. Lipid analysis demonstrated different triglyceride composition and a shift towards short chain and omega-3 fatty acids in shunt versus healthy dogs, with no difference in lipid species composition between shunt types. All organoids showed a similar increase in triacylglycerols after free fatty acids enrichment. This study demonstrates that steatosis is probably secondary to canine portosystemic shunts. Unravelling the pathogenesis of this hepatic steatosis might contribute to a better understanding of steatosis in NAFLD.
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Directory of Open Access Journals (Sweden)
Catherine B Poole
Full Text Available Accurate detection of filarial parasites in humans is essential for the implementation and evaluation of mass drug administration programs to control onchocerciasis and lymphatic filariasis. Determining the infection levels in vector populations is also important for assessing transmission, deciding when drug treatments may be terminated and for monitoring recrudescence. Immunological methods to detect infection in humans are available, however, cross-reactivity issues have been reported. Nucleic acid-based molecular assays offer high levels of specificity and sensitivity, and can be used to detect infection in both humans and vectors. In this study we developed loop-mediated isothermal amplification (LAMP tests to detect three different filarial DNAs in human and insect samples using pH sensitive dyes for enhanced visual detection of amplification. Furthermore, reactions were performed in a portable, non-instrumented nucleic acid amplification (NINA device that provides a stable heat source for LAMP. The efficacy of several strand displacing DNA polymerases were evaluated in combination with neutral red or phenol red dyes. Colorimetric NINA-LAMP assays targeting Brugia Hha I repeat, Onchocerca volvulus GST1a and Wuchereria bancrofti LDR each exhibit species-specificity and are also highly sensitive, detecting DNA equivalent to 1/10-1/5000th of one microfilaria. Reaction times varied depending on whether a single copy gene (70 minutes, O. volvulus or repetitive DNA (40 min, B. malayi and W. bancrofti was employed as a biomarker. The NINA heater can be used to detect multiple infections simultaneously. The accuracy, simplicity and versatility of the technology suggests that colorimetric NINA-LAMP assays are ideally suited for monitoring the success of filariasis control programs.
Singh, Neetu; Heneberg, Petr; Rathaur, Sushma
2014-10-01
The ecto protein tyrosine phosphatases (PTP) are known to play a crucial role in the pathogenesis and survival of the intracellular parasites. However, their presence and role in filarial parasites is still unknown. We found a significant amount of tyrosine phosphatase activity in the surface antigen fraction extracted from Setaria cervi (S. cervi), a bovine filarial parasite. An antibody designed against the conserved catalytic core of human protein tyrosine phosphatases, PTP1B cross reacted with a 63 kDa band in the surface antigen. We detected a significant amount of PTP activity in the intact S. cervi adult parasites as well as microfilariae in this study for the first time. This PTP may be localized on the surface of the parasite with an exposed active site available for the external substrates. The PTP activity was also inhibited by sodium orthovanadate and phenyl arsine oxide, specific inhibitors of PTP in both the life stages. The Km and Vmax for PTP in the adult parasites and microfilariae were determined to be 2.574 ± 0.14 mM; 206.3 ± 2.75 μM Pi/h/two parasites and 5.510 ± 0.59 mM; 62.27 ± 2.27 μM Pi/h/10(6) parasites respectively using O-P-L-Tyrosine as substrate. Interestingly, a positive correlation was observed between the inhibition in PTP activity and reduction in the motility/ viability of the parasites when they were subjected to the specific PTP inhibitors (Orthovanadate and Phenyl arsine oxide) for 4 h in the KRB maintenance medium. The activity was also significantly inhibited in the parasites exposed to antifilarial drug/compounds for e.g. Diethylcarbamazine, Acetylsalicylic Acid and SK7, a methyl chalcone. Therefore suggesting a possible role played by PTP in the survival of the parasite, its interaction with the host as well as in the screening of newly synthesized antifilarials/drugs.
Tasić, Aleksandar; Tasić-Otašević, Suzana; Gabrielli, Simona; Miladinović-Tasić, Nataša; Ignjatović, Aleksandra; Dorđević, Jovana; Dimitrijević, Sanda; Cancrini, Gabriella
2012-12-01
In 2009 canine filarial infections were investigated in two northern areas of Serbia (Pančevo and Veliko Gradište), applying morphometry, biochemical staining, and immunological kit to detect Dirofilaria immitis antigens, and two home-made ELISAs to detect antibodies to D. repens and D. immitis somatic/metabolic polyproteins. Moreover, molecular tools were applied to analyze the phylogenetic relationships of the isolates. The microfilariae detected in 21/122 dogs (17.2%) were identified as D. repens (n=21) and D. immitis (n=2). D. immitis antigens were found in another 13 animals with occult infection. All of the 15 heartworm-positive dogs also had antibodies to this parasite, which were detected in another 13 subjects, indicating an overall D. immitis seroprevalence rate of 22.9%. Serology for D. repens revealed evidence of antibodies in 42.6% of the dogs, but was negative for 4 microfilaremic dogs. As for the two different areas, the prevalence of microfilariae and/or D. immitis antigens, mainly due to D. repens microfilaremic animals, was not significantly higher in Veliko Gradište (33.3%) than in Pančevo (22%). However, serology showed a different epidemiological picture. Heartworm infection occurred more often in both areas, and antibodies to dirofilarial nematodes were detected in 72.9% of dogs living in Pančevo, a rate higher than in those living in Veliko Gradište (57.1%). No risk factors for infection were found, confirming the uselessness of prophylactic drugs against D. repens, and suggesting the presence in these areas of sunrise- or sunset-biting mosquitoes as important vectors. The results indicate the need for both appropriate entomological studies and further research on the intra-species variability shown by D. repens.
Molla, Yordanos B; Wardrop, Nicola A; Le Blond, Jennifer S; Baxter, Peter; Newport, Melanie J; Atkinson, Peter M; Davey, Gail
2014-06-20
The precise trigger of podoconiosis - endemic non-filarial elephantiasis of the lower legs - is unknown. Epidemiological and ecological studies have linked the disease with barefoot exposure to red clay soils of volcanic origin. Histopathology investigations have demonstrated that silicon, aluminium, magnesium and iron are present in the lower limb lymph node macrophages of both patients and non-patients living barefoot on these clays. We studied the spatial variation (variations across an area) in podoconiosis prevalence and the associated environmental factors with a goal to better understanding the pathogenesis of podoconiosis. Fieldwork was conducted from June 2011 to February 2013 in 12 kebeles (administrative units) in northern Ethiopia. Geo-located prevalence data and soil samples were collected and analysed along with secondary geological, topographic, meteorological and elevation data. Soil data were analysed for chemical composition, mineralogy and particle size, and were interpolated to provide spatially continuous information. Exploratory, spatial, univariate and multivariate regression analyses of podoconiosis prevalence were conducted in relation to primary (soil) and secondary (elevation, precipitation, and geology) covariates. Podoconiosis distribution showed spatial correlation with variation in elevation and precipitation. Exploratory analysis identified that phyllosilicate minerals, particularly clay (smectite and kaolinite) and mica groups, quartz (crystalline silica), iron oxide, and zirconium were associated with podoconiosis prevalence. The final multivariate model showed that the quantities of smectite (RR = 2.76, 95% CI: 1.35, 5.73; p = 0.007), quartz (RR = 1.16, 95% CI: 1.06, 1.26; p = 0.001) and mica (RR = 1.09, 95% CI: 1.05, 1.13; p < 0.001) in the soil had positive associations with podoconiosis prevalence. More quantities of smectite, mica and quartz within the soil were associated with podoconiosis prevalence. Together with previous
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
[Diagnostic tools for canine parvovirus infection].
Proksch, A L; Hartmann, K
2015-01-01
Canine parvovirus (CPV) infection is one of the most important and common infectious diseases in dogs, in particular affecting young puppies when maternal antibodies have waned and vaccine-induced antibodies have not yet developed. The mortality rate remains high. Therefore, a rapid and safe diagnostic tool is essential to diagnose the disease to 1) provide intensive care treatment and 2) to identify virus-shedding animals and thus prevent virus spread. Whilst the detection of antibodies against CPV is considered unsuitable to diagnose the disease, there are several different methods to directly detect complete virus, virus antigen or DNA. Additionally, to test in commercial laboratories, rapid in-house tests based on ELISA are available worldwide. The specificity of the ELISA rapid in-house tests is reported to be excellent. However, results on sensitivity vary and high numbers of false-negative results are commonly reported, which potentially leads to misdiagnosis. Polymerase chain reaction (PCR) is a very sensitive and specific diagnostic tool. It also provides the opportunity to differentiate vaccine strains from natural infection when sequencing is performed after PCR.
da Fontoura Budaszewski, Renata; Hudacek, Andrew; Sawatsky, Bevan; Krämer, Beate; Yin, Xiangping; Schnell, Matthias J.; von Messling, Veronika
2017-01-01
The development of multivalent vaccines is an attractive methodology for the simultaneous prevention of several infectious diseases in vulnerable populations. Both canine distemper virus (CDV) and rabies virus (RABV) cause lethal disease in wild and domestic carnivores. While RABV vaccines are inactivated, the live-attenuated CDV vaccines retain residual virulence for highly susceptible wildlife species. In this study, we developed recombinant bivalent vaccine candidates based on recombinant ...
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression
2009-01-01
Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8) and solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively). Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies. PMID:20028558
Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression
Directory of Open Access Journals (Sweden)
Triche Timothy
2009-12-01
Full Text Available Abstract Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8 and solute carrier family 1 (glial high affinity glutamate transporter, member 3 (SLC1A3, which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively. Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies.
de Scally, M P; Leisewitz, A L; Lobetti, R G; Thompson, P N
2006-12-01
Pigmented serum, usually due to free haemoglobin and/or bilirubin, is a common finding in dogs with babesiosis, resulting in interference with all biochemical tests that rely on photochemistry. This is particularly true of urea and creatinine determinations, complicating the diagnosis of acute renal failure, which is a serious complication of babesiosis. A disproportionately raised serum urea concentration of unknown origin occurs in severely anaemic canine babesiosis patients and gives rise to an increased serum urea:creatinine ratio. The assay for cystatin-C, an excellent measure of glomerular filtration rate, is unaffected by free serum haemoglobin, and due to its different intrinsic origins, is free of influence by the metabolic derangements and organ pathology, other than renal disease, encountered in canine babesiosis. Serum cystatin-C was used to compare the concentrations of serum urea and serum creatinine in dogs with the severely anaemic form of canine babesiosis as well as a canine babesiosis-free reference group. Mean serum urea and mean serum urea:creatinine ratio were significantly elevated in the babesia-infected group relative to the reference population in this study. Mean serum creatinine and mean serum cystatin-C were within the reference ranges. Therefore an elevated urea:creatinine ratio in canine babesiosis in the presence of a normal serum creatinine concentration is considered to be caused by an elevated serum urea concentration and is most likely of non-renal origin. Serum creatinine was therefore as specific a measure of renal function as serum cystatin-C in canine babesiosis in this study. The sensitivity of serum creatinine as a measure of renal function was not established by this study. Serum urea, however, proved to be of little use compared to serum cystatin-C and serum creatinine. Serum urea should therefore not be used to diagnose renal failure in canine babesiosis.
Urine neutrophil gelatinase-associated lipocalin (NGAL as a biomarker for acute canine kidney injury
Directory of Open Access Journals (Sweden)
Lee Ya-Jane
2012-12-01
Full Text Available Abstract Background Biomarkers for the early prediction of canine acute kidney injury (AKI are clinically important. Recently, neutrophil gelatinase-associated lipocalin (NGAL was found to be a sensitive biomarker for the prediction of human AKI at a very early stage and the development of AKI after surgery. However, NGAL has not yet been studied with respect to dog kidney diseases. The application of NGAL canine AKI was investigated in this study. Results The canine NGAL gene was successfully cloned and expressed. Polyclonal antibodies against canine NGAL were generated and used to develop an ELISA for measuring NGAL protein in serum and urine samples that were collected from 39 dogs at different time points after surgery. AKI was defined by the standard method, namely a serum creatinine increase of greater than or equal to 26.5 μmol/L from baseline within 48 h. At 12 h after surgery, compared to the group without AKI (12 dogs, the NGAL level in the urine of seven dogs with AKI was significantly increased (median 178.4 pg/mL vs. 88.0 pg/mL, and this difference was sustained to 72 h. Conclusion As the increase in NGAL occurred much earlier than the increase in serum creatinine, urine NGAL seems to be able to serve as a sensitive and specific biomarker for the prediction of AKI in dogs.
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Status of therapeutic gene transfer to treat canine dilated cardiomyopathy in dogs.
Sleeper, Meg M; Bish, Lawrence T; Sweeney, H Lee
2010-07-01
Therapeutic gene transfer holds promise as a way to treat dilated cardiomyopathy from any underlying cause because the approach attempts to address metabolic disturbances that occur at the molecular level of the failing heart. Calcium-handling abnormalities and increased rates of apoptosis are abnormalities that occur in many types of heart disease, and gene therapies that target these metabolic defects have proven to be beneficial in numerous rodent models of heart disease. The authors are currently evaluating this approach to treat canine idiopathic dilated cardiomyopathy.
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
de Carvalho, Otávio Valério; Félix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, Márcia Rogéria; Bressan, Gustavo Costa; Pena, Lindomar José; Silva-Júnior, Abelardo
2017-06-26
Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic strategies synergizing with vaccine programs for effectively controlling canine distemper. 6-methylmercaptopurine riboside (6MMPr) is a modified thiopurine nucleoside with known antiviral properties against certain RNA viruses. We tested the inhibitory effects of 6MMPr against a wild-type CDV strain infection in cell culture. We measured infectious particle production and viral RNA levels in treated and untreated CDV-infected cells. Ribavirin (RIB) was used as a positive control. Here, we report for the first time the antiviral effects of 6MMPr against canine distemper virus (CDV) in vitro. 6MMPr was able to reduce viral RNA levels and to inhibit the production of infectious CDV particles. The therapeutic selectivity of 6MMPr was approximately six times higher than that of ribavirin. Our results indicate that 6MMPr has high anti-CDV potential and warrants further testing against other paramyxoviruses, as well as clinical testing of the compound against CDV.
In vitro evaluation of canine leukocytes radiolabeled in whole blood with 99mTc stannous colloid
International Nuclear Information System (INIS)
Abushhiwa, Mohamed H.; Salehi, Nouria S.; Whitton, Robert C.; Charles, Jennifer A.; Finnin, Peter J.; Lording, Peter M.; Caple, Ivan W.; Parry, Bruce W.
2008-01-01
Introduction: Technetium-99m stannous colloid ( 99m TcSnC)-labeled leukocytes are used to investigate a variety of inflammatory diseases in human medicine. The present study investigates the in vitro behavior of canine leukocytes labeled in whole blood with 99m TcSnC. Methods: Blood samples from 10 healthy dogs were labeled with 99m TcSnC using a standard procedure. The distribution of radioactivity among blood components (plasma, leukocyte layers and erythrocytes) was measured following separation of the radiolabeled samples across Histopaque density gradients. Phagocytic function of labeled and unlabeled leukocytes was estimated using zymosan particles. Labeling retention by leukocytes was determined at 1, 3, 4 and 7 h postlabeling. Results: The mean±standard error percentage of radioactivity associated with plasma, erythrocyte and leukocyte fractions was 2.0±0.21%, 55.5±0.60% and 42.5±0.54%, respectively (the last comprising 70.2±0.83% in polymorphonuclear leukocytes and 29.8±0.83% in mononuclear leukocytes). Labeled canine leukocytes had a phagocytic activity of 91.3±0.28% (control, 91.7±0.26%). The radiolabeled canine leukocytes retained 94.1±0.30% of radioactivity at 7 h postlabeling. Conclusions: Radiolabeling of canine leukocytes in whole blood with 99m TcSnC has minor adverse effect on their phagocytic function. The radiolabeled canine leukocytes retained a large percentage of radioactivity for at least 7 h postlabeling
Echocardiography as an approach for canine cardiac disease diagnosis
Directory of Open Access Journals (Sweden)
P. Singh
2014-11-01
Full Text Available Aim: The aim of the study was to establish the methods for diagnosis various canine cardiac ailments using echocardiography. Materials and Methods: M-mode, two-dimensional echocardiography and Doppler studies were performed on 10 cases. Dogs showing signs of cardiac ailment either clinically, radiographic or via electrocardiographic examination were selected for study. Right parasternal short axis view was used for echocardiographic measurements. Right parasternal long axis and left parasternal apical views were used for Doppler studies. Doppler studies were performed at the level of aortic valve and atrioventricular valves for semi quantitative diagnosis of regurgitation. Results: Dogs were found affected with dilated cardiomyopathy (DCM (n=5, pericardial effusion (PE (n=1, combined PE and DCM (n=2 and remaining two showed abnormality on radiographic or electrographically evaluation but were found out to be normal echocardiographically (n=2. Conclusion: Echocardiography is an effective tool for diagnosis of various heart ailments.
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
Directory of Open Access Journals (Sweden)
Ana M. Aguiar-Santos
2013-05-01
intestinal em três amostras de fezes, analisadas pelo método de Hoffmann, Pons e Janer. A investigação filarial foi feita com teste antigênico pela técnica de imunocromatográfica rápida (ICT e pesquisa de microfilárias, utilizando filtração em membrana de policarbonato. Para análise de dados utilizou-se a estatística descritiva através do programa EpiInfo versão 7. Resultados: A prevalência de filariose por ICT foi de 13,8% e por microfilaremia de 1,2%, enquanto a de parasitoses intestinais foi 64,2%. A concomitância do diagnóstico filarial e de parasitoses intestinais foi de 9,4% e, 31,5% eram isentos de ambas as parasitoses. Entre os indivíduos com parasitoses intestinais, 55% eram monoparasitados e 45% poliparasitados. A presença de geohelmintos ocorreu em 72,5% dos parasitados. No grupo com infecção filarial a ocorrência de geohelmintíase foi de 54,5%. Conclusões: O diagnóstico simultâneo de infecção filarial e parasitose intestinal, bem como a elevada frequência de geohelmintos justificam uma reavaliação da estratégia terapêutica do tratamento coletivo no programa de filariose no Brasil. Keywords: Filariasis, Helminthiasis, Neglected diseases, Intestinal parasitic, Prevention and control, Palavras-chave: Filariose linfática, Helmintíase, Doenças negligenciadas, Enteropatias parasitárias, Prevenção e controle
Li, Jonathan Y; Middleton, Dana M; Chen, Steven; White, Leonard; Ellinwood, N Matthew; Dickson, Patricia; Vite, Charles; Bradbury, Allison; Provenzale, James M
2017-08-01
Purpose We describe a novel technique for measuring diffusion tensor imaging metrics in the canine brain. We hypothesized that a standard method for region of interest placement could be developed that is highly reproducible, with less than 10% difference in measurements between raters. Methods Two sets of canine brains (three seven-week-old full-brains and two 17-week-old single hemispheres) were scanned ex-vivo on a 7T small-animal magnetic resonance imaging system. Strict region of interest placement criteria were developed and then used by two raters to independently measure diffusion tensor imaging metrics within four different white-matter regions within each specimen. Average values of fractional anisotropy, radial diffusivity, and the three eigenvalues (λ1, λ2, and λ3) within each region in each specimen overall and within each individual image slice were compared between raters by calculating the percentage difference between raters for each metric. Results The mean percentage difference between raters for all diffusion tensor imaging metrics when pooled by each region and specimen was 1.44% (range: 0.01-5.17%). The mean percentage difference between raters for all diffusion tensor imaging metrics when compared by individual image slice was 2.23% (range: 0.75-4.58%) per hemisphere. Conclusion Our results indicate that the technique described is highly reproducible, even when applied to canine specimens of differing age, morphology, and image resolution. We propose this technique for future studies of diffusion tensor imaging analysis in canine brains and for cross-sectional and longitudinal studies of canine brain models of human central nervous system disease.
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
An update on the treatment of canine atopic dermatitis
Directory of Open Access Journals (Sweden)
Marsella R
2012-08-01
Full Text Available Rosanna MarsellaDepartment of Small Animal Clinical Sciences, College of Veterinary Medicine, University of Florida Gainesville, FL, USAAbstract: Remarkable progress has been made in recent years concerning our understanding of the pathogenesis of canine atopic dermatitis (AD. As our understanding improves, the therapeutic approach evolves. Of utmost importance is the documentation of skin barrier impairment in canine AD: ceramides deficiency leads to increased permeability and increased allergen penetration and sensitization. It is currently unknown whether this dysfunction is primary and genetically inherited or secondary to inflammation but it is accepted that skin barrier deficiency plays an important role in either starting or minimally exacerbating canine AD. Thus, the therapeutic approach has changed from focusing on the control of the inflammation to a combined approach that includes therapies aimed at skin barrier repair. The issue of skin barrier repair has been addressed both with oral administration of essential fatty acids and the topical application of products containing a combination of ceramides and fatty acids. These strategies are most helpful as adjunctive treatments and would be best used in young patients that have not developed chronic skin changes. Importantly, treatment for canine AD is multimodal and tailored to the individual patient, the age, and the duration of the disease. Client education plays an important role in explaining the importance of a long-term approach to minimize flare-ups and, in this context, topical therapy to correct skin barrier can be of great benefit. This is an area still in infancy and much work is needed to identify the best formulation. In human medicine, long-term use of moisturizers can have a profound effect on skin barrier and gene expression of proteins involved in skin barrier. This effect is variable depending on the formulation used. It is reasonable to speculate that the same may be
Mahon, Jennifer L; Rozanski, Elizabeth A; Paul, April L
2017-06-15
OBJECTIVE To determine the prevalence of dogs hospitalized in an intensive care unit (ICU) with serum antibody titers against canine distemper virus (CDV) and canine parvovirus (CPV). DESIGN Prospective observational study. ANIMALS 80 dogs. PROCEDURES Dogs hospitalized in an ICU for > 12 hours between February 1 and June 1, 2015, that had at least 0.25 mL of serum left over from diagnostic testing were eligible for study inclusion. Dogs with serum antibody titers > 1:32 (as determined by serum neutralization) and > 1:80 (as determined by hemagglutination inhibition) were considered seropositive for CDV and CPV, respectively. The date of last vaccination was obtained from the medical record of each dog. RESULTS Of the 80 dogs, 40 (50%) and 65 (81%) dogs were seropositive for CDV and CPV, respectively. Of the 40 dogs that were seronegative for CDV, 27 had been vaccinated against CDV within 3 years prior to testing. Of the 15 dogs that were seronegative for CPV, 3 had been vaccinated against CPV within 3 years prior to testing. Ten dogs were seronegative for both CDV and CPV. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated the prevalence of dogs hospitalized in an ICU that were seropositive for CDV and CPV was lower than expected given the high vaccination rate reported for dogs. Although the antibody titer necessary to prevent disease caused by CDV or CPV in critically ill dogs is unknown, adherence to infectious disease control guidelines is warranted when CDV- or CPV-infected dogs are treated in an ICU.
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.
Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P
2016-03-23
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.
Studies on manifestations of canine distemper virus infection in an urban dog population.
Blixenkrone-Møller, M; Svansson, V; Have, P; Orvell, C; Appel, M; Pedersen, I R; Dietz, H H; Henriksen, P
1993-10-01
An upsurge of canine distemper was recognized at the beginning of 1991 in the urban dog population of the Copenhagen area. The outbreak had the characteristics of a virulent morbillivirus introduction in a partly immune population, where the disease primarily was manifested in young individuals. Testing of single serum samples for the presence of canine distemper virus (CDV) IgM antibodies using an IgM ELISA confirmed current and recent CDV infections in an urban dog population, where the use of attenuated CDV vaccines was widespread. In 49 out of 66 sera from clinical cases suspected of canine distemper we detected CDV IgM antibodies, as compared to the detection of viral antigen by indirect immunofluorescence in 27 of 65 specimens of conjunctival cells. The antigenic make-up of isolates from acute and subacute clinical cases was investigated with a panel of 51 monoclonal antibodies directed against CDV and the related phocine distemper virus. The isolates exhibited an homogeneous reaction pattern and shared overall antigenic characteristics of the CDV prototype. The majority of cases were diagnosed among unvaccinated dogs and individuals with unknown or obscure vaccination record. However, severe clinical cases were also diagnosed in vaccinated individuals.
Xuan, X; Tuchiya, K; Sato, I; Nishikawa, Y; Onoderaz, Y; Takashima, Y; Yamamoto, A; Katsumata, A; Iwata, A; Ueda, S; Mikami, T; Otsuka, H
1998-01-01
In order to evaluate whether canine herpesvirus (CHV) could be used as a live vector for the expression of heterologous immunogenes, we constructed a recombinant canine herpesvirus (CHV) expressing glycoprotein (G protein) of rabies virus (RV). The gene of G protein was inserted within the thymidine kinase gene of CHV YP11mu strain under the control of the human cytomegalovirus immediate early promoter. The G protein expressed by the recombinant CHV was processed and transported to the cell surface as in RV infected cells, and showed the same biological activities such as low pH dependent cell fusion and hemadsorption. The antigenic authenticity of the recombinant G protein was confirmed by a panel of monoclonal antibodies specific for G protein. Dogs inoculated intransally with the recombinant CHV produced higher titres of virus neutralizing antibodies against RV than those inoculated with a commercial, inactivated rabies vaccine. These results suggest that the CHV recombinant expressing G protein can be used as a vaccine to control canine rabies and that CHV may be useful as a vector to develop live recombinant against other infectious diseases in dogs.
Treatment of canine benign prostatic hyperplasia with medroxyprogesterone acetate
International Nuclear Information System (INIS)
Bamberg-Thalen, B.; Linde-Forsberg, C.
1993-01-01
Nineteen dogs with clinical signs of benign prostatic hyperplasia (BPH) were given a subcutaneous injection of medroxyprogesterone acetate (MPA). At the first follow-up four to six weeks after treatment, 16 (84%) showed no signs of prostatic disease, and in 10 (53%) radiography revealed that the prostate had decreased in size. The dogs were followed for an average of 17 months. Twelve (64%) showed no signs of prostatic disease for at least 10 months. Relapses occurred in 10 between 10 and 24 months after treatment. Based on the results of this study and an earlier study on the effects of estrogen on BPH, it was concluded that MPA was a good alternative for treatment of canine BPH
An update on canine cardiomyopathies - is it all in the genes?
Dutton, E; López-Alvarez, J
2018-04-17
Dilated cardiomyopathy is the second most common cardiac disease in dogs and causes considerable morbidity and mortality. Primary dilated cardiomyopathy is suspected to be familial, and genetic loci have been associated with the disease in a number of breeds. Because it is an adult-onset disease, usually with late onset, testing breeding dogs and bitches before breeding for a genetic mutation that could lead to dilated cardiomyopathy would be helpful to prevent disease. There is growing evidence that the genetic basis may be multigenic rather than monogenic in the majority of studied breeds. This review article describes the known genetic aspects of canine dilated cardiomyopathy and the implications of genetic tests on heart testing and the future of veterinary cardiology. © 2018 British Small Animal Veterinary Association.
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old
Simon, Alison G; Mills, DeEtta K; Furton, Kenneth G
2017-06-01
Raffaelea lauricola, a fungus causing a vascular wilt (laurel wilt) in Lauraceae trees, was introduced into the United States in the early 2000s. It has devastated forests in the Southeast and has now moved into the commercial avocado groves in southern Florida. Trained detection canines are currently one of the few successful methods for early detection of pre-symptomatic diseased trees. In order to achieve the universal and frequent training required to have successful detection canines, it is desirable to create accessible, safe, and long-lasting training aids. However, identification of odorants and compounds is limited by several factors, including both the availability of chemicals and the need to present chemicals individually and in combination to detection canines. A method for the separation and identification of volatile organic compounds (VOCs) from environmental substances for the creation of such a canine training aid is presented here. Headspace solid phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) was used to identify the odors present in avocado trees infected with the R. lauricola phytopathogen. Twenty-eight compounds were detected using this method, with nine present in greater than 80% of samples. The majority of these compounds were not commercially available as standard reference materials, and a canine trial was designed to identify the active odors without the need of pure chemical compounds. To facilitate the creation of a canine training aid, the VOCs above R. lauricola were separated by venting a 0.53mm ID solgel-wax gas chromatography column to the atmosphere. Ten minute fractions of the odor profile were collected on cotton gauze in glass vials and presented to the detection canines in a series of field trials. The canines alerted to the VOCs from the vials that correspond to a portion of the chromatogram containing the most volatile species from R. lauricola. This innovative fractionation and collection
Consequences of crown shortening canine teeth in Greenland sled dogs
DEFF Research Database (Denmark)
Kortegaard, H E; Anthony Knudsen, T; Dahl, S
2015-01-01
OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...
Dental anomalies associated with buccally- and palatally-impacted maxillary canines.
Sajnani, Anand K; King, Nigel M
2014-08-01
The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.
SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.
Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi
2017-10-01
Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.
Overexpression of vimentin in canine prostatic carcinoma
DEFF Research Database (Denmark)
Rodrigues, M M P; Rema, A; Gärtner, F
2011-01-01
Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....
Successful Treatment of Canine Sporotrichosis with Terbinafine: Case Reports and Literature Review.
Viana, Paula Gonçalves; Figueiredo, Anna Barreto Fernandes; Gremião, Isabella Dib Ferreira; de Miranda, Luisa Helena Monteiro; da Silva Antonio, Isabela Maria; Boechat, Jéssica Sepulveda; de Sá Machado, Ana Caroline; de Oliveira, Manoel Marques Evangelista; Pereira, Sandro Antonio
2018-04-01
Sporotrichosis occurs worldwide, and the metropolitan region of Rio de Janeiro, Brazil, is a main endemic area, with a large number of human and animal cases in the last 19 years. This mycosis is more frequently described in cats rather than in dogs. There are a limited number of oral antifungal agents for the treatment of sporotrichosis in animals. In this context, the effectiveness of terbinafine in the treatment of sporotrichosis in humans, as well as the promising results of in vitro susceptibility tests, inspired us to use this drug in the therapy of this mycosis in dogs. We reported for the first time the use of terbinafine in the treatment of two dogs with sporotrichosis caused by Sporothrix brasiliensis. Moreover, we provided an overview of therapeutic features of canine sporotrichosis cases reported since the 1960s. One of the dogs presented the fixed cutaneous form of the disease, while the other patient presented hyperemia of the nasal mucosa and respiratory signs only. Terbinafine showed high antifungal activity in vitro against the canine Sporothrix isolates. The dogs were successfully treated with terbinafine, with remission of all clinical signs initially presented. The current reports indicate that this drug can emerge as a therapeutic option for canine sporotrichosis.
In vitro antiviral efficacy of caffeic acid against canine distemper virus.
Wu, Zong-Mei; Yu, Zhen-Jiang; Cui, Zhen-Qiang; Peng, Lu-Yuan; Li, Hao-Ran; Zhang, Chun-Lei; Shen, Hai-Qing; Yi, Peng-Fei; Fu, Ben-Dong
2017-09-01
Canine distemper (CD) is a highly contagious disease caused by the canine distemper virus (CDV), and mortality can be as high as 100%. However, there is no specific treatment for CD. In this study, the antiviral activity of the caffeic acid against CDV was evaluated in vitro. The results showed that the IC 50 of the caffeic acid against CDV at 1 and 2 h post infection (PI) is 23.3 and 32.3 μg/mL, respectively. Consistently, at 1 and 2 h PI, the caffeic acid exhibited a reduced (23.3-57.0% and 37.2-38.1%) viral inhibitory effect in vero cells. Furthermore, the caffeic acid plus Ribavirin (RBV) has greater antiviral activity against CDV than the caffeic acid or RBV individually. In addition, the caffeic acid reduced the total viral RNA synthesis by 59-86% at 24-72 h. Therefore, our data provided the experimental evidence that the caffeic acid effectively inhibited CDV infection in vero cells, which may potentially be used to treat clinical disease associated with CDV infection. Copyright © 2017. Published by Elsevier Ltd.
Vaccines for Canine Leishmaniasis
Directory of Open Access Journals (Sweden)
Faeze Foroughi-Parvar
2014-01-01
Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.
Upper canine inclination influences the aesthetics of a smile.
Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S
2015-02-01
This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.
Canine parvovirus effect on wolf population change and pup survival
Mech, L.D.; Goyal, S.M.
1993-01-01
Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.
Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia
Saasa, Ngonda; Nalubamba, King Shimumbo; M’kandawire, Ethel; Siwila, Joyce
2016-01-01
Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibod...
Treatment modalities of palatal impacted canines
Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona
2012-01-01
Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...
Oz, A Z; Ciger, S
2018-03-01
The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.
Comprehensive characterization of commercially available canine training aids.
Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A
2014-09-01
Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine
Canine distemper in Siberian tiger cubs from Zagreb ZOO: case report
Directory of Open Access Journals (Sweden)
Dean Konjević
2011-01-01
Full Text Available Canine distemper is a contagious, potentially lethal disease of mainly domestic and wild canids, but also of many other mammalian species including large felids. In February 2004, two Siberian tiger (Panthera tigris altaica cubs at the age of six months died at the Zagreb ZOO. The animals were presented for necropsy with two days history of severe digestive disorders, characterized mainly by haemathemesis. Dissections revealed catarrhal to pseudomembranous gastroenteritis (depending on the animal accompanied with haemorrhagic oedema of the lungs. Necrotic tonsillitis and disseminated depletion of the lymphocytes were the most prominent histological findings in both examined animals, while intranuclear and intracytoplasmatic inclusion bodies were found in the samples of the tongues and intestines. Representative portions of the livers, intestines, tonsils and lymph nodes were submitted for bacteriological and mycological analysis. The presence of Clostridium spp., Campylobacter coli and Escherichia coli was detected in gut samples, coli-like bacteria were found in samples of liver, tonsils and lymph nodes, while Candida sp. was found in the gut and pharynx samples. Toxicological analysis excluded anticoagulant and organophosphorous intoxication as the cause of death. Immunohistochemical analysis was positive for canine distemper virus. Based on all this, epizootiological, clinical and additional findings, canine distemper was recognized as the cause of the observed condition in these animals.
Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb
2017-07-01
Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...
Evaluation of post-vaccination immunity to canine distemper and ...
African Journals Online (AJOL)
SERVER
2007-08-20
Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...
Isolation and characterization of canine parvovirus type 2c (CPV-2c from symptomatic puppies
Directory of Open Access Journals (Sweden)
R Puentes
2012-09-01
Full Text Available Canine parvovirus type 2 (CPV-2 is a leading cause of diarrhea in puppies in several parts of the world. In this study CPV-2 was detected and recovered from puppies showing clinical disease from Montevideo, Uruguay. Samples were processed and used to infect CRFK and MDCK cells in order to isolate the virus. Out of twelve, two samples were positive for CPV-2. A genomic region of 583 bp was amplified and the molecular characterization was performed by sequencing, phylogenetic analysis and Restriction Fragment Length Polymorphism (RFLP. Two isolated viruses (UY1 and UY2 were CPV-2c-like viruses. The comparison between the cytophatic effect (CPE of CPV-2 (vaccinal virus and CPV-2c (isolated virus on primary canine cells cultures and on CRFK line cells, demonstrated that CPV-2c is less citopathogenic in CRFK than in primary cultures. Our study represents the first report on isolation and characterization of canine parvovirus type 2c (CPV-2c in cell cultures from South American dogs.
Schuh, Elizabeth M; Portela, Roberta; Gardner, Heather L; Schoen, Christian; London, Cheryl A
2017-10-02
Hyperthermia is an established anti-cancer treatment but is limited by tolerance of adjacent normal tissues. Parenteral administration of gold nanorods (NRs) as a photosensitizer amplifies the effects of hyperthermia treatment while sparing normal tissues. This therapy is well tolerated and has demonstrated anti-tumor effects in mouse models. The purpose of this phase 1 study was to establish the safety and observe the anti-tumor impact of gold NR enhanced (plasmonic) photothermal therapy (PPTT) in client owned canine patients diagnosed with spontaneous neoplasia. Seven dogs underwent gold NR administration and subsequent NIR PPTT. Side effects were mild and limited to local reactions to NIR laser. All of the dogs enrolled in the study experienced stable disease, partial remission or complete remission. The overall response rate (ORR) was 28.6% with partial or complete remission of tumors at study end. PPTT utilizing gold nanorod therapy can be safely administered to canine patients. Further studies are needed to determine the true efficacy in a larger population of canine cancer patients and to and identify those patients most likely to benefit from this therapy.
Canine as a biomedical research model: immunological, hematological, and oncological aspects
International Nuclear Information System (INIS)
Shifrine, M.; Wilson, F.D.
1980-01-01
The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies
Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts.
Directory of Open Access Journals (Sweden)
Lindsay Van den Bossche
Full Text Available Non-alcoholic fatty liver disease (NAFLD is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in this large animal model. Hepatic lipid accumulation, gene-expression analysis and HPLC-MS of neutral lipids and phospholipids in extrahepatic (EHPSS and intrahepatic portosystemic shunts (IHPSS was compared to healthy control dogs. Liver organoids of diseased dogs and healthy control dogs were incubated with palmitic- and oleic-acid, and lipid accumulation was quantified using LD540. In histological slides of shunt livers, a 12-fold increase of lipid content was detected compared to the control dogs (EHPSS P<0.01; IHPSS P = 0.042. Involvement of lipid-related genes to steatosis in portosystemic shunting was corroborated using gene-expression profiling. Lipid analysis demonstrated different triglyceride composition and a shift towards short chain and omega-3 fatty acids in shunt versus healthy dogs, with no difference in lipid species composition between shunt types. All organoids showed a similar increase in triacylglycerols after free fatty acids enrichment. This study demonstrates that steatosis is probably secondary to canine portosystemic shunts. Unravelling the pathogenesis of this hepatic steatosis might contribute to a better understanding of steatosis in NAFLD.
New developments in canine hepatozoonosis in North America: a review
Little, Susan E; Allen, Kelly E; Johnson, Eileen M; Panciera, Roger J; Reichard, Mason V; Ewing, Sidney A
2009-01-01
Canine hepatozoonosis is caused by Hepatozoon canis and Hepatozoon americanum, apicomplexan parasites transmitted to dogs by ingestion of infectious stages. Although the two agents are phylogenetically related, specific aspects, including characteristics of clinical disease and the natural history of the parasites themselves, differ between the two species. Until recently, H. canis infections had not been clearly documented in North America, and autochthonous infection with H. americanum has yet to be reported outside of the southern United States. However, recent reports demonstrate H. canis is present in areas of North America where its vector tick, Rhipicephalus sanguineus, has long been endemic, and that the range of H. americanum is likely expanding along with that of its vector tick, Amblyomma maculatum; co-infections with the two organisms have also been identified. Significant intraspecific variation has been reported in the 18S rRNA gene sequence of both Hepatozoon spp.-infecting dogs, suggesting that each species may represent a complex of related genogroups rather than well-defined species. Transmission of H. americanum to dogs via ingestion of cystozoites in muscle of infected vertebrates was recently demonstrated, supporting the concept of predation as a means of natural transmission. Although several exciting advances have occurred in recent years, much remains to be learned about patterns of infection and the nature of clinical disease caused by the agents of canine hepatozoonosis in North America. PMID:19426444
Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan
2014-06-01
More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year
Directory of Open Access Journals (Sweden)
Sophia Pfahler
Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.
Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).
Christiansen, Per
2008-07-01
The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.
Canine length in wild male baboons: maturation, aging and social dominance rank.
Directory of Open Access Journals (Sweden)
Jordi Galbany
Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.
Bilić, Petra; Guillemin, Nicolas; Kovačević, Alan; Beer Ljubić, Blanka; Jović, Ines; Galan, Asier; Eckersall, Peter David; Burchmore, Richard; Mrljak, Vladimir
2018-05-15
Idiopathic dilated cardiomyopathy (iDCM) is a primary myocardial disorder with an unknown aetiology, characterized by reduced contractility and ventricular dilation of the left or both ventricles. Naturally occurring canine iDCM was used herein to identify serum proteomic signature of the disease compared to the healthy state, providing an insight into underlying mechanisms and revealing proteins with biomarker potential. To achieve this, we used high-throughput label-based quantitative LC-MS/MS proteomics approach and bioinformatics analysis of the in silico inferred interactome protein network created from the initial list of differential proteins. To complement the proteomic analysis, serum biochemical parameters and levels of know biomarkers of cardiac function were measured. Several proteins with biomarker potential were identified, such as inter-alpha-trypsin inhibitor heavy chain H4, microfibril-associated glycoprotein 4 and apolipoprotein A-IV, which were validated using an independent method (Western blotting) and showed high specificity and sensitivity according to the receiver operating characteristic curve analysis. Bioinformatics analysis revealed involvement of different pathways in iDCM, such as complement cascade activation, lipoprotein particles dynamics, elastic fibre formation, GPCR signalling and respiratory electron transport chain. Idiopathic dilated cardiomyopathy is a severe primary myocardial disease of unknown cause, affecting both humans and dogs. This study is a contribution to the canine heart disease research by means of proteomic and bioinformatic state of the art analyses, following similar approach in human iDCM research. Importantly, we used serum as non-invasive and easily accessible biological source of information and contributed to the scarce data on biofluid proteome research on this topic. Bioinformatics analysis revealed biological pathways modulated in canine iDCM with potential of further targeted research. Also, several
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki
2012-10-01
The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.
de Carvalho, Ot?vio Val?rio; F?lix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, M?rcia Rog?ria; Bressan, Gustavo Costa; Pena, Lindomar Jos?; Silva-J?nior, Abelardo
2017-01-01
Background Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic stra...
National clinical guidelines for management of the palatally ectopic maxillary canine.
Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M
2012-08-01
This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.
Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A
2000-07-01
Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.
Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.
Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka
2016-07-01
Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.
Management of an Unusual Ectopic Eruption of Maxillary Canine.
Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula
2017-05-01
Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.
The Ondersteport Canine distemper virus strain and measles ...
African Journals Online (AJOL)
Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...
Management of an impacted and transposed maxillary canine
Directory of Open Access Journals (Sweden)
Deepti A
2010-03-01
Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.
Canine distemper outbreak in pet store puppies linked to a high-volume dog breeder.
Schumaker, Brant A; Miller, Myrna M; Grosdidier, Paul; Cavender, Jacqueline L; Montgomery, Donald L; Cornish, Todd E; Farr, Robert M; Driscoll, Michael; Maness, Lori J; Gray, Tangney; Petersen, Dana; Brown, William L; Logan, Jim; O'Toole, Donal
2012-11-01
Canine distemper is uncommon in the pet trade in the United States, in large part due to effective vaccines against Canine distemper virus (CDV). This is a report of CDV affecting 24 young dogs of multiple breeds shortly after sale by 2 pet stores in Wyoming during August-October 2010. Cases were diagnosed over 37 days. Diagnosis was established by a combination of fluorescent antibody staining, reverse transcription polymerase chain reaction, negative stain electron microscopy, and necropsy with histopathology. Viral hemagglutinin gene sequences were analyzed from 2 affected dogs and were identical (GenBank accession no. JF283477). Sequences were distinct from those in a contemporaneous unrelated case of CDV in a Wyoming dog (JF283476) that had no contact with the pet store dogs. The breeding property from which the puppies originated was quarantined by the Kansas Animal Health Department. Puppies intended for sale were tested for CDV. Canine distemper was diagnosed on site in November 2010. At that point 1,466 dogs were euthanized to eliminate dispersal of the disease through commercial channels. The investigation underscores the risks inherent in large-scale dog breeding when vaccination and biosecurity practices are suboptimal.
Typing of Canine Parvovirus Strains Circulating in North-East China.
Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S
2017-04-01
Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.
Advances in canine distemper virus pathogenesis research: a wildlife perspective.
Loots, Angelika K; Mitchell, Emily; Dalton, Desiré L; Kotzé, Antoinette; Venter, Estelle H
2017-03-01
Canine distemper virus (CDV) has emerged as a significant disease of wildlife, which is highly contagious and readily transmitted between susceptible hosts. Initially described as an infectious disease of domestic dogs, it is now recognized as a global multi-host pathogen, infecting and causing mass mortalities in a wide range of carnivore species. The last decade has seen the effect of numerous CDV outbreaks in various wildlife populations. Prevention of CDV requires a clear understanding of the potential hosts in danger of infection as well as the dynamic pathways CDV uses to gain entry to its host cells and its ability to initiate viral shedding and disease transmission. We review recent research conducted on CDV infections in wildlife, including the latest findings on the causes of host specificity and cellular receptors involved in distemper pathogenesis.
Aspects and clinical procedures of eruptive changes of permanent upper canines
Directory of Open Access Journals (Sweden)
Sheila Marcia Francisco
2012-04-01
Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.
Qeska, V; Barthel, Y; Iseringhausen, M; Tipold, A; Stein, V M; Khan, M A; Baumgärtner, W; Beineke, A
2013-12-15
Canine distemper virus (CDV) infection causes immunosuppression and demyelinating leukoencephalitis in dogs. In viral diseases, an ambiguous function of regulatory T cells (Treg), with both beneficial effects by reducing immunopathology and detrimental effects by inhibiting antiviral immunity, has been described. However, the role of Treg in the pathogenesis of canine distemper remains unknown. In order to determine the effect of CDV upon immune homeostasis, the amount of Foxp3(+) Treg in spleen and brain of naturally infected dogs has been determined by immunohistochemistry. In addition, splenic cytokine expression has been quantified by reverse transcriptase polymerase chain reaction. Splenic depletion of Foxp3(+) Treg was associated with an increased mRNA-expression of tumor necrosis factor and decreased transcription of interleukin-2 in the acute disease phase, indicative of disturbed immunological counter regulation in peripheral lymphoid organs. In the brain, a lack of Foxp3(+) Treg in predemyelinating and early demyelinating lesions and significantly increased infiltrations of Foxp3(+) Treg in chronic demyelinating lesions were observed. In conclusion, disturbed peripheral and CNS immune regulation associated with a reduction of Treg represents a potential prerequisite for excessive neuroinflammation and early lesion development in canine distemper leukoencephalitis. © 2013 Elsevier B.V. All rights reserved.
A randomized clinical study of two interceptive approaches to palatally displaced canines.
Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela
2008-08-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.
International Nuclear Information System (INIS)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-01-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed
Grozdanic, Sinisa D; Kecova, Helga; Lazic, Tatjana
2013-09-01
To develop fast and reliable testing routines for diagnosing retina and optic nerve diseases in canine cataract patients based on chromatic properties of the pupillary light reflex response. Seventy-seven canine patients with a history of cataract and decreased vision (43 patients with cataracts and no evidence of retina or optic nerve disease, 21 patients with cataracts and retinal degeneration [RD], 13 patients with cataracts and retinal detachment [RDT]), 11 canine patients with optic neuritis (ON) and 23 healthy dogs were examined using chromatic pupillary light reflex (cPLR) analysis with red and blue light and electroretinography. Electroretinography analysis showed statistically significant deficits in a- and b-wave amplitudes in dogs with cataracts and RD, or cataracts and RDT, when compared to dogs with cataracts without evidence of retinal abnormalities. Evaluation of b-wave amplitudes showed that presence of 78.5-μV (or lower) amplitudes had high sensitivity of 100% (95% CI: 87.2-100%) and high specificity of 96.7% (95% CI: 88.4-100%) in RD and RDT. Evaluation of cPLR responses using red light showed that presence of the pupil end constriction diameter of 5.5 mm (or higher) had moderately high sensitivity of 76.5% (95% CI: 50.1-93.2%) and high specificity of 100% (95% CI: 91.2-100%) in detecting RD and RDT. Optic neuritis patients had absent cPLR responses, regardless of the visual status. Chromatic evaluation of the pupillary light reflex is a rapid and accurate test for diagnosing retina and optic nerve diseases in canine patients. © 2012 American College of Veterinary Ophthalmologists.
DEFF Research Database (Denmark)
Kaewsakhorn, T.; Kisseberth, W.C.; Capen, C.C.
2005-01-01
Background: Transitional cell carcinoma (TCC) in dogs is associated with high morbidity and mortality. Calcitriol and its analog seocalcitol, combined with medium-chain triglyceride (MCT), have potential for the treatment of this disease. Materials and Methods: TCC cells were treated with calcitr...... inhibited TCC cell growth via induction of cell cycle arrest and MCT enhanced this effect. Therefore, calcitriol and seocalcitol with MCT may have therapeutic potential for canine bladder cancer....... with calcitriol or seocalcitol, alone or combined with MCT. Cell growth, cell cycle kinetics, vitamin D receptor (VDR) localization and expression, and Bcl-2 expression were measured. Results: Canine TCC expresses high levels of nuclear VDR. Furthermore, calcitriol and seocalcitol significantly inhibited cell...
Canine neosporosis: perspectives on pathogenesis and management
Directory of Open Access Journals (Sweden)
Silva RC
2016-04-01
Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs
Evaluation of prognostic markers for canine mast cell tumors treated with vinblastine and prednisone
Directory of Open Access Journals (Sweden)
Yuzbasiyan-Gurkan Vilma
2008-08-01
Full Text Available Abstract Background Canine cutaneous mast cell tumor (MCT is a common neoplastic disease associated with a variable biologic behavior. Surgery remains the primary treatment for canine MCT; however, radiation therapy (RT and chemotherapy are commonly used to treat aggressive MCT. The goals of this study were to evaluate the prognostic utility of histologic grade, c-KIT mutations, KIT staining patterns, and the proliferation markers Ki67 and AgNORs in dogs postoperatively treated with vinblastine and prednisone +/- RT, and to compare the outcome of dogs treated with post-operative chemotherapy +/- RT to that of a prognostically matched group treated with surgery alone. Associations between prognostic markers and survival were evaluated. Disease-free intervals (DFI and overall survival times (OS of dogs with similar pretreatment prognostic indices postoperatively treated with chemotherapy were compared to dogs treated with surgery alone. Results Histologic grade 3 MCTs, MCTs with c-KIT mutations, MCTs with increased cytoplasmic KIT, and MCTs with increased Ki67 and AgNOR values were associated with decreased DFI and OS. Dogs with histologic grade 3 MCT had significantly increased DFI and OS when treated with chemotherapy vs. surgery alone. Although not statistically significant due to small sample sizes, MCTs with c-KIT mutations had increased DFI and OS when treated with chemotherapy vs. surgery alone. Conclusion and clinical importance This study confirms the prognostic value of histologic grade, c-KIT mutations, KIT staining patterns, and proliferation analyses for canine MCT. Additionally, the results of this study further define the benefit of postoperative vinblastine and prednisone for histologic grade 3 MCTs.
Choi, Chi-Bong; Kim, Sang-Young; Lee, Sung-Ho; Jahng, Geon-Ho; Kim, Hwi-Yool; Choe, Bo-Young; Ryu, Kyung-Nam; Yang, Dal-Mo; Yim, Sung-Vin; Choi, Woo-Suk
2011-01-01
Parkinson's disease (PD) is a neurodegenerative disorder characterized by the progressive loss of the dopaminergic neurons in the substantia nigra pars compacta, which projects to the striatum. We induced a selective loss of nigrostriatal dopamine neurons, by infusing the mitochondrial complex 1 inhibitor 1-methyl 4-phenyl 1,2,3,6-tetrahydropyridine (MPTP) into adult beagle dogs (N=5). Single voxel ¹H water suppressed magnetic resonance spectroscopy (¹H-MRS) at 3 T was used to assess the metabolic changes in the striatum of canine before and after MPTP intoxication. The metabolite spectra obtained from the striatum (voxel size: 2 cm³) showed a lower N-acetyl aspartate to total creatine (creatine+phosphocreatine) ratio after MPTP intoxication. There were no significant differences in other metabolite ratios such as glutamate+glutamine, choline-containing compounds (glycerophosphocholine+phophorylcholine and myo-inositol). Our findings indicated that ¹H-MRS is a sensitive, noninvasive measure of neural toxicity and biochemical alterations of the striatum in a canine model of PD, and further studies are needed to confirm brain metabolic changes in association with progression of MPTP-intoxication. Copyright © 2011 Elsevier Inc. All rights reserved.
Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.
Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul
2017-02-01
The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Canine detection of free-ranging brown treesnakes on Guam
Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.
2011-01-01
We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.
Directory of Open Access Journals (Sweden)
Milcah C. Scott
2016-12-01
Full Text Available Osteosarcoma (OS is a heterogeneous and rare disease with a disproportionate impact because it mainly affects children and adolescents. Lamentably, more than half of patients with OS succumb to metastatic disease. Clarification of the etiology of the disease, development of better strategies to manage progression, and methods to guide personalized treatments are among the unmet health needs for OS patients. Progress in managing the disease has been hindered by the extreme heterogeneity of OS; thus, better models that accurately recapitulate the natural heterogeneity of the disease are needed. For this study, we used cell lines derived from two spontaneous canine OS tumors with distinctly different biological behavior (OS-1 and OS-2 for heterotypic in vivo modeling that recapitulates the heterogeneous biology and behavior of this disease. Both cell lines demonstrated stability of the transcriptome when grown as orthotopic xenografts in athymic nude mice. Consistent with the behavior of the original tumors, OS-2 xenografts grew more rapidly at the primary site and had greater propensity to disseminate to lung and establish microscopic metastasis. Moreover, OS-2 promoted formation of a different tumor-associated stromal environment than OS-1 xenografts. OS-2-derived tumors comprised a larger percentage of the xenograft tumors than OS-1-derived tumors. In addition, a robust pro-inflammatory population dominated the stromal cell infiltrates in OS-2 xenografts, whereas a mesenchymal population with a gene signature reflecting myogenic signaling dominated those in the OS-1 xenografts. Our studies show that canine OS cell lines maintain intrinsic features of the tumors from which they were derived and recapitulate the heterogeneous biology and behavior of bone cancer in mouse models. This system provides a resource to understand essential interactions between tumor cells and the stromal environment that drive the progression and metastatic propensity of
Scott, Milcah C; Tomiyasu, Hirotaka; Garbe, John R; Cornax, Ingrid; Amaya, Clarissa; O'Sullivan, M Gerard; Subramanian, Subbaya; Bryan, Brad A; Modiano, Jaime F
2016-12-01
Osteosarcoma (OS) is a heterogeneous and rare disease with a disproportionate impact because it mainly affects children and adolescents. Lamentably, more than half of patients with OS succumb to metastatic disease. Clarification of the etiology of the disease, development of better strategies to manage progression, and methods to guide personalized treatments are among the unmet health needs for OS patients. Progress in managing the disease has been hindered by the extreme heterogeneity of OS; thus, better models that accurately recapitulate the natural heterogeneity of the disease are needed. For this study, we used cell lines derived from two spontaneous canine OS tumors with distinctly different biological behavior (OS-1 and OS-2) for heterotypic in vivo modeling that recapitulates the heterogeneous biology and behavior of this disease. Both cell lines demonstrated stability of the transcriptome when grown as orthotopic xenografts in athymic nude mice. Consistent with the behavior of the original tumors, OS-2 xenografts grew more rapidly at the primary site and had greater propensity to disseminate to lung and establish microscopic metastasis. Moreover, OS-2 promoted formation of a different tumor-associated stromal environment than OS-1 xenografts. OS-2-derived tumors comprised a larger percentage of the xenograft tumors than OS-1-derived tumors. In addition, a robust pro-inflammatory population dominated the stromal cell infiltrates in OS-2 xenografts, whereas a mesenchymal population with a gene signature reflecting myogenic signaling dominated those in the OS-1 xenografts. Our studies show that canine OS cell lines maintain intrinsic features of the tumors from which they were derived and recapitulate the heterogeneous biology and behavior of bone cancer in mouse models. This system provides a resource to understand essential interactions between tumor cells and the stromal environment that drive the progression and metastatic propensity of OS. © 2016
Cryopreservation of microencapsulated canine sperm.
Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu
2011-03-01
The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.
Pathologic and Molecular Virologic Characterization of a Canine Distemper Outbreak in Farmed Civets.
Techangamsuwan, S; Banlunara, W; Radtanakatikanon, A; Sommanustweechai, A; Siriaroonrat, B; Lombardini, E D; Rungsipipat, A
2015-07-01
In October 2011, a fatal disease outbreak occurred in 3 civet species farmed for their use in the coffee industry in Thailand. The disease quickly killed 20 animals in a mixed population of Asian palm civets (Paradoxurus hermaphroditus; n = 18), a masked palm civet (Paguma larvata; n = 1), and small Indian civet (Viverricula indica; n = 1). Clinical signs consisted of severe lethargy, weakness, vomiting, and diarrhea with associated dehydration, dyspnea, nasal and footpad hyperkeratosis, and seizures. All civets were positive for canine morbillivirus using the commercial canine distemper virus (CDV) antigen test kit. Consistently observed necropsy findings consisted of severe pneumonia and hemorrhagic enteritis. Microscopic examination revealed severe gastroenteritis, bronchointerstitial pneumonia, lymphadenitis, necrotizing dermatitis, nonsuppurative polioencephalitis, and characteristic intranuclear/intracytoplasmic eosinophilic viral inclusions in multiple tissues. Immunohistochemical analysis revealed immunoreactivity of varying intensity, while virus isolation demonstrated typical cytopathic effects. To confirm CDV infection, reverse transcription-polymerase chain reaction against fusion (F), phosphoprotein (P), and hemagglutinin (H) genes showed bands of expected size using conjunctival swabs (9 civets, 1 dog [Canis lupus familiaris] living on the farm). Phylogenetic analyses and restriction fragment length polymorphism results indicated that the civets were infected by the Asia-1 strain of CDV commonly found in dogs in Thailand. The deduced amino acid sequences of the signaling lymphocyte activation molecule binding region of the CDV-H proteins revealed a Y549H mutation in both CDV-infected Asian palm civets (n = 4) and a co-located dog. We report a canine distemper outbreak in a civet colony with lineage classification and a Y549H mutation in noncanid species in Thailand. © The Author(s) 2014.
Canine parvovirus: the worldwide occurrence of antigenic variants.
Miranda, Carla; Thompson, Gertrude
2016-09-01
The most important enteric virus infecting canids is canine parvovirus type 2 (CPV-2). CPV is the aetiologic agent of a contagious disease, mainly characterized by clinical gastroenteritis signs in younger dogs. CPV-2 emerged as a new virus in the late 1970s, which could infect domestic dogs, and became distributed in the global dog population within 2 years. A few years later, the virus's original type was replaced by a new genetic and antigenic variant, called CPV-2a. Around 1984 and 2000, virus variants with the single change to Asp or Glu in the VP2 residue 426 were detected (sometimes termed CPV-2b and -2c). The genetic and antigenic changes in the variants have also been correlated with changes in their host range; in particular, in the ability to replicate in cats and also host range differences in canine and other tissue culture cells. CPV-2 variants have been circulating among wild carnivores and have been well-documented in several countries around the world. Here, we have reviewed and summarized the current information about the worldwide distribution and evolution of CPV-2 variants since they emerged, as well as the host ranges they are associated with.
I.K.G. Visser (Ilona); M.W.G. van de Bildt (Marco); H.N. Brugge; P.J.H. Reijnders; E.J. Vedder (Lies); J. Kuiper; P. de Vries (Petra); J. Groen (Jan); H.C. Walvoort; F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)
1989-01-01
textabstractTwo inactivated canine distemper virus (CDV) vaccines--an adjuvanted whole inactivated virus and a subunit ISCOM preparation--were tested for their ability to induce protective immunity in harbour seals (Phoca vitulina) against phocid distemper, a disease that recently killed greater
Dog as a model in studies on human hereditary diseases and their gene therapy.
Switonski, Marek
2014-03-01
During the last 15 years spectacular progress has been achieved in knowledge on the dog genome organization and the molecular background of hereditary diseases in this species. A majority of canine genetic diseases have their counterparts in humans and thus dogs are considered as a very important large animal model in human biomedicine. Among canine monogenic diseases with known causative gene mutations there are two large groups classified as retinal dystrophies and lysosomal storage diseases. Specific types of these diseases are usually diagnosed in a single or several breeds. A well known disorder, restricted to a single breed, is congenital stationary night blindness described in Briards. This disease is a counterpart of Leber amaurosis in children. On the other hand, one of the most common monogenic human diseases (Duchenne muscular dystrophy), has its canine counterparts in several breeds (e.g., the Golden retriever, Beagle and German short-haired pointer). For some of the canine diseases gene therapy strategy was successfully applied, e.g., for congenital stationary night blindness, rod-cone dystrophy and muccopolysaccharydoses type I, IIIB and VII. Since phenotypic variability between the breeds is exceptionally high, the dog is an interesting model to study the molecular background of congenital malformations (e.g., dwarfism and osteoporosis imperfecta). Also disorders of sexual development (DSD), especially testicular or ovotesticular DSD (78,XX; SRY-negative), which is widely distributed across dozens of breeds, are of particular interest. Studies on the genetic background of canine cancers, a major health problem in this species, are also quite advanced. On the other hand, genetic studies on canine counterparts of major human complex diseases (e.g., obesity, the metabolic syndrome and diabetes mellitus) are still in their infancy. Copyright © 2014 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish
Directory of Open Access Journals (Sweden)
Carolina Guadalupe Sosa-Gutierrez
2013-01-01
Full Text Available Ehrlichia canis is a rickettsial intracellular obligate bacterial pathogen and agent of canine monocytic ehrlichiosis. The prevalence of this disease in veterinary medicine can vary depending on the diagnostic method used and the geographic location. One hundred and fifty-two canine blood samples from six veterinary clinics and two shelters from Sinaloa State (Mexico were analyzed in this study. All animals were suspected of having Canine Monocytic Ehrlichiosis (CME. The diagnostic methods used were the ELISA (Snap4Dx, IDEXX together with blood smear and platelet count. From all dogs blood samples analyzed, 74.3% were positive to E. canis by ELISA and 40.1% were positive by blood smear. The sensitivity and specificity observed in the ELISA test were 78.8% and 86.7%. In addition, thrombocytopenia was presented in 87.6% of positive dogs. The predominant clinical manifestations observed were fever, anorexia, depression, lethargy, and petechiae. Consequently, this is the first report in which the morulae were visualized in the blood samples, and E. canis-specific antibodies were detected in dogs from Sinaloa, Northwest of Mexico.
Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2006-01-01
Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.
Management of impacted all canines with surgical exposure and alignment by orthodontic treatment
Directory of Open Access Journals (Sweden)
Radha Katiyar
2013-01-01
Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.
Mitsuhiro Isaka; Masahiko Befu; Nami Matsubara; Mayuko Ishikawa; Yurie Arase; Toshiyuki Tsuyama; Akiko Doi; Shinichi Namba
2014-01-01
Canine medial patellar luxation (MPL) is a very common orthopedic disease in small animals. Because the pathophysiology of this disease involves various pathways, the surgical techniques and results vary according to the veterinarian. Further, the landmark for block recession is not completely clear. We retrospectively evaluated 75 dogs (107 limbs) with MPL in whom our landmark for block recession was used from July 2008 to May 2013. Information regarding the breed, age, sex, body weight, bod...
Directory of Open Access Journals (Sweden)
Renato A. K. Kalil
2002-09-01
Full Text Available OBJECTIVE: To assess the transfection of the gene that encodes green fluorescent protein (GFP through direct intramyocardial injection. METHODS: The pREGFP plasmid vector was used. The EGFP gene was inserted downstream from the constitutive promoter of the Rous sarcoma virus. Five male dogs were used (mean weight 13.5 kg, in which 0.5 mL of saline solution (n=1 or 0.5 mL of plasmid solution containing 0.5 µg of pREGFP/dog (n=4 were injected into the myocardium of the left ventricular lateral wall. The dogs were euthanized 1 week later, and cardiac biopsies were obtained. RESULTS: Fluorescence microscopy showed differences between the cells transfected and not transfected with pREGFP plasmid. Mild fluorescence was observed in the cardiac fibers that received saline solution; however, the myocardial cells transfected with pREGFP had overt EGFP expression. CONCLUSION: Transfection with the EGFP gene in healthy canine myocardium was effective. The reproduction of this efficacy using vascular endothelial growth factor (VEGF instead of EGFP aims at developing gene therapy for ischemic heart disease.
Wang, Xiang; Erickson, Antonia M.; Allen, Matthew R.; Burr, David B.; Martin, R. Bruce; Hazelwood, Scott J.
2009-01-01
Bisphosphonates suppress bone remodeling activity, increase bone volume, and significantly reduce fracture risk in individuals with osteoporosis and other metabolic bone diseases. The objectives of the current study were to develop a mathematical model that simulates control and 1 year experimental results following bisphosphonate treatment (alendronate or risedronate) in the canine fourth lumbar vertebral body, validate the model by comparing simulation predictions to 3 year experimental res...
Alpha-1-antitrypsin studies: canine serum and canine surfactant protein
International Nuclear Information System (INIS)
Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.
1974-01-01
Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)
Canine hip dysplasia: significance of early bony spurring
International Nuclear Information System (INIS)
Morgan, J.P.
1987-01-01
It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head
Radiographic assessment of dental anomalies in patients with ectopic maxillary canines
DEFF Research Database (Denmark)
Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul
2008-01-01
dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...
Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.
Directory of Open Access Journals (Sweden)
Da-Wei Yao
2014-06-01
Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.
Nuttall, Tim; Reece, Douglas; Roberts, Elizabeth
2014-01-01
Ciclosporin (Atopica; Novartis Animal Health) has been licensed for canine atopic dermatitis (AD) since 2002. Adverse events (AEs) have been reported in 55 per cent of 759 dogs in 15 clinical trials, but are rare in pharmacovigilance data (71.81 AEs/million capsules sold). Gastrointestinal reactions were most common, but were mild and rarely required intervention. Other AEs were rare (≤1 per cent in clinical trials; metabolism is not clinically significant for normal dogs. Concomitant treatment with most drugs is safe. Effects on cytochrome P450 and MDR1 P-glycoprotein activity may elevate plasma ciclosporin concentrations, but short-term changes are not clinically significant. Monitoring of complete blood counts, urinalysis or ciclosporin levels is not justified except with higher than recommended doses and/or long-term concurrent immunosuppressive drugs. Ciclosporin is not a contraindication for killed (including rabies) vaccines, but the licensed recommendation is that live vaccination is avoided during treatment. In conclusion, ciclosporin has a positive risk-benefit profile for the long-term management of canine AD. PMID:24682696
Case report of canine co-infection with Leishmania infantum and Ehrlichia canis
Directory of Open Access Journals (Sweden)
Stefanovska Jovana
2011-05-01
Full Text Available Canine leishmaniasis (CanL due to Leishmania infantum and canine monocytic ehrilichiosis (CME due to Ehrlichia canis are common diseases with zoonotic potential in the Mediterranean area. Their prevalence in R. Macedonia as a neighboring Mediterranean county is expected. In both diseases similar clinical symptoms can be manifested in dogs such as: lethargy, anorexia, weight loss, epistaxis, fever, pale mucous membranes, enlarged lymph nodes, splenomegaly, ocular signs. This case report present an atypical case of 11 year old female Samoyed with starting single clinical symptom epistaxys. Initial diagnostic procedures revealed the presence only of CanL, which was diagnosed using indirect immunofluorescence method and ELISA. First laboratory findings showed normal hematological and renal profiles. Dog was put on a treatment with Allopurinol (20mg/kg, p/o for at least 9 months. Termination of the therapy after 6 months brought a numerous clinical symptoms involving weakness, dehydration, pale mucous membranes lost pupilar reflex, uremic breath and biochemical parameters revealed a renal failure. Using a commercial ELISA kit Ehrlichia canis as a co infection was diagnosed. Most probably the second infectious agent was induced in the past 6 months, causing more severe pathological effects than CanL infection alone.
The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D
Directory of Open Access Journals (Sweden)
Markéta Vaňková
2016-01-01
Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.
Increased expression of MERTK is associated with a unique form of canine retinopathy.
Directory of Open Access Journals (Sweden)
Saija J Ahonen
Full Text Available Progressive retinal degenerations are among the most common causes of blindness both in human and in dogs. Canine progressive retinal atrophy (PRA resembles human retinitis pigmentosa (RP and is typically characterized by a progressive loss of rod photoreceptors followed by a loss of cone function. The disease gradually progress from the loss of night and day vision to a complete blindness. We have recently described a unique form of retinopathy characterized by the multifocal gray/brown discoloration and thinning of the retina in the Swedish Vallhund (SV breed. We aimed to identify the genetic cause by performing a genome wide association analysis in a cohort of 18 affected and 10 healthy control dogs using Illumina's canine 22k SNP array. We mapped the disease to canine chromosome 17 (p = 7.7×10(-5 and found a 6.1 Mb shared homozygous region in the affected dogs. A combined analysis of the GWAS and replication data with additional 60 dogs confirmed the association (p = 4.3×10(-8, OR = 11.2 for homozygosity. A targeted resequencing of the entire associated region in four cases and four controls with opposite risk haplotypes identified several variants in the coding region of functional candidate genes, such as a known retinopathy gene, MERTK. However, none of the identified coding variants followed a compelling case- or breed-specific segregation pattern. The expression analyses of four candidate genes in the region, MERTK, NPHP1, ANAPC1 and KRCC1, revealed specific upregulation of MERTK in the retina of the affected dogs. Collectively, these results indicate that the retinopathy is associated with overexpression of MERTK, however further investigation is needed to discover the regulatory mutation for the better understanding of the disease pathogenesis. Our study establishes a novel gain-of-function model for the MERTK biology and provides a therapy model for retinopathy MERTK inhibitors. Meanwhile, a marker-based genetic
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Directory of Open Access Journals (Sweden)
Sumitra
2012-01-01
Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.
Prostate histotripsy for BPH: initial canine results
Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.
2009-02-01
Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.
Directory of Open Access Journals (Sweden)
Rita de Cássia Carmona Castro
2005-04-01
Full Text Available At the Veterinary Teaching Hospital (HOVET in FMVZ/USP, sarcoptic and notoedric mange are the second and the third most commonly diagnosed parasitic skin diseases, respectively. Between 1984 and 2002, 2907 cases of canine and feline scabies were diagnosed at HOVET. Canine scabies (2283 and feline scabies (624 represented 6.4% and 15.7%, respectively, of the cases seen. Feline scabies was more frequent than canine scabies (p<0.05 . Canine scabies was more prevalent in pure breeds dogs (58.0% with long hair (74.2% and the most commonly affected dog breeds were: Poodle, Cocker Spaniel and German Shepherds. Canine and feline scabies were more frequent in males. Dogs (54.7% and cats (63.5% < 12 months old were the most affected. For notoedric mange stray cats, short-haired (74.2% were most commonly affected. Feline scabies was most common in Siamese , Persian and Burmese cat breed. There was no seasonal difference in the occurence of scabies in either cats or dogs when results were analysed.
International Nuclear Information System (INIS)
Fabbro, D.E.
1988-01-01
Kinetic and immunologic techniques were developed to investigate the nature of the acid β-glucosidase (β-Glc) defects which results in human and canine Gaucher disease (GD). Two new affinity columns, using the potent inhibitors of β-Glc (N-alkyl-deoxynojirimycins) as affinity ligands, were synthesized and methods were developed to obtain homogeneous β-Glc from normal human placenta. Polyclonal and monoclonal (representing 14 different epitopes from 18 clones) antibodies were produced to the pure normal β-Glc. Monospecific polyclonal IgG and tritiated-bromo-conduritol B epoxide ([ 3 H]Br-CBE), a specific covalent active site directed inhibitor of β-Glc, were used to quantitate the functional catalytic sites in normal and Type 1 Ashkenazi Jewish GD (AJGD) enzyme preparations: The k cat values for several new substrates with the mutant enzymes from spleen were about 1.5-fold less than the respective normal enzyme, indicating a nearly normal catalytic capacity of the mutant enzymes. Immunoblotting studies with polyclonal or several monoclonal antibodies indicated three molecular forms of β-Glc (M r = 67,000, 62,000 to 65,000 and 58,000) in fibroblast extracts from normals and Type 1 AJGD patients. In comparison, only one form of cross-reacting immunologic material (CRIM) was detected in fibroblast extracts from Types 2 and 3 or several non-Jewish Type 1 GD patients
Difficulties in estimating the human burden of canine rabies.
Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H
2017-01-01
Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Lucy J Holcombe
Full Text Available Periodontal disease (PD is a significant problem in dogs affecting between 44% and 63.6% of the population. The main etiological agent for PD is plaque, a microbial biofilm that colonizes teeth and causes inflammation of the gingiva. Understanding how this biofilm initiates on the tooth surface is of central importance in developing interventions against PD. Although the stages of plaque development on human teeth have been well characterized little is known about how canine plaque develops. Recent studies of the canine oral microbiome have revealed distinct differences between the canine and human oral environments and the bacterial communities they support, particularly with respect to healthy plaque. These differences mean knowledge about the nature of plaque formation in humans may not be directly translatable to dogs. The aim of this study was to identify the bacterial species important in the early stages of canine plaque formation in vivo and then use isolates of these species in a laboratory biofilm model to develop an understanding of the sequential processes which take place during the initial colonization of enamel. Supra-gingival plaque samples were collected from 12 dogs at 24 and 48 hour time points following a full mouth descale and polish. Pyrosequencing of the 16S rDNA identified 134 operational taxonomic units after statistical analysis. The species with the highest relative abundance were Bergeyella zoohelcum, Neisseria shayeganii and a Moraxella species. Streptococcal species, which tend to dominate early human plaque biofilms, had very low relative abundance. In vitro testing of biofilm formation identified five primary colonizer species, three of which belonged to the genus Neisseria. Using these pioneer bacteria as a starting point, viable two and three species communities were developed. Combining in vivo and in vitro data has led us to construct novel models of how the early canine plaque biofilm develops.
Wyllie, S E; Kelman, M; Ward, M P
2016-07-01
To determine the status and distribution of distemper in Australian dogs and ferrets. Retrospective case series. Cases were identified via a national voluntary disease reporting system, veterinarian groups and a national laboratory database. The geographic distribution, seasonal distribution, signalment and clinical presentation of cases were described using maps and frequency distributions. A total of 48 individually affected dogs and ferrets in 27 case groups were identified, including eight confirmed case groups (> one individual). Confirmed cases were more common in summer and on the central coast of New South Wales and southern Victoria, and occurred exclusively in young, unvaccinated dogs. For dogs there was no obvious sex predilection. A mortality rate of 100% in ferrets and up to 77% in dogs was estimated. Neurological, gastrointestinal and respiratory were the most commonly reported systems affected in dogs and ferrets. There was no evidence that any large, unreported outbreaks occurred during the study period. Continuation of vaccination against canine distemper virus is justified within Australia, particularly for younger dogs. Veterinarians should continue to consider distemper in their differential diagnosis of cases with neurological, gastrointestinal and respiratory presentation. © 2016 Australian Veterinary Association.
Detection of the Canine Parvovirus 2c Subtype in Australian Dogs.
Woolford, Lucy; Crocker, Paul; Bobrowski, Hannah; Baker, Trevor; Hemmatzadeh, Farhid
2017-06-01
Canine parvovirus (CPV-2) is an important cause of hemorrhagic enteritis in dogs. In Australia the disease has been associated with CPV-2a and CPV-2b variants. A third more recently emerged variant overseas, CPV-2c, has not been detected in surveys of the Australian dog population. In this study, we report three cases of canine parvoviral enteritis associated with CPV-2c infection; case 1 occurred in an 8-week-old puppy that died following acute hemorrhagic enteritis. Cases 2 and 3 were an 11-month-old female entire Saint Bernard and a 9-month-old male entire Siberian husky, respectively, both which had completed vaccination schedules and presented with vomiting or mild diarrhea only. Full genomic sequencing of parvoviral DNA from cases 1, 2, and 3 revealed greater than 99% homology to known CPV-2c variants and predicted protein sequences from the VP2 region of viral DNA from all three cases identified; glutamic acid residues at the 426 amino acid residue, characteristic of the CPV-2c variant. Veterinary professionals should be aware that CPV-2c is now present in Australia, detected in a puppy and vaccinated young adult dogs in this study. Further characterization of CPV-2c-associated disease and its prevalence in Australian dogs requires additional research.
Characterisation of canine parvovirus strains isolated from cats with feline panleukopenia.
Decaro, Nicola; Buonavoglia, Domenico; Desario, Costantina; Amorisco, Francesca; Colaianni, Maria Loredana; Parisi, Antonio; Terio, Valentina; Elia, Gabriella; Lucente, Maria Stella; Cavalli, Alessandra; Martella, Vito; Buonavoglia, Canio
2010-10-01
Unlike the original canine parvovirus type 2 (CPV-2), CPV-2 variants have gained the ability to replicate in vivo in cats but there is limited information on the disease patterns induced by these variants in the feline host. During 2008, two distinct cases of parvoviral infection were diagnosed in our laboratories. A CPV-2a variant was identified in a 3-month-old Persian kitten displaying clinical sign of feline panleukopenia (FPL) (acute gastroenteritis and marked leukopenia) and oral ulcerations, that died eight days after the onset of the disease. Two pups living in the same pet shop as the cat were found to shed a CPV-2a strain genetically identical to the feline virus and were likely the source of infection. Also, non-fatal infection by a CPV-2c strain occurred in a 2.5-month-old European shorthair kitten displaying non-haemorrhagic diarrhoea and normal white blood cell counts. By sequence analysis of the major capsid protein (VP2) gene, the feline CPV-2c strain showed 100% identity to a recent canine type-2c isolate. Both kittens had been administered multivalent vaccines against common feline pathogens including FPL virus. Whether and to which extent the FPL vaccines can protect cats adequately from the antigenic variants of CPV-2 should be assessed. 2010 Elsevier Ltd. All rights reserved.
Survey of Borreliae in ticks, canines, and white-tailed deer from Arkansas, U.S.A.
Directory of Open Access Journals (Sweden)
Fryxell Rebecca T
2012-07-01
. lonestari sequences: 281 of the 296 sequenced ticks, 3 canines, and 27 deer. Only 22 deer, 7 canines, and 15 tick flaB amplicons (12 I. scapularis, 2 A. maculatum, and 1 Amblyomma species were homologous with B. burgdorferi sequences. Conclusions Data from this study identified multiple Borreliae genotypes in Arkansas ticks, canines and deer including B. burgdorferi and B. lonestari; however, B. lonestari was significantly more prevalent in the tick population than B. burgdorferi. Results from this study suggest that the majority of tick-borne diseases in Arkansas are not B. burgdorferi.
Energy Technology Data Exchange (ETDEWEB)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-10-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.
Lotspeich, Erica; Kitts, Kelley; Goodpaster, John
2012-07-10
It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Halos Lénaïg
2014-01-01
Full Text Available The incidence of canine babesiosis may vary considerably from one country to another depending on the distribution of the causative parasite species and their specific vectors. The aim of the present study was to evaluate the clinical occurrence of canine babesiosis diagnosed in European veterinary clinics and propose an updated map of the disease distribution in Western Europe. Questionnaires were sent to companion animal veterinary clinics in Spain, France, Benelux, Germany and Austria. The annual number of babesiosis cases in 2010, the number of practitioners in the clinic and the location of the clinic were recorded. The total numbers of dogs and practitioners in each country were used for definition of the reference populations and the annual incidence of canine babesiosis was calculated by dividing the total number of reported babesiosis cases by the total number of dogs in the veterinary practices involved in the study. Data were georeferenced for distribution map construction. The overall annual incidence of clinical babesiosis amongst the investigated dog population was 0.7%, with significant variations amongst countries and regions. Three epidemiological situations were described: (i Spain, with co-existence of several species of piroplasms and patchy distribution of babesiosis, (ii France, with overall presence of babesiosis due to Babesia canis and local variations and (iii Benelux, Germany and Austria, with overall low prevalence of the disease associated with localised description related either to imported cases or to small autochthonous foci of B. canis infection.
Halos, Lénaïg; Lebert, Isabelle; Abrial, David; Danlois, Fabien; Garzik, Karin; Rodes, Daniel; Schillmeier, Monika; Ducrot, Christian; Guillot, Jacques
2014-01-01
The incidence of canine babesiosis may vary considerably from one country to another depending on the distribution of the causative parasite species and their specific vectors. The aim of the present study was to evaluate the clinical occurrence of canine babesiosis diagnosed in European veterinary clinics and propose an updated map of the disease distribution in Western Europe. Questionnaires were sent to companion animal veterinary clinics in Spain, France, Benelux, Germany and Austria. The annual number of babesiosis cases in 2010, the number of practitioners in the clinic and the location of the clinic were recorded. The total numbers of dogs and practitioners in each country were used for definition of the reference populations and the annual incidence of canine babesiosis was calculated by dividing the total number of reported babesiosis cases by the total number of dogs in the veterinary practices involved in the study. Data were georeferenced for distribution map construction. The overall annual incidence of clinical babesiosis amongst the investigated dog population was 0.7%, with significant variations amongst countries and regions. Three epidemiological situations were described: (i) Spain, with co-existence of several species of piroplasms and patchy distribution of babesiosis, (ii) France, with overall presence of babesiosis due to Babesia canis and local variations and (iii) Benelux, Germany and Austria, with overall low prevalence of the disease associated with localised description related either to imported cases or to small autochthonous foci of B. canis infection. PMID:24626325
Nodular Epiescleritis Granulomatous Canine. Case Report
Directory of Open Access Journals (Sweden)
Camilo Guarín Patarroyo
2011-12-01
Full Text Available Granulomatous epiescleritis nodular disease in canines is a very unusual presentation that affects or external fibrous tunic of the eyeball and conjunctiva, which was an increase similar to a unilateral or bilateral tumor. Suspected immune-mediated disease due to lack of identification of an etiologic agent and the response to treatment with immunosuppressive drugs (Couto, 1992. The ideal therapy is the application of steroids via intralesional, topical or systemic, or other immunosuppressants such as cyclosporine and azathioprine; it is still advisable to apply antibiotic is the ideal combination of tetracycline and neomycin (Gilger & Whitley, 1999. The diagnostic method of episcleritis is made by histopathology, which is evident in changes similar to chronic granulomatous inflammation. Are claiming a racial bias in Alsatian, Shepherd Collie Shetland Shepherd, Coker Spaniel, Rottweiler and Labrador Retriever (Gough & Thomas, 2004. The following case is a report of a nodular epiescleritis affecting the cornea, sclera, and the corneoscleral limbus, which describes the diagnosis, signology and treatment.
Theoretical Modeling of Molecular Mechanisms, Time Scales and Strains in Prion Diseases
2008-01-01
106 46 (Lou Gehrig’s (20% of cases) stress all ALS) disease)53 Type II diabetes54 IAPP ? High ( obesity 14 106 per year (U.S.) 40 trigger...and in enhancing conversion kinetics for inherited forms of the disease and explain resistance (for canines ) involving hypothesized coupling to...bovine spongiform encephalopathy (BSE) prions in England through contaminated protein supplements, canines , cervids, and pigs appear to have escaped
Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).
Glickman, L T; Appel, M J
1981-08-01
Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.
Eruption of the maxillary canines in relation to skeletal maturity.
Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica
2008-05-01
Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.
Citizen science: a new direction in canine behavior research.
Hecht, Julie; Spicer Rice, Eleanor
2015-01-01
Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.
Canine hypothyroidism. A diagnostic challenge?
International Nuclear Information System (INIS)
Boretti, Felicitos; Reusch, C.E.
2010-01-01
Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered ) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high
Expression and activity of the urokinase plasminogen activator system in canine primary brain tumors
Directory of Open Access Journals (Sweden)
Rossmeisl JH
2017-04-01
-time quantitative polymerase chain reaction analyses, and by the assay of the activity of uPA using casein–plasminogen zymography.Results: Expression of uPAR was observed in multiple tumoral microenvironmental niches, including neoplastic cells, stroma, and the vasculature of canine brain tumors. Relative to normal brain tissues, uPAR protein and mRNA expression were significantly greater in canine meningiomas, gliomas, and choroid plexus tumors. Increased activity of uPA was documented in all tumor types.Conclusions: uPAR is overexpressed and uPA activity increased in canine meningiomas, gliomas, and choroid plexus tumors. This study illustrates the potential of uPAR/uPA molecularly targeted approaches for canine brain tumor therapeutics and reinforces the translational significance of canines with spontaneous brain tumors as models for human disease. Keywords: brain tumor, neuro-oncology, dog, animal model, protease, meningioma, glioma
Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe
2018-04-01
Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.
Analysis of the full-length VP2 protein of canine parvoviruses circulating in Hungary.
Cságola, Attila; Varga, Szilvia; Lőrincz, Márta; Tuboly, Tamás
2014-09-01
In recent years, the number of cases of disease caused by canine parvovirus 2 (CPV-2) in vaccinated dogs has increased. The aim of the present study was to identify CPV-2 strains present in Hungary. Forty-two out of 50 faecal specimens examined were positive, and 25 VP2 sequences were determined and analysed. Based on the current classification, the Hungarian viruses belong to New CPV-2a type, except two viruses that are recombinants of vaccine viruses and CPV-2a strains. The Tyr324Ile alteration was detected for the first time in Europe, and a "Hungarian-specific" substitution (Ala516Thr) was also identified in this study. The immunologically important parts of the currently spreading canine parvoviruses were examined and found to differ greatly from the vaccine strains that are widely used in Hungary.
Ultrasonographic evaluation of the canine shoulder.
Long, C D; Nyland, T G
1999-01-01
The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.
Low Titers of Canine Distemper Virus Antibody in Wild Fishers (Martes pennanti) in the Eastern USA.
Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L
2016-01-01
Canine distemper virus (CDV) infects species in the order Carnivora. Members of the family Mustelidae are among the species most susceptible to CDV and have a high mortality rate after infection. Assessing an animal's pathogen or disease load prior to any reintroduction project is important to help protect the animal being reintroduced, as well as the wildlife and livestock in the area of relocation. We screened 58 fishers for CDV antibody prior to their release into Pennsylvania, US, as part of a reintroduction program. Five of the 58 (9%) fishers had a weak-positive reaction for CDV antibody at a dilution of 1:16. None of the fishers exhibited any clinical sign of canine distemper while being held prior to release.
Expert Opinion to Identify High-Risk Entry Routes of Canine Rabies into Papua New Guinea.
Brookes, V J; Ward, M P
2017-03-01
The proximity of Papua New Guinea (PNG) to canine rabies-endemic countries in South-East Asia presents a risk of incursion of this disease into PNG and the rest of the Oceanic region. The objective of this study was to identify the highest risk routes for entry of dogs - associated with movement of people - into PNG from canine rabies-endemic countries. A structured, in-country expert-elicitation workshop was used, and 20 entry routes were identified. The highest risk routes were three land routes from Papua, Indonesia (hunters, traditional border crossers and unregulated, unchecked 'shopper-crossers') and two sea routes (fishing and logging). These results will be used to direct more detailed risk assessments to develop surveillance strategies and incursion response plans. © 2016 Blackwell Verlag GmbH.
Detection of Dirofilaria immitis in a brown bear (Ursus arctos in Greece
Directory of Open Access Journals (Sweden)
Papadopoulos E.
2017-09-01
Full Text Available Dirofilaria immitis (canine heartworm is a filarial nematode found in the pulmonary circulation and the heart of susceptible hosts. It represents an important zoonotic vector-borne disease of domestic dogs and several wildlife species. Herein we report for the first time, the finding of Dirofilaria immitis worms in a brown bear killed in a vehicle collision in Northern Greece. The worms were morphologically identified; molecular examination, based on the analysis of the mitochondrial genes 12S (433 bp and CO1 (610 bp, verified the identification by demonstrating 100% similarity to D. immitis specimens deposited in GenBank. Brown bears in Greece occupy habitats that are shared with the potential wild and domestic hosts and the vectors of D. immitis and thus may be particularly susceptible to this parasite. This report contributes to the knowledge of dirofilariosis spread in Europe and on the epidemiological threats that may affect the survival of the endangered brown bear in Greece.
Canine distemper viral infection threatens the giant panda population in China
Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan
2017-01-01
We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas (Ailuropoda melanoleuca) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin (H) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population. PMID:29371956
Canine distemper viral infection threatens the giant panda population in China.
Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan
2017-12-26
We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas ( Ailuropoda melanoleuca ) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin ( H ) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population.
Directory of Open Access Journals (Sweden)
Shalini Gupta
2014-01-01
Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.
[Nonsurgical endodontic treatment of an invaginated canine].
Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P
1989-01-01
We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.
Genetic characterization of canine influenza A virus (H3N2) in Thailand.
Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn
2014-02-01
In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.
Common and emerging infectious diseases in the animal shelter.
Pesavento, P A; Murphy, B G
2014-03-01
The beneficial role that animal shelters play is unquestionable. An estimated 3 to 4 million animals are cared for or placed in homes each year, and most shelters promote public health and support responsible pet ownership. It is, nonetheless, inevitable that shelters are prime examples of anthropogenic biological instability: even well-run shelters often house transient, displaced, and mixed populations of animals. Many of these animals have received minimal to no prior health care, and some have a history of scavenging or predation to survive. Overcrowding and poor shelter conditions further magnify these inherent risks to create individual, intraspecies, and interspecies stress and provide an environment conducive to exposure to numerous potentially collaborative pathogens. All of these factors can contribute to the evolution and emergence of new pathogens or to alterations in virulence of endemic pathogens. While it is not possible to effectively anticipate the timing or the pathogen type in emergence events, their sites of origin are less enigmatic, and pathologists and diagnosticians who work with sheltered animal populations have recognized several such events in the past decade. This article first considers the contribution of the shelter environment to canine and feline disease. This is followed by summaries of recent research on the pathogenesis of common shelter pathogens, as well as research that has led to the discovery of novel or emerging diseases and the methods that are used for their diagnosis and discovery. For the infectious agents that commonly affect sheltered dogs and cats, including canine distemper virus, canine influenza virus, Streptococcus spp, parvoviruses, feline herpesvirus, feline caliciviruses, and feline infectious peritonitis virus, we present familiar as well as newly recognized lesions associated with infection. Preliminary studies on recently discovered viruses like canine circovirus, canine bocavirus, and feline norovirus
A case of unusual root morphology: Maxillary canine with two roots
Directory of Open Access Journals (Sweden)
Nagesh Bolla
2009-01-01
Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.
Directory of Open Access Journals (Sweden)
Franklin B Magalhães
Full Text Available Current strategies for the control of zoonotic visceral leishmaniasis (VL rely on its efficient diagnosis in both human and canine hosts. The most promising and cost effective approach is based on serologic assays with recombinant proteins. However, no single antigen has been found so far which can be effectively used to detect the disease in both dogs and humans. In previous works, we identified Leishmania infantum antigens with potential for the serodiagnosis of VL. Here, we aimed to expand the panel of the available antigens for VL diagnosis through another screening of a genomic expression library. Seven different protein-coding gene fragments were identified, five of which encoding proteins which have not been previously studied in Leishmania and rich in repetitive motifs. Poly-histidine tagged polypeptides were generated from six genes and evaluated for their potential for diagnosis of VL by ELISA (Enzyme Linked ImmunoSorbent Assay with sera from infected humans and dogs. None of those was valid for the detection of human VL (26-52% sensitivity although their performance was increased in the canine sera (48-91% sensitivity, with one polypeptide useful for the diagnosis of canine leishmaniasis. Next, we assayed a mixture of three antigens, found to be best for human or canine VL, among 13 identified through different screenings. This "Mix" resulted in similar levels of sensitivity for both human (84% and canine (88% sera. With improvements, this validates the use of multiple proteins, including antigens identified here, as components of a single system for the diagnosis of both forms of leishmaniasis.
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E
2016-11-01
The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of
Orthodontic Traction of Impacted Canine Using Cantilever
Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé
2016-01-01
The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...
Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon
2016-02-01
To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Patil Sandeep S
2012-01-01
Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.
Duchenne Muscular Dystrophy Gene Therapy in the Canine Model
2015-01-01
Abstract Duchenne muscular dystrophy (DMD) is an X-linked lethal muscle disease caused by dystrophin deficiency. Gene therapy has significantly improved the outcome of dystrophin-deficient mice. Yet, clinical translation has not resulted in the expected benefits in human patients. This translational gap is largely because of the insufficient modeling of DMD in mice. Specifically, mice lacking dystrophin show minimum dystrophic symptoms, and they do not respond to the gene therapy vector in the same way as human patients do. Further, the size of a mouse is hundredfolds smaller than a boy, making it impossible to scale-up gene therapy in a mouse model. None of these limitations exist in the canine DMD (cDMD) model. For this reason, cDMD dogs have been considered a highly valuable platform to test experimental DMD gene therapy. Over the last three decades, a variety of gene therapy approaches have been evaluated in cDMD dogs using a number of nonviral and viral vectors. These studies have provided critical insight for the development of an effective gene therapy protocol in human patients. This review discusses the history, current status, and future directions of the DMD gene therapy in the canine model. PMID:25710459
Wilmes, Benedict; Drescher, Dieter
2009-05-01
In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.
In vivo electrical conductivity imaging of a canine brain using a 3 T MREIT system
International Nuclear Information System (INIS)
Kim, Hyung Joong; Oh, Tong In; Kim, Young Tae; Lee, Byung Il; Woo, Eung Je; Lee, Soo Yeol; Seo, Jin Keun; Kwon, Ohin; Park, Chunjae; Kang, Byeong Teck; Park, Hee Myung
2008-01-01
Magnetic resonance electrical impedance tomography (MREIT) aims at producing high-resolution cross-sectional conductivity images of an electrically conducting object such as the human body. Following numerous phantom imaging experiments, the most recent study demonstrated successful conductivity image reconstructions of postmortem canine brains using a 3 T MREIT system with 40 mA imaging currents. Here, we report the results of in vivo animal imaging experiments using 5 mA imaging currents. To investigate any change of electrical conductivity due to brain ischemia, canine brains having a regional ischemic model were scanned along with separate scans of canine brains having no disease model. Reconstructed multi-slice conductivity images of in vivo canine brains with a pixel size of 1.4 mm showed a clear contrast between white and gray matter and also between normal and ischemic regions. We found that the conductivity value of an ischemic region decreased by about 10–14%. In a postmortem brain, conductivity values of white and gray matter decreased by about 4–8% compared to those in a live brain. Accumulating more experience of in vivo animal imaging experiments, we plan to move to human experiments. One of the important goals of our future work is the reduction of the imaging current to a level that a human subject can tolerate. The ability to acquire high-resolution conductivity images will find numerous clinical applications not supported by other medical imaging modalities. Potential applications in biology, chemistry and material science are also expected
How Soil Scientists Help Combat Podoconiosis, A Neglected Tropical Disease
Directory of Open Access Journals (Sweden)
Benjamin Jelle Visser
2014-05-01
Full Text Available Podoconiosis or “endemic non-filarial elephantiasis” is a tropical disease caused by prolonged exposure of bare feet to irritant alkaline clay soils of volcanic origin [1]. The name of the disease is derived from the Greek words for foot: podos, and dust: konos. Small mineral particles from irritant soils penetrate the skin and provoke an inflammatory response leading to fibrosis and blockage of lymphatic vessels, causing lymphoedema [2]. Patients suffer from disabling physical effects, but also stigma [1]. The disease can simply be prevented by avoiding contact with irritant soils (wearing shoes but this is still an unaffordable “luxury” for many people. Podoconiosis is unique because it is a completely preventable non-communicable tropical disease [1]. In the past few years, podoconiosis has received increased advocacy and is now step by step appearing on the agenda of medical researchers as well as politicians. [...
The Canine Sand Maze: An Appetitive Spatial Memory Paradigm Sensitive to Age-Related Change in Dogs
Salvin, Hannah E.; McGreevy, Paul D.; Sachdev, Perminder S.; Valenzuela, Michael J.
2011-01-01
Aged dogs exhibit a spectrum of cognitive abilities including a syndrome similar to Alzheimer's disease. A major impediment to research so far has been the lack of a quick and accurate test of visuospatial memory appropriate for community-based animals. We therefore report on the development and validation of the Canine Sand Maze. A 4.5-m-diameter…
Human and canine echinococcosis infection in informal, unlicensed abattoirs in Lima, Peru.
Directory of Open Access Journals (Sweden)
Maria M Reyes
Full Text Available Echinococcus granulosus infections are a major public health problem in livestock-raising regions around the world. The life cycle of this tapeworm is sustained between dogs (definitive host, canine echinococcosis, and herbivores (intermediary host, cystic hydatid disease. Humans may also develop cystic hydatid disease. Echinococcosis is endemic in rural areas of Peru; nevertheless, its presence or the extension of the problem in urban areas is basically unknown. Migration into Lima, an 8-million habitant's metropolis, creates peripheral areas where animals brought from endemic areas are slaughtered without veterinary supervision. We identified eight informal, unlicensed abattoirs in a peripheral district of Lima and performed a cross-sectional study in to assess the prevalence of canine echinococcosis, evaluated by coproELISA followed by PCR evaluation and arecoline purge. Eight of 22 dogs (36% were positive to coproELISA, and four (18% were confirmed to be infected with E. granulosus tapeworms either by PCR or direct observation (purge. Later evaluation of the human population living in these abattoirs using abdominal ultrasound, chest X-rays and serology, found 3 out of 32 (9.3% subjects with echinococcal cysts in the liver (two viable, one calcified, one of whom had also lung involvement and a strongly positive antibody response. Autochthonous transmission of E. granulosus is present in Lima. Informal, unlicensed abattoirs may be sources of infection to neighbouring people in this urban environment.
DEFF Research Database (Denmark)
Trebbien, Ramona; Chriél, Mariann; Struve, Tina
2014-01-01
A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus...
Orthodontic treatment of a complete transposed impacted maxillary canine
Directory of Open Access Journals (Sweden)
Pi-Huei Liu
2015-03-01
Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.
Gabrielli, S; Galuppi, R; Fraulo, M; Savini, F; Morandi, B; Cancrini, G; Poglayen, G
2016-07-01
The genus Micipsella comprises three species of filariae to date identified in lagomorphs only, whereas the other genera belonging to the subfamily Splendidofilariinae are described as parasites of birds, reptiles and mammals. In the present study seven specimens of Micipsella numidica (Seurat, 1917), collected from the hare Lepus europaeus in Italy, were characterized genetically by molecular amplification of the mitochondrial genes (12S rDNA; cox1) and the 5S rDNA gene spacer region. Phylogenetic trees inferred using available sequences from filariae and those identified in this study evidenced a close relationship between M. numidica and Splendidofilariinae of other mammals and reptiles (Rumenfilaria andersoni and Madathamugadia hiepei). The present findings, apart from adding new data about the hosts in Italy, support the taxonomic position of M. numidica and highlight the substantial biological and molecular differences existing between Splendidofilariinae and other Onchocercidae. The study also contributes to our knowledge of the molecular/genetic diagnosis of filarial parasites of veterinary and medical concern in any vertebrate or invertebrate host.
Davis, Ian J; Jones, Andrew W; Creese, Andrew J; Staunton, Ruth; Atwal, Jujhar; Chapple, Iain L C; Harris, Stephen; Grant, Melissa M
2016-07-01
Inflammatory periodontal disease is widespread in dogs. This study evaluated site-specific changes in the canine gingival crevicular fluid (GCF) proteome during longitudinal progression from very mild gingivitis to mild periodontitis. Periodontitis diagnosis in dogs requires general anaesthesia with associated risks and costs; our ultimate aim was to develop a periodontitis diagnostic for application in conscious dogs. The objective of this work was to identify potential biomarkers of periodontal disease progression in dogs. Gingival crevicular fluid was sampled from a total of 10 teeth in eight dogs at three different stages of health/disease and samples prepared for quantitative mass spectrometry (data available via ProteomeXchange; identifier PXD003337). A univariate mixed model analysis determined significantly altered proteins between health states and six were evaluated by ELISA. Four hundred and six proteins were identified with 84 present in all samples. The prevalence of 40 proteins was found to be significantly changed in periodontitis relative to gingivitis. ELISA measurements confirmed that haptoglobin was significantly increased. This study demonstrates for the first time that proteins detected by mass spectrometry have potential to identify novel biomarkers for canine periodontal disease. Further work is required to validate additional biomarkers for a periodontitis diagnostic. © 2016 The Authors. Journal of Clinical Periodontology Published by John Wiley & Sons Ltd.
Evaluation of the canine tympanic membrane by positive contrast ear canalography
International Nuclear Information System (INIS)
Trower, N.D.; Gregory, S.P.; Renfrew, H.; Lamb, C.R.
1998-01-01
Positive contrast ear canalography was described briefly in 1973 as a method for detecting rupture of the tympanic membrane in dogs with otitis media. The purpose of this study was to evaluate the sensitivity and usefulness of the technique. The ears of 10 normal canine cadavers and 31 dogs with clinical signs of ear disease were examined using otoscopy, radiography and contrast radiography after infusing 2 to 5 ml of positive contrast medium into the ear canals. These examinations were repeated in the cadavers after the tympanic membrane had been punctured with a Spreull needle. In the cadavers 14 of 19 (74 per cent) of the tympanic membranes were visible otoscopically; contrast medium did not enter the tympanic bulla of any of the ears before the tympanic membrane was ruptured, but was visible in the bulla in every ear after rupture. In the clinical study, 40 of 61 (66 per cent) of the tympanic membranes were visible otoscopically, and 12 appeared to be ruptured. Radiographic signs of otitis media (increased opacity and/or thickening of the tympanic bulla) were identified in seven ears. Canalography was positive for rupture of the tympanic membrane in 13 ears, including four in which it appeared to be intact otoscopically. In normal canine ears, canalography was a more accurate method for detecting iatrogenic tympanic membrane rupture than otoscopy. In dogs with ear disease, canalography may be more sensitive for otitis media than either otoscopy or survey radiography
Distemper-like disease and encephalitozoonosis in wild dogs (Lycaon pictus).
Van Heerden, J; Bainbridge, N; Burroughs, R E; Kriek, N P
1989-01-01
Clinical signs of a fatal disease resembling those of canine distemper were observed in two groups of captive wild dog (Lycaon pictus) pups 13 days after vaccination with a commercially available combination vaccine for dogs which contained a live attenuated strain of canine distemper virus. Histopathological examination of tissues revealed the presence of intranuclear inclusion bodies in neurons and lesions resembling canine distemper as well as colonies of an Encephalitozoon sp. in the central nervous system and kidneys. Lesions were observed in both organs which resembled those described in other species infected with Encephalitozoon cuniculi.