WorldWideScience

Sample records for canine filarial diseases

  1. Filarial-specific antibody response in East African bancroftian filariasis: effects of host infection, clinical disease, and filarial endemicity

    DEFF Research Database (Denmark)

    Jaoko, Walter G; Simonsen, Paul E; Meyrowitsch, Dan W;

    2006-01-01

    The effect of host infection, chronic clinical disease, and transmission intensity on the patterns of specific antibody responses in Bancroftian filariasis was assessed by analyzing specific IgG1, IgG2, IgG3, IgG4, and IgE profiles among adults from two communities with high and low Wuchereria...... bancrofti endemicity. In the high endemicity community, intensities of the measured antibodies were significantly associated with infection status. IgG1, IgG2, and IgE were negatively associated with microfilaria (MF) status, IgG3 was negatively associated with circulating filarial antigen (CFA) status...

  2. Survey on the Ability of Wolbachia to Control Human Viral, Protozoan, and Filarial Disease Pathogens

    Directory of Open Access Journals (Sweden)

    Garedaghi Yagoob

    2014-04-01

    Full Text Available Objective: Most human filarial nematode parasites and arthropods are hosts for a bacterial endosymbiont, Wolbachia. In filariasis, Wolbachia are required for normal development, fertility, and survival. However, in arthropods, Wolbachia are largely parasitic and can influence development and reproduction, but are generally not required for host survival. Materials and Methods: Due to their obligate nature in filarial parasites, Wolbachia have been a target for drug discovery initiatives using several approaches including diversity and focused library screening and genomic sequence analysis. Results: In vitro and in vivo anti-Wolbachia antibiotic treatments have been shown to have adulticidal activity, a long sought goal of filarial parasite drug discovery. In mosquitoes, it has been shown that the presence of Wolbachia can inhibit the transmission of certain viruses, such as dengue, chikungunya, yellow fever, West Nile, as well as the infectivity of the malaria-causing protozoan, Plasmodium and filarial nematodes. Conclusion: Wolbachia can cause a form of conditional sterility that can be used to suppress populations of mosquitoes and additional medically important insects. Thus, Wolbachia, a pandemic endosymbiont, offers great potential for elimination of a wide-variety of devastating human diseases.

  3. Lymphatic filariasis: Perspectives on lymphatic remodeling and contractile dysfunction in filarial disease pathogenesis

    OpenAIRE

    Chakraborty, Sanjukta; Gurusamy, Manokaran; Zawieja, David C.; Muthuchamy, Mariappan

    2013-01-01

    Lymphatic filariasis, one of the most debilitating diseases associated with the lymphatic system, affects over a hundred million people worldwide and manifests itself in a variety of severe clinical pathologies. The filarial parasites specifically target the lymphatics and impair lymph flow, which is critical for the normal functions of the lymphatic system in maintenance of body fluid balance and physiological interstitial fluid transport. The resultant contractile dysfunction of the lymphat...

  4. The Potentials and Pitfalls of Microarrays in Neglected Tropical Diseases: A Focus on Human Filarial Infections.

    Science.gov (United States)

    Kwarteng, Alexander; Ahuno, Samuel Terkper

    2016-01-01

    Data obtained from expression microarrays enables deeper understanding of the molecular signatures of infectious diseases. It provides rapid and accurate information on how infections affect the clustering of gene expression profiles, pathways and networks that are transcriptionally active during various infection states compared to conventional diagnostic methods, which primarily focus on single genes or proteins. Thus, microarray technologies offer advantages in understanding host-parasite interactions associated with filarial infections. More importantly, the use of these technologies can aid diagnostics and helps translate current genomic research into effective treatment and interventions for filarial infections. Studying immune responses via microarray following infection can yield insight into genetic pathways and networks that can have a profound influence on the development of anti-parasitic vaccines. PMID:27600086

  5. Circulating microbial products and acute phase proteins as markers of pathogenesis in lymphatic filarial disease.

    Directory of Open Access Journals (Sweden)

    R Anuradha

    Full Text Available Lymphatic filariasis can be associated with development of serious pathology in the form of lymphedema, hydrocele, and elephantiasis in a subset of infected patients. Dysregulated host inflammatory responses leading to systemic immune activation are thought to play a central role in filarial disease pathogenesis. We measured the plasma levels of microbial translocation markers, acute phase proteins, and inflammatory cytokines in individuals with chronic filarial pathology with (CP Ag+ or without (CP Ag- active infection; with clinically asymptomatic infections (INF; and in those without infection (endemic normal [EN]. Comparisons between the two actively infected groups (CP Ag+ compared to INF and those without active infection (CP Ag- compared to EN were used preliminarily to identify markers of pathogenesis. Thereafter, we tested for group effects among all the four groups using linear models on the log transformed responses of the markers. Our data suggest that circulating levels of microbial translocation products (lipopolysaccharide and LPS-binding protein, acute phase proteins (haptoglobin and serum amyloid protein-A, and inflammatory cytokines (IL-1β, IL-12, and TNF-α are associated with pathogenesis of disease in lymphatic filarial infection and implicate an important role for circulating microbial products and acute phase proteins.

  6. Filarial and Wolbachia genomics

    OpenAIRE

    Scott, A.L.; Ghedin, E.; Nutman, T B; McReynolds, L A; C. B. Poole; Slatko, B E; Foster, J. M.

    2012-01-01

    Filarial nematode parasites, the causative agents for a spectrum of acute and chronic diseases including lymphatic filariasis and river blindness, threaten the well-being and livelihood of hundreds of millions of people in the developing regions of the world. The 2007 publication on a draft assembly of the 95-Mb genome of the human filarial parasite Brugia malayi – representing the first helminth parasite genome to be sequenced – has been followed in rapid succession by projects that have res...

  7. Altered circulating levels of matrix metalloproteinases and inhibitors associated with elevated type 2 cytokines in lymphatic filarial disease.

    Directory of Open Access Journals (Sweden)

    Rajamanickam Anuradha

    Full Text Available BACKGROUND: Infection with Wuchereria bancrofti can cause severe disease characterized by subcutaneous fibrosis and extracellular matrix remodeling. Matrix metalloproteinases (MMPs are a family of enzymes governing extracellular remodeling by regulating cellular homeostasis, inflammation, and tissue reorganization, while tissue-inhibitors of metalloproteinases (TIMPs are endogenous regulators of MMPs. Homeostatic as well as inflammation-induced balance between MMPs and TIMPs is considered critical in mediating tissue pathology. METHODS: To elucidate the role of MMPs and TIMPs in filarial pathology, we compared the plasma levels of a panel of MMPs, TIMPs, other pro-fibrotic factors, and cytokines in individuals with chronic filarial pathology with (CP Ag+ or without (CP Ag- active infection to those with clinically asymptomatic infections (INF and in those without infection (endemic normal [EN]. Markers of pathogenesis were delineated based on comparisons between the two actively infected groups (CP Ag+ compared to INF and those without active infection (CP Ag- compared to EN. RESULTS AND CONCLUSION: Our data reveal that an increase in circulating levels of MMPs and TIMPs is characteristic of the filarial disease process per se and not of active infection; however, filarial disease with active infection is specifically associated with increased ratios of MMP1/TIMP4 and MMP8/TIMP4 as well as with pro-fibrotic cytokines (IL-5, IL-13 and TGF-β. Our data therefore suggest that while filarial lymphatic disease is characterized by a non-specific increase in plasma MMPs and TIMPs, the balance between MMPs and TIMPs is an important factor in regulating tissue pathology during active infection.

  8. Diagnosis and management of canine claw diseases.

    Science.gov (United States)

    Mueller, R S

    1999-11-01

    The diagnostic workup for canine claw disease consists of a good history and complete clinical examination which may provide clues for a possible underlying disorder. In dogs with claw disease but no other clinical or historical signs, further recommended diagnostic procedures include cytological evaluation of impression smears or discharge from the claw fold, bacterial culture and sensitivity testing, biopsy of the claw matrix, and an elimination diet for 6 to 8 weeks. If no underlying disease can be identified, trial treatment with essential fatty acid supplementation, vitamin E, or a combination of doxycycline hydrochloride and niacinamide may be useful. In some patients, onychectomy of all claws may be considered. PMID:10563005

  9. Filarial abscess in the submandibular region

    OpenAIRE

    Rupinder Kaur; Kandathil Joseph Philip; Laxman, Kumar R; Kanwal Masih

    2013-01-01

    Filariasis is a parasitic infectious disease caused by filarial nematode worms. These worms mainly dwell in subcutaneous tissues and lymphatics of the human host, with a predilection for lower limbs, retroperitoneal tissues, spermatic cord, and epididymis. Oral or perioral involvement of the filarial nematode is rare. This case report describes a filarial abscess in the right submandibular region. Fine needle aspiration cytology of the abscess revealed the presence of microfilaria of Wucherer...

  10. Canine vector-borne diseases in Brazil

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe

    2008-08-01

    Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.

  11. Loop-mediated isothermal amplification applied to filarial parasites detection in the mosquito vectors: Dirofilaria immitis as a study model

    Directory of Open Access Journals (Sweden)

    Nelson Bryce

    2009-03-01

    Full Text Available Abstract Background Despite recent advances in our understanding of the basic biology behind transmission of zoonotic infectious diseases harbored by arthropod vectors these diseases remain threatening public health concerns. For effective control of vector and treatment, precise sampling indicating the prevalence of such diseases is essential. With an aim to develop a quick and simple method to survey zoonotic pathogen-transmitting vectors, LAMP (loop-mediated isothermal amplification was applied to the detection of filarial parasites using a filarial parasite-transmitting experimental model that included one of the mosquito vectors, Aedes aegypti, and the canine heartworm, Dirofilaria immitis. Results LAMP reactions amplifying the cytochrome oxidase subunit I gene demonstrated high sensitivity when a single purified D. immitis microfilaria was detected. Importantly, the robustness of the LAMP reaction was revealed upon identification of an infected mosquito carrying just a single parasite, a level easily overlooked using conventional microscopic analysis. Furthermore, successful detection of D. immitis in wild-caught mosquitoes demonstrated its applicability to field surveys. Conclusion Due to its simplicity, sensitivity, and reliability, LAMP is suggested as an appropriate diagnostic method for routine diagnosis of mosquito vectors carrying filarial parasites. This method can be applied to the survey of not only canine filariasis but also lymphatic filariasis, another major public health problem. Therefore, this method offers great promise as a useful diagnostic method for filarial parasite detection in endemic filariasis regions.

  12. Nutraceuticals for canine liver disease: assessing the evidence.

    Science.gov (United States)

    Vandeweerd, Jean-Michel; Cambier, Carole; Gustin, Pascal

    2013-09-01

    Nutraceuticals, or nutritional supplements, have been promoted for the ancillary treatment of liver disease in dogs. However, minimal information is available in the scientific literature about commonly used nutraceuticals, such as S-adenosylmethionine, silymarin, and vitamin E. No strong clinical evidence exists regarding the efficacy of these compounds as hepatoprotectants in canine liver disease. Until this evidence exists, individual veterinarians must assume responsibility for their decision to use nutritional supplements in their canine patients with liver disease. PMID:23890245

  13. Filarial abscess in the submandibular region

    Directory of Open Access Journals (Sweden)

    Rupinder Kaur

    2013-01-01

    Full Text Available Filariasis is a parasitic infectious disease caused by filarial nematode worms. These worms mainly dwell in subcutaneous tissues and lymphatics of the human host, with a predilection for lower limbs, retroperitoneal tissues, spermatic cord, and epididymis. Oral or perioral involvement of the filarial nematode is rare. This case report describes a filarial abscess in the right submandibular region. Fine needle aspiration cytology of the abscess revealed the presence of microfilaria of Wuchereria bancrofti species. The parasite was also present in the peripheral blood smear. Filarial infection presenting in this region is unusual and can cause diagnostic dilemma. The clinician can consider filariasis as one of the differential diagnosis while treating those abscesses in the orofacial region that are unresponsive to routine management, especially, patients hailing from endemic areas.

  14. Molecular identification of bacteria associated with canine periodontal disease

    OpenAIRE

    Riggio, Marcello P.; Lennon, Alan; Taylor, David J.; Bennett, David

    2011-01-01

    Abstract Periodontal disease is one of the most common diseases of adult dogs, with up to 80% of animals affected. The aetiology of the disease is poorly studied, although bacteria are known to play a major role. The purpose of this study was to identify the bacteria associated with canine gingivitis and periodontitis and to compare this with the normal oral flora. Swabs were obtained from the gingival margin of three dogs with gingivitis and three orally healthy controls, and subg...

  15. "Filarial dance sign" real-time ultrasound diagnosis of filarial oophoritis.

    Science.gov (United States)

    Panditi, Surekha; Shelke, Ashwini G; Thummalakunta, Laxmi Narasimha Praveen

    2016-10-01

    Filariasis is a parasitic disease caused by Filarial nematodes (Wuchereria bancrofti, Brugia malayi, and Brugia timori) that commonly causes lymphatic obstruction resulting in edema and increase in the size of the affected organ. Filariasis is diagnosed by identifying microfilariae on Giemsa stain. The immunochromatographic card test is diagnostic. Ultrasound is the imaging modality of choice for detecting adult filarial worms/microfilaria in the lymphatic system, which are responsible for the classic "filarial dance sign" caused by twirling movements of the microfilariae. © 2016 Wiley Periodicals, Inc. J Clin Ultrasound 44:500-501, 2016. PMID:27130361

  16. Lymphangiosarcoma after filarial infection

    Energy Technology Data Exchange (ETDEWEB)

    Sordillo, E.M.; Sordillo, P.P.; Hajdu, S.I.; Good, R.A.

    1981-03-01

    A case of lymphangiosarcoma of a lower extremity is described in a patient with chronic lymphedema of that leg from a filarial infection in childhood. Histologically, the neoplasm resembled lymphangiosarcomas that arise in arms that become lymphedematous after mastectomies, but was different in that it also contained areas of calcification consistent with prior filarial infection. Calcifications were also present in muscle uninvolved by the lymphangiosarcoma of this case. The prolonged survival of this patient is unlike that of most patients with lymphangiosarcoma, which is generally shorter. Although lymphedema after filariasis is common, this is the first case of a lymphangiosarcoma arising in chronic lymphedema of filarial origin.

  17. Magnetic resonance imaging of canine degenerative lumbar spine diseases

    International Nuclear Information System (INIS)

    Degenerative lumbar spine diseases, i.e., sacrolumbar stenosis, intervertebral disk degeneration and protrusion and spondylosis deformans of the canine lumbar spine were studied in eleven canine patients and three healthy controls using radiography and 0.02 T and 0.04 T low field magnetic resonance imaging. The T1 and T2 weighted images were obtained in sagittal and transverse planes. The loss of hydration of nucleus pulposus, taken as a sign of degeneration in the intervertebral disks, could be evaluated in both T1 and T2 weighted images. As a noninvasive method magnetic resonance imaging gave more exact information about the condition of intervertebral disks than did radiography. Sacrolumbar stenosis and compression of the spinal cord or cauda equina and surrounding tissue could be evaluated without contrast medium

  18. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    Directory of Open Access Journals (Sweden)

    Andrew Specht

    2011-01-01

    Full Text Available A canine model of Glycogen storage disease type Ia (GSDIa is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  19. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    OpenAIRE

    Andrew Specht; Laurie Fiske; Kirsten Erger; Travis Cossette; John Verstegen; Martha Campbell-Thompson; Struck, Maggie B.; Young Mok Lee; Chou, Janice Y.; Byrne, Barry J; Correia, Catherine E.; Mah, Cathryn S.; Weinstein, David A.; Conlon, Thomas J.

    2011-01-01

    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size,...

  20. Wolbachia filarial interactions.

    Science.gov (United States)

    Taylor, Mark J; Voronin, Denis; Johnston, Kelly L; Ford, Louise

    2013-04-01

    Wolbachia pipientis is a widespread intracellular bacterial symbiont of arthropods and is common in insects. One of their more exotic and unexpected hosts is the filarial nematodes, notable for the parasites responsible for onchocerciasis (river blindness), lymphatic filariasis (elephantiasis) and dirofilariasis (heartworm). Wolbachia are only present in a subgroup of the filarial nematodes and do not extend to other groups of nematodes either parasitic or free-living. In the medically and veterinary important species that host Wolbachia, the symbiont has become an essential partner to key biological processes in the life of the nematode to the point where antibiotic elimination of the bacteria leads to a potent and effective anti-filarial drug treatment. We review the cellular and molecular basis of Wolbachia filarial interactions and highlight the key processes provided by the endosymbiont upon which the nematodes have become entirely dependent. This dependency is primarily restricted to periods of the lifecycle with heavy metabolic demands including growth and development of larval stages and embryogenesis in the adult female. Also, the longevity of filarial parasites is compromised following depletion of the symbiont, which for the first time has delivered a safe and effective treatment to kill adult parasites with antibiotics. PMID:23210448

  1. Canine Degenerative Valve Disease: A Case Report

    Directory of Open Access Journals (Sweden)

    Carmenza Janneth Benavides Melo

    2014-07-01

    Full Text Available Degenerative valvular disease or endocardiosis is the most common cardiovascular pathology in dogs. It is characterized by regurgitation of blood into the atria with decreased cardiac output, leading to volume overload with eccentric hypertrophy and congestive heart failure. This report describes the clinical and autopsy findings of a dog, suggestive of valvular endocardiosis. The patient was admitted to the outpatient Veterinary Clinic “Carlos Martínez Hoyos” at the University of Nariño (Pasto, Colombia. His owner said the dog was sick for two months, with signs of respiratory disease, weight loss, and decay. Clinical examination showed very pale mucous membranes, inspiratory dyspnea, rale, split S2, grade 4 mid-systolic murmur of regurgitation, and abdominal dilatation with sign of positive shock wave. Necropsy evidenced plenty of translucent watery material in the abdominal, chest and pericardium cavity, severely enlarged and rounded heart with thickened atrioventricular valves, moderate reduction in liver size and signs of lobulation, severely diminished and pale kidneys with irregular surface showing the presence of multiple cystic areas in corticomedullary region. Samples were taken from these tissues and fixed in 10% buffered formalin to be processed for histopathological analysis at the Laboratory of Pathology at the University of Nariño, using hematoxylin and eosin stain. This way, degenerative valvular disease was diagnosed.

  2. Bancroftian filarial pleural effusion.

    OpenAIRE

    Aggarwal, J.; Kapila, K.; Gaur, A.; Wali, J. P.

    1993-01-01

    This paper describes a case of filarial pleural effusion, the fifth such to be reported. Microfilariae of Wuchereria bancrofti were detected in the pleural fluid on cytological examination. There was a prompt and complete response to treatment with diethylcarbamazine. There were, however, no symptoms and signs of tropical pulmonary eosinophilia nor any peripheral eosinophilia.

  3. Distribution and characterization of canine Chagas disease in Texas.

    Science.gov (United States)

    Kjos, S A; Snowden, K F; Craig, T M; Lewis, B; Ronald, N; Olson, J K

    2008-04-15

    Although acute and chronic cases of canine Chagas disease have been reported from multiple areas in the southern region of the United States, little data are available on current disease occurrence patterns in endemic areas. Therefore, a study to assess frequency, geographic distribution, signalment, and clinical spectrum of Chagas disease in domestic dogs from Texas was conducted. Serology, histopathology, and clinical case records from multiple institutions for the time period 1993-2007 were analyzed. A total of 537 serologically and/or histopathologically confirmed cases were documented. Cases were reported from 48 of 254 counties within Texas, covering all major geographic regions. Forty-eight dog breeds were represented among the cases, primarily in the sporting and working groups. In histopathologically confirmed cases, acute death occurred in 42%, approximately half of which were ecoregions of Texas, affecting a broad range of dog breeds and age groups. PMID:18255233

  4. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio

    2016-08-30

    A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. PMID:27527760

  5. Using the canine genome to cure cancer and other diseases.

    Science.gov (United States)

    Olson, P N

    2007-08-01

    A high-quality draft genome sequence of the domestic dog (Canis familiaris), together with a dense map of single nucleotide polymorphisms, has been reported. Such new tools offer scientists amazing opportunities to define genetic, nutritional, environmental, and other risk factors for various canine diseases. Because many of the diseases that affect man's best friend also affect us, understanding a dog's disease may lead to new preventions and therapies for diseases that affect both dogs and people. Since a dog's life span is shorter than that for a human, monitoring potential risk factors in a well-controlled population of dogs is possible. Such a population should be one where dogs live in close relationship with their owners. Although longitudinal studies have been previously conducted on animals housed in laboratory environments, the natural environment offers a chance to study dogs in environments shared by their owners. If dogs are carefully monitored, and select exposures defined, considerable information could be collected in a dog's lifetime--the next 10-20 years. Such information could hold the clues for important discoveries, including causes and cures for cancer. PMID:17498794

  6. Epidemiological Survey on Canine Parvovirus Disease in Taizhou Region,Jiangsu Province,China

    Institute of Scientific and Technical Information of China (English)

    Yuan; Weifeng; Liu; Jing; Zhao; Xuegang; Lu; Jiang; Zheng; Xiaoliang; Zhu; Hongfei

    2014-01-01

    The canine parvovirus disease is an acute infectious disease caused by canine parvovirus(CPV). It is clinically characterized by severe vomiting,hemorrhagic enteritis,significant reduction in white blood cells and myocarditis. The disease with high incidence,highly infectious and high mortality has become one of the serious infectious diseases threatening dog raising industry in China. In this research,260 cases of canine parvovirus case from an Aite Pet Clinic in Taizhou City during January 2010 and March 2011 were analyzed. This study discloses the epidemiology of CPV in Taizhou region of Jiangsu Province,i. e.,the incidence of CPV and canine motility are closely correlated with age,breed,immune inoculation and season. This study provides useful guide for the clinical treatment of CPV in the future.

  7. Canine brucellosis: Epizootiological characteristics, therapy and control of the disease

    Directory of Open Access Journals (Sweden)

    Radojičić Sonja

    2006-01-01

    Full Text Available The paper describes different aspects of canine brucellosis caused by Brucella canis. The disease is present in a large number of countries all over the world, where it inflicts severe economic damages, in particular in the commercial breeding and major dog breeding facilities. The disease was discovered in 1966 in the United States of America, but there were no data about its presence or distribution in our country until 1999. It was established, following the initial investigations, that the prevalence of the disease is extremely high, and that it amounted to 4.27% among pet dogs in the territory of Belgrade. Investigations of stray dogs in the territory of Podgorica showed that the seroprevalence (an equal titer or higher than 1/200 was 9.37%, while the prevalence among stray dogs in the territory of Belgrade was 10.87%. Data for other parts of Serbia are mostly lacking, and the seroprevalence for stray dogs in the Municipality of Pozarevac amounted to over 15%, while not a single serologically positive case was found among pet dogs. In addition to the epizootiological specificities of the disease established in our country, isolates of B. canis from the territory of Serbia also indicate digressions in the test of resistance to colors with respect to the referent strain RM6/66. All isolates (SR1-SR-7 are resistant to base fuchsine, and it is probable that this characteristic could also be an important epizootiological marker. Even though the isolation of the cause is the most reliable diagnostic method, it is not possible to achieve this in most cases. That is why one of the most important tasks is to define the most ideal tests for the serological diagnostics of the disease, and the obligation of reporting the disease makes it imperative that wider-scale investigations are conducted and that measures are taken toward reducing the number of positive cases in our country. .

  8. Studies on breeding habitats and density of postembryonic immature filarial vector in a filarial endemic area

    Institute of Scientific and Technical Information of China (English)

    Manas Paramanik; Indranil Bhattacharjee; Goutam Chandra

    2012-01-01

    Objective: To obtain a complete and systematic data about the breeding habitats and density of vector immatures (larvae & pupae) in a filarial endemic area. Methods: All the possible permanent and temporary water bodies were surveyed systematically. Four hundred samples were taken in each season from each type of habitats. Sampling was done with a 250 mL dipper and immature mosquitoes were identified following standard keys. Results: In summer, rainy and winter seasons, overall 49.64%, 44.64%, and 28.57% of the habitats were positive for immature filarial vector (Culex quinquefasciatus) respectively; 36.93%, 35.11%, and 21.18%of the samples were positive for immatures respectively and overall per dip densities (PDD) of them were 10.29, 10.18, and 4.40 respectively. In the study year overall PDD were much higher in open cesspits (19.53) and drains (17.24) than in other habitats. Peak PDD of vector immatures in Dobas (ditches), open cesspits and drains were in March whereas in paddy fields and temporary water bodies peak PPD were in September. Conclusion: Dobas, paddy fields, open cesspits, drains, and temporary water bodies were found to be the main breeding sites of filarial vector, Cx. quinquefasciatus in different months. Open cesspits and drains were suitable almost throughout the year with peak in summer. Dobas also act as a steady breeding site throughout the year, whereas temporary water bodies immerge as strong breeding site during pre-monsoon and monsoon seasons. Information about the breeding habitats will be helpful to formulate a filarial vector control strategy and in turn to control the filarial diseases in the study area.

  9. How do the macrocyclic lactones kill filarial nematode larvae?

    Science.gov (United States)

    Wolstenholme, Adrian J; Maclean, Mary J; Coates, Ruby; McCoy, Ciaran J; Reaves, Barbara J

    2016-09-01

    The macrocyclic lactones (MLs) are one of the few classes of drug used in the control of the human filarial infections, onchocerciasis and lymphatic filariasis, and the only one used to prevent heartworm disease in dogs and cats. Despite their importance in preventing filarial diseases, the way in which the MLs work against these parasites is unclear. In vitro measurements of nematode motility have revealed a large discrepancy between the maximum plasma concentrations achieved after drug administration and the amounts required to paralyze worms. Recent evidence has shed new light on the likely functions of the ML target, glutamate-gated chloride channels, in filarial nematodes and supports the hypothesis that the rapid clearance of microfilariae that follows treatment involves the host immune system. PMID:27279086

  10. Nuclear techniques in the study of resistance to filarial infections

    International Nuclear Information System (INIS)

    Filariasis is a vector-borne parasitic disease of major public health importance affecting several millions of people of tropical and sub-tropical regions of the world. There are, at present, no safe and reliable chemotherapeutic agents that act particularly on the infective larvae and adult stages of the filarial parasites. Furthermore, the vectors exhibit considerable resistance to conventional insecticides. Even early diagnosis of the disease presents considerable problems. However, recent studies employing nuclear techniques have contributed significantly to clarifying the host-parasite interactions in lymphatic filariasis, with particular reference to the induction of resistance to the filarial infections. Such knowledge is still not available on other filarial infections pathogenic to man, largely due to lack of suitable animal models. The current information on some of the above aspects is briefly reviewed. (author)

  11. Polyanhydride Nanoparticle Delivery Platform Dramatically Enhances Killing of Filarial Worms.

    Directory of Open Access Journals (Sweden)

    Andrea M Binnebose

    Full Text Available Filarial diseases represent a significant social and economic burden to over 120 million people worldwide and are caused by endoparasites that require the presence of symbiotic bacteria of the genus Wolbachia for fertility and viability of the host parasite. Targeting Wolbachia for elimination is a therapeutic approach that shows promise in the treatment of onchocerciasis and lymphatic filariasis. Here we demonstrate the use of a biodegradable polyanhydride nanoparticle-based platform for the co-delivery of the antibiotic doxycycline with the antiparasitic drug, ivermectin, to reduce microfilarial burden and rapidly kill adult worms. When doxycycline and ivermectin were co-delivered within polyanhydride nanoparticles, effective killing of adult female Brugia malayi filarial worms was achieved with approximately 4,000-fold reduction in the amount of drug used. Additionally the time to death of the macrofilaria was also significantly reduced (five-fold when the anti-filarial drug cocktail was delivered within polyanhydride nanoparticles. We hypothesize that the mechanism behind this dramatically enhanced killing of the macrofilaria is the ability of the polyanhydride nanoparticles to behave as a Trojan horse and penetrate the cuticle, bypassing excretory pumps of B. malayi, and effectively deliver drug directly to both the worm and Wolbachia at high enough microenvironmental concentrations to cause death. These provocative findings may have significant consequences for the reduction in the amount of drug and the length of treatment required for filarial infections in terms of patient compliance and reduced cost of treatment.

  12. Filarial hydropneumothorax: a strange journey.

    Science.gov (United States)

    Chakraborty, Arkaprabha; Mukherjee, Anindya; Talukdar, Payel; Talukdar, Arunansu

    2015-01-01

    Filarial infection can have varied manifestations, but hydropneumothorax at presentation has not yet been reported. A 28-year-old man presented to our hospital with heaviness of the left chest for the past 10 days, which was preceded by a sudden, short stabbing pain in the left chest after straining. Chest X-ray revealed left-sided hydropneumothorax. A peripheral blood picture revealed significant eosinophilia. A pleural fluid report also showed eosinophilia and a few motile microfilaria of Wuchereria bancrofti. Microfilaria was also documented in peripheral blood. There was no evidence of other organ system involvement. The patient was diagnosed with 'Filarial Hydropneumothorax'. After treatment with a temporary chest drain and oral diethylcarbamazine citrate, there was dramatic relief of symptoms and radiological improvement. The patient has been symptom free with no features of recurrence through 8 months of follow-up. PMID:26604240

  13. Controversial results of therapy with mesenchymal stem cells in the acute phase of canine distemper disease.

    Science.gov (United States)

    Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E

    2016-01-01

    Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms. PMID:27323085

  14. Filarial parasites develop faster and reproduce earlier in response to host immune effectors that determine filarial life expectancy.

    Directory of Open Access Journals (Sweden)

    Simon A Babayan

    Full Text Available Humans and other mammals mount vigorous immune assaults against helminth parasites, yet there are intriguing reports that the immune response can enhance rather than impair parasite development. It has been hypothesized that helminths, like many free-living organisms, should optimize their development and reproduction in response to cues predicting future life expectancy. However, immune-dependent development by helminth parasites has so far eluded such evolutionary explanation. By manipulating various arms of the immune response of experimental hosts, we show that filarial nematodes, the parasites responsible for debilitating diseases in humans like river blindness and elephantiasis, accelerate their development in response to the IL-5 driven eosinophilia they encounter when infecting a host. Consequently they produce microfilariae, their transmission stages, earlier and in greater numbers. Eosinophilia is a primary host determinant of filarial life expectancy, operating both at larval and at late adult stages in anatomically and temporally separate locations, and is implicated in vaccine-mediated protection. Filarial nematodes are therefore able to adjust their reproductive schedules in response to an environmental predictor of their probability of survival, as proposed by evolutionary theory, thereby mitigating the effects of the immune attack to which helminths are most susceptible. Enhancing protective immunity against filarial nematodes, for example through vaccination, may be less effective at reducing transmission than would be expected and may, at worst, lead to increased transmission and, hence, pathology.

  15. Toward Molecular Parasitologic Diagnosis: Enhanced Diagnostic Sensitivity for Filarial Infections in Mobile Populations▿

    OpenAIRE

    Fink, Doran L.; Fahle, Gary A.; Fischer, Steven; Fedorko, Daniel F.; Nutman, Thomas B.

    2010-01-01

    The diagnosis of filarial infections among individuals residing in areas where the disease is not endemic requires both strong clinical suspicion and expert training in infrequently practiced parasitological methods. Recently developed filarial molecular diagnostic assays are highly sensitive and specific but have limited availability and have not been closely evaluated for clinical use outside populations residing in areas of endemicity. In this study, we assessed the performance of a panel ...

  16. Heterogeneity in the spread and control of infectious disease: consequences for the elimination of canine rabies

    OpenAIRE

    Ferguson, Elaine A.; Katie Hampson; Sarah Cleaveland; Ramona Consunji; Raffy Deray; John Friar; Haydon, Daniel T; Joji Jimenez; Marlon Pancipane; Townsend, Sunny E

    2015-01-01

    Understanding the factors influencing vaccination campaign effectiveness is vital in designing efficient disease elimination programmes. We investigated the importance of spatial heterogeneity in vaccination coverage and human-mediated dog movements for the elimination of endemic canine rabies by mass dog vaccination in Region VI of the Philippines (Western Visayas). Household survey data was used to parameterise a spatially-explicit rabies transmission model with realistic dog movement and v...

  17. Cloning and sequence analysis of partial genomic DNA coding for HtrA-type serine protease of Wolbachia from human lymphatic filarial parasite, Wuchereria bancrofti

    OpenAIRE

    Dhamodharan, R.; Hoti, SL; Sivapragasam, G; Das, MK

    2011-01-01

    Background: Periplasmic serine proteases of HtrA type of Wolbachia have been shown to play a role in the pathogenesis of filarial disease. Aims: This study was aimed to sequence Wb-HtrA serine protease and analyze its phylogenetic position by comparing with other filarial and non-filarial nematode homologs. Materials and Methods: Partial HtrA gene fragment was amplified from DNA isolated from periodic and sub-periodic Wuchereria bancrofti parasites collected from Pondicherry and Nicobar islan...

  18. Filarial elephantiasis of penis: a crippling manifestation.

    Science.gov (United States)

    Rakesh, K; Kumar, M V; Anant, K; Ashutosh, T

    1991-09-01

    Filarial involvement of penis in endemic areas is not an uncommon entity. In the late stage it may lead to crippling "ramhorn" penis. A case of filarial penis is presented which was successfully managed by split thickness free graft. PMID:1953079

  19. Canine breeds at high risk of developing inflammatory bowel disease in the south-eastern UK.

    Science.gov (United States)

    Kathrani, A; Werling, D; Allenspach, K

    2011-12-10

    Genetics are an important factor in the development of human inflammatory bowel disease (IBD); however, there is very little information available regarding the role of genetics in canine IBD. The purpose of this study was to gather information about which canine breeds in the south-eastern UK are at a high risk for developing IBD. Determination of such breeds may help further genetic research in this complex disease. The computer medical records at the Queen Mother Hospital for Animals, Royal Veterinary College dating from August 1, 2003 to December 31, 2009 were retrospectively searched for cases diagnosed with IBD. Five hundred and forty-six dogs with IBD were identified, representing 86 different breeds. The comparison group consisted of all dogs from these same 86 breeds without IBD admitted to the hospital during the same period that amounted to 27,463 dogs. The breeds at significantly higher risk of developing IBD compared with mixed-breed dogs consisted of weimaraner (odds ratio [OR]=3.6797, 95 per cent confidence interval [CI]=2.0167 to 6.7141, Pborder collie (OR=1.9936, 95 per cent CI=1.1655 to 3.4101, P=0.0118) and boxer (OR=1.6961, 95 per cent CI=1.0441 to 2.755, P=0.0328). This study demonstrates for the first time canine breeds in the south-eastern UK that are highly susceptible to developing IBD. Identification of such breeds may allow for a more focused investigation of genetic mutations associated with canine IBD. PMID:21896567

  20. Efficacy of canine influenza virus (H3N8) vaccine to decrease severity of clinical disease after co-challenge with canine influenza virus and Streptococcus equi subsp. Zooepidemicus

    Science.gov (United States)

    Since first emerging into the North American canine population in 2004, canine influenza virus (CIV) subtype H3N8 has shown horizontal transmission among dogs, with a high level of adaptation to this species. Severity of disease is variable, and co-infection by other respiratory pathogens is an impo...

  1. Canine Leishmaniasis, Italy

    OpenAIRE

    Ferroglio, Ezio; Maroli, Michele; Gastaldo, Silvia; Mignone, Walter; Rossi, Luca

    2005-01-01

    We report the results of a survey to determine the prevalence of canine leishmaniasis and the presence of sand flies in northwestern Italy, where autochthonous foci of canine leishmaniasis have not been reported. Active foci of canine leishmaniasis were identified, which suggests that the disease is now also endemic in continental climate areas.

  2. Regenerative and fibrotic pathways in canine liver disease

    NARCIS (Netherlands)

    Spee, Bart

    2006-01-01

    Liver diseases occur quite frequently in dogs; the overall incidence in dogs has been estimated around 1-2% of the clinical cases. Most liver diseases are, like in humans, chronic and occur through chronic inflammation due to different causes. In all cases the on-going liver cell damage leads to a r

  3. The canine hepatic progenitor cell niche: molecular characterisation in health and disease.

    Science.gov (United States)

    Kruitwagen, H S; Spee, B; Viebahn, C S; Venema, H B; Penning, L C; Grinwis, G C M; Favier, R P; van den Ingh, T S G A M; Rothuizen, J; Schotanus, B A

    2014-09-01

    Hepatic progenitor cells (HPCs) are an adult stem cell compartment in the liver that contributes to liver regeneration when replication of mature hepatocytes is insufficient. In this study, laser microdissection was used to isolate HPC niches from the livers of healthy dogs and dogs with lobular dissecting hepatitis (LDH), in which HPCs are massively activated. Gene expression of HPC, hepatocyte and biliary markers was determined by quantitative reverse transcriptase PCR. Expression and localisation of selected markers were further studied at the protein level by immunohistochemistry and immunofluorescent double staining in samples of normal liver and liver from dogs with LDH, acute and chronic hepatitis, and extrahepatic cholestasis. Activated HPC niches had higher gene expression of the hepatic progenitor markers OPN, FN14, CD29, CD44, CD133, LIF, LIFR and BMI1 compared to HPCs from normal liver. There was lower expression of albumin, but activated HPC niches were positive for the biliary markers SOX9, HNF1β and keratin 19 by immunohistochemistry and immunofluorescence. Laminin, activated stellate cells and macrophages are abundant extracellular matrix and cellular components of the canine HPC niche. This study demonstrates that the molecular and cellular characteristics of canine HPCs are similar to rodent and human HPCs, and that canine HPCs are distinctively activated in different types of liver disease. PMID:24923752

  4. Decision making in the management of canine intervertebral disc disease

    International Nuclear Information System (INIS)

    Intervertebral disc disease is a frequent disorder of dogs; it is only rarely a cause of clinical signs in cats. Most clinicians are familiar with the diagnosis of the condition, but there may be some confusion about the most appropriate methods of treatment. While there is some controversy regarding certain regimens, particularly involving unconventional methods, there is a large amount of data in the veterinary literature concerning the disease. This article draws on this data to present guidelines which can be used in selecting the most appropriate method of treatment for individual patients

  5. Regenerative and fibrotic pathways in canine liver disease

    OpenAIRE

    Spee, Bart

    2006-01-01

    Liver diseases occur quite frequently in dogs; the overall incidence in dogs has been estimated around 1-2% of the clinical cases. Most liver diseases are, like in humans, chronic and occur through chronic inflammation due to different causes. In all cases the on-going liver cell damage leads to a reduction of the functional liver cell mass and progressive deposition of fibrous tissue in the liver. These two phenomena, atrophy and fibrosis, are two sides of one medal and go hand in hand to ca...

  6. ACUTE FILARIAL INFECTION PRESENTING WITH FITS AND A LTERED SENSORIUM- RARE PRESENTATION. A CASE REPORT

    Directory of Open Access Journals (Sweden)

    Mona

    2013-05-01

    Full Text Available INTRODUCTION: Filarial worms are nematodes that live in lymphatic s and subcutaneous tissues. Eight filarial species are known to infect humans out of which most serious filarial infections are caused mostly by four parasites like Wuchereria bancrofti, Brugia malayi, Onchocerca volvulus and Loa loa. These parasites ar e transmitted by specific species of mosquitoes or other arthropods. The clinical manife stations of filarial diseases develop relatively slowly, these infections should be consi dered to induce chronic diseases with possible long- term debilitating effects. Characteristically , filarial disease is more acute and intense in newly exposed individuals than in natives of endemic areas. [1] Lymphatic filariasis (LF causes lymphoedema, hydrocele and acute attacks of dermato- lymphangio-adenitis. [2] It represents a major public health problem in tropical and subtropical regions of the world. [3] It is mainly a disease of the adult and older age-classes and appear s to be more prevalent in males. [4] Lymphatic filariasis is a major tropical disease aff ecting approximately 120 million people worldwide. India contributes about 40% of the tota l global burden and accounts for about 50% of the people at the risk of infection. A recent sur vey has shown that out of the 25 States/Union territories in India, 22 are endemic and nine state s (Andhra Pradesh, Bihar, Gujarat, Kerala, Maharashtra, Orissa, Tamil Nadu, Utter Pradesh and West Bengal contribute to about 95% of total burden. W. bancrofti is the predominant species accounting for about 98% of the national burden. [5

  7. Canine stage 1 periodontal disease: a latent pathology.

    Science.gov (United States)

    Whyte, A; Bonastre, C; Monteagudo, L V; Les, F; Obon, J; Whyte, J; Tejedor, M T

    2014-07-01

    To evaluate the potential health issues associated with periodontal disease (PD) in dogs, 1004 teeth from 25 dogs were examined. The dogs were randomly selected, aged 2-14 years, and had at least 95% of their teeth at the first PD stage. Significant positive correlations between plaque grade (PG) and gum inflammation, gingival regression, periodontal pocket, age and serum alanine aminotransferase (ALT) activity were identified. In contrast, PG was negatively correlated to total platelet count. Altogether, these findings suggest that prevention and therapy at the first PD stages can have an important impact on the general health condition of dogs. PMID:24878263

  8. 犬细小病毒病的诊治%Diagnosis and Treatment of Canine Parvovirus Disease

    Institute of Scientific and Technical Information of China (English)

    崔继东; 王权

    2012-01-01

    Infection sources, pathogen characteristics and epidemic situation of canine parvovirus disease were introduced, the diagnosis method was proposed, and then the prevention and treatment measures were put forward, so as to provide references for the control of canine parvovirus disease.%介绍了犬细小病毒病的传染源、病原特点及流行情况,提出其诊断方法,并总结了预防与治疗措施,以期为犬细小病毒病的防治提供参考。

  9. Respiratory disease outbreak in a veterinary hospital associated with canine parainfluenza virus infection

    OpenAIRE

    Weese, J Scott; Stull, Jason

    2013-01-01

    A cluster of canine parainfluenza virus infections was identified in a veterinary referral hospital. While hospital-associated outbreaks of canine parainfluenza virus infection have not been previously reported, veterinary hospitals possess some of the same risk factors that may be present in traditional high-risk sites such as kennels. Hospital-associated transmission of canine respiratory pathogens, therefore, must be considered.

  10. Doxycycline Improves Filarial Lymphedema Independent of Active Filarial Infection: A Randomized Controlled Trial

    OpenAIRE

    Mand, S; DEBRAH, A Y; Klarmann, U; Batsa, L.; Marfo-Debrekyei, Y.; Kwarteng, A; S. SPECHT; Belda-Domene, A.; Fimmers, R; Taylor, M; Adjei, O.; Hoerauf, A.

    2012-01-01

    Treatment with doxycycline leads to improvement of filarial lymphedema independent of active infection (ie, patients positive or negative for circulating filarial antigen). Therefore, doxycycline (200 mg/d for 6 weeks) should be considered for patients with stage 1–3 lymphedema to improve morbidity management.

  11. Molecular survey of canine vector-borne diseases in stray dogs in Thailand.

    Science.gov (United States)

    Liu, Mingming; Ruttayaporn, Ngasaman; Saechan, Vannarat; Jirapattharasate, Charoonluk; Vudriko, Patrick; Moumouni, Paul Franck Adjou; Cao, Shinuo; Inpankaew, Tawin; Ybañez, Adrian P; Suzuki, Hiroshi; Xuan, Xuenan

    2016-08-01

    Despite the large population of stray dogs in Thailand, there is limited information on the prevalence of canine vector-borne diseases (CVBDs). In this study, a molecular survey was conducted to determine the prevalence of Babesia spp., Ehrlichia canis, Hepatozoon spp., Anaplasma platys and Mycoplasma spp. in dogs in Thailand. Of the 181 dog blood samples tested by PCR, 78/181 (43.1%) were found to be infected with one or more pathogens. The overall prevalence rates of Mycoplasma spp., Hepatozoon spp., Babesia spp., A. platys and E. canis infections were 19.9%, 18.8%, 9.4%, 4.4% and 3.9%, respectively. To the authors' knowledge, this is the first report of Mycoplasma infection in Thailand in dogs. The current findings are important for future surveillance of CVBDs and designing appropriate approaches for diagnosis and control for the diseases in Thailand. PMID:27143604

  12. Dimethylnitrosamine-induced hepatotoxicosis in dogs as a model of progressive canine hepatic disease.

    Science.gov (United States)

    Boothe, D M; Jenkins, W L; Green, R A; Corrier, D E; Cullen, J M; Boothe, H W; Weise, D

    1992-03-01

    A model of toxin-induced progressive hepatitis is described in Beagles. The toxin, dimethylnitrosamine, was administered orally to 18 Beagles; 6 dogs comprised a control group. Clinical signs and laboratory test results were monitored as disease progressed and were used to determine the end point of disease. Following euthanasia, histologic lesions were scored and used to derive a total severity score for each dog. Severity scores were then used to allot the 18 dogs to 3 groups of hepatic disease, defined as mild, moderate, or severe. Changes in clinical laboratory test results, including tests of hepatic function, and clinical signs indicative of liver disease were described chronologically for all dogs. Group means of clinical laboratory test results and quantifiable clinical signs (eg, weight loss and ascitic fluid accumulation) were compared. This model offers several advantages, compared with other experimental models of canine hepatic disease. These include hepatospecificity, similarity to natural disease (eg, the development of multiple extrahepatic portosystemic shunts), and the ability to titrate the disease to a desired end point. The major disadvantages of this model were the toxic nature of the drug to human beings and the variation in individual animal response to the toxin, which precludes preassignment of animals into groups. PMID:1595969

  13. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas

    2014-11-01

    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  14. 犬细小病毒病诊断及防治%Diagnosis, Prevention and Treament of Canine Parvovirus Disease

    Institute of Scientific and Technical Information of China (English)

    孙彦锋; 崔战领

    2014-01-01

    The prevalence characteristics and clinical symptoms of canine parvovirus were analyzed. The pathologic characteristics of canine parvovirus and its diagnosis and treatment methods were discussed. And some concrete measures were proposed for preventing and curing this disease.%通过分析犬细小病毒病的流行特点和临床症状,探讨了犬细小病毒病的病理特征、诊断和治疗方法,并提出了预防和对症治疗的具体措施,以供参考。

  15. Surveillance of zoonotic and infectious diseases in Ecuador: implications for special operations forces medical operations, personnel, and canines.

    Science.gov (United States)

    McCown, Michael; Monterroso, Victor H; Grzeszak, Benjamin

    2011-01-01

    Vector-borne diseases (VBD) make up a large number of emerging infectious and zoonotic diseases. Ticks, fleas, and mosquitoes are effective vectors parasitizing canines, making dogs adequate reservoirs for zoonoses. The U.S. military deploys personnel and government-owned animals around the world with possible risk of exposure to VBD. Canine VBD have veterinary and public health significance for the host nations as well as for the U.S. troops and its working animals deployed in the theater of operations. These factors make disease surveillance a great importance. The objective of this work was to survey canines from the cities of Manta and Guayaquil in Ecuador to determine prevalence of heartworm disease (D. immitis), ehrlichi os is (E. canis), Lyme disease (B. burgdorf eri), and anapl asmosis (A. phagocytophilum). Canine blood samples (1-3ml) collected from the cities of Manta (n=50) and Guayaquil (n=50) were tested on site using a SNAPR 4DxR Test Kit. Prevalence for single or multiple disease status was calculated for each city. In the city of Manta the overall prevalence of diseases was 78%; 52% for E. canis alone, and 26% for co-infection with E. canis and A. phagocytophilum. The overall prevalence for the city of Guayaquil was 88%; 40% for E. canis alone, 22% for A. phagocytophilum alone, and 26% for co-infection with E. canis and A. phagocytophilum. Neither heartworm disease nor Lyme disease was detected in any samp le. In conclusion, this study showed the extensive presence of E. canis and A. phagocytophilum in both cities in Ecuador, emphasizing the value of surveillance for zoonotic diseases to determine disease prevalence and risk assessments, as well as to implement control measures. PMID:22173599

  16. Filarial worms reduce Plasmodium infectivity in mosquitoes.

    Directory of Open Access Journals (Sweden)

    Matthew T Aliota

    Full Text Available BACKGROUND: Co-occurrence of malaria and filarial worm parasites has been reported, but little is known about the interaction between filarial worm and malaria parasites with the same Anopheles vector. Herein, we present data evaluating the interaction between Wuchereria bancrofti and Anopheles punctulatus in Papua New Guinea (PNG. Our field studies in PNG demonstrated that An. punctulatus utilizes the melanization immune response as a natural mechanism of filarial worm resistance against invading W. bancrofti microfilariae. We then conducted laboratory studies utilizing the mosquitoes Armigeres subalbatus and Aedes aegypti and the parasites Brugia malayi, Brugia pahangi, Dirofilaria immitis, and Plasmodium gallinaceum to evaluate the hypothesis that immune activation and/or development by filarial worms negatively impact Plasmodium development in co-infected mosquitoes. Ar. subalbatus used in this study are natural vectors of P. gallinaceum and B. pahangi and they are naturally refractory to B. malayi (melanization-based refractoriness. METHODOLOGY/PRINCIPAL FINDINGS: Mosquitoes were dissected and Plasmodium development was analyzed six days after blood feeding on either P. gallinaceum alone or after taking a bloodmeal containing both P. gallinaceum and B. malayi or a bloodmeal containing both P. gallinaceum and B. pahangi. There was a significant reduction in the prevalence and mean intensity of Plasmodium infections in two species of mosquito that had dual infections as compared to those mosquitoes that were infected with Plasmodium alone, and was independent of whether the mosquito had a melanization immune response to the filarial worm or not. However, there was no reduction in Plasmodium development when filarial worms were present in the bloodmeal (D. immitis but midgut penetration was absent, suggesting that factors associated with penetration of the midgut by filarial worms likely are responsible for the observed reduction in malaria

  17. Canine vector-borne diseases in India: a review of the literature and identification of existing knowledge gaps

    Directory of Open Access Journals (Sweden)

    Coleman Glen T

    2010-04-01

    Full Text Available Abstract Despite the combination of favourable climate for parasites and vectors, and large populations of stray dogs, information concerning the epidemiology, diagnosis and management of canine vector-borne diseases in India is limited. However, with the country's expanding economy and adaptation to western culture, higher expectations and demands are being placed on veterinary surgeons for improved knowledge of diseases and control. This review aims to provide an overview of the current state of knowledge of these diseases in India and identify existing knowledge gaps in the literature which need to be addressed. The available literature on this subject, although limited, suggests that a number of canine vector-borne diseases such as filariasis, babesiosis and ehrlichiosis are endemic throughout India, as diagnosed mostly by morphological methods. Detailed investigations of the epidemiology and zoonotic potential of these pathogens has been neglected. Further study is essential to develop a better understanding of the diversity of canine vector-borne diseases in India, and their significance for veterinary and public health.

  18. Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection

    Science.gov (United States)

    Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas

    2016-01-01

    The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target. PMID:27446935

  19. Expression Profiling of Circulating MicroRNAs in Canine Myxomatous Mitral Valve Disease

    Directory of Open Access Journals (Sweden)

    Qinghong Li

    2015-06-01

    Full Text Available MicroRNAs (miRNAs are small non-coding RNAs that have shown promise as noninvasive biomarkers in cardiac disease. This study was undertaken to investigate the miRNA expression profile in dogs with myxomatous mitral valve disease (MMVD. 277 miRNAs were quantified using RT-qPCR from six normal dogs (American College of Veterinary Internal Medicine Stage A, six dogs with MMVD mild to moderate cardiac enlargement (ACVIM Stage B1/B2 and six dogs with MMVD and congestive heart failure (ACVIM Stage C/D. Eleven miRNAs were differentially expressed (False Discovery Rate < 0.05. Dogs in Stage B1/B2 or C/D had four upregulated miRNAs, including three cfa-let-7/cfa-miR-98 family members, while seven others were downregulated, compared to Stage A. Expression of six of the 11 miRNAs also were significantly different between dogs in Stage C/D and those in Stage B1/B2. The expression changes were greater as disease severity increased. These miRNAs may be candidates for novel biomarkers and may provide insights into genetic regulatory pathways in canine MMVD.

  20. Mosquito infection responses to developing filarial worms.

    Directory of Open Access Journals (Sweden)

    Sara M Erickson

    Full Text Available Human lymphatic filariasis is a mosquito-vectored disease caused by the nematode parasites Wuchereria bancrofti, Brugia malayi and Brugia timori. These are relatively large roundworms that can cause considerable damage in compatible mosquito vectors. In order to assess how mosquitoes respond to infection in compatible mosquito-filarial worm associations, microarray analysis was used to evaluate transcriptome changes in Aedes aegypti at various times during B. malayi development. Changes in transcript abundance in response to the different stages of B. malayi infection were diverse. At the early stages of midgut and thoracic muscle cell penetration, a greater number of genes were repressed compared to those that were induced (20 vs. 8. The non-feeding, intracellular first-stage larvae elicited few differences, with 4 transcripts showing an increased and 9 a decreased abundance relative to controls. Several cecropin transcripts increased in abundance after parasites molted to second-stage larvae. However, the greatest number of transcripts changed in abundance after larvae molted to third-stage larvae and migrated to the head and proboscis (120 induced, 38 repressed, including a large number of putative, immunity-related genes (approximately 13% of genes with predicted functions. To test whether the innate immune system of mosquitoes was capable of modulating permissiveness to the parasite, we activated the Toll and Imd pathway controlled rel family transcription factors Rel1 and Rel2 (by RNA interference knockdown of the pathway's negative regulators Cactus and Caspar during the early stages of infection with B. malayi. The activation of either of these immune signaling pathways, or knockdown of the Toll pathway, did not affect B. malayi in Ae. aegypti. The possibility of LF parasites evading mosquito immune responses during successful development is discussed.

  1. Canine muscle cell culture and consecutive patch-clamp measurements - a new approach to characterize muscular diseases in dogs

    OpenAIRE

    Schenk Henning Christian; Krampfl Klaus; Baumgärtner Wolfgang; Tipold Andrea

    2012-01-01

    Abstract Background The recognition of functional muscular disorders, (e.g. channelopathies like Myotonia) is rising in veterinary neurology. Morphologic (e.g. histology) and even genetic based studies in these diseases are not able to elucidate the functional pathomechanism. As there is a deficit of knowledge and skills considering this special task, the aim of the current pilot study was to develop a canine muscle cell culture system derived from muscle biopsies of healthy client-owned dogs...

  2. Evaluation of AAV-mediated Gene Therapy for Central Nervous System Disease in Canine Mucopolysaccharidosis VII.

    Science.gov (United States)

    Gurda, Brittney L; De Guilhem De Lataillade, Adrien; Bell, Peter; Zhu, Yanqing; Yu, Hongwei; Wang, Ping; Bagel, Jessica; Vite, Charles H; Sikora, Tracey; Hinderer, Christian; Calcedo, Roberto; Yox, Alexander D; Steet, Richard A; Ruane, Therese; O'Donnell, Patricia; Gao, Guangping; Wilson, James M; Casal, Margret; Ponder, Katherine P; Haskins, Mark E

    2016-02-01

    Mucopolysaccharidosis VII (MPS VII) is a lysosomal storage disease arising from mutations in β-d-glucuronidase (GUSB), which results in glycosaminoglycan (GAG) accumulation and a variety of clinical manifestations including neurological disease. Herein, MPS VII dogs were injected intravenously (i.v.) and/or intrathecally (i.t.) via the cisterna magna with AAV9 or AAVrh10 vectors carrying the canine GUSB cDNA. Although i.v. injection alone at 3 days of age resulted in normal cerebrospinal fluid (CSF) GUSB activity, brain tissue homogenates had only ~1 to 6% normal GUSB activity and continued to have elevated GAG storage. In contrast, i.t. injection at 3 weeks of age resulted in CSF GUSB activity 44-fold normal while brain tissue homogenates had >100% normal GUSB activity and reduced GAGs compared with untreated dogs. Markers for secondary storage and inflammation were eliminated in i.t.-treated dogs and reduced in i.v.-treated dogs compared with untreated dogs. Given that i.t.-treated dogs expressed higher levels of GUSB in the CNS tissues compared to those treated i.v., we conclude that i.t. injection of AAV9 or AAVrh10 vectors is more effective than i.v. injection alone in the large animal model of MPS VII. PMID:26447927

  3. Heterogeneity in the spread and control of infectious disease: consequences for the elimination of canine rabies

    Science.gov (United States)

    Ferguson, Elaine A.; Hampson, Katie; Cleaveland, Sarah; Consunji, Ramona; Deray, Raffy; Friar, John; Haydon, Daniel T.; Jimenez, Joji; Pancipane, Marlon; Townsend, Sunny E.

    2015-12-01

    Understanding the factors influencing vaccination campaign effectiveness is vital in designing efficient disease elimination programmes. We investigated the importance of spatial heterogeneity in vaccination coverage and human-mediated dog movements for the elimination of endemic canine rabies by mass dog vaccination in Region VI of the Philippines (Western Visayas). Household survey data was used to parameterise a spatially-explicit rabies transmission model with realistic dog movement and vaccination coverage scenarios, assuming a basic reproduction number for rabies drawn from the literature. This showed that heterogeneous vaccination reduces elimination prospects relative to homogeneous vaccination at the same overall level. Had the three vaccination campaigns completed in Region VI in 2010-2012 been homogeneous, they would have eliminated rabies with high probability. However, given the observed heterogeneity, three further campaigns may be required to achieve elimination with probability 0.95. We recommend that heterogeneity be reduced in future campaigns through targeted efforts in low coverage areas, even at the expense of reduced coverage in previously high coverage areas. Reported human-mediated dog movements did not reduce elimination probability, so expending limited resources on restricting dog movements is unnecessary in this endemic setting. Enhanced surveillance will be necessary post-elimination, however, given the reintroduction risk from long-distance dog movements.

  4. Progress and impact of 13 years of the global programme to eliminate lymphatic filariasis on reducing the burden of filarial disease.

    Directory of Open Access Journals (Sweden)

    K D Ramaiah

    2014-11-01

    Full Text Available A Global Programme to Eliminate Lymphatic Filariasis was launched in 2000, with mass drug administration (MDA as the core strategy of the programme. After completing 13 years of operations through 2012 and with MDA in place in 55 of 73 endemic countries, the impact of the MDA programme on microfilaraemia, hydrocele and lymphedema is in need of being assessed.During 2000-2012, the MDA programme made remarkable achievements - a total of 6.37 billion treatments were offered and an estimated 4.45 billion treatments were consumed by the population living in endemic areas. Using a model based on empirical observations of the effects of treatment on clinical manifestations, it is estimated that 96.71 million LF cases, including 79.20 million microfilaria carriers, 18.73 million hydrocele cases and a minimum of 5.49 million lymphedema cases have been prevented or cured during this period. Consequently, the global prevalence of LF is calculated to have fallen by 59%, from 3.55% to 1.47%. The fall was highest for microfilaraemia prevalence (68%, followed by 49% in hydrocele prevalence and 25% in lymphedema prevalence. It is estimated that, currently, i.e. after 13 years of the MDA programme, there are still an estimated 67.88 million LF cases that include 36.45 million microfilaria carriers, 19.43 million hydrocele cases and 16.68 million lymphedema cases.The MDA programme has resulted in significant reduction of the LF burden. Extension of MDA to all at-risk countries and to all regions within those countries where MDA has not yet reached 100% geographic coverage is imperative to further reduce the number of microfilaraemia and chronic disease cases and to reach the global target of interrupting transmission of LF by 2020.

  5. Molecular epidemiology, phylogeny and evolution of the filarial nematode Wuchereria bancrofti.

    Science.gov (United States)

    Small, Scott T; Tisch, Daniel J; Zimmerman, Peter A

    2014-12-01

    Wuchereria bancrofti (Wb) is the most widely distributed of the three nematodes known to cause lymphatic filariasis (LF), the other two being Brugia malayi and Brugia timori. Current tools available to monitor LF are limited to diagnostic tests targeting DNA repeats, filarial antigens, and anti-filarial antibodies. While these tools are useful for detection and surveillance, elimination programs have yet to take full advantage of molecular typing for inferring infection history, strain fingerprinting, and evolution. To date, molecular typing approaches have included whole mitochondrial genomes, genotyping, targeted sequencing, and random amplified polymorphic DNA (RAPDs). These studies have revealed much about Wb biology. For example, in one study in Papua New Guinea researchers identified 5 major strains that were widespread and many minor strains some of which exhibit geographic stratification. Genome data, while rare, has been utilized to reconstruct evolutionary relationships among taxa of the Onchocercidae (the clade of filarial nematodes) and identify gene synteny. Their phylogeny reveals that speciation from the common ancestor of both B. malayi and Wb occurred around 5-6 millions years ago with shared ancestry to other filarial nematodes as recent as 15 million years ago. These discoveries hold promise for gene discovery and identifying drug targets in species that are more amenable to in vivo experiments. Continued technological developments in whole genome sequencing and data analysis will likely replace many other forms of molecular typing, multiplying the amount of data available on population structure, genetic diversity, and phylogenetics. Once widely available, the addition of population genetic data from genomic studies should hasten the elimination of LF parasites like Wb. Infectious disease control programs have benefited greatly from population genetics data and recently from population genomics data. However, while there is currently a surplus

  6. Prevention and Treatment of Canine Leptospirosis Disease%犬钩端螺旋体病的防治措施

    Institute of Scientific and Technical Information of China (English)

    王飞; 刘士国

    2015-01-01

    The pathogen,epidemiolo-gy,clinical symptoms,necropsy lesions and diagnosis methods of canine lep-tospirosis disease were elaborated,and some prevention measures were proposed to provide a reference for the prevention and treatment of this disease.%阐述了犬钩端螺旋体病的病原、流行病学、临床症状、病理变化、诊断方法,并提出了相应的防治措施,旨在为该病的防治提供参考。

  7. Cloning and sequence analysis of partial genomic DNA coding for HtrA-type serine protease of Wolbachia from human lymphatic filarial parasite, Wuchereria bancrofti

    Science.gov (United States)

    Dhamodharan, R; Hoti, SL; Sivapragasam, G; Das, MK

    2011-01-01

    Background: Periplasmic serine proteases of HtrA type of Wolbachia have been shown to play a role in the pathogenesis of filarial disease. Aims: This study was aimed to sequence Wb-HtrA serine protease and analyze its phylogenetic position by comparing with other filarial and non-filarial nematode homologs. Materials and Methods: Partial HtrA gene fragment was amplified from DNA isolated from periodic and sub-periodic Wuchereria bancrofti parasites collected from Pondicherry and Nicobar islands, respectively. The amplicons were sequenced, and sequence homology and phylogenetic relationship with other filarial and non-filarial nematodes were analyzed. Results: Partial orthologue of HtrA-type serine protease from Wolbachia of W. bancrofti was amplified, cloned and sequenced. The deduced amino acid sequence exhibited 87%, 81% and 74% identity with the homologous Wolbachia proteases identified from Brugia malayi, Onchocerca volvulus and Drosophila melanogaster, respectively. The Wb-HtrA has arthologues in several proteobacteria with very high homology and hence is highly conserved not only among Wolbachia of filarial parasites but also across proteobacteria. The phylogenetic tree constructed using Neighbor-Joining method showed two main clusters: cluster-I containing bacteria that dwell in diverse habitats such as soil, fresh and marine waters and plants and cluster-II comprising Anaplasma sp. and Erlichia, and Wolbachia endosymbionts of insects and nematodes, in distinct groups. Conclusions: HtrA-type serine protease from Wolbachia of W. bancrofti is highly conserved among filarial parasites. It will be of interest to know whether filarial Wolbachia HtrA type of serine protease might influence apoptosis and lymphatic epithelium, thereby playing a role in the filarial pathogenesis. Such information will be useful for identifying targets for the development of newer drugs for filariasis treatment, especially for preventing lymphatic pathology. PMID:23508470

  8. Newcastle Disease Virus: Potential Therapeutic Application for Human and Canine Lymphoma

    Directory of Open Access Journals (Sweden)

    Diana Sánchez

    2015-12-01

    Full Text Available Research on oncolytic viruses has mostly been directed towards the treatment of solid tumors, which has yielded limited information regarding their activity in hematological cancer. It has also been directed towards the treatment of humans, yet veterinary medicine may also benefit. Several strains of the Newcastle disease virus (NDV have been used as oncolytics in vitro and in a number of in vivo experiments. We studied the cytolytic effect of NDV-MLS, a low virulence attenuated lentogenic strain, on a human large B-cell lymphoma cell line (SU-DHL-4, as well as on primary canine-derived B-cell lymphoma cells, and compared them to healthy peripheral blood mononuclear cells (PBMC from both humans and dogs. NDV-MLS reduced cell survival in both human (42% ± 5% and dog (34% ± 12% lymphoma cells as compared to untreated controls. No significant effect on PBMC was seen. Cell death involved apoptosis as documented by flow-cytometry. NDV-MLS infections of malignant lymphoma tumors in vivo in dogs were confirmed by electron microscopy. Early (24 h biodistribution of intravenous injection of 1 × 1012 TCID50 (tissue culture infective dose in a dog with T-cell lymphoma showed viral localization only in the kidney, the salivary gland, the lung and the stomach by immunohistochemistry and/or endpoint PCR. We conclude that NDV-MLS may be a promising agent for the treatment of lymphomas. Future research is needed to elucidate the optimal therapeutic regimen and establish appropriate biosafety measures.

  9. Newcastle Disease Virus: Potential Therapeutic Application for Human and Canine Lymphoma.

    Science.gov (United States)

    Sánchez, Diana; Pelayo, Rosana; Medina, Luis Alberto; Vadillo, Eduardo; Sánchez, Rogelio; Núñez, Luis; Cesarman-Maus, Gabriela; Sarmiento-Silva, Rosa Elena

    2016-01-01

    Research on oncolytic viruses has mostly been directed towards the treatment of solid tumors, which has yielded limited information regarding their activity in hematological cancer. It has also been directed towards the treatment of humans, yet veterinary medicine may also benefit. Several strains of the Newcastle disease virus (NDV) have been used as oncolytics in vitro and in a number of in vivo experiments. We studied the cytolytic effect of NDV-MLS, a low virulence attenuated lentogenic strain, on a human large B-cell lymphoma cell line (SU-DHL-4), as well as on primary canine-derived B-cell lymphoma cells, and compared them to healthy peripheral blood mononuclear cells (PBMC) from both humans and dogs. NDV-MLS reduced cell survival in both human (42% ± 5%) and dog (34% ± 12%) lymphoma cells as compared to untreated controls. No significant effect on PBMC was seen. Cell death involved apoptosis as documented by flow-cytometry. NDV-MLS infections of malignant lymphoma tumors in vivo in dogs were confirmed by electron microscopy. Early (24 h) biodistribution of intravenous injection of 1 × 10(12) TCID50 (tissue culture infective dose) in a dog with T-cell lymphoma showed viral localization only in the kidney, the salivary gland, the lung and the stomach by immunohistochemistry and/or endpoint PCR. We conclude that NDV-MLS may be a promising agent for the treatment of lymphomas. Future research is needed to elucidate the optimal therapeutic regimen and establish appropriate biosafety measures. PMID:26703717

  10. Exploration of Therapy for Coinfection of Canine Distemper and Canine Parvovirus Disease%犬瘟热与犬细小病毒病混合感染的治疗探析

    Institute of Scientific and Technical Information of China (English)

    赵晓莹

    2014-01-01

    犬瘟热(CD)与犬细小病毒病(CP)单独发生率较高,治疗效果也很好。但是目前细小病毒病与犬瘟热混合感染的疾病发生率呈上升趋势,且死亡率很高,给宠物犬造成严重的威胁。笔者针对一例犬的混合感染病例,提出了相应的治疗方案和预防措施。%The breaking out of either canine distemper or canine parvovirus disease solely is a common phenomenon and the therapeutic effect of the sole case is obvious. However, the case of coinfection of canine distemper and canine parvovirus disease is seldom, which caused a huge threat to pet dogs and high mortality. Aiming at a case of mixed infections, the corresponding treatment and preventive measures are put forward.

  11. Canine pulmonary angiostrongylosis

    DEFF Research Database (Denmark)

    Koch, Jørgen; Willesen, Jakob Lundgren

    2009-01-01

    Canine pulmonary angiostrongylosis is an emerging snail-borne disease causing verminous pnemonia and coagulopathy in dogs. The parasite is fund in Europe, North and South America and Africa, covering tropical, subtropical and temperate regions. Its distribution has been characterised by isolated...... larvae may not reflect what happens under field conditions. There is insufficient understanding of the spread of infection and the dynamic consequences of this parasite in the canine population. This review discusses the biology, epidemiology, clinical aspects and management of canine pulmonary...

  12. Cutaneous Lymphangiosarcoma Following Chronic Lymphedema of Filarial Origin

    OpenAIRE

    Abhijit S Acharya; Sulhyan, K.R; R V Ramteke; V Y Kunghadkar

    2013-01-01

    We are reporting a case of 36 yr old female with chronic filarial lymphedema of both legs. Subsequently she developed lymphangiosarcoma of her left leg which was confirmed histologically and on immunohistochemistry. Only three more cases of lymphagiosarcoma occurring in patients with filarial lymphedema are reviewed from available literature.

  13. Canine Distemper

    Science.gov (United States)

    Although this brochure provides basic information about canine distemper, your veterinarian is always your best source of ... Consult your veterinarian for more information about canine distemper and its prevention. And Now A Note On ...

  14. Storage of filarial parasites in CsTFA and precipitation of filarial DNA using MTAB.

    Science.gov (United States)

    Egwang, T G; Akue, J P; Pinder, M

    1989-11-01

    Immunological and biochemical studies on some parasite species are hampered by a limited availability of parasite material. Thomas Egwang Jean-Paul Akue and Margaret Pinder discuss a technique for preserving material from adult filarial worms during transport through endemic areas. PMID:15463158

  15. Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

    NARCIS (Netherlands)

    T.C. Harder (Timm); M.J.H. Kenter (Marcel); H. Vos; C.H.J. Siebelink (Kees); W. Huisman (Willem); C. Örvell; T. Barrett (Thomas); M.J.G. Appel (Max); A.D.M.E. Osterhaus (Albert); G. van Amerongen (Geert)

    1996-01-01

    textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated

  16. A Clinico- Epidemiological Study Of Filarial Related Orthopaedic Manifestations

    Directory of Open Access Journals (Sweden)

    Patond K.R

    1992-01-01

    Full Text Available An epidemiological study was undertaken to study the incidence and distribution of orthopaedic manifestations of filariasis in an endemic area. A total of 207 cases were clinically examined and investigated. Patients were divided into three groups , viz., Group A: Orthopaedic manifestations with no history of filariasis . Group B: Orthopaedic manifestations with history of filariasis such as microfilaraemia or filarial fevers etc., Group C: Orthopaedic manifestations with chronic manifestations such as elephantiasis, hydrocele etc. To confirm filarial etiology, all the cases were examined for the presence of filarial antibody by indirect ELISA using wuchereda bancrofti microfilarial excretory- secretary antigen (wd Mf ESAg . A total of 61 of 102 patients of Group A, 14 of 21 patients of group B, and 73 of 84 patients of Group C were positive for filarial antibody. This study showed the prevalence of filarial antibody in about 71.4% of various orthopaedic manifestations.

  17. Point-of-care quantification of blood-borne filarial parasites with a mobile phone microscope

    OpenAIRE

    D'Ambrosio, M. V.; Bakalar, M.; Bennuru, S.; Reber, C.; Skandarajah, A.; Nilsson, L.; Switz, N.; Kamgno, J.; Pion, Sébastien; Boussinesq, Michel; Nutman, T B; Fletcher, D. A.

    2015-01-01

    Parasitic helminths cause debilitating diseases that affect millions of people in primarily low-resource settings. Efforts to eliminate onchocerciasis and lymphatic filariasis in Central Africa through mass drug administration have been suspended because of ivermectin-associated serious adverse events, including death, in patients infected with the filarial parasite Loa loa. To safely administer ivermectin for onchocerciasis or lymphatic filariasis in regions co-endemic with L. loa, a strateg...

  18. AAV gene transfer delays disease onset in a TPP1-deficient canine model of the late infantile form of Batten disease

    Science.gov (United States)

    Katz, Martin L.; Tecedor, Luis; Chen, Yonghong; Williamson, Baye G.; Lysenko, Elena; Wininger, Fred A.; Young, Whitney M.; Johnson, Gayle C.; Whiting, Rebecca E. H.; Coates, Joan R.; Davidson, Beverly L.

    2016-01-01

    The most common form of the childhood neurodegenerative disease late infantile neuronal ceroid lipofuscinosis (also called Batten disease) is caused by deficiency of the soluble lysosomal enzyme tripeptidyl peptidase 1 (TPP1) resulting from mutations in the TPP1 gene. We tested whether TPP1 gene transfer to the ependyma, the epithelial lining of the brain ventricular system, in TPP1-deficient dogs would be therapeutically beneficial. A one-time administration of recombinant adeno-associated virus (rAAV) expressing canine TPP1 (rAAV.caTPP1) resulted in high expression of TPP1 predominantly in ependymal cells and secretion of the enzyme into the cerebrospinal fluid leading to clinical benefit. Diseased dogs treated with rAAV.caTPP1 showed delays in onset of clinical signs and disease progression, protection from cognitive decline, and extension of life span. By immunostaining and enzyme assay, recombinant protein was evident throughout the brain and spinal cord, with correction of the neuropathology characteristic of the disease. This study in a naturally occurring canine model of TPP1 deficiency highlights the utility of AAV transduction of ventricular lining cells to accomplish stable secretion of recombinant protein for broad distribution in the central nervous system and therapeutic benefit. PMID:26560358

  19. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes

    Science.gov (United States)

    Hytönen, Marjo K.; Arumilli, Meharji; Lappalainen, Anu K.; Owczarek-Lipska, Marta; Jagannathan, Vidhya; Hundi, Sruthi; Salmela, Elina; Venta, Patrick; Sarkiala, Eva; Jokinen, Tarja; Gorgas, Daniela; Kere, Juha; Nieminen, Pekka

    2016-01-01

    One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined genome-wide association and next generation sequencing, to investigate the clinico-pathological features and genetic causes of three developmental syndromes in dogs, including craniomandibular osteopathy (CMO), a previously undescribed skeletal syndrome, and dental hypomineralization, for which we identified pathogenic variants in the canine SLC37A2 (truncating splicing enhancer variant), SCARF2 (truncating 2-bp deletion) and FAM20C (missense variant) genes, respectively. CMO is a clinical equivalent to an infantile cortical hyperostosis (Caffey disease), for which SLC37A2 is a new candidate gene. SLC37A2 is a poorly characterized member of a glucose-phosphate transporter family without previous disease associations. It is expressed in many tissues, including cells of the macrophage lineage, e.g. osteoclasts, and suggests a disease mechanism, in which an impaired glucose homeostasis in osteoclasts compromises their function in the developing bone, leading to hyperostosis. Mutations in SCARF2 and FAM20C have been associated with the human van den Ende-Gupta and Raine syndromes that include numerous features similar to the affected dogs. Given the growing interest in the molecular characterization and treatment of human rare diseases, our study presents three novel physiologically relevant models for further research and therapy approaches, while providing the molecular identity for the canine conditions. PMID:27187611

  20. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes.

    Science.gov (United States)

    Hytönen, Marjo K; Arumilli, Meharji; Lappalainen, Anu K; Owczarek-Lipska, Marta; Jagannathan, Vidhya; Hundi, Sruthi; Salmela, Elina; Venta, Patrick; Sarkiala, Eva; Jokinen, Tarja; Gorgas, Daniela; Kere, Juha; Nieminen, Pekka; Drögemüller, Cord; Lohi, Hannes

    2016-05-01

    One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined genome-wide association and next generation sequencing, to investigate the clinico-pathological features and genetic causes of three developmental syndromes in dogs, including craniomandibular osteopathy (CMO), a previously undescribed skeletal syndrome, and dental hypomineralization, for which we identified pathogenic variants in the canine SLC37A2 (truncating splicing enhancer variant), SCARF2 (truncating 2-bp deletion) and FAM20C (missense variant) genes, respectively. CMO is a clinical equivalent to an infantile cortical hyperostosis (Caffey disease), for which SLC37A2 is a new candidate gene. SLC37A2 is a poorly characterized member of a glucose-phosphate transporter family without previous disease associations. It is expressed in many tissues, including cells of the macrophage lineage, e.g. osteoclasts, and suggests a disease mechanism, in which an impaired glucose homeostasis in osteoclasts compromises their function in the developing bone, leading to hyperostosis. Mutations in SCARF2 and FAM20C have been associated with the human van den Ende-Gupta and Raine syndromes that include numerous features similar to the affected dogs. Given the growing interest in the molecular characterization and treatment of human rare diseases, our study presents three novel physiologically relevant models for further research and therapy approaches, while providing the molecular identity for the canine conditions. PMID:27187611

  1. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes.

    Directory of Open Access Journals (Sweden)

    Marjo K Hytönen

    2016-05-01

    Full Text Available One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined genome-wide association and next generation sequencing, to investigate the clinico-pathological features and genetic causes of three developmental syndromes in dogs, including craniomandibular osteopathy (CMO, a previously undescribed skeletal syndrome, and dental hypomineralization, for which we identified pathogenic variants in the canine SLC37A2 (truncating splicing enhancer variant, SCARF2 (truncating 2-bp deletion and FAM20C (missense variant genes, respectively. CMO is a clinical equivalent to an infantile cortical hyperostosis (Caffey disease, for which SLC37A2 is a new candidate gene. SLC37A2 is a poorly characterized member of a glucose-phosphate transporter family without previous disease associations. It is expressed in many tissues, including cells of the macrophage lineage, e.g. osteoclasts, and suggests a disease mechanism, in which an impaired glucose homeostasis in osteoclasts compromises their function in the developing bone, leading to hyperostosis. Mutations in SCARF2 and FAM20C have been associated with the human van den Ende-Gupta and Raine syndromes that include numerous features similar to the affected dogs. Given the growing interest in the molecular characterization and treatment of human rare diseases, our study presents three novel physiologically relevant models for further research and therapy approaches, while providing the molecular identity for the canine conditions.

  2. Gender-associated genes in filarial nematodes are important for reproduction and potential intervention targets.

    Directory of Open Access Journals (Sweden)

    Ben-Wen Li

    Full Text Available BACKGROUND: A better understanding of reproductive processes in parasitic nematodes may lead to development of new anthelmintics and control strategies for combating disabling and disfiguring neglected tropical diseases such as lymphatic filariasis and onchocerciasis. Transcriptomatic analysis has provided important new insights into mechanisms of reproduction and development in other invertebrates. We have performed the first genome-wide analysis of gender-associated (GA gene expression in a filarial nematode to improve understanding of key reproductive processes in these parasites. METHODOLOGY/PRINCIPAL FINDINGS: The Version 2 Filarial Microarray with 18,104 elements representing ∼85% of the filarial genome was used to identify GA gene transcripts in adult Brugia malayi worms. Approximately 19% of 14,293 genes were identified as GA genes. Many GA genes have potential Caenorhabditis elegans homologues annotated as germline-, oogenesis-, spermatogenesis-, and early embryogenesis- enriched. The potential C. elegans homologues of the filarial GA genes have a higher frequency of severe RNAi phenotypes (such as lethal and sterility than other C. elegans genes. Molecular functions and biological processes associated with GA genes were gender-segregated. Peptidase, ligase, transferase, regulator activity for kinase and transcription, and rRNA and lipid binding were associated with female GA genes. In contrast, catalytic activity from kinase, ATP, and carbohydrate binding were associated with male GA genes. Cell cycle, transcription, translation, and biological regulation were increased in females, whereas metabolic processes of phosphate and carbohydrate metabolism, energy generation, and cell communication were increased in males. Significantly enriched pathways in females were associated with cell growth and protein synthesis, whereas metabolic pathways such as pentose phosphate and energy production pathways were enriched in males. There were

  3. Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

    OpenAIRE

    Harder, Timm; Kenter, Marcel; Vos, H.; Siebelink, Kees; Huisman, Willem; Örvell, C.; Barrett, Thomas,; Appel, Max; Osterhaus, Albert; Amerongen, Geert

    1996-01-01

    textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated CDV viraemia along with pronounced lymphopenia but did not show any clinical symptoms. Plasma neutralizing-antibody titres against the homologous CDV (A92-27/4, isolated from the Chinese leopard) w...

  4. Recombinant Newcastle disease viral vector expressing hemagglutinin or fusion of canine distemper virus is safe and immunogenic in minks.

    Science.gov (United States)

    Ge, Jinying; Wang, Xijun; Tian, Meijie; Gao, Yuwei; Wen, Zhiyuan; Yu, Guimei; Zhou, Weiwei; Zu, Shulong; Bu, Zhigao

    2015-05-15

    Canine Distemper Virus (CDV) infects many carnivores and cause several high-mortality disease outbreaks. The current CDV live vaccine cannot be safely used in some exotic species, such as mink and ferret. Here, we generated recombinant lentogenic Newcastle disease virus (NDV) LaSota expressing either envelope glycoproyein, heamagglutinine (H) or fusion protein (F), named as rLa-CDVH and rLa-CDVF, respectively. The feasibility of these recombinant NDVs to serve as live virus-vectored CD vaccine was evaluated in minks. rLa-CDVH induced significant neutralization antibodies (NA) to CDV and provided solid protection against virulent CDV challenge. On the contrast, rLa-CDVF induced much lower NA to CDV and fail to protected mink from virulent CDV challenge. Results suggest that recombinant NDV expressing CDV H is safe and efficient candidate vaccine against CDV in mink, and maybe other host species. PMID:25865465

  5. Supergroup C Wolbachia, mutualist symbionts of filarial nematodes, have a distinct genome structure.

    Science.gov (United States)

    Comandatore, Francesco; Cordaux, Richard; Bandi, Claudio; Blaxter, Mark; Darby, Alistair; Makepeace, Benjamin L; Montagna, Matteo; Sassera, Davide

    2015-12-01

    Wolbachia pipientis is possibly the most widespread endosymbiont of arthropods and nematodes. While all Wolbachia strains have historically been defined as a single species, 16 monophyletic clusters of diversity (called supergroups) have been described. Different supergroups have distinct host ranges and symbiotic relationships, ranging from mutualism to reproductive manipulation. In filarial nematodes, which include parasites responsible for major diseases of humans (such as Onchocerca volvulus, agent of river blindness) and companion animals (Dirofilaria immitis, the dog heartworm), Wolbachia has an obligate mutualist role and is the target of new treatment regimens. Here, we compare the genomes of eight Wolbachia strains, spanning the diversity of the major supergroups (A-F), analysing synteny, transposable element content, GC skew and gene loss or gain. We detected genomic features that differ between Wolbachia supergroups, most notably in the C and D clades from filarial nematodes. In particular, strains from supergroup C (symbionts of O. volvulus and D. immitis) present a pattern of GC skew, conserved synteny and lack of transposable elements, unique in the Wolbachia genus. These features could be the consequence of a distinct symbiotic relationship between C Wolbachia strains and their hosts, highlighting underappreciated differences between the mutualistic supergroups found within filarial nematodes. PMID:26631376

  6. Canine Parvovirus Disease Pathology and Clinical Observation%犬细小病毒病的病理观察及临床治疗

    Institute of Scientific and Technical Information of China (English)

    王守山

    2011-01-01

    犬细小病毒病是由犬细小病毒(Canine parvovirus,CPV)引起的一种高度接触性传染病,临床上以剧烈呕吐、排血样粪便或心肌炎为特征.病犬和带毒犬是该病的主要传染源,临床症状表现为两种类型:心肌炎型和肠炎型,造成胃肠、心脏严重的组织病变.其中,肠炎型较为常见.犬细小病毒病在感染的初期,如果能够准确诊断,及早治疗,采取综合性治疗措施,限制病毒血症的程度和持续时间,可取得理想的治疗效果.%Canine parvovirus disease is caused by canine parvovirus(Canine parvovirus,CPV) causes a highly contagious disease,the clinical to severe vomiting,stool or blood discharge is characterized by myocarditis.Infected dogs,and dogs are the main source of infection,disease,clinical symptoms of two types: type myocarditis and enteritis-type,resulting in gastrointestinal,heart,severe tissue lesions.Among them,the more common type of colitis.Canine parvovirus disease in the early stages of infection,if an accurate diagnosis,early treatment,comprehensive treatment measures taken to limit the degree of viremia and duration,can achieve the desired therapeutic effect.

  7. Canine prostatic disease: comparison of radiographic appearance with morphologic and microbiologic findings: 30 cases (1981-1985)

    International Nuclear Information System (INIS)

    A retrospective analysis was made of radiographs from 24 clinically normal young adult male Beagles used in previously reported base-line research on the distal male urinary tract. The ventrodorsal and craniocaudal prostate gland dimensions were measured, as visualized on the lateral radiographic view, and expressed as a ratio of the distance between the cranial aspect of the public bone and the sacral promontory. In 17 of these 24 dogs, there was sufficient image clarity to permit confident measurement of prostatic dimensions. From these data, the largest acceptable prostatic dimension, as visualized on the lateral radiographic view, was 70% of the public-promontory distance. A retrospective analysis was made of 30 cases of canine prostatic disease, with the objective of identifying the radiographic (survey and distention retrograde urethrocystogram) appearance most often associated with the various spontaneous prostatic diseases. Prostatomegaly was not specific for the cause of prostatic disease, except if the apparent parenchymal dimensions were greater than or equal to 90% of the public-promontory distance wherein neoplasia, abscess, and paraprostatic cysts (readily differentiated from diffuse intraparenchymal disease by ultrasonography) were the principle considerations. Multifocal, irregularly shaped, parenchymal mineral densities were observed only in dogs with prostatic carcinoma (4/7 cases) or prostatitis (1 case of chronic prostatitis). Narrowing of the prostatic portion of the urethra was observed only in association with abscess, neoplasm, or noninflammatory nonneoplastic disease (possibly benign hypertrophy/hyperplasia), whereas widening of this part of the urethra was not observed

  8. Factors affecting response to medical management in patients of filarial chyluria: A prospective study

    Science.gov (United States)

    Goyal, Neeraj Kumar; Goel, Apul; Sankhwar, Satyanarayan; Singh, Vishwajeet; Ali, Wahid; Natu, S. M.; Singh, Bhupendra Pal; Sinha, Rahul Janak; Dalela, Divakar

    2014-01-01

    Introduction: Filarial chyluria is a common problem in filarial endemic countries. Its management begins with medical therapy but some patients progress to require surgery. The present study aimed to determine factors affecting response to medical management in patients of filarial chyluria. Materials and Methods: This prospective study conducted between August 2008 and November 2012, included conservatively managed patients of chyluria. Demographic profile, clinical presentation, treatment history and urinary triglycerides (TGs) and cholesterol levels at baseline were compared between the responders and non-responders. Apart from the clinical grade of chyluria, hematuria was evaluated as an independent risk factor. Results: Out of the 222 patients (mean age, 37.99 ± 13.29 years, 129 males), 31 patients failed to respond while 35 had a recurrence after initial response; the overall success rate being 70.3% at a mean follow-up of 25 months. No difference was observed in demographics, clinical presentation, presence of hematuria, disease duration and mean urinary TGs loss between responders and non-responders. On multivariate analysis, patients with treatment failure were found to have a higher-grade disease (14.3% Grade-I, 36.6% Grades-II and 60% Grade-III), higher number of pretreatment courses (1.59 ± 1.08 vs. 1.02 ± 0.79) and heavier cholesterol (26.54 ± 23.46 vs. 8.81 ± 8.55 mg/dl) loss at baseline compared with responders (P < 0.05). Conclusion: Conservative management has a success rate in excess of 70%, not affected by the disease chronicity, previous episodes and recurrent nature. However, higher-grade disease, extensive pre-treatment with drugs and higher urinary cholesterol loss at baseline are the predictors of poor response. Hematuria is not an independent poor risk factor for conservative management. PMID:24497677

  9. Intrarenal Distributions and Changes of Angiotensin-Converting Enzyme and Angiotensin-Converting Enzyme 2 in Feline and Canine Chronic Kidney Disease

    OpenAIRE

    MITANI, Sawane; Yabuki, Akira; Sawa, Mariko; Chang, Hye-Sook; YAMATO, Osamu

    2013-01-01

    ABSTRACT Angiotensin-converting enzyme (ACE) is a key enzyme in the renin-angiotensin system (RAS). ACE2 is a newly identified member of the RAS. The present immunohistochemical study focused on changes in intrarenal ACE and ACE2 immunoreactivity in feline and canine chronic kidney disease (CKD). ACE immunoreactivity was predominantly observed in the brush border of the proximal tubules in dogs and cats. ACE immunoreactivity was lower in CKD kidneys than in normal kidneys, and quantitative an...

  10. Thorough investigation of a canine autoinflammatory disease (AID) confirms one main risk locus and suggests a modifier locus for amyloidosis.

    Science.gov (United States)

    Olsson, Mia; Tintle, Linda; Kierczak, Marcin; Perloski, Michele; Tonomura, Noriko; Lundquist, Andrew; Murén, Eva; Fels, Max; Tengvall, Katarina; Pielberg, Gerli; Dufaure de Citres, Caroline; Dorso, Laetitia; Abadie, Jérôme; Hanson, Jeanette; Thomas, Anne; Leegwater, Peter; Hedhammar, Åke; Lindblad-Toh, Kerstin; Meadows, Jennifer R S

    2013-01-01

    Autoinflammatory disease (AID) manifests from the dysregulation of the innate immune system and is characterised by systemic and persistent inflammation. Clinical heterogeneity leads to patients presenting with one or a spectrum of phenotypic signs, leading to difficult diagnoses in the absence of a clear genetic cause. We used separate genome-wide SNP analyses to investigate five signs of AID (recurrent fever, arthritis, breed specific secondary dermatitis, otitis and systemic reactive amyloidosis) in a canine comparative model, the pure bred Chinese Shar-Pei. Analysis of 255 DNA samples revealed a shared locus on chromosome 13 spanning two peaks of association. A three-marker haplotype based on the most significant SNP (pELMO1, HAS2 and IL6). These results illustrate that phenotypic heterogeneity need not be a reflection of genetic heterogeneity, and that genetic modifiers of disease could be masked if syndromes were not first considered as individual clinical signs and then as a sum of their component parts. PMID:24130694

  11. Regulatory T cells subsets in filarial infection and their function

    Directory of Open Access Journals (Sweden)

    Simon eMetenou

    2013-09-01

    Full Text Available Filarial infections in humans are chronic infections that cause significant morbidity. The chronic nature of these infections with continuous antigen release is associated with a parasite-specific T cell hypo-responsiveness that may over time also affect the immune responses to bystander antigens. Previous studies have shown the filarial parasite antigen-specific T cells hypo-responsiveness is mediated by regulatory cytokines -- IL-10 and TGF-β in particular. Recent studies have suggested that the modulated/regulated T cell responses associated with patent filarial infection may reflect an expansion of regulatory T cells (Tregs that include both Tregs induced in peripheral circulation or pTregs and the thymus-derived Tregs or tTregs. Although much is known about the phenotype of these regulatory populations, the mechanisms underlying their expansion and their mode of action in filarial and other infections remain unclear. Nevertheless there are data to suggest that while many of these regulatory cells are activated in an antigen-specific manner the ensuing effectors of this activation are relatively non-specific and may affect a broad range of immune cells. This review will focus on the subsets and function of regulatory T cells in filarial infection.

  12. Canine cutaneous leishmaniasis caused by neotropical Leishmania infantum despite of systemic disease: A case report.

    Science.gov (United States)

    Cavalcanti, Amanda; Lobo, Rogério; Cupolillo, Elisa; Bustamante, Fábio; Porrozzi, Renato

    2012-12-01

    Visceral leishmaniasis is an anthropozoonosis caused by a protozoan Leishmania infantum (syn. Leishmania chagasi). Here, we report a typical case of canine cutaneous leishmaniasis due to L. infantum infection without any other systemic symptom in one dog in the city of Rio de Janeiro, Brazil. A mongrel female dog was admitted in a veterinary clinic with reports of chronic wounds in the body. Physical examination revealed erosive lesions in the limbs, nasal ulcers, presence of ectoparasites and seborrheic dermatitis. Blood samples and fragments of healthy and injured skin were collected. The complete hemogram revealed aregenerative normocytic normochromic anemia and erythrocyte rouleaux, and biochemical analysis revealed normal renal and hepatic functions. Cytology of the muzzle and skin lesions suggested pyogranulomatous inflammatory process. The histopathology of a skin fragment was performed and revealed suspicion of protozoa accompanied by necrotizing dermatitis. The diagnosis of leishmaniasis was accomplished by positive serology, isolation of Leishmania from the skin lesion, and also by molecular test (PCR targeting the conserved region of Leishmania kDNA). Culture was positive for damaged skin samples. PCR targeting a fragment of Leishmania hsp70 gene was performed employing DNA extracted from damaged skin. RFLP of the amplified hsp70 fragment identified the parasite as L. infantum, instead of Leishmania braziliensis, the main agent of cutaneous leishmaniasis in Rio de Janeiro. Characterization of isolated promastigotes by five different enzymatic systems confirmed the species identification of the etiological agent. Serology was positive by ELISA and rapid test. This case warns to the suspicion of viscerotropic Leishmania in cases of chronic skin lesions and brings the discussion of the mechanisms involved in the parasite tissue tropism. PMID:22583758

  13. Experimental Model of Gene Transfection in Healthy Canine Myocardium: Perspectives of Gene Therapy for Ischemic Heart Disease

    Directory of Open Access Journals (Sweden)

    Renato A. K. Kalil

    2002-09-01

    Full Text Available OBJECTIVE: To assess the transfection of the gene that encodes green fluorescent protein (GFP through direct intramyocardial injection. METHODS: The pREGFP plasmid vector was used. The EGFP gene was inserted downstream from the constitutive promoter of the Rous sarcoma virus. Five male dogs were used (mean weight 13.5 kg, in which 0.5 mL of saline solution (n=1 or 0.5 mL of plasmid solution containing 0.5 µg of pREGFP/dog (n=4 were injected into the myocardium of the left ventricular lateral wall. The dogs were euthanized 1 week later, and cardiac biopsies were obtained. RESULTS: Fluorescence microscopy showed differences between the cells transfected and not transfected with pREGFP plasmid. Mild fluorescence was observed in the cardiac fibers that received saline solution; however, the myocardial cells transfected with pREGFP had overt EGFP expression. CONCLUSION: Transfection with the EGFP gene in healthy canine myocardium was effective. The reproduction of this efficacy using vascular endothelial growth factor (VEGF instead of EGFP aims at developing gene therapy for ischemic heart disease.

  14. Vector-borne disease surveillance in puerto rico: pathogen prevalence rates in canines ? Implications for public health and the u.s. Military ? Applying the one health concept.

    Science.gov (United States)

    McCown, Michael E; Opel, Taylor; Grzeszak, Benjamin

    2013-01-01

    Vector-borne diseases (VBDs) make up a large number of emerging infectious and zoonotic diseases. Vectors such as ticks, fleas, and mosquitoes parasitize dogs, thus making canine populations adequate reservoirs for infectious disease and zoonoses. The U.S. military deploys its personnel and Military Working Dogs (MWDs) throughout the world with possible risk of exposure to VBDs. Canine VBDs continue to have veterinary and public health significance for the host nations as well as for deployed U.S. personnel and MWDs. Thus, ongoing and consistent disease surveillance is an essential component to preserve health. The purpose of this study was to survey dogs from multiple cities and varying regions throughout Puerto Rico to determine the prevalence of ehrlichiosis (Ehrlichia canis), anaplasmosis (Anaplasma phagocytophilum), Lyme disease (Borrelia burgdorferi), and heartworm disease (Dirofilaria immitis) from May to July 2012. Canine blood samples (1?3 ml) from the cities of San Juan (n = 629), Guaynabo (n = 50), Ponce (n = 20) and Vieques Island (n = 53) were obtained and tested on-site using an IDEXX SNAP? 4Dx? (enzyme-linked immunosorbent assay) test kit. Prevalence for single or multiple disease status was calculated for each site. The overall period prevalence of VBD in Puerto Rico in the shelter population was 57.7% (71/123). In Guaynabo, the VBD prevalence was 30% (15/50); 2 (13%) of these positive dogs had VBD co-infection. In the coastal port city of Ponce, it was 60% (12/20); 6 (50%) dogs were infected by two or more VBDs. On Vieques Island, it was 83% (44/53); 27 (61%) dogs were coinfected. Conversely, samples collected at the Fort Buchanan Veterinary Clinic in the capitol city of San Juan resulted in a VBD prevalence of 8.9% (56/629). Lyme disease was not detected in any sample. This study showed the presence of D. immitis, E. canis, and A. phagocytophilum in all four sites of Puerto Rico, emphasizing the value of surveillance for VBDs to determine disease

  15. Immunomodulatory drugs and their application to the management of canine immune-mediated disease.

    Science.gov (United States)

    Whitley, N T; Day, M J

    2011-02-01

    This review summarises the current understanding of immune response and T cell subsets in the context of development of autoimmunity in the dog. Mode of action and rational usage in immune-mediated disease in the dog are discussed for the following drugs: glucocorticoids, azathioprine, cyclophosphamide, ciclosporin, tacrolimus, human intravenous immunoglobulin, vincristine, danazol, leflunomide, mycophenolate mofetil and liposome-encapsulated clodronate. Disease mechanisms are discussed and published evidence for drug efficacy is scrutinised for five important immune-mediated diseases: immune-mediated haemolytic anaemia, immune-mediated thrombocytopenia, myasthenia gravis, glomerulonephritis and inflammatory bowel disease. Future strategies for more refined manipulation of adverse immune responses are presented. PMID:21265846

  16. Thorough investigation of a canine autoinflammatory disease (AID confirms one main risk locus and suggests a modifier locus for amyloidosis.

    Directory of Open Access Journals (Sweden)

    Mia Olsson

    Full Text Available Autoinflammatory disease (AID manifests from the dysregulation of the innate immune system and is characterised by systemic and persistent inflammation. Clinical heterogeneity leads to patients presenting with one or a spectrum of phenotypic signs, leading to difficult diagnoses in the absence of a clear genetic cause. We used separate genome-wide SNP analyses to investigate five signs of AID (recurrent fever, arthritis, breed specific secondary dermatitis, otitis and systemic reactive amyloidosis in a canine comparative model, the pure bred Chinese Shar-Pei. Analysis of 255 DNA samples revealed a shared locus on chromosome 13 spanning two peaks of association. A three-marker haplotype based on the most significant SNP (p<2.6×10(-8 from each analysis showed that one haplotypic pair (H13-11 was present in the majority of AID individuals, implicating this as a shared risk factor for all phenotypes. We also noted that a genetic signature (F ST distinguishing the phenotypic extremes of the breed specific Chinese Shar-Pei thick and wrinkled skin, flanked the chromosome 13 AID locus; suggesting that breed development and differentiation has played a parallel role in the genetics of breed fitness. Intriguingly, a potential modifier locus for amyloidosis was revealed on chromosome 14, and an investigation of candidate genes from both this and the chromosome 13 regions revealed significant (p<0.05 renal differential expression in four genes previously implicated in kidney or immune health (AOAH, ELMO1, HAS2 and IL6. These results illustrate that phenotypic heterogeneity need not be a reflection of genetic heterogeneity, and that genetic modifiers of disease could be masked if syndromes were not first considered as individual clinical signs and then as a sum of their component parts.

  17. The heme biosynthetic pathway of the obligate Wolbachia endosymbiont of Brugia malayi as a potential anti-filarial drug target.

    Directory of Open Access Journals (Sweden)

    Bo Wu

    Full Text Available BACKGROUND: Filarial parasites (e.g., Brugia malayi, Onchocerca volvulus, and Wuchereria bancrofti are causative agents of lymphatic filariasis and onchocerciasis, which are among the most disabling of neglected tropical diseases. There is an urgent need to develop macro-filaricidal drugs, as current anti-filarial chemotherapy (e.g., diethylcarbamazine [DEC], ivermectin and albendazole can interrupt transmission predominantly by killing microfilariae (mf larvae, but is less effective on adult worms, which can live for decades in the human host. All medically relevant human filarial parasites appear to contain an obligate endosymbiotic bacterium, Wolbachia. This alpha-proteobacterial mutualist has been recognized as a potential target for filarial nematode life cycle intervention, as antibiotic treatments of filarial worms harboring Wolbachia result in the loss of worm fertility and viability upon antibiotic treatments both in vitro and in vivo. Human trials have confirmed this approach, although the length of treatments, high doses required and medical counter-indications for young children and pregnant women warrant the identification of additional anti-Wolbachia drugs. METHODS AND FINDINGS: Genome sequence analysis indicated that enzymes involved in heme biosynthesis might constitute a potential anti-Wolbachia target set. We tested different heme biosynthetic pathway inhibitors in ex vivo B. malayi viability assays and report a specific effect of N-methyl mesoporphyrin (NMMP, which targets ferrochelatase (FC, the last step. Our phylogenetic analysis indicates evolutionarily significant divergence between Wolbachia heme genes and their human homologues. We therefore undertook the cloning, overexpression and analysis of several enzymes of this pathway alongside their human homologues, and prepared proteins for drug targeting. In vitro enzyme assays revealed a approximately 600-fold difference in drug sensitivities to succinyl acetone (SA between

  18. Immunization with L. sigmodontis microfilariae reduces peripheral microfilaraemia after challenge infection by inhibition of filarial embryogenesis.

    Directory of Open Access Journals (Sweden)

    Sebastian Ziewer

    Full Text Available BACKGROUND: Lymphatic filariasis and onchocerciasis are two chronic diseases mediated by parasitic filarial worms causing long term disability and massive socioeconomic problems. Filariae are transmitted by blood-feeding mosquitoes that take up the first stage larvae from an infected host and deliver it after maturation into infective stage to a new host. After closure of vector control programs, disease control relies mainly on mass drug administration with drugs that are primarily effective against first stage larvae and require many years of annual/biannual administration. Therefore, there is an urgent need for alternative treatment ways, i.e. other effective drugs or vaccines. METHODOLOGY/PRINCIPAL FINDINGS: Using the Litomosoides sigmodontis murine model of filariasis we demonstrate that immunization with microfilariae together with the adjuvant alum prevents mice from developing high microfilaraemia after challenge infection. Immunization achieved 70% to 100% protection in the peripheral blood and in the pleural space and furthermore strongly reduced the microfilarial load in mice that remained microfilaraemic. Protection was associated with the impairment of intrauterine filarial embryogenesis and with local and systemic microfilarial-specific host IgG, as well as IFN-γ secretion by host cells from the site of infection. Furthermore immunization significantly reduced adult worm burden. CONCLUSIONS/SIGNIFICANCE: Our results present a tool to understand the immunological basis of vaccine induced protection in order to develop a microfilariae-based vaccine that reduces adult worm burden and prevents microfilaraemia, a powerful weapon to stop transmission of filariasis.

  19. Egg and larvae of filarial worm in fine-needle aspiration smears of lymph node

    Directory of Open Access Journals (Sweden)

    Jitendra Singh Nigam

    2013-01-01

    Full Text Available Filariasis is a major health problem in tropical countries like India. Detection of egg with or without larva in fine-needle aspiration cytology (FNAC is very unusual despite the high incidence of this parasite in endemic zone. Early diagnosis and treatment prevent the more severe manifestations of disease. A 6-year-old male from eastern Uttar Pradesh presented with the complaints of axillary swelling, fever and loss of appetite. On examination, swelling was 3 cm × 2 cm in size, freely mobile, firm and non-tender. FNA was performed and air-dried smears were stained with Giemsa stain. Smears showed many short and blunt larvae without any distinct sheath and nuclei. Numerous round to oval eggs with short coiled larvae inside them were also seen. A diagnosis of filarial lymphadenopathy was made. The case was considered worth documentation to highlight the finding of filarial eggs in FNA of lymph node, which can be missed or misdiagnosed by an unexperienced pathologist leading to delayed or wrong treatment of a curable disease.

  20. Canine Distemper Virus: an Emerging Disease in Wild Endangered Amur Tigers (Panthera tigris altaica)

    OpenAIRE

    Seimon, Tracie A.; Miquelle, Dale G.; Chang, Tylis Y.; Newton, Alisa L.; Korotkova, Irina; Ivanchuk, Galina; Lyubchenko, Elena; Tupikov, Andre; Slabe, Evgeny; McAloose, Denise

    2013-01-01

    ABSTRACT Fewer than 500 Amur tigers (Panthera tigris altaica) remain in the wild. Due to low numbers and their solitary and reclusive nature, tiger sightings across their range in the Russian Far East and China are rare; sightings of sick tigers are rarer still. Serious neurologic disease observed in several wild tigers since 2001 suggested disease emergence in this endangered species. To investigate this possibility, histology, immunohistochemistry (IHC), in situ hybridization (ISH), and rev...

  1. Characterization of a canine model of glycogen storage disease type IIIa

    OpenAIRE

    Yi, Haiqing; Thurberg, Beth L.; Curtis, Sarah; Austin, Stephanie; Fyfe, John; Koeberl, Dwight D.; Kishnani, Priya S.; Sun, Baodong

    2012-01-01

    SUMMARY Glycogen storage disease type IIIa (GSD IIIa) is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE) in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR). The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We ...

  2. Investigation of Epidemiology,Prevention and Treatment on Canine Parvovirus Disease in Changji of Xinjiang%新疆昌吉市犬细小病毒病流行病学与防治调查

    Institute of Scientific and Technical Information of China (English)

    孙梅; 吴建华

    2014-01-01

    通过对昌吉市犬细小病毒病的流行病学和防治的调查,得出犬细小病毒病的发生与犬的品种、年龄、季节具有明显关系,即纯种犬比杂种犬的发病率高,6月龄以内的犬发病率高,每年4月、9月为高发月份。犬细小病毒病的发病率与疫苗免疫密切相关,因此接种疫苗预防仍然是控制该病流行的最主要途径。%Through the investigation of epidemiology and prevention of canine parvovirus disease in Changji City,the canine parvovirus disease has obvious characteristics in canine breed,age and season.The canine parvovirus disease affects pure bred dogs more than other dogs,The high incidence occurred in less than 6 month dogs,and in April and September.Canine parvovirus disease is closely related with vaccine.So vac-cination prevention is still the most important way to control the disease epidemic.

  3. Use of serologic tests to predict resistance to Canine distemper virus-induced disease in vaccinated dogs.

    Science.gov (United States)

    Jensen, Wayne A; Totten, Janet S; Lappin, Michael R; Schultz, Ronald D

    2015-09-01

    The objective of the current study was to determine whether detection of Canine distemper virus (CDV)-specific serum antibodies correlates with resistance to challenge with virulent virus. Virus neutralization (VN) assay results were compared with resistance to viral challenge in 2 unvaccinated Beagle puppies, 9 unvaccinated Beagle dogs (4.4-7.2 years of age), and 9 vaccinated Beagle dogs (3.7-4.7 years of age). Eight of 9 (89%) unvaccinated adult dogs exhibited clinical signs after virus challenge, and 1 (13%) dog died. As compared to adult dogs, the 2 unvaccinated puppies developed more severe clinical signs and either died or were euthanized after challenge. In contrast, no clinical signs were detected after challenge of the 9 adult vaccinated dogs with post-vaccination intervals of up to 4.4 years. In vaccinated dogs, the positive and negative predictive values of VN assay results for resistance to challenge were 100% and 0%, respectively. Results indicate that dogs vaccinated with modified live CDV can be protected from challenge for ≤4.4 years postvaccination and that detection of virus-specific antibodies is predictive of whether dogs are resistant to challenge with virulent virus. Results also indicate that CDV infection in unvaccinated dogs results in age-dependent morbidity and mortality. Knowledge of age-dependent morbidity and mortality, duration of vaccine-induced immunity, and the positive and negative predictive values of detection of virus-specific serum antibodies are useful in development of rational booster vaccination intervals for the prevention of CDV-mediated disease in adult dogs. PMID:26330396

  4. Contrast-enhanced ultrasonographic characteristics of the diseased canine prostate gland.

    Science.gov (United States)

    Troisi, Alessandro; Orlandi, Riccardo; Bargellini, Paolo; Menchetti, Laura; Borges, Paulo; Zelli, Riccardo; Polisca, Angela

    2015-11-01

    The work was carried out on a total of 26 male dogs that on the basis of clinical examination, prostate ultrasound and prostate biopsy, were divided prospectively into four groups: (1) normal dogs (control group; n = 8); (2) dogs with benign prostatic hyperplasia (group BPH; n = 8); (3) dogs suffering from prostatitis (group prostatitis; n = 4); (4) dogs with prostatic tumors (group tumors; n = 6). The examination of the prostate by means of contrast medium and dedicated ultrasound system allowed a detailed qualitative and quantitative analysis of prostatic vessels in normal and diseased conditions, enabling the detection and characterization of different disease states, and quantification of parameters such as peak intensity of perfusion (%), arrival time of the contrast medium to its maximum value of video intensity (time to peak [TTP; seconds]), regional blood volume, regional blood flow, and mean transit time (MTT [seconds]). The hemodynamic indices TTP (P < 0.01) and MTT (P < 0.001) of diseased prostate groups were significantly lower than those in the normal prostate group although there were no differences among diseases. Optimal cutoff values were 31 seconds (Sensitivity: 72%; Specificity: 88%) and 47 seconds (Sensitivity: 100%; Specificity: 88%) while area under receiver operating characteristic curves were 0.86 (P < 0.01) and 0.97 (P < 0.01) for TTP and MTT, respectively. The qualitative evaluation of vascular patterns showed differences between normal and diseased prostate glands. The latter were characterized by an alteration of the normal vascular appearance consisting of loss of the subcapsular arterioles and lack of a centripetal vascular pattern. The qualitative aspect of the study highlighted the different vascular architecture between BPH, prostatitis, adenocarcinoma, and lymphoma. This study shows how contrast-enhanced ultrasound represents a valid and noninvasive method for highlighting and characterizing prostatic vasculature

  5. Absence of the Filarial Endosymbiont Wolbachia in Seal Heartworm (Acanthocheilonema spirocauda) but Evidence of Ancient Lateral Gene Transfer.

    Science.gov (United States)

    Keroack, Caroline D; Wurster, Jenna I; Decker, Caroline G; Williams, Kalani M; Slatko, Barton E; Foster, Jeremy M; Williams, Steven A

    2016-06-01

    The symbiotic relationship of Wolbachia spp. was first observed in insects and subsequently in many parasitic filarial nematodes. This bacterium is believed to provide metabolic and developmental assistance to filarial parasitic nematodes, although the exact nature of this relationship remains to be fully elucidated. While Wolbachia is present in most filarial nematodes in the family Onchocercidae, it is absent in several disparate species such as the human parasite Loa loa . All tested members of the genus Acanthocheilonema, such as Acanthocheilonema viteae, have been shown to lack Wolbachia. Consistent with this, we show that Wolbachia is absent from the seal heartworm (Acanthocheilonema spirocauda), but lateral gene transfer (LGT) of DNA sequences between Wolbachia and A. spirocauda has occurred, indicating a past evolutionary association. Seal heartworm is an important pathogen of phocid seals and understanding its basic biology is essential for conservation of the host. The findings presented here may allow for the development of future treatments or diagnostics for the disease and also aid in clarification of the complicated nematode-Wolbachia relationship. PMID:26859724

  6. 犬细小病毒病的临床诊疗效果研究%Experience of Clinical Diagnosis and Treatment on Canine Parvovirus Disease

    Institute of Scientific and Technical Information of China (English)

    邓树义; 田风林

    2012-01-01

    犬细小病毒病是由犬细小病毒(cpv)引起的一种急性传染病,发病率和死亡率比较高,达10%~50%,自愈率〈5%.笔者在近一年中的犬病治疗过程中用犬细小病毒快速诊断试纸条确诊为犬细小病毒病的有16例。经过临床治疗得出,除了采用高免血清和对症治疗外,治愈率的高低在很大程度上取决于输液,此外对病犬的护理正确精细与否也有一定的关系。本文重点介绍了犬细小病毒病的临床症状、剖检变化、鉴别诊断、治疗情况及治疗体会。%Canine parvovirus (CPV) disease is a kind of acute infectious disease caused by canine parvovirus. Rate of incidence and mortality is high, up to 10~50%, self healing rate is lower than 5%. Sixteen cases were diagnosed during about one year's therapy process using fast dignosis test strip. Cure rate relied heavily on the infusion, besides high titer serum and symptomatic treatment as well as right and careful care. In this article, clinical symptom, necropsy, differential diagnosis, cure condition and experience of canine parvovirus disease were introduced.

  7. Newcastle Disease Virus: Potential Therapeutic Application for Human and Canine Lymphoma

    OpenAIRE

    Diana Sánchez; Rosana Pelayo; Luis Alberto Medina; Eduardo Vadillo; Rogelio Sánchez; Luis Núñez; Gabriela Cesarman-Maus; Rosa Elena Sarmiento-Silva

    2015-01-01

    Research on oncolytic viruses has mostly been directed towards the treatment of solid tumors, which has yielded limited information regarding their activity in hematological cancer. It has also been directed towards the treatment of humans, yet veterinary medicine may also benefit. Several strains of the Newcastle disease virus (NDV) have been used as oncolytics in vitro and in a number of in vivo experiments. We studied the cytolytic effect of NDV-MLS, a low virulence attenuated lentogenic s...

  8. Characterization of a canine model of glycogen storage disease type IIIa

    Directory of Open Access Journals (Sweden)

    Haiqing Yi

    2012-11-01

    Glycogen storage disease type IIIa (GSD IIIa is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR. The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We characterized in detail the disease expression and progression in eight dogs from age 2 to 16 months. Monthly blood biochemistry revealed elevated and gradually increasing serum alanine transaminase (ALT, aspartate transaminase (AST and alkaline phosphatase (ALP activities; serum creatine phosphokinase (CPK activity exceeded normal range after 12 months. Analysis of tissue biopsy specimens at 4, 12 and 16 months revealed abnormally high glycogen contents in liver and muscle of all dogs. Fasting liver glycogen content increased from 4 months to 12 months, but dropped at 16 months possibly caused by extended fibrosis; muscle glycogen content continually increased with age. Light microscopy revealed significant glycogen accumulation in hepatocytes at all ages. Liver histology showed progressive, age-related fibrosis. In muscle, scattered cytoplasmic glycogen deposits were present in most cells at 4 months, but large, lake-like accumulation developed by 12 and 16 months. Disruption of the contractile apparatus and fraying of myofibrils was observed in muscle at 12 and 16 months by electron microscopy. In conclusion, the CCR dogs are an accurate model of GSD IIIa that will improve our understanding of the disease progression and allow opportunities to investigate treatment interventions.

  9. Characterization of a canine model of glycogen storage disease type IIIa.

    Science.gov (United States)

    Yi, Haiqing; Thurberg, Beth L; Curtis, Sarah; Austin, Stephanie; Fyfe, John; Koeberl, Dwight D; Kishnani, Priya S; Sun, Baodong

    2012-11-01

    Glycogen storage disease type IIIa (GSD IIIa) is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE) in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR). The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We characterized in detail the disease expression and progression in eight dogs from age 2 to 16 months. Monthly blood biochemistry revealed elevated and gradually increasing serum alanine transaminase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP) activities; serum creatine phosphokinase (CPK) activity exceeded normal range after 12 months. Analysis of tissue biopsy specimens at 4, 12 and 16 months revealed abnormally high glycogen contents in liver and muscle of all dogs. Fasting liver glycogen content increased from 4 months to 12 months, but dropped at 16 months possibly caused by extended fibrosis; muscle glycogen content continually increased with age. Light microscopy revealed significant glycogen accumulation in hepatocytes at all ages. Liver histology showed progressive, age-related fibrosis. In muscle, scattered cytoplasmic glycogen deposits were present in most cells at 4 months, but large, lake-like accumulation developed by 12 and 16 months. Disruption of the contractile apparatus and fraying of myofibrils was observed in muscle at 12 and 16 months by electron microscopy. In conclusion, the CCR dogs are an accurate model of GSD IIIa that will improve our understanding of the disease progression and allow opportunities to investigate treatment interventions. PMID:22736456

  10. Mapping of the disease locus and identification of ADAMTS10 as a candidate gene in a canine model of primary open angle glaucoma.

    Directory of Open Access Journals (Sweden)

    John Kuchtey

    2011-02-01

    Full Text Available Primary open angle glaucoma (POAG is a leading cause of blindness worldwide, with elevated intraocular pressure as an important risk factor. Increased resistance to outflow of aqueous humor through the trabecular meshwork causes elevated intraocular pressure, but the specific mechanisms are unknown. In this study, we used genome-wide SNP arrays to map the disease gene in a colony of Beagle dogs with inherited POAG to within a single 4 Mb locus on canine chromosome 20. The Beagle POAG locus is syntenic to a previously mapped human quantitative trait locus for intraocular pressure on human chromosome 19. Sequence capture and next-generation sequencing of the entire canine POAG locus revealed a total of 2,692 SNPs segregating with disease. Of the disease-segregating SNPs, 54 were within exons, 8 of which result in amino acid substitutions. The strongest candidate variant causes a glycine to arginine substitution in a highly conserved region of the metalloproteinase ADAMTS10. Western blotting revealed ADAMTS10 protein is preferentially expressed in the trabecular meshwork, supporting an effect of the variant specific to aqueous humor outflow. The Gly661Arg variant in ADAMTS10 found in the POAG Beagles suggests that altered processing of extracellular matrix and/or defects in microfibril structure or function may be involved in raising intraocular pressure, offering specific biochemical targets for future research and treatment strategies.

  11. Genomics of Loa loa, a Wolbachia-free filarial parasite of humans

    OpenAIRE

    Desjardins, Christopher A.; Cerqueira, Gustavo C.; Goldberg, Jonathan M.; Hotopp, Julie C Dunning; Haas, Brian J.; Zucker, Jeremy; Ribeiro, Jose’ M.C.; Saif, Sakina; Levin, Joshua Z.; Fan, Lin; Zeng, Qiandong; Russ, Carsten; Wortman, Jennifer R.; Fink, Doran L.; Birren, Bruce W.

    2014-01-01

    Loa loa, the African eyeworm, is a major filarial pathogen of humans. Unlike most filariae, Loa loa does not contain the obligate intracellular Wolbachia endosymbiont. We describe the 91.4 Mb genome of Loa loa, and the genome of the related filarial parasite Wuchereria bancrofti, and predict 14,907 Loa loa genes based on microfilarial RNA sequencing. By comparing these genomes to that of another filarial parasite, Brugia malayi, and to several other nematode genomes, we demonstrate synteny am...

  12. Filarial Nematode Infection in Ixodes scapularis Ticks Collected from Southern Connecticut

    OpenAIRE

    Pabbati Namrata; Jamie M. Miller; Madari Shilpa; Patlolla Raghavender Reddy; Cheryl Bandoski; Rossi, Michael J.; Eva Sapi

    2014-01-01

    It was recently demonstrated that the lone star tick Amblyomma americanum could harbor filarial nematodes within the genus Acanthocheilonema. In this study, Ixodes scapularis (deer) ticks collected from Southern Connecticut were evaluated for their potential to harbor filarial nematodes. Non-engorged nymphal and adult stage Ixodes scapularis ticks were collected in Southern Connecticut using the standard drag method. In situ hybridization with filarial nematode specific sequences demonstrate...

  13. Canine mastocytosis

    OpenAIRE

    Paiva, D.; Mendonça, A; Vala, Helena

    2013-01-01

    Mastocytosis is a mast cell disorder in which its exaggerated proliferation can occur in two forms: systemic and cutaneous (Davis et al., 1992). Because canine mastocytosis is a rare situation of controversial and difficult diagnosis, the goal of this study consists in a current revision of this subject, in order to sensitize the veterinary staff to its severity, with particular focus on the information the veterinary nurse must hold to better apply a specialized nursing care with the hig...

  14. Detection of filarial specific IgG4 antibodies in individuals residing in endemic areas using panLFRAPID test card

    OpenAIRE

    K Athisaya Mary; Hoti, S. L.; Krishnamoorthy, K.; Das, P K; Rahmah, N.

    2011-01-01

    In order to achieve the goal of global programme for elimination of lymphatic filariasis (GPELF), chemotherapy programmes are underway to interrupt transmission of the disease. At this point, detection of exposure will be more appropriate to monitor the programme and to certify areas cleared of active transmission as disease-free. A recently available cassette form of rapid test, panLFRAPID is a filarial IgG4 antibody detection test that may be useful for the programme. Therefore, we carried ...

  15. 19例犬细小病毒病的诊疗报告%The Diagnosis and Treatment of Nineteen Cases of Canine Parvovirus Disease

    Institute of Scientific and Technical Information of China (English)

    李博岩; 陆曼

    2015-01-01

    Nineteen cases of enteritis type canine parvovirus disease in an animal hospital were diagnosed based on the analysis of the treatment protocol and experience. Among the cases, two of them were mixed infection with parasite, four of them were mixed infection with coronavirus, and other 13 cases were simple infection of parvovirus. The sufficient and prompt employment of antiviral drugs combining with anti-inflammation, fluid infusion and correcting the unbalance between acid and alkali were effective treatment measures for canine parvovirus disease.%对某动物医院确诊的19例犬细小病毒病患犬的治疗方法和经验进行汇总、归纳和分析,发现19例均为肠炎型。其中,与寄生虫混合感染的有2例,与冠状病毒感染的有4例,其余13例为单纯犬细小病毒感染。对于细小病毒病患犬要尽早、足量使用抗病毒药物治疗,并配合采取消炎、补液、纠正酸碱失衡等措施是保证疗效的关键。

  16. Human filarial Wolbachia lipopeptide directly activates human neutrophils in vitro.

    Science.gov (United States)

    Tamarozzi, F; Wright, H L; Johnston, K L; Edwards, S W; Turner, J D; Taylor, M J

    2014-10-01

    The host inflammatory response to the Onchocerca volvulus endosymbiont, Wolbachia, is a major contributing factor in the development of chronic pathology in humans (onchocerciasis/river blindness). Recently, the toll-like pattern recognition receptor motif of the major inflammatory ligands of filarial Wolbachia, membrane-associated diacylated lipoproteins, was functionally defined in murine models of pathology, including mediation of neutrophil recruitment to the cornea. However, the extent to which human neutrophils can be activated in response to this Wolbachia pattern recognition motif is not known. Therefore, the responses of purified peripheral blood human neutrophils to a synthetic N-terminal diacylated lipopeptide (WoLP) of filarial Wolbachia peptidoglycan-associated lipoprotein (PAL) were characterized. WoLP exposure led to a dose-dependent activation of healthy, human neutrophils that included gross morphological alterations and modulation of surface expressed integrins involved in tethering, rolling and extravasation. WoLP exposure induced chemotaxis but not chemokinesis of neutrophils, and secretion of the major neutrophil chemokine, interleukin 8. WoLP also induced and primed the respiratory burst, and enhanced neutrophil survival by delay of apoptosis. These results indicate that the major inflammatory motif of filarial Wolbachia lipoproteins directly activates human neutrophils in vitro and promotes a molecular pathway by which human neutrophils are recruited to sites of Onchocerca parasitism. PMID:24909063

  17. Exoemission of Ethiopian soils and the endemicity of non-filarial elephantiasis

    International Nuclear Information System (INIS)

    Non-filarial elephantiasis is an endemic disease in the bare-footed population of Ethiopia. The distribution of this condition is linked with that of local red clay soil. Recently, thermoluminescence has been successfully used to distinguish between endemic and non-endemic soils. Instrinsic lattice defects, frozen in during cooling of volcanic material, are considered to be responsible for characteristic thermoluminescence signals. However, the biological reactivity of the absorbed soil particles will depend upon their surface properties. Exoemission has therefore been studied in samples from both endemic (5 samples) and non-endemic (4 samples) areas. All samples from endemic areas, on first heating, demonstrate an emission peak at 750C. Post-irradiation storage of samples in a moist atmosphere tends to decrease emissivity while wetting irreversibly reduces the response to irradiation. In an hydrated biological environement, this surface reactivity may be linked to the pathogenicity of the soil particles. (author)

  18. Exoemission of Ethiopian soils and the endemicity of non-filarial elephantiasis

    Energy Technology Data Exchange (ETDEWEB)

    Davies, J.E. (Birmingham Univ. (UK). Dept. of Anatomy); Townsend, P.D. (Sussex Univ., Brighton (UK))

    1983-01-01

    Non-filarial elephantiasis is an endemic disease in the bare-footed population of Ethiopia. The distribution of this condition is linked with that of local red clay soil. Recently, thermoluminescence has been successfully used to distinguish between endemic and non-endemic soils. Instrinsic lattice defects, frozen in during cooling of volcanic material, are considered to be responsible for characteristic thermoluminescence signals. However, the biological reactivity of the absorbed soil particles will depend upon their surface properties. Exoemission has therefore been studied in samples from both endemic (5 samples) and non-endemic (4 samples) areas. All samples from endemic areas, on first heating, demonstrate an emission peak at 75/sup 0/C. Post-irradiation storage of samples in a moist atmosphere tends to decrease emissivity while wetting irreversibly reduces the response to irradiation. In an hydrated biological environment, this surface reactivity may be linked to the pathogenicity of the soil particles.

  19. Intrarenal distributions and changes of Angiotensin-converting enzyme and Angiotensin-converting enzyme 2 in feline and canine chronic kidney disease.

    Science.gov (United States)

    Mitani, Sawane; Yabuki, Akira; Sawa, Mariko; Chang, Hye-Sook; Yamato, Osamu

    2014-01-01

    Angiotensin-converting enzyme (ACE) is a key enzyme in the renin-angiotensin system (RAS). ACE2 is a newly identified member of the RAS. The present immunohistochemical study focused on changes in intrarenal ACE and ACE2 immunoreactivity in feline and canine chronic kidney disease (CKD). ACE immunoreactivity was predominantly observed in the brush border of the proximal tubules in dogs and cats. ACE immunoreactivity was lower in CKD kidneys than in normal kidneys, and quantitative analysis demonstrated negative correlations between ACE and renal tissue damage in dogs. ACE2 immunoreactivity was also detected in the proximal tubules; it increased or decreased with CKD in dogs, depending on the renal region assessed. The changes in ACE and ACE2 in CKD were associated with the plasma creatinine concentration in dogs. Findings from dogs with glomerulonephritis were similar to those from dogs with non-glomerulonephritis. The present study suggests that changes in the intrarenal expression of ACE and ACE2 contribute to the pathological mechanisms of canine CKD, but not to the mechanisms of feline CKD. PMID:24004970

  20. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2009-03-01

    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  1. Prognostic markers of canine pyometra

    OpenAIRE

    M.C. Sant'Anna; L.G.P. Giordano; K.K.M.C. Flaiban; E.E. Muller; M.I.M. Martins

    2014-01-01

    The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra tre...

  2. Métodos de diagnóstico para detecção de prostatopatias caninas Canine prostatic disease: diagnosis methods

    Directory of Open Access Journals (Sweden)

    Ceres Mussel

    2010-12-01

    Full Text Available As doenças prostáticas são comuns em cães, desenvolvendo-se após a maturidade sexual. Entre as afecções que acometem a próstata desses animais, a mais frequente é a hiperplasia prostática benigna (HPB. As neoplasias prostáticas, apesar de menos frequentes, são altamente malignas e um diagnóstico tardio está associado a um prognóstico ruim. Os principais métodos de diagnóstico das enfermidades prostáticas em cães incluem um exame clínico detalhado, ultrassonografia, punção aspirativa e biópsia. A utilização de biomarcadores séricos vem sendo estudada como uma maneira de se detectar a doença precocemente, evitando possíveis complicações no quadro clínico dos pacientes. Assim, estudos visando ao diagnóstico precoce de prostatopatias caninas, especialmente o câncer prostático, são cruciais para um tratamento eficaz e melhora da qualidade de vida do animal acometido.Prostatic diseases are common in older dogs, developing after sexual maturity. The most common affecting canine prostate is benign prostatic hyperplasia (BPH. Although less frequent, prostatic neoplasias are highly malignant, and a late diagnosis is closely associated with a poor prognosis. The main methods of diagnosis of the canine prostatic disease include a detailed clinical exam, ultrasound, prostatic fine-needle aspirate and biopsy. Studies towards early diagnosis of this condition are crucial for effective treatment and improvement of quality of life of affected animals. The use of biomarkers has been studied for early detection of the disease, avoiding possible complications in clinical patients.

  3. 中西结合治疗216例犬细小病毒病疗效观察%Clinical Observation of 216 Cases of Canine Parvovirus Disease by Treatment of Combining TCM and WM

    Institute of Scientific and Technical Information of China (English)

    宋洋铭; 叶得河

    2012-01-01

    通过临床症状、流行病学特点和犬细小病毒抗原试剂盒对疑似细小病毒感染的216例病犬进行确诊,并对确诊为细小病毒感染的部分病例进行抗体水平检测,以判断其预后,采用中西结合的综合措施治疗发病犬,治愈率达到70%,提出了有效的预防措施.%Author confirmed 216 cases of suspected canine parvovirus disease through the clinical signs, epidemiological characteristics and antigen rapid canine parvovirus test kit, to determine its prognosis, author detected antibody level of some cases of confirmed canine parvovirus disease, in addition, author achieved cure rate of 70% by comprehensive measures of treatment of combining TCM and WM, at last author propose effective prevention measures for canine parvovirus disease.

  4. Clinical investigation on canine parvovirus diseases%犬细小病毒病的临床调查

    Institute of Scientific and Technical Information of China (English)

    谢子茂; 陈广宏

    2007-01-01

    犬细小病毒病是由犬细小病毒(Canine parvovirus,CPV)引起的一种急性接触性传染病,临床上以发生出血性肠炎的病例多见。广州市怡友动物医院自2005年1月至2006年12月两年间接诊CPV感染犬317例,笔者对此进行了临床调查和分析。

  5. Disease: H01104 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available H01104 Loiasis Loiasis is an infection with Loa loa, a filarial parasite found in c...lications. Infectious disease Loa loa Diethylcarbamazine [DR:D07825] Ivermectin [DR:D00804] Vector: Mango fl

  6. Detection of circulating parasite-derived microRNAs in filarial infections.

    Science.gov (United States)

    Tritten, Lucienne; Burkman, Erica; Moorhead, Andrew; Satti, Mohammed; Geary, James; Mackenzie, Charles; Geary, Timothy

    2014-07-01

    Filarial nematodes cause chronic and profoundly debilitating diseases in both humans and animals. Applications of novel technology are providing unprecedented opportunities to improve diagnosis and our understanding of the molecular basis for host-parasite interactions. As a first step, we investigated the presence of circulating miRNAs released by filarial nematodes into the host bloodstream. miRNA deep-sequencing combined with bioinformatics revealed over 200 mature miRNA sequences of potential nematode origin in Dirofilaria immitis-infected dog plasma in two independent analyses, and 21 in Onchocerca volvulus-infected human serum. Total RNA obtained from D. immitis-infected dog plasma was subjected to stem-loop RT-qPCR assays targeting two detected miRNA candidates, miR-71 and miR-34. Additionally, Brugia pahangi-infected dog samples were included in the analysis, as these miRNAs were previously detected in extracts prepared from this species. The presence of miR-71 and miR-34 discriminated infected samples (both species) from uninfected samples, in which no specific miRNA amplification occurred. However, absolute miRNA copy numbers were not significantly correlated with microfilaraemia for either parasite. This may be due to the imprecision of mf counts to estimate infection intensity or to miRNA contributions from the unknown number of adult worms present. Nonetheless, parasite-derived circulating miRNAs are found in plasma or serum even for those species that do not live in the bloodstream. PMID:25033073

  7. Detection of circulating parasite-derived microRNAs in filarial infections.

    Directory of Open Access Journals (Sweden)

    Lucienne Tritten

    2014-07-01

    Full Text Available Filarial nematodes cause chronic and profoundly debilitating diseases in both humans and animals. Applications of novel technology are providing unprecedented opportunities to improve diagnosis and our understanding of the molecular basis for host-parasite interactions. As a first step, we investigated the presence of circulating miRNAs released by filarial nematodes into the host bloodstream. miRNA deep-sequencing combined with bioinformatics revealed over 200 mature miRNA sequences of potential nematode origin in Dirofilaria immitis-infected dog plasma in two independent analyses, and 21 in Onchocerca volvulus-infected human serum. Total RNA obtained from D. immitis-infected dog plasma was subjected to stem-loop RT-qPCR assays targeting two detected miRNA candidates, miR-71 and miR-34. Additionally, Brugia pahangi-infected dog samples were included in the analysis, as these miRNAs were previously detected in extracts prepared from this species. The presence of miR-71 and miR-34 discriminated infected samples (both species from uninfected samples, in which no specific miRNA amplification occurred. However, absolute miRNA copy numbers were not significantly correlated with microfilaraemia for either parasite. This may be due to the imprecision of mf counts to estimate infection intensity or to miRNA contributions from the unknown number of adult worms present. Nonetheless, parasite-derived circulating miRNAs are found in plasma or serum even for those species that do not live in the bloodstream.

  8. Systemic inflammarory response in canine pyometra

    OpenAIRE

    Fransson, Boel

    2003-01-01

    Research efforts have focused mainly on the hormonal aspects of canine pyometra for more than 6 decades. However, this disease is often manifested as systemic illness in response to the bacterial uterine infection. Studies I-II were undertaken to clarify bacteriological aspects of canine pyometra; i.e. the origin of the infecting bacteria, the infecting bacteria’s impact on severity of the systemic illness and the presence of bacterial endotoxin in the systemic circulation. Study I, a bacteri...

  9. Autochthonous canine leishmaniasis in Romania: neglected or (re)emerging?

    OpenAIRE

    Mircean, Viorica; Dumitrache, Mirabela Oana; MIRCEAN, MIRCEA; Bolfa, Pompei; Györke, Adriana; Mihalca, Andrei Daniel

    2014-01-01

    Canine leishmaniasis is a vector-borne zoonotic disease caused by the protozoan parasite Leishmania infantum. In Romania between 1955 and 2013, no cases of human autochthonous visceral leishmaniasis were reported. Data regarding canine leishmaniasis is similarly scarce. Since the first report of clinical autochthonous canine leishmaniasis in 1935, there were only three sporadic reports of positive dogs all without any clinical signs. Our study reports the first clinical case of autochthonous ...

  10. [Assessment of disease severity and outcome of dietary, antibiotic, and immunosuppressive interventions by use of the canine IBD activity index in 21 dogs with chronic inflammatory bowel disease].

    Science.gov (United States)

    Münster, Michael; Hörauf, Angelika; Bilzer, Thomas

    2006-01-01

    Recently, the canine IBD activity index (CIBDAI) was developed for evaluation of the severity of illness, therapeutic strategies, and efficacy of therapy. The aim of the present study was to assess the severity of illness and the therapeutic strategy in dogs with IBD by the use of CIBDAI, serum albumin concentration, and histologic score (HPEG). Furthermore the use of CIBDAI and the efficacy of therapy in a prospective study during a 3 month treatment period were evaluated. Twentyone dogs with inflammatory bowel disease (lymphocytic-plasmacytic enteritis and enterocolitis) were examined in this study. In 11 dogs with IBD the severity of illness was assessed as low, according to CIBDAI and HPEG (CIBDAI score 4 or between 5 and 10 with HPEG score between 1 and 1.5). Six dogs were treated with hypoallergenic diet (Group D), five dogs were treated with hypoallergenic diet and metronidazole (15.6-22,3 mg/kg/day) (Group M). In 10 dogs with IBD the severity of illness was assessed as high (CIBDAI azathioprine (n=5; 0.9-2.3 mg/kg/day), sulfasalazine (n=4; 18.2-25 mg/kg/day) and hypoallergenic diet (n=10). Efficacy of therapy was evaluated prospectively 3 times in a 12 weeks treatment period. Remission (CIBDAI score or =4) indicated poor therapeutic response. Age, CIBDAI score and HPEG score were significantly different in IBD dogs with low severity of illness (age: median 60 months; CIBDAI score: median 5; HPEG score: median (1) and IBD dogs with high severity of illness (age: median 90 months; CIBDAI score: median 9.5; HPEG score: median 2.25) (p = 0.0101 and p = 0.0099, respectively). The presence of hypoalbuminemia was not significantly different between these two groups (p = 0.3108). There was no significant correlation between CIBDAI score and serum albumin concentration (r = 0.0394; p = 0.0802) or between CIBDAI score and HPEG score (r = 0.2587; p = 0.2574). In the treatment groups, HPEG score was only significantly different between D-group and group I (p 0.05). All

  11. In vitro flubendazole-induced damage to vital tissues in adult females of the filarial nematode Brugia malayi.

    Science.gov (United States)

    O'Neill, Maeghan; Geary, James F; Agnew, Dalen W; Mackenzie, Charles D; Geary, Timothy G

    2015-12-01

    The use of a microfilaricidal drug for the control of onchocerciasis and lymphatic filariasis necessitates prolonged yearly dosing. Prospects for elimination or eradication of these diseases would be enhanced by availability of a macrofilaricidal drug. Flubendazole (FLBZ), a benzimidazole anthelmintic, is an appealing candidate macrofilaricide. FLBZ has demonstrated profound and potent macrofilaricidal effects in a number of experimental filarial rodent models and one human trial. Unfortunately, FLBZ was deemed unsatisfactory for use in mass drug administration (MDA) campaigns due to its markedly limited oral bioavailability. However, a new formulation that provided sufficient bioavailability following oral administration could render FLBZ an effective treatment for onchocerciasis and LF. This study characterized the effects of FLBZ and its reduced metabolite (FLBZ-R) on filarial nematodes in vitro to determine the exposure profile which results in demonstrable damage. Adult female Brugia malayi were exposed to varying concentrations of FLBZ or FLBZ-R (100 nM-10 μM) for up to five days, after which worms were fixed for histology. Morphological damage following exposure to FLBZ was observed prominently in the hypodermis and developing embryos at concentrations as low as 100 nM following 24 h exposure. The results indicate that damage to tissues required for reproduction and survival can be achieved at pharmacologically relevant concentrations. PMID:26288741

  12. In vitro flubendazole-induced damage to vital tissues in adult females of the filarial nematode Brugia malayi

    Directory of Open Access Journals (Sweden)

    Maeghan O'Neill

    2015-12-01

    Full Text Available The use of a microfilaricidal drug for the control of onchocerciasis and lymphatic filariasis necessitates prolonged yearly dosing. Prospects for elimination or eradication of these diseases would be enhanced by availability of a macrofilaricidal drug. Flubendazole (FLBZ, a benzimidazole anthelmintic, is an appealing candidate macrofilaricide. FLBZ has demonstrated profound and potent macrofilaricidal effects in a number of experimental filarial rodent models and one human trial. Unfortunately, FLBZ was deemed unsatisfactory for use in mass drug administration (MDA campaigns due to its markedly limited oral bioavailability. However, a new formulation that provided sufficient bioavailability following oral administration could render FLBZ an effective treatment for onchocerciasis and LF. This study characterized the effects of FLBZ and its reduced metabolite (FLBZ-R on filarial nematodes in vitro to determine the exposure profile which results in demonstrable damage. Adult female Brugia malayi were exposed to varying concentrations of FLBZ or FLBZ-R (100 nM–10 μM for up to five days, after which worms were fixed for histology. Morphological damage following exposure to FLBZ was observed prominently in the hypodermis and developing embryos at concentrations as low as 100 nM following 24 h exposure. The results indicate that damage to tissues required for reproduction and survival can be achieved at pharmacologically relevant concentrations.

  13. Canine mammary tumours, an overview.

    Science.gov (United States)

    Sleeckx, N; de Rooster, H; Veldhuis Kroeze, E J B; Van Ginneken, C; Van Brantegem, L

    2011-12-01

    Canine mammary tumours (CMTs) are the most common neoplasms in intact female dogs. Although the prevalence of these tumours decreases in regions where preventive ovari(ohyster)ectomy is performed, it remains an important disease entity in veterinary medicine. Moreover, treatment options are limited in comparison with human breast cancer. Nevertheless, recent human treatment protocols might have potential in bitches suffering from CMTs. PMID:21645126

  14. Chronic Lymphedema of Filarial Origin: A Very Rare Etiology of Cutaneous Lymphangiosarcoma

    OpenAIRE

    Agale, Shubhangi V.; Wasif Ali ZA Khan; Karishma Chawlani

    2013-01-01

    Lymphedema-associated angiosarcoma also known as lymphangiosarcoma is the commonest type of cutaneous angiosarcoma. Post-mastectomy lymphedema is the most frequent cause, while chronic filarial lymphedema is one of the most uncommon etiology for development of lymphangiosarcoma. We report a case of a 50 year old male suffering from chronic filarial lymphedema of right lower extremity, presented with brownish nodules on the right leg, which were diagnosed histopathologically as lymphangiosarcoma.

  15. A review of the complexity of biology of lymphatic filarial parasites

    OpenAIRE

    K. P. Paily; Hoti, S. L.; Das, P K

    2009-01-01

    There are about five more common, including Wuchereria bancrofti and Brugia malayi, and four less common filarial parasites infecting human. Genetic analysis of W. bancrofti populations in India showed that two strains of the species are prevalent in the country. The adult filarial parasites are tissue specific in the human host and their embryonic stage, called microfilariae (mf), are found in the blood or skin of the host, depending upon the species of the parasite. Three genetically determ...

  16. Influence of anti-filarial chemotherapy strategies on the genetic structure of Wuchereria bancrofti populations

    OpenAIRE

    Dhamodharan Ramasamy; Hoti Sugeerappa Laxmanappa; Rohit Sharma; Manoj Kumar Das

    2011-01-01

    Lymphatic filarial (LF) parasites have been under anti-filarial drug pressure for more than half a century. Currently, annual mass drug administration (MDA) of diethylcarbamazine (DEC) or ivermectin in combination with albendazole (ALB) have been used globally to eliminate LF. Long-term chemotherapies exert significant pressure on the genetic structure of parasitic populations. We investigated the genetic variation among 210 Wuchereria bancrofti populations that were under three different che...

  17. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-02-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  18. Genome-wide mRNA sequencing of a single canine cerebellar cortical degeneration case leads to the identification of a disease associated SPTBN2 mutation

    Directory of Open Access Journals (Sweden)

    Forman Oliver P

    2012-07-01

    Full Text Available Abstract Background Neonatal cerebellar cortical degeneration is a neurodegenerative disease described in several canine breeds including the Beagle. Affected Beagles are unable to ambulate normally from the onset of walking and the main pathological findings include Purkinje cell loss with swollen dendritic processes. Previous reports suggest an autosomal recessive mode of inheritance. The development of massively parallel sequencing techniques has presented the opportunity to investigate individual clinical cases using genome-wide sequencing approaches. We used genome-wide mRNA sequencing (mRNA-seq of cerebellum tissue from a single Beagle with neonatal cerebellar cortical degeneration as a method of candidate gene sequencing, with the aim of identifying the causal mutation. Results A four-week old Beagle dog presented with progressive signs of cerebellar ataxia and the owner elected euthanasia. Histopathology revealed findings consistent with cerebellar cortical degeneration. Genome-wide mRNA sequencing (mRNA-seq of RNA from cerebellum tissue was used as a method of candidate gene sequencing. After analysis of the canine orthologues of human spinocerebellar ataxia associated genes, we identified a homozygous 8 bp deletion in the β-III spectrin gene, SPTBN2, associated with spinocerebellar type 5 in humans. Genotype analysis of the sire, dam, ten clinically unaffected siblings, and an affected sibling from a previous litter, showed the mutation to fully segregate with the disorder. Previous studies have shown that β-III spectrin is critical for Purkinje cell development, and the absence of this protein can lead to cell damage through excitotoxicity, consistent with the observed Purkinje cell loss, degeneration of dendritic processes and associated neurological dysfunction in this Beagle. Conclusions An 8 bp deletion in the SPTBN2 gene encoding β-III spectrin is associated with neonatal cerebellar cortical degeneration in Beagle dogs

  19. Beneficial Effect of a Cellulose-Containing Chew Treat on Canine Periodontal Disease in a Double-Blind, Placebo-Controlled Trial

    Directory of Open Access Journals (Sweden)

    A. C. Beynen

    2010-01-01

    Full Text Available Problem statement: There are indications that appropriate chew treats can contribute to the control of canine periodontal disease. It was reasoned that the incorporation of a cellulose fiber network into the treat may improve the efficacy, but for proof experimental data were required. Approach: A double-blind, placebo-controlled trial with privately owned dogs was carried out to assess the efficacy of a cellulose preparation (Arbocel BWW40® in the treatment of periodontal disease. With the use of a questionnaire, the clinical signs were evaluated by the owners. There were 10 clinical signs: extent and severity of dental plaque and calculus, extent of gingivitis, redness, swelling, bleeding and firmness of gingivae and halitosis. For a period of 8 weeks, the test dogs daily received a chew treat to which 4% of the cellulose preparation was added. The control dogs were given a chew treat with identical formula, but without added cellulose. During the trial, all dogs were fed the same, complete dry food. There were 16 test dogs and 15 control dogs. Results: When compared with the baseline values, the administration of the test chew significantly improved 8 out of the 10 clinical signs. In the placebo group there was a significant improvement for 6 clinical signs. When the improvements over time for the two groups were compared, there were no statistically significant differences. When the score changes for all 10 clinical signs were added up as an overall index of improvement of periodontal disease, the test group showed a 17% greater amelioration than did the control group. Conclusion: The addition of the cellulose preparation had further enhanced the efficacy of the treat, possibly through an increase in mechanical cleansing and chewing time. This study indicates that a cellulose-containing treat is beneficial for dogs with periodontal disease and it is suggested that it may also impair its development.

  20. A retrospective investigation of canine adenovirus (CAV) infection in adult dogs in Turkey : article

    OpenAIRE

    Gur, S; A. Acar

    2009-01-01

    Canine adenovirus (CAV) type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11), and Akbash dogs (n = 17) and Turkish Greyhounds (n=15) in Es...

  1. First report of canine visceral leishmaniasis in Bulgaria

    OpenAIRE

    TSATCHEV, Illia; KYRIAZIS, Ioannis D.; BOUTSINI, Sofia; Karagouni, Evdokia; Dotsika, Eleni

    2010-01-01

    Seroepidemiological studies on canine leishmaniasis in Bulgaria, even in areas where human leishmaniasis has been detected, are controversial. This report describes 2 clinical cases of canine visceral leishmaniasis. The disease was confirmed by microscopical, serological, and molecular methods. It is, therefore, suggested that infected dogs could constitute the reservoir for human leishmaniasis in the country.

  2. A mechanism for chronic filarial hydrocele with implications for its surgical repair.

    Directory of Open Access Journals (Sweden)

    Joaquim Norões

    Full Text Available BACKGROUND: Chronic hydrocele is the most common manifestation of bancroftian filariasis, an endemic disease in 80 countries. In a prospective study, we evaluated the occurrence of intrascrotal lymphangiectasia, gross appearance/consistency of the testis, and the efficacy of complete excision of hydrocele sac in patients living in a bancroftian filariasis endemic area who underwent hydrocelectomy at the Center for Teaching, Research and Tertiary Referral for Bancroftian Filariasis (NEPAF. METHODOLOGY/PRINCIPAL FINDINGS: A total of 968 patients with uni- or bilateral filarial hydrocele (Group-1 and a Comparison Group (CG of 218 patients from the same area who already had undergone hydrocele-sac-sparing hydrocelectomy elsewhere were enrolled at NEPAF. Twenty-eight patients from the Comparison Group with hydrocele recurrence were re-operated on at NEPAF and constitute Group-2. In Group-1 a total of 1,128 hydrocelectomies were performed (mean patient age of 30.3 yr and mean follow-up of 8.6 yr [range 5.3-12]. The hydrocele recurrence rates in Group-1 and in the Comparison Group (mean age of 31.5 yr were 0.3%, and 19.3%, respectively (p<0,001. There was no hydrocele recurrence in Group-2 (mean patient age of 25.1 yr and mean follow-up of 6 yr [range 5-6.9]. Per surgically leaking or leak-prone dilated lymphatic vessels were seen in the inner or outer surface of the hydrocele sac wall or in surrounding tissue, particularly in the retrotesticular area, in 30.9% and in 46.3% of patients in Group-1 and Group-2, respectively (p = 0.081. The testicles were abnormal in shape, volume, and consistency in 203/1,128 (18% and 10/28 (35.7% of patients from Group-1 and Group-2, respectively (p = 0,025. CONCLUSIONS/SIGNIFICANCE: Lymph fluid from ruptured dilated lymphatic vessels is an important component of chronic filarial hydrocele fluid that threatens the integrity of the testis in an adult population living in bancroftian filariasis endemic areas. To avoid

  3. Novel pharmaceutical rationale against human lymphatic fi-larial parasite:An oxidative premise

    Institute of Scientific and Technical Information of China (English)

    R.D.Sharma; P.B.Janardhana; D.Gajalakshmi; M.V.R.Reddy; K.Goswami

    2009-01-01

    Objective:Mandate from WHO has boosted up anti-filarial drug research.Diethylcarbamazine citrate (DEC) was not known for any direct effect on filarial parasites.However,recent report proposed its direct apoptotic effect.Oxidative stress has been implicated in apoptotic impact.A study was designed to explore the possibili-ty of oxidative rationale to be operative in the direct anti-filarial effect of DEC.Methods:Various doses of DEC and potent oxidant H2 O2 alone were used in vitro to check for the effects on B.malayi microfilariae,fol-lowed by the use of DEC in combination with H2 O2 .Reversal of the oxidative impact of the drug was tested u-sing the antioxidant,vitamin C and also lipid peroxidation levels in the post incubation culture supernatants were assayed.Result:As expected,DEC alone failed to record any anti-filarial effect.H2 O2 alone also failed to show any significant effect until a very high dose was used.However,in combination significant anti-filarial effect was noticed,which allowed even 44% reduction in the dose of H2 O2 .Any significant lipid peroxidation was not found.Vitamin C demonstrated 30 % inhibitory effect.Conclusion:DEC and H2 O2 combination be-ing able to educe synergistic anti-filarial effect and inhibition of the same by vitamin C hinted towards covert oxidative component in the mechanism of DEC.Further implication of non-significant lipid peroxidation was addressed in the perspective of subtle oxidative nexus that seems to be operative in observed anti-filarial effect. Exploration of such rationale might lead to novel drug development.

  4. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    OpenAIRE

    Otávio Valério Carvalho; Clarisse Vieira Botelho; Caroline Gracielle Torres Ferreira; Paulo Oldemar Scherer; Jamária Adriana Pinheiro Soares-Martins; Márcia Rogéria de Almeida; Abelardo Silva Júnior

    2012-01-01

    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availabilit...

  5. Recent developments in Canine Cognitive Dysfunction Syndrome

    OpenAIRE

    Seisdedos Benzal, Alejandro; Galán Rodríguez, Alba

    2016-01-01

    Canine Cognitive Dysfunction Syndrome (CCD) is a neurodegenerative disease affecting aging dogs. CCD is an underdiagnosed disease that involves at least 14% of geriatric dogs, but apparently less than 2% of diseased dogs are diagnosed. There are several physiopathological similarities between Alzheimer disease (AD) and CCD, developing amyloid-β deposits in brain parenchyma and blood vessels, brain atrophy and neuronal loss. The clinical signs lead to behavioural changes. They are ...

  6. Finding Wolbachia in Filarial larvae and Culicidae Mosquitoes in Upper Egypt Governorate.

    Science.gov (United States)

    Dyab, Ahmed K; Galal, Lamia A; Mahmoud, Abeer E; Mokhtar, Yasser

    2016-06-01

    Wolbachia is an obligatory intracellular endosymbiotic bacterium, present in over 20% of all insects altering insect reproductive capabilities and in a wide range of filarial worms which is essential for worm survival and reproduction. In Egypt, no available data were found about Wolbachia searching for it in either mosquitoes or filarial worms. Thus, we aimed to identify the possible concurrent presence of Wolbachia within different mosquitoes and filarial parasites, in Assiut Governorate, Egypt using multiplex PCR. Initially, 6 pools were detected positive for Wolbachia by single PCR. The simultaneous detection of Wolbachia and filarial parasites (Wuchereria bancrofti, Dirofilaria immitis, and Dirofilaria repens) by multiplex PCR was spotted in 5 out of 6 pools, with an overall estimated rate of infection (ERI) of 0.24%. Unexpectedly, the highest ERI (0.53%) was for Anopheles pharoensis with related Wolbachia and W. bancrofti, followed by Aedes (0.42%) and Culex (0.26%). We also observed that Wolbachia altered Culex spp. as a primary vector for W. bancrofti to be replaced by Anopheles sp. Wolbachia within filaria-infected mosquitoes in our locality gives a hope to use bacteria as a new control trend simultaneously targeting the vector and filarial parasites. PMID:27417080

  7. APPLICATION OF BIOTECHNOLOGY TO THE STUDY OF FILARIAL PARASITES AND THEIR VECTORS

    Directory of Open Access Journals (Sweden)

    A. C. Vickery

    2012-09-01

    Full Text Available Over 200 species of filarial parasites have been described, although the life cycle and nature of their obligate intermediate arthropod vectors have been identified for only about a quarter of them. Traditional methods of studying phylogenetic relationships between closely related parasite species have utilized morphologic, biochemical and biologic characteristics, usually of the microfilarial stage. Identification of competent vectors from among complexes of sibling species, has employed similar techniques, despite the fact that differences between geographical isolates may reflect environmental rather than genetically controlled factors. Studies of the prevalence and transmission of animal, human and zoonotic filarids, so important for vector identification and control, has lead to the examination of filarial parasites at the genetic level. Genomic DNA libraries are being constructed and screened for clones which are species specific. From this work, DNA probes which can accurately enumerate larval stages in vector squash preparations, and monoclonal antibodies specific for defined filarial antigens, are being prepared. The nucleotide sequences of rRNA are also being defined. The application of these technologies to the study of filarial parasites and their vectors, promises to not only allow the construction of accurate phylogenetic trees, but also to provide the data necessary for the identification and control of the vectors of filarial pathogens of animals and man.

  8. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers: a new canine model for copper-metabolism disorders

    Directory of Open Access Journals (Sweden)

    Hille Fieten

    2016-01-01

    Full Text Available The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to Wilson disease, which is characterized by a predominantly hepatic copper accumulation. The low incidence and the phenotypic variability of human copper toxicosis hamper identification of causal genes or modifier genes involved in the disease pathogenesis. The Labrador retriever was recently characterized as a new canine model for copper toxicosis. Purebred dogs have reduced genetic variability, which facilitates identification of genes involved in complex heritable traits that might influence phenotype in both humans and dogs. We performed a genome-wide association study in 235 Labrador retrievers and identified two chromosome regions containing ATP7A and ATP7B that were associated with variation in hepatic copper levels. DNA sequence analysis identified missense mutations in each gene. The amino acid substitution ATP7B:p.Arg1453Gln was associated with copper accumulation, whereas the amino acid substitution ATP7A:p.Thr327Ile partly protected against copper accumulation. Confocal microscopy indicated that aberrant copper metabolism upon expression of the ATP7B variant occurred because of mis-localization of the protein in the endoplasmic reticulum. Dermal fibroblasts derived from ATP7A:p.Thr327Ile dogs showed copper accumulation and delayed excretion. We identified the Labrador retriever as the first natural, non-rodent model for ATP7B-associated copper toxicosis. Attenuation of copper accumulation by the ATP7A mutation sheds an interesting light on the interplay of copper transporters in body copper homeostasis and warrants a thorough investigation of ATP7A as a modifier gene in copper-metabolism disorders. The identification of two new functional

  9. Mosquito species diversity and abundance in relation to riceland agroecosystem and filarial infection in Kafr El-Sheikh Governorate, Egypt

    Directory of Open Access Journals (Sweden)

    TAREK M.Y. EL-SHEIKH , *KOTB M. HAMMAD AND **WALAA A. MOSELHI

    2010-06-01

    that filarial vectors Cx. pipiens and Cx. antennatus had a wide distribution and high relative density especially in irrigated rice regions and hence its role in disease transmission in Kafr El-Sheikh region needs further investigation .

  10. Chronic filarial infection provides protection against bacterial sepsis by functionally reprogramming macrophages.

    Directory of Open Access Journals (Sweden)

    Fabian Gondorf

    2015-01-01

    Full Text Available Helminths immunomodulate their hosts and induce a regulatory, anti-inflammatory milieu that prevents allergies and autoimmune diseases. Helminth immunomodulation may benefit sepsis outcome by preventing exacerbated inflammation and severe pathology, but the influence on bacterial clearance remains unclear. To address this, mice were chronically infected with the filarial nematode Litomosoides sigmodontis (L.s. and the outcome of acute systemic inflammation caused by i.p. Escherichia coli injection was determined. L.s. infection significantly improved E. coli-induced hypothermia, bacterial clearance and sepsis survival and correlated with reduced concentrations of associated pro-inflammatory cytokines/chemokines and a less pronounced pro-inflammatory macrophage gene expression profile. Improved sepsis outcome in L.s.-infected animals was mediated by macrophages, but independent of the alternatively activated macrophage subset. Endosymbiotic Wolbachia bacteria that are present in most human pathogenic filariae, as well as L.s., signal via TLR2 and modulate macrophage function. Here, gene expression profiles of peritoneal macrophages from L.s.-infected mice revealed a downregulation of genes involved in TLR signaling, and pulsing of macrophages in vitro with L.s. extract reduced LPS-triggered activation. Subsequent transfer improved sepsis outcome in naïve mice in a Wolbachia- and TLR2-dependent manner. In vivo, phagocytosis was increased in macrophages from L.s.-infected wild type, but not TLR2-deficient animals. In association, L.s. infection neither improved bacterial clearance in TLR2-deficient animals nor ameliorated E. coli-induced hypothermia and sepsis survival. These results indicate that chronic L.s. infection has a dual beneficial effect on bacterial sepsis, reducing pro-inflammatory immune responses and improving bacterial control. Thus, helminths and their antigens may not only improve the outcome of autoimmune and allergic diseases

  11. C-cinnamoyl glycosides as a new class of anti-filarial agents.

    Science.gov (United States)

    Roy, Priya; Dhara, Debashis; Parida, Pravat Kumar; Kar, Rajiv Kumar; Bhunia, Anirban; Jana, Kuladip; Sinha Babu, Santi P; Misra, Anup Kumar

    2016-05-23

    A series of C-cinnamoyl glycosides has been synthesized in good yield by the BF3·OEt2 catalyzed aldol condensation of C-glycosylated acetone derivative with a variety of aromatic aldehydes. The synthesized compounds were evaluated for their potential as anti-filarial agents against bovine filarial parasite Setaria cervi and human filariid Wuchereria bancrofti using a number of biological assays such as relative movability (RM) assessment and MTT reduction assay. Among twenty seven test compounds six compounds were found active in terms of MIC, IC50 and LC50 values. Further biological studies were carried out using three lead compounds because of their significantly low MIC values and IC50 values compared to the standard anti-filarial drug Ivermectin. In addition, structure activity relationship study of the test compounds has been carried out using 3D-QSAR analysis. PMID:27015610

  12. Canine Distemper Outbreak in Rhesus Monkeys, China

    OpenAIRE

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang

    2011-01-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  13. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes

    OpenAIRE

    Hytönen, Marjo K.; Meharji Arumilli; Lappalainen, Anu K; Marta Owczarek-Lipska; Vidhya Jagannathan; Sruthi Hundi; Elina Salmela; Patrick Venta; Eva Sarkiala; Tarja Jokinen; Daniela Gorgas; Juha Kere; Pekka Nieminen; Cord Drögemüller; Hannes Lohi

    2016-01-01

    One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined ge...

  14. Molecular Characterization of Three Canine Models of Human Rare Bone Diseases: Caffey, van den Ende-Gupta, and Raine Syndromes.

    OpenAIRE

    Hytönen, Marjo K.; Arumilli, Meharji; Lappalainen, Anu K; Owczarek, Marta; Jagannathan, Vidhya; Hundi, Sruthi; Salmela, Elina; Venta, Patrick; Sarkiala, Eva; Jokinen, Tarja; Gorgas, Daniela; Kere, Juha; Nieminen, Pekka; Drögemüller, Cord; Lohi, Hannes

    2016-01-01

    One to two percent of all children are born with a developmental disorder requiring pediatric hospital admissions. For many such syndromes, the molecular pathogenesis remains poorly characterized. Parallel developmental disorders in other species could provide complementary models for human rare diseases by uncovering new candidate genes, improving the understanding of the molecular mechanisms and opening possibilities for therapeutic trials. We performed various experiments, e.g. combined ge...

  15. Thorough Investigation of a Canine Autoinflammatory Disease (AID) Confirms One Main Risk Locus and Suggests a Modifier Locus for Amyloidosis

    OpenAIRE

    Olsson, Mia; Tintle, Linda; Kierczak, Marcin; Perloski, Michele; Tonomura, Noriko; Lundquist, Andrew; Murén, Eva; Fels, Max; Tengvall, Katarina; Pielberg, Gerli; Dufaure De Citres, Caroline; Dorso, Laetitia; Abadie, Jérôme; Hanson, Jeanette; Thomas, Anne

    2013-01-01

    Autoinflammatory disease (AID) manifests from the dysregulation of the innate immune system and is characterised by systemic and persistent inflammation. Clinical heterogeneity leads to patients presenting with one or a spectrum of phenotypic signs, leading to difficult diagnoses in the absence of a clear genetic cause. We used separate genome-wide SNP analyses to investigate five signs of AID (recurrent fever, arthritis, breed specific secondary dermatitis, otitis and systemic reactive amylo...

  16. Diversity, Host Specialization, and Geographic Structure of Filarial Nematodes Infecting Malagasy Bats.

    Directory of Open Access Journals (Sweden)

    Beza Ramasindrazana

    Full Text Available We investigated filarial infection in Malagasy bats to gain insights into the diversity of these parasites and explore the factors shaping their distribution. Samples were obtained from 947 individual bats collected from 52 sites on Madagascar and representing 31 of the 44 species currently recognized on the island. Samples were screened for the presence of micro- and macro-parasites through both molecular and morphological approaches. Phylogenetic analyses showed that filarial diversity in Malagasy bats formed three main groups, the most common represented by Litomosa spp. infecting Miniopterus spp. (Miniopteridae; a second group infecting Pipistrellus cf. hesperidus (Vespertilionidae embedded within the Litomosoides cluster, which is recognized herein for the first time from Madagascar; and a third group composed of lineages with no clear genetic relationship to both previously described filarial nematodes and found in M. griveaudi, Myotis goudoti, Neoromicia matroka (Vespertilionidae, Otomops madagascariensis (Molossidae, and Paratriaenops furculus (Hipposideridae. We further analyzed the infection rates and distribution pattern of Litomosa spp., which was the most diverse and prevalent filarial taxon in our sample. Filarial infection was disproportionally more common in males than females in Miniopterus spp., which might be explained by some aspect of roosting behavior of these cave-dwelling bats. We also found marked geographic structure in the three Litomosa clades, mainly linked to bioclimatic conditions rather than host-parasite associations. While this study demonstrates distinct patterns of filarial nematode infection in Malagasy bats and highlights potential drivers of associated geographic distributions, future work should focus on their alpha taxonomy and characterize arthropod vectors.

  17. Diversity, Host Specialization, and Geographic Structure of Filarial Nematodes Infecting Malagasy Bats.

    Science.gov (United States)

    Ramasindrazana, Beza; Dellagi, Koussay; Lagadec, Erwan; Randrianarivelojosia, Milijaona; Goodman, Steven M; Tortosa, Pablo

    2016-01-01

    We investigated filarial infection in Malagasy bats to gain insights into the diversity of these parasites and explore the factors shaping their distribution. Samples were obtained from 947 individual bats collected from 52 sites on Madagascar and representing 31 of the 44 species currently recognized on the island. Samples were screened for the presence of micro- and macro-parasites through both molecular and morphological approaches. Phylogenetic analyses showed that filarial diversity in Malagasy bats formed three main groups, the most common represented by Litomosa spp. infecting Miniopterus spp. (Miniopteridae); a second group infecting Pipistrellus cf. hesperidus (Vespertilionidae) embedded within the Litomosoides cluster, which is recognized herein for the first time from Madagascar; and a third group composed of lineages with no clear genetic relationship to both previously described filarial nematodes and found in M. griveaudi, Myotis goudoti, Neoromicia matroka (Vespertilionidae), Otomops madagascariensis (Molossidae), and Paratriaenops furculus (Hipposideridae). We further analyzed the infection rates and distribution pattern of Litomosa spp., which was the most diverse and prevalent filarial taxon in our sample. Filarial infection was disproportionally more common in males than females in Miniopterus spp., which might be explained by some aspect of roosting behavior of these cave-dwelling bats. We also found marked geographic structure in the three Litomosa clades, mainly linked to bioclimatic conditions rather than host-parasite associations. While this study demonstrates distinct patterns of filarial nematode infection in Malagasy bats and highlights potential drivers of associated geographic distributions, future work should focus on their alpha taxonomy and characterize arthropod vectors. PMID:26751792

  18. Oncolytic Virotherapy of Canine and Feline Cancer

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    2014-05-01

    Full Text Available Cancer is the leading cause of disease-related death in companion animals such as dogs and cats. Despite recent progress in the diagnosis and treatment of advanced canine and feline cancer, overall patient treatment outcome has not been substantially improved. Virotherapy using oncolytic viruses is one promising new strategy for cancer therapy. Oncolytic viruses (OVs preferentially infect and lyse cancer cells, without causing excessive damage to surrounding healthy tissue, and initiate tumor-specific immunity. The current review describes the use of different oncolytic viruses for cancer therapy and their application to canine and feline cancer.

  19. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  20. Detection of filarial antigen in urine of humans with Wuchereria bancrofti infection by immunoradiometric assay

    International Nuclear Information System (INIS)

    Human urine samples of different groups were analyzed for the presence of filarial antigen by immuno-radiometric assay (IRMA) using 125I-Rabbit IgG antibodies to B. malayi antigen. Six out of ten microfilaraemia, one out of five clinical filariasis had detectable antigen, while none of the endemic and non-endemic normals (n=12) were positive. The effect of heat-acid treatment on the detectability of antigen in the urine and serum was explored. Heat-acid treatment in general did not reduce the level of filarial antigen in the urine samples while there was a measurable reduction in the antigen levels in the sera. (author)

  1. Lipoprotein biosynthesis as a target for anti-Wolbachia treatment of filarial nematodes

    Directory of Open Access Journals (Sweden)

    Slatko Barton E

    2010-10-01

    Full Text Available Abstract Background Lymphatic filariasis and onchocerciasis are debilitating diseases caused by filarial nematodes. Disease pathogenesis is induced by inflammatory responses following the death of the parasite. Wolbachia endosymbionts of filariae are potent inducers of innate and adaptive inflammation and bacterial lipoproteins have been identified as the ligands that bind toll-like receptors (TLR 2 and TLR6. Lipoproteins are important structural and functional components of bacteria and therefore enzymes involved in Wolbachia lipoprotein biosynthesis are potential chemotherapeutic targets. Results Globomycin, a signal peptidase II (LspA inhibitor, has activity against Gram-negative bacteria and a putative lspA gene has been identified from the Wolbachia genome of Brugia malayi (wBm. The amino acids required for function are strictly conserved and functionality was verified by complementation tests in a temperature-sensitive Escherichia coli lspA mutant. Also, transformation of wild type E. coli with Wolbachia lspA conferred significant globomycin resistance. A cell-based screen has been developed utilizing a Wolbachia-containing Aedes albopictus cell line to assay novel compounds active against Wolbachia. Globomycin was screened using this assay, which resulted in a dose-dependent reduction in Wolbachia load. Furthermore, globomycin was also effective in reducing the motility and viability of adult B. malayi in vitro. Conclusions These studies validate lipoprotein biosynthesis as a target in an organism for which no genetic tools are available. Further studies to evaluate drugs targeting this pathway are underway as part of the A-WOL drug discovery and development program.

  2. CLONING AND CHARACTERISATION OF ALKALI MYOSIN LIGHT CHAIN GENE (MLC-3 OF CATTLE FILARIAL PARASITE SETARIA DIGITATA

    Directory of Open Access Journals (Sweden)

    Arumugam Murugananthan, Eric Hamilton Karunanayake*, Kamani Hemamala Tennekoon

    2010-11-01

    Full Text Available Lymphatic filariasis is a tropical disease caused by filarial parasites including Wuchereria bancrofti. Although bancroftian filariasis causes severe disabling and debilitating clinical conditions in human, very little is known about the molecular biology of the parasite. The paucity of parasitic material is the main reason for this lack of knowledge. Setaria digitata is a cattle filarial parasite, closely resembling W. bancrofti in many aspects. Therefore it can be used as a model organism to study W. bancrofti. In the present study, the genomic library of S. digitata adult parasites was constructed and probed with a 32P labeled partial mRNA sequence PCR amplified from a previously isolated cDNA clone containing a 661 bp mRNA transcript of S. digitata alkali myosin light chain gene. Isolated positive clones were sequenced and edited by using bioinformatics tools. Though the 5´ flanking region did not reveal any consensus TATA box sequences, a potential CAAT box like sequence, CCAAT and seven possible transcription factor elements were identified. The entire gene had four exons encoding 149 amino acids interrupted by three introns of varying lengths of 87, 295 and 69 bp respectively. Sequences around the splice junctions were fairly conserved and agreed with the general GT-AG splicing rule. The 3´ flanking region consists of three putative polyadenylation signals with the sequence AATAAA. The gene was AT rich with a GC content of 35%. Southern hybridisation studies suggested that this gene is likely to be a single-copy gene. Homology search of amino acid sequences showed more than 80% similarity with Caenorhabditis species and 40-50% with other vertebrate and invertebrate myosin light chains. Analysis of the amino acid sequence with the NCBI conserved domain database for interactive domain family identified the protein as a member of calcium binding protein family as it comprised of two highly conserved EF hand motifs, and may suggest a

  3. Early eruption of permanent canines

    Directory of Open Access Journals (Sweden)

    S Madhu

    2012-01-01

    Full Text Available Systemic and local factors can modify the eruption time of teeth. Generalized eruption time changes could be due to some systemic diseases like hyperthyroidism, hypophosphatasia, precocious puberty, Proteus syndrome, etc. Localized early eruption of permanent teeth could be due to early extraction of deciduous teeth. Presented here is an extremely rare case of early eruption of permanent canines in a 7-year old female child. Though the number of such cases is very limited, the clinician should poses adequate knowledge and keeps an open eye to identify such cases.

  4. The Canine Oral Microbiome

    OpenAIRE

    Dewhirst, Floyd E.; Klein, Erin A.; Thompson, Emily C.; Blanton, Jessica M.; Chen, Tsute; Milella, Lisa; Buckley, Catherine M. F.; Davis, Ian J.; Bennett, Marie-Lousie; Marshall-Jones, Zoe V.

    2012-01-01

    Determining the bacterial composition of the canine oral microbiome is of interest for two primary reasons. First, while the human oral microbiome has been well studied using molecular techniques, the oral microbiomes of other mammals have not been studied in equal depth using culture independent methods. This study allows a comparison of the number of bacterial taxa, based on 16S rRNA-gene sequence comparison, shared between humans and dogs, two divergent mammalian species. Second, canine or...

  5. Eosinophils and filarial parasites. Factors affecting eosinophils in animal models and the detection of filarial antigens by radioimmunoassay

    International Nuclear Information System (INIS)

    The effects of drugs, such as diethylcarbamazine (DEC), hydrocortisone and an immunologically stimulated state of the host on the sites of localization and behaviour of 113Insup(m)-eosinophils, were studied in guinea pigs. The sites of localization of 113Insup(m)-eosinophils were in the lungs, liver, spleen, bone and muscle. Administration of hydrocortisone did not change the normal distribution. After administration of DEC higher levels of 113Insup(m)-eosinophils were seen in the circulation, bone and muscle. When animals were actively immunized there was an avid concentration of cells in the liver and spleen. Preliminary experiments were undertaken to demonstrate the existence of an eosinophilopoetic factor in tropical eosinophilia (TE), using a rat model. Human gammaglobulin (HGG)-coated latex particles when injected intravenously induced a rise of eosinophils in the bone marrow on the fourth post-injection day, followed by a rise in peripheral eosinophils on the sixth day. When sera of stimulated rats were re-injected into normal rats there was again an eosinophilic response, suggesting the presence of a humoral transferable factor. Sera of two patients of TE also induced a rise of eosinophils in the bone marrow of rats injected with the sera, suggesting the presence of some circulating factor in TE which can stimulate eosinophilopoesis in rats. Serological diagnosis of filariasis by testing for antibodies does not necessarily detect active infection. However, determination of circulating antigens may prove to be more useful. Owing to the difficulty of obtaining W. bancrofti antigens, heteroantigens of Settaria cervii, which is cross-active with W. bancrofti, are used in the development of a radioimmunoassay for filarial antigens. (author)

  6. Comparison of selected canine vector-borne diseases between urban animal shelter and rural hunting dogs in Korea

    Directory of Open Access Journals (Sweden)

    Ahn KyuSung

    2010-04-01

    Full Text Available Abstract A serological survey for Dirofilaria immitis, Anaplasma phagocytophilum, Ehrlichia canis, and Borrelia burgdorferi infections in rural hunting and urban shelter dogs mainly from southwestern regions of the Republic of Korea (South Korea was conducted. From a total of 229 wild boar or pheasant hunting dogs, the number of serologically positive dogs for any of the four pathogens was 93 (40.6%. The highest prevalence observed was D. immitis (22.3%, followed by A. phagocytophilum (18.8%, E. canis (6.1% and the lowest prevalence was B. burgdorferi (2.2%. In contrast, stray dogs found within the city limits of Gwangju showed seropositivity only to D. immitis (14.6%, and none of the 692 dogs responded positive for A. phagocytophilum, E. canis or B. burgdorferi antibodies. This study indicates that the risk of exposure to vector-borne diseases in rural hunting dogs can be quite high in Korea, while the urban environment may not be suitable for tick infestation on dogs, as evidenced by the low infection status of tick-borne pathogens in stray dogs.

  7. Point-of-care quantification of blood-borne filarial parasites with a mobile phone microscope.

    Science.gov (United States)

    D'Ambrosio, Michael V; Bakalar, Matthew; Bennuru, Sasisekhar; Reber, Clay; Skandarajah, Arunan; Nilsson, Lina; Switz, Neil; Kamgno, Joseph; Pion, Sébastien; Boussinesq, Michel; Nutman, Thomas B; Fletcher, Daniel A

    2015-05-01

    Parasitic helminths cause debilitating diseases that affect millions of people in primarily low-resource settings. Efforts to eliminate onchocerciasis and lymphatic filariasis in Central Africa through mass drug administration have been suspended because of ivermectin-associated serious adverse events, including death, in patients infected with the filarial parasite Loa loa. To safely administer ivermectin for onchocerciasis or lymphatic filariasis in regions co-endemic with L. loa, a strategy termed "test and (not) treat" has been proposed whereby those with high levels of L. loa microfilariae (>30,000/ml) that put them at risk for life-threatening serious adverse events are identified and excluded from mass drug administration. To enable this, we developed a mobile phone-based video microscope that automatically quantifies L. loa microfilariae in whole blood loaded directly into a small glass capillary from a fingerprick without the need for conventional sample preparation or staining. This point-of-care device automatically captures and analyzes videos of microfilarial motion in whole blood using motorized sample scanning and onboard motion detection, minimizing input from health care workers and providing a quantification of microfilariae per milliliter of whole blood in under 2 min. To validate performance and usability of the mobile phone microscope, we tested 33 potentially Loa-infected patients in Cameroon and confirmed that automated counts correlated with manual thick smear counts (94% specificity; 100% sensitivity). Use of this technology to exclude patients from ivermectin-based treatment at the point of care in Loa-endemic regions would allow resumption/expansion of mass drug administration programs for onchocerciasis and lymphatic filariasis in Central Africa. PMID:25947164

  8. Transcription profiling reveals stage- and function-dependent expression patterns in the filarial nematode Brugia malayi

    Directory of Open Access Journals (Sweden)

    Li Ben-Wen

    2012-05-01

    Full Text Available Abstract Background Brugia malayi is a nematode parasite that causes lymphatic filariasis, a disfiguring and disabiling tropical disease. Although a first draft genome sequence was released in 2007, very little is understood about transcription programs that govern developmental changes required for the parasite’s development and survival in its mammalian and insect hosts. Results We used a microarray with probes that represent some 85% of predicted genes to generate gene expression profiles for seven parasite life cycle stages/sexes. Approximately 41% of transcripts with detectable expression signals were differentially expressed across lifecycle stages. Twenty-six percent of transcripts were exclusively expressed in a single parasite stage, and 27% were expressed in all stages studied. K-means clustering of differentially expressed transcripts revealed five major transcription patterns that were associated with parasite lifecycle stages or gender. Examination of known stage-associated transcripts validated these data sets and suggested that newly identified stage or gender-associated transcripts may exercise biological functions in development and reproduction. The results also indicate that genes with similar transcription patterns were often involved in similar functions or cellular processes. For example, nuclear receptor family gene transcripts were upregulated in gene expression pattern four (female-enriched while protein kinase gene family transcripts were upregulated in expression pattern five (male-enriched. We also used pair-wise comparisons to identify transcriptional changes between life cycle stages and sexes. Conclusions Analysis of gene expression patterns of lifecycle in B. malayi has provided novel insights into the biology of filarial parasites. Proteins encoded by stage-associated and/or stage-specific transcripts are likely to be critically important for key parasite functions such as establishment and maintenance of

  9. Canine pluripotent stem cells: Are they ready for clinical applications?

    Directory of Open Access Journals (Sweden)

    Dean Harvey Betts

    2015-10-01

    Full Text Available The derivation of canine embryonic stem cells and generation of canine induced pluripotent stem cells are significant achievements that have unlocked the potential for developing novel cell-based disease models, drug discovery platforms and transplantation therapies in the dog. A progression from concept to cure in this clinically relevant companion animal will not only help our canine patients but also help advance human regenerative medicine. Nevertheless, many issues remain to be resolved before pluripotent cells can be used clinically in a safe and reproducible manner.

  10. Prognostic markers of canine pyometra

    Directory of Open Access Journals (Sweden)

    M.C. Sant'Anna

    2014-12-01

    Full Text Available The pyometra is a disease that affects middle age and elderly female dogs during diestrus. Hormonal, microbiological, biochemical and hematological aspects are well described. However, few studies have evaluated the role of each in the prognosis of canine pyometra. The aim of this study was to identify markers associated with clinical worsening of dogs with pyometra. We prospectively evaluated 80 dogs with pyometra treated surgically. Group 1 consisted of dogs that were discharged within 48 hours after surgery and Group 2 consisted of those who required prolonged hospitalization or died. The findings of hematological, biochemical and blood lactate levels were compared between groups and variables such as bacterial multidrug resistance, systemic inflammatory response syndrome (SIRS, hyperlactatemia and increased creatinine were analyzed through the dispersion of frequencies between groups. Among the variables studied, the presence of SIRS and elevated serum creatinine >2.5mg/mL were effective in predicting the worsening of the disease and can be used as prognostic markers of canine pyometra.

  11. Xenomonitoring of different filarial nematodes using single and multiplex PCR in mosquitoes from Assiut Governorate, Egypt.

    Science.gov (United States)

    Dyab, Ahmed Kamal; Galal, Lamia Ahmed; Mahmoud, Abeer El-Sayed; Mokhtar, Yasser

    2015-02-01

    Wuchereria bancrofti, Dirofilaria immitis, and Dirofilaria repens are filarial nematodes transmitted by mosquitoes belonging to Culex, Aedes, and Anopheles genera. Screening by vector dissection is a tiresome technique. We aimed to screen filarial parasites in their vectors by single and multiplex PCR and evaluate the usefulness of multiplex PCR as a rapid xenomonitoring and simultaneous differentiation tool, in area where 3 filarial parasites are coexisting. Female mosquitoes were collected from 7 localities in Assiut Governorate, were microscopically identified and divided into pools according to their species and collection site. Detection of W. bancrofti, D. immitis, and D. repens using single PCR was reached followed by multiplex PCR. Usefulness of multiplex PCR was evaluated by testing mosquito pools to know which genera and species are used by filarial parasites as a vector. An overall estimated rate of infection (ERI) in mosquitoes was 0.6%; the highest was Culex spp. (0.47%). W. bancrofti, D. immitis, and D. repens could be simultaneously and differentially detected in infected vectors by using multiplex PCR. Out of 100 mosquito pools, 8 were positive for W. bancrofti (ERI of 0.33%) and 3 pools each were positive for D. immitis and D. repens (ERI 0.12%). The technique showed 100% sensitivity and 98% specificity. El-Nikhila, El-Matiaa villages, and Sahel Seleem district in Assiut Governorate, Egypt are still endemic foci for filarial parasites. Multiplex PCR offers a reliable procedure for molecular xenomonitoring of filariasis within their respective vectors in endemic areas. Therefore, it is recommended for evaluation of mosquito infection after lymphatic filariasis eradication programs. PMID:25748712

  12. Inhibition of cathepsin B by E-64 induces oxidative stress and apoptosis in filarial parasite.

    Directory of Open Access Journals (Sweden)

    Mohit Wadhawan

    Full Text Available Current available antifilarial drug strategies only eliminate the larval stages of filarial parasites. Therefore, there is an urgent need of drugs which are macrofilaricidals. Identification of molecular targets crucial for survival of parasite is a prerequisite for drug designing. Cathepsin B, a cysteine protease family member is known to play crucial role in the normal growth, digestion of nutrients, exsheathment of the helminth parasites. Therefore, we targeted this enzyme in the filarial parasite using its specific inhibitor, E-64.We have exposed the parasites to E-64 and observed their motility and viability at various time intervals. It caused marked decrease in the motility and viability of the parasites ultimately leading to their death after 8 hours. It is well known that E-64 protects the cell from apoptosis, however, it causes apoptotic effect in carcinoma cell lines. To understand the mechanism of action of E-64 on parasite survival, we have measured levels of different apoptotic markers in the treated parasites. E-64 significantly reduced the level of ced-9 and activity of tyrosine phosphatases, cytochrome c oxidase. It also activated ced-3, homolog of mammalian caspase 3 suggesting initiation of an apoptotic like event in the filarial parasites. Different antioxidant enzymes were also evaluated to further explore the mechanism behind the death of the parasites. There was marked decrease in the level of GSH and activity of Glutathione reductase and glutathione-s-transferase leading to increased generation of reactive oxygen species. This led to the induced oxidation of fatty acids and protein which might alter the mitochondrial membrane permeability.This study suggests that inhibition of cathepsin B by E-64 generates oxidative stress followed by mitochondrial mediated apoptotic like event in filarial parasites leading to their death. Hence, suggesting filarial cathepsin B as a potential chemotherapeutic target for lymphatic

  13. Characterization of a Canine Homolog of Human Aichivirus

    OpenAIRE

    Kapoor, A.; Simmonds, P.; Dubovi, E. J.; Qaisar, N.; Henriquez, J.A.; Medina, J.; Shields, S.; Lipkin, W. I.

    2011-01-01

    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions...

  14. Characterization of a Canine Homolog of Human Aichivirus▿

    OpenAIRE

    Kapoor, Amit; Simmonds, Peter; Dubovi, Edward J.; Qaisar, Natasha; Henriquez, Jose A.; Medina, Jan; Shields, Shelly; Lipkin, W. Ian

    2011-01-01

    Many of our fatal “civilization” infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5′ and 3′ untranslated regions...

  15. Characterization of a Canine Homolog of Human Aichivirus▿

    OpenAIRE

    Kapoor, A; Simmonds, P.; Dubovi, E J; Qaisar, N.; Henriquez, J. A.; J. Medina; S Shields; Lipkin, W. I.

    2011-01-01

    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions...

  16. Insights into the Pathogenesis of Disease in Human Lymphatic Filariasis

    OpenAIRE

    Nutman, Thomas B.

    2013-01-01

    Although two thirds of the 120 million people infected with lymph-dwelling filarial parasites have subclinical infections, ∼40 million have lymphedema and/or other pathologic manifestations including hydroceles (and other forms of urogenital disease), episodic adenolymphangitis, lymphedema, and (in its most severe form) elephantiasis. Adult filarial worms reside in the lymphatics and lymph nodes and induce lymphatic dilatation. Progressive lymphatic damage and pathology results primarily from...

  17. Avian-origin H3N2 canine influenza A viruses in Southern China

    OpenAIRE

    Li, Shoujun; Shi, Zhihai; Jiao, Peirong; Zhang, Guihong; Zhong, Zhiwen; Tian, Wenru; Long, Li-Ping; Cai, Zhipeng; Zhu, Xingquan; Liao, Ming; Wan, Xiu-Feng

    2010-01-01

    This study reports four sporadic cases of H3N2 canine influenza in southern China, which were identified from sick dogs from May 2006 to October 2007. The evolutionary analysis showed that all eight segments of these four viruses are avian-origin and phylogenetically close to the H3N2 canine influenza viruses reported earlier in South Korea. Systematic surveillance is required to monitor the disease and evolutionary behavior of this virus in canine populations in China.

  18. Evidence-based control of canine rabies: a critical review of population density reduction

    OpenAIRE

    Morters, M.K.; Restif, O.; Hampson, K.; Cleaveland, S.; Wood, J.L.N.; Conlan, A J K; Boots, M.

    2013-01-01

    Control measures for canine rabies include vaccination and reducing population density through culling or sterilization. Despite the evidence that culling fails to control canine rabies, efforts to reduce canine population density continue in many parts of the world. The rationale for reducing population density is that rabies transmission is density-dependent, with disease incidence increasing directly with host density. This may be based, in part, on an incomplete interpretation of historic...

  19. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho

    2012-01-01

    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  20. Seasonal prevalence and blood meal analysis of filarial vector Culex quinquefasciatus in coastal areas of Digha, West Bengal, India

    Directory of Open Access Journals (Sweden)

    Syed Afrin Azmi

    2015-01-01

    Interpretation & conclusion: This study suggested Cx. quinquefasciatus as the dominant mosquito species in the study area; and the anthropophilic nature of Cx. quinquefasciatus might be the reason of increase in the intensity of filarial transmission in coastal areas of Digha.

  1. Disease: H01043 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available H01043 Onchocerciasis; River blindness; Robles' Disease Human onchocerciasis is an infection cau ... sed by the filarial nematode ... Onchocerca volvulus transmitted by Simulium blackf ... ualistic symbionts and these Wolbachia affects the nematode ... survival. Infectious disease Onchocerca volvulus W ...

  2. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  3. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Hepatitis and Canine Adenovirus...; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus. Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed...

  4. Comparing the mitochondrial genomes of Wolbachia-dependent and independent filarial nematode species

    Directory of Open Access Journals (Sweden)

    McNulty Samantha N

    2012-04-01

    Full Text Available Abstract Background Many species of filarial nematodes depend on Wolbachia endobacteria to carry out their life cycle. Other species are naturally Wolbachia-free. The biological mechanisms underpinning Wolbachia-dependence and independence in filarial nematodes are not known. Previous studies have indicated that Wolbachia have an impact on mitochondrial gene expression, which may suggest a role in energy metabolism. If Wolbachia can supplement host energy metabolism, reduced mitochondrial function in infected filarial species may account for Wolbachia-dependence. Wolbachia also have a strong influence on mitochondrial evolution due to vertical co-transmission. This could drive alterations in mitochondrial genome sequence in infected species. Comparisons between the mitochondrial genome sequences of Wolbachia-dependent and independent filarial worms may reveal differences indicative of altered mitochondrial function. Results The mitochondrial genomes of 5 species of filarial nematodes, Acanthocheilonema viteae, Chandlerella quiscali, Loa loa, Onchocerca flexuosa, and Wuchereria bancrofti, were sequenced, annotated and compared with available mitochondrial genome sequences from Brugia malayi, Dirofilaria immitis, Onchocerca volvulus and Setaria digitata. B. malayi, D. immitis, O. volvulus and W. bancrofti are Wolbachia-dependent while A. viteae, C. quiscali, L. loa, O. flexuosa and S. digitata are Wolbachia-free. The 9 mitochondrial genomes were similar in size and AT content and encoded the same 12 protein-coding genes, 22 tRNAs and 2 rRNAs. Synteny was perfectly preserved in all species except C. quiscali, which had a different order for 5 tRNA genes. Protein-coding genes were expressed at the RNA level in all examined species. In phylogenetic trees based on mitochondrial protein-coding sequences, species did not cluster according to Wolbachia dependence. Conclusions Thus far, no discernable differences were detected between the mitochondrial

  5. Canine epilepsy as a translational model?

    Science.gov (United States)

    Potschka, Heidrun; Fischer, Andrea; von Rüden, Eva-Lotta; Hülsmeyer, Velia; Baumgärtner, Wolfgang

    2013-04-01

    Dogs with spontaneous diseases can exhibit a striking similarity in etiology, clinical manifestation, and disease course when compared to human patients. Therefore, dogs are intensely discussed as a translational model of human disease. In particular, genetic studies in selected dog breeds serve as an excellent tool to identify epilepsy disease genes. In addition, canine epilepsy is discussed as a translational platform for drug testing. On one hand, epileptic dogs might serve as an interesting model by allowing the evaluation of drug efficacy and potency under clinical conditions with a focus on chronic seizures resistant to standard medication, preventive strategies, or status epilepticus. On the other hand, several limitations need to be considered including owner-based seizure monitoring, species differences in pharmacokinetics and drug interactions, as well as cost-intensiveness. The review gives an overview on the current state of knowledge regarding the etiology, clinical manifestation, pathology, and drug response of canine epilepsy, also pointing out the urgent need for further research on specific aspects. Moreover, the putative advantages, the disadvantages, and limitations of antiepileptic drug testing in canine epilepsy are critically discussed. PMID:23506100

  6. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias

    2016-02-01

    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  7. Microbiological and histopathological aspects of canine pyometra

    OpenAIRE

    Coggan, Jennifer Anne; Melville, Priscilla Anne; de Oliveira, Clair Motos; Faustino, Marcelo; Moreno, Andréa Micke; Benites, Nilson Roberti

    2008-01-01

    As pyometra is recognized as one of the main causes of disease and death in the bitch the purposes of this study were to evaluate microbiological and histopathological aspects of canine pyometra and to research the virulence factors of the E. coli isolates identifying possible risks to human health. The microbiological isolation from the intrauterine contents of 100 dogs with pyometra was carried out and the virulence factors in the E. coli strains were identified using PCR method. This study...

  8. DIVERSITY AND MORPHOMETRIC DATA OF BLOOD FILARIAL lARVAE IN CARNIVOROUS FROM BULGARIA

    OpenAIRE

    Panayotova–Pencheva M.; Trifonova A.; Mirchev R.; Movsesyan S.

    2014-01-01

    During the period 2012-2013 investigations of blood samples from domestic dogs ( Canis familiaris ), goldon jackals ( Canis aureus ) and red foxes ( Vulpes vulpes ) originated from different regions of Bulgaria were performed aiming to document diversity and morphometric characteristics of established filarial larvae. Following features of microfilariae were analyzed: peculiarities in the shape, body length and maximum body width. According to the morphological characteristics three types of ...

  9. A rare case of giant leiomyosarcoma in a filarial scrotum: a case report

    Directory of Open Access Journals (Sweden)

    Kallianpur Ashwin A

    2011-02-01

    Full Text Available Abstract Giant leiomyosarcoma of scrotum is a rare tumour. A case of scrotum leiomyosarcoma is presented in a 67 year old patient with scrotal filariasis which was managed successfully with total scrotectomy with bilateral orchidectomy, degloved penis reconstructed with rotation advancement supra pubic fasciocutaneous flap. We made a literature search proving the rarity of this lesion type. Only 36 cases have been described and the first case in a filarial scrotum

  10. Impact of basic lymphedema management and antifilarial treatment on acute dermatolymphangioadenitis episodes and filarial antigenaemia

    OpenAIRE

    H A El-Nahas; A M El-Shazly; Abulhassan, M; N A Nabih; N Mousa

    2011-01-01

    Background: A major factor in the progression of lymphedema is acute dermatolymphangioadenitis (ADLA). Aims : To study ADLA episodes and antigenaemia in patients with different grades of filarial lymphedema at pre- and two years post-treatment. Setting and Design: A prospectively conducted study from May 2008 through May 2010. Patients and Methods: Forty five patients complaining of limb swelling with present or past history of limb redness suggestive of ADLA attacks were included. Patients w...

  11. Diversity, Host Specialization, and Geographic Structure of Filarial Nematodes Infecting Malagasy Bats

    OpenAIRE

    Beza Ramasindrazana; Koussay Dellagi; Erwan Lagadec; Milijaona Randrianarivelojosia; Goodman, Steven M; Pablo Tortosa

    2016-01-01

    International audience We investigated filarial infection in Malagasy bats to gain insights into the diversity of these parasites and explore the factors shaping their distribution. Samples were obtained from 947 individual bats collected from 52 sites on Madagascar and representing 31 of the 44 species currently recognized on the island. Samples were screened for the presence of micro-and macro-parasites through both molecular and morphological approaches. Phylo-genetic analyses showed th...

  12. A new filarial nematode (Onchocercidae) from warthogs (Phacochoerus aethiopicus) of the Kruger National Park.

    Science.gov (United States)

    Palmieri, J R; Pletcher, J M; De Vos, V; Boomker, J

    1985-09-01

    Fifty-five warthogs [Phacochoerus aethiopicus (Suidae: Artiodactyla)] from the Kruger National Park, Republic of South Africa, were examined for parasites. Adult filarial nematodes were found in lymphatic vessels adjacent to peripheral and visceral lymph nodes, and microfilariae were found in lymph nodes and circulating blood. Both the adult parasite and the microfilaria are described. Specific identification is pending confirmation and recovery of intact adult specimens and microfilariae identical to those described herein. PMID:4067247

  13. Sequencing and G-quadruplex folding of the canine proto-oncogene KIT promoter region: might dog be used as a model for human disease?

    Directory of Open Access Journals (Sweden)

    Silvia Da Ros

    Full Text Available Downregulation of gene expression by induction of non-canonical DNA structures at promotorial level is a novel attractive anticancer strategy. In human, two guanine-rich sequences (h_kit1 and h_kit2 were identified in the promotorial region of oncogene KIT. Their stabilization into G-quadruplex structures can find applications in the treatment of leukemias, mastocytosis, gastrointestinal stromal tumor, and lung carcinomas which are often associated to c-kit mis-regulation. Also the most common skin cancer in domestic dog, mast cell tumor, is linked to a mutation and/or to an over-expression of c-kit, thus supporting dog as an excellent animal model. In order to assess if the G-quadruplex mediated mechanism of regulation of c-kit expression is conserved among the two species, herein we cloned and sequenced the canine KIT promoter region and we compared it with the human one in terms of sequence and conformational equilibria in physiologically relevant conditions. Our results evidenced a general conserved promotorial sequence between the two species. As experimentally confirmed, this grants that the conformational features of the canine kit1 sequence are substantially shared with the human one. Conversely, two isoforms of the kit2 sequences were identified in the analyzed dog population. In comparison with the human counterpart, both of them showed an altered distribution among several folded conformations.

  14. Limitations of the radioimmunoprecipitation polyethylene glycol assay (RIPEGA) for detection of filarial antigens in serum

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, R.G.; Alexander, E.; Adkinson, N.F. (Johns Hopkins Univ., Baltimore, MD (USA). School of Medicine); Hussain, R. (National Institutes of Health, Bethesda, MD (USA))

    1984-03-30

    The performance of the radioimmunoprecipitation polyethylene glycol assay (RIPEGA) was examined for quantitation of filarial antigens (Brugia malayi and Dirofilaria immitis) in serum from infected human and animal hosts and non-infected controls. Multiple PEG concentrations were employed to determine the level of non-specific binding (NSB) in non-exposed human sera (NEHS) containing no filarial antigen. The NSB observed when 3 different /sup 125/I-labelled IgG antibodies were added to 26 NEHS varied 3-fold and was correlated significantly with total serum IgM (r = 0.80, P < 0.005, n = 24) but not with serum IgA (r = 0.37) or IgG (r = 0.45). NSB levels were significantly reduced when a Fab'/sub 2/ fragment of the /sup 125/I-labelled antibody was used, but the correlation of NSB with total serum IgM remained significant (r = 0.57, P < 0.01). The presence of rheumatoid factor in NEHS sera also significantly increased NSB by an average of 3-fold. These effects eliminated the assay's ability to detect in sera from infected hosts filarial antigen the presence of which could be readily demonstrated by an immunoradiometric assay. The RIPEGA's precision (intra-assay coefficient of variation (CV) = 21% at 35% Bsub(max)) and reproducibility (inter-assay CV = 29% at 35% Bsub(max)) are less satisfactory than many alternative immunoassays.

  15. Pneumocystosis associated with canine distemper virus infection in a mink.

    OpenAIRE

    Dyer, N W; Schamber, G J

    1999-01-01

    An adult mink from a farm experiencing 100% mortality in affected animals was submitted for diagnostic examination. Clinical history included signs of respiratory disease, oculonasal discharge, and thickening of footpads. Canine distemper virus and Pneumocystis carinii were identified in lung tissue, suggesting immunosuppresion and secondary infection due to morbillivirus disease.

  16. Health-Seeking Behaviors and Self-Care Practices of People with Filarial Lymphoedema in Nepal: A Qualitative Study

    Directory of Open Access Journals (Sweden)

    Ram Kumar Adhikari

    2015-01-01

    Full Text Available Background. Lymphatic filariasis is endemic in Nepal. This study aimed to investigate health-seeking behaviors and self-care practices of people with filarial Lymphoedema in Nepal. Methods. A cross-sectional study was conducted using qualitative methods in three endemic districts. Twenty-three patients with current Lymphoedema were recruited in the study. Results. Hydrocele was found to be a well-known condition and a major health problem in the studied communities. People with Lymphoedema primarily sought health care from traditional healers, whereas sometimes home-based care was their first treatment. Later Ayurvedic and allopathic hospital-based care were sought. Respondents reported various psychological problems such as difficulty in engaging in sexual intercourse, anxiety, worry and stress, depression, low self-esteem, feeling weak, fear of being abandoned, and fear of transmitting disease to the children. Standard foot care practices except washing were largely absent. Conclusions. Lymphoedema in the limbs and hydrocele were found to be major health problems. The traditional health care providers were the first contact of care for the majority of respondents. Only a few patients had been practicing standard foot care practices.

  17. Health-Seeking Behaviors and Self-Care Practices of People with Filarial Lymphoedema in Nepal: A Qualitative Study

    Science.gov (United States)

    Adhikari, Ram Kumar; Sherchand, Jeevan Bahadur; Mishra, Shiva Raj; Ranabhat, Kamal; Pokharel, Amrit; Devkota, Pramila; Mishra, Durga; Ghimire, Yadu Chandra; Gelal, Khageshwor; Paudel, Rajan; Wagle, Rajendra Raj

    2015-01-01

    Background. Lymphatic filariasis is endemic in Nepal. This study aimed to investigate health-seeking behaviors and self-care practices of people with filarial Lymphoedema in Nepal. Methods. A cross-sectional study was conducted using qualitative methods in three endemic districts. Twenty-three patients with current Lymphoedema were recruited in the study. Results. Hydrocele was found to be a well-known condition and a major health problem in the studied communities. People with Lymphoedema primarily sought health care from traditional healers, whereas sometimes home-based care was their first treatment. Later Ayurvedic and allopathic hospital-based care were sought. Respondents reported various psychological problems such as difficulty in engaging in sexual intercourse, anxiety, worry and stress, depression, low self-esteem, feeling weak, fear of being abandoned, and fear of transmitting disease to the children. Standard foot care practices except washing were largely absent. Conclusions. Lymphoedema in the limbs and hydrocele were found to be major health problems. The traditional health care providers were the first contact of care for the majority of respondents. Only a few patients had been practicing standard foot care practices. PMID:25694785

  18. Increasing Incidence of Canine Leptospirosis in Switzerland

    Directory of Open Access Journals (Sweden)

    Andrea Major

    2014-07-01

    Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

  19. Production of antibodies to canine IL-1beta and canine TNF to assess the role of proinflammatory cytokines.

    Science.gov (United States)

    Baggio, Vannozza; Ott, Fabienne; Fischer, René W; Gram, Hermann; Peele, John; Spreng, David; Schmökel, Hugo; Jungi, Thomas W

    2005-08-15

    IL-1 and TNF are important proinflammatory cytokines implicated in both antimicrobial host defense and pathogenesis of diseases with an immune-mediated and/or inflammatory component. Respective studies in the dog have been hampered by the unavailability of reagents allowing the specific measurement of canine cytokine proteins and the effect of canine cytokine neutralization by Ab. Starting with recombinant canine (rcan) IL-1beta and rcanTNF, four polyclonal antisera and 22 mAb specific for rcanIL-1beta and rcanTNF were generated. Their usefulness in neutralization assays was determined. Using cytokine-containing supernatants of canine cells in bioassays, polyclonal antisera neutralized either canine IL-1beta or TNF. TNF was also neutralized by three antibodies developed in this study and one commercial mAb. The usefulness of monoclonal and polyclonal Ab in canine cytokine-specific Ab capture ELISA's was assessed. This resulted in the identification of a commercial mAb combination and one pair developed in this study allowing low levels of TNF to be detected by antibody capture ELISA. The detection limit was 141 pg/ml rcanTNF for both combinations. Using rcanIL-1beta as an antigen allowed the detection of lower concentrations of rcanIL-1beta (20 pg/ml, on the average) by a pair of polyclonal antisera than when monoclonals were used. By using such IL-1beta-specific and TNF-specific ELISA's, the respective cytokines were detected in supernatants of canine PBMC stimulated with LPS or heat-killed Listeria monocytogenes and interferon-gamma combined. Thus, monoclonal and polyclonal reagents were identified allowing the quantitation of canine IL-1beta and TNF production in vitro, and the neutralization of these cytokines. PMID:15982477

  20. Ultrasonographic characteristics of canine renal lymphoma.

    Science.gov (United States)

    Taylor, Angela J; Lara-Garcia, Ana; Benigni, Livia

    2014-01-01

    There is little published information on the ultrasonographic appearance of canine renal lymphoma. The purpose of this retrospective study was to provide additional information regarding the ultrasonographic characteristics of canine renal lymphoma, suggest ultrasonographic description criteria, and evaluate the role of fine-needle aspirate cytology in the diagnosis of this disease. The ultrasonographic features of confirmed renal lymphoma were reviewed in ten dogs. Pyelectasia was found in all dogs. Other ultrasonographic findings were loss of corticomedullary distinction (9/10 dogs), renomegaly (8/10 dogs), renal deformity (6/10 dogs), hypoechoic lesion(s) (6/10 dogs), and hyperechoic lesion(s) (2/10 dogs). Hypoechoic lesions were described as masses, nodules, and indistinct areas. In 30% of the cases (3/10 dogs) ultrasound revealed only minor abnormalities, including grade 1 pyelectasia, mild renomegaly, and focal loss of corticomedullary definition. Bilateral lesions were seen in nine dogs (90%). Renal fine-needle aspirates were performed in 9/10 dogs, yielding a diagnosis in seven on first attempt (78%). Two dogs had been given a provisional cytological diagnosis of round cell neoplasia; in one dog lymphoma was confirmed by second aspirate and by tissue core biopsy in the other. In 1/10 dogs, lymphoma was found at necropsy. Findings indicated that ultrasonographic signs of canine renal lymphoma may be subtle, canine renal lymphoma should be included in the differential diagnosis when the above ultrasonographic features are observed, and fine-needle aspirate cytology is a useful method for diagnosing this disease. PMID:24629062

  1. The canine vomeronasal organ.

    OpenAIRE

    Adams, D. R.; Wiekamp, M D

    1984-01-01

    The vomeronasal organ was studied in mature dogs with the optical, transmission electron, and scanning electron microscopes. The canine vomeronasal complex is structurally well developed. Large blood vessels are present deep to both the lateral, 'non-receptor' and medial, 'receptor' epithelia. In addition to the unmyelinated vomeronasal nerves in the lamina propria deep to the 'receptor' epithelium, numerous nerves containing both myelinated and unmyelinated fibres are present deep to the 'no...

  2. Definition, Classification, and Pathophysiology of Canine Glaucoma.

    Science.gov (United States)

    Pizzirani, Stefano

    2015-11-01

    Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. PMID:26456751

  3. Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

    Directory of Open Access Journals (Sweden)

    Sophie Le Poder

    2011-01-01

    Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  4. Modulation of CD4+ and CD8+ T-Cell Function by Interleukin 19 and Interleukin 24 During Filarial Infections.

    Science.gov (United States)

    Anuradha, Rajamanickam; Munisankar, Saravanan; Dolla, Chandrakumar; Kumaran, Paul; Nutman, Thomas B; Babu, Subash

    2016-03-01

    Interleukin 19 (IL-19) and interleukin 24 (IL-24) are cytokines that are highly expressed in filarial infections. To study the role of IL-19 and IL-24 in regulating T-cell responses, we examined the frequency of T-helper type 1 (Th1)/Tc1, Th2/Tc2, Th9/Tc9, Th17/Tc17, Th22/Tc22, and Tr1 cells in 26 filariae-infected individuals stimulated with filarial antigen following IL-19 or IL-24 neutralization. IL-19 or IL-24 neutralization resulted in significantly enhanced frequencies of Th1/Tc1 and/or Th17/Tc17 cells and significantly reduced frequencies of Th2/Tc2, Tr1, and/or Th9/Tc9 cells. Thus, we demonstrate that IL-19 and IL-24 are associated with the modulation of T-cell responses in filarial infections. PMID:26486636

  5. Increasing incidence of canine leptospirosis in Switzerland.

    Science.gov (United States)

    Major, Andrea; Schweighauser, Ariane; Francey, Thierry

    2014-07-01

    A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes 90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25) or rainy days (r2 0.38). Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%), pulmonary (76.7%), hepatic (26.0%), and hemorrhagic syndromes (18.2%), leading to a high mortality rate (43.3%). Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3). Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species. PMID:25032740

  6. Increasing Incidence of Canine Leptospirosis in Switzerland

    Science.gov (United States)

    Major, Andrea; Schweighauser, Ariane; Francey, Thierry

    2014-01-01

    A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes 90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25) or rainy days (r2 0.38). Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%), pulmonary (76.7%), hepatic (26.0%), and hemorrhagic syndromes (18.2%), leading to a high mortality rate (43.3%). Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3). Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species. PMID:25032740

  7. Spatial analysis of visceral leishmaniasis in the municipality of Rondonópolis, in the Brazilian State of Mato Grosso, from 2003 to 2012: human, canine and vector distribution in areas of disease transmission

    Directory of Open Access Journals (Sweden)

    Alexander Gonçalves Ferreira Guimarães

    2015-06-01

    Full Text Available INTRODUCTION: Visceral leishmaniasis (VL is a zoonosis of great importance to public health and is considered a neglected disease by the World Health Organization. The disease has expanded and become more prevalent in urban areas in Brazil. METHODS: Geospatial analyses were performed and thematic maps of the triad of the disease were produced for the study period (2003-2012 in the urban area of the municipality of Rondonópolis in the midwestern State of Mato Grosso (MT, Brazil, TerraView 4.2.2 software was used for the analyses. RESULTS: A total of 87.9% of the 186 confirmed human cases of VL were cured. Children between the ages of 1 and 4 were the most affected. Registered deaths were predominant among adults aged 60 years or older. The urban area of the municipality consists of eight strata and 12 census districts include 237 neighborhoods. All sectors had confirmed cases of VL. During the study period, human cases of the disease were recorded in 90 neighborhoods. The 23 deaths from the disease were distributed in 21 neighborhoods. Sandflies carrying the parasite were captured in 192 out of 200 neighborhoods evaluated for the presence of the VL vector. The presence of dogs carrying the parasite was confirmed in, 140 out of 154 surveyed neighborhoods. CONCLUSIONS: The data demonstrated the endemic nature of VL, with a high percentage of infected children, a high distribution of canine infection, and a wide adaptation and dispersal of the vectors in the urban environment. These results, illustrate the process of urbanization of VL in the municipality of Rondonópolis, MT, Brazil.

  8. Associations between neurologic dysfunction and lesions in canine fucosidosis.

    Science.gov (United States)

    Fletcher, J L; Taylor, R M

    2016-04-01

    Canine fucosidosis in English Springer spaniels is the only animal model of the neurovisceral lysosomal storage disease fucosidosis available for preclinical therapeutic trials. For this reason, it is crucial to identify critical time points in disease progression, and if there are particular lesions associated with specific aspects of neurologic dysfunction. Historical records of 53 canine fucosidosis cases from 1979 to 2009 containing a neurologic dysfunction score assessing motor, behavioral and sensory dysfunction were interrogated by statistical analysis. Motor and behavioral dysfunction scores assessing gait deficits and apprehensive behavior first significantly increased at 12-17 months, and increased at each 6-month interval thereafter. Sensory dysfunction scores, assessing hearing loss, balance and vision deterioration, did not significantly increase until 18-23 months, and coincided with a rapid decline in neurologic function. Regression analysis incorporating published neuropathology data, measured by image analysis, identified neuroinflammation and apoptotic cell death as significant informative predictors of increasing neurologic dysfunction. These findings indicate that the level of neuropathology required to induce consistent and conspicuous clinical signs in canine fucosidosis is reached by approximately 12 months of age in the absence of other disease processes. Significant association between neuroinflammation and apoptotic cell death also suggests that specifically targeting these lesions combined with enzyme replacement in future studies may reduce disease burden in fucosidosis. Overall, examining this historical clinical data to identify associations between the extent of neuropathology and degree of clinical dysfunction provides a useful reference tool for monitoring disease and evaluating therapeutic trials conducted in canine fucosidosis. PMID:26711085

  9. Evaluation of immune response elicited by inulin as an adjuvant with filarial antigens in mice model.

    Science.gov (United States)

    Mahalakshmi, N; Aparnaa, R; Kaliraj, P

    2014-10-01

    Filariasis caused by infectious parasitic nematodes has been identified as the second leading source of permanent and long-term disability in Sub-Saharan Africa, Asia and Latin America. Several vaccine candidates were identified from infective third-stage larvae (L3) which involves in the critical transition from arthropod to human. Hitherto studies of these antigens in combination with alum adjuvant have shown to elicit its characteristic Th2 responses. Inulin is a safe, non-toxic adjuvant that principally stimulates the innate immune response through the alternative complement pathway. In the present study, the immune response elicited by inulin and alum as adjuvants were compared with filarial antigens from different aetiological agents: secreted larval acidic protein 1 (SLAP1) from Onchocerca volvulus and venom allergen homologue (VAH) from Brugia malayi as single or as cocktail vaccines in mice model. The study revealed that inulin can induce better humoral response against these antigens than alum adjuvant. Antibody isotyping disclosed inulin's ability to elevate the levels of IgG2a and IgG3 antibodies which mediates in complement-dependent cytotoxicity and antibody-dependent cell-mediated cytotoxicity (ADCC), respectively, in mice. Splenocyte analysis showed that T cells prestimulated with inulin have higher stimulation index (P < 0.05) than alum except for BmVAH antigen. In vitro ADCC assay showed that inulin formulation had induced higher cytotoxicity with filarial antigens (as single P < 0.01 and as cocktail P < 0.05, respectively) than alum. The results had confirmed the capability of inulin to deplete the levels of Treg and brought a balance in Th1/Th2 arms against filarial antigens in mice. PMID:25041426

  10. A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.

    Directory of Open Access Journals (Sweden)

    Sandra J Laney

    Full Text Available BACKGROUND: Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript. METHODOLOGY/PRINCIPAL FINDINGS: Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes. CONCLUSIONS/SIGNIFICANCE: This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.

  11. A canine model of multiple portosystemic shunting.

    Science.gov (United States)

    Howe, L M; Boothe, H W; Miller, M W; Boothe, D M

    2000-01-01

    The objective of this study was to develop and describe an experimental canine model of multiple acquired portosystemic shunts (PSS) similar in nature to spontaneously occurring PSS. Sixteen dogs were used and were divided into a control (n = 6) and a diseased group (n = 10). Dogs of the diseased group were administered dimethylnitrosamine (2 mg/kg of body weight, po) twice weekly, and clinicopathologic, ultrasonographic, and hepatic scintigraphic findings were recorded during the development of hepatic disease and PSS. Surgery was then performed to permit visual verification of multiple shunts, catheter placement for portography examination, and biopsy of the liver. All diseased dogs developed severe hepatic disease and multiple PSS as documented visually at surgery and on portography. Based on this study, dimethylnitrosamine-induced portosystemic shunting appears to be an appropriate model for spontaneously occurring multiple PSS secondary to portal hypertension. PMID:10741951

  12. The complete mitochondrial genome of an Antarctic moss Syntrichia filaris (Müll.Hal.) R.H. Zander.

    Science.gov (United States)

    Yoon, Young-Jun; Kang, Yoonjee; Kim, Mi-Kyeong; Lee, Jungeun; Park, Hyun; Kim, Ji Hee; Lee, Hyoungseok

    2016-07-01

    The mitogenome of the Syntrichia filaris (GenBank accession number KP984758) has a total length of 106,343 bp and consists of 40 protein-coding genes, 3 ribosomal RNA (rRNA) and 24 transfer RNA. The mitochondrial structure and gene order was similar to other Bryophytes. Phylogenetic tree based on the combined analysis of amino acid sequences of 31 mitochondrial genes common in S. filaris, 17 Bryophyta and 3 Marchantiophyta, was well congruent with traditional species relationship of the moss order Pottiales. PMID:26114320

  13. Filarial/Human Immunodeficiency Virus Coinfection in Urban Southern India

    OpenAIRE

    Talaat, Kawsar R.; Kumarasamy, Nagalingeswaran; Swaminathan, Soumya; Gopinath, Ramya; Nutman, Thomas B.

    2008-01-01

    The disease course of human immunodeficiency virus (HIV) is often altered by existing or newly acquired coinfections. Treatment or prevention of these concomitant infections often improves the quality and duration of life of HIV-infected persons. The impact of helminth infections on infections with HIV is less clear. However, HIV is frequently most problematic in areas where helminth infections are common. In advance of the widespread distribution of drugs for elimination of lymphatic filaria...

  14. Diagnostic imaging of the male canine reproductive organs: methods and limitations

    International Nuclear Information System (INIS)

    Survey radiographic, contrast radiographic, and ultrasonographic techniques for evaluation of the male canine reproductive organs are reviewed. The applications and limitations of these technique as they apply to reproductive diseases involving the prostate gland and testicles are illustrated

  15. Canine mast cell tumors.

    Science.gov (United States)

    Macy, D W

    1985-07-01

    Despite the fact that the mast cell tumor is a common neoplasm of the dog, we still have only a meager understanding of its etiology and biologic behavior. Many of the published recommendations for treatment are based on opinion rather than facts derived from careful studies and should be viewed with some skepticism. Because of the infrequent occurrence of this tumor in man, only a limited amount of help can be expected from human oncologists; therefore, burden of responsibility for progress in predicting behavior and developing treatment effective for canine mast cell tumors must fall on the shoulders of the veterinary profession. PMID:3929444

  16. Brazilian canine hepatozoonosis.

    Science.gov (United States)

    O'Dwyer, Lucia Helena

    2011-01-01

    The genus Hepatozoon includes hundreds of species that infect birds, reptiles, amphibians and mammals, in all continents with tropical and subtropical climates. Two species have been described in domestic dogs: H. canis, reported in Europe, Asia, Africa, South America and the United States; and H. americanum, which so far has only been diagnosed in the United States. In Brazil, the only species found infecting dogs is H. canis. The objective of this review was to detail some aspects of canine hepatozoonosis, caused by H. canis, and the main points of its biology, transmission, pathogenicity, symptoms, epidemiology and diagnostic methods, with emphasis on research developed in Brazil. PMID:21961746

  17. Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

    Science.gov (United States)

    Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

    2015-11-01

    Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies. PMID:26315688

  18. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high interobserver

  19. Canine distemper virus - a morbillivirus in search of new hosts?

    OpenAIRE

    Harder, Timm; Osterhaus, Albert

    1997-01-01

    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions frequently occur, often leading to devastating epizootics in highly susceptible or immunologically naive populations.

  20. Canine brachycephalic airway syndrome: pathophysiology, diagnosis, and nonsurgical management.

    Science.gov (United States)

    Trappler, Michelle; Moore, Kenneth

    2011-05-01

    Canine brachycephalic airway syndrome is a progressive disease that affects many brachycephalic dogs. This article describes the components of this syndrome and focuses on acute emergency management and long-term conservative management of these patients. Surgical management is described in a companion article. PMID:21870353

  1. Prognosis in canine idiopathic immune-mediated haemolytic anaemia

    NARCIS (Netherlands)

    Piek, C.J.

    2011-01-01

    Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and

  2. Canine distemper virus - a morbillivirus in search of new hosts?

    NARCIS (Netherlands)

    T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions fr

  3. Canine hypertrophic osteopathy associated with extra-thoracic lesions

    OpenAIRE

    Headley Selwyn Arlington; Ribeiro Eduardo Alcântara; Santos Gustavo José Von G. dos; Bettini Carlos Maia; Mattos Júnior Ewaldo

    2005-01-01

    Canine hypertrophic osteopathy is described in a dog that presented extra-thoracic lesions, mainly in the liver. Hepatic lesions were characterized by necrosis, hemorrhage, severe hydropic degeneration of centrolobular hepatocytes, proliferation of epithelial cells of bile ducts, and mild biliary stasis. The disease syndrome was diagnosed based on clinical signs, radiological evaluation, and inspection of macerated bones.

  4. Canine distemper spillover in domestic dogs from urban wildlife.

    Science.gov (United States)

    Kapil, Sanjay; Yeary, Teresa J

    2011-11-01

    Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing. PMID:22041204

  5. Survey of Canine Dirofilaria immitis Infection in New Caledonia

    OpenAIRE

    Watier-Grillot, S.; J.-L. Marié; Cabre, O.; Davoust, B

    2011-01-01

    Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis) infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe) and the Rapid Immuno Migration ( R I M ) test: WITNESS DIROFILARIA (Synbiotics Europe). Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs recei...

  6. Canine dysautonomia in a litter of Havanese puppies.

    Science.gov (United States)

    Hull, Noah C; O'Toole, Donal; Miller, Myrna M; Shoults, Hannah; Deck, Robin; Jones, Warren; Johnson, Gayle C; Shaw, Daniel P; Schumaker, Brant A

    2015-09-01

    Canine dysautonomia is a sporadic, generally fatal disease that rarely affects groups of related animals. Four 10-week-old Havanese puppies from a litter of 5 developed clinical signs of canine dysautonomia. The 4 affected dogs were exposed to an outdoor environment, whereas the fifth littermate was not exposed to the outdoors and remained clinically healthy. Clinical signs of dysautonomia developed 10-16 days after going outside the house. An unrelated dog also developed dysautonomia after exposure to 1 of the affected Havanese littermates. All 5 dogs had morphological changes consistent with dysautonomia (widespread neuronal degeneration in autonomic ganglia, select brainstem nuclei, and ventral horn motor neurons). Differential diagnoses were excluded through negative toxicological evaluation, fecal parasite screening, negative Canine distemper virus reverse transcription polymerase chain reaction, fluorescent antibody testing, attempted virus isolation, and electron microscopy. The 5 affected dogs were in the Kansas City, Missouri area, where there is a high incidence of dysautonomia. PMID:26179098

  7. Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

    Science.gov (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

    2016-01-01

    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. PMID:27543040

  8. Immunoprophylactic potential of filarial glutathione-s-transferase in lymphatic filariaisis

    Institute of Scientific and Technical Information of China (English)

    BalM; MandalN; AcharyKG; DasMK; KarSK

    2011-01-01

    Objective:To elucidates the immunoprophylactic potential of glutathion-s-transferase (GST) from cattle filarial parasite Setaria digitata (S. digitata) against lymphatic filariasis. Methods:GST was purified through affinity chromatography (SdGST) and chacterized by SDS-PAGE and Nano-LC MS/MS analysis. Antibody isotypes to SdGST were measured by ELISA. Antibody dependant cellular cytotoxicity (ADCC) was performed in vitro using sera from immunized animals and immune individuals. T-cell proliferation and cytokine response to SdGST in different groups of filariasis were measured. Immunoprophylactic potential of SdGST was evaluate in animal model. Results: SdGST exhibited 30-fold enhancement of enzyme activity over crude parasitic extract. It was found to be 26 kDa by SDS-PAGE. Nano LC-MS/MS analysis followed by blast search showed 100%homology with Dirofilaria immitis (D. immitis) and only 43%with Homo sapiens (H. sapiens). Immunoblotting analysis showed putatively immune individuals carry significant level of antibodies to SdGST as compared with microfilaraemics. Immunized sera and sera endemic normal could neutralize the enzymatic activity of SdGST and inducing in vitro cytotoxicity of microfilariae. Peripheral blood mononuclear cells (PBMC) from endemic normals upon stimulation with SdGST showed a mixed type of Th1/Th2 response. SdGST immunization clear microfilariae from circulation in S. digitata implanted mastomys. Conclusions:The heterologous GST could be potentially developed as a vaccine candidate against lymphatic filarial parasite.

  9. Influence of anti-filarial chemotherapy strategies on the genetic structure of Wuchereria bancrofti populations

    Directory of Open Access Journals (Sweden)

    Dhamodharan Ramasamy

    2011-03-01

    Full Text Available Lymphatic filarial (LF parasites have been under anti-filarial drug pressure for more than half a century. Currently, annual mass drug administration (MDA of diethylcarbamazine (DEC or ivermectin in combination with albendazole (ALB have been used globally to eliminate LF. Long-term chemotherapies exert significant pressure on the genetic structure of parasitic populations. We investigated the genetic variation among 210 Wuchereria bancrofti populations that were under three different chemotherapy strategies, namely MDA with DEC alone (group I, n = 74, MDA with DEC and ALB (group II, n = 60 and selective therapy (ST with DEC (group III, n = 34 to understand the impact of these three drug regimens on the parasite genetic structure. Randomly amplified polymorphic DNA profiles were generated for the three groups of parasite populations; the gene diversity, gene flow and genetic distance values were determined and phylogenetic trees were constructed. Analysis of these parameters indicated that parasite populations under ST with a standard dose of DEC (group III were genetically more diverse (0.2660 than parasite populations under MDA with DEC alone (group I, H = 0.2197 or with DEC + ALB (group II, H = 0.2317. These results indicate that the MDA may reduce the genetic diversity of W. bancrofti populations when compared to the genetic diversity of parasite populations under ST.

  10. Identification of Ecdysone Hormone Receptor Agonists as a Therapeutic Approach for Treating Filarial Infections

    Science.gov (United States)

    Mhashilkar, Amruta S.; Vankayala, Sai L.; Liu, Canhui; Kearns, Fiona; Mehrotra, Priyanka; Tzertzinis, George; Palli, Subba R.; Woodcock, H. Lee; Unnasch, Thomas R.

    2016-01-01

    Background A homologue of the ecdysone receptor has previously been identified in human filarial parasites. As the ecdysone receptor is not found in vertebrates, it and the regulatory pathways it controls represent attractive potential chemotherapeutic targets. Methodology/ Principal Findings Administration of 20-hydroxyecdysone to gerbils infected with B. malayi infective larvae disrupted their development to adult stage parasites. A stable mammalian cell line was created incorporating the B. malayi ecdysone receptor ligand-binding domain, its heterodimer partner and a secreted luciferase reporter in HEK293 cells. This was employed to screen a series of ecdysone agonist, identifying seven agonists active at sub-micromolar concentrations. A B. malayi ecdysone receptor ligand-binding domain was developed and used to study the ligand-receptor interactions of these agonists. An excellent correlation between the virtual screening results and the screening assay was observed. Based on both of these approaches, steroidal ecdysone agonists and the diacylhydrazine family of compounds were identified as a fruitful source of potential receptor agonists. In further confirmation of the modeling and screening results, Ponasterone A and Muristerone A, two compounds predicted to be strong ecdysone agonists stimulated expulsion of microfilaria and immature stages from adult parasites. Conclusions The studies validate the potential of the B. malayi ecdysone receptor as a drug target and provide a means to rapidly evaluate compounds for development of a new class of drugs against the human filarial parasites. PMID:27300294

  11. Nuclear techniques in the biochemistry and experimental chemotherapy of filarial worms

    International Nuclear Information System (INIS)

    There is an almost complete lack of biochemical data on filarial worms of medical importance and most of the available information has been obtained from four laboratory-maintained species, Brugia pahangi, Dipetalonema viteae, Litomosoides carinii and Dirofilaria immitis. Several workers have attempted to study the vector-borne stages of filariae, either by an autoradiographic study of the distribution of radioactive substrates introduced to the mosquito by feeding or by micro-injection into the thorax. Comparison of the levels of folate metabolism in uninfected and B. pahangi-infected Aedes aegypti have also been made. Biochemical studies on adult worms have focussed mainly on carbohydrate and folate metabolism. Those species investigated did not possess significant tricarboxylic acid cycle activity and relied upon glycolysis for carbohydrate catabolism and energy production. B. pahangi and D. immitis cannot synthesize dihydrofolate de novo, but are able to utilize 5-methyl tetrahydrofolate for the production of metabolically active tetrahydrofolate cofactors. Information on folate metabolism is reviewed. Filarial nematodes resemble cestodes and schistosomes in possessing a cuticle which is freely permeable to a wide range of low molecular weight substances. The surface of the cuticle is bounded by antigenic proteins which may be shed from the worms in vivo. Data on the immunological and physiological properties of the surface are discussed. The interaction of standard filaricidal compounds, suramin and diethylcarbamazine, with the biochemical pathways of carbohydrate and folate metabolism are described. (author)

  12. Increasing Incidence of Canine Leptospirosis in Switzerland

    OpenAIRE

    Andrea Major; Ariane Schweighauser; Thierry Francey

    2014-01-01

    A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73) and rainfall (r2 0.39), >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of ...

  13. Novel parasitic nematode-specific protein of bovine filarial parasite Setaria digitata displays conserved gene structure and ubiquitous expression.

    Science.gov (United States)

    Rodrigo, W W; Dassanayake, R S; Weerasena, S J; Silva Gunawardene, Y I

    2014-09-01

    Setaria digitata is an animal filarial parasite, which can cause fatal diseases to livestock such as cattle, sheep, goat, buffaloes, horses etc. inflicting considerable economic losses to livelihood of livestock farmers. In spite of this, the biology and parasitic nature of this organism is largely unknown. As a step towards understanding these, we screened the cDNA library of S. digitata and identified an open reading frame that code for parasitic nematode-specific protein, which showed a significant homology to functionally and structurally unannotated sequences of parasitic nematodes Wuchereria bancrofti, Brugia malayi, Onchocerca volvulus, Loa loa etc., suggesting its role in parasitism. RT-PCR analysis indicated that the S. digitata novel gene (SDNP) is expressed in adult female and male, and microfilariae. Southern hybridization studies revealed that this gene is a single-copy gene. Sequence analysis of the genomic region obtained from overlapping PCR amplification indicated that the size of the genomic region is 1819 bp in which four exons encoding 205 amino acids were interrupted by three introns of varying lengths of 419, 659 and 123 bp, and also the expansion of the size of the introns of S. digitata compared to its orthologues by integrating micro and mini-satellite containing sequence. Sequences around the splice junctions were conserved and agreed with the general GT-AG splicing rule. The gene was found to be AT rich with a GC content of 38.1%. Bioinformatic analysis indicated that the gene structure of SDNP and its orthologues is conserved and it expressed ubiqutously in all the stages of nematode's life cycle. Therefore, taking these outcomes together, it can be concluded that SDNP is a parasitic nematode-specific, single copy gene having conserved gene structure of four exons interrupted by three introns and that the gene is expressed ubiquitously throughout nematode's life cycle. PMID:25382479

  14. Smoke repellency and mosquito larvicidal potentiality of Mesua ferra L. leaf extract against filarial vector Culex quinquefasciatus Say

    Institute of Scientific and Technical Information of China (English)

    Someshwar Singha; Utpal Adhikari; Goutam Chandra

    2011-01-01

    Objective: Present study was made to evaluate the smoke repellent potentiality and mosquito larvicidal activity of Mesua ferra (M. ferra) leaves against filarial vector Culex quinquefasciatus (Cx.quinquefasciatus ). Methods: Crude, petroleum-ether, chloroform: methanol (1:1 v/v) and ethyl acetate extracts of mature plant leaves were investigated to establish its biocontrol potentiality under laboratory condition against larvae of Cx. quinquefasciatus at different concentrations i.e. 25 ppm, 50 ppm and 75 ppm. Mosquito coil prepared from M. ferra leaves powder were tested for smoke toxicity effect against Cx. quinquefasciatus adult mosquitoes. Results: The mortality rates of crude extract at 0.5% concentration were higher than all other concentrations tested against the first, second, third and fourth instars larvae at 24 h, 48 h and 72 h of exposure. Larval mortality rate in chloroform: methanol (1:1 v/v) extract was significantly higher (P<0.05) than other extracts. LC50 value of petroleum ether, chloroform: methanol (1:1 v/v) and ethyl acetate extracts were 195.33 ppm, 27.28 ppm and 74.19 ppm respectively, after 48 h of exposure. Smoke exposed gravid females oviposited fewer eggs when compared to non exposed female mosquitoes. Conclusions:In conclusion M. ferra crude and chloroform: methanol (1:1) extract can be used effectively against mosquito control programmes. Smoke from M. ferra can play an important role in the interruption of transmission of those diseases where mosquitoes act as vector at the individual level.

  15. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter;

    2009-01-01

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is...

  16. Novel canine bocavirus strain associated with severe enteritis in a dog litter.

    Science.gov (United States)

    Bodewes, Rogier; Lapp, Stefanie; Hahn, Kerstin; Habierski, André; Förster, Christine; König, Matthias; Wohlsein, Peter; Osterhaus, Albert D M E; Baumgärtner, Wolfgang

    2014-11-01

    Bocaviruses are small non-enveloped viruses with a linear ssDNA genome, that belong to the genus Bocaparvovirus of the subfamiliy Parvovirinae. Bocavirus infections are associated with a wide spectrum of disease in humans and various mammalian species. Here we describe a fatal enteritis associated with infection with a novel strain of canine bocavirus 2 (CaBoV-2), that occurred in a litter of German wirehaired pointers. Necropsy performed on three puppies revealed an enteritis reminiscent of canine parvovirus associated enteritis, accompanied with signs of lymphocytolytic disease in bone marrow, spleen, lymph nodes and thymus. While other major causes of enteritis of young dogs, including canine parvovirus, were excluded, by random PCR in combination with next-generation sequencing, a novel CaBoV-2 strain was detected. Phylogenetic analysis of the genome of this novel canine bocavirus strain indicated that this virus was indeed most closely related to group 2 canine bocaviruses. Infection with canine bocavirus was confirmed by in situ hybridization, which revealed the presence of CaBoV-2 nucleic acid in the intestinal tract and lymphoid tissues of the dogs. In a small-scale retrospective analysis concerning the role of CaBoV-2 no additional cases were identified. The findings of this study provide novel insights into the pathogenicity of canine bocaviruses. PMID:25263495

  17. 9 CFR 113.305 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine.

    Science.gov (United States)

    2010-01-01

    ... STANDARD REQUIREMENTS Live Virus Vaccines § 113.305 Canine Hepatitis and Canine Adenovirus Type 2 Vaccine. Canine Hepatitis Vaccine and Canine Adenovirus Type 2 Vaccine shall be prepared from virus-bearing cell... hepatitis, the test is inconclusive and may be repeated. (B) If at least 19 of the 20 vaccinates do...

  18. Morphologic and biochemical studies of canine mucopolysaccharidosis I.

    OpenAIRE

    Shull, R M; Helman, R. G.; Spellacy, E.; Constantopoulos, G.; Munger, R. J.; Neufeld, E F

    1984-01-01

    This report presents the necropsy and biochemical findings on the first dog to die with alpha-L-iduronidase deficiency (mucopolysaccharidosis I, MPS I). Gross pathologic features, light- and electron-microscopic findings, and tissue enzyme, glycosaminoglycan (GAG), and sphingolipid levels are compared with the human disease counterpart and the previously described feline model. Results lend further support for the similarities of the canine disease and human MPS I.

  19. Feline and canine coronaviruses : common genetic and pathobiological features

    OpenAIRE

    Sophie Le Poder

    2011-01-01

    A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious ...

  20. FLT3 mutations in canine acute lymphocytic leukemia

    International Nuclear Information System (INIS)

    FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

  1. Canine babesiosis treatment with three different medicines

    Directory of Open Access Journals (Sweden)

    Torbica G.

    2013-01-01

    Full Text Available Canine babesiosis is a relatively frequent disease in Croatia. Elevated body temperature, anemia and haemoglobinuria are the most common signs. Diagnosis is rapidly obtained by employing blood smears, as B. canis is present in the red blood cells of affected dogs. Treatment is favourable and without consequences. Blood work was performed initialy, prior to treatment, and on the 1st and the 7th day following treatment. Following history and examination of the dogs blood and urine samples were taken. After confirmation of B. canis in the red blood cells, alltogether 226 dogs were tretated. Out of them 80 were tretaed with Berenil® (diminazen aceturate, Hoechst, 72 were tretated with Imizol® (imidocarb dipropionate, Schering-Plough-Animal-Health and 74 with Oxopirvedin® (fenamidine dizetionate, Merial. Clinical findings, haematological analysis and urine analysis are given and statistically assesed. After tretment with Berenil®, symptoms of babesiosis regressed within 24 hours. Health improved more slowly in the group treated with Oxopirvedin® in comparioson with the group treated with Berenil®. Contrary to the above, Imizol® displayed the slowest regression of the disease and reinfestation with B. canis within 30 days was not noted. That is not the case if treatment was provided by Berenil® and Oxopirvedin®. In all 226 cases of canine babesiosis side effects were not noted, except topically inflammed tissue at the site of subcutaneous application.

  2. Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

    Directory of Open Access Journals (Sweden)

    Víctor Acero P

    2015-09-01

    Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

  3. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

    2011-01-01

    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  4. Recent advances in canine leptospirosis: focus on vaccine development

    Directory of Open Access Journals (Sweden)

    Klaasen HLBM

    2015-06-01

    Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis

  5. A confusing case of canine vector-borne disease: clinical signs and progression in a dog co-infected with Ehrlichia canis and Bartonella vinsonii ssp. berkhoffii

    OpenAIRE

    Maggi Ricardo G; Breitschwerdt Edward B

    2009-01-01

    Abstract Bartonella spp. are important pathogens in human and veterinary medicine, and bartonellosis is considered as an emerging zoonosis that is being reported with increasing frequency. Of 22 known species and subspecies of Bartonella, seven have been isolated from dogs, causing disease manifestations similar to those seen in human beings. The wide variety of clinical signs and the possible chronic progression of disease manifestations are illustrated in the case of an infected Labrador re...

  6. Current state of knowledge: the canine gastrointestinal microbiome.

    Science.gov (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S

    2012-06-01

    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome. PMID:22647637

  7. Adult filarial worm from the breast aspirate of a young man.

    Science.gov (United States)

    Fernandes, Hilda; Thomas, Beena Mary; Putran, Indira

    2016-06-01

    Microfilariae and adult filarial worm have been incidentally detected in fine needle aspirates of various lesions in clinically unsuspected cases. Here we report a male patient who presented with a tender breast nodule and single enlarged lymph node. Fine Needle Aspiration (FNA) yielded 1 ml of yellow coloured fluid and single thread like worm measuring 6 × 0.2 cm. A diagnosis of breast abscess with a worm morphologically consistent with filariasis was offered. A follow up visit after 2 months showed regression of the breast lesion and the lymph node. Filariasis of the breast is an uncommon condition and can cause a diagnostic dilemma at times. FNA cytology appears to be a more convenient and effective diagnostic tool in patients with mass lesions. Demonstration and identification of the parasite in smears helps in avoiding surgical excision and early institution of prompt therapy especially in young patients. PMID:27413335

  8. Canine distemper virus infection in a lesser grison (Galictis cuja): first report and virus phylogeny

    OpenAIRE

    Jane Megid; Teixeira, Carlos R; Adriana Cortez; Heinemann, Marcos B; Antunes, João M.A.P.; Felipe Fornazari; Fabricio B. Rassy; Richtzenhain, Leonardo J

    2013-01-01

    Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV) has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja). A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosi...

  9. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy)

    OpenAIRE

    Veneziano Vincenzo; Catelan Dolores; Musella Vincenzo; Biggeri Annibale; Carbone Sabrina; Rinaldi Laura; Cringoli Giuseppe

    2006-01-01

    Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts) by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks,...

  10. Major HGF-mediated regenerative pathways are similarly affected in human and canine cirrhosis

    OpenAIRE

    Spee, Bart; Arends, Brigitte; van den Ingh, Ted SGAM; Roskams, Tania; Rothuizen, Jan; Penning, Louis C

    2007-01-01

    Background The availability of non-rodent animal models for human cirrhosis is limited. We investigated whether privately-owned dogs (Canis familiaris) are potential model animals for liver disease focusing on regenerative pathways. Several forms of canine hepatitis were examined: Acute Hepatitis (AH), Chronic Hepatitis (CH), Lobular Dissecting Hepatitis (LDH, a specific form of micronodulair cirrhosis), and Cirrhosis (CIRR). Canine cirrhotic samples were compared to human liver samples from ...

  11. Canine babesiosis in Slovenia: Molecular evidence of Babesia canis canis and Babesia canis vogeli

    OpenAIRE

    Duh, Darja; Tozon, Nataša; Petrovec, Miroslav; StraŠek, Katja; AvŠic-Županc, Tatjana

    2004-01-01

    Canine babesiosis, caused by intraerythrocytic Babesia spp., is a tick-borne disease of worldwide importance. No information on canine babesiosis has been documented in Slovenia. Therefore, 238 dogs admitted to the Small animal clinic in Ljubljana from the years 2000 to 2002 were tested for the presence of babesial parasites in the blood. Based on clinical, microscopic and molecular investigations, 14 dogs (5.9%) were determined as being infected with babesiae. Clinical signs relating to acut...

  12. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.;

    2006-01-01

    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause of...... lineage. These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  13. The feasibility of canine rabies elimination in Africa: dispelling doubts with data

    OpenAIRE

    Lembo, T.; Hampson, K.; Kaare, M.T.; Ernest, E.; Knobel, D.; Kazwala, R.R.; Haydon, D. T.; Cleaveland, S.

    2010-01-01

    Background: Canine rabies causes many thousands of human deaths every year in Africa, and continues to increase throughout much of the continent. Methodology/Principal Findings: This paper identifies four common reasons given for the lack of effective canine rabies control in Africa: (a) a low priority given for disease control as a result of lack of awareness of the rabies burden; (b) epidemiological constraints such as uncertainties about the required levels of vaccination coverage and...

  14. Laboratory and field evaluation of medicinal plant extracts against filarial vector, Culex quinquefasciatus Say (Diptera: Culicidae).

    Science.gov (United States)

    Kovendan, Kalimuthu; Murugan, Kadarkarai; Panneerselvam, Chellasamy; Mahesh Kumar, Palanisamy; Amerasan, Duraisamy; Subramaniam, Jayapal; Vincent, Savariar; Barnard, Donald R

    2012-06-01

    The present study explored the effects of Jatropha curcas, Hyptis suaveolens, Abutilon indicum, and Leucas aspera tested against third instar larvae of filarial vector, Culex quinquefasciatus. The dried plant materials were powdered by an electrical blender. From each sample, 500 g powder was macerated with 1.5 L of hexane, chloroform, ethyl acetate, and methanol 8h, using Soxhlet apparatus, and filtered. The extracts were concentrated at reduced temperature on a rotary evaporator and stored at a temperature of 4°C. The yield of crude extract was 11.4, 12.2, 10.6, and 13.5 g in hexane, chloroform, ethyl acetate, and methanol, respectively. The hexane, chloroform, ethyl acetate, and methanol extract of J. curcas with LC(50) values of 230.32, 212.85, 192.07, and 113.23 ppm; H. suaveolens with LC(50) values of 213.09, 217.64, 167.59, and 86.93 ppm; A. indicum with LC(50) values of 204.18, 155.53, 166.32, and 111.58 ppm; and L. aspera with LC(50) values of 152.18, 118.29, 111.43, and 107.73 ppm, respectively, against third instar larvae of C. quinquefasciatus. The larval mortality was observed after 24 h of exposure. Maximum larvicidal activity was observed in the methanolic extract followed by ethyl acetate, chloroform, and hexane extract. No mortality was observed in the control. The observed mortality were statistically significant at P < 0.05 level. L. aspera showed the highest mortality rate against the mosquito larvae in laboratory and field. The larval density was decreased after the treatment of plant extracts at the breeding sites (sewage water), and hence, these plant extracts of the suitable alternatives of synthetic insecticides for the mosquito vector management. The present results suggest that the medicinal plants extract was an excellent potential for controlling filarial vector, C. quinquefasciatus. PMID:22146997

  15. Kinetic Characterisation of Phosphofructokinase Purified from Setaria cervi: A Bovine Filarial Parasite

    Directory of Open Access Journals (Sweden)

    Bechan Sharma

    2011-01-01

    Full Text Available Phosphofructokinase (PFK, a regulatory enzyme in glycolytic pathway, has been purified to electrophoretic homogeneity from adult female Setaria cervi and partially characterized. For this enzyme, the Lineweaver-Burk's double reciprocal plots of initial rates and D-fructose-6-phosphate (F-6-P or Mg-ATP concentrations for varying values of cosubstrate concentration gave intersecting lines indicating that Km values for F-6-P (1.05 mM and ATP (3 μM were independent of each other. S. cervi PFK, when assayed at inhibitory concentration of ATP (>0.1 mM, exhibited sigmoidal behavior towards binding with F-6-P with a Hill coefficient (n value equal to 1.8 and 1.7 at 1.0 and 0.33 mM ATP, respectively. D-fructose-1,6-diphosphate (FDP competitively inhibited the filarial enzyme: Ki and Hill coefficient values being 0.18 μM and 2.0, respectively. Phosphoenolpyruvate (PEP also inhibited the enzyme competitively with the Ki value equal to 0.8 mM. The Hill coefficient values (>1.5 for F-6-P (at inhibitory concentration of ATP and FDP suggested its positive cooperative kinetics towards F-6-P and FDP, showing presence of more than one binding sites for these molecules in enzyme protein and allosteric nature of the filarial enzyme. The product inhibition studies gave us the only compatible mechanism of random addition process with a probable orientation of substrates and products on the enzyme surface.

  16. Impact of basic lymphedema management and antifilarial treatment on acute dermatolymphangioadenitis episodes and filarial antigenaemia

    Directory of Open Access Journals (Sweden)

    H A El-Nahas

    2011-01-01

    Full Text Available Background: A major factor in the progression of lymphedema is acute dermatolymphangioadenitis (ADLA. Aims : To study ADLA episodes and antigenaemia in patients with different grades of filarial lymphedema at pre- and two years post-treatment. Setting and Design: A prospectively conducted study from May 2008 through May 2010. Patients and Methods: Forty five patients complaining of limb swelling with present or past history of limb redness suggestive of ADLA attacks were included. Patients were clinically examined for lymphedema grading, detection of potential entry points and diagnosis of microfilaraemia. Wuchereria bancrofti antigen titer was estimated by "Trop-Ag W. Bancrofti" ELISA kit. Basic lymphedema management and treatment with antifilarial drugs were applied. Statistical Analysis : Mann−Whitney test and Chi-square test were used. Results: The number of ADLA attacks in the pretreatment period, ranged from one to three per year. Mean duration of the attacks was 3.87±0.79 days. Entry points were detected in 82% of cases. The study revealed statistical significance between extension and grade of lymphedema and number of ADLA attacks per year (P=0.018 and 0.022, respectively. Microfilaraemia was detected in four cases and positive filarial antigenaemia were detected in 29 patients (64.4. The number of ADLA attacks per year significantly decreased from the pre-treatment period (mean: 2.05±0.560 to be 1.23±0.706 after one year and 0.89±0.575 after two years post treatment. There was a significant decrease in the mean antigen titer one year and two years after treatment. Conclusion: Basic lymphedema management is effective for controlling ADLA attacks in areas where lymphatic filariasis is endemic.

  17. Both asymmetric mitotic segregation and cell-to-cell invasion are required for stable germline transmission of Wolbachia in filarial nematodes

    OpenAIRE

    Frédéric Landmann; Odile Bain; Coralie Martin; Shigehiko Uni; Taylor, Mark J.; William Sullivan

    2012-01-01

    Summary Parasitic filarial nematodes that belong to the Onchocercidae family live in mutualism with Wolbachia endosymbionts. We developed whole-mount techniques to follow the segregation patterns of Wolbachia through the somatic and germline lineages of four filarial species. These studies reveal multiple evolutionarily conserved mechanisms that are required for Wolbachia localization to the germline. During the initial embryonic divisions, Wolbachia segregate asymmetrically such that they...

  18. Emerging perspectives on hereditary glomerulopathies in canines

    Directory of Open Access Journals (Sweden)

    Littman MP

    2015-04-01

    Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

  19. An Update on Therapeutic Management of Canine Demodicosis

    Directory of Open Access Journals (Sweden)

    S. K. Singh

    2011-02-01

    Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44

  20. Analyses of critical target cell responses during preclinical phases of evolving chronic radiation-induced myeloproliferative disease-exploitation of a unique canine model

    Energy Technology Data Exchange (ETDEWEB)

    Seed, T.M.; Kaspar, L.V.; Tolle, D.V.; Fritz, T.E.; Frazier, M.E.

    1988-01-01

    This document briefly summarizes and highlights ongoing studies on the cellular and molecular processes involved in the induction and progression of myeloid leukemia in dogs chronically exposed to low daily doses of wholebody gamma irradiation. Under such conditions, select groups of dogs exhibit extremely high frequencies of myeloproliferative disease (MPD) (i.e., /congruent/50%) of which myeloid leukemia is most prominent. 2 figs.

  1. Guidelines for the diagnosis and antimicrobial therapy of canine superficial bacterial folliculitis (Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases)

    DEFF Research Database (Denmark)

    Hillier, Andrew; Lloyd, David H.; Weese, J. Scott;

    2014-01-01

    of an internationally available resource guiding practitioners in the diagnosis, treatment and prevention of SBF. DEVELOPMENT OF THE GUIDELINES: The guidelines were developed by the Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases, with consultation and advice...

  2. Analyses of critical target cell responses during preclinical phases of evolving chronic radiation-induced myeloproliferative disease-exploitation of a unique canine model

    International Nuclear Information System (INIS)

    This document briefly summarizes and highlights ongoing studies on the cellular and molecular processes involved in the induction and progression of myeloid leukemia in dogs chronically exposed to low daily doses of wholebody gamma irradiation. Under such conditions, select groups of dogs exhibit extremely high frequencies of myeloproliferative disease (MPD) (i.e., /congruent/50%) of which myeloid leukemia is most prominent. 2 figs

  3. Characterization of canine dendritic cells in healthy, atopic, and non-allergic inflamed skin.

    Science.gov (United States)

    Ricklin, Meret Elisabeth; Roosje, Petra; Summerfield, Artur

    2010-11-01

    Atopic dermatitis in humans and dogs is a chronic relapsing allergic skin disease. Dogs show a spontaneous disease similar to the human counterpart and represent a model to improve our understanding of the immunological mechanisms, the pathogenesis of the disease, and new therapy development. The aim of the study was to determine the frequency and phenotype of dendritic cells (DC) in the epidermis and dermis of healthy, canine atopic dermatitis lesional, and non-allergic inflammatory skin to further validate the model and to obtain insights into the contribution of DC to the pathogenesis of skin diseases in dogs. We first characterized canine skin DC using flow-cytometric analysis of isolated skin DC combined with an immunohistochemical approach. A major population of canine skin dendritic cells was identified as CD1c(+)CD11c(+)CD14(-)CD80(+)MHCII(+)MAC387(-) cells, with dermal DC but not Langerhans cells expressing CD11b. In the epidermis of lesional canine atopic dermatitis and non-allergic inflammatory skin, we found significantly more dendritic cells compared with nonlesional and control skin. Only in canine atopic dermatitis skin did we find a subset of dendritic cells positive for IgE, in the epidermis and the dermis. Under all inflammatory conditions, dermal dendritic cells expressed more CD14 and CD206. MAC387(+) putative macrophages were absent in healthy but present in inflamed skin, in particular during non-allergic diseases. This study permits a phenotypic identification and differentiation of canine skin dendritic cells and has identified markers and changes in dendritic cells and macrophage populations related to allergic and non-allergic inflammatory conditions. Our data suggest the participation of dendritic cells in the pathogenesis of canine atopic dermatitis similar to human atopic dermatitis and further validate the only non-murine spontaneous animal model for this disease. PMID:20676740

  4. Seroepidemiology of Canine parvovirus infection in dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow

    2004-10-01

    Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.

  5. Canine neosporosis: perspectives on pathogenesis and management

    Directory of Open Access Journals (Sweden)

    Silva RC

    2016-04-01

    Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

  6. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    International Nuclear Information System (INIS)

    Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

  7. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    Directory of Open Access Journals (Sweden)

    Kiupel Matti

    2006-04-01

    Full Text Available Abstract Background Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. Methods In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. Results No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. Conclusion In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs.

  8. Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

    Directory of Open Access Journals (Sweden)

    Emily J Shields

    Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

  9. Circulating filarial antigen in serum and hydrocele fluid from individuals living in an endemic area for bancroftian filariasis

    Directory of Open Access Journals (Sweden)

    Shah A

    2007-01-01

    Full Text Available This study examined circulating filarial antigen by monoclonal antibody Og4C3-enzyme-linked immunosorbent assay (ELISA from 114 men with hydrocele, living in an endemic area. Nocturnal blood and hydrocele fluid were collected and examined for microfilaria. ELISA was performed on serum and hydrocele fluid for detection of antigen. Amongst 114 cases, 5(4.4% showed microfilaria in blood but none in fluid. ELISA was positive in 13(11.40% serum and 5 (4.4% fluid samples. All five fluid antigen positive cases were positive for antibodies and showed microfilaria in blood. These findings emphasize the use of circulating filarial antigen detection and alternative usage of hydrocele fluid for diagnosis of filariasis.

  10. Functional analysis of a highly conserved abundant larval transcript-2 (alt-2) intron 2 repeat region of lymphatic filarial parasites.

    Science.gov (United States)

    Sakthidevi, Moorthy; Hoti, Sugeerappa Laxmanappa; Kaliraj, Perumal

    2014-06-01

    The filarial-specific protein abundant larval transcript-2 (ALT-2) is expressed exclusively in the infective larval stage (L3) and is a crucial protein for establishing immunopathogenesis in human hosts. The alt-2 gene has a conserved minisatellite repeat (29 or 27bp) in intron 2 (IR2) whose significance within lymphatic filarial species is unknown. Here, we report the role of IR2 in the regulation of alt-2 gene expression using an in vitro model. Using electrophoretic mobility shift assays, we identified the presence of a putative nuclear protein binding region within IR2. Subsequent transient expression experiments in eukaryotic cell lines demonstrated that the IR2 downregulated the expression of a downstream luciferase reporter gene, which was further validated with RT-PCR. We therefore identify IR2 as a suppressor element that regulates L3 stage-specific expression of alt-2. PMID:24681262

  11. Cytokine production in BALB/c mice immunized with radiation attenuated third stage larvae of the filarial nematode, Brugia pahangi

    International Nuclear Information System (INIS)

    BALB/c mice immunized with radiation-attenuated third stage larvae of the filarial nematode Brugia pahangi are strongly immune to challenge infection. Investigation of the profile of cytokines secreted by spleen cells from immune mice stimulated in vitro with either parasite Ag or with Con A revealed high levels of IL-5 and IL-9 and moderate levels of IL-4. In contrast, secretion of IFN-γ by spleen cells from immune animals was negligible. Spleen cells from control mice secreted low levels of all cytokines assayed. Levels of parasite-specific IgE were significantly elevated in immune animals and a peripheral blood eosinophilia was observed, which exhibited a biphasic distribution. Our results are consistent with the preferential expansion of Th2 cells in immune animals and provide the basis for dissecting the means by which radiation-attenuated larvae of filarial nematodes stimulate immunity. 5l refs., 3 figs., 3 tabs

  12. Health-Seeking Behaviors and Self-Care Practices of People with Filarial Lymphoedema in Nepal: A Qualitative Study

    OpenAIRE

    Ram Kumar Adhikari; Jeevan Bahadur Sherchand; Shiva Raj Mishra; Kamal Ranabhat; Amrit Pokharel; Pramila Devkota; Durga Mishra; Yadu Chandra Ghimire; Khageshwor Gelal; Rajan Paudel; Rajendra Raj Wagle

    2015-01-01

    Background. Lymphatic filariasis is endemic in Nepal. This study aimed to investigate health-seeking behaviors and self-care practices of people with filarial Lymphoedema in Nepal. Methods. A cross-sectional study was conducted using qualitative methods in three endemic districts. Twenty-three patients with current Lymphoedema were recruited in the study. Results. Hydrocele was found to be a well-known condition and a major health problem in the studied communities. People with Lymphoedema pr...

  13. Comparative studies on the biology and filarial susceptibility of selected blood-feeding and autogenous Aedes togoi sub-colonies

    OpenAIRE

    Anuluck Junkum; Wej Choochote; Atchariya Jitpakdi; Somjai Leemingsawat; Narumon Komalamisra; Narissara Jariyapan; Chavalit Boonyatakorn

    2003-01-01

    Blood-feeding and autogenous sub-colonies were selected from a laboratory, stock colony of Aedes togoi, which was originally collected from Koh Nom Sao, Chanthaburi province, Southeast Thailand. Comparative biology and filarial susceptibility between the two sub-colonies (blood-feeding: F11, F13; autogeny: F38, F40) were investigated to evaluate their viability and vectorial capacity. The results of comparison on biology revealed intraspecific differences, i.e., the average egg deposition/gra...

  14. Efficacy of Three-Week Oxytetracycline or Rifampin Monotherapy Compared with a Combination Regimen against the Filarial Nematode Onchocerca ochengi

    OpenAIRE

    Bah, G. S.; Ward, E. L.; A Srivastava; Trees, A. J.; Tanya, V. N.; B.L. Makepeace

    2014-01-01

    Onchocerciasis (river blindness), caused by the filarial nematode Onchocerca volvulus, is a major cause of visual impairment and dermatitis in sub-Saharan Africa. As O. volvulus contains an obligatory bacterial symbiont (Wolbachia), it is susceptible to antibiotic chemotherapy, although current regimens are considered too prolonged for community-level control programs. The aim of this study was to compare the efficacies of oxytetracycline and rifampin, administered separately or in combinatio...

  15. A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

    Directory of Open Access Journals (Sweden)

    S. Gur

    2009-05-01

    Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

  16. A retrospective investigation of canine adenovirus (CAV) infection in adult dogs in Turkey.

    Science.gov (United States)

    Gür, S; Acar, A

    2009-06-01

    Canine adenovirus (CAV) type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serum samples were collected from native pure-bred Kangal(n = 11), and Akbash dogs (n = 17) and Turkish Greyhounds (n = 15) in Eskişehir and Konya provinces. None of the dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2%, 93.3% and 100% prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51) were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3%) were detected as seropositive. In total, 82 of 94 dogs (87.2%) were found to be positive for CAV serum antibodies. PMID:19831268

  17. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  18. Health status, infection and disease in California sea lions (Zalophus californianus) studied using a canine microarray platform and machine-learning approaches.

    Science.gov (United States)

    Mancia, Annalaura; Ryan, James C; Chapman, Robert W; Wu, Qingzhong; Warr, Gregory W; Gulland, Frances M D; Van Dolah, Frances M

    2012-04-01

    Conservation biologists face many challenges in assessing health, immune status and infectious diseases in protected species. These challenges include unpredictable sample populations, diverse genetic and environmental backgrounds of the animals, as well as the practical, legal and ethical issues involved in experimentation. The use of whole genome scale transcriptomics with animal samples obtained in a minimally invasive manner is an approach that shows promise for health assessment. In this study we assessed the utility of a microarray to identify changes in gene expression predictive of health status by interrogating blood samples from California sea lions (Zalophus californianus) in rehabilitation. A custom microarray was developed from the commercially available dog microarray (Canis familiaris) by selecting probes that demonstrated reliable cross-hybridization with RNA in sea lion blood. This custom microarray was used for the analysis of RNA from 73 sea lion blood samples, from animals with a broad spectrum of health changes. Both traditional classifying techniques and newer artificial neural network approaches correctly classified sea lions with respect to health status, primarily distinguishing between leptospirosis infection and domoic acid exposure. Real time PCR validation for a small set of genes, followed by sequencing, showed good correlation with array results and high identity (96-98%) between the dog and sea lion sequences. This approach to health status classification shows promise for disease identification in a clinical setting, and assessment of health status of wildlife. PMID:22067742

  19. A canine orthologue of the human GFAP c.716G>A (p.Arg239His) variant causes Alexander disease in a Labrador retriever.

    Science.gov (United States)

    Van Poucke, Mario; Martlé, Valentine; Van Brantegem, Leen; Ducatelle, Richard; Van Ham, Luc; Bhatti, Sofie; Peelman, Luc J

    2016-06-01

    Alexander disease (AxD) is a fatal neurodegenerative disorder of astrocyte dysfunction in man, for which already a number of causal variants are described, mostly de novo dominant missense variants in the glial fibrillary acidic protein (GFAP). A similar disorder was already phenotypically described in animals but without the identification of causal variants. We diagnosed a Labrador retriever with a juvenile form of AxD based on clinical (tetraparesis with spastic front limbs mimicking 'swimming puppy syndrome') and pathological (the detection of GFAP containing Rosenthal fibers in astrocytes) features. In order to identify a causal variant, the coding sequences of the four detected GFAP transcript variants (orthologues from human transcript variants α, γ, δ/ɛ and κ) were sequenced. From the five detected variants, a heterozygous c.719G>A nucleotide substitution resulting in a p.Arg240His substitution was considered to be causal, because it is orthologous to the heterozygous de novo dominant c.716G>A (p.Arg239His) hotspot variant in man, proven to cause a severe phenotype. In addition, the variant was not found in 50 unrelated healthy Labrador retrievers. Because the condition in dogs is morphologically similar to man, it could be a promising animal model for further elucidating the genotype/phenotype correlation in order to treat or prevent this disease. PMID:26486469

  20. Survey of Canine Dirofilaria immitis Infection in New Caledonia.

    Science.gov (United States)

    Watier-Grillot, S; Marié, J-L; Cabre, O; Davoust, B

    2011-01-01

    Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis) infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe) and the Rapid Immuno Migration (RIM) test: WITNESS DIROFILARIA (Synbiotics Europe). Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs received a permanent chemoprophylaxis (moxidectin). In 11 stray dogs, both tests were positive (22.4%). All the military dogs were negative, showing efficiency of chemoprophaxis. Results were discrepant in 6 dogs, negative with one test and doubtful with the other. Antigen heartworm test kits are available and reliable diagnostic tools. They are useful to evaluate the efficiency of chemoprophylaxis and to detect infected animals in order to treat them and to prevent the spreading of the disease. PMID:21547264

  1. Survey of Canine Dirofilaria immitis Infection in New Caledonia

    Directory of Open Access Journals (Sweden)

    S. Watier-Grillot

    2011-01-01

    Full Text Available Canine dirofilariosis is a frequent parasitic disease in New-Caledonia. A survey of canine heartworm (Dirofilaria immitis infection among dogs from the cities of Tontouta, Nandaï and Nouméa, was performed in March 2009 using two antigen test kits; the microwell ELISA test: DiroCHE (Synbiotics Europe and the Rapid Immuno Migration (RIM test: WITNESS DIROFILARIA (Synbiotics Europe. Blood samples were collected from 64 dogs: 49 strays and 15 military working dogs. The military dogs received a permanent chemoprophylaxis (moxidectin. In 11 stray dogs, both tests were positive (22.4%. All the military dogs were negative, showing efficiency of chemoprophaxis. Results were discrepant in 6 dogs, negative with one test and doubtful with the other. Antigen heartworm test kits are available and reliable diagnostic tools. They are useful to evaluate the efficiency of chemoprophylaxis and to detect infected animals in order to treat them and to prevent the spreading of the disease.

  2. Identification of new genovariants of canine distemper virus in dogs from the State of Mexico by analyzing the nucleocapsid gene

    OpenAIRE

    CE Gámiz-Mejía; J Simón-Martínez; RC Fajardo-Muñoz

    2012-01-01

    Globally, Canine Distemper Disease is one of the most important viral diseases in dogs due to its high mortality and morbidity. It is caused by an RNA canine paramyxovirus with an elevated genetic diversity. We previously reported the presence of an apparently exclusive genovariant in the State of Mexico, but we do not have data on molecular epidemiology of this virus. In order to determine his genetic diversity in this State, samples collected from dogs showing clinical signs of ...

  3. Canine distemper infections, with special reference to South Africa, with a review of the literature : review article

    OpenAIRE

    A.L. Leisewitz; Carter, A; M. Van Vuuren; van Blerk, L

    2001-01-01

    Canine distemper virus is a member of the genus Morbillivirus of the family Paramyxoviridaethat causes severe disease in dogs and a range of wild mammals. The clinical signs relate essentially to the respiratory, gastrointestinal and central nervous systems. In South Africa, infection with Ehrlichia canis and canine parvovirus may present similarly. Many dogs will initially present with a wide range of central nervous system signs without any history of systemic disease. A recent South Africa...

  4. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

    Directory of Open Access Journals (Sweden)

    Veneziano Vincenzo

    2006-09-01

    Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

  5. Antioxidants in the Canine Model of Human Aging

    OpenAIRE

    Dowling, Amy L. S.; Head, Elizabeth

    2011-01-01

    Oxidative damage can lead to neuronal dysfunction in the brain due to modifications to proteins, lipids and DNA/RNA. In both human and canine brain, oxidative damage progressively increases with age. In the Alzheimer’s disease (AD) brain, oxidative damage is further exacerbated, possibly due to increased deposition of beta-amyloid (Aβ) peptide in senile plaques. These observations have led to the hypothesis that antioxidants may be beneficial for brain aging and AD. Aged dogs naturally develo...

  6. Canine parvovirus effect on wolf population change and pup survival

    Science.gov (United States)

    Mech, L.D.; Goyal, S.M.

    1993-01-01

    Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

  7. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated n

  8. The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia.

    Science.gov (United States)

    Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P

    2015-07-01

    The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. PMID:25841899

  9. Establishment of Canine-Derived Giardia duodenalis Isolates in Culture.

    Science.gov (United States)

    Tysnes, Kristoffer R; Robertson, Lucy J

    2016-06-01

    Researchers continue to rely on axenic cultivation of Giardia duodenalis trophozoites in vitro to study the life cycle and host-parasite interactions of G. duodenalis and to develop vaccines and drugs to prevent and treat giardiasis. The majority of in vitro studies of G. duodenalis have used a small subset of isolates, mostly of assemblage A, and these isolates are usually originally isolated from humans. The most commonly used isolate for lab studies is known as WB. Canine giardiasis is a disease of veterinary importance, but it may also be of relevance in zoonotic transmission. Few G. duodenalis isolates from dogs have been adapted to in vitro culture, probably because the methods used are not suitable for the canine-specific genotypes that tend to dominate in most dog populations. In the current study, an experimental approach to cultivating canine-derived isolates of G. duodenalis was attempted by modification of the standard protocol based on physiological differences between the human and canine digestive system. An adapted method is described for improving the rate of in vitro excystation of cysts isolated from dogs by chemically weakening the cyst wall. A new canine-derived assemblage A G. duodenalis isolate was successfully adapted to axenic culture by using this method; the dog apparently had a mixed infection of assemblages A and D, but the assemblage A successfully outcompeted the assemblage D under conditions of in vitro culture. Based on the results, reasons regarding why humans do not seem to be suitable hosts for G. duodenalis in assemblages C and D are discussed. PMID:26835750

  10. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  11. Pathophysiology, diagnosis, and treatment of canine hip dysplasia

    International Nuclear Information System (INIS)

    Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education

  12. European surveillance for pantropic canine coronavirus.

    Science.gov (United States)

    Decaro, Nicola; Cordonnier, Nathalie; Demeter, Zoltan; Egberink, Herman; Elia, Gabriella; Grellet, Aurélien; Le Poder, Sophie; Mari, Viviana; Martella, Vito; Ntafis, Vasileios; von Reitzenstein, Marcela; Rottier, Peter J; Rusvai, Miklos; Shields, Shelly; Xylouri, Eftychia; Xu, Zach; Buonavoglia, Canio

    2013-01-01

    Highly virulent pantropic canine coronavirus (CCoV) strains belonging to subtype IIa were recently identified in dogs. To assess the distribution of such strains in Europe, tissue samples were collected from 354 dogs that had died after displaying systemic disease in France (n = 92), Hungary (n = 75), Italy (n = 69), Greece (n = 87), The Netherlands (n = 27), Belgium (n = 4), and Bulgaria (n = 1). A total of 124 animals tested positive for CCoV, with 33 of them displaying the virus in extraintestinal tissues. Twenty-four CCoV strains (19.35% of the CCoV-positive dogs) detected in internal organs were characterized as subtype IIa and consequently assumed to be pantropic CCoVs. Sequence and phylogenetic analyses of the 5' end of the spike protein gene showed that pantropic CCoV strains are closely related to each other, with the exception of two divergent French viruses that clustered with enteric strains. PMID:23100349

  13. Wolbachia endosymbionts and human disease control.

    Science.gov (United States)

    Slatko, Barton E; Luck, Ashley N; Dobson, Stephen L; Foster, Jeremy M

    2014-07-01

    Most human filarial nematode parasites and arthropods are hosts for a bacterial endosymbiont, Wolbachia. In filaria, Wolbachia are required for normal development, fertility and survival, whereas in arthropods, they are largely parasitic and can influence development and reproduction, but are generally not required for host survival. Due to their obligate nature in filarial parasites, Wolbachia have been a target for drug discovery initiatives using several approaches including diversity and focused library screening and genomic sequence analysis. In vitro and in vivo anti-Wolbachia antibiotic treatments have been shown to have adulticidal activity, a long sought goal of filarial parasite drug discovery. In mosquitoes, it has been shown that the presence of Wolbachia can inhibit the transmission of certain viruses, such as Dengue, Chikungunya, Yellow Fever, West Nile, as well as the infectivity of the malaria-causing protozoan, Plasmodium and filarial nematodes. Furthermore, Wolbachia can cause a form of conditional sterility that can be used to suppress populations of mosquitoes and additional medically important insects. Thus Wolbachia, a pandemic endosymbiont offers great potential for elimination of a wide-variety of devastating human diseases. PMID:25046729

  14. A repurposing strategy for Hsp90 inhibitors demonstrates their potency against filarial nematodes.

    Directory of Open Access Journals (Sweden)

    Victoria Gillan

    2014-02-01

    Full Text Available Novel drugs are required for the elimination of infections caused by filarial worms, as most commonly used drugs largely target the microfilariae or first stage larvae of these infections. Previous studies, conducted in vitro, have shown that inhibition of Hsp90 kills adult Brugia pahangi. As numerous small molecule inhibitors of Hsp90 have been developed for use in cancer chemotherapy, we tested the activity of several novel Hsp90 inhibitors in a fluorescence polarization assay and against microfilariae and adult worms of Brugia in vitro. The results from all three assays correlated reasonably well and one particular compound, NVP-AUY922, was shown to be particularly active, inhibiting Mf output from female worms at concentrations as low as 5.0 nanomolar after 6 days exposure to drug. NVP-AUY922 was also active on adult worms after a short 24 h exposure to drug. Based on these in vitro data, NVP-AUY922 was tested in vivo in a mouse model and was shown to significantly reduce the recovery of both adult worms and microfilariae. These studies provide proof of principle that the repurposing of currently available Hsp90 inhibitors may have potential for the development of novel agents with macrofilaricidal properties.

  15. Synergistic effect of Croton caudatus (fruits) and Tiliacora acuminata (flowers) extracts against filarial vector Culex quinquefasciatus

    Institute of Scientific and Technical Information of China (English)

    Someshwar Singha; Siddharthasankar Banerjee; Goutam Chandra

    2011-01-01

    Objective:To investigate the synergistic effect of crude and solvent extract of Croton caudatus (C. caudatus ) (fruits) and Tiliacora acuminata (T. acuminata) (flowers) against the larval form of Culex quinquefasciatus (Cx. quinquefasciatus). Methods: Crude and solvent [chloroform:methanol (1:1 v/v), benzene and ethyl acetate] extracts of two plants, C. caudatus (fruits) and T. acuminata (flowers) were examined separately against filarial vector Cx. quinquefasciatus larvae with gradually increasing concentration i.e. from 0.1%to 0.5%of crude extract and 25 ppm to 75 ppm of solvent extracts. To observe the synergistic effect, if any, extracts of these two plant parts were mixed at different concentrations and treated against mosquito larvae. Phytochemical analyses of extracts of both the plant parts were carried out. Results: In a 72-h bioassay experiment with plant extracts, highest mortalities were recorded at 0.5% (crude) and 75 ppm (solvent) concentration for fruits of C. caudatus and flowers of T. acuminata individually. For synergistic effect, only 0.2%of the mixture of these two crude extracts and 75 ppm concentration of chloroform:methanol (1:1 v/v) and ethyl acetate extracts showed 100%mortality after 24 h and 48 h of exposure respectively. Conclusions:In the field of mosquito control, insecticides of plant origin may serve as suitable alternative to the toxic chemicals. Some secondary metabolites in combination may be responsible for better larvicidal activity.

  16. Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.

    Science.gov (United States)

    Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D

    2014-12-01

    Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis. PMID:25320495

  17. 犬瘟热的诊治%Diagnosis and Treatment of Canine Distemper

    Institute of Scientific and Technical Information of China (English)

    罗厚强; 段龙川; 王清艳; 涂宜强; 涂国众

    2012-01-01

    Canine distemper is an acute infectious disease caused by the canine distemper virus in Canidae. Many symptoms were characterized by infected dogs, such as biphasic fever, rhinitis, severe inflammation of the digestive tract and respiratory inflammation. The pathogen, epidemiology, clinical symptoms and pathological changes of canine distemper were introduced in the paper. Though a typical case of canine distemper, a series of effective measures to treat canine distemper were introduced in order to provide reference for the control of canine distemper.%犬瘟热是一种由犬瘟热病毒引起的犬科动物急性传染病,病犬以双相热、鼻炎、严重的消化障碍和呼吸道炎症为特征。主要对该病的病原、流行病学、临床症状及病理变化等作一阐述,并以一例犬瘟热典型病例的诊治为例,介绍了治疗该病的有效措施,以期为有效防治犬瘟热提供参考。

  18. Maxillary canine with two root canals

    OpenAIRE

    Nagesh Bolla; Sarath Raj Kavuri

    2011-01-01

    To report a rare case of maxillary canine with two root canals. The case describes the treatment of a maxillary canine with two root canals which was referred from department of prosthodontia for intentional root canal treatment for prosthetic rehabilitation. Clinical examination revealed a maxillary canine with carious lesion and responded within normal limits to electric pulp test. Radiographic examination revealed a distal carious lesion (close proximity to pulp) and also appeared to be an...

  19. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael; Wiinberg, Bo; Clausen, Jes T.; Hansen, Jens Jacob; Nichols, Timothy C.; Kjalke, Marianne; Jensen, Asger Lundorff; Kristensen, Annemarie Thuri

    2011-01-01

    Canine coagulation factor VII (FVII) deficiency can be hereditary or acquired and may cause life threatening bleeding episodes if untreated. FVII procoagulant activity can be measured by FVII activity (FVII:C), but assays for measurement of canine specific FVII antigen (FVII:Ag) have not been...... available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...... in the diagnosis of hereditary canine FVII deficiency....

  20. The effect of nematode administration on canine atopic dermatitis.

    Science.gov (United States)

    Mueller, R S; Specht, L; Helmer, M; Epe, C; Wolken, S; Denk, D; Majzoub, M; Sauter-Luis, C

    2011-09-27

    Canine atopic dermatitis is a common disease and is considered as an animal model of the human disease. Immunomodulation by helminths is reported in several species. The aim of this study was to determine whether nematodes have an immunomodulatory effect on atopic dermatitis in dogs. In the pilot study, 12 atopic dogs were infected with either embryonated eggs of Trichuris vulpis (500 and 2500 eggs in 3 dogs each) or L3 larvae of Uncinaria stenocephala (100, 500 and 2500 eggs in 2 dogs each), respectively, for 3 months. Pruritus was evaluated with visual analogue scales and clinical lesions with the canine atopic dermatitis extent and severity index (CADESI). Skin biopsies were obtained for histopathology at the beginning and end of the study. In the subsequent placebo-controlled, double-blinded, randomised study, 21 dogs received either 2500 embryonated T. vulpis eggs or placebo and were evaluated similarly. In addition, allergen-specific serum IgE concentrations were determined. All dogs in the pilot study improved in their lesion scores, most in their pruritus scores. The cutaneous inflammatory infiltrate did not change significantly. In the subsequent randomised study, there was no significant difference between placebo and Trichuris administration in regard to pruritus or CADESI. IgE concentrations also did not change significantly. Infection with T. vulpis did not significantly change clinical signs of canine atopic dermatitis. PMID:21621922

  1. Canine IgA nephropathy: a case report.

    Science.gov (United States)

    Yabuki, Akira; Shimokawa Miyama, Takako; Kohyama, Moeko; Yamato, Osamu

    2016-04-01

    Immunoglobulin (Ig) A nephropathy is a rare form of canine glomerular disease. This report describes a case of canine IgA nephropathy showing characteristics typical of human IgA nephropathy. An 8-year-old, spayed female Miniature Dachshund showed persistent severe proteinuria without azotemia. She was receiving long-term glucocorticoid therapy due to chronic gastritis and an intra-abdominal suture granuloma. A renal biopsy demonstrated mesangial proliferative glomerulonephritis with predominantly mesangial IgA deposition and electron-dense deposits in the paramesangium. These findings closely resembled those of human IgA nephropathy. Glucocorticoid treatment was discontinued, and the angiotensin-converting enzyme inhibitor enalapril was administrated as an antiproteinuric agent. The proteinuria subsequently went into remission, and the patient has maintained good condition without recurrence. PMID:26596464

  2. Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells

    Directory of Open Access Journals (Sweden)

    Michelle G. Ritt

    2015-04-01

    Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.

  3. Sewage surveillance reveals the presence of canine GVII norovirus and canine astrovirus in Uruguay.

    Science.gov (United States)

    Lizasoain, A; Tort, L F L; García, M; Gómez, M M; Leite, J P G; Miagostovich, M P; Cristina, J; Berois, M; Colina, R; Victoria, Matías

    2015-11-01

    Canine norovirus (NoV) and astrovirus (AstV) were studied in 20 domestic sewage samples collected in two cities in Uruguay. Four samples were characterized as canine AstV after phylogenetic analysis clustering with strains detected in Italy and Brazil in 2008 and 2012, respectively. One sample was characterized as canine NoV and clustered with a strain detected in Hong Kong and recently classified as GVII. This study shows the occurrence of a canine NoV GVII strain for the first time in the American continent and also warns about possible zoonotic infection, since canine strains were detected in domestic sewage. PMID:26280526

  4. Canine mammary tumors - clinical survey

    OpenAIRE

    Elena Atanaskova Petrov; Ksenija Ilievska; Plamen Trojacanec; Irena Celeska; Goran Nikolovski; Ivica Gjurovski; Toni Dovenski

    2014-01-01

    Mammary tumours are the second most frequent neoplasia in dogs, mainly affecting older female patients. Approximately 50% of the mammary tumours are malignant with high percentage of mortality if not treated in time. The aim of this study was to analyze the data of canine patients with mammary tumours, to evaluate the type of tumours, as well as the relationship between tumour incidence and dogs’ age, reproductive cycle and sterilization. The survey was used to retrieve the information in the...

  5. Surgical innovations in canine gonadectomy

    OpenAIRE

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  6. Impact of canine control on the epidemiology of canine and human visceral leishmaniasis in Brazil.

    Science.gov (United States)

    Palatnik-de-Sousa, C B; dos Santos, W R; França-Silva, J C; da Costa, R T; Reis, A B; Palatnik, M; Mayrink, W; Genaro, O

    2001-11-01

    Brazil is the only country endemic for zoonotic visceral leishmaniasis (ZVL) that regularly conducts epidemiologic and prophylactic control programs that involve the treatment of human cases, insect vector control, and the removal of seropositive infected dogs. This report reviews 60 studies reporting data on the efficacy of these recommended control tools and concludes that in Brazil 1) eradication of the disease in Minas Gerais was achieved by the concomitant use of the three control methods, 2) although seropositivity by an immunofluorescent assay is not completely related to infectiousness, the removal of seropositive dogs leads to a significant reduction of canine and human incidence, 3) improvement of the sensitivity of the diagnostic tool used for canine control should optimize the efficacy of control, and 4) although difficult and expensive, the public health dog control campaigns performed in Brazil reduced the incidence of ZVL and should be maintained since treatment of dogs is an unrealistic intervention, both because of its prohibitive cost and relatively poor effectiveness. PMID:11716106

  7. Effect of simulated stages of the canine oestrous cycle on Escherichia coli binding to canine endometrium.

    Science.gov (United States)

    Krekeler, N; Lodge, K M; Anderson, G A; Browning, G F; Charles, J A; Wright, P J

    2012-12-01

    Pyometra, a prevalent infectious uterine disease that affects intact middle-aged bitches, is typically associated with Escherichia coli. Our hypotheses were (i) that bacterial adhesion to canine endometrium differs between different stages of the oestrous cycle and (ii) that the adhesin FimH facilitates this adhesion. Twelve post-pubertal, ovariectomized greyhound bitches were treated with exogenous hormones to simulate different stages of the oestrous cycle. Tissue samples from each uterus were incubated with a pathogenic E. coli strain carrying the fimH gene, but no other adhesin genes (P4-wt)--or an E. coli strain in which fimH was insertionally inactivated (P4-∆fimH::kan)--or with phosphate-buffered saline as a negative control. After washing, tissue samples were homogenized for quantification of adherent bacteria. The differences in binding to canine endometrium at different stages of the oestrous cycle were not significant. However, the mean difference in binding of the P4-wt and the P4-∆fimH::kan across all stages of the simulated oestrous cycle was significant (p < 0.001 by paired t-test on geometric means). Individual differences in numbers of P4-wt bacteria bound between dogs might suggest genetic variations or epigenetic differences in FimH receptor expression by the endometrium, unrelated to the stage of the oestrous cycle. PMID:23279531

  8. Canine adenovirus based rabies vaccines.

    Science.gov (United States)

    Tordo, N; Foumier, A; Jallet, C; Szelechowski, M; Klonjkowski, B; Eloit, M

    2008-01-01

    Adenovirus based vectors are very attractive candidates for vaccination purposes as they induce in mammalian hosts potent humoral, mucosal and cellular immune responses to antigens encoded by the inserted genes. We have generated E1-deleted and replication-competent recombinant canine type-2 adenoviruses expressing the rabies virus glycoprotein (G). The effectiveness of both vectors to express a native G protein has been characterized in vitro in permissive cell lines. We compared the humoral and cellular immune responses induced in mice by intramuscular injection of the recombinant canine adenovirus vectors with those induced by a human (Ad5) E1-deleted virus expressing the same rabies G protein. Humoral responses specific to the adenoviruses or the rabies glycoprotein antigens were studied. The influence of the mouse strain was observed using replication-competent canine adenovirus. A high level of rabies neutralizing antibody was observed upon i.m. inoculation, and 100% of mice survived lethal challenge. These results are very promising in the perspective of oral vaccine for dog rabies control. PMID:18634509

  9. Genetic Control of Canine Leishmaniasis: Genome-Wide Association Study and Genomic Selection Analysis

    OpenAIRE

    Quilez, Javier; Martínez, Verónica; Woolliams, John A.; Sanchez, Armand; Pong-Wong, Ricardo; Kennedy, Lorna J.; Quinnell, Rupert J.; William E. R. Ollier; Roura, Xavier; Ferrer, Lluís; Altet, Laura; Francino, Olga

    2012-01-01

    Background: the current disease model for leishmaniasis suggests that only a proportion of infected individuals develop clinical disease, while others are asymptomatically infected due to immune control of infection. The factors that determine whether individuals progress to clinical disease following Leishmania infection are unclear, although previous studies suggest a role for host genetics. Our hypothesis was that canine leishmaniasis is a complex disease with multiple loci responsible for...

  10. Genetic control of canine leishmaniasis: genome-wide association study and genomic selection analysis

    OpenAIRE

    Javier Quilez; Verónica Martínez; Woolliams, John A.; Armand Sanchez; Ricardo Pong-Wong; Kennedy, Lorna J.; Quinnell, Rupert J; Ollier, William E.R.; Xavier Roura; Lluís Ferrer; Laura Altet; Olga Francino

    2012-01-01

    BACKGROUND: The current disease model for leishmaniasis suggests that only a proportion of infected individuals develop clinical disease, while others are asymptomatically infected due to immune control of infection. The factors that determine whether individuals progress to clinical disease following Leishmania infection are unclear, although previous studies suggest a role for host genetics. Our hypothesis was that canine leishmaniasis is a complex disease with multiple loci responsible for...

  11. [Diagnostic tools for canine parvovirus infection].

    Science.gov (United States)

    Proksch, A L; Hartmann, K

    2015-01-01

    Canine parvovirus (CPV) infection is one of the most important and common infectious diseases in dogs, in particular affecting young puppies when maternal antibodies have waned and vaccine-induced antibodies have not yet developed. The mortality rate remains high. Therefore, a rapid and safe diagnostic tool is essential to diagnose the disease to 1) provide intensive care treatment and 2) to identify virus-shedding animals and thus prevent virus spread. Whilst the detection of antibodies against CPV is considered unsuitable to diagnose the disease, there are several different methods to directly detect complete virus, virus antigen or DNA. Additionally, to test in commercial laboratories, rapid in-house tests based on ELISA are available worldwide. The specificity of the ELISA rapid in-house tests is reported to be excellent. However, results on sensitivity vary and high numbers of false-negative results are commonly reported, which potentially leads to misdiagnosis. Polymerase chain reaction (PCR) is a very sensitive and specific diagnostic tool. It also provides the opportunity to differentiate vaccine strains from natural infection when sequencing is performed after PCR. PMID:26403490

  12. Host NK cells are required for the growth of the human filarial parasite Brugia malayi in mice.

    Science.gov (United States)

    Babu, S; Porte, P; Klei, T R; Shultz, L D; Rajan, T V

    1998-08-01

    Human lymphatic filariasis, which afflicts an estimated 120 million people worldwide, is caused by the large nematode parasites Wuchereria bancrofti and Brugia malayi. Filarial nematodes require both an arthropod vector and a mammalian host to complete their life cycle. Within the definitive (mammalian) host, the lymphatic filarial parasites reside in the lymph nodes and lymphatics, a seemingly hostile environment for infectious agents, since the location exposes them to the immune defenses of the host. We present data here that suggest that the growth of B. malayi in the mammalian host is dependent on host NK cell function. Comparisons of worm survival and development in different strains of mice with varying levels of NK cell activity reveal that NOD/LtSz-scid/scid and NOD/LtSz-scid/scid B2m(null) mice (with diminished to absent NK cell activity respectively), are nonpermissive to worm growth, while C.B-17-scid/scid mice with normal NK cell activity are highly permissive. Depletion of NK cells in the permissive C57BL/6J-scid/scid mice renders them nonpermissive to B. malayi growth, whereas stimulation of NK cells in NOD/LtSz-scid/scid mice makes them permissive. Tg epsilon26 mice, which lack NK and T cells, are nonpermissive, but, when reconstituted with NK cells by adoptive transfer of bone marrow cells from C57BL16J-scid/scid mice, are rendered permissive. This requirement for NK cell activity may explain the site specificity of these parasites. Furthermore, these data suggest that the interaction of the host immune system with the filarial parasite is double edged, with both host protective and parasite growth-promoting activities emanating from the former. PMID:9686607

  13. High pressure freezing/freeze substitution fixation improves the ultrastructural assessment of Wolbachia endosymbiont-filarial nematode host interaction.

    Directory of Open Access Journals (Sweden)

    Kerstin Fischer

    Full Text Available BACKGROUND: Wolbachia α-proteobacteria are essential for growth, reproduction and survival for many filarial nematode parasites of medical and veterinary importance. Endobacteria were discovered in filarial parasites by transmission electron microscopy in the 1970's using chemically fixed specimens. Despite improvements of fixation and electron microscopy techniques during the last decades, methods to study the Wolbachia/filaria interaction on the ultrastructural level remained unchanged and the mechanisms for exchange of materials and for motility of endobacteria are not known. METHODOLOGY/PRINCIPAL FINDING: We used high pressure freezing/freeze substitution to improve fixation of Brugia malayi and its endosymbiont, and this led to improved visualization of different morphological forms of Wolbachia. The three concentric, bilayer membranes that surround the endobacterial cytoplasm were well preserved. Vesicles with identical membrane structures were identified close to the endobacteria, and multiple bacteria were sometimes enclosed within a single outer membrane. Immunogold electron microscopy using a monoclonal antibody directed against Wolbachia surface protein-1 labeled the membranes that enclose Wolbachia and Wolbachia-associated vesicles. High densities of Wolbachia were observed in the lateral chords of L4 larvae, immature, and mature adult worms. Extracellular Wolbachia were sometimes present in the pseudocoelomic cavity near the developing female reproductive organs. Wolbachia-associated actin tails were not observed. Wolbachia motility may be explained by their residence within vacuoles, as they may co-opt the host cell's secretory pathway to move within and between cells. CONCLUSIONS/SIGNIFICANCE: High pressure freezing/freeze substitution significantly improved the preservation of filarial tissues for electron microscopy to reveal membranes and sub cellular structures that could be crucial for exchange of materials between Wolbachia

  14. Detection of the prototype of a potential novel genus in the family Papillomaviridae in association with canine epidermodysplasia verruciformis

    OpenAIRE

    Tobler, K.; Favrot, C; Nespeca, G; Ackermann, M.

    2006-01-01

    Epidermodysplasia verruciformis (EV) is a rare human genetic predisposition to develop flat warts, some of which subsequently undergo cancer transformation. Some human papillomaviruses (HPVs), i.e. HPV 5 and 8, have been associated with cancer development as a sequela of EV. As similar diseases have been observed in dogs, it was hypothesized that unknown canine papillomaviruses (CPVs) may exist and that they may be present in cases of canine EV. Consequently, DNA was extracted from a ma...

  15. Thai generic-brand dry canine foods: mutagenicity and the effects of feeding in vivo and in vitro

    OpenAIRE

    Khuntamoon, Tanyalak; Thepouyporn, Apanchanid; Kaewprasert, Sarunya; Prangthip, Pattaneeya; Pooudoung, Somchai; Chaisri, Urai; Maneesai, Phudit; Kwanbunjan, Karunee

    2016-01-01

    Background The commercial pet-food industry and the market value of the pet industry have increased. Most owners are concerned about their pets’ health, and prefer commercial pet foods as their regular diet. This study thus aimed to determine whether a selection of local generic-brand dry canine foods had any potential to promote chronic disease. Methods Five local, generic-brand, dry canine foods were studied for potential mutagenicity; the effects of long-term consumption were also observed...

  16. Complete Genome Sequence of an H3N2 Canine Influenza Virus from Dogs in Jiangsu, China

    OpenAIRE

    Lin, Yan; Zhao, Yan-bing; Zeng, Xu-Jian; Lu, Cheng-Ping; Liu, Yong-jie

    2012-01-01

    A canine influenza virus (CIV) strain of avian origin designated A/Canine/Jiangsu/06/2010 (H3N2) was isolated from dogs exhibiting severe respiratory disease in Jiangsu, China. We announce the complete genome sequence of this viral strain and report major findings from the genomic analysis. This sequence will help us understand the molecular characteristics and evolutionary of H3N2 CIV in China.

  17. Seasonal and diurnal biting activities and zoonotic filarial infections of two Simulium species (Diptera: Simuliidae in northern Thailand

    Directory of Open Access Journals (Sweden)

    Ishii Y.

    2008-06-01

    Full Text Available Seasonal and daily biting activity patterns, and natural filarial infections of adult black flies attracted to human bait were investigated at Ban Pang Faen, a rural area in Chiang Mai Province in northern Thailand. Collections were carried out twice a month from 06-00 to 18-00 hours from January 2005 to February 2006. Among ten Simulium species collected, S. nodosum and S. asakoae were predominant occupying 57.3% and 37.2% of the total 16, 553 females, respectively. These two predominant species showed different patterns in seasonal abundance: majority of S. nodosum (86.7% were collected in hot season (from mid February to mid May, while most of S. asakoae (74.5% were collected in rainy season (from mid May to mid October. For the daily biting activity, S. nodosum had two patterns: the main one was unimodal with a peak from 17-00 to 18-00, and the other was bimodal and had the major peak from 16-00 to 18-00 and the minor one from 07-00 to 09-00. The pattern of S. asakoae was mostly unimodal with a peak from 06-00 to 10-00. The filarial larvae found in S. nodosum and S. asakoae were morphologically different from each other. The short and thick infective larvae found in S. asakoae differed from all known filarial larvae; it is suggested that they might be a bird parasite, Splendidofilariinae or Lemdaninae. The infection of the mammophilic S. nodosum with large Onchocerca type infective larvae was confirmed in this area. Natural filarial infections were found in each month (except December in either S. nodosum or S. asakoae or in both. Monthly infection rates with all stages of larvae were 0.6-5.0% for S. nodosum, and 1.0-4.0% for S. asakoae. It is suggested that people in this village are exposed to the risk of infection with zoonotic filariae throughout the year.

  18. Localization of a filarial phosphate permease that is up-regulated in response to depletion of essential Wolbachia endobacteria.

    Science.gov (United States)

    Arumugam, Sridhar; Hoerauf, Achim; Pfarr, Kenneth M

    2014-03-01

    Wolbachia of filarial nematodes are essential, obligate endobacteria. When depleted by doxycycline worm embryogenesis, larval development and worm survival are inhibited. The molecular basis governing the endosymbiosis between Wolbachia and their filarial host is still being deciphered. In rodent filarial nematode Litomosoides sigmodontis, a nematode encoded phosphate permease gene (Ls-ppe-1) was up-regulated at the mRNA level in response to Wolbachia depletion and this gene promises to have an important role in Wolbachia-nematode endosymbiosis. To further characterize this gene, the regulation of phosphate permease during Wolbachia depletion was studied at the protein level in L. sigmodontis and in the human filaria Onchocerca volvulus. And the localization of phosphate permease (PPE) and Wolbachia in L. sigmodontis and O. volvulus was investigated in untreated and antibiotic treated worms. Depletion of Wolbachia by tetracycline (Tet) resulted in up-regulation of Ls-ppe-1 in L. sigmodontis. On day 36 of Tet treatment, compared to controls (Con), >98% of Wolbachia were depleted with a 3-fold increase in mRNA levels of Ls-ppe-1. Anti-Ls-PPE serum used in Western blots showed up-regulation of Ls-PPE at the protein level in Tet worms on day 15 and 36 of treatment. Immunohistology revealed the localization of Wolbachia and Ls-PPE in the embryos, microfilariae and hypodermis of L. sigmodontis female worms and up-regulation of Ls-PPE in response to Wolbachia depletion. Expression of O. volvulus phosphate permease (Ov-PPE) studied using anti-Ov-PPE serum, showed up-regulation of Ov-PPE at the protein level in doxycycline treated Wolbachia depleted O. volvulus worms and immunohistology revealed localization of Ov-PPE and Wolbachia and up-regulation of Ov-PPE in the hypodermis and embryos of doxycycline treated worms. Ls-PPE and Ov-PPE are upregulated upon Wolbachia depletion in same tissues and regions where Wolbachia are located in untreated worms, reinforcing a link

  19. Clinical Manifestations of Mesoendemic Onchocerciasis in an Area with Multiple Filarial Species

    Directory of Open Access Journals (Sweden)

    EC Uttah

    2009-12-01

    Full Text Available "nBackground: The Imo River Basin, Nigeria is endemic for onchocerciasis, bancroftian filariasis, loaiasis and mansonellosis. This study was aimed at determining the clinical manifestations of onchocerciasis in this region. "nMethods: A cross-sectional study was carried out in 2006 in Umuowaibu I and Ndiorji commu­nities in Okigwe Local Government Area of Imo State, Nigeria. Consenting individuals were ex­amined for various gradations of skin manifestations, subcutaneous nodules, and visual im­pair­ments by qualified medical doctors. Five categories of skin manifestations were observed, namely permanent itching, onchodermatitis, atrophy of skin, leopard skin, and sowda. A total of 1024 individuals were examined. "nResults: The prevalence of the skin manifestations were permanent itching (2.5%, onchoder­ma­titis (3.9%, atrophy of the skin (5.8%, leopard skin (22.1%, and sowda (0.1%. The preva­lence of subcutaneous nodules was 25.3%, but 88.9% among the oldest age group, and mostly found in lower half of body. The majority of cases of visual acuity problems (6.8% overall prev­alence were in the oldest age groups. Among those who were ≥ 20 years old, the prevalence of visual acuity problems was significantly higher in females than in males (χ2-test; P< 0.05. Only two of the examined persons were observed to be blind. "nConclusion: Clinical manifestations of onchocerciasis are perhaps more intense in the area prob­ably because of presence of endemic infections of other filarial species.

  20. Moxidectin causes adult worm mortality of human lymphatic filarial parasite Brugia malayi in rodent models.

    Science.gov (United States)

    Verma, Meenakshi; Pathak, Manisha; Shahab, Mohd; Singh, Kavita; Mitra, Kalyan; Misra-Bhattacharya, Shailja

    2014-12-01

    Moxidectin is a macrocyclic lactone belonging to milbemycin family closely related to ivermectin and is currently progressing towards Phase III clinical trial against human infection with the filaria Onchocerca volvulus (Leuckart, 1894). There is a single report on the microfilaricidal and embryostatic activity of moxidectin in case of the human lymphatic filarial parasite Brugia malayi (Brug, 1927) in Mastomys coucha (Smith) but without any adulticidal action. In the present study, the in vitro and in vivo antifilarial efficacy of moxidectin was evaluated on, B. malayi. In vitro moxidectin showed 100% reduction in adult female worm motility at 0.6 μM concentration within 7 days with 68% inhibition in the reduction of MTT (3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide dye) (which is used to detect viability of worms). A 50% inhibitory concentration (IC50) of moxidectin for adult female parasite was 0.242 μM, for male worm 0.186 μM and for microfilaria IC50 was 0.813 μM. In adult B. malayi-transplanted primary screening model (Meriones unguiculatus Milne-Edwards), moxidectin at a single optimal dose of 20 mg/kg by oral and subcutaneous route was found effective on both adult parasites and microfilariae. In secondary screening (M coucha, subcutaneously inoculated with infective larvae), moxidectin at the same dose by subcutaneous route brought about death of 49% of adult worms besides causing sterilisation in 54% of the recovered live female worms. The treated animals exhibited a continuous and sustained reduction in peripheral blood microfilaraemia throughout the observation period of 90 days. The mechanism of action of moxidectin is suggested to be similar to avermectins. The in silico studies were also designed to explore the interaction of moxidectin with glutamate-gated chloride channels of B. malayi. The docking results revealed a close interaction of moxidectin with various GluCl ligand sites of B. malayi. PMID:25651699

  1. Reproductive biology of Onchocerca ochengi, a nodule forming filarial nematode in zebu cattle.

    Science.gov (United States)

    Hildebrandt, Julia C; Eisenbarth, Albert; Renz, Alfons; Streit, Adrian

    2014-09-15

    Onchocerca ochengi is a nodule-forming filarial nematode parasite of cattle in tropical Africa and closely related to the human pathogen Onchocerca volvulus. The adult worms reside in intradermal nodules. While females are sedentary, males may move between nodules. The first stage larvae (microfilariae) disperse in the skin of the host waiting to be taken up by the intermediate host. The density of microfilariae in the skin is largely independent of the number of adult worms present indicating some form of density dependent control. Recently, Onchocerca sp. Siisa, a form of Onchocerca distinguishable from O. ochengi by mitochondrial DNA sequences but not by morphology, was described to occur in cattle. This raised the question if Onchocerca sp. Siisa represents a different mitochondrial clade of O. ochengi or a new species. In order to study the reproductive biology and to understand this self-control of the off-spring population we systematically analyzed all Onchocerca nodules from the skin of one zebu cow and we examined a sample of microfilariae from a skin biopsy. We identified 87 O. ochengi females and 146 males. 56 (64.4%) of the females contained developing embryos. In order to assign the progeny to their respective parents we determined the genotypes at six nuclear and two mitochondrial molecular genetic markers in the adult worms, in a fraction of the progeny present in the uteri of the females and in the skin microfilariae. The 121 skin microfilariae we analyzed originated from at least 17 different mothers, which contributed rather differently to the total. Forty-five larvae (37.2%) were the progeny of a single female. Of the adult worms 16.7% were of the type Onchocerca sp. Siisa. These worms appeared to interbreed freely with the rest of the O. ochengi population and therefore belong to the same species. PMID:24986433

  2. Multiple filarial species microfilaraemia: a comparative study of areas with endemic and sporadic onchocerciasis

    Directory of Open Access Journals (Sweden)

    Emmanuel Uttah & Dominic C. Ibeh

    2011-12-01

    Full Text Available Background & objectives: The study was aimed at determining the pattern of co-occurrence of species ofmicrofilaraemia between onchocerciasis endemic and sporadic populations.Methods: From every consenting person of one year and above, 50 μl of day and night blood samples werecollected and processed respectively with Haemotoxylin and Giemsa as vital stains. Two skin snips (one eachfrom the waist and the shoulder were also taken from these individuals and processed.Results: Results showed single species microfilaraemia (86.4 and 82.3%, double species microfilaraemia (12.2and 16.9% and triple species microfilaraemia (1.4 and 0.7% for endemic and sporadic populations respectively.All the species had single species microfilaraemia mostly, but Mansonella perstans and Loa loa showed greatestt endency towa rds doubl e and t r ipl e spe c i e s mi c rof i l a r a emi a . The pr eva l enc e of Wuche re r ia banc rof t imicrofilaraemia among those positive for Onchocerca volvulus was significantly lower than the overall prevalenceof Wuchereria bancrofti. Wuchereria bancrofti microfilaraemia was most common among those who had L. loamicrofilaraemia. Wuchereria bancrofti microfilarial intensity was higher among those with M. perstansmicrofilaraemia than among those positive for any of the other filarial species. Similarly, the intensity of M.perstans microfilaraemia among those positive for W. bancrofti exceeded the overall intensity of M. perstans.Conclusion: It is concluded that there was no definite pattern in mf densities discernible from co-occurrenceinfections either in the onchocerciasis endemic or sporadic population. There could be varied outcomes ofonchocerciasis infection attributable to positive or negative regulatory effects of other pathogens harbored bythe victims.

  3. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    Science.gov (United States)

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  4. Canine and feline megaesophagus

    International Nuclear Information System (INIS)

    Megaesophagus is rare in cats and occurs as a congenital or secondary acquired disorder. In dogs, megaesophagus can occur as a congenital disorder, as a secondary acquired disorder, or as an adult-onset idiopathic disease. This article reviews the anatomy, pathogenesis, causes, clinical signs, diagnosis, and management of megaesophagus. Pathogenesis includes experimental evidence that evaluates the neural pathway of affected patients. The many disease that can cause megaesophagus are delineated. Discussion focuses on the most common causes-myasthenia gravis, hypoadrenocorticism and possibly hypothyroidism, and the obstructive lesions of the esophagus (vascular ring anomalies, tumors, granulomas, strictures, and foreign bodies). The most common clinical sign associated with megaesophagus is regurgitation. Traditional as well as newer techniques (i.e., manometry and nuclear scintigraphy) for evaluating esophageal motility are presented. Definitive diagnosis requires identification of a dilated esophagus on survey thoracic radiographs or a barium esophagogram. Medical management, including alternative feeding methods and the role of prokinetic drugs, is discussed

  5. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of...

  6. The serological and virological investigation of canine adenovirus infection on the dogs.

    Science.gov (United States)

    Bulut, Oya; Yapici, Orhan; Avci, Oguzhan; Simsek, Atilla; Atli, Kamil; Dik, Irmak; Yavru, Sibel; Hasircioglu, Sibel; Kale, Mehmet; Mamak, Nuri

    2013-01-01

    Two types of Canine Adenovirus (CAVs), Canine Adenovirus type 1 (CAV-1), the virus which causes infectious canine hepatitis, and Canine Adenovirus type 2 (CAV-2), which causes canine infectious laryngotracheitis, have been found in dogs. In this study, blood samples taken from 111 dogs, which were admitted to the Internal Medicine Clinic of Selcuk University, Faculty of Veterinary Medicine, with clinical symptoms. Seventy-seven dogs were sampled from Isparta and Burdur dog shelters by random sampling, regardless of the clinical findings. Dogs showed a systemic disease, characterized by fever, diarrhea, vomiting, oculonasal discharge, conjunctivitis, severe moist cough, signs of pulmonary disease and dehydration. Two dogs had corneal opacity and photophobia. In serological studies, 188 serum samples were investigated on the presence of CAV antibodies by ELISA. Total 103 (103/188-54.7%) blood samples were detected to be positive for CAV antibodies by ELISA. However, 85 (85/188-45.2%) blood samples were negative. Blood leukocyte samples from dogs were processed and inoculated onto confluent monolayers of MDCK cells using standard virological techniques. After third passage, cells were examined by direct immunoflourescence test for virus isolation. But positive result was not detected. In conclusion, this study clearly demonstrates the high prevalence of CAV infection in dogs. PMID:24223508

  7. Characterization of a Canine Homolog of Human Aichivirus▿

    Science.gov (United States)

    Kapoor, Amit; Simmonds, Peter; Dubovi, Edward J.; Qaisar, Natasha; Henriquez, Jose A.; Medina, Jan; Shields, Shelly; Lipkin, W. Ian

    2011-01-01

    Many of our fatal “civilization” infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5′ and 3′ untranslated regions. Comparative phylogenetic analysis using various structural and nonstructural proteins of CKoV confirmed it as the animal virus homolog most closely related to human Aichivirus (AiV). Bayesian Markov chain Monte Carlo analysis suggests a mean recent divergence time of CKoV and AiV within the past 20 to 50 years, well after the domestication of canines. The discovery of CKoV provides new insights into the origin and evolution of AiV and the species specificity and pathogenesis of kobuviruses. PMID:21880761

  8. Characterization of a canine homolog of human Aichivirus.

    Science.gov (United States)

    Kapoor, Amit; Simmonds, Peter; Dubovi, Edward J; Qaisar, Natasha; Henriquez, Jose A; Medina, Jan; Shields, Shelly; Lipkin, W Ian

    2011-11-01

    Many of our fatal "civilization" infectious diseases have arisen from domesticated animals. Although picornaviruses infect most mammals, infection of a companion animal is not known. Here we describe the identification and genomic characterization of the first canine picornavirus. Canine kobuvirus (CKoV), identified in stool samples from dogs with diarrhea, has a genomic organization typical of a picornavirus and encodes a 2,469-amino-acid polyprotein flanked by 5' and 3' untranslated regions. Comparative phylogenetic analysis using various structural and nonstructural proteins of CKoV confirmed it as the animal virus homolog most closely related to human Aichivirus (AiV). Bayesian Markov chain Monte Carlo analysis suggests a mean recent divergence time of CKoV and AiV within the past 20 to 50 years, well after the domestication of canines. The discovery of CKoV provides new insights into the origin and evolution of AiV and the species specificity and pathogenesis of kobuviruses. PMID:21880761

  9. Does contemporary canine diet cause cancer? ; A review

    Directory of Open Access Journals (Sweden)

    Joseph B Gentzel

    2013-07-01

    Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer

  10. Lipids and FA analysis of canine prostate tissue.

    Science.gov (United States)

    Attar-Bashi, Nadia M; Orzeszko, Karyn; Slocombe, Ronald F; Sinclair, Andrew J

    2003-06-01

    It is widely reported that an association exists between dietary fat intake and the incidence of prostate cancer in humans. To study this association, there is a need for an animal model where prostate carcinogenesis occurs spontaneously. The canine prostate is considered a suitable experimental model for prostate cancer in humans since it is morphologically similar to the human prostate and both humans and dogs have a predisposition to benign and malignant prostate disease. In this study, the FA and lipids profiles of the normal canine prostate tissue from nine dogs were examined. The total lipid content of the canine prostate tissue was 1.7 +/- 0.5% (wet weight). The lipid composition analysis using TLC-FID showed that the two major lipid classes were phospholipids and TAG. Total FA, phospholipid, and TAG FA analysis showed that the major FA were palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2n-6), and arachidonic acid (20:4n-6). The n-3 FA were present at premium brand dogfoods was <3% (wet weight), and the n-3/n-6 ratio was low. PMID:12934677

  11. Selection of reference genes in canine uterine tissues.

    Science.gov (United States)

    Du, M; Wang, X; Yue, Y W; Zhou, P Y; Yao, W; Li, X; Ding, X B; Liu, X F; Guo, H; Ma, W Z

    2016-01-01

    Real-time quantitative polymerase chain reaction (RT-qPCR) is usually employed in gene expression studies in veterinary research, including in studies on canine pyometra. Canine pyometra is a common clinical disease in bitches. When using RT-qPCR, internal standards, such as reference genes, are necessary to investigate relative gene expression by quantitative measurements of mRNA levels. The aim of this study was to evaluate the stability of reference genes and select reference genes suitable for canine pyometra studies. We collected 24 bitch uterine tissue samples, including five healthy and 19 pyometra infected samples. These were used to screen the best reference genes of seven candidate genes (18SrRNA, ACTB, B2M, GAPDH, HPRT, RPL13A, and YWHAZ). The method of KH Sadek and the GeNorm, Normfinder, BestKeeper, and RefFinder software were used to evaluate the stability of gene expression in both pyometra and healthy uterine samples. The results showed that the expression stability of the candidate gene in pyometra and healthy tissues differed. We showed that YWHAZ was the best reference gene, which could be used as an accurate internal control gene in canine pyometra studies. To further validate this recommendation, the expression profile of a target gene insulin-like growth factor 1 receptor gene (IGF1R) was investigated. We found that the expression of IGF1R was significantly altered when different reference genes were used. All reference genes identified in the present study will enable more accurate normalization of gene expression data in both pyometra infected and healthy uterine tissues. PMID:27323194

  12. Animal models of primary myocardial diseases.

    OpenAIRE

    Liu, S. K.; Tilley, L. P.

    1980-01-01

    Feline and canine cardiomyopathies (primary myocardial diseases) were reviewed and divided into three groups based on the clinical, hemodynamic, angiocardiographic, and pathologic findings: (1) feline and canine hypertrophic cardiomyopathy, (2) feline and canine congestive (dilated) cardiomyopathy, and (3) feline restrictive cardiomyopathy. All three groups consisted predominantly of mature adult male cats and dogs. Cardiomyopathy in the hamster and turkey was also reviewed. The most common p...

  13. Nodular Epiescleritis Granulomatous Canine. Case Report

    Directory of Open Access Journals (Sweden)

    Camilo Guarín Patarroyo

    2011-12-01

    Full Text Available Granulomatous epiescleritis nodular disease in canines is a very unusual presentation that affects or external fibrous tunic of the eyeball and conjunctiva, which was an increase similar to a unilateral or bilateral tumor. Suspected immune-mediated disease due to lack of identification of an etiologic agent and the response to treatment with immunosuppressive drugs (Couto, 1992. The ideal therapy is the application of steroids via intralesional, topical or systemic, or other immunosuppressants such as cyclosporine and azathioprine; it is still advisable to apply antibiotic is the ideal combination of tetracycline and neomycin (Gilger & Whitley, 1999. The diagnostic method of episcleritis is made by histopathology, which is evident in changes similar to chronic granulomatous inflammation. Are claiming a racial bias in Alsatian, Shepherd Collie Shetland Shepherd, Coker Spaniel, Rottweiler and Labrador Retriever (Gough & Thomas, 2004. The following case is a report of a nodular epiescleritis affecting the cornea, sclera, and the corneoscleral limbus, which describes the diagnosis, signology and treatment.

  14. Filarial antigenemia and Loa loa night blood microfilaremia in an area without bancroftian filariasis in the Democratic Republic of Congo.

    Science.gov (United States)

    Bakajika, Didier K; Nigo, Maurice M; Lotsima, Jean Pierre; Masikini, Germain A; Fischer, Kerstin; Lloyd, Melanie M; Weil, Gary J; Fischer, Peter U

    2014-12-01

    Implementation of mass drug administration for lymphatic filariasis (LF) has been delayed in central Africa because of incomplete mapping and coendemic loiasis. We mapped two regions in eastern Democratic Republic of Congo that were suspected to have LF. Night blood samples were collected from 2,724 subjects in 30 villages. Filarial antigenemia rates by card test exceeded 1% in 28 villages (range = 0-14%). Prevalence rates for large sheathed microfilariae (Mf) ranged from 4% to 40%; Mansonella perstans rates ranged from 22% to 98%. Large Mf were exclusively Loa loa by microscopy, and only 1 of 337 samples tested by quantitative polymerase chain reaction (qPCR) was positive for Wuchereria bancrofti DNA. Filarial antigen positivity was strongly associated with high L. loa Mf counts. Periodicity studies revealed atypical patterns, with no significant diurnal periodicity in some individuals. Thus, methods routinely used for LF mapping may not be reliable in areas in central Africa that are highly endemic for loiasis. PMID:25223938

  15. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  16. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

    OpenAIRE

    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

    2002-01-01

    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  17. Oxidative stress plays major role in mediating apoptosis in filarial nematode Setaria cervi in the presence of trans-stilbene derivatives.

    Science.gov (United States)

    Mukherjee, Niladri; Parida, Pravat Kumar; Santra, Abhishek; Ghosh, Tamashree; Dutta, Ananya; Jana, Kuladip; Misra, Anup Kumar; Sinha Babu, Santi P

    2016-04-01

    Lymphatic filariasis, affecting around 120 million people in 80 countries worldwide, is an extremely painful disease and caused permanent and long term disability. Owing to its alarming prevalence there is immediate need for development of new therapeutics. A series of trans-stilbene derivatives were synthesized using aqueous reaction condition showing potential as antifilarial agents demonstrated in vitro. MTT reduction assay and dye exclusion test were performed to evaluate the micro and macrofilaricidal potential of these compounds. Amid 20 trans-stilbene derivatives together with Resveratrol (RSV), a multifunctional natural product was screened; nine compounds (28, 29, 33, 35, 36, 38, 39, 41 and 42) have showed promising micro and macrofilaricidal activities and four of them (28, 39, 41 and 42) showed better effectiveness than RSV. In the treated parasites apoptosis was established by DNA laddering, in situ DNA fragmentation and FACS analysis. The generation of ROS in the treated parasites was indicated by the depletion in the level of GSH, GR and GST activity and elevation of SOD, catalase, GPx activity and superoxide anion and H2O2 level. Along with the ROS generation and oxidative stress, the decreased expression of anti-apoptotic ced-9 gene and increased expression of nematode specific pro-apoptotic genes, egl-1, ced-4 and ced-3 at the level of transcription and translation level; the up-regulation of caspase-3 activity and involvement of caspase-8,9,3, cytochrome-c and PARP were also observed and which denotes the probable existence of both extrinsic and intrinsic pathways apoptosis in parasitic nematodes. This observation is reported first time and thus it confirmed the mode of action and effectiveness of the compounds. Further, the comparative bioavailability-pharmacokinetics studies showed that compound 28 possesses comparable properties with Ivermectin. This study will certainly intensify our understanding of the pharmacological importance of trans

  18. Fitness Cost of Litomosoides sigmodontis Filarial Infection in Mite Vectors; Implications of Infected Haematophagous Arthropod Excretory Products in Host-Vector Interactions

    Directory of Open Access Journals (Sweden)

    Adélaïde Nieguitsila

    2013-01-01

    Full Text Available Filariae are a leading cause of infections which are responsible for serious dermatological, ocular, and vascular lesions. Infective third stage larvae (L3 are transmitted through the bite of a haematophagous vector. Litomosoides sigmodontis is a well-established model of filariasis in the mouse, with the vector being the mite Ornithonyssus bacoti. The aim of the study was to analyse the filarial infection in mites to determine the consequences of filarial infection in the blood-feeding and the reproduction of mites as well as in the regulation of vector-induced inflammation in the mouse skin. Firstly, L3 are unevenly distributed throughout the host population and the majority of the population harbours a moderate infection (1 to 6 L3. Filarial infection does not significantly affect the probing delay for blood feeding. The number of released protonymphs is lower in infected mites but is not correlated with the L3 burden. Finally, induced excreted proteins from infected mites but not from uninfected mites stimulate TNF-α and the neutrophil-chemoattractant KC production by antigen-presenting cells (APCs. Altogether, these results describe the modification of the mite behavior under filarial infection and suggest that the immunomodulatory capacity of the mite may be modified by the presence of the parasite, hindering its defensive ability towards the vertebrate host.

  19. Clinical and hematological study of canine Ehrlichiosis with other hemoprotozoan parasites in Kolkata, West Bengal, India

    Directory of Open Access Journals (Sweden)

    Mousam Das

    2013-11-01

    Conclusions: The results of this study stated that clinical and haematological changes occurred in canine ehrlichiosis with babesiosis and hepatozoonosis due to parasitemia. In mixed infection, the disease more severe, and also it depended on immunity of animals. Babesia gibsoni and Hepatozoon canis with Ehrlichia sp. were first reported from West Bengal state of India by this study.

  20. First Genome Sequence of a Canine Distemper Virus Strain from South America

    OpenAIRE

    Sarute, Nicolás; Delgado, María V.; Carrau, Lucía; Benech, Alejandro; Francia, Lourdes; Pérez, Ruben; Panzera, Yanina

    2014-01-01

    Canine distemper virus causes a severe infectious disease in carnivores worldwide. Herein, we sequenced and analyzed the genome of a new strain (Uy251/2012) isolated from a dog in Uruguay. The Uy251/2012 strain belongs to the Europe1/South America1 lineage, and constitutes the first report of a genomic sequence in South America.

  1. Leukocyte count affects expression of reference genes in canine whole blood samples

    NARCIS (Netherlands)

    Piek, C.J.; Brinkhof, B.; Rothuizen, J.; Dekker, A.; Penning, L.C.

    2011-01-01

    Background The dog is frequently used as a model for hematologic human diseases. In this study the suitability of nine potential reference genes for quantitative RT-PCR studies in canine whole blood was investigated. Findings The expression of these genes was measured in whole blood samples of 263 i

  2. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent;

    2015-01-01

    Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...

  3. Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny

    Directory of Open Access Journals (Sweden)

    Jane Megid

    2013-02-01

    Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.

  4. Subcutaneously Administered Ultrafine PLGA Nanoparticles Containing Doxycycline Hydrochloride Target Lymphatic Filarial Parasites.

    Science.gov (United States)

    Singh, Yuvraj; Srinivas, Adepu; Gangwar, Mamta; Meher, Jaya Gopal; Misra-Bhattacharya, Shailja; Chourasia, Manish K

    2016-06-01

    Systemic chemotherapeutic targeting of filarial parasites is unfocused due to their deep seated location in lymphatic vessels. This warrants a prolonged dosing regimen in high doses for an anthelmintic like doxycycline hydrochloride (DOX). In order to provide an alternative, we have constructed ultrafine PLGA nanoparticles of DOX (DPNPs), so as to exploit the peculiarity of lymphatic vasculature underneath the subcutaneous layer of skin, which preferentially allows entry of only 10-100 nm sized particles. DPNPs were constructed using a novel solvent diffusion method aided by probe sonication, which resulted in an average size 95.43 ± 0.8 nm as per DLS, PDI 0.168 ± 0.03, zeta potential -7.38 ± 0.32, entrapment efficiency 75.58 ± 1.94%, and refrigerator stability of 7 days with respect to size in the optimized batch. TEM further substantiated the spherical shape of DPNPs along with their actual nonhydrated size as being well below 100 nm. FTIR analysis of DOX, dummy nanoparticles, and freeze-dried DPNPs revealed that the formulation step did not induce prominent changes in the chemical nature of DOX. The drug release was significantly altered (p < 0.05) with 64.6 ± 1.67% release in 48 h from DPNPs and was dictated by Fickian diffusion. Pharmacokinetic studies in Wistar rats further revealed that DPNPs caused a 16-fold prolongation in attainment of plasma Tmax and a 2-fold extension of elimination half-life (28.569 ± 1.27 h) at a dose of 5 mg/kg when compared to native drug (DOX solution) of the same strength. Contrastingly the trend was reversed in regional lymph nodes where Cmax for DPNPs (820 ± 84 ng/mg) was 4-fold greater, and lymphatic Tmax was attained in one-fourth of what was required for DOX solution. This size based preferential lymphatic targeting resulted in significantly greater in vivo antifilarial activity of DPNPs when compared to DOX solution as gauged by several parameters in Brugia malayi infected Mastomys coucha. Interestingly, the

  5. Canine chronic inflammatory rhinitis.

    Science.gov (United States)

    Windsor, Rebecca C; Johnson, Lynelle R

    2006-05-01

    Chronic inflammatory rhinitis is commonly found in dogs with chronic nasal disease and is characterized by lymphoplasmacytic infiltrates in the nasal mucosa in the absence of an obvious etiologic process. The pathogenesis of lymphoplasmacytic rhinitis remains unknown. Animals respond poorly to antibiotics, oral glucocorticoids, and antihistamines, making primary infectious, immune-mediated, or allergic etiologies unlikely. Aberrant immune response to inhaled organisms or allergens may induce inflammation in some animals. Common clinical signs include nasal discharge, sneezing, coughing, epistaxis, and stertor. Diagnosis is made by performing a thorough history, physical examination, radiography or advanced imaging (via computed tomography or magnetic resonance imaging), rhinoscopy, and nasal mucosal biopsy to rule out primary etiologies of nasal discharge. Treatment strategies have included various antibiotics, antihistamines, oral and inhalant steroids, nonsteroidal antiinflammatories, and antifungal medications. Some dogs may respond partially to doxycycline or azithromycin, although it is unclear whether response is related to antimicrobial or antiinflammatory properties of these drugs. Hydration of the nasal cavity through nasal drops or aerosols may limit nasal discharge, and some animals may improve with inhalant (but rarely oral) glucocorticoids. PMID:16711613

  6. New agents for targeting of IL-13RA2 expressed in primary human and canine brain tumors.

    Directory of Open Access Journals (Sweden)

    Waldemar Debinski

    Full Text Available Interleukin 13 receptor alpha 2 (IL-13RA2 is over-expressed in a vast majority of human patients with high-grade astrocytomas like glioblastoma. Spontaneous astrocytomas in dogs resemble human disease and have been proposed as translational model system for investigation of novel therapeutic strategies for brain tumors. We have generated reagents for both detection and therapeutic targeting of IL-13RA2 in human and canine brain tumors. Peptides from three different regions of IL-13RA2 with 100% sequence identity between human and canine receptors were used as immunogens for generation of monoclonal antibodies. Recombinant canine mutant IL-13 (canIL-13.E13K and canIL-13.E13K based cytotoxin were also produced. The antibodies were examined for their immunoreactivities in western blots, immunohistochemistry, immunofluorescence and cell binding assays using human and canine tumor specimen sections, tissue lysates and established cell lines; the cytotoxin was tested for specific cell killing. Several isolated MAbs were immunoreactive to IL-13RA2 in western blots of cell and tissue lysates from glioblastomas from both human and canine patients. Human and canine astrocytomas and oligodendrogliomas were also positive for IL-13RA2 to various degrees. Interestingly, both human and canine meningiomas also exhibited strong reactivity. Normal human and canine brain samples were virtually negative for IL-13RA2 using the newly generated MAbs. MAb 1E10B9 uniquely worked on tissue specimens and western blots, bound live cells and was internalized in GBM cells over-expressing IL-13RA2. The canIL-13.E13K cytotoxin was very potent and specific in killing canine GBM cell lines. Thus, we have obtained several monoclonal antibodies against IL-13RA2 cross-reacting with human and canine receptors. In addition to GBM, other brain tumors, such as high grade oligodendrogliomas, meningiomas and canine choroid plexus papillomas, appear to express the receptor at high levels

  7. Direct preparation protocol to obtain mitotic chromosomes from canine mammary tumors.

    Science.gov (United States)

    Morais, C S D; Affonso, P R A M; Bitencourt, J A; Wenceslau, A A

    2015-01-01

    Currently, mammary neoplasms in female canines are a serious problem in veterinary clinics. In addition, the canine species is an excellent disease model for human oncology because of the biological and genetic similarities between the species. Cytogenetics has allowed further study of the characterization of neoplasms in canines. We hypothesized that the use of a direct preparation protocol for mitotic chromosome analysis would provide a simple and low cost protocol for use in all laboratories. The objective of this method is to display in a few hours of dividing cells just like the time of collection since cell division in tissue can be obtained. Ten female canines with the spontaneous occurrence of mammary neoplasia were used to test a pioneering direct preparation protocol to obtain mitotic chromosomes. The excised breast tumor tissue fragments were subjected to the protocol consisting of treatment with colchicine, treatment with hypotonic solution, and fixation. Mitotic chromosomes were absent in cell suspensions of only two samples among the 10 materials analyzed, based on the analysis of five blades for each preparation obtained. So, the cell suspension obtained allowed for the observation of eight tissue samples viable for cytogenetic analysis, five of which had excellent numbers of mitotic chromosomes. However, the technique was unsuccessful in producing high-quality cell suspensions because of inadequate condensation and scattering of chromosomes. While adjustments to methodological procedures are needed, this protocol represents a low cost and simplified method to study the cytogenetics of canine tumors. PMID:26782592

  8. Ebola virus mediated infectivity is restricted in canine and feline cells.

    Science.gov (United States)

    Han, Ziying; Bart, Stephen M; Ruthel, Gordon; Vande Burgt, Nathan H; Haines, Kathleen M; Volk, Susan W; Vite, Charles H; Freedman, Bruce D; Bates, Paul; Harty, Ronald N

    2016-01-15

    Ebolaviruses and marburgviruses belong to the Filoviridae family and often cause severe, fatal hemorrhagic fever in humans and non-human primates. The magnitude of the 2014 outbreak in West Africa and the unprecedented emergence of Ebola virus disease (EVD) in the United States underscore the urgency to better understand the dynamics of Ebola virus infection, transmission and spread. To date, the susceptibility and possible role of domestic animals and pets in the transmission cycle and spread of EVD remains unclear. We utilized infectious VSV recombinants and lentivirus pseudotypes expressing the EBOV surface glycoprotein (GP) to assess the permissiveness of canine and feline cells to EBOV GP-mediated entry. We observed a general restriction in EBOV-mediated infection of primary canine and feline cells. To address the entry mechanism, we used cells deficient in NPC1, a host protein implicated in EBOV entry, and a pharmacological blockade of cholesterol transport, to show that an NPC1-dependent mechanism of EBOV entry is conserved in canine and feline cells. These data demonstrate that cells of canine and feline origin are susceptible to EBOV GP mediated infection; however, infectivity of these cells is reduced significantly compared to controls. Moreover, these data provide new insights into the mechanism of EBOV GP mediated entry into cells of canine and feline origin. PMID:26711035

  9. Doxorubicin and deracoxib adjuvant therapy for canine splenic hemangiosarcoma: a pilot study.

    Science.gov (United States)

    Kahn, S Anthony; Mullin, Christine M; de Lorimier, Louis-Philippe; Burgess, Kristine E; Risbon, Rebecca E; Fred, Rogers M; Drobatz, Kenneth; Clifford, Craig A

    2013-03-01

    Canine hemangiosarcoma (HSA) is a highly malignant tumor for which standard chemotherapy has done little to substantially improve survival. Cyclooxygenase-2 (Cox-2) plays a role in the formation, growth, and metastasis of tumors and inhibitors have demonstrated therapeutic benefit with certain canine cancers. In this prospective study, 21 dogs received adjuvant therapy combining the selective Cox-2 inhibitor deracoxib with doxorubicin, following splenectomy for HSA. The combination was well-tolerated with only low-grade gastrointestinal and hematologic toxicities noted. An overall median survival of 150 days (range; 21 to 1506 days) was noted. Although there was no significant difference in survival based upon stage of disease, dogs with stage III HSA (n = 11) had a median survival of 149 days, which appears to be longer than previously reported. Further studies are warranted to evaluate the potential benefit of Cox-2 inhibitors in the treatment of canine HSA. PMID:23997259

  10. EPIDEMIOLOGICAL AND VECTOR IDENTIFICATION STUDIES ON CANINE BABESIOSIS

    Directory of Open Access Journals (Sweden)

    I. N. Bashir, Z. I. Chaudhry, S. Ahmed and M. A. Saeed

    2009-05-01

    Full Text Available Canine babesiosis is increasing in incidence and prevalence and is now a major problem in dogs. During this study, a total of 6204 dogs were examined for babesiosis over a 12 month period from January to December, 2006 in Lahore and 2.62% were found positive. The dogs were grouped on the basis of their age, sex and breed and season of the year. The male dogs were more prone to disease than female dogs (3.39 vs. 1.32%, whereas the incidence of disease was higher in younger dogs (6.9% than older age groups. Crossbreds were more prone to the infection (10.9% than purebreds. However, none of them were completely resistant. Warm and humid season played a key role in the spread of disease. Predominant vector of the disease was found to be Rhipicephalus species.

  11. Estimating canine tooth crown height in early Australopithecus.

    Science.gov (United States)

    Plavcan, J Michael; Ward, Carol V; Paulus, Faydre L

    2009-07-01

    Canine tooth size reduction and the associated reduction in canine dimorphism is a basal hominin character that also provides important evidence for models of behavioral evolution. Two specimens of Australopithecus anamensis (KNM-KP 29287 and KNM-KP 29283) that do not preserve the canine crown, but do preserve the root or alveolus, appear to suggest that canine size variation and canine dimorphism in this species may have been greater than in other hominins. We evaluate canine root and crown dimensions in a series of extant hominoids, and estimate canine crown height in Australopithecus afarensis and A. anamensis. Our results demonstrate that it is possible to generate estimates of canine crown height from basal canine crown and root dimensions with a moderate degree of accuracy. Estimates of maxillary canine crown size for A. anamensis are slightly larger than those of A. afarensis, and are approximately the same size as canines of modern female chimpanzees. Estimated mandibular canine crown height is very similar in the two species. Variation within the A. anamensis sample of estimated canine crown heights is similar to that of modern humans, suggesting a low degree of sexual dimorphism. Inclusion of estimates for KNM-KP 29287 and KNM-KP 29283 does not substantially increase either the estimate of overall canine size or variation for A. anamensis. PMID:19482334

  12. CANINE BUTTERFLY GLIOBLASTOMAS: A NEURORADIOLOGICAL REVIEW

    Directory of Open Access Journals (Sweden)

    John Henry Rossmeisl

    2016-05-01

    Full Text Available In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a ‘butterfly’ glioma (BG. While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here we describe the magnetic resonance imaging (MRI characteristics of BG in three dogs, and review the potential differential diagnoses based on neuroimaging findings. All dogs presented with generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3 or symmetrical (1/3, bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes and associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and FLAIR signal intensities, variable contrast enhancement (2/3, and mass effect. All tumors demonstrated classical histopathological features of glioblastoma (GBM including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation, as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  13. Canine Butterfly Glioblastomas: A Neuroradiological Review

    Science.gov (United States)

    Rossmeisl, John H.; Clapp, Kemba; Pancotto, Theresa E.; Emch, Samantha; Robertson, John L.; Debinski, Waldemar

    2016-01-01

    In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a “butterfly” glioma (BG). While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here, we describe the magnetic resonance imaging (MRI) characteristics of BG in three dogs and review the potential differential diagnoses based on neuroimaging findings. All dogs presented for generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3) or symmetrical (1/3), bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes that were associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and fluid-attenuated inversion recovery signal intensities, variable contrast enhancement (2/3), and mass effect. All tumors demonstrated classical histopathological features of glioblastoma multiforme (GBM), including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with an MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  14. Experimental canine parvovirus infection in dogs.

    Science.gov (United States)

    Pollock, R V

    1982-04-01

    In specific pathogen-free dogs, clinical signs of experimental canine parvovirus infection were mild, inconsistent and transient. Clinical signs were more pronounced in conventionally-raised dogs, but the severe disease reported in field cases was not reproduced in either group. A pronounced plasma viremia occurred on the 2nd to 4th day post-infection (d.p.i.) in dogs challenged oronasally. Antibody was detectable on the 5th d.p.i. Marked pyrexia was rare, but a significant temperature rise usually coincided with the appearance of antibody and the cessation of viremia. Significant lymphopenia, but not leukopenia, occurred on the 3rd to 7th d.p.i. Virus could be readily isolated from fecal matter on the 3rd to 8th d.p.i.; a few dogs continued to shed virus for up to 12 days. In dogs challenged parenterally, the onset of elevated temperatures, viral shed and antibody production occurred 24-48 hours sooner. Convalescent dogs were no longer contagious for susceptible contact animals 25 days or longer after challenge, although infectious virus persisted in feces for more than 6 months at room temperature. Active giardiasis seemed to exacerbate the clinical syndrome, although treatment with corticosteroids or anti-thymocyte serum did not. PMID:6211333

  15. Culling Dogs in Scenarios of Imperfect Control: Realistic Impact on the Prevalence of Canine Visceral Leishmaniasis

    Science.gov (United States)

    Costa, Danielle N. C. C.; Codeço, Cláudia T.; Silva, Moacyr A.; Werneck, Guilherme L.

    2013-01-01

    Background Visceral leishmaniasis belongs to the list of neglected tropical diseases and is considered a public health problem worldwide. Spatial correlation between the occurrence of the disease in humans and high rates of canine infection suggests that in the presence of the vector, canine visceral leishmaniasis is the key factor for triggering transmission to humans. Despite the control strategies implemented, such as the sacrifice of infected dogs being put down, the incidence of American visceral leishmaniasis remains high in many Latin American countries. Methodology/Principal Findings Mathematical models were developed to describe the transmission dynamics of canine leishmaniasis and its control by culling. Using these models, imperfect control scenarios were implemented to verify the possible factors which alter the effectiveness of controlling this disease in practice. Conclusions/Significance A long-term continuous program targeting both asymptomatic and symptomatic dogs should be effective in controlling canine leishmaniasis in areas of low to moderate transmission (R0 up to 1.4). However, the indiscriminate sacrifice of asymptomatic dogs with positive diagnosis may jeopardize the effectiveness of the control program, if tests with low specificity are used, increasing the chance of generating outrage in the population, and leading to lower adherence to the program. Therefore, culling must be planned accurately and implemented responsibly and never as a mechanical measure in large scale. In areas with higher transmission, culling alone is not an effective control strategy. PMID:23951375

  16. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.

    2008-01-01

    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying. Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the nutritional and

  17. Triple bone labeling of canine mandibles

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H

    1990-01-01

    Fluorescence microscopy was used for evaluation of new bone formation in 16 canine mandibles augmented with hydroxylapatite (HA) granules. Three fluorochromes were injected at different time intervals during therapeutic radiation treatment. Oxytetracycline, DCAF, and alizarin-complexone were give...

  18. Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

    Science.gov (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

    2014-12-01

    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing. PMID:25632689

  19. [Nonsurgical endodontic treatment of an invaginated canine].

    Science.gov (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

    1989-01-01

    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment. PMID:2638021

  20. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F;

    2011-01-01

    associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests that...... the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

  1. Breed predisposition to canine gastric carcinoma

    DEFF Research Database (Denmark)

    Seim-Wikse, Tonje; Jörundsson, Einar; Nødtvedt, Ane;

    2013-01-01

    Previous research has indicated a breed predisposition to gastric carcinoma in dogs. However, results to date are inconsistent since several studies have failed to prove such a predisposition. Better knowledge of breeds at risk could facilitate early detection of gastric carcinoma in dogs. The aim...... of the study was to retrospectively investigate the proportion and possible breed predisposition to canine gastric carcinoma using the Norwegian Canine Cancer Register for calculations of proportional morbidity ratios (PMRs) for the period 1998-2009....

  2. Clinical and Statistical Study on Canine Impaction

    Directory of Open Access Journals (Sweden)

    Adina-Simona Coșarcă

    2013-08-01

    Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

  3. Environmental contamination by canine geohelminths

    Science.gov (United States)

    2014-01-01

    Intestinal nematodes affecting dogs, i.e. roundworms, hookworms and whipworms, have a relevant health-risk impact for animals and, for most of them, for human beings. Both dogs and humans are typically infected by ingesting infective stages, (i.e. larvated eggs or larvae) present in the environment. The existence of a high rate of soil and grass contamination with infective parasitic elements has been demonstrated worldwide in leisure, recreational, public and urban areas, i.e. parks, green areas, bicycle paths, city squares, playgrounds, sandpits, beaches. This review discusses the epidemiological and sanitary importance of faecal pollution with canine intestinal parasites in urban environments and the integrated approaches useful to minimize the risk of infection in different settings. PMID:24524656

  4. CANINE: a robotic mine dog

    Science.gov (United States)

    Stancil, Brian A.; Hyams, Jeffrey; Shelley, Jordan; Babu, Kartik; Badino, Hernán.; Bansal, Aayush; Huber, Daniel; Batavia, Parag

    2013-01-01

    Neya Systems, LLC competed in the CANINE program sponsored by the U.S. Army Tank Automotive Research Development and Engineering Center (TARDEC) which culminated in a competition held at Fort Benning as part of the 2012 Robotics Rodeo. As part of this program, we developed a robot with the capability to learn and recognize the appearance of target objects, conduct an area search amid distractor objects and obstacles, and relocate the target object in the same way that Mine dogs and Sentry dogs are used within military contexts for exploration and threat detection. Neya teamed with the Robotics Institute at Carnegie Mellon University to develop vision-based solutions for probabilistic target learning and recognition. In addition, we used a Mission Planning and Management System (MPMS) to orchestrate complex search and retrieval tasks using a general set of modular autonomous services relating to robot mobility, perception and grasping.

  5. Environmental contamination by canine geohelminths.

    Science.gov (United States)

    Traversa, Donato; Frangipane di Regalbono, Antonio; Di Cesare, Angela; La Torre, Francesco; Drake, Jason; Pietrobelli, Mario

    2014-01-01

    Intestinal nematodes affecting dogs, i.e. roundworms, hookworms and whipworms, have a relevant health-risk impact for animals and, for most of them, for human beings. Both dogs and humans are typically infected by ingesting infective stages, (i.e. larvated eggs or larvae) present in the environment. The existence of a high rate of soil and grass contamination with infective parasitic elements has been demonstrated worldwide in leisure, recreational, public and urban areas, i.e. parks, green areas, bicycle paths, city squares, playgrounds, sandpits, beaches. This review discusses the epidemiological and sanitary importance of faecal pollution with canine intestinal parasites in urban environments and the integrated approaches useful to minimize the risk of infection in different settings. PMID:24524656

  6. Comparative studies on the biology and filarial susceptibility of selected blood-feeding and autogenous Aedes togoi sub-colonies

    Directory of Open Access Journals (Sweden)

    Anuluck Junkum

    2003-06-01

    Full Text Available Blood-feeding and autogenous sub-colonies were selected from a laboratory, stock colony of Aedes togoi, which was originally collected from Koh Nom Sao, Chanthaburi province, Southeast Thailand. Comparative biology and filarial susceptibility between the two sub-colonies (blood-feeding: F11, F13; autogeny: F38, F40 were investigated to evaluate their viability and vectorial capacity. The results of comparison on biology revealed intraspecific differences, i.e., the average egg deposition/gravid female (F11/F38; F13/F40, embryonation rate (F13/F40, hatchability rate (F11/F38; F13/F40, egg width (F11/F38, wing length of females (F13/F40, and wing length and width of males (F11/F38 in the blood-feeding sub-colony were significantly greater than that in the autogenous sub-colony; and egg length (F11/F38 and width (F13/F40, and mean longevity of adult females (F11/F38 and males (F13/F40 in the blood-feeding sub-colony were significantly less than that in the autogenous sub-colony. The results of comparison on filarial susceptibility demonstrated that both sub-colonies yielded similar susceptibilities to Brugia malayi [blood-feeding/autogeny = 56.7% (F11/53.3%(F38, 60%(F13/83.3%(F40] and Dirofilaria immitis [blood-feeding/autogeny = 85.7%(F11/75%(F38, 45%(F13/29.4%(F40], suggesting autogenous Ae. togoi sub-colony was an efficient laboratory vector in study of filariasis.

  7. Dual RNA-seq of parasite and host reveals gene expression dynamics during filarial worm-mosquito interactions.

    Directory of Open Access Journals (Sweden)

    Young-Jun Choi

    2014-05-01

    Full Text Available BACKGROUND: Parasite biology, by its very nature, cannot be understood without integrating it with that of the host, nor can the host response be adequately explained without considering the activity of the parasite. However, due to experimental limitations, molecular studies of parasite-host systems have been predominantly one-sided investigations focusing on either of the partners involved. Here, we conducted a dual RNA-seq time course analysis of filarial worm parasite and host mosquito to better understand the parasite processes underlying development in and interaction with the host tissue, from the establishment of infection to the development of infective-stage larva. METHODOLOGY/PRINCIPAL FINDINGS: Using the Brugia malayi-Aedes aegypti system, we report parasite gene transcription dynamics, which exhibited a highly ordered developmental program consisting of a series of cyclical and state-transitioning temporal patterns. In addition, we contextualized these parasite data in relation to the concurrent dynamics of the host transcriptome. Comparative analyses using uninfected tissues and different host strains revealed the influence of parasite development on host gene transcription as well as the influence of the host environment on parasite gene transcription. We also critically evaluated the life-cycle transcriptome of B. malayi by comparing developmental stages in the mosquito relative to those in the mammalian host, providing insight into gene expression changes underpinning the mosquito-borne parasitic lifestyle of this heteroxenous parasite. CONCLUSIONS/SIGNIFICANCE: The data presented herein provide the research community with information to design wet lab experiments and select candidates for future study to more fully dissect the whole set of molecular interactions of both organisms in this mosquito-filarial worm symbiotic relationship. Furthermore, characterization of the transcriptional program over the complete life cycle of

  8. Progress towards eliminating canine rabies: policies and perspectives from Latin America and the Caribbean

    OpenAIRE

    Vigilato, Marco Antonio Natal; Clavijo, Alfonso; Knobl, Terezinha; Silva, Hugo Marcelo Tamayo; Cosivi, Ottorino; Schneider, Maria Cristina; Leanes, Luis Fernando; Belotto, Albino José; Espinal, Marcos Antonio

    2013-01-01

    Human rabies transmitted by dogs is considered a neglected disease that can be eliminated in Latin America and the Caribbean (LAC) by 2015. The aim of this paper is to discuss canine rabies policies and projections for LAC regarding current strategies for achieving this target and to critically review the political, economic and geographical factors related to the successful elimination of this deadly disease in the context of the difficulties and challenges of the region. The strong politica...

  9. Epidemiological aspects of canine visceral leishmaniosis in the Islamic Republic of Iran.

    Science.gov (United States)

    Mohebali, Mehdi; Hajjaran, Homa; Hamzavi, Yazdan; Mobedi, Iraj; Arshi, Shahnam; Zarei, Zabih; Akhoundi, Behnaz; Naeini, Koroush Manouchehri; Avizeh, Reza; Fakhar, Mehdi

    2005-05-15

    An epidemiological study to examine the sero-prevalence of zoonotic visceral leishmaniosis (ZVL) among domestic and wild canines in endemic foci of Iran was carried out during 1999-2003 to assess the distribution of the disease and the possible association between infection in dogs, wild canines and people. Anti-leishmanial antibodies were detected by the direct agglutination test (DAT). Parasitological study was performed for all captured wild canines and were detected in some of the seropositive dogs with specific clinical signs (n=107). Serum samples (n=1568) were collected from domestic dogs in villages that are known endemic foci of human visceral leishmaniosis (HVL). Wild canine sera were collected from jackals (Canis aureus, n=10), foxes (Vulpes vulpes, n=10) and wolves (Canis lupus, n=10). Of the 1568 serum sampled collected from domestic dogs, 222 (14.2%) were positive by DAT (1:320 and above). No statistically significant difference was found between male (15.2%) and female (11.8%) sero-prevalence (P=0.083). Dogs of 8 years and above showed the highest sero-prevalence (40.6%). Only 23.9% of the seropositive domestic dogs had clinical signs. Parasitology and serology tests that were performed in 30 wild canines showed 10% these animals were infected by Leishmania infantum. Ten out of 11 Leishmania spp. isolated from the dogs and wild canines were identified as L. infantum and one other as L. tropica by molecular and biochemical techniques. For the first time in Iran, L. infantum and L. tropica were isolated from viscera of both a wolf and a domestic dog. PMID:15845279

  10. Characterization of a canine homolog of hepatitis C virus.

    Science.gov (United States)

    Kapoor, Amit; Simmonds, Peter; Gerold, Gisa; Qaisar, Natasha; Jain, Komal; Henriquez, Jose A; Firth, Cadhla; Hirschberg, David L; Rice, Charles M; Shields, Shelly; Lipkin, W Ian

    2011-07-12

    An estimated 3% of the world's population is chronically infected with hepatitis C virus (HCV). Although HCV was discovered more than 20 y ago, its origin remains obscure largely because no closely related animal virus homolog has been identified; furthermore, efforts to understand HCV pathogenesis have been hampered by the absence of animal models other than chimpanzees for human disease. Here we report the identification in domestic dogs of a nonprimate hepacivirus. Comparative phylogenetic analysis of the canine hepacivirus (CHV) confirmed it to be the most genetically similar animal virus homolog of HCV. Bayesian Markov chains Monte Carlo and associated time to most recent common ancestor analyses suggest a mean recent divergence time of CHV and HCV clades within the past 500-1,000 y, well after the domestication of canines. The discovery of CHV may provide new insights into the origin and evolution of HCV and a tractable model system with which to probe the pathogenesis, prevention, and treatment of diseases caused by hepacivirus infection. PMID:21610165

  11. Potential of regenerative medicine techniques in canine hepatology.

    Science.gov (United States)

    Schotanus, Baukje A; Penning, Louis C; Spee, Bart

    2013-12-01

    Liver cell turnover is very slow, especially compared to intestines and stomach epithelium and hair cells. Since the liver is the main detoxifying organ in the body, it does not come as a surprise that the liver has an unmatched regenerative capacity. After 70% partial hepatectomy, the liver size returns to normal in about two weeks due to replication of differentiated hepatocytes and cholangiocytes. Despite this, liver diseases are regularly encountered in the veterinary clinic. Dogs primarily present with parenchymal pathologies such as hepatitis. The estimated frequency of canine hepatitis depends on the investigated population and accounts for 1%-2% of our university clinic referral population, and up to 12% in a general population. In chronic and severe acute liver disease, the regenerative and replicative capacity of the hepatocytes and/or cholangiocytes falls short and the liver is not restored. In this situation, proliferation of hepatic stem cells or hepatic progenitor cells (HPCs), on histology called the ductular reaction, comes into play to replace the damaged hepatocytes or cholangiocytes. For unknown reasons the ductular reaction is often too little and too late, or differentiation into fully differentiated hepatocytes or cholangiocytes is hampered. In this way, HPCs fail to fully regenerate the liver. The presence and potential of HPCs does, however, provide great prospectives for their use in regenerative strategies. This review highlights the regulation of, and the interaction between, HPCs and other liver cell types and discusses potential regenerative medicine-oriented strategies in canine hepatitis, making use of (liver) stem cells. PMID:24422896

  12. 犬瘟热的诊断%Diagnosis of Canine Distemper Virus from Dog

    Institute of Scientific and Technical Information of China (English)

    梅胜尧; 孙宝海

    2012-01-01

    犬瘟热是危害犬、狐、貂最严重的烈性传染病之一.作者对某试验动物犬饲养厂的病死犬进行临床症状观察,病理剖检及实验室诊断,通过病毒的分离培养及间接免疫荧光鉴定,确诊为犬瘟热病毒感染.鉴于该病的危害程度,建议加强对犬瘟热病的诊断及监控.%Canine distemper is one of the most serious deadly infectious diseases to dog. fox and mink. The paper introduced a dog farm. The clinical symptoms and pathological lesions and laboratory diagnosis were observed, and canine distemper was detected by virus isolation culture and indirect immunofluorescence. the final diagnosis result was canine distemper. Because the existence of the disease and the harm fulness to the experimental animals industry, the diagnosis and monitoring of canine distemper should be strengthening.

  13. The feasibility of canine rabies elimination in Africa: dispelling doubts with data.

    Directory of Open Access Journals (Sweden)

    Tiziana Lembo

    Full Text Available BACKGROUND: Canine rabies causes many thousands of human deaths every year in Africa, and continues to increase throughout much of the continent. METHODOLOGY/PRINCIPAL FINDINGS: This paper identifies four common reasons given for the lack of effective canine rabies control in Africa: (a a low priority given for disease control as a result of lack of awareness of the rabies burden; (b epidemiological constraints such as uncertainties about the required levels of vaccination coverage and the possibility of sustained cycles of infection in wildlife; (c operational constraints including accessibility of dogs for vaccination and insufficient knowledge of dog population sizes for planning of vaccination campaigns; and (d limited resources for implementation of rabies surveillance and control. We address each of these issues in turn, presenting data from field studies and modelling approaches used in Tanzania, including burden of disease evaluations, detailed epidemiological studies, operational data from vaccination campaigns in different demographic and ecological settings, and economic analyses of the cost-effectiveness of dog vaccination for human rabies prevention. CONCLUSIONS/SIGNIFICANCE: We conclude that there are no insurmountable problems to canine rabies control in most of Africa; that elimination of canine rabies is epidemiologically and practically feasible through mass vaccination of domestic dogs; and that domestic dog vaccination provides a cost-effective approach to the prevention and elimination of human rabies deaths.

  14. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    OpenAIRE

    Del Puerto, Helen L; Vasconcelos, Anilton C.; Luciana Moro; Fabiana Alves; Braz, Gissandra F; Almir S. Martins

    2010-01-01

    A quantitative real time polymerase chain reaction (PCR) revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus...

  15. Focos de dirofilariose canina na Ilha do Marajó: um fator de risco para a saúde humana Focus of canine heartworm disease in Marajó Island, North of Brazil: a risk factor for human health

    Directory of Open Access Journals (Sweden)

    Lourdes Maria Garcez

    2006-08-01

    Full Text Available A ocorrência de dirofilariose pulmonar humana relaciona-se com a prevalência de infecção por Dirofilaria immitis na população canina. Várias espécies de mosquitos são vetores desse nematóide. Analisaram-se amostras de sangue canino coletados nas vilas Pingo d'Água e União, município de Salvaterra (Ilha do Marajó, PA, em junho, 2004 (n=34 e abril, 2005 (N=90. Os diagnósticos parasitológico e imunológico (ELISA - kit SNAP® 3DX™, Biobrasil foram comparados (chi2, alfa=0,05 no exame de 34 amostras. A prevalência na população (N=90 foi avaliada pelo ELISA. O ELISA revelou mais positivos (25/34; 73,5% que a gota espessa (23/34, 67,6% e o Knott (21/34, 61,8%, mas a diferença não foi significativa (p>0,05. A freqüência de infecção por D. immitis na faixa de 0 a 2 anos foi 58%, enquanto em cães mais velhos foi 100%. A prevalência da dirofilariose canina em Pingo d'Água e Vila União foi alta (53,5%, indicando risco de transmissão do parasito às pessoas nessa área.The occurrence of human pulmonary dirofilariasis maintains a relation with the prevalence of Dirofilaria immitis infection in the canine population. Several mosquito species are vectors of this nematode. Canine blood samples collected in Pingo d'Água and União villages, Salvaterra municipality (Marajó Island, Pará, in June, 2004 (n=34 and April, 2005 (N=90 were analyzed. Parasitological and immunological (ELISA - kit SNAP® 3DX™, Biobrasil diagnoses were compared following the examination of 34 samples. The prevalence in the population (N=90 was evaluated by means of ELISA. ELISA revealed more positive samples (25/34; 73.5% than thick smears (23/34, 67.6% or Knott (21/34, 61.8%, but the differences were not significant (p>0.05. The frequency of D. immitis infection was 58% in dogs ranging from 0-2 years old, whereas in older dogs it was 100%. The prevalence of canine dirofilariasis was high in Pingo d'Água and Vila União (53.5%, indicating the risk of

  16. Changes of Haematobiochemical Parameters during Canine Parvoviral Enteritis

    Directory of Open Access Journals (Sweden)

    BLERINA DOKU

    2015-10-01

    Full Text Available Canine parvovirus is a highly contagious virus that can affect all dogs, but unvaccinated dogs and puppies younger than four months old are the most at risk. The pathology caused by CPV-2 is very common in Albania despite the existence of an effective vaccine.Changes in haematobiochemical parameters during canine parvoviral enteritiswould be very important for determining the prognosis of the disease. This hypothesis prompted the start of the study. From fecal samples taken from puppies 65 individuals resulted positive. Of all individuals 14 of them (21.5% failed to survive. All puppies presented leukopenia. In individuals that survived the WBC count began to grow in the first 24- 48 hours (p <0.05. In non-survivors the WBC was never higher than 2.1x109 / l at the time of admission in the clinic and in the first 24-48 hours began to decline further (p <0.05. There weren’t significant change in RBC count (p <0.05. In the first 12-24 hours 54% of individuals who did not survive had a PLT count less than 362.28x109 / l compared to only 8% of individuals who survived. Urea and creatinine were higher in survivors compared to nonsurvivors (p <0.05.These parameters reached normal levels after the start of the treatment in individuals that survived. Urea and creatinine levels in non-survivors continued to decrease until they died. The changes observed in leukocyte, platelet, urea and serum creatinine levels duringfirst stages of canine parvoviral enteritiscan be used to determine prognosis.

  17. Development of the canine tooth in the beagle

    International Nuclear Information System (INIS)

    The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

  18. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper...

  19. Review of the Risks of Some Canine Zoonoses from Free-Roaming Dogs in the Post-Disaster Setting of Latin America

    OpenAIRE

    Gerardo Acosta-Jamett; Barend Mark Bronsvoort; Elena Garde

    2013-01-01

    Simple Summary Free-roaming dogs are seldom considered an important public health risk following natural disasters in developing regions. With the high number of recognized canine zoonoses and evidence of increased transmission of some significant diseases this is a risk that may be being overlooked. Communities with free-roaming dogs and endemic canine zoonoses of importance should be developing appropriate community preparedness and response plans to mitigate the occurrence of increased tra...

  20. Comparison of serological reactions of typed Fusobacterium nucleatum strains with those of isolates from humans, canines, and a Macaca mulatta monkey.

    OpenAIRE

    Vincent, J W; Falkler, W A; Craig, J A

    1983-01-01

    In the present study, we compared typed F. nucleatum strains with isolates from various human periodontal diseases, canines, and a Macaca mulatta monkey. All isolates displayed biochemical reactions similar to those of the typed strains in the API 20A system (Analytab Products, Plainville, N.Y.). The human and monkey isolates displayed both type I and type II colonial morphologies on crystal violet erythromycin agar, whereas the canine isolates displayed only type I. Antigen preparations of t...

  1. The potential of canine sentinels for reemerging Trypanosoma cruzi transmission

    Science.gov (United States)

    Neyra, Ricardo Castillo; Chu, Lily Chou; Quispe-Machaca, Victor; Ancca-Juarez, Jenny; Malaga Chavez, Fernando S.; Mazuelos, Milagros Bastos; Naquira, Cesar; Bern, Caryn; Gilman, Robert H.; Levy, Michael Z.

    2015-01-01

    Background Chagas disease, a vector-borne disease transmitted by triatomine bugs and caused by the parasite Trypanosoma cruzi, affects millions of people in the Americas. In Arequipa, Peru, indoor residual insecticide spraying campaigns are routinely conducted to eliminate Triatoma infestans, the only vector in this area. Following insecticide spraying, there is risk of vector return and reinitiation of parasite transmission. Dogs are important reservoirs of T. cruzi and may play a role in reinitiating transmission in previously sprayed areas. Dogs may also serve as indicators of reemerging transmission. Methods We conducted a cross-sectional serological screening to detect T. cruzi antibodies in dogs, in conjunction with an entomological vector collection survey at the household level, in a disease endemic area that had been treated with insecticide 13 years prior. Spatial clustering of infected animals and vectors was assessed using Ripley’s K statistic, and the odds of being seropositive for dogs proximate to infected colonies was estimated with multivariate logistic regression. Results There were 106 triatomine-infested houses (41.1%), and 45 houses infested with T. cruzi-infected triatomine insects (17.4%). Canine seroprevalence in the area was 12.3% (n=154); all seropositive dogs were 9 months old or older. We observed clustering of vectors carrying the parasite, but no clustering of seropositive dogs. The age- and sex-adjusted odds ratio between seropositivity to T. cruzi and proximity to an infected triatomine (≤50m) was 5.67 (95% CI: 1.12 – 28.74; p=0.036). Conclusions Targeted control of reemerging transmission can be achieved by improved understanding of T. cruzi in canine populations. Our results suggest that dogs may be useful sentinels to detect re-initiation of transmission following insecticide treatment. Integration of canine T. cruzi blood sampling into existing interventions for zoonotic disease control (e.g. rabies vaccination programs

  2. Canine hypothyroidism. A diagnostic challenge?; Die canine Hypothyreose. Eine diagnostische Herausforderung?

    Energy Technology Data Exchange (ETDEWEB)

    Boretti, Felicitos; Reusch, C.E. [Klinik fuer Kleintiermedizin, Vetsuisse Fakultaet Zuerich, Univ. Zuerich (Switzerland)

    2010-03-15

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen {sup registered}) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  3. Transmigration of mandibular canine – case report

    International Nuclear Information System (INIS)

    Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

  4. Canine kobuvirus infections in Korean dogs.

    Science.gov (United States)

    Oem, Jae-Ku; Choi, Jeong-Won; Lee, Myoung-Heon; Lee, Kyoung-Ki; Choi, Kyoung-Seong

    2014-10-01

    To investigate canine kobuvirus (CaKoV) infection, fecal samples (n = 59) were collected from dogs with or without diarrhea (n = 21 and 38, respectively) in the Republic of Korea (ROK) in 2012. CaKoV infection was detected in four diarrheic samples (19.0 %) and five non-diarrheic samples (13.2 %). All CaKoV-positive dogs with diarrhea were found to be infected in mixed infections with canine distemper virus and canine parvovirus or canine adenovirus. There was no significant difference in the prevalence of CaKoV in dogs with and without diarrhea. By phylogenetic analysis based on partial 3D genes and complete genome sequences, the Korean isolates were found to be closely related to each other regardless of whether they were associated with diarrhea, and to the canine kobuviruses identified in the USA and UK. This study supports the conclusion that CaKoVs from different countries are not restricted geographically and belong to a single lineage. PMID:24906525

  5. Evaluation of a commercial kit of chromatographic immunoassay for detection of canine distemper antigen in dogs with systemic or neurologic signs of the diseaseAvaliação de um kit de imunoensaio cromatográfico para detecção do antígeno do vírus da cinomose em cães com sinais sistêmicos ou neurológicos da doença

    Directory of Open Access Journals (Sweden)

    Murilo Cézar Curti

    2012-12-01

    Full Text Available The canine distemper is a multisystemic disease highly contagious which can lead to serious consequences and even to death. Different types of tests can be used for the ante mortem diagnosis of canine distemper, however, due to unpredictable course of the disease, the final diagnosis remains uncertain in some cases. We evaluated in 33 dogs with suspected canine distemper, the effectiveness of a commercial test for detection of antigen (Ag of canine distemper, still comparing the frequency of clinical and neurological signs among positive and negative dogs. In 27/33 dogs the material was collected from the ocular mucosa, in 5/33 dogs the test was performed with CSF and in one animal material was collected from the ocular mucosa and CSF. In 14 dogs was performed also the RT-PCR technique. The Ag test was positive in 7/13 confirmed cases of canine distemper, all of them with systemic signs, but in dogs that had only neurologic signs, the antigen test was negative. In six dogs the antigen test was negative, however the RT-PCR was positive. The results of this study showed that the antigen test did not help for the canine distemper diagnosis in many cases with systemic and neurologic signs, still allowing that several cases had false-negative results. A cinomose é uma doença multisistêmica altamente contagiosa, que pode levar a graves sequelas e até ao óbito. Diferentes tipos de exames podem ser usados para o diagnóstico ante mortem da cinomose, entretanto, devido ao curso imprevisível da doença, o diagnóstico final permanece incerto em alguns casos. O objetivo deste trabalho foi avaliar a eficácia do teste comercial de imunoensaio cromatográfico para detecção de antígeno (Ag da cinomose em 33 cães com suspeita de cinomose canina, comparandose ainda a frequência dos sinais clínicos e neurológicos entre cães positivos e negativos. Em 27/33 o material foi coletado da mucosa ocular, em 5/33 foi coletado do LCR e em um animal o

  6. Insights into the Pathogenesis of Disease in Human Lymphatic Filariasis

    Science.gov (United States)

    2013-01-01

    Abstract Although two thirds of the 120 million people infected with lymph-dwelling filarial parasites have subclinical infections, ∼40 million have lymphedema and/or other pathologic manifestations including hydroceles (and other forms of urogenital disease), episodic adenolymphangitis, lymphedema, and (in its most severe form) elephantiasis. Adult filarial worms reside in the lymphatics and lymph nodes and induce lymphatic dilatation. Progressive lymphatic damage and pathology results primarily from the host inflammatory response to the parasites but also perhaps from the host inflammatory response to the parasite's Wolbachia endosymbiont and as a consequence of superimposed bacterial or fungal infections. This review will attempt to shed light on disease pathogenesis in lymphatic filariasis. PMID:24044755

  7. Mass Drug Administration Trial to Eliminate Lymphatic Filariasis in Papua New Guinea: Changes in Microfilaremia, Filarial Antigen, and Bm14 Antibody after Cessation

    OpenAIRE

    Tisch, Daniel J; Bockarie, Moses J.; Dimber, Zachary; Kiniboro, Benson; Tarongka, Nandao; Hazlett, Fred E.; Kastens, Will; Alpers, Michael P.; Kazura, James W.

    2008-01-01

    Laboratory tools to monitor infection burden are important to evaluate progress and determine endpoints in programs to eliminate lymphatic filariasis. We evaluated changes in Wuchereria bancrofti microfilaria, filarial antigen and Bm14 antibody in individuals who participated in a five-year mass drug administration trial in Papua New Guinea. Comparing values before treatment and one year after four annual treatments, the proportion of microfilaria positive individuals declined to the greatest...

  8. RT-PCR assay for the detection of infective (L3) larvae of lymphatic filarial parasite, Wuchereria bancrofti, in vector mosquito Culex quinquefasciatus

    OpenAIRE

    K.P. Patra; Hoti, S.L.; V. Vasuki

    2008-01-01

    Background & objectives: Periodic monitoring of vector population for infection and infectivity rates is central to the evaluation of the filariasis elimination strategies in endemic areas to monitor the success of MDA and also to establish endpoints for intervention. The main objective of this study was to develop a RT-PCR assay, based on L3 stage-specific primers to detect the presence of infective stage larvae of filarial parasite, Wuchereria bancrofti in the vector Culex quinquefasciatus....

  9. [The canine neuronal ceroid-lipofuscinosis: a review].

    Science.gov (United States)

    Karli, P; Karol, A; Oevermann, A; Drögemüller, C; Gorgas, D; Henke, D

    2014-09-01

    The present article gives a survey over the current scientific knowledge of the canine neuronal ceroid-lipofuscinosis (NCL). NCL is a heterogenous group of lysosomal storage diseases in humans and animals. In consequence of a gene mutation, there is an accumulation of ceroid-lipofuscin in neurons, cells of the retina and the skin and other cells. The stored ceroid-lipofuscin in neurons leads to an impaired cell function and subsequently to cell death. Recently, the underlying genetic defect was discovered in several dog breeds. Genetic testing permits an ante mortem diagnosis of the disease, which up to now was only possible with a positive biopsy result. Another advantage is the identification of carrier animals to eliminate the deleterious alleles. PMID:25183673

  10. Plasma biomarkers of SIRS and MODS associated with canine babesiosis.

    Science.gov (United States)

    Kuleš, J; de Torre-Minguela, C; Barić Rafaj, R; Gotić, J; Nižić, P; Ceron, J J; Mrljak, V

    2016-04-01

    Canine babesiosis is a tick-borne disease caused by the haemoprotozoan parasites of the genus Babesia. Early detection of systemic inflammatory response syndrome (SIRS) and multiple organ dysfunction syndrome (MODS) is of major importance in clinical practice for providing information about severity and outcomes of the disease and therapy. Plasma samples were taken at admission from five dogs with uncomplicated babesiosis caused by B. canis canis, five dogs with babesiosis and SIRS, five dogs with babesiosis and MODS, and five healthy dogs. After two-dimensional electrophoresis and capillary reversed - phase liquid chromatography coupled online with tandem mass spectrometry, 68 differentially expressed spots with level of significance P<0.05 were detected between groups. SIRS in babesiosis was characterised by increases in paraoxonase 1 and apoA-I, whereas MODS with decrease of complement inhibitors leading to prolonged complement activation and decrease of vitamin D binding protein due to haemolysis and activation of the coagulation cascade. PMID:27033937

  11. Canine mammary tumors - clinical survey

    Directory of Open Access Journals (Sweden)

    Elena Atanaskova Petrov

    2014-10-01

    Full Text Available Mammary tumours are the second most frequent neoplasia in dogs, mainly affecting older female patients. Approximately 50% of the mammary tumours are malignant with high percentage of mortality if not treated in time. The aim of this study was to analyze the data of canine patients with mammary tumours, to evaluate the type of tumours, as well as the relationship between tumour incidence and dogs’ age, reproductive cycle and sterilization. The survey was used to retrieve the information in the period of two years from the patient data base of the University Veterinary Hospital at the Faculty of Veterinary medicine in Skopje. Patients included in this survey were subjected to routine clinical investigation and additional laboratory tests (cytological examination, x-rays imaging, CBC and biochemical profile, histopathology of the tumor samples. Aged female patients (12 – 13 years are the most susceptible category for development of mammary tumours. The reproductive history showed that five of the patients with malignant mammary tumourshave never whelped and were not treated with any exogenous hormones. Malignant tumours (adenocarcinoma were diagnosed in 90% of the patients. Three patients died due to lung metastasis. Late diagnosis is one of the major problems that results in lethal outcome due to lung metastases. Since ovarian steroids play an important role in the aetiology, the most effective prevention of mammary tumoursis elective ovariectomy of the bitch at an early age.

  12. Composite mandibular allografts in canines

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective: To evaluate the feasibility of transplanting composite mandibular allografts to repair large mandibular defects. Methods: Three composite mandibular transplantation models were established. The first model consisted of hemimandible with the attached teeth, muscle and skin, and oral mucosa. The second model was transplanted in the same way with the first one excluding oral mucosa and some teeth, and third one excluding the oral mucosa and all dental crowns. Fourteen transplanting operations were performed in canines. Cyclosporine A and methylprednisone were given for immunosuppression. Results: The composite mandibular organs had an effective and closed return circuit. Transplantation of vascularized allograft of mandibular compound organs was feasible. Two longest time survivors of 67 d and 76 d were in the third model group. Cyclosporine A was successful in suppressing rejection of transplanted composite allograft and prolonging survival time of transplantation models. Conclusions: The composite mandibular allografts were available with large block of living composite tissue,and helpful in restoration of appearance and function for severe mandibular defects.

  13. Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.

    Directory of Open Access Journals (Sweden)

    David Kovacevic

    Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.

  14. Isolation and phylogenetic characterization of Canine distemper virus from India.

    Science.gov (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek

    2015-09-01

    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains. PMID:26396979

  15. Duchenne muscular dystrophy gene therapy in the canine model.

    Science.gov (United States)

    Duan, Dongsheng

    2015-03-01

    Duchenne muscular dystrophy (DMD) is an X-linked lethal muscle disease caused by dystrophin deficiency. Gene therapy has significantly improved the outcome of dystrophin-deficient mice. Yet, clinical translation has not resulted in the expected benefits in human patients. This translational gap is largely because of the insufficient modeling of DMD in mice. Specifically, mice lacking dystrophin show minimum dystrophic symptoms, and they do not respond to the gene therapy vector in the same way as human patients do. Further, the size of a mouse is hundredfolds smaller than a boy, making it impossible to scale-up gene therapy in a mouse model. None of these limitations exist in the canine DMD (cDMD) model. For this reason, cDMD dogs have been considered a highly valuable platform to test experimental DMD gene therapy. Over the last three decades, a variety of gene therapy approaches have been evaluated in cDMD dogs using a number of nonviral and viral vectors. These studies have provided critical insight for the development of an effective gene therapy protocol in human patients. This review discusses the history, current status, and future directions of the DMD gene therapy in the canine model. PMID:25710459

  16. Serologic survey of selected canine pathogens among free-ranging jackals in Kenya.

    Science.gov (United States)

    Alexander, K A; Kat, P W; Wayne, R K; Fuller, T K

    1994-10-01

    Serum samples from 76 free-ranging adult jackals of three species from four localities in Kenya were examined for circulating antibodies against four canine pathogens: rabies virus, canine parvovirus (CPV-2), canine distemper virus (CDV), and Ehrlichia canis. Samples were collected between April 1987 and January 1988. Among black-backed jackals (Canis mesomelas), the most sampled species, the mean prevalence of antibodies to CPV-2, CDV, rabies virus, and E. canis was 34% (14 positive/55 sampled), 9% (4/55), 3% (1/28), and 2% (1/36), respectively. There were no significantly differences among sampling locations. In one area, antibody prevalence of CPV-2 was significantly higher for golden jackals (C. aureus; 9/16) than for C. mesomelas (5/26). Only three side-striped jackals (C. adustus) were sampled, but antibodies to CPV-2 and CDV were present. As jackals often are the most abundant wild carnivore in African ecosystems, they could serve as an important indicator species to monitor the potential of exposure of rare and endangered canids to specific canine diseases. PMID:7760476

  17. In vivo electrical conductivity imaging of a canine brain using a 3 T MREIT system

    International Nuclear Information System (INIS)

    Magnetic resonance electrical impedance tomography (MREIT) aims at producing high-resolution cross-sectional conductivity images of an electrically conducting object such as the human body. Following numerous phantom imaging experiments, the most recent study demonstrated successful conductivity image reconstructions of postmortem canine brains using a 3 T MREIT system with 40 mA imaging currents. Here, we report the results of in vivo animal imaging experiments using 5 mA imaging currents. To investigate any change of electrical conductivity due to brain ischemia, canine brains having a regional ischemic model were scanned along with separate scans of canine brains having no disease model. Reconstructed multi-slice conductivity images of in vivo canine brains with a pixel size of 1.4 mm showed a clear contrast between white and gray matter and also between normal and ischemic regions. We found that the conductivity value of an ischemic region decreased by about 10–14%. In a postmortem brain, conductivity values of white and gray matter decreased by about 4–8% compared to those in a live brain. Accumulating more experience of in vivo animal imaging experiments, we plan to move to human experiments. One of the important goals of our future work is the reduction of the imaging current to a level that a human subject can tolerate. The ability to acquire high-resolution conductivity images will find numerous clinical applications not supported by other medical imaging modalities. Potential applications in biology, chemistry and material science are also expected

  18. Urine neutrophil gelatinase-associated lipocalin (NGAL as a biomarker for acute canine kidney injury

    Directory of Open Access Journals (Sweden)

    Lee Ya-Jane

    2012-12-01

    Full Text Available Abstract Background Biomarkers for the early prediction of canine acute kidney injury (AKI are clinically important. Recently, neutrophil gelatinase-associated lipocalin (NGAL was found to be a sensitive biomarker for the prediction of human AKI at a very early stage and the development of AKI after surgery. However, NGAL has not yet been studied with respect to dog kidney diseases. The application of NGAL canine AKI was investigated in this study. Results The canine NGAL gene was successfully cloned and expressed. Polyclonal antibodies against canine NGAL were generated and used to develop an ELISA for measuring NGAL protein in serum and urine samples that were collected from 39 dogs at different time points after surgery. AKI was defined by the standard method, namely a serum creatinine increase of greater than or equal to 26.5 μmol/L from baseline within 48 h. At 12 h after surgery, compared to the group without AKI (12 dogs, the NGAL level in the urine of seven dogs with AKI was significantly increased (median 178.4 pg/mL vs. 88.0 pg/mL, and this difference was sustained to 72 h. Conclusion As the increase in NGAL occurred much earlier than the increase in serum creatinine, urine NGAL seems to be able to serve as a sensitive and specific biomarker for the prediction of AKI in dogs.

  19. Evidence-based control of canine rabies: a critical review of population density reduction.

    Science.gov (United States)

    Morters, Michelle K; Restif, Olivier; Hampson, Katie; Cleaveland, Sarah; Wood, James L N; Conlan, Andrew J K

    2013-01-01

    Control measures for canine rabies include vaccination and reducing population density through culling or sterilization. Despite the evidence that culling fails to control canine rabies, efforts to reduce canine population density continue in many parts of the world. The rationale for reducing population density is that rabies transmission is density-dependent, with disease incidence increasing directly with host density. This may be based, in part, on an incomplete interpretation of historical field data for wildlife, with important implications for disease control in dog populations. Here, we examine historical and more recent field data, in the context of host ecology and epidemic theory, to understand better the role of density in rabies transmission and the reasons why culling fails to control rabies. We conclude that the relationship between host density, disease incidence and other factors is complex and may differ between species. This highlights the difficulties of interpreting field data and the constraints of extrapolations between species, particularly in terms of control policies. We also propose that the complex interactions between dogs and people may render culling of free-roaming dogs ineffective irrespective of the relationship between host density and disease incidence. We conclude that vaccination is the most effective means to control rabies in all species. PMID:23004351

  20. Use of a doxycycline-enrofloxacin-metronidazole combination with/without diminazene diaceturate to treat naturally occurring canine babesiosis caused by Babesia gibsoni

    Directory of Open Access Journals (Sweden)

    Huang Hui-Pi

    2010-04-01

    Full Text Available Abstract Canine babesiosis is an important worldwide, tick-borne disease caused by hemoprotozoan parasites of the genus Babesia. Babesia gibsoni is the predominant species that causes canine babesiosis in Taipei, Taiwan. It is a small pleomorphic intraerythrocytic parasite that can cause erythrocyte destruction and hemolytic anemia. Efficacy of oral administration of a doxycycline-enrofloxacin-metronidazole combination with and without injections of diminazene diaceturate in the management of naturally occurring canine babesiosis caused by B. gibsoni was evaluated retrospectively. The overall efficacy of this combination of doxycycline-enrofloxacin-metronidazole in conjunction with and without administration of diminazene diaceturate was 85.7% and 83.3%, respectively; with a mean recovery time of 24.2 and 23.5 days, respectively. Concomitant use of intramuscular diminazene diaceturate may not improve the efficacy of a doxycycline-enrofloxacin-metronidazole combination in management of canine babesiosis caused by B. gibsoni.

  1. Factors associated with Trypanosoma cruzi exposure among domestic canines in Tennessee.

    Science.gov (United States)

    Rowland, Meghan E; Maloney, Jenny; Cohen, Sara; Yabsley, Michael J; Huang, Junjun; Kranz, Melissa; Green, Alice; Dunn, John R; Carpenter, L Rand; Jones, Timothy F; Moncayo, Abelardo C

    2010-06-01

    Trypanosoma cruzi , the etiologic agent of Chagas' disease, is enzootic in animal populations of the southeastern United States. In the United States, T. cruzi prevalence has been reported for over 20 different wildlife species, and 7 autochthonous human cases have been documented since 1955. Previous canine (Canis familiaris) serosurveys have been limited either by small sample size or confined geographic reporting areas. In this study, we report a seroprevalence of 6.4% among 860 canines from 31 counties and 5 ecoregions throughout Tennessee, using an indirect immunofluorescent assay (IFA). Statistically significant associations between seropositivity and age, weight, and outdoor living were noted. Differences in seropositivity were not seen based on American Kennel Club (AKC) group, sex, habitat, land cover, and ecoregion. Greater attention should be given to possible T. cruzi transmission in Tennessee and veterinarians should consider Chagas' disease as a differential diagnosis with compatible signs. PMID:20557201

  2. The Canine Sand Maze: An Appetitive Spatial Memory Paradigm Sensitive to Age-Related Change in Dogs

    Science.gov (United States)

    Salvin, Hannah E.; McGreevy, Paul D.; Sachdev, Perminder S.; Valenzuela, Michael J.

    2011-01-01

    Aged dogs exhibit a spectrum of cognitive abilities including a syndrome similar to Alzheimer's disease. A major impediment to research so far has been the lack of a quick and accurate test of visuospatial memory appropriate for community-based animals. We therefore report on the development and validation of the Canine Sand Maze. A 4.5-m-diameter…

  3. Vaccination of harbour seals (Phoca vitulina) against phocid distemper with two different inactivated canine distemper virus (CDV) vaccines.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); M.W.G. van de Bildt (Marco); H.N. Brugge; P.J.H. Reijnders; E.J. Vedder (Lies); J. Kuiper; P. de Vries (Petra); J. Groen (Jan); H.C. Walvoort; F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Ab)

    1989-01-01

    textabstractTwo inactivated canine distemper virus (CDV) vaccines--an adjuvanted whole inactivated virus and a subunit ISCOM preparation--were tested for their ability to induce protective immunity in harbour seals (Phoca vitulina) against phocid distemper, a disease that recently killed greater tha

  4. PiB fails to map amyloid deposits in cerebral cortex of aged dogs with Canine Cognitive Dysfunction

    DEFF Research Database (Denmark)

    Fast, Rikke; Rodell, Anders; Gjedde, Albert; Mouridsen, Kim; Alstrup, Aage Kristian Olsen; Bjarkam, Carsten Reidies; West, Mark J.; Berendt, Mette; Møller, Arne

    2013-01-01

    Dogs with Canine Cognitive Dysfunction (CCD) accumulate amyloid beta (Aβ) in the brain. As the cognitive decline and neuropathology of these old dogs share features with Alzheimer's disease (AD), the relation between Aβ and cognitive decline in animal models of cognitive decline is of interest to...

  5. Effects of calcitriol, seocalcitol, and medium-chain triglyceride on a canine transitional cell carcinoma cell line

    DEFF Research Database (Denmark)

    Kaewsakhorn, T.; Kisseberth, W.C.; Capen, C.C.;

    2005-01-01

    Background: Transitional cell carcinoma (TCC) in dogs is associated with high morbidity and mortality. Calcitriol and its analog seocalcitol, combined with medium-chain triglyceride (MCT), have potential for the treatment of this disease. Materials and Methods: TCC cells were treated with...... calcitriol or seocalcitol, alone or combined with MCT. Cell growth, cell cycle kinetics, vitamin D receptor (VDR) localization and expression, and Bcl-2 expression were measured. Results: Canine TCC expresses high levels of nuclear VDR. Furthermore, calcitriol and seocalcitol significantly inhibited cell...... inhibited TCC cell growth via induction of cell cycle arrest and MCT enhanced this effect. Therefore, calcitriol and seocalcitol with MCT may have therapeutic potential for canine bladder cancer....

  6. Analysis of Single Nucleotide Polymorphism (SNP) rs22114085 Associated with Canine Atopic Dermatitis by PCR-RFLP Method

    OpenAIRE

    Martina Miluchová; Michal Gábor; Anna Trakovická; Jana Hanusová

    2012-01-01

    Canine atopic dermatitis (cAD) is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema). The aim of the paper was to identify of the SNP rs22114085 in different dog breeds. The material involved 52 dogs from 5 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA) carrier and from blood by using commercial kit NucleospinBlood and used ...

  7. Analysis of single nucleotide polymorphism (SNP) RS23472497 associated with canine atopic dermatitis by ACRS-PCR method

    OpenAIRE

    Martina Miluchová; Michal Gábor; Anna Trakovická; Jana Hanusova; Radovan Kasarda

    2014-01-01

    The aim of the paper was to identify of the SNP rs23472497 associated with canine atopic dermatitis (cAD). cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema). The material involved 60 dogs from 6 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA) carrier and from blood by using commercial kit NucleospinBlood and used in...

  8. Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

    OpenAIRE

    Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane; Chriél, Mariann; Larsen, Lars Erik

    2013-01-01

    Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed that the farmed mink and wild fox population were infected by identical viruses which strongly indicate an epidemiological link between these populations. Accordingly, diseased and dead foxes were ob...

  9. Characteristics of a Canine Distemper Virus Outbreak in Dichato, Chile Following the February 2010 Earthquake

    OpenAIRE

    Gerardo Acosta-Jamett; Barend Mark Bronsvoort; Guillermo Pérez; Elena Garde

    2013-01-01

    Simple Summary A disease outbreak in domestic dogs was reported by a coastal Chilean community following the February 2010 earthquake and tsunami. Using clinical exams and diagnostic testing, canine distemper virus was confirmed. Most dogs seen had never been vaccinated, and the majority of those with positive results were recorded in dogs less than two years of age. There were no facilities to contain or treat dogs locally, and no plan to shelter free-roaming dogs. This observational study d...

  10. Comparison of the Oral Microbiomes of Canines and Their Owners Using Next-Generation Sequencing

    OpenAIRE

    Oh, Changin; Lee, Kunkyu; Cheong, Yeotaek; Lee, Sang-Won; Park, Seung-Yong; Song, Chang-Seon; Choi, In-Soo; Lee, Joong-Bok

    2015-01-01

    The oral microbiome, which is closely associated with many diseases, and the resident pathogenic oral bacteria, which can be transferred by close physical contact, are important public health considerations. Although the dog is the most common companion animal, the composition of the canine oral microbiome, which may include human pathogenic bacteria, and its relationship with that of their owners are unclear. In this study, 16S rDNA pyrosequencing was used to compare the oral microbiomes of ...

  11. A predictive model for canine dilated cardiomyopathy—a meta-analysis of Doberman Pinscher data

    Directory of Open Access Journals (Sweden)

    Siobhan Simpson

    2015-03-01

    Full Text Available Dilated cardiomyopathy is a prevalent and often fatal disease in humans and dogs. Indeed dilated cardiomyopathy is the third most common form of cardiac disease in humans, reported to affect approximately 36 individuals per 100,000 individuals. In dogs, dilated cardiomyopathy is the second most common cardiac disease and is most prevalent in the Irish Wolfhound, Doberman Pinscher and Newfoundland breeds. Dilated cardiomyopathy is characterised by ventricular chamber enlargement and systolic dysfunction which often leads to congestive heart failure. Although multiple human loci have been implicated in the pathogenesis of dilated cardiomyopathy, the identified variants are typically associated with rare monogenic forms of dilated cardiomyopathy. The potential for multigenic interactions contributing to human dilated cardiomyopathy remains poorly understood. Consistent with this, several known human dilated cardiomyopathy loci have been excluded as common causes of canine dilated cardiomyopathy, although canine dilated cardiomyopathy resembles the human disease functionally. This suggests additional genetic factors contribute to the dilated cardiomyopathy phenotype.This study represents a meta-analysis of available canine dilated cardiomyopathy genetic datasets with the goal of determining potential multigenic interactions relating the sex chromosome genotype (XX vs. XY with known dilated cardiomyopathy associated loci on chromosome 5 and the PDK4 gene in the incidence and progression of dilated cardiomyopathy. The results show an interaction between known canine dilated cardiomyopathy loci and an unknown X-linked locus. Our study is the first to test a multigenic contribution to dilated cardiomyopathy and suggest a genetic basis for the known sex-disparity in dilated cardiomyopathy outcomes.

  12. Designing programs for eliminating canine rabies from islands: Bali, Indonesia as a case study

    OpenAIRE

    Townsend, S.E.; Sumantra, I.P.; Pudjiatmoko,; Bagus, G.N.; Brum, E.; Cleaveland, S.; Crafter, S.; Dewi, A.P.M.; Dharma, D.M.N.; Dushoff, J.; Girardi, J.; Gunata, I.K.; Hiby, E.F.; Kalalo, C.; Knobel, D.L.

    2013-01-01

    Background: Canine rabies is one of the most important and feared zoonotic diseases in the world. In some regions rabies elimination is being successfully coordinated, whereas in others rabies is endemic and continues to spread to uninfected areas. As epidemics emerge, both accepted and contentious control methods are used, as questions remain over the most effective strategy to eliminate rabies. The Indonesian island of Bali was rabies-free until 2008 when an epidemic in domestic dogs beg...

  13. Rabies Exposures, Post-Exposure Prophylaxis and Deaths in a Region of Endemic Canine Rabies

    OpenAIRE

    Hampson, K.; Dobson, A.; Kaare, M.; Dushoff, J.; Magoto, M.; Sindoya, E.; Cleaveland, S.

    2008-01-01

    Background Thousands of human deaths from rabies occur annually despite the availability of effective vaccines following exposure, and for disease control in the animal reservoir. Our aim was to assess risk factors associated with exposure and to determine why human deaths from endemic canine rabies still occur. Methods and Findings Contact tracing was used to gather data on rabies exposures, post-exposure prophylaxis (PEP) delivered and deaths in two rural districts in northwestern Tanzania ...

  14. Small animal disease surveillance: respiratory disease

    OpenAIRE

    Sánchez-Vizcaíno, Fernando; Daly, Janet M.; Philip H Jones; Dawson, Susan; Gaskell, Rosalind; Menacere, Tarek; Heayns, Bethaney; Wardeh, Maya; Newman, Jenny; Everitt, Sally; Day, Michael J.; McConnell, Katie; Noble, Peter J.M.; Radford, Alan D

    2016-01-01

    This second Small Animal Disease Surveillance report focuses on syndromic surveillance of i) respiratory disease in veterinary practice and ii) feline calicivirus (FCV) based on laboratory diagnosis, in a large veterinary-visiting pet population of the UK between January 2014 and December 2015. Presentation for respiratory disease comprised 1.7%, 2.3% and 2.5% of canine, feline and rabbit consultations, respectively. In dogs, the most frequent respiratory sign reported was coughing (71.1% of ...

  15. Production of monoclonal antibodies against canine leukocytes.

    Science.gov (United States)

    Aguiar, Paulo Henrique Palis; Borges dos Santos, Roberto Robson; Lima, Carla Andrade; Rios de Sousa Gomes, Hilton; Larangeira, Daniela Farias; Santos, Patrícia Meira; Barrouin-Melo, Stella Maria; Conrado dos-Santos, Washington Luis; Pontes-de-Carvalho, Lain

    2004-04-01

    A panel of anti-canine leukocyte monoclonal antibodies (MAbs) was produced by immunizing BALB/c mice with canine peripheral blood mononuclear cells (PBMC), either resting or stimulated with concanavalin A (ConA). Three out of 28 clones-IH1, AB6, and HG6-screened by ELISA and producing antibody with the highest specificity for canine cell immunostaining, were subjected to three subsequent subcloning steps by limiting dilution, and selected for further characterization. These MAbs belonged to IgG1 (HG6 and IH1) and IgG2a (AB6) isotypes. The distribution of cell populations expressing the antigen recognized by the antibodies was identified by indirect immunoflorescence on canine PBMC and on tissue sections of lymph node, spleen, liver and skin. The possible crossreactivity with human PBMC was also examined in immunocytochemistry. One of the antibodies specifically recognized macrophages. The MAbs presented here can be foreseen as possible valuable diagnostic and research tools to study immune functions in dogs. PMID:15165486

  16. Experimental Forelimb Allotransplantation in Canine Model

    Science.gov (United States)

    2016-01-01

    As reconstructive transplantation is gaining popularity as a viable alternative for upper limb amputees, it is becoming increasingly important for plastic surgeons to renew surgical skills and knowledge of this area. Forelimb allotransplantation research has been performed previously in rodent and swine models. However, preclinical canine forelimb allotransplantation studies are lacking in the literature. The purpose of this paper is to provide an overview of the surgical skills necessary to successfully perform forelimb transplantation in canines as a means to prepare for clinical application. A total of 18 transplantation operations on canines were performed. The recipient limb was shortened at the one-third proximal forearm level. The operation was performed in the following order: bones (two reconstructive plates), muscles and tendons (separately sutured), nerves (median, ulnar, and radial nerve), arteries (two), and veins (two). The total mean time of transplantation was 5 hours ± 30 minutes. All of the animals that received transplantation were treated with FK-506 (tacrolimus, 2 mg/kg) for 7 days after surgery. Most allografts survived with perfect viability without vascular problems during the early postoperative period. The canine forelimb allotransplantation model is well qualified to be a suitable training model for standard transplantation and future research work. PMID:27597952

  17. Seroprevalence of Canine Distemper Virus in Cats

    OpenAIRE

    Ikeda, Yasuhiro; Nakamura, Kazuya; Miyazawa, Takayuki; Chen, Ming-Chu; Kuo, Tzong-Fu; Lin, James A; Mikami, Takeshi; Kai, Chieko; TAKAHASHI, Eiji

    2001-01-01

    A seroepidemiological survey of canine distemper virus (CDV) infection in Asian felids revealed that the prevalence of antibodies varied depending on region and, in some cases, exposure to dogs. The serologic pattern in cats with antibodies indicated that they had likely been exposed to field strains rather than typical CDV vaccine strains.

  18. Experimental Forelimb Allotransplantation in Canine Model.

    Science.gov (United States)

    Hong, Sa-Hyeok; Eun, Seok-Chan

    2016-01-01

    As reconstructive transplantation is gaining popularity as a viable alternative for upper limb amputees, it is becoming increasingly important for plastic surgeons to renew surgical skills and knowledge of this area. Forelimb allotransplantation research has been performed previously in rodent and swine models. However, preclinical canine forelimb allotransplantation studies are lacking in the literature. The purpose of this paper is to provide an overview of the surgical skills necessary to successfully perform forelimb transplantation in canines as a means to prepare for clinical application. A total of 18 transplantation operations on canines were performed. The recipient limb was shortened at the one-third proximal forearm level. The operation was performed in the following order: bones (two reconstructive plates), muscles and tendons (separately sutured), nerves (median, ulnar, and radial nerve), arteries (two), and veins (two). The total mean time of transplantation was 5 hours ± 30 minutes. All of the animals that received transplantation were treated with FK-506 (tacrolimus, 2 mg/kg) for 7 days after surgery. Most allografts survived with perfect viability without vascular problems during the early postoperative period. The canine forelimb allotransplantation model is well qualified to be a suitable training model for standard transplantation and future research work. PMID:27597952

  19. Case study in canine intestinal lymphangiectasia

    OpenAIRE

    Brooks, Thomas A.

    2005-01-01

    A 9.52 kg, 9-year-old, spayed female beagle was presented with the chief complaint of abdominal distention of 1 week’s duration. A presumptive diagnosis of canine intestinal lymphangectasia was arrived at by exclusion of other causes for the patient’s ascites. The patient was successfully treated with dietary modification and immunosuppressive therapy.

  20. DELINEATING TOXIC AREAS BY CANINE OLFACTION

    Science.gov (United States)

    A research project was undertaken to learn how the highly acute olfactory sensitivity of the canine could be applied with advantage to environmental problems. The objectives were to determine how dogs could be trained to detect hazardous and toxic pollutants in the environment an...

  1. Molecular and phylogenetic analysis of the filarial nematode Micipsella numidica from the hare Lepus europaeus in Italy.

    Science.gov (United States)

    Gabrielli, S; Galuppi, R; Fraulo, M; Savini, F; Morandi, B; Cancrini, G; Poglayen, G

    2016-07-01

    The genus Micipsella comprises three species of filariae to date identified in lagomorphs only, whereas the other genera belonging to the subfamily Splendidofilariinae are described as parasites of birds, reptiles and mammals. In the present study seven specimens of Micipsella numidica (Seurat, 1917), collected from the hare Lepus europaeus in Italy, were characterized genetically by molecular amplification of the mitochondrial genes (12S rDNA; cox1) and the 5S rDNA gene spacer region. Phylogenetic trees inferred using available sequences from filariae and those identified in this study evidenced a close relationship between M. numidica and Splendidofilariinae of other mammals and reptiles (Rumenfilaria andersoni and Madathamugadia hiepei). The present findings, apart from adding new data about the hosts in Italy, support the taxonomic position of M. numidica and highlight the substantial biological and molecular differences existing between Splendidofilariinae and other Onchocercidae. The study also contributes to our knowledge of the molecular/genetic diagnosis of filarial parasites of veterinary and medical concern in any vertebrate or invertebrate host. PMID:26123728

  2. Identification and characterization of novel membrane-bound PRL protein tyrosine phosphatases from Setaria cervi, a bovine filarial parasite.

    Science.gov (United States)

    Singh, Neetu; Yadav, Smita; Rathaur, Sushma

    2015-11-01

    A significant amount of protein tyrosine phosphatase (PTP) activity was detected in the detergent-soluble membrane-bound fraction of Setaria cervi, a bovine filarial parasite. The membrane-bound PTP activity was significantly inhibited when the adult parasites were exposed to compounds having antifilarial activity like aspirin and SK7 as well as phenylarsine oxide, a specific PTP inhibitor suggesting that this activity is stress regulated. Further, this enzyme was purified as a single protein of apparently 21 kDa using two different chromatographic techniques. The MALDI-MS/MS analysis of its peptides showed closest match with protein tyrosine phosphatase PRL (Aedes aegypti). This purified enzyme (named as PRL) showed maximum activity at pH 5.5/37 °C and hydrolysed para nitro phenyl phosphate (pNPP) at the highest rate followed by O-P-L-tyrosine and O-P-L-threonine. It showed significant inhibition by specific inhibitors of PTP such as sodium orthovanadate, phenylarsine oxide and ammonium molybdate and was activated by dithiothreitol (DTT). The active site modification studies suggested involvement of cysteine, arginine, histidine and aspartic acid in the catalytic activity of PRL. The activity of S. cervi PRL was also found to be resistant towards the external oxidative stress. Thus, S. cervi PRL could be taken as a potential target for the management of human lymphatic filariasis. PMID:26341797

  3. Molecular cloning and characterization of three beta-defensins from canine testes.

    Science.gov (United States)

    Sang, Yongming; Ortega, M Teresa; Blecha, Frank; Prakash, Om; Melgarejo, Tonatiuh

    2005-05-01

    Mammalian beta-defensins are small cationic peptides possessing broad antimicrobial and physiological activities. Because dogs are particularly resilient to sexually transmitted diseases, it has been proposed that their antimicrobial peptide repertoire might provide insight into novel antimicrobial therapeutics and treatment regimens. To investigate this proposal, we cloned the full-length cDNA of three canine beta-defensin isoforms (cBD-1, -2, and -3) from canine testicular tissues. Their predicted peptides share identical N-terminal 65-amino-acid residues, including the beta-defensin consensus six-cysteine motif. The two longer isoforms, cBD-2 and -3, possess 4 and 34 additional amino acids, respectively, at the C terminus. To evaluate the antimicrobial activity of cBD, a 34-amino-acid peptide derived from the shared mature peptide region was synthesized. Canine beta-defensin displayed broad antimicrobial activity against gram-positive bacteria (Listeria monocytogenes and Staphylococcus aureus; MICs of 6 and 100 mug/ml, respectively), gram-negative bacteria (Escherichia coli, Klebsiella pneumoniae, and Neisseria gonorrhoeae; MICs of 20 to 50, 20, and 50 mug/ml, respectively), and yeast (Candida albicans; MIC of 5 to 50 mug/ml) and lower activity against Ureaplasma urealyticum and U. canigenitalium (MIC of 200 mug/ml). Antimicrobial potency was significantly reduced at salt concentrations higher than 140 mM. All three canine beta-defensins were highly expressed in testis. In situ hybridization indicated that cBD-1 was expressed primarily in Sertoli cells within the seminiferous tubules. In contrast, cBD-2 was located primarily within Leydig cells. The longest isoform, cBD-3, was detected in Sertoli cells and to a lesser extent in the interstitium. The tissue-specific expression and broad antimicrobial activity suggest that canine beta-defensins play an important role in host defense and other physiological functions of the male reproductive system. PMID:15845463

  4. Comparison of the Oral Microbiomes of Canines and Their Owners Using Next-Generation Sequencing.

    Directory of Open Access Journals (Sweden)

    Changin Oh

    Full Text Available The oral microbiome, which is closely associated with many diseases, and the resident pathogenic oral bacteria, which can be transferred by close physical contact, are important public health considerations. Although the dog is the most common companion animal, the composition of the canine oral microbiome, which may include human pathogenic bacteria, and its relationship with that of their owners are unclear. In this study, 16S rDNA pyrosequencing was used to compare the oral microbiomes of 10 dogs and their owners and to identify zoonotic pathogens. Pyrosequencing revealed 246 operational taxonomic units in the 10 samples, representing 57 genera from eight bacterial phyla. Firmicutes (57.6%, Proteobacteria (21.6%, Bacteroidetes (9.8%, Actinobacteria (7.1%, and Fusobacteria (3.9% were the predominant phyla in the human oral samples, whereas Proteobacteria (25.7%, Actinobacteria (21%, Bacteroidetes (19.7%, Firmicutes (19.3%, and Fusobacteria (12.3% were predominant in the canine oral samples. The predominant genera in the human samples were Streptococcus (43.9%, Neisseria (10.3%, Haemophilus (9.6%, Prevotella (8.4%, and Veillonella (8.1%, whereas the predominant genera in the canine samples were Actinomyces (17.2%, Unknown (16.8, Porphyromonas (14.8, Fusobacterium (11.8, and Neisseria (7.2%. The oral microbiomes of dogs and their owners were appreciably different, and similarity in the microbiomes of canines and their owners was not correlated with residing in the same household. Oral-to-oral transfer of Neisseria shayeganii, Porphyromonas canigingivalis, Tannerella forsythia, and Streptococcus minor from dogs to humans was suspected. The finding of potentially zoonotic and periodontopathic bacteria in the canine oral microbiome may be a public health concern.

  5. In Vitro Influence of Mycophenolic Acid on Selected Parameters of Stimulated Peripheral Canine Lymphocytes

    Science.gov (United States)

    Guzera, Maciej; Szulc-Dąbrowska, Lidia; Cywińska, Anna; Archer, Joy; Winnicka, Anna

    2016-01-01

    Mycophenolic acid (MPA) is an active metabolite of mycophenolate mofetil, a new immunosuppressive drug effective in the treatment of canine autoimmune diseases. The impact of MPA on immunity is ambiguous and its influence on the canine immune system is unknown. The aim of the study was to determine markers of changes in stimulated peripheral canine lymphocytes after treatment with MPA in vitro. Twenty nine healthy dogs were studied. Phenotypic and functional analysis of lymphocytes was performed on peripheral blood mononuclear cells cultured with mitogens and different MPA concentrations– 1 μM (10−3 mol/m3), 10 μM or 100 μM. Apoptotic cells were detected by Annexin V and 7-aminoactinomycin D (7-AAD). The expression of antigens (CD3, CD4, CD8, CD21, CD25, forkhead box P3 [FoxP3] and proliferating cell nuclear antigen [PCNA]) was assessed with monoclonal antibodies. The proliferation indices were analyzed in carboxyfluorescein diacetate succinimidyl ester (CFSE)-labeled cells. All analyses were performed using flow cytometry. The influence of MPA on apoptosis was dependent on the mechanism of cell activation and MPA concentration. MPA caused a decrease in the expression of lymphocyte surface antigens, CD3, CD8 and CD25. Its impact on the expression of CD4 and CD21 was negligible. Its negative influence on the expression of FoxP3 was dependent on cell stimulation. MPA inhibited lymphocyte proliferation. In conclusion, MPA inhibited the activity of stimulated canine lymphocytes by blocking lymphocyte activation and proliferation. The influence of MPA on the development of immune tolerance–expansion of Treg cells and lymphocyte apoptosis–was ambiguous and was dependent on the mechanism of cellular activation. The concentration that MPA reaches in the blood may lead to inhibition of the functions of the canine immune system. The applied panel of markers can be used for evaluation of the effects of immunosuppressive compounds in the dog. PMID:27138877

  6. Genotypic characterization of canine coronaviruses associated with fatal canine neonatal enteritis in the United States.

    Science.gov (United States)

    Licitra, Beth N; Whittaker, Gary R; Dubovi, Edward J; Duhamel, Gerald E

    2014-12-01

    Emerging canine coronavirus (CCoV) variants that are associated with systemic infections have been reported in the European Union; however, CCoV-associated disease in the United States is incompletely characterized. The purpose of this study was to correlate the clinicopathological findings and viral antigen distribution with the genotypic characteristics of CCoV in 11 puppies from nine premises in five states that were submitted for diagnostic investigation at Cornell University between 2008 and 2013. CCoV antigen was found in epithelial cells of small intestinal villi in all puppies and the colon in 2 of the 10 puppies where colon specimens were available. No evidence of systemic CCoV infection was found. Comparative sequence analyses of viral RNA extracted from intestinal tissues revealed CCoV-II genotype in 9 out of 11 puppies. Of the nine CCoV-IIs, five were subtyped as group IIa and one as IIb, while three CCoVs could not be subtyped. One of the CCoV-IIa variants was isolated in cell culture. Infection with CCoV alone was found in five puppies, of which two also had small intestinal intussusception. Concurrent infections with either parvovirus (n = 1), attaching-effacing Escherichia coli (n = 4), or protozoan parasites (n = 3) were found in the other six puppies. CCoV is an important differential diagnosis in outbreaks of severe enterocolitis among puppies between 4 days and 21 weeks of age that are housed at high population density. These findings will assist with the rapid laboratory diagnosis of enteritis in puppies and highlight the need for continued surveillance for CCoV variants and intestinal viral diseases of global significance. PMID:25253797

  7. Seroprevalence of heartworm (Dirofilaria immitis) in feline and canine hosts from central and northern Portugal.

    Science.gov (United States)

    Vieira, L; Silvestre-Ferreira, A C; Fontes-Sousa, A P; Balreira, A C; Morchón, R; Carretón, E; Vilhena, H; Simón, F; Montoya-Alonso, J A

    2015-09-01

    Dirofilaria immitis is endemic in Portugal. Several studies have reported the presence of canine heartworm disease, although no previous studies on feline infections have been published. The aim of this study was to determine the prevalence of D. immitis in cats and dogs from central and northern Portugal. Blood samples from 434 cats were tested for circulating anti-D. immitis and anti-Wolbachia antibodies. Furthermore, 386 dogs were tested for circulating D. immitis antigens. Overall feline seroprevalence was 15%, while canine prevalence was 2.1%. The highest feline seroprevalences of 18.7% and 17.6% were found in Aveiro and Viseu, respectively, while the highest canine prevalences of 8.8% and 6.8% were found in Coimbra and Aveiro, respectively. Cats and dogs showing respiratory signs presented higher prevalences of 24.4% and 17%, respectively, while 50% of cats with gastrointestinal signs were seropositive. The present study confirms the seropositivity of D. immitis in the feline population in central and northern Portugal, and suggests the importance of including heartworm disease in the list of differential diagnoses of cats and dogs showing clinical signs compatible with the disease. PMID:24824176

  8. Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management

    Directory of Open Access Journals (Sweden)

    Loftus JP

    2014-12-01

    Full Text Available John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is associated with dermatological issues, diabetes mellitus, neoplasia, and urolithiasis. The health issues appear to be slightly different across the two species, which may be due to some inherent differences in the hormonal milieu involved in obesity that differs between the dog and the cat. In this review, we discuss the complicated nature of the pathogenesis of obesity, the hormonal stimulus for orexigenic and anorexigenic behavior, adipose tissue as an endocrine organ, and most importantly, clinical management of the number one disease in canine and feline medicine.Keywords: obesity, canine, feline, veterinary

  9. Canine visceral leishmaniasis on Margarita Island (Nueva Esparta, Venezuela).

    Science.gov (United States)

    Zerpa, O; Ulrich, M; Negrón, E; Rodríguez, N; Centeno, M; Rodríguez, V; Barrios, R M; Belizario, D; Reed, S; Convit, J

    2000-01-01

    The frequency of American visceral leishmaniasis affecting humans on Margarita Island, Venezuela, has increased in recent years, and infected dogs appear to constitute the principal source of infection. ELISA tests with Leishmania donovani promastigotes and rK39 antigen from L. chagasi in serum from 541 dogs were positive in 33.1% and 21.6% of the samples, respectively. A second blood sample taken from 50 animals after 8-10 months revealed an increase from 24% to 40% of ELISA positivity to both antigens, suggesting high susceptibility and transmission in the canine population. Among 42 serologically positive dogs, 33% of which showed clinical signs of disease, 79% were positive in polymerase chain reactions using primers specific for the L. donovani complex. Control measures including epidemiological hypersurveillance, the humane sacrifice of infected dogs, and rapid diagnosis and treatment of human cases have been initiated. PMID:11132371

  10. EGFR and microvessel density in canine malignant mammary tumours.

    Science.gov (United States)

    Carvalho, Maria Isabel; Guimarães, Maria João; Pires, Isabel; Prada, Justina; Silva-Carvalho, Ricardo; Lopes, Carlos; Queiroga, Felisbina L

    2013-12-01

    The epidermal growth factor receptor (EGFR) is a transmembrane tyrosine kinase receptor which has been shown to have an important role in human breast cancer. Its role appears to be associated with increased angiogenesis and metastasis. In order to clarify its role in canine mammary tumours (CMT), 61 malignant neoplasms were studied by using immunohistochemistry, comparing expression of EGFR, microvessel density (MVD) by CD31 immunolabelling and characteristics of tumour aggressiveness. High EGFR immunoexpression was statistically significantly associated with tumour size, tumour necrosis, mitotic grade, histological grade of malignancy and clinical stage. High CD31 immunoreactivity was statistically significantly associated with tubule formation, histological grade of malignancy and clinical stage. A positive correlation between EGFR and CD31 immunoexpression (r = 0.843; P aggression in malignant CMT, presenting the possibility of using EGFR inhibitors in the context of metastatic disease treatment. PMID:24091029

  11. KRAS Mutations in Canine and Feline Pancreatic Acinar Cell Carcinoma.

    Science.gov (United States)

    Crozier, C; Wood, G A; Foster, R A; Stasi, S; Liu, J H W; Bartlett, J M S; Coomber, B L; Sabine, V S

    2016-07-01

    Companion animals may serve as valuable models for studying human cancers. Although KRAS is the most commonly mutated gene in human ductal pancreatic cancers (57%), with mutations frequently occurring at codons 12, 13 and 61, human pancreatic acinar cell carcinomas (ACCs) lack activating KRAS mutations. In the present study, 32 pancreatic ACC samples obtained from 14 dogs and 18 cats, including seven metastases, were analyzed for six common activating KRAS mutations located in codons 12 (n = 5) and 13 (n = 1) using Sequenom MassARRAY. No KRAS mutations were found, suggesting that, similar to human pancreatic ACC, KRAS mutations do not play a critical role in feline or canine pancreatic ACC. Due to the similarity of the clinical disease in dogs and cats to that of man, this study confirms that companion animals offer potential as a suitable model for investigating this rare subtype of pancreatic carcinoma. PMID:27290644

  12. Evidence supporting the conceptual framework of cancer chemoprevention in canines.

    Science.gov (United States)

    Kondratyuk, Tamara P; Adrian, Julie Ann Luiz; Wright, Brian; Park, Eun-Jung; van Breemen, Richard B; Morris, Kenneth R; Pezzuto, John M

    2016-01-01

    As with human beings, dogs suffer from the consequences of cancer. We investigated the potential of a formulation comprised of resveratrol, ellagic acid, genistein, curcumin and quercetin to modulate biomarkers indicative of disease prevention. Dog biscuits were evaluated for palatability and ability to deliver the chemopreventive agents. The extent of endogenous DNA damage in peripheral blood lymphocytes from dogs given the dietary supplement or placebo showed no change. However, H2O2-inducible DNA damage was significantly decreased after consumption of the supplement. The expression of 11 of 84 genes related to oxidative stress was altered. Hematological parameters remained in the reference range. The concept of chemoprevention for the explicit benefit of the canine is compelling since dogs are an important part of our culture. Our results establish a proof-of-principle and provide a framework for improving the health and well-being of "man's best friend". PMID:27216246

  13. Canine pemphigus foliaceus with concurrent immune-mediated thrombocytopenia.

    Science.gov (United States)

    Kawarai, Shinpei; Hisasue, Masaharu; Matsuura, Shinobu; Ito, Tetsuro; Inoue, Yukari; Neo, Sakurako; Fujii, Yoko; Madarame, Hiroo; Shirota, Kinji; Tsuchiya, Ryo

    2015-01-01

    A 3 yr old wirehaired fox terrier was presented to his primary care veterinarian with fever, thrombocytopenia, and generalized crusting dermatitis. The skin lesion had progressed for at least 18 days, and thrombocytopenia had developed 3 days before presentation. Histopathology and direct immunofluorescence studies of the skin were consistent with pemphigus foliaceus (PF). Immunofluorescence revealed immunoglobulin G deposition around the keratinocytes in the stratum spinosum. A diagnosis of immune-mediated thrombocytopenia (IMT) was confirmed by the presence of platelet surface-associated immunoglobulin using flow cytometry. Systemic immunosuppressive therapy with cyclosporine and azathioprine was effective, and the dog survived for >2 years from the initial presentation. IMT is rarely associated with PF. This appears to be the first detailed report of a definitive diagnosis of concurrent PF and IMT in a dog. The authors' findings indicate that canine PF could be complicated by hematologic immune-mediated diseases such as IMT. PMID:25415212

  14. Canine visceral leishmaniasis in Sicily.

    Science.gov (United States)

    Orndorff, G R; Cooper, B A; Smith, W; Ryan, J R

    2000-01-01

    The Sicilian province of Catania is an active foci for human visceral leishmaniasis (VL) in the Mediterranean area. Approximately 10 to 15 cases of VL are diagnosed via hospital admissions each year in this community. Recently, an increase in VL case reporting by Sicilian physicians was noted, with 38 and 37 VL cases in 1996 and 1997, respectively. Before 1995, there were no reported VL cases among U.S. military personnel or their family members living in Sicily. However, since 1996, there have been four cases referred to Walter Reed Army Medical Center for diagnosis and treatment, all involving the children of personnel assigned to Naval Air Station Sigonella. Exposure histories for all infected individuals excluded exposure to Leishmania parasites outside of Sicily. All patients lived in areas where vectoring sandflies are present. All had dogs as family pets. To evaluate the level of infection among dogs owned by Navy personnel and their families, U.S. Navy Environmental and Preventive Medicine Unit 7, in a collaborative study with the U.S. Army Veterinary Clinic, Naval Air Station Sigonella, and the Walter Reed Army Institute of Research, performed clinical evaluation and serological testing of 50 dogs residing with U.S. personnel assigned to Naval Air Station Sigonella. The data indicate a high exposure rate to Leishmania (60% of the animals tested had elevated immunoglobulin M antibody levels) in the study population, suggesting that they were infected with Leishmania infantum. Distribution of seropositive dogs by sex was equal. Most of the dogs studied appeared to be in good health. However, inapparent infection of dogs, seen by Italian veterinarians, has been observed throughout all areas of Catania. Sandflies responsible for vectoring L. infantum were trapped in the same locations as the dogs sampled in this study. The level of subclinical infection was 75% among seropositive dogs. The overall level of canine infection observed was higher than expected

  15. Effects of canine serum collected from dogs at different estrous cycle stages on in vitro nuclear maturation of canine oocytes.

    Science.gov (United States)

    Oh, Hyun Ju; Fibrianto, Yuda Heru; Kim, Min Kyu; Jang, Goo; Hossein, M Shamim; Kim, Hye Jin; Kang, Sung Keun; Lee, Byeong Chun; Hwang, Woo Suk

    2005-08-01

    Canine oocytes are ovulated at prophase of the first meiotic division and undergo maturation in the distal part of the oviduct for at least 48-72 h. Because of these differences from other domestic mammals, the efficiency of in vitro maturation (IVM) of canine oocyte is very low. The present study was conducted to evaluate the effects of canine serum on IVM of canine oocytes recovered from ovaries in various reproductive states (follicular, luteal or anestrous stages). Oocytes were recovered by mincing ovaries from bitches presented for ovariohysterectomy at various stages of the estrous cycle. Heat-inactivated canine serum was prepared with blood taken from dogs at the anestrous, estrous or diestrous stage of the estrous cycle as determined by progesterone concentration and vaginal cytology. Oocytes were cultured for 72 h in tissue culture medium (TCM)-199 supplemented with 10% canine anestrous, estrous or diestrous serum or fetal bovine serum (FBS) (experiment 1), or supplemented with 0 (control), 5%, 10% or 20% canine estrous serum (experiment 2). In experiment 1, IVM of oocytes collected at the follicular stage of the estrous cycle to metaphase II (MII) stage was higher (p < 0.05) with canine estrous serum (14.2%) than with canine anestrous (5.2%) or diestrous serum (6.3%), FBS (2.2%) or in the control (2.2%). In experiment 2, oocytes collected at the follicular stage of the estrous cycle cultured in TCM-199 with 10% canine estrous serum showed a higher maturation rate to MII stage (13.5%, p < 0.05) compared with those cultured with 5% (1.3% MII) or 20% canine estrous serum (5.1% MII) or the control (2.7% MII). In conclusion, our results demonstrate that supplementing culture medium with 10% canine estrous serum improves IVM of canine follicular stage oocytes. PMID:16261767

  16. Combined orthodontic-surgical management of a transmigrated mandibular canine.

    Science.gov (United States)

    Cavuoti, Serena; Matarese, Giovanni; Isola, Gaetano; Abdolreza, Jamilian; Femiano, Felice; Perillo, Letizia

    2016-07-01

    The presence of an impacted mandibular canine is one of the most difficult challenges that an orthodontist will meet. Orthodontic treatment is planned on an individual basis after thoroughly considering the patient's overall facial and dentoskeletal characteristics; the duration, risks, and costs of treatment; patient preferences; and the orthodontist's experience. This article reports an orthodontic treatment of a boy, age 12.9 years, with an impacted mandibular canine in the permanent dentition that was successfully managed. Radiographic analysis indicated a transmigration of the mandibular right canine. The orthodontic treatment plan included extraction of the deciduous right canine followed by surgical exposure and ligation of the permanent canine. Eruption was properly guided, and the correct position of the tooth was achieved. This challenging treatment approach is described in detail, including the mechanics used to align the impacted canine. PMID:26502299

  17. Bi-rooted Primary Maxillary Canines: A Case Report

    OpenAIRE

    2010-01-01

    This report presents a rare case of bi-rooted primary maxillary canines. A 6-year-old girl presented at the Department of Pediatric Dentistry, Faculty of Dentistry, Mashhad University of Medical Sciences, Iran, with the chief complaint of pain in the lower right quadrant of her dentition. Radiographic examination revealed bifurcation of primary maxillary canine roots. This report discusses the possible etiology of bi-rooted canines, implications for the developing dentition, and treatment opt...

  18. Portrait of a Canine Probiotic – from Gut to Gut

    OpenAIRE

    O'Mahony, D.; Murphy, K. Barry; MacSharry, J.; Boileau, T.; Sunvold, G.; Reinhart, G.; Kiely, B.; Shanahan, F; O'Mahony, L.

    2009-01-01

    Abstract The gastrointestinal environment is a complex interactive system involving the host, ingested dietary components, and numerous microbial species. We hypothesised that isolation and screening of Lactobacilli and Bifidobacteria adherent to healthy canine gastrointestinal tissue would yield strains with commensal activity in canines. The aims of this study were 1) to isolate a bank of commensal organisms from the canine gastrointestinal tract; 2) to screen these novel microbi...

  19. Canine oral biofilms: Cultural, molecular, and in vitro studies.

    OpenAIRE

    Elliott, D. R.

    2006-01-01

    The canine oral microbiota is poorly understood compared to that of humans. The aim of this work was to improve understanding of the canine oral microbiota. This was achieved by surveying the canine oral microbiota, determining coaggregation interactions between its members, and developing a laboratory microcosm. Bacteria were isolated from the dental plaque and saliva of dogs, and isolates were identified by comparative 16S rRNA gene sequencing. From 339 isolates, 84 phylotypes belonging to ...

  20. Use of a simple DNA extraction method for high-throughput detection of filarial parasite Wuchereria bancrofti in the vector mosquitoes.

    Science.gov (United States)

    Vasuki, V; Subramanian, S; Hoti, S L; Jambulingam, P

    2012-12-01

    Molecular xenomonitoring of filariasis is the detection of filarial DNA in mosquitoes by PCR and a useful tool for monitoring transmission. DNA extraction coupled with PCR allows rapid detection of the presence or absence of the filarial parasite in vector mosquitoes compared to traditional method of manual dissection of the mosquito and observation for parasite under a microscope. A Tris-EDTA (TE) buffer-based boiling method of DNA extraction developed earlier by us was employed and explored for its suitability in the detection of Wuchereria bancrofti DNA in pools of Culex quinquefasciatus mosquitoes in real-time PCR assay. In this preliminary study, 1,000 laboratory-reared C. quinquefasciatus were made into 40 pools, each containing 25 mosquitoes spiked with 2mf. DNA from the first 20 pools was extracted using Qiagen DNeasy blood and tissue kit as standard, and the other 20 pools were subjected to TE buffer-based boiling method of DNA extraction. When the results (Ct values) obtained for DNA samples extracted by TE buffer-based boiling method were compared with that of the DNA samples extracted by the standard Qiagen method, they were found to be highly concordant without any significant difference (P = 0.9). Besides being cost- and time-effective, this protocol was found useful in extracting filarial DNA from two other mosquito genus Aedes and Anopheles, species of which have been reported as important vectors of W. bancrofti in other endemic regions of the world. Thus, TE buffer-based boiling method of DNA extraction is useful for the high-throughput detection of W. bancrofti in vector mosquitoes. PMID:22777703

  1. The Development of a Recombinant scFv Monoclonal Antibody Targeting Canine CD20 for Use in Comparative Medicine.

    Science.gov (United States)

    Jain, Saurabh; Aresu, Luca; Comazzi, Stefano; Shi, Jianguo; Worrall, Erin; Clayton, John; Humphries, William; Hemmington, Sandra; Davis, Paul; Murray, Euan; Limeneh, Asmare A; Ball, Kathryn; Ruckova, Eva; Muller, Petr; Vojtesek, Borek; Fahraeus, Robin; Argyle, David; Hupp, Ted R

    2016-01-01

    Monoclonal antibodies are leading agents for therapeutic treatment of human diseases, but are limited in use by the paucity of clinically relevant models for validation. Sporadic canine tumours mimic the features of some human equivalents. Developing canine immunotherapeutics can be an approach for modeling human disease responses. Rituximab is a pioneering agent used to treat human hematological malignancies. Biologic mimics that target canine CD20 are just being developed by the biotechnology industry. Towards a comparative canine-human model system, we have developed a novel anti-CD20 monoclonal antibody (NCD1.2) that binds both human and canine CD20. NCD1.2 has a sub-nanomolar Kd as defined by an octet red binding assay. Using FACS, NCD1.2 binds to clinically derived canine cells including B-cells in peripheral blood and in different histotypes of B-cell lymphoma. Immunohistochemical staining of canine tissues indicates that the NCD1.2 binds to membrane localized cells in Diffuse Large B-cell lymphoma, Marginal Zone Lymphoma, and other canine B-cell lymphomas. We cloned the heavy and light chains of NCD1.2 from hybridomas to determine whether active scaffolds can be acquired as future biologics tools. The VH and VL genes from the hybridomas were cloned using degenerate primers and packaged as single chains (scFv) into a phage-display library. Surprisingly, we identified two scFv (scFv-3 and scFv-7) isolated from the hybridoma with bioactivity towards CD20. The two scFv had identical VH genes but different VL genes and identical CDR3s, indicating that at least two light chain mRNAs are encoded by NCD1.2 hybridoma cells. Both scFv-3 and scFv-7 were cloned into mammalian vectors for secretion in CHO cells and the antibodies were bioactive towards recombinant CD20 protein or peptide. The scFv-3 and scFv-7 were cloned into an ADEPT-CPG2 bioconjugate vector where bioactivity was retained when expressed in bacterial systems. These data identify a recombinant anti-CD20

  2. The Development of a Recombinant scFv Monoclonal Antibody Targeting Canine CD20 for Use in Comparative Medicine

    Science.gov (United States)

    Jain, Saurabh; Aresu, Luca; Comazzi, Stefano; Shi, Jianguo; Worrall, Erin; Clayton, John; Humphries, William; Hemmington, Sandra; Davis, Paul; Murray, Euan; Limeneh, Asmare A.; Ball, Kathryn; Ruckova, Eva; Muller, Petr; Vojtesek, Borek; Fahraeus, Robin; Argyle, David; Hupp, Ted R.

    2016-01-01

    Monoclonal antibodies are leading agents for therapeutic treatment of human diseases, but are limited in use by the paucity of clinically relevant models for validation. Sporadic canine tumours mimic the features of some human equivalents. Developing canine immunotherapeutics can be an approach for modeling human disease responses. Rituximab is a pioneering agent used to treat human hematological malignancies. Biologic mimics that target canine CD20 are just being developed by the biotechnology industry. Towards a comparative canine-human model system, we have developed a novel anti-CD20 monoclonal antibody (NCD1.2) that binds both human and canine CD20. NCD1.2 has a sub-nanomolar Kd as defined by an octet red binding assay. Using FACS, NCD1.2 binds to clinically derived canine cells including B-cells in peripheral blood and in different histotypes of B-cell lymphoma. Immunohistochemical staining of canine tissues indicates that the NCD1.2 binds to membrane localized cells in Diffuse Large B-cell lymphoma, Marginal Zone Lymphoma, and other canine B-cell lymphomas. We cloned the heavy and light chains of NCD1.2 from hybridomas to determine whether active scaffolds can be acquired as future biologics tools. The VH and VL genes from the hybridomas were cloned using degenerate primers and packaged as single chains (scFv) into a phage-display library. Surprisingly, we identified two scFv (scFv-3 and scFv-7) isolated from the hybridoma with bioactivity towards CD20. The two scFv had identical VH genes but different VL genes and identical CDR3s, indicating that at least two light chain mRNAs are encoded by NCD1.2 hybridoma cells. Both scFv-3 and scFv-7 were cloned into mammalian vectors for secretion in CHO cells and the antibodies were bioactive towards recombinant CD20 protein or peptide. The scFv-3 and scFv-7 were cloned into an ADEPT-CPG2 bioconjugate vector where bioactivity was retained when expressed in bacterial systems. These data identify a recombinant anti-CD20

  3. New aspects of canine pyometra

    OpenAIRE

    Hagman, Ragnvi

    2004-01-01

    Pyometra is a common and lethal disease in bitches characterised by uterine bacterial infection leading to subsequent systemic illness. The objectives of the present thesis were to investigate the incidence of the disease in relation to breed and age, to assess bacteriological aspects of pyometra and to evaluate the involvement of endotoxin and prostaglandin F2α in the pathogenesis. Animal insurance data revealed age- and breed-dependent differences in the incidence of pyometra. On average 23...

  4. Low Titers of Canine Distemper Virus Antibody in Wild Fishers (Martes pennanti) in the Eastern USA.

    Science.gov (United States)

    Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L

    2016-01-01

    Canine distemper virus (CDV) infects species in the order Carnivora. Members of the family Mustelidae are among the species most susceptible to CDV and have a high mortality rate after infection. Assessing an animal's pathogen or disease load prior to any reintroduction project is important to help protect the animal being reintroduced, as well as the wildlife and livestock in the area of relocation. We screened 58 fishers for CDV antibody prior to their release into Pennsylvania, US, as part of a reintroduction program. Five of the 58 (9%) fishers had a weak-positive reaction for CDV antibody at a dilution of 1:16. None of the fishers exhibited any clinical sign of canine distemper while being held prior to release. PMID:26555109

  5. New insights into the evolution of Wolbachia infections in filarial nematodes inferred from a large range of screened species.

    Directory of Open Access Journals (Sweden)

    Emanuele Ferri

    Full Text Available BACKGROUND: Wolbachia are intriguing symbiotic endobacteria with a peculiar host range that includes arthropods and a single nematode family, the Onchocercidae encompassing agents of filariases. This raises the question of the origin of infection in filariae. Wolbachia infect the female germline and the hypodermis. Some evidences lead to the theory that Wolbachia act as mutualist and coevolved with filariae from one infection event: their removal sterilizes female filariae; all the specimens of a positive species are infected; Wolbachia are vertically inherited; a few species lost the symbiont. However, most data on Wolbachia and filaria relationships derive from studies on few species of Onchocercinae and Dirofilariinae, from mammals. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the Wolbachia distribution testing 35 filarial species, including 28 species and 7 genera and/or subgenera newly screened, using PCR, immunohistochemical staining, whole mount fluorescent analysis, and cocladogenesis analysis. (i Among the newly screened Onchocercinae from mammals eight species harbour Wolbachia but for some of them, bacteria are absent in the hypodermis, or in variable density. (ii Wolbachia are not detected in the pathological model Monanema martini and in 8, upon 9, species of Cercopithifilaria. (iii Supergroup F Wolbachia is identified in two newly screened Mansonella species and in Cercopithifilaria japonica. (iv Type F Wolbachia infect the intestinal cells and somatic female genital tract. (v Among Oswaldofilariinae, Waltonellinae and Splendidofilariinae, from saurian, anuran and bird respectively, Wolbachia are not detected. CONCLUSIONS/SIGNIFICANCE: The absence of Wolbachia in 63% of onchocercids, notably in the ancestral Oswaldofilariinae estimated 140 mya old, the diverse tissues or specimens distribution, and a recent lateral transfer in supergroup F Wolbachia, modify the current view on the role and evolution of the endosymbiont and their

  6. A deep sequencing approach to comparatively analyze the transcriptome of lifecycle stages of the filarial worm, Brugia malayi.

    Directory of Open Access Journals (Sweden)

    Young-Jun Choi

    2011-12-01

    Full Text Available BACKGROUND: Developing intervention strategies for the control of parasitic nematodes continues to be a significant challenge. Genomic and post-genomic approaches play an increasingly important role for providing fundamental molecular information about these parasites, thus enhancing basic as well as translational research. Here we report a comprehensive genome-wide survey of the developmental transcriptome of the human filarial parasite Brugia malayi. METHODOLOGY/PRINCIPAL FINDINGS: Using deep sequencing, we profiled the transcriptome of eggs and embryos, immature (≤3 days of age and mature microfilariae (MF, third- and fourth-stage larvae (L3 and L4, and adult male and female worms. Comparative analysis across these stages provided a detailed overview of the molecular repertoires that define and differentiate distinct lifecycle stages of the parasite. Genome-wide assessment of the overall transcriptional variability indicated that the cuticle collagen family and those implicated in molting exhibit noticeably dynamic stage-dependent patterns. Of particular interest was the identification of genes displaying sex-biased or germline-enriched profiles due to their potential involvement in reproductive processes. The study also revealed discrete transcriptional changes during larval development, namely those accompanying the maturation of MF and the L3 to L4 transition that are vital in establishing successful infection in mosquito vectors and vertebrate hosts, respectively. CONCLUSIONS/SIGNIFICANCE: Characterization of the transcriptional program of the parasite's lifecycle is an important step toward understanding the developmental processes required for the infectious cycle. We find that the transcriptional program has a number of stage-specific pathways activated during worm development. In addition to advancing our understanding of transcriptome dynamics, these data will aid in the study of genome structure and organization by facilitating

  7. Efficacy of three-week oxytetracycline or rifampin monotherapy compared with a combination regimen against the filarial nematode Onchocerca ochengi.

    Science.gov (United States)

    Bah, Germanus S; Ward, Emma L; Srivastava, Abhishek; Trees, Alexander J; Tanya, Vincent N; Makepeace, Benjamin L

    2014-01-01

    Onchocerciasis (river blindness), caused by the filarial nematode Onchocerca volvulus, is a major cause of visual impairment and dermatitis in sub-Saharan Africa. As O. volvulus contains an obligatory bacterial symbiont (Wolbachia), it is susceptible to antibiotic chemotherapy, although current regimens are considered too prolonged for community-level control programs. The aim of this study was to compare the efficacies of oxytetracycline and rifampin, administered separately or in combination, against a close relative of O. volvulus (Onchocerca ochengi) in cattle. Six animals per group were treated with continuous or intermittent oxytetracycline regimens, and effects on adult worm viability, dermal microfilarial loads, and Wolbachia density in worm tissues were assessed. Subsequently, the efficacies of 3-week regimens of oxytetracycline and rifampin alone and a combination regimen were compared, and rifampin levels in plasma and skin were quantified. A 6-month regimen of oxytetracycline with monthly dosing was strongly adulticidal, while 3-week and 6-week regimens exhibited weaker adulticidal effects. However, all three regimens achieved >2-log reductions in microfilarial load. In contrast, rifampin monotherapy and oxytetracycline-rifampin duotherapy failed to induce substantive reductions in either adult worm burden or microfilarial load, although a borderline effect on Wolbachia density was observed following duotherapy. Dermal rifampin levels were maintained above the MIC for >24 h after a single intravenous dose. We conclude that oxytetracycline-rifampin duotherapy is less efficacious against O. ochengi than oxytetracycline alone. Further studies will be required to determine whether rifampin reduces oxytetracycline bioavailability in this system, as suggested by human studies using other tetracycline-rifampin combinations. PMID:24247133

  8. Molecular and functional characterization of macrophage migration inhibitory factor (MIF) homolog of human from lymphatic filarial parasite Wuchereria bancrofti.

    Science.gov (United States)

    Sharma, Rohit; Hoti, S L; Meena, R L; Vasuki, V; Sankari, T; Kaliraj, P

    2012-11-01

    The ability of nematode parasites to survive in a highly complex immune system involves diverse strategies including production of a variety of host immune modulators. Various parasite-associated surface antigens or excretory and secretory products may possibly play a role in the host-parasite interactions and successful survival of parasite in their respective host. One among these molecules is a human cytokine homolog, macrophage migration inhibitory factor-1 (MIF-1) in various parasites. We identified a homolog of this cytokine from human lymphatic filarial parasite, Wuchereria bancrofti, expression cloned and investigated its molecular characteristics and catalytic properties. We also assessed the humoral reactivity of the recombinant MIF-1 of W. bancrofti (rWb-MIF-1) against sera belonging to different categories of individuals viz. microfilaremic, chronic patients, endemic normal, and non-endemic normal. Our results showed that the complete coding sequence of W. bancrofti is 1,078 bp, comprising two introns and three exons: first and second introns being 577 and 153 bp long, while the three exons I, II, and III being 108, 173, and 67 bp long, respectively. The rWb-MIF-1 was overexpressed in a salt-inducible host, Escherichia coli GJ 1158, and its functional activity was determined by dopachrome tautomerase and insulin reduction assays. The results of both the assays showed that the purified protein is functionally active and hence folded appropriately. The rWb-MIF-1 protein did not show elevation of specific IgG4 antibodies in microfilaremic cases, a hallmark in case of lymphatic filariasis, while it showed IgE reactivity in some of these cases (five out of ten). PMID:22875393

  9. Identification and biochemical characterization of macrophage migration inhibitory factor-2 (MIF-2) homologue of human lymphatic filarial parasite, Wuchereria bancrofti.

    Science.gov (United States)

    Chauhan, Nikhil; Sharma, Rohit; Hoti, S L

    2015-02-01

    Homologues of human macrophage migration inhibitory factor (hMIF) have been reported from vertebrates, invertebrates and prokaryotes, as well as plants. Filarial parasites produce two homologues of hMIF viz., MIF-1 and MIF-2, which play important role in the host immune modulation. Earlier, we have characterized MIF-1 (Wba-mif-1) from Wuchereria bancrofti, the major causal organism of human lymphatic filariasis. Here, we are reporting the molecular and biochemical characterization of MIF-2 from this parasite (Wba-mif-2). The complete Wba-mif-2 gene and its cDNA were amplified, cloned and sequenced. The size of Wba-mif-2 gene and cDNA were found to be 4.275 kb and 363 bp, respectively. The gene annotation revealed the presence of a large intron of 3.912 kb interspersed with two exons of 183 bp and 180 bp. The alignment of derived amino acid sequences of Wba-MIF-2 with Wba-MIF-1 showed 44% homology. The conserved CXXC oxido-reductase catalytic site present in Wba-mif-1 was found absent in Wba-mif-2 coding sequence. The amplified Wba-mif-2 cDNA was cloned into an expression vector pRSET-B and transformed into salt inducible Escherichia coli strain GJ1158. The expressed recombinant Wba-MIF-2 protein showed tautomerase activity against L-dopachrome methyl ester and the specific activity was determined to be 18.57±0.77 μmol/mg/min. Three known inhibitors of hMIF tautomerase activity significantly inhibited the tautomerase activity of recombinant Wba-MIF-2. Although the conserved CXXC oxido-reductase motif is absent in Wba-mif-2, the recombinant protein showed significant oxido-reductase activity in the insulin reduction assay, possibly because of the presence of vicinal cysteine residues. PMID:25446175

  10. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette;

    2010-01-01

    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  11. Antigenic typing Polish isolates of canine parvovirus

    International Nuclear Information System (INIS)

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs

  12. Myoepithelial cells in canine mammary tumours.

    Science.gov (United States)

    Sánchez-Céspedes, Raquel; Millán, Yolanda; Guil-Luna, Silvia; Reymundo, Carlos; Espinosa de Los Monteros, Antonio; Martín de Las Mulas, Juana

    2016-01-01

    Mammary tumours are the most common neoplasms of female dogs. Compared to mammary tumours of humans and cats, myoepithelial (ME) cell involvement is common in canine mammary tumours (CMT) of any subtype. Since ME cell involvement in CMT influences both histogenetic tumour classification and prognosis, correct identification of ME cells is important. This review describes immunohistochemical methods for identification of canine mammary ME cells used in vivo. In addition, phenotypic and genotypic methods to isolate ME cells for in vitro studies to analyse tumour-suppressor protein production and gene expression are discussed. The contribution of ME cells to both histogenetic classifications and the prognosis of CMT is compared with other species and the potential use of ME cells as a method to identify carcinoma in situ is discussed. PMID:26639832

  13. Characterization of pantropic canine coronavirus from Brazil.

    Science.gov (United States)

    Pinto, Luciane D; Barros, Iracema N; Budaszewski, Renata F; Weber, Matheus N; Mata, Helena; Antunes, Jéssica R; Boabaid, Fabiana M; Wouters, Angélica T B; Driemeier, David; Brandão, Paulo E; Canal, Cláudio W

    2014-12-01

    Characterization of canine coronavirus (CCoV) strains currently in circulation is essential for understanding viral evolution. The aim of this study was to determine the presence of pantropic CCoV type IIa in tissue samples from five puppies that died in Southern Brazil as a result of severe gastroenteritis. Reverse-transcriptase PCR was used to generate amplicons for sequence analysis. Phylogenetic analysis of the CCoV-IIa strains indicated that they were similar to those found in other countries, suggesting a common ancestor of these Brazilian isolates. This is the first report of pantropic CCoV-II in puppies from Latin America and our findings highlight that CCoV should be included as a differential diagnosis when dogs present with clinical signs and lesions typically seen with canine parvovirus infection. PMID:25294661

  14. Antigenic typing Polish isolates of canine parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)

    1995-12-31

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

  15. Chemokine receptor 7 (CCR7)-expression and IFNγ production define vaccine-specific canine T-cell subsets.

    Science.gov (United States)

    Hartley, Ashley N; Tarleton, Rick L

    2015-04-15

    Canines suffer from and serve as strong translational animals models for many immunological disorders and infectious diseases. Routine vaccination has been a mainstay of protecting dogs through the stimulation of robust antibody responses and expansion of memory T-cell populations. Commercially available reagents and described techniques are limited for identifying and characterizing canine T-cell subsets and evaluating T-cell-specific effector function. To define reagents for delineating naïve versus activated T-cells and identify antigen-specific T-cells, we tested anti-human and anti-bovine T-cell specific cell surface marker reagents for cross-reactivity with canine peripheral blood mononuclear cells (PBMCs. Both CD4(+) and CD8(+) T-cells from healthy canine donors showed reactivity to CCL19-Ig, a CCR7 ligand, and coexpression with CD62L. An in vitro stimulation with concanavalin A validated downregulation of CCR7 and CD62L expression on stimulated healthy control PBMCs, consistent with an activated T-cell phenotype. Anti-IFNγ antibodies identified antigen-specific IFNγ-producing CD4(+) and CD8(+) T-cells upon in vitro vaccine antigen PBMC stimulation. PBMC isolation within 24h of sample collection allowed for efficienT-cell recovery and accurate T-cell effector function characterization. These data provide a reagent and techniques platform via flow cytometry for identifying canine T-cell subsets and characterizing circulating antigen-specific canine T-cells for potential use in diagnostic and field settings. PMID:25758065

  16. Socio-cultural practices of deciduous canine tooth bud removal among Maasai children.

    Science.gov (United States)

    Mutai, J; Muniu, E; Sawe, J; Hassanali, J; Kibet, P; Wanzala, P

    2010-04-01

    The removal of teeth amongst the Maasai is a traditional practice as part of an initiation or to make space for feeding in an event of diseases locking the jaw. Removal of deciduous canine tooth buds (DCB) among infants below 2 years has been reported in several studies to be common mainly amongst communities in East Africa, Ethiopia and Sudan. The main reason for the practice revolves around the belief that tooth buds or 'maggots' are false teeth, nylon or worms and are responsible for diarrhoea, vomiting, fever and growth retardation in children, amongst other illnesses. The main objective of this study was to assess the socio-cultural factors which contribute to this practice. The main methods of data collected included Focus Group Discussions (FGD) with mothers of children in that age group and Traditional Birth Attendants (TBA). In-depth interviews (IDI)were conducted with key informants versed with Maasai traditions whereas observations were done within the manyattas where participants live. Proceedings at both the FGD and the IDI were recorded on paper and were analysed thematically. The study showed that the removal of canine tooth buds amongst children that started initially with calves--that diseases that cause diarrhoea in calves were brought about by the canine tooth buds that were turning reddish in colour--is deeply rooted and practised in the community despite sensitisation interventions mounted jointly by the University of Nairobi, Kenya Medical Research Institute and the Kenya Medical Training College, among others. This study discovered that canine tooth buds are associated with bad spirits that cause diarrhoea and vomiting and the belief that removing them is a sure way of providing a cure for all children's ailments. PMID:20476714

  17. Eliminating canine rabies, the principal source of human infection: what will it take?

    Science.gov (United States)

    Meslin, F-X; Briggs, D J

    2013-05-01

    More than 50,000 people die of rabies each year; most are children in developing countries, and almost all have been bitten by dogs. Eliminating canine rabies throughout the world would save thousands of lives and would reduce the economic impact of the disease by dramatically reducing the requirement for postexposure prophylaxis (PEP). Lengthy experience in the industrialized countries and ongoing programs in Latin America, Africa, and Asia have shown that the elimination of rabies in dogs is an achievable goal. The presence of canine rabies in developing countries is associated with poverty, and most deaths occur in the lowest socioeconomic sectors. To be successful, national rabies control programs should share responsibility with local communities for prevention and control activities and maintaining disease-free status. Legislation should be adapted to local conditions and the realities of dog ownership. While the provision of PEP to all bite victims is affordable in many countries, it is usually beyond the capacity of impoverished nations, which deal with many other health priorities. Ministries of health should provide PEP, either free or with a charge preferably at a subsidized price, replacing the current system in many countries, in which biologics are sold by government-owned and private clinics at a cost beyond the means of bite victims. The public health sector should assume responsibility when animal control strategies are not effectively implemented or when PEP is not administered correctly or is not available. A global strategy is needed to identify gaps in surveillance and diagnosis, improve access to PEP and enhance canine immunization and population management. Such approaches based on a "One Health" model should be coordinated across regions, and should extend control efforts to other dog-related zoonoses. This article introduces a symposium in Antiviral Research on the elimination of canine rabies. PMID:23523768

  18. Extrusion processing : effects on dry canine diets

    OpenAIRE

    Tran, Q.D.

    2008-01-01

    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying. Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the nutritional and physical quality of the product. Effects of extrusion on the feed quality for other animals than pets have been well recognized. Our studies investigated to what extent extrusion and/or drying of a c...

  19. Remote detection of explosives using trained canines

    International Nuclear Information System (INIS)

    Use of dogs is a search method which combines high probability of detection, speed of search, and low cost. It was concluded that the canine could be used for explosive screening of personnel, but that it was imperative that the dog be in a position remote from employees and employee traffic. A study was made of the design of booths and air flow for this purpose. Results of tests and conclusions are given and discussed

  20. Cardiac troponin I levels in canine pyometra

    OpenAIRE

    Hagman Ragnvi; Lagerstedt Anne-Sofie; Fransson Boel A; Bergström Annika; Häggström Jens

    2007-01-01

    Abstract Background Myocardial injury may contribute to unexpected deaths due to pyometra. To detect myocardial damage, measurement of cardiac troponin I (cTnI) is currently the most sensitive and specific method. The aims of the present study were to evaluate presence of myocardial damage in canine pyometra by analysis of cTnI, to explore whether myocardial injury was associated with systemic inflammatory response syndrome (SIRS) and to evaluate whether other clinical or laboratory parameter...

  1. Hormonal change and cytokine mRNA expression in peripheral blood mononuclear cells during the development of canine autoimmune thyroiditis.

    Science.gov (United States)

    Choi, E-W; Shin, I-S; Bhang, D-H; Lee, D-H; Bae, B-K; Kang, M-S; Kim, D-Y; Hwang, C-Y; Lee, C-W; Youn, H-Y

    2006-10-01

    To elucidate the hormonal change and alteration in cytokine expression in peripheral blood mononuclear cells (PBMC) during the early stage of autoimmune thyroiditis, we have developed a canine model of this disease, in which normal dogs were immunized with bovine thyroglobulin (Tg) and/or canine thyroid extract. Serum samples were collected weekly, anti-canine Tg antibody was measured by enzyme-linked immunosorbent assay (ELISA) and thyroid stimulating hormone (TSH) and total T4 levels by radioimmunoassay. We also assayed T lymphocyte proliferation in response to Tg, as well as measuring cytokine mRNA by semiquantitative reverse transcription-polymerase chain reaction (RT-PCR). All six dogs immunized with bovine Tg had both canine Tg autoantibody and anti-T4 antibody. When the sample from the highest TgAA titre time-point was compared with baseline the expression of mRNA encoding the Th1-type cytokine such as interferon (IFN)-gamma, interleukin (IL)-18 and IL-15 was increased during the development of autoimmune thyroiditis. Expression of the Th2-type cytokine, IL-6 showed minimal change and IL-4 expression was not detected in any of the samples. Expression of the T suppressive cytokine, IL-10 and transforming growth factor (TGF)-beta was increased in the presence of antigen stimulation. These findings suggest that, although autoimmune thyroiditis is an organ-specific autoimmune disease, systemic cytokine mRNA expression is also changed. PMID:16968404

  2. Canine kobuviruses in diarrhoeic dogs in Italy.

    Science.gov (United States)

    Di Martino, Barbara; Di Felice, Elisabetta; Ceci, Chiara; Di Profio, Federica; Marsilio, Fulvio

    2013-09-27

    Canine kobuviruses (CaKVs) are newly recognized picornaviruses recently detected in dogs in the US. By molecular analysis of the whole genome, CaKV that appeared genetically closest to the murine kobuvirus (MuKV) and to the human Aichi virus (AiV), may be classified in the Kobuvirus genus as new genotype (CaKV type 1) within the species Aichivirus A. To date, there are no information on the epidemiology of these novel viruses in other continents. In this study, by screening a collection of 256 dog fecal samples either from diarrhoeic or asymptomatic animals, CaKV was identified in six specimens with an overall prevalence of 2.34% (6/256). All the positive dogs presented diarrhea and were found to be infected by CaKV alone or in mixed infections with canine coronavirus (CCoV) and/or canine parvovirus type 2 (CPV-2). By molecular analysis of the partial 3D gene, all the strains detected displayed a close relatedness with the CaKVs recently identified in the US. This study provides evidence that CaKVs circulate in diarrhoeic dogs in Italy and are not geographically restricted to the North American continent, where they were first signaled. PMID:23806200

  3. Cytodiagnostics of canine lymphomas - possibilities and limitations.

    Science.gov (United States)

    Sapierzyński, R; Kliczkowska-Klarowicz, K; Jankowska, U; Jagielski, D

    2016-01-01

    Malignant lymphomas are one of the most common malignant tumours occurring in dogs. The basic method of lymphoma diagnosis in human, as well as in canine oncology is histopathology supported by immunohistochemistry. It was suggested that in veterinary medicine excisional biopsy of lymph node and histopathology should be considered only where the cytologic diagnosis is equivocal or needs to be confirmed. There are at least three basic reasons for which cytological examination ought to be accepted as a sufficient and reliable diagnostic method for lymphoma in dogs. Firstly, most dog owners consider the fine-needle biopsy as an acceptable non-harmful method of sample collection. Secondly, an increasing number of studies recommend cytology as an accurate test for diagnosing and subtyping canine lymphoma. Finally, the vast majority of canine lymphoma subtypes belong to 4-5 categories characterized by a typical cytological picture. Immunocytochemical staining of cytological smears gives new diagnostic possibilities, such as detection of markers better characterizing given growth or a potential goal for target therapy in individual cases (for example inhibitors of platelet-derived growth factor). PMID:27487521

  4. Genomic prediction of traits related to canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    Enrique eSanchez-Molano

    2015-03-01

    Full Text Available Increased concern for the welfare of pedigree dogs has led to development of selection programs against inherited diseases. An example is canine hip dysplasia (CHD, which has a moderate heritability and a high prevalence in some large-sized breeds. To date, selection using phenotypes has led to only modest improvement, and alternative strategies such as genomic selection may prove more effective. The primary aims of this study were to compare the performance of pedigree- and genomic-based breeding against CHD in the UK Labrador retriever population and to evaluate the performance of different genomic selection methods. A sample of 1179 Labrador Retrievers evaluated for CHD according to the UK scoring method (hip score, HS was genotyped with the Illumina CanineHD BeadChip. Twelve functions of HS and its component traits were analyzed using different statistical methods (GBLUP, Bayes C and Single-Step methods, and results were compared with a pedigree-based approach (BLUP using cross-validation. Genomic methods resulted in similar or higher accuracies than pedigree-based methods with training sets of 944 individuals for all but the untransformed HS, suggesting that genomic selection is an effective strategy. GBLUP and Bayes C gave similar prediction accuracies for HS and related traits, indicating a polygenic architecture. This conclusion was also supported by the low accuracies obtained in additional GBLUP analyses performed using only the SNPs with highest test statistics, also indicating that marker-assisted selection would not be as effective as genomic selection. A Single-Step method that combines genomic and pedigree information also showed higher accuracy than GBLUP and Bayes C for the log-transformed HS, which is currently used for pedigree based evaluations in UK. In conclusion, genomic selection is a promising alternative to pedigree-based selection against CHD, requiring more phenotypes with genomic data to improve further the accuracy

  5. Genomic prediction of traits related to canine hip dysplasia.

    Science.gov (United States)

    Sánchez-Molano, Enrique; Pong-Wong, Ricardo; Clements, Dylan N; Blott, Sarah C; Wiener, Pamela; Woolliams, John A

    2015-01-01

    Increased concern for the welfare of pedigree dogs has led to development of selection programs against inherited diseases. An example is canine hip dysplasia (CHD), which has a moderate heritability and a high prevalence in some large-sized breeds. To date, selection using phenotypes has led to only modest improvement, and alternative strategies such as genomic selection (GS) may prove more effective. The primary aims of this study were to compare the performance of pedigree- and genomic-based breeding against CHD in the UK Labrador retriever population and to evaluate the performance of different GS methods. A sample of 1179 Labrador Retrievers evaluated for CHD according to the UK scoring method (hip score, HS) was genotyped with the Illumina CanineHD BeadChip. Twelve functions of HS and its component traits were analyzed using different statistical methods (GBLUP, Bayes C and Single-Step methods), and results were compared with a pedigree-based approach (BLUP) using cross-validation. Genomic methods resulted in similar or higher accuracies than pedigree-based methods with training sets of 944 individuals for all but the untransformed HS, suggesting that GS is an effective strategy. GBLUP and Bayes C gave similar prediction accuracies for HS and related traits, indicating a polygenic architecture. This conclusion was also supported by the low accuracies obtained in additional GBLUP analyses performed using only the SNPs with highest test statistics, also indicating that marker-assisted selection (MAS) would not be as effective as GS. A Single-Step method that combines genomic and pedigree information also showed higher accuracy than GBLUP and Bayes C for the log-transformed HS, which is currently used for pedigree based evaluations in UK. In conclusion, GS is a promising alternative to pedigree-based selection against CHD, requiring more phenotypes with genomic data to improve further the accuracy of prediction. PMID:25821457

  6. Surgical construction of a novel simulated carotid siphon in canines

    International Nuclear Information System (INIS)

    Objective: To develop in vivo carotid siphon models by surgical method using the shaped devices for testing the performance of covered stent specially designed for intracranial vascular diseases. Methods: Six carotid siphon-shaped devices were established using stereolithographic biomodeling and the lost-wax technique. Six canines underwent surgery to expose and isolate bilateral CCA. The right CCA origin was ligated and incised distal to the ligation point after the distal right CCA was temporarily closed. The distal left CCA was ligated and incised proximal to the ligation point after the left CCA origin was closed. The proximal isolated left CCA was passed through the shaped device. The distal isolated right CCA and the proximal isolated left CCA were anastomosed end-to-end. Finally, the shaped device of carotid siphon was fixed with suture and embedded in the left neck. The intraarterial DSA was performed on postprocedural 7 days, 2 weeks and 1 month. The morphological characteristics of carotid siphon models were visually evaluated by two observers. The patency of siphon model and the stenosis of anastomotic stoma were followed-up. Results: All animals tolerated the surgical procedure well with mean model time construction of 90 minutes. The morphological characteristics of siphon models were similar to those in human. The anastomotic stoma stenosis occurred in 2 siphon models, and thrombosis of anastomotic stoma in 1, but all siphons of these models were patent on post-procedural follow-up angiography. Conclusion: Surgical construction of an in vivo carotid siphon model of canine with shaped device is practically feasible. This model can be used for testing neurovascular devices. (authors)

  7. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)

    2014-04-15

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  8. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    International Nuclear Information System (INIS)

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  9. Genetic and antigenic characterization of recombinant nucleocapsid proteins derived from canine coronavirus and canine respiratory coronavirus in China.

    Science.gov (United States)

    Lu, Shuai; Chen, Yingzhu; Qin, Kun; Zhou, Jianfang; Lou, Yongliang; Tan, Wenjie

    2016-06-01

    To characterize the antigenicity of nucleocapsid proteins (NP) derived from canine coronavirus (CCoV) and canine respiratory coronavirus (CRCoV) in China, the N genes of CCoV (CCoV-BJ70) and CRCoV (CRCoV-BJ202) were cloned from swabs obtained from diseased pet dogs in Beijing and then sequenced. The recombinant NPs (rNPs) were expressed in Escherichia coli and purified by nickel-affinity column and size exclusion chromatography. Sequencing data indicated that the N genes of CCoV-BJ70 and CRCoV-BJ202 belonging to two distinctly different groups were relatively conserved within each subgroup. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) results showed that rNPs of CCoV and CRCoV were expressed efficiently and isolated with a final purity of over 95%. Western blot analysis revealed the rNP from CRCoV could cross-react with mice antisera against human coronavirus (HCoV-229E, NL63, OC43, HKU1), while rNP of CCoV had cross-reactivity with only anti-sera against viruses belonging to the same group (HCoV-229E and NL63). In summary, CCoV and CRCoV rNPs were successfully expressed in E. coli and showed antigenic cross-reactivity with antisera raised against human coronaviruses. These findings indicate that further serologic studies on coronavirus infections at the animal-human interface are needed. PMID:27084706

  10. Clinical canine parvovirus type 2C infection in a group of Asian small-clawed otters (Aonyx cinerea).

    Science.gov (United States)

    Gjeltema, Jenessa; Murphy, Hayley; Rivera, Sam

    2015-03-01

    Despite the occurrence of clinical disease in a wide range of carnivore hosts, only vague accounts of clinical canine parvovirus type 2 (CPV-2) in any otter species have been reported in the literature. Over the course of 25 days, nine Asian small-clawed otters (Aonyx cinerea) presented for evaluation of inappetence, lethargy, vomiting, and diarrhea. A diagnosis of canine parvovirus type 2c was made based on electron microscopy, polymerase chain reaction, and DNA sequencing of group fecal samples. Supportive care was provided based on individual clinical assessment and included subcutaneous crystalline fluid therapy, antiemetics, antibiotics, appetite stimulants, and a neuraminidase inhibitor. Five of the nine otters exhibited moderate to severe disease requiring treatment, and one case was fatal despite supportive efforts. In light of this case report, CPV-2 should be recognized as a potential cause of gastrointestinal disease in Asian small-clawed otters. PMID:25831584

  11. Population genomics of the filarial nematode parasite Wuchereria bancrofti from mosquitoes.

    Science.gov (United States)

    Small, Scott T; Reimer, Lisa J; Tisch, Daniel J; King, Christopher L; Christensen, Bruce M; Siba, Peter M; Kazura, James W; Serre, David; Zimmerman, Peter A

    2016-04-01

    Wuchereria bancrofti is a parasitic nematode and the primary cause of lymphatic filariasis--a disease specific to humans. W. bancrofti currently infects over 90 million people throughout the tropics and has been acknowledged by the world health organization as a vulnerable parasite. Current research has focused primarily on the clinical manifestations of disease and little is known about the evolutionary history of W. bancrofti. To improve upon knowledge of the evolutionary history of W. bancrofti, we whole genome sequenced 13 W. bancrofti larvae. We circumvent many of the difficulties of multiple infections by sampling larvae directly from mosquitoes that were experimentally inoculated with infected blood. To begin, we used whole genome data to reconstruct the historical population size. Our results support a history of fluctuating population sizes that can be correlated with human migration and fluctuating mosquito abundances. Next, we reconstructed the putative pedigree of W. bancrofti worms within an infection using the kinship coefficient. We deduced that there are full-sib and half-sib relationships residing within the same larval cohort. Through combined analysis of the mitochondrial and nuclear genomes we concluded that this is likely a results of polyandrous mating, the first time reported for W. bancrofti. Lastly, we scanned the genomes for signatures of natural selection. Annotation of putative selected regions identified proteins that may have aided in a parasitic life style or may have evolved to protect against current drug treatments. We discuss our results in the greater context of understanding the biology of an animal with a unique life history and ecology. PMID:26850696

  12. Survey of Borreliae in ticks, canines, and white-tailed deer from Arkansas, U.S.A.

    Directory of Open Access Journals (Sweden)

    Fryxell Rebecca T

    2012-07-01

    . lonestari sequences: 281 of the 296 sequenced ticks, 3 canines, and 27 deer. Only 22 deer, 7 canines, and 15 tick flaB amplicons (12 I. scapularis, 2 A. maculatum, and 1 Amblyomma species were homologous with B. burgdorferi sequences. Conclusions Data from this study identified multiple Borreliae genotypes in Arkansas ticks, canines and deer including B. burgdorferi and B. lonestari; however, B. lonestari was significantly more prevalent in the tick population than B. burgdorferi. Results from this study suggest that the majority of tick-borne diseases in Arkansas are not B. burgdorferi.

  13. Evaluation of an attenuated strain of Ehrlichia canis as a vaccine for canine monocytic ehrlichiosis.

    Science.gov (United States)

    Rudoler, Nir; Baneth, Gad; Eyal, Osnat; van Straten, Michael; Harrus, Shimon

    2012-12-17

    Canine monocytic ehrlichiosis is an important tick-borne disease worldwide. No commercial vaccine for the disease is currently available and tick control is the main preventive measure against the disease. The aim of this study was to evaluate the potential of a multi-passaged attenuated strain of Ehrlichia canis to serve as a vaccine for canine monocytic ehrlichiosis, and to assess the use of azithromycin in the treatment of acute ehrlichiosis. Twelve beagle dogs were divided into 3 groups of 4 dogs. Groups 1 and 2 were inoculated (vaccinated) with an attenuated strain of E. canis (#611A) twice or once, respectively. The third group consisted of naïve dogs which served as controls. All 3 groups were challenged with a wild virulent strain of E. canis by administering infected dog-blood intravenously. Transient thrombocytopenia was the only hematological abnormality observed following inoculation of dogs with the attenuated strain. Challenge with the virulent strain resulted in severe disease in all 4 control dogs while only 3 of 8 vaccinated dogs presented mild transient fever. Furthermore, the mean blood rickettsial load was significantly higher in the control group (27-92-folds higher during days 14-19 post challenge with the wild the strain) as compared to the vaccinated dogs. The use of azithromycin was assessed as a therapeutic agent for the acute disease. Four days treatment resulted in further deterioration of the clinical condition of the dogs. Molecular comparison of 4 genes known to express immunoreactive proteins and virulence factors (p30, gp19, VirB4 and VirB9) between the attenuated strain and the challenge wild strain revealed no genetic differences between the strains. The results of this study indicate that the attenuated E. canis strain may serve as an effective and secure future vaccine for canine ehrlichiosis. PMID:23072894

  14. Canine evolution in sabretoothed carnivores: natural selection or sexual selection?

    Science.gov (United States)

    Randau, Marcela; Carbone, Chris; Turvey, Samuel T

    2013-01-01

    The remarkable elongated upper canines of extinct sabretoothed carnivorous mammals have been the subject of considerable speculation on their adaptive function, but the absence of living analogues prevents any direct inference about their evolution. We analysed scaling relationships of the upper canines of 20 sabretoothed feliform carnivores (Nimravidae, Barbourofelidae, Machairodontinae), representing both dirk-toothed and scimitar-toothed sabretooth ecomorphs, and 33 non-sabretoothed felids in relation to body size in order to characterize and identify the evolutionary processes driving their development, using the scaling relationships of carnassial teeth in both groups as a control. Carnassials display isometric allometry in both sabretooths and non-sabretooths, supporting their close relationship with meat-slicing, whereas the upper canines of both groups display positive allometry with body size. Whereas there is no statistical difference in allometry of upper canine height between dirk-toothed and scimitar-toothed sabretooth ecomorphs, the significantly stronger positive allometry of upper canine height shown by sabretooths as a whole compared to non-sabretooths reveals that different processes drove canine evolution in these groups. Although sabretoothed canines must still have been effective for prey capture and processing by hypercarnivorous predators, canine morphology in these extinct carnivores was likely to have been driven to a greater extent by sexual selection than in non-sabretooths. Scaling relationships therefore indicate the probable importance of sexual selection in the evolution of the hypertrophied sabretooth anterior dentition. PMID:23951334

  15. Canine evolution in sabretoothed carnivores: natural selection or sexual selection?

    Directory of Open Access Journals (Sweden)

    Marcela Randau

    Full Text Available The remarkable elongated upper canines of extinct sabretoothed carnivorous mammals have been the subject of considerable speculation on their adaptive function, but the absence of living analogues prevents any direct inference about their evolution. We analysed scaling relationships of the upper canines of 20 sabretoothed feliform carnivores (Nimravidae, Barbourofelidae, Machairodontinae, representing both dirk-toothed and scimitar-toothed sabretooth ecomorphs, and 33 non-sabretoothed felids in relation to body size in order to characterize and identify the evolutionary processes driving their development, using the scaling relationships of carnassial teeth in both groups as a control. Carnassials display isometric allometry in both sabretooths and non-sabretooths, supporting their close relationship with meat-slicing, whereas the upper canines of both groups display positive allometry with body size. Whereas there is no statistical difference in allometry of upper canine height between dirk-toothed and scimitar-toothed sabretooth ecomorphs, the significantly stronger positive allometry of upper canine height shown by sabretooths as a whole compared to non-sabretooths reveals that different processes drove canine evolution in these groups. Although sabretoothed canines must still have been effective for prey capture and processing by hypercarnivorous predators, canine morphology in these extinct carnivores was likely to have been driven to a greater extent by sexual selection than in non-sabretooths. Scaling relationships therefore indicate the probable importance of sexual selection in the evolution of the hypertrophied sabretooth anterior dentition.

  16. Stroma and extracellular matrix proteins in canine tumours

    NARCIS (Netherlands)

    Mukaratirwa, Sydney

    2004-01-01

    In this thesis, studies on temporal and spatial changes in stromal cells and extracellular matrix (ECM) molecules in canine gastrointestinal (GIT) tumours and canine transmissible venereal (CTVT) tumours are described. The mechanisms involved in the phenotypic transformation of fibroblasts to myofib

  17. Management of an Unusual Maxillary Canine: A Rare Entity

    OpenAIRE

    Jaya Nagendra Krishna Muppalla; Krishnamurthy Kavuda; Rajani Punna; Amulya Vanapatla

    2015-01-01

    Clinicians need to have intimate knowledge and thorough understanding of both pulp chamber and root canal anatomy. They should be aware of possibility of anatomical variations in the root canal system during endodontic treatment. Maxillary canines usually have single root and root canal but rarely may have single root with two root canals. This case describes a lengthier maxillary canine with two root canals.

  18. 9 CFR 113.317 - Parvovirus Vaccine (Canine).

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... for immunogenicity. The selected virus dose shall be established as follows: (1) Twenty-five...

  19. Black flies (Diptera : Simuliidae attracted to humans and water buffalos and natural infections with filarial larvae, probably Onchocerca sp., in northern Thailand

    Directory of Open Access Journals (Sweden)

    Takaoka H.

    2003-03-01

    Full Text Available Several Simulium species were investigated as to their biting habits and natural infections with filarial larvae at Ban Pan Fan, Chiang Mai Province, in northern Thailand. Female adults flies landing on or flighting around a human and a water buffalo were collected during the daytime from 06.00 to 19.00 hours on 22 June 2001. As a result, 217 S. nodosum, 86 S. asakoae and two S. nigrogilvum were obtained from a human attractant, and 416 S. nodosum, 25 S. nakhonense, 16 S. asakoae, four 5. fenestratum and two S. nigrogilvum, from a water buffalo. The blood-feeding was confirmed only for S. nodosum and S. nigrogilvum on humans, and for S. nodosum and S. nakhonense on water buffalos. Dissections of these simuliids showed that S. nodosum was naturally infected with developing filarial larvae. Two types of microfilariae were distinguished but only one type of infective larvae. These larvae resembled Onchocerca suzukii, a parasite from a wild Japanese bovid, suggesting that an unknown Onchocerca species from ruminants was transmitted in Thailand. Infection rates with all stages of larvae and third-stage larvae were 2.3 % (14/608 and 1 .0 % (6/608, respectively. This is the first report of natural infections of black flies with Onchocerca larvae in Southeast Asia, and the involved black fly species is shown to be not only anthropophilic but also zoophilic in this region.

  20. Measurement of Circulating Filarial Antigen Levels in Human Blood with a Point-of-Care Test Strip and a Portable Spectrodensitometer.

    Science.gov (United States)

    Chesnais, Cédric B; Vlaminck, Johnny; Kunyu-Shako, Billy; Pion, Sébastien D; Awaca-Uvon, Naomi-Pitchouna; Weil, Gary J; Mumba, Dieudonné; Boussinesq, Michel

    2016-06-01

    The Alere Filariasis Test Strip (FTS) is a qualitative, point-of-care diagnostic tool that detects Wuchereria bancrofti circulating filarial antigen (CFA) in human blood, serum, or plasma. The Global Program to Eliminate Lymphatic Filariasis employs the FTS for mapping filariasis-endemic areas and assessing the success of elimination efforts. The objective of this study was to explore the relationship between the intensity of positive test lines obtained by FTS with CFA levels as determined by enzyme-linked immunosorbent assay (ELISA) with blood and plasma samples from 188 individuals who live in a filariasis-endemic area. The intensity of the FTS test line was assessed visually to provide a semiquantitative score (visual Filariasis Test Strip [vFTS]), and line intensity was measured with a portable spectrodensitometer (quantitative Filariasis Test Strip [qFTS]). These results were compared with antigen levels measured by ELISA in plasma from the same subjects. qFTS measurements were highly correlated with vFTS scores (ρ = 0.94; P bancrofti CFA levels in human blood, which are correlated with adult worm burdens. This tool may be useful for assessing the impact of treatment on adult filarial worms in individuals and communities. PMID:27114288

  1. Both asymmetric mitotic segregation and cell-to-cell invasion are required for stable germline transmission of Wolbachia in filarial nematodes

    Directory of Open Access Journals (Sweden)

    Frédéric Landmann

    2012-04-01

    Parasitic filarial nematodes that belong to the Onchocercidae family live in mutualism with Wolbachia endosymbionts. We developed whole-mount techniques to follow the segregation patterns of Wolbachia through the somatic and germline lineages of four filarial species. These studies reveal multiple evolutionarily conserved mechanisms that are required for Wolbachia localization to the germline. During the initial embryonic divisions, Wolbachia segregate asymmetrically such that they concentrate in the posteriorly localized P2 blastomere, a precursor to the adult germline and hypodermal lineages. Surprisingly, in the next division they are excluded from the germline precursor lineage. Rather, they preferentially segregate to the C blastomere, a source of posterior hypodermal cells. Localization to the germline is accomplished by a distinct mechanism in which Wolbachia invade first the somatic gonadal cells close to the ovarian distal tip cell, the nematode stem cell niche, from the hypodermis. This tropism is associated with a cortical F-actin disruption, suggesting an active engulfment. Significantly, germline invasion occurs only in females, explaining the lack of Wolbachia in the male germline. Once in the syncytial environment of the ovaries, Wolbachia rely on the rachis to multiply and disperse into the germ cells. The utilization of cell-to-cell invasion for germline colonization may indicate an ancestral mode of horizontal transfer that preceded the acquisition of the mutualism.

  2. Canine and feline nasal neoplasia.

    Science.gov (United States)

    Malinowski, Christine

    2006-05-01

    Dogs and cats of our society have outgrown their status as merely pets and are now considered our close companions and even family members. This shift in their roles has led to pet owners seeking improved preventative medicine for their four-legged friends. Subsequently, dogs and cats are living longer lives than ever before and developing more old-age-related diseases. One of the most devastating diseases of older animals is cancer. Once a veterinarian has detected cancer in a pet, pet owners seek advice on their next course of action. This article is intended to provide concise information regarding the diagnosis and treatment of intranasal tumors of the dog and cat. This article outlines the forms of nasal tumors that are the most common, the recommended imaging and biopsy techniques to diagnose the tumor, and the most appropriate treatments of them. PMID:16711615

  3. Canine and feline oral pathology

    OpenAIRE

    Costa, S.; Pais, B.; Almeida, D.; Simões, J.; Mega, A. C.; Vala, Helena

    2013-01-01

    The aim of this work was to present a brief review of the main conditions affecting the oral cavity of dogs and cats. In recent years there has been increased attention with regard to veterinary dentistry, being several and frequent the pathologies located in the oral cavity of our pets. These diseases mainly affect the teeth and the mucous membranes of the oral cavity, and may, in chronic cases, also affect vital organs. This condition could have different causes, including hereditary, conge...

  4. Ocular manifestation in canine leishmaniasis

    OpenAIRE

    Ralić Marjan; Jovanović Milan

    2011-01-01

    This paper presents a case of ocular changes in leishmaniasis in a dog brought in for examination because of visible changes in the eyes. An ocular manifestation in leishmaniasis can be bilateral or unilateral. Changes most often occur on the conjunctive and the front segment of the eye, the cornea and iris. From 70 to 80% of dogs diseased with leishmaniasis exhibit frontal uveitis, and dry eye, keratoconjunctivitis sicca, is also a frequent finding. Based ...

  5. Filamentation temperature-sensitive protein Z (FtsZ) of Wolbachia, endosymbiont of Wuchereria bancrofti: a potential target for anti-filarial chemotherapy.

    Science.gov (United States)

    Sharma, Rohit; Hoti, S L; Vasuki, V; Sankari, T; Meena, R L; Das, P K

    2013-03-01

    Lymphatic filariasis (LF) is a leading cause of morbidity in the tropical world. It is caused by the filarial parasites Wuchereria bancrofti, Brugia malayi and Brugia timori and transmitted by vector mosquitoes. Currently a programme for the elimination of LF, Global programme for Elimination of Lymphatic Filariasis (GPELF), is underway with the strategy of mass administration of single dose of diethylcarbamazine or ivermectin, in combination with an anthelmintic drug, albendazole. However, antifilarial drugs used in the programme are only microfilaricidal but not or only partially macrofilaricidal. Hence, there is a need to identify new targets for developing antifilarial drugs. Filarial parasites harbor rickettsial endosymbionts, Wolbachia sp., which play an important role in their biology and hence are considered as potential targets for antifilarial chemotherapy development. In this study, one of the cell division proteins of Wolbachia of the major lymphatic filarial parasite, W. bancrofti, viz., filamentation temperature-sensitive protein Z (FtsZ), was explored as a drug target. The gene coding for FtsZ protein was amplified from the genomic DNA of W. bancrofti, cloned and sequenced. The derived amino acid sequence of the gene revealed that FtsZ protein is 396 amino acids long and contained the tubulin motif (GGGTGTG) involved in GTP binding and the GTP hydrolyzing motif (NLDFAD). The FtsZ gene of endosymbiont showed limited sequence homology, but exhibited functional homology with β-tubulin of its host, W. bancrofti, as it had both the functional motifs and conserved amino acids that are critical for enzymatic activity. β-tubulin is the target for the anti-helminthic activity of albendazole and since FtsZ shares functional homology with, β-tubulin it may also be sensitive to albendazole. Therefore, the effect of albendazole was tested against Wolbachia occurring in mosquitoes instead of filarial parasites as the drug has lethal effect on the latter. Third

  6. Apicotomy: surgical management of maxillary dilacerated or ankylosed canines.

    Science.gov (United States)

    Araújo, Eustáquio A; Araújo, Cristiana V; Tanaka, Orlando M

    2013-12-01

    This clinical article reports a technique, apicotomy, for managing dilacerated or ankylosed canines. The records of 3 patients successfully treated with apicotomy are presented. Orthodontists observe clinically significant incidences of impacted maxillary canines in their daily practices. Several procedures have been described to bring an ankylosed, impacted tooth into occlusion. Luxation is the most widely used solution, but there are risks involved with that approach, and the success rate is low. Surgical repositioning has also been used, but morbidity is high, and the aggressiveness of the procedure might also contraindicate it. Ankylosis might be related to the anatomic position of the canine's root apex and its adjacent anatomic structures. Apicotomy is a guided fracture of a canine root apex, followed by its orthodontic traction. It is a conservative surgical alternative for treating impacted canines with dilacerations or apical root ankylosis. PMID:24286914

  7. Frequency and Clinical Epidemiology of Canine Monocytic Ehrlichiosis in Dogs Infested with Ticks from Sinaloa, Mexico

    Directory of Open Access Journals (Sweden)

    Carolina Guadalupe Sosa-Gutierrez

    2013-01-01

    Full Text Available Ehrlichia canis is a rickettsial intracellular obligate bacterial pathogen and agent of canine monocytic ehrlichiosis. The prevalence of this disease in veterinary medicine can vary depending on the diagnostic method used and the geographic location. One hundred and fifty-two canine blood samples from six veterinary clinics and two shelters from Sinaloa State (Mexico were analyzed in this study. All animals were suspected of having Canine Monocytic Ehrlichiosis (CME. The diagnostic methods used were the ELISA (Snap4Dx, IDEXX together with blood smear and platelet count. From all dogs blood samples analyzed, 74.3% were positive to E. canis by ELISA and 40.1% were positive by blood smear. The sensitivity and specificity observed in the ELISA test were 78.8% and 86.7%. In addition, thrombocytopenia was presented in 87.6% of positive dogs. The predominant clinical manifestations observed were fever, anorexia, depression, lethargy, and petechiae. Consequently, this is the first report in which the morulae were visualized in the blood samples, and E. canis-specific antibodies were detected in dogs from Sinaloa, Northwest of Mexico.

  8. Optimization of contrast-enhanced multidetector abdominal computed tomography in sedated canine patients.

    Science.gov (United States)

    Fields, Erica L; Robertson, Ian D; Brown, James C

    2012-01-01

    A major disadvantage of computed tomography for abdominal screening in dogs has been the need for general anesthesia to prevent motion artifacts. With multidetector helical CT, it is possible to decrease examination time, allowing patients to be scanned under sedation. It is also desirable to decrease tube loading to prolong x-ray tube life. To develop a protocol that will allow for examination of sedated patients with minimal image artifacts, milliamperage (mA) and helical pitch were varied, providing 16 experimental scan protocols. A standard clinical protocol was also tested, providing 17 protocols for evaluation. These protocols were tested, using a standard CT phantom, canine tissues in a water bath, and a canine cadaver. The cadaver images were scored semiquantitatively by three reviewers to determine the protocol with the best combination of speed and minimal image artifact. The optimized protocol was then applied to 27 sedated canine patients of three body weight categories. The images obtained were compared to the standard protocol by two reviewers for presence of motion, streak, and quantum mottle artifacts. There was significantly more streak artifact noted by one observer using the optimized study protocol, but no significant difference in any other category. Scanning under sedation was well tolerated in all patients, and sedated CT examination is a promising tool for screening abdominal disease in dogs. PMID:22612282

  9. Temporal patterns of human and canine Giardia infection in the United States: 2003-2009.

    Science.gov (United States)

    Mohamed, Ahmed S; Levine, Michael; Camp, Joseph W; Lund, Elisabeth; Yoder, Jonathan S; Glickman, Larry T; Moore, George E

    2014-02-01

    Giardia protozoa have been suspected to be of zoonotic transmission, including transmission from companion animals such as pet dogs to humans. Patterns of infection have been previously described for dogs and humans, but such investigations have used different time periods and locations for these two species. Our objective was to describe and compare the overall trend and seasonality of Giardia species infection among dogs and humans in the United States from 2003 through 2009 in an ecological study using public health surveillance data and medical records of pet dogs visiting a large nationwide private veterinary hospital. Canine data were obtained from all dogs visiting Banfield hospitals in the United States with fecal test results for Giardia species, from January 2003 through December 2009. Incidence data of human cases from the same time period were obtained from the CDC. Descriptive time plots, a seasonal trend decomposition (STL) procedure, and seasonal autoregressive moving-average (SARIMA) models were used to assess the temporal characteristics of Giardia infection in the two species. Canine incidence showed a gradual decline from 2003 to 2009 with no significant/distinct regular seasonal component. By contrast, human incidence showed a stable annual rate with a significant regular seasonal cycle, peaking in August and September. Different temporal patterns in human and canine Giardia cases observed in this study suggest that the epidemiological disease processes underlying both series might be different, and Giardia transmission between humans and their companion dogs seems uncommon. PMID:24309130

  10. Why is Southern African canine babesiosis so virulent? An evolutionary perspective

    Directory of Open Access Journals (Sweden)

    Penzhorn Barend L

    2011-04-01

    Full Text Available Abstract Canine babesiosis is a common, highly virulent disease in Southern Africa with even pups and juveniles being severely affected. This contrasts with bovine babesiosis, for example, where host, parasite and vector co-evolved and young animals develop immunity after infection without showing clinical signs. Babesia rossi, the main causative organism of canine babesiosis in sub-Saharan Africa, was first described from a side-striped jackal (Canis adustus in Kenya. Although data are meagre, there is evidence that indigenous African canids, such as jackals and wild dogs (Lycaon pictus, can harbour the parasite without showing untoward effects. Dogs are not indigenous to Africa. The vast majority of dogs presented at veterinary facilities in South Africa represent recently introduced European, Asian or American breeds. The contention is that B. rossi is a new challenge to which these dogs have not adapted. With intensive treatment of clinical cases, natural selection is effectively negated and the status quo will probably be maintained indefinitely. It is postulated that Babesia vogeli, which frequently results in unapparent infections or mild manifestations in dogs, represents or is closely related to the ancestral form of the canine parasite, possibly originating from wolves (Canis lupus.

  11. Positive correlation of steroid hormones and EGF in canine mammary cancer.

    Science.gov (United States)

    Queiroga, Felisbina L; Pérez-Alenza, Dolores; Silvan, Gema; Peña, Laura; Illera, Juan C

    2009-05-01

    There are no published studies focused on the potential crosstalk between steroid hormones and EGF in canine mammary tumourigenesis. The objective was to investigate the role of EGF in canine mammary tumours (CMT) and the relationship with steroid hormones. Sixty-three CMT (39 malignant including 10 inflammatory mammary carcinomas (IMC); 19 benign and 5 dysplasias), and 13 normal mammary glands from dogs without history of neoplastic disease were analysed. Levels of EGF and steroid hormones [progesterone (P4); 17beta-estradiol (E2); androstenedione (A4) and dehydroepiandrosterone (DHEA)], were analysed by EIA in CMT homogenates. Levels of EGF were significantly higher in malignant compared with benign tumours, dysplasias and normal mammary glands (pIMC presented the highest EGF levels, with statistical significant difference between IMC and non-IMC cases (pIMC and IMC), a strong correlation was observed between EGF and: P4 (r=0.452; p=0.003); E2 (r=0.624; p=0.023); A4 (r=0.496; p=0.038); DHEA (r=0.431; p=0.005). These results suggest that EGF is implicated in canine mammary tumourigenesis. The positive correlation observed, opens an interesting perspective of interaction that should be further investigated. PMID:19429455

  12. Isolation and characterization of canine parvovirus type 2c (CPV-2c from symptomatic puppies

    Directory of Open Access Journals (Sweden)

    R Puentes

    2012-09-01

    Full Text Available Canine parvovirus type 2 (CPV-2 is a leading cause of diarrhea in puppies in several parts of the world. In this study CPV-2 was detected and recovered from puppies showing clinical disease from Montevideo, Uruguay. Samples were processed and used to infect CRFK and MDCK cells in order to isolate the virus. Out of twelve, two samples were positive for CPV-2. A genomic region of 583 bp was amplified and the molecular characterization was performed by sequencing, phylogenetic analysis and Restriction Fragment Length Polymorphism (RFLP. Two isolated viruses (UY1 and UY2 were CPV-2c-like viruses. The comparison between the cytophatic effect (CPE of CPV-2 (vaccinal virus and CPV-2c (isolated virus on primary canine cells cultures and on CRFK line cells, demonstrated that CPV-2c is less citopathogenic in CRFK than in primary cultures. Our study represents the first report on isolation and characterization of canine parvovirus type 2c (CPV-2c in cell cultures from South American dogs.

  13. HORSE SPECIES SYMPOSIUM: Canine intestinal microbiology and metagenomics: From phylogeny to function.

    Science.gov (United States)

    Guard, B C; Suchodolski, J S

    2016-06-01

    Recent molecular studies have revealed a complex microbiota in the dog intestine. Convincing evidence has been reported linking changes in microbial communities to acute and chronic gastrointestinal inflammation, especially in canine inflammatory bowel disease (IBD). The most common microbial changes observed in intestinal inflammation are decreases in the bacterial phyla Firmicutes (i.e., Lachnospiraceae, Ruminococcaceae, and ) and Bacteroidetes, with concurrent increases in Proteobacteria (i.e., ). Due to the important role of microbial-derived metabolites for host health, it is important to elucidate the metabolic consequences of gastrointestinal dysbiosis and physiological pathways implicated in specific disease phenotypes. Metagenomic studies have used shotgun sequencing of DNA as well as phylogenetic investigation of communities by reconstruction of unobserved states (PICRUSt) to characterize functional changes in the bacterial metagenome in gastrointestinal disease. Furthermore, wide-scale and untargeted measurements of metabolic products derived by the host and the microbiota in intestinal samples allow a better understanding of the functional alterations that occur in gastrointestinal disease. For example, changes in bile acid metabolism and tryptophan catabolism recently have been reported in humans and dogs. Also, metabolites associated with the pentose phosphate pathway were significantly altered in chronic gastrointestinal inflammation and indicate the presence of oxidative stress in dogs with IBD. This review focuses on the advancements made in canine metagenomics and metabolomics and their implications in understanding gastrointestinal disease as well as the development of better treatment approaches. PMID:27285902

  14. Bancroftian filariasis: the patterns of filarial-specific immunoglobulin G1 (IgG1), IgG4, and circulating antigens in an endemic community of northeastern Tanzania

    DEFF Research Database (Denmark)

    Simonsen, P E; Lemnge, M M; Msangeni, H A;

    1996-01-01

    The profile of filarial-specific immunoglobulin G1 (IgG1), IgG4, and Wuchereria bancrofti-specific circulating antigen (Og4C3) was analyzed in individuals one year of age and older in a community with high endemicity for Bancroftian filariasis. The overall microfilarial (mf) prevalence...

  15. Thermographic image analysis as a pre-screening tool for the detection of canine bone cancer

    Science.gov (United States)

    Subedi, Samrat; Umbaugh, Scott E.; Fu, Jiyuan; Marino, Dominic J.; Loughin, Catherine A.; Sackman, Joseph

    2014-09-01

    Canine bone cancer is a common type of cancer that grows fast and may be fatal. It usually appears in the limbs which is called "appendicular bone cancer." Diagnostic imaging methods such as X-rays, computed tomography (CT scan), and magnetic resonance imaging (MRI) are more common methods in bone cancer detection than invasive physical examination such as biopsy. These imaging methods have some disadvantages; including high expense, high dose of radiation, and keeping the patient (canine) motionless during the imaging procedures. This project study identifies the possibility of using thermographic images as a pre-screening tool for diagnosis of bone cancer in dogs. Experiments were performed with thermographic images from 40 dogs exhibiting the disease bone cancer. Experiments were performed with color normalization using temperature data provided by the Long Island Veterinary Specialists. The images were first divided into four groups according to body parts (Elbow/Knee, Full Limb, Shoulder/Hip and Wrist). Each of the groups was then further divided into three sub-groups according to views (Anterior, Lateral and Posterior). Thermographic pattern of normal and abnormal dogs were analyzed using feature extraction and pattern classification tools. Texture features, spectral feature and histogram features were extracted from the thermograms and were used for pattern classification. The best classification success rate in canine bone cancer detection is 90% with sensitivity of 100% and specificity of 80% produced by anterior view of full-limb region with nearest neighbor classification method and normRGB-lum color normalization method. Our results show that it is possible to use thermographic imaging as a pre-screening tool for detection of canine bone cancer.

  16. Succinate dehydrogenase subunit D and succinate dehydrogenase subunit B mutation analysis in canine phaeochromocytoma and paraganglioma.

    Science.gov (United States)

    Holt, D E; Henthorn, P; Howell, V M; Robinson, B G; Benn, D E

    2014-07-01

    Phaeochromocytomas (PCs) are tumours of the adrenal medulla chromaffin cells. Paragangliomas (PGLs) arise in sympathetic ganglia (previously called extra-adrenal PCs) or in non-chromaffin parasympathetic ganglia cells that are usually non-secretory. Parenchymal cells from these tumours have a common embryological origin from neural crest ectoderm. Several case series of canine PCs and PGLs have been published and a link between the increased incidence of chemoreceptor neoplasia in brachycephalic dog breeds and chronic hypoxia has been postulated. A similar link to hypoxia in man led to the identification of germline heterozygous mutations in the gene encoding succinate dehydrogenase subunit D (SDHD) and subsequently SDHA, SDHB and SDHC in similar tumours. We investigated canine PCs (n = 6) and PGLs (n = 2) for SDHD and SDHB mutations and in one PGL found a somatic SDHD mutation c.365A>G (p.Lys122Arg) in exon 4, which was not present in normal tissue from this brachycephalic dog. Two PCs were heterozygous for both c.365A>G (p.Lys122Arg) mutation and an exon 3 silent variant c.291G>A. We also identified the heterozygous SDHB exon 2 mutation c.113G>A (p.Arg38Gln) in a PC. These results illustrate that genetic mutations may underlie tumourigenesis in canine PCs and PGLs. The spontaneous nature of these canine diseases and possible association of PGLs with hypoxia in brachycephalic breeds may make them an attractive model for studying the corresponding human tumours. PMID:24813157

  17. Progress on Canine Distemper Vaccines%犬瘟热疫苗研究进展

    Institute of Scientific and Technical Information of China (English)

    薛向红; 胡博; 赵建军; 刘昊; 徐淑娟; 闫喜军

    2015-01-01

    Canine distemper caused by an agent of canine distemper virus in dogs and other carnivorous spe-cies,is a highly mortal and contagious disease.In recent years,many cases of naturally infection with canine distemper virus outbroke in wild animals.Currently,there is no effective drugs against canine distemper, whose prevention mainly rely on vaccination.The modified live vaccine has been widely used,but it also re-mains some problems.In order to provide a reference for the development of a safe and effective CD vac-cine,this paper mainly reviewed the recent progresses on the promising vaccine candidates including tradi-tional modified live vaccines,DNA vaccines,viral vector vaccines.%犬瘟热(CD)是由犬瘟热病毒(CDV)感染犬和其他食肉动物引起的一种病死率高的接触性传染病。近年来暴发了多起犬和野生动物自然感染犬瘟热病毒的案例。目前尚无治疗犬瘟热的有效药物或生物制剂。犬瘟热的预防主要依靠接种疫苗,应用最为广泛的是弱毒活疫苗,但也存在一些问题。论文主要概述了犬瘟热弱毒活疫苗、基因疫苗、病毒载体疫苗的研究进展,以期为研制安全、高效的犬瘟热新疫苗提供参考。

  18. An integrated in vitro imaging platform for characterizing filarial parasite behavior within a multicellular microenvironment.

    Directory of Open Access Journals (Sweden)

    Timothy Kassis

    2014-11-01

    Full Text Available Lymphatic Filariasis, a Neglected Tropical Disease, is caused by thread-like parasitic worms, including B. malayi, which migrate to the human lymphatic system following transmission. The parasites reside in collecting lymphatic vessels and lymph nodes for years, often resulting in lymphedema, elephantiasis or hydrocele. The mechanisms driving worm migration and retention within the lymphatics are currently unknown. We have developed an integrated in vitro imaging platform capable of quantifying B. malayi migration and behavior in a multicellular microenvironment relevant to the initial site of worm injection by incorporating the worm in a Polydimethylsiloxane (PDMS microchannel in the presence of human dermal lymphatic endothelial cells (LECs and human dermal fibroblasts (HDFs. The platform utilizes a motorized controllable microscope with CO2 and temperature regulation to allow for worm tracking experiments with high resolution over large length and time scales. Using post-acquisition algorithms, we quantified four parameters: 1 speed, 2 thrashing intensity, 3 percentage of time spent in a given cell region and 4 persistence ratio. We demonstrated the utility of our system by quantifying these parameters for L3 B. malayi in the presence of LECs and HDFs. Speed and thrashing increased in the presence of both cell types and were altered within minutes upon exposure to the anthelmintic drug, tetramisole. The worms displayed no targeted migration towards either cell type for the time course of this study (3 hours. When cells were not present in the chamber, worm thrashing correlated directly with worm speed. However, this correlation was lost in the presence of cells. The described platform provides the ability to further study B. malayi migration and behavior.

  19. Estimating the global burden of endemic canine rabies.

    Directory of Open Access Journals (Sweden)

    Katie Hampson

    2015-04-01

    Full Text Available Rabies is a notoriously underreported and neglected disease of low-income countries. This study aims to estimate the public health and economic burden of rabies circulating in domestic dog populations, globally and on a country-by-country basis, allowing an objective assessment of how much this preventable disease costs endemic countries.We established relationships between rabies mortality and rabies prevention and control measures, which we incorporated into a model framework. We used data derived from extensive literature searches and questionnaires on disease incidence, control interventions and preventative measures within this framework to estimate the disease burden. The burden of rabies impacts on public health sector budgets, local communities and livestock economies, with the highest risk of rabies in the poorest regions of the world. This study estimates that globally canine rabies causes approximately 59,000 (95% Confidence Intervals: 25-159,000 human deaths, over 3.7 million (95% CIs: 1.6-10.4 million disability-adjusted life years (DALYs and 8.6 billion USD (95% CIs: 2.9-21.5 billion economic losses annually. The largest component of the economic burden is due to premature death (55%, followed by direct costs of post-exposure prophylaxis (PEP, 20% and lost income whilst seeking PEP (15.5%, with only limited costs to the veterinary sector due to dog vaccination (1.5%, and additional costs to communities from livestock losses (6%.This study demonstrates that investment in dog vaccination, the single most effective way of reducing the disease burden, has been inadequate and that the availability and affordability of PEP needs improving. Collaborative investments by medical and veterinary sectors could dramatically reduce the current large, and unnecessary, burden of rabies on affected communities. Improved surveillance is needed to reduce uncertainty in burden estimates and to monitor the impacts of control efforts.

  20. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

    OpenAIRE

    Sudarisman

    2006-01-01

    Serum neutralisation test (SNT) has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA) is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig) G antibodies to canine distemper virus (CDV) was developed by using Onderstepoort strain of canine dis...