WorldWideScience

Sample records for canine filarial diseases

  1. Filarial-specific antibody response in East African bancroftian filariasis: effects of host infection, clinical disease, and filarial endemicity

    DEFF Research Database (Denmark)

    Jaoko, Walter G; Simonsen, Paul E; Meyrowitsch, Dan W

    2006-01-01

    bancrofti endemicity. In the high endemicity community, intensities of the measured antibodies were significantly associated with infection status. IgG1, IgG2, and IgE were negatively associated with microfilaria (MF) status, IgG3 was negatively associated with circulating filarial antigen (CFA) status......, and IgG4 was positively associated with CFA status. None of the associations were significantly influenced by chronic lymphatic disease status. In contrast, IgG1, IgG2, and IgG4 responses were less vigorous in the low endemicity community and, except for IgG4, did not show any significant associations...... with MF or CFA status. The IgG3 responses were considerably more vigorous in the low endemicity community than in the high endemicity one. Only IgG4 responses exhibited a rather similar pattern in the two communities, being significantly positively associated with CFA status in both communities. The IgG4...

  2. Podoconiosis - non-filarial geochemical elephantiasis - a neglected tropical disease?

    Science.gov (United States)

    Nenoff, Pietro; Simon, Jan Christoph; Muylowa, Grace K; Davey, Gail

    2010-01-01

    Podoconiosis or mossy foot is a form of non-filarial lymphedema. This geochemical elephantiasis is a disabling condition caused by the passage of microparticles of silica and aluminum silicates through the skin of people walking barefoot in areas with a high content of soil of volcanic origin. Podoconiosis is widespread in tropical Africa, Central America and North India, yet it remains a neglected and under-researched condition. The disabling effects of podoconiosis cause great hardship to patients. It adversely affects the economic (reduced productivity and absenteeism), social (marriage, education, etc.) and psychological (social stigma) well-being of those affected. Podoconiosis can be prevented; the main primary preventive measure is protective footwear. Secondary measures include a strict hygiene regimen and compression therapy, which can reverse initial lesions. Tertiary approaches include surgical management, such as shaving operations to reduce hyperplastic and verrucous elephantiasis.

  3. Survey on the Ability of Wolbachia to Control Human Viral, Protozoan, and Filarial Disease Pathogens

    Directory of Open Access Journals (Sweden)

    Garedaghi Yagoob

    2014-04-01

    Full Text Available Objective: Most human filarial nematode parasites and arthropods are hosts for a bacterial endosymbiont, Wolbachia. In filariasis, Wolbachia are required for normal development, fertility, and survival. However, in arthropods, Wolbachia are largely parasitic and can influence development and reproduction, but are generally not required for host survival. Materials and Methods: Due to their obligate nature in filarial parasites, Wolbachia have been a target for drug discovery initiatives using several approaches including diversity and focused library screening and genomic sequence analysis. Results: In vitro and in vivo anti-Wolbachia antibiotic treatments have been shown to have adulticidal activity, a long sought goal of filarial parasite drug discovery. In mosquitoes, it has been shown that the presence of Wolbachia can inhibit the transmission of certain viruses, such as dengue, chikungunya, yellow fever, West Nile, as well as the infectivity of the malaria-causing protozoan, Plasmodium and filarial nematodes. Conclusion: Wolbachia can cause a form of conditional sterility that can be used to suppress populations of mosquitoes and additional medically important insects. Thus, Wolbachia, a pandemic endosymbiont, offers great potential for elimination of a wide-variety of devastating human diseases.

  4. Circulating microbial products and acute phase proteins as markers of pathogenesis in lymphatic filarial disease.

    Directory of Open Access Journals (Sweden)

    R Anuradha

    Full Text Available Lymphatic filariasis can be associated with development of serious pathology in the form of lymphedema, hydrocele, and elephantiasis in a subset of infected patients. Dysregulated host inflammatory responses leading to systemic immune activation are thought to play a central role in filarial disease pathogenesis. We measured the plasma levels of microbial translocation markers, acute phase proteins, and inflammatory cytokines in individuals with chronic filarial pathology with (CP Ag+ or without (CP Ag- active infection; with clinically asymptomatic infections (INF; and in those without infection (endemic normal [EN]. Comparisons between the two actively infected groups (CP Ag+ compared to INF and those without active infection (CP Ag- compared to EN were used preliminarily to identify markers of pathogenesis. Thereafter, we tested for group effects among all the four groups using linear models on the log transformed responses of the markers. Our data suggest that circulating levels of microbial translocation products (lipopolysaccharide and LPS-binding protein, acute phase proteins (haptoglobin and serum amyloid protein-A, and inflammatory cytokines (IL-1β, IL-12, and TNF-α are associated with pathogenesis of disease in lymphatic filarial infection and implicate an important role for circulating microbial products and acute phase proteins.

  5. New and emerging pathogens in canine infectious respiratory disease.

    Science.gov (United States)

    Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

    2014-03-01

    Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

  6. Canine vector-borne diseases in Brazil

    Science.gov (United States)

    Dantas-Torres, Filipe

    2008-01-01

    Canine vector-borne diseases (CVBDs) are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi), bacteria (e.g., Anaplasma platys and Ehrlichia canis), and helminths (e.g., Dirofilaria immitis and Dipylidium caninum) that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance) of CVBDs in Brazil and discusses research gaps to be addressed in future studies. PMID:18691408

  7. Canine vector-borne diseases in Brazil

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe

    2008-08-01

    Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.

  8. Ecology of genus Porphyromonas in canine periodontal disease.

    Science.gov (United States)

    Isogai, H; Kosako, Y; Benno, Y; Isogai, E

    1999-09-01

    Asaccharolytic pigmented Porphyromonas species, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were isolated from the plaque of adult dogs, but not from any oral sites of puppies and adolescent dogs. With age-dependency, the proportion of Porphyromonas species in the flora of plaque increased. Isolation of the genus Porphyromonas was clearly associated with the progress of periodontol disease. We suggested that Porphyromonas is the exogenous organism and obligate pathogen for canine periodontal diseases.

  9. Human innate lymphoid cells (ILCs) in filarial infections.

    Science.gov (United States)

    Bonne-Année, S; Nutman, T B

    2018-02-01

    Filarial infections are characteristically chronic and can cause debilitating diseases governed by parasite-induced innate and adaptive immune responses. Filarial parasites traverse or establish niches in the skin (migrating infective larvae), in nonmucosal tissues (adult parasite niche) and in the blood or skin (circulating microfilariae) where they intersect with the host immune response. While several studies have demonstrated that filarial parasites and their antigens can modulate myeloid cells (monocyte, macrophage and dendritic cell subsets), T- and B-lymphocytes and skin resident cell populations, the role of innate lymphoid cells during filarial infections has only recently emerged. Despite the identification and characterization of innate lymphoid cells (ILCs) in murine helminth infections, little is actually known about the role of human ILCs during parasitic infections. The focus of this review will be to highlight the composition of ILCs in the skin, lymphatics and blood; where the host-parasite interaction is well-defined and to examine the role of ILCs during filarial infections. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  10. Detection of canine pneumovirus in dogs with canine infectious respiratory disease.

    Science.gov (United States)

    Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe

    2013-12-01

    Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.

  11. Considerations for using minocycline vs doxycycline for treatment of canine heartworm disease.

    Science.gov (United States)

    Papich, Mark G

    2017-11-09

    Doxycycline has been considered the first drug of choice for treating Wolbachia, a member of the Rickettsiaceae, which has a symbiotic relationship with filarial worms, including heartworms. Wolbachia, is susceptible to tetracyclines, which have been used as adjunctive treatments for heartworm disease. Treatment with doxycycline reduces Wolbachia numbers in all stages of heartworms and improves outcomes and decreased microfilaremia in dogs treated for heartworm disease. The American Heartworm Society recommends treatment with doxycycline in dogs diagnosed with heartworm disease at a dose of 10 mg/kg twice daily for 28 days. If doxycycline is not available, minocycline can be considered as a substitute. However, minocycline has not undergone an evaluation in dogs with heartworm disease, nor has an effective dose been established. Minocycline is an attractive option because of the higher cost of doxycycline and new pharmacokinetic information for dogs that provides guidance for appropriate dosage regimens to achieve pharmacokinetic-pharmacodynamic (PK-PD) targets. Published reports from the Anti-Wolbachia Consortium (A-WOL) indicate superior in vitro activity of minocycline over doxycycline. Studies performed in mouse models to measure anti-Wolbachia activity showed that minocycline was 1.7 times more effective than doxycycline, despite a 3-fold lower pharmacokinetic exposure. To achieve the same exposure as achieved in the mouse infection model, a pharmacokinetic-pharmacodynamic (PK-PD) analysis was conducted to determine optimal dosages for dogs. The analysis showed that an oral minocycline dose of 3.75 to 5 mg/kg administered twice daily would attain similar targets as observed in mice and predicted for human infections. There are potentially several advantages for use of minocycline in animals. It is well absorbed from oral administration, it has less protein binding than doxycycline (65% vs 92%) allowing for better distribution into tissue, and it is

  12. Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology.

    Science.gov (United States)

    Fenger, Joelle M; London, Cheryl A; Kisseberth, William C

    2014-01-01

    Osteosarcoma (OSA) is the most common form of malignant bone cancer in children and dogs, although the disease occurs in dogs approximately 10 times more frequently than in people. Multidrug chemotherapy and aggressive surgical techniques have improved survival; however, new therapies for OSA are critical, as little improvement in survival times has been achieved in either dogs or people over the past 15 years, even with significant efforts directed at the incorporation of novel therapeutic approaches. Both clinical and molecular evidence suggests that human and canine OSA share many key features, including tumor location, presence of microscopic metastatic disease at diagnosis, development of chemotherapy-resistant metastases, and altered expression/activation of several proteins (e.g. Met, ezrin, phosphatase and tensin homolog, signal transducer and activator of transcription 3), and p53 mutations, among others. Additionally, canine and pediatric OSA exhibit overlapping transcriptional profiles and shared DNA copy number aberrations, supporting the notion that these diseases are similar at the molecular level. This review will discuss the similarities between pediatric and canine OSA with regard to histology, biologic behavior, and molecular genetic alterations that indicate canine OSA is a relevant, spontaneous, large animal model of the pediatric disease and outline how the study of naturally occurring OSA in dogs will offer additional insights into the biology and future treatment of this disease in both children and dogs. © The Author 2014. Published by Oxford University Press on behalf of the Institute for Laboratory Animal Research. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Effect of Japanese Green Tea Extract on Canine Periodontal Diseases

    OpenAIRE

    Isogai, E.; Isogai, H.; Kimura, K.; Nishikawa, T.; Fujii, N.; Benno, Y.

    2011-01-01

    Asaccharolytic pigmented Porphyromonas strains were isolated from the plaque of dogs with gingivitis and periodontitis. Various species of Porphyromonas, including P. endodontalis, P. gingivalis, P. circumdentaria and unclassified species, were detectable. Canine Porphyromonas were sensitive to Japanese green tea extract (JGTE). We examined the effects of dietary JGTE on periodontal diseases. A special diet was prepared on the basis of the minimum inhibitory concentration (MIC: 0.8 mg/ml) of ...

  14. Magnetic resonance imaging of canine degenerative lumbar spine diseases

    International Nuclear Information System (INIS)

    Karkkainen, M.; Punto, L.U.; Tulamo, R.M.

    1993-01-01

    Degenerative lumbar spine diseases, i.e., sacrolumbar stenosis, intervertebral disk degeneration and protrusion and spondylosis deformans of the canine lumbar spine were studied in eleven canine patients and three healthy controls using radiography and 0.02 T and 0.04 T low field magnetic resonance imaging. The T1 and T2 weighted images were obtained in sagittal and transverse planes. The loss of hydration of nucleus pulposus, taken as a sign of degeneration in the intervertebral disks, could be evaluated in both T1 and T2 weighted images. As a noninvasive method magnetic resonance imaging gave more exact information about the condition of intervertebral disks than did radiography. Sacrolumbar stenosis and compression of the spinal cord or cauda equina and surrounding tissue could be evaluated without contrast medium

  15. Glycogen storage disease type Ia in canines: a model for human metabolic and genetic liver disease.

    Science.gov (United States)

    Specht, Andrew; Fiske, Laurie; Erger, Kirsten; Cossette, Travis; Verstegen, John; Campbell-Thompson, Martha; Struck, Maggie B; Lee, Young Mok; Chou, Janice Y; Byrne, Barry J; Correia, Catherine E; Mah, Cathryn S; Weinstein, David A; Conlon, Thomas J

    2011-01-01

    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including "lactic acidosis", larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  16. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    Directory of Open Access Journals (Sweden)

    Andrew Specht

    2011-01-01

    Full Text Available A canine model of Glycogen storage disease type Ia (GSDIa is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size, and longer lifespan compared to other animal models. Use of this model in preclinical trials of gene therapy is described and briefly compared to the murine model. Although the canine model offers a number of advantages for evaluating potential therapies for GSDIa, there are also some significant challenges involved in its use. Despite these challenges, the canine model of GSDIa should continue to provide valuable information about the potential for generating curative therapies for GSDIa as well as other genetic hepatic diseases.

  17. Glycogen Storage Disease Type Ia in Canines: A Model for Human Metabolic and Genetic Liver Disease

    OpenAIRE

    Specht, Andrew; Fiske, Laurie; Erger, Kirsten; Cossette, Travis; Verstegen, John; Campbell-Thompson, Martha; Struck, Maggie B.; Lee, Young Mok; Chou, Janice Y.; Byrne, Barry J.; Correia, Catherine E.; Mah, Cathryn S.; Weinstein, David A.; Conlon, Thomas J.

    2011-01-01

    A canine model of Glycogen storage disease type Ia (GSDIa) is described. Affected dogs are homozygous for a previously described M121I mutation resulting in a deficiency of glucose-6-phosphatase-α. Metabolic, clinicopathologic, pathologic, and clinical manifestations of GSDIa observed in this model are described and compared to those observed in humans. The canine model shows more complete recapitulation of the clinical manifestations seen in humans including “lactic acidosis”, larger size,...

  18. Study on clinical symptoms in canine cardiac diseases

    Directory of Open Access Journals (Sweden)

    F. Karlette Anne

    Full Text Available Cardiac diseases in canines are an extensively studied phenomenon all over the world but meagre information has been reported in India. Certain problems, including historical, physical, and laboratory abnormalities, are associated with cardiovascular or pulmonary disease. In India however, the recognition of canine cardiac diseases has been delayed, and ignored on account of lack of awareness and knowledge by the owner and inadequate diagnostic facility to a field veterinarian. Considering the above facts, the present study was undertaken in Gujarat to survey the prevalence of common cardiac diseases in hospital population of dogs along with the clinical symptoms which often goes undetected due to lack of proper diagnostic techniques to be implied and the most forms of heart disease may be present for many years before any evidence of failure develops. In the present study most of the clinical cases of cardiac diseases were presented with a history of nocturnal coughing (seven cases; 2.55%, exercise intolerance (five cases; 1.82%, partial or complete anorexia (five cases; 1.82%, swelling in abdominal area (four cases; 1.45%, dullness and depression (two cases; 0.72%, cachexia and hepatojugular pulsation (one case each; 0.36% each at times. [Vet World 2009; 2(8.000: 307-309

  19. Interspecies dynamics among bacteria associated with canine periodontal disease.

    Science.gov (United States)

    Sanguansermsri, P; Nobbs, A H; Jenkinson, H F; Surarit, R

    2018-02-01

    The etiology and pathogenic mechanisms associated with canine periodontal disease are less well understood than the disease in humans. In this study we have reconstructed defined consortia biofilms in vitro of microorganisms identified as prevalent in a same-breed cohort of dogs with or without periodontal disease. Frederiksenia canicola and Neisseria canis were selected as potential early colonizers of salivary pellicle, and Fusobacterium nucleatum and Porphyromonas gulae were included as high incidence canine oral bacteria. N. canis formed a biofilm substratum under aerobic conditions, but was unable to tolerate anaerobic conditions. Fr. canicola exhibited synergistic biofilm growth with Po. gulae under anaerobic conditions, but displayed an antagonistic relationship with Fu. nucleatum. However, strong co-adhesion between Fu. nucleatum and Po. gulae was able to overcome the inhibitory effects of Fr. canicola to facilitate three-species biofilm formation. Parvimonas micra, an anaerobic, asaccharolytic Gram-positive coccus found only under disease conditions in vivo, was able to form biofilms in conjunction with Fr. canicola and Po. gulae. Furthermore, the specific proteolytic activities of biofilms containing Fr. canicola and Po. gulae or Fu. nucleatum and Po. gulae were increased several-fold upon the addition of Pa. micra. This suggests that anaerobic cocci such as Pa. micra might provide a catalyst for progressive tissue destruction, inflammation and alveolar bone loss in canine periodontal disease, in keeping with the keystone-pathogen hypothesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. A survey of canine tick-borne diseases in India

    Directory of Open Access Journals (Sweden)

    Coleman Glen T

    2011-07-01

    Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.

  1. Canine Degenerative Valve Disease: A Case Report

    Directory of Open Access Journals (Sweden)

    Carmenza Janneth Benavides Melo

    2014-07-01

    Full Text Available Degenerative valvular disease or endocardiosis is the most common cardiovascular pathology in dogs. It is characterized by regurgitation of blood into the atria with decreased cardiac output, leading to volume overload with eccentric hypertrophy and congestive heart failure. This report describes the clinical and autopsy findings of a dog, suggestive of valvular endocardiosis. The patient was admitted to the outpatient Veterinary Clinic “Carlos Martínez Hoyos” at the University of Nariño (Pasto, Colombia. His owner said the dog was sick for two months, with signs of respiratory disease, weight loss, and decay. Clinical examination showed very pale mucous membranes, inspiratory dyspnea, rale, split S2, grade 4 mid-systolic murmur of regurgitation, and abdominal dilatation with sign of positive shock wave. Necropsy evidenced plenty of translucent watery material in the abdominal, chest and pericardium cavity, severely enlarged and rounded heart with thickened atrioventricular valves, moderate reduction in liver size and signs of lobulation, severely diminished and pale kidneys with irregular surface showing the presence of multiple cystic areas in corticomedullary region. Samples were taken from these tissues and fixed in 10% buffered formalin to be processed for histopathological analysis at the Laboratory of Pathology at the University of Nariño, using hematoxylin and eosin stain. This way, degenerative valvular disease was diagnosed.

  2. Polyanhydride Nanoparticle Delivery Platform Dramatically Enhances Killing of Filarial Worms.

    Directory of Open Access Journals (Sweden)

    Andrea M Binnebose

    Full Text Available Filarial diseases represent a significant social and economic burden to over 120 million people worldwide and are caused by endoparasites that require the presence of symbiotic bacteria of the genus Wolbachia for fertility and viability of the host parasite. Targeting Wolbachia for elimination is a therapeutic approach that shows promise in the treatment of onchocerciasis and lymphatic filariasis. Here we demonstrate the use of a biodegradable polyanhydride nanoparticle-based platform for the co-delivery of the antibiotic doxycycline with the antiparasitic drug, ivermectin, to reduce microfilarial burden and rapidly kill adult worms. When doxycycline and ivermectin were co-delivered within polyanhydride nanoparticles, effective killing of adult female Brugia malayi filarial worms was achieved with approximately 4,000-fold reduction in the amount of drug used. Additionally the time to death of the macrofilaria was also significantly reduced (five-fold when the anti-filarial drug cocktail was delivered within polyanhydride nanoparticles. We hypothesize that the mechanism behind this dramatically enhanced killing of the macrofilaria is the ability of the polyanhydride nanoparticles to behave as a Trojan horse and penetrate the cuticle, bypassing excretory pumps of B. malayi, and effectively deliver drug directly to both the worm and Wolbachia at high enough microenvironmental concentrations to cause death. These provocative findings may have significant consequences for the reduction in the amount of drug and the length of treatment required for filarial infections in terms of patient compliance and reduced cost of treatment.

  3. Filarial parasites develop faster and reproduce earlier in response to host immune effectors that determine filarial life expectancy.

    Science.gov (United States)

    Babayan, Simon A; Read, Andrew F; Lawrence, Rachel A; Bain, Odile; Allen, Judith E

    2010-10-19

    Humans and other mammals mount vigorous immune assaults against helminth parasites, yet there are intriguing reports that the immune response can enhance rather than impair parasite development. It has been hypothesized that helminths, like many free-living organisms, should optimize their development and reproduction in response to cues predicting future life expectancy. However, immune-dependent development by helminth parasites has so far eluded such evolutionary explanation. By manipulating various arms of the immune response of experimental hosts, we show that filarial nematodes, the parasites responsible for debilitating diseases in humans like river blindness and elephantiasis, accelerate their development in response to the IL-5 driven eosinophilia they encounter when infecting a host. Consequently they produce microfilariae, their transmission stages, earlier and in greater numbers. Eosinophilia is a primary host determinant of filarial life expectancy, operating both at larval and at late adult stages in anatomically and temporally separate locations, and is implicated in vaccine-mediated protection. Filarial nematodes are therefore able to adjust their reproductive schedules in response to an environmental predictor of their probability of survival, as proposed by evolutionary theory, thereby mitigating the effects of the immune attack to which helminths are most susceptible. Enhancing protective immunity against filarial nematodes, for example through vaccination, may be less effective at reducing transmission than would be expected and may, at worst, lead to increased transmission and, hence, pathology.

  4. Filarial parasites develop faster and reproduce earlier in response to host immune effectors that determine filarial life expectancy.

    Directory of Open Access Journals (Sweden)

    Simon A Babayan

    Full Text Available Humans and other mammals mount vigorous immune assaults against helminth parasites, yet there are intriguing reports that the immune response can enhance rather than impair parasite development. It has been hypothesized that helminths, like many free-living organisms, should optimize their development and reproduction in response to cues predicting future life expectancy. However, immune-dependent development by helminth parasites has so far eluded such evolutionary explanation. By manipulating various arms of the immune response of experimental hosts, we show that filarial nematodes, the parasites responsible for debilitating diseases in humans like river blindness and elephantiasis, accelerate their development in response to the IL-5 driven eosinophilia they encounter when infecting a host. Consequently they produce microfilariae, their transmission stages, earlier and in greater numbers. Eosinophilia is a primary host determinant of filarial life expectancy, operating both at larval and at late adult stages in anatomically and temporally separate locations, and is implicated in vaccine-mediated protection. Filarial nematodes are therefore able to adjust their reproductive schedules in response to an environmental predictor of their probability of survival, as proposed by evolutionary theory, thereby mitigating the effects of the immune attack to which helminths are most susceptible. Enhancing protective immunity against filarial nematodes, for example through vaccination, may be less effective at reducing transmission than would be expected and may, at worst, lead to increased transmission and, hence, pathology.

  5. Molecular identification of bacteria associated with canine periodontal disease.

    Science.gov (United States)

    Riggio, Marcello P; Lennon, Alan; Taylor, David J; Bennett, David

    2011-06-02

    Periodontal disease is one of the most common diseases of adult dogs, with up to 80% of animals affected. The aetiology of the disease is poorly studied, although bacteria are known to play a major role. The purpose of this study was to identify the bacteria associated with canine gingivitis and periodontitis and to compare this with the normal oral flora. Swabs were obtained from the gingival margin of three dogs with gingivitis and three orally healthy controls, and subgingival plaque was collected from three dogs with periodontitis. Samples were subjected to routine bacterial culture. The prevalent species identified in the normal, gingivitis and periodontitis groups were uncultured bacterium (12.5% of isolates), Bacteroides heparinolyticus/Pasteurella dagmatis (10.0%) and Actinomyces canis (19.4%), respectively. Bacteria were also identified using culture-independent methods (16S rRNA gene sequencing) and the predominant species identified were Pseudomonas sp. (30.9% of clones analysed), Porphyromonas cangingivalis (16.1%) and Desulfomicrobium orale (12.0%) in the normal, gingivitis and periodontitis groups, respectively. Uncultured species accounted for 13.2%, 2.0% and 10.5%, and potentially novel species for 38.2%, 38.3% and 35.3%, of clones in the normal, gingivitis and periodontitis groups, respectively. This is the first study to use utilise culture-independent methods for the identification of bacteria associated with this disease. It is concluded that the canine oral flora in health and disease is highly diverse and also contains a high proportion of uncultured and, in particular, potentially novel species. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. The burden of non-filarial elephantiasis in Ethiopia.

    Science.gov (United States)

    Animut, Abebe

    2007-12-01

    Although known for many years, non-filarial elephantiasis remains a public health problem in tropical Africa, including the farming community of Ethiopia. The problem may be exacerbated in women who shoulder most of the burden of agricultural labour in the countryside. The intention of this brief review is to emphasise the burden of the disease and to alert researchers and organisations concerned with health care and prevention.

  7. The "filarial dance" is not characteristic of filariasis: observations of "dancing megasperm" on high-resolution sonography in patients from nonendemic areas mimicking the filarial dance and a proposed mechanism for this phenomenon.

    Science.gov (United States)

    Adejolu, Margaret; Sidhu, Paul S

    2011-08-01

    The objective of this series was to show that the sonographic appearance described as the "filarial dance" is not characteristic of filariasis but occurs in nonendemic areas as a manifestation of epididymal obstruction. An experienced observer documented cases after initial observation of the filarial dance in routine clinical practice using high-frequency linear array transducers. The filarial dance was described as excessive to-and-fro movement of echogenic particles within a prominent epididymis and graded 1 to 4 according to the extent and distribution of the abnormality. The country of birth, exposure to filarial infection or travel to a filarial-endemic area, previous scrotal surgery including vasectomy, any previous or current scrotal inflammatory disease, and any congenital testicular abnormalities were recorded. Over a 10-year period, sonographic appearances consistent with the filarial dance were observed in 18 patients (bilateral in 6). The mean patient age was 47.7 (range, 28-91) years. The abnormality was graded in the 24 affected testes as follows: grade 1, n = 3; grade 2, n = 8; grade 3, n = 8; and grade 4, n = 5. No patient had a history of filariasis or travel to an endemic area. Six of 18 patients (33.3%) had bilateral vasectomies; 5 (27.8%) had a history of epididymo-orchitis in the ipsilateral testis; 3 (16.7%) had previous scrotal surgery; and 4 (22.2%) had no relevant urologic history. We have described a sonographic appearance identical to the filarial dance in men with no history of filarial infection. Most had previous scrotal surgery or infection, suggesting that the filarial dance may not always be due to movement of filarial worms. The unifying condition in patients with filariasis and our patients is lymphatic obstruction, likely the underlying cause of the appearance in both groups.

  8. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio

    2016-08-30

    A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Disease Modeling and Gene Therapy of Copper Storage Disease in Canine Hepatic Organoids

    Directory of Open Access Journals (Sweden)

    Sathidpak Nantasanti

    2015-11-01

    Full Text Available The recent development of 3D-liver stem cell cultures (hepatic organoids opens up new avenues for gene and/or stem cell therapy to treat liver disease. To test safety and efficacy, a relevant large animal model is essential but not yet established. Because of its shared pathologies and disease pathways, the dog is considered the best model for human liver disease. Here we report the establishment of a long-term canine hepatic organoid culture allowing undifferentiated expansion of progenitor cells that can be differentiated toward functional hepatocytes. We show that cultures can be initiated from fresh and frozen liver tissues using Tru-Cut or fine-needle biopsies. The use of Wnt agonists proved important for canine organoid proliferation and inhibition of differentiation. Finally, we demonstrate that successful gene supplementation in hepatic organoids of COMMD1-deficient dogs restores function and can be an effective means to cure copper storage disease.

  10. Canine brucellosis: Epizootiological characteristics, therapy and control of the disease

    Directory of Open Access Journals (Sweden)

    Radojičić Sonja

    2006-01-01

    Full Text Available The paper describes different aspects of canine brucellosis caused by Brucella canis. The disease is present in a large number of countries all over the world, where it inflicts severe economic damages, in particular in the commercial breeding and major dog breeding facilities. The disease was discovered in 1966 in the United States of America, but there were no data about its presence or distribution in our country until 1999. It was established, following the initial investigations, that the prevalence of the disease is extremely high, and that it amounted to 4.27% among pet dogs in the territory of Belgrade. Investigations of stray dogs in the territory of Podgorica showed that the seroprevalence (an equal titer or higher than 1/200 was 9.37%, while the prevalence among stray dogs in the territory of Belgrade was 10.87%. Data for other parts of Serbia are mostly lacking, and the seroprevalence for stray dogs in the Municipality of Pozarevac amounted to over 15%, while not a single serologically positive case was found among pet dogs. In addition to the epizootiological specificities of the disease established in our country, isolates of B. canis from the territory of Serbia also indicate digressions in the test of resistance to colors with respect to the referent strain RM6/66. All isolates (SR1-SR-7 are resistant to base fuchsine, and it is probable that this characteristic could also be an important epizootiological marker. Even though the isolation of the cause is the most reliable diagnostic method, it is not possible to achieve this in most cases. That is why one of the most important tasks is to define the most ideal tests for the serological diagnostics of the disease, and the obligation of reporting the disease makes it imperative that wider-scale investigations are conducted and that measures are taken toward reducing the number of positive cases in our country. .

  11. Filarial worms reduce Plasmodium infectivity in mosquitoes.

    Directory of Open Access Journals (Sweden)

    Matthew T Aliota

    2011-02-01

    Full Text Available Co-occurrence of malaria and filarial worm parasites has been reported, but little is known about the interaction between filarial worm and malaria parasites with the same Anopheles vector. Herein, we present data evaluating the interaction between Wuchereria bancrofti and Anopheles punctulatus in Papua New Guinea (PNG. Our field studies in PNG demonstrated that An. punctulatus utilizes the melanization immune response as a natural mechanism of filarial worm resistance against invading W. bancrofti microfilariae. We then conducted laboratory studies utilizing the mosquitoes Armigeres subalbatus and Aedes aegypti and the parasites Brugia malayi, Brugia pahangi, Dirofilaria immitis, and Plasmodium gallinaceum to evaluate the hypothesis that immune activation and/or development by filarial worms negatively impact Plasmodium development in co-infected mosquitoes. Ar. subalbatus used in this study are natural vectors of P. gallinaceum and B. pahangi and they are naturally refractory to B. malayi (melanization-based refractoriness.Mosquitoes were dissected and Plasmodium development was analyzed six days after blood feeding on either P. gallinaceum alone or after taking a bloodmeal containing both P. gallinaceum and B. malayi or a bloodmeal containing both P. gallinaceum and B. pahangi. There was a significant reduction in the prevalence and mean intensity of Plasmodium infections in two species of mosquito that had dual infections as compared to those mosquitoes that were infected with Plasmodium alone, and was independent of whether the mosquito had a melanization immune response to the filarial worm or not. However, there was no reduction in Plasmodium development when filarial worms were present in the bloodmeal (D. immitis but midgut penetration was absent, suggesting that factors associated with penetration of the midgut by filarial worms likely are responsible for the observed reduction in malaria parasite infections.These results could have an

  12. Canine visceral leishmaniasis as a systemic fibrotic disease

    Science.gov (United States)

    Silva, Lucelia C; Castro, Rodrigo S; Figueiredo, Maria M; Michalick, Marilene S M; Tafuri, Washington L; Tafuri, Wagner L

    2013-01-01

    We propose that canine visceral leishmaniasis (CVL) is a systemic fibrotic disease, as evidenced by the wide distribution of fibrosis that we have found in the dogs suffering from chronic condition. The inflammatory cells apparently direct fibrosis formation. Twenty-four cases (symptomatic dogs) were identified from a total of one hundred and five cases that had been naturally infected with Leishmania chagasi and had been documented during an epidemiological survey of CVL carried out by the metropolitan area of the municipality of Belo Horizonte, MG, Brazil. The histological criterion was intralobular liver fibrosis, as has been described previously in dogs with visceral leishmaniasis. In addition to the findings in the liver, here we describe and quantify conspicuous and systemic deposition of collagen in other organs, including spleen, cervical lymph nodes, lung and kidney of all the infected symptomatic dogs. Thus we report that there is a systematic fibrotic picture in these animals, where inflammatory cells appear to direct fibrosis in all organs that have been studied. Therefore we propose that CVL is a systemic fibrotic disease. PMID:23419132

  13. Survey of canine tick-borne diseases in Lábrea, Brazilian Amazon: ‘accidental’ findings of Dirofilaria immitis infection

    Directory of Open Access Journals (Sweden)

    Herbert Sousa Soares

    2014-12-01

    Full Text Available Blood samples were collected from 99 domestic dogs from the urban and rural areas of the Lábrea municipality, state of Amazonas, Brazil. Canine serum samples were tested by immunofluorescence assay against Rickettsia spp., which revealed that only 3.0% (1/33 and 7.6% (5/66 of the dogs from urban and rural areas, respectively, reacted positively to at least one Rickettsia species. DNA was extracted from canine blood and tested by a battery of PCR assays targeting protozoa of the genera Babesia and Hepatozoon, and bacteria of the genera Rickettsia and Ehrlichia and family Anaplasmataceae. All samples were negative in the PCR assays targeting the genera Babesia, Hepatozoon, Ehrlichia and Rickettsia. For Anaplasmataceae, 3% (1/33 and 39.4% (26/66 of the urban and rural dogs, respectively, yielded amplicons that generated DNA sequences 100% identical to the corresponding sequence of Wolbachia endosymbiont of Dirofilaria immitis. Because of these results, all canine DNA samples were further tested in a PCR assay targeting filarial nematodes, which was positive for 18.2% (6/33 and 57.6% (38/66 urban and rural dogs, respectively. Filarial-PCR products generated DNA sequences 100% identical to D. immitis. While tick-borne infections were rare in Lábrea, D. immitis infection rates were among the highest reported in South America.

  14. Electroencephalography as a diagnostic technique for canine neurological diseases

    Directory of Open Access Journals (Sweden)

    Wrzosek Marcin

    2016-06-01

    Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.

  15. Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease

    International Nuclear Information System (INIS)

    Erles, Kerstin; Toomey, Crista; Brooks, Harriet W.; Brownlie, Joe

    2003-01-01

    An investigation into the causes of canine infectious respiratory disease was carried out in a large rehoming kennel. Tissue samples taken from the respiratory tract of diseased dogs were tested for the presence of coronaviruses using RT-PCR with conserved primers for the polymerase gene. Sequence analysis of four positive samples showed the presence of a coronavirus with high similarity to both bovine and human coronavirus (strain OC43) in their polymerase and spike genes, whereas there was a low similarity to comparable genes in the enteric canine coronavirus. This canine respiratory coronavirus (CRCV) was detected by RT-PCR in 32/119 tracheal and 20/119 lung samples, with the highest prevalence being detected in dogs with mild clinical symptoms. Serological analysis showed that the presence of antibodies against CRCV on the day of entry into the kennel decreased the risk of developing respiratory disease

  16. European surveillance of emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe

    2017-12-01

    Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. A novel method for objective vision testing in canine models of inherited retinal disease.

    Science.gov (United States)

    Gearhart, Patricia M; Gearhart, Chris C; Petersen-Jones, Simon M

    2008-08-01

    The use of canine models of retinal disease in the development of therapeutic strategies for inherited retinal disorders is a growing area of research. To evaluate accurately the success of potential vision-enhancing treatments, reliable methods for objectively assessing visual function in canine models is necessary. A simple vision-testing device was constructed that consisted of a junction box with four exit tunnels. Dogs were placed in the junction box and given one vision-based choice for exit. The first-choice tunnel and time to exit were recorded and analyzed. Two canine models of retinal disease with distinct molecular defects, a null mutation in the gene encoding the alpha subunit of rod cyclic GMP phosphodiesterase (PDE6A), and a null mutation in the gene encoding a retinal pigment epithelium-specific protein (RPE65) were tested and compared to those in unaffected dogs. With the use of bright light versus dim red light, the test differentiated between unaffected dogs and dogs affected with either mutation with a high degree of certainty. The white-light intensity series showed a significantly different performance between the unaffected and affected dogs. A significant difference in performance was detected between the dogs with each mutation. The results indicate that this novel canine vision-testing method is an accurate and sensitive means of distinguishing between unaffected dogs and dogs affected with two different forms of inherited retinal disease and should be useful as a means of assessing response to therapy in future studies.

  18. Filarial excretory-secretory products induce human monocytes to produce lymphangiogenic mediators.

    Directory of Open Access Journals (Sweden)

    Tiffany Weinkopff

    2014-07-01

    Full Text Available The nematodes Wuchereria bancrofti and Brugia spp. infect over 120 million people worldwide, causing lymphedema, elephantiasis and hydrocele, collectively known as lymphatic filariasis. Most infected individuals appear to be asymptomatic, but many exhibit sub-clinical manifestations including the lymphangiectasia that likely contributes to the development of lymphedema and elephantiasis. As adult worm excretory-secretory products (ES do not directly activate lymphatic endothelial cells (LEC, we investigated the role of monocyte/macrophage-derived soluble factors in the development of filarial lymphatic pathology. We analyzed the production of IL-8, IL-6 and VEGF-A by peripheral blood mononuclear cells (PBMC from naïve donors following stimulation with filarial ES products. ES-stimulated PBMCs produced significantly more IL-8, IL-6 and VEGF-A compared to cells cultured in medium alone; CD14(+ monocytes appear to be the primary producers of IL-8 and VEGF-A, but not IL-6. Furthermore, IL-8, IL-6 and VEGF-A induced in vitro tubule formation in LEC Matrigel cultures. Matrigel plugs supplemented with IL-8, IL-6, VEGF-A, or with supernatants from ES-stimulated PBMCs and implanted in vivo stimulated lymphangiogenesis. Collectively, these data support the hypothesis that monocytes/macrophages exposed to filarial ES products may modulate lymphatic function through the secretion of soluble factors that stimulate the vessel growth associated with the pathogenesis of filarial disease.

  19. Echocardiography as an approach for canine cardiac disease diagnosis

    Directory of Open Access Journals (Sweden)

    P. Singh

    2014-11-01

    Full Text Available Aim: The aim of the study was to establish the methods for diagnosis various canine cardiac ailments using echocardiography. Materials and Methods: M-mode, two-dimensional echocardiography and Doppler studies were performed on 10 cases. Dogs showing signs of cardiac ailment either clinically, radiographic or via electrocardiographic examination were selected for study. Right parasternal short axis view was used for echocardiographic measurements. Right parasternal long axis and left parasternal apical views were used for Doppler studies. Doppler studies were performed at the level of aortic valve and atrioventricular valves for semi quantitative diagnosis of regurgitation. Results: Dogs were found affected with dilated cardiomyopathy (DCM (n=5, pericardial effusion (PE (n=1, combined PE and DCM (n=2 and remaining two showed abnormality on radiographic or electrographically evaluation but were found out to be normal echocardiographically (n=2. Conclusion: Echocardiography is an effective tool for diagnosis of various heart ailments.

  20. Controversial results of therapy with mesenchymal stem cells in the acute phase of canine distemper disease.

    Science.gov (United States)

    Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E

    2016-05-23

    Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms.

  1. Magnetic resonance findings of the corpus callosum in canine and feline lysosomal storage diseases.

    Science.gov (United States)

    Hasegawa, Daisuke; Tamura, Shinji; Nakamoto, Yuya; Matsuki, Naoaki; Takahashi, Kimimasa; Fujita, Michio; Uchida, Kazuyuki; Yamato, Osamu

    2013-01-01

    Several reports have described magnetic resonance (MR) findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats) and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment) of the corpus callosum in juvenile-onset gangliosidoses.

  2. Full-genome analysis of a canine pneumovirus causing acute respiratory disease in dogs, Italy.

    Directory of Open Access Journals (Sweden)

    Nicola Decaro

    Full Text Available An outbreak of canine infectious respiratory disease (CIRD associated to canine pneumovirus (CnPnV infection is reported. The outbreak occurred in a shelter of the Apulia region and involved 37 out of 350 dogs that displayed cough and/or nasal discharge with no evidence of fever. The full-genomic characterisation showed that the causative agent (strain Bari/100-12 was closely related to CnPnVs that have been recently isolated in the USA, as well as to murine pneumovirus, which is responsible for respiratory disease in mice. The present study represents a useful contribution to the knowledge of the pathogenic potential of CnPnV and its association with CIRD in dogs. Further studies will elucidate the pathogenicity and epidemiology of this novel pneumovirus, thus addressing the eventual need for specific vaccines.

  3. Progress and Impact of 13 Years of the Global Programme to Eliminate Lymphatic Filariasis on Reducing the Burden of Filarial Disease

    Science.gov (United States)

    Ramaiah, K. D.; Ottesen, Eric A.

    2014-01-01

    Background A Global Programme to Eliminate Lymphatic Filariasis was launched in 2000, with mass drug administration (MDA) as the core strategy of the programme. After completing 13 years of operations through 2012 and with MDA in place in 55 of 73 endemic countries, the impact of the MDA programme on microfilaraemia, hydrocele and lymphedema is in need of being assessed. Methodology/Principal findings During 2000–2012, the MDA programme made remarkable achievements – a total of 6.37 billion treatments were offered and an estimated 4.45 billion treatments were consumed by the population living in endemic areas. Using a model based on empirical observations of the effects of treatment on clinical manifestations, it is estimated that 96.71 million LF cases, including 79.20 million microfilaria carriers, 18.73 million hydrocele cases and a minimum of 5.49 million lymphedema cases have been prevented or cured during this period. Consequently, the global prevalence of LF is calculated to have fallen by 59%, from 3.55% to 1.47%. The fall was highest for microfilaraemia prevalence (68%), followed by 49% in hydrocele prevalence and 25% in lymphedema prevalence. It is estimated that, currently, i.e. after 13 years of the MDA programme, there are still an estimated 67.88 million LF cases that include 36.45 million microfilaria carriers, 19.43 million hydrocele cases and 16.68 million lymphedema cases. Conclusions/Significance The MDA programme has resulted in significant reduction of the LF burden. Extension of MDA to all at-risk countries and to all regions within those countries where MDA has not yet reached 100% geographic coverage is imperative to further reduce the number of microfilaraemia and chronic disease cases and to reach the global target of interrupting transmission of LF by 2020. PMID:25412180

  4. A Clinico- Epidemiological Study Of Filarial Related Orthopaedic Manifestations

    Directory of Open Access Journals (Sweden)

    Patond K.R

    1992-01-01

    Full Text Available An epidemiological study was undertaken to study the incidence and distribution of orthopaedic manifestations of filariasis in an endemic area. A total of 207 cases were clinically examined and investigated. Patients were divided into three groups , viz., Group A: Orthopaedic manifestations with no history of filariasis . Group B: Orthopaedic manifestations with history of filariasis such as microfilaraemia or filarial fevers etc., Group C: Orthopaedic manifestations with chronic manifestations such as elephantiasis, hydrocele etc. To confirm filarial etiology, all the cases were examined for the presence of filarial antibody by indirect ELISA using wuchereda bancrofti microfilarial excretory- secretary antigen (wd Mf ESAg . A total of 61 of 102 patients of Group A, 14 of 21 patients of group B, and 73 of 84 patients of Group C were positive for filarial antibody. This study showed the prevalence of filarial antibody in about 71.4% of various orthopaedic manifestations.

  5. ANTIGENAEMIA AS AN INDICATOR OF FILARIAL ENDEMICITY

    Directory of Open Access Journals (Sweden)

    F. Partono

    2012-09-01

    Full Text Available This is a report of 1 -year evaluation of chemotherapeutic intervention in an area of Indonesia endemic for lymphatic filariasis. Control measures were initiated in 1977 by parasite control, informal health educa­tion, and community participation at the village level, well in accord with the WHO-concept of health for all. Diethylcarbamazine (DEC was mass distributed in 1977 and 1988, and selectively distributed in 1978, 1979, 1981, and 1982 to those who were micro-filaraemic prior to DEC treatments, those with a history of adenoly mphangitis over the previous one year period, and to all new comers. In addition, each villager with acute symptoms of adenolymphangitis was immediately treated with a single course of 300 mg DEC for 10 days. No intervention measures were taken between 1982 to 1988, and no attempt was taken to control the vector or to restrict movement between controlled and uncontrolled areas during the whole studies. With these measures, the microfilaria (mf rate decreased from 30% to 0%, the adenolymphangitis rate from 46% to 11%, and the elephantiasis rate from 35% to 3%. The abatement of acute and chronic filarial symptoms over the study period and the disappearance of microfilaremia in the community are pointing towards the possibility of eradicating the partasite from the community. To test this hypothesis, serum samples were tested for circulating filarial antigen by a two-site antigen capture assay employing anti-phosphorylcholine monoclonal antibodies. There was a sharp fall in circulating antigenaemia, demonstrating that infection has either been eliminated from nearly all villagers, or that intensity of infection is now undetectably low. We feel that antigenaemia can be used as an indicator of filarial endemicity.

  6. How patient positioning affects radiographic signs of canine lung disease

    International Nuclear Information System (INIS)

    Steyn, P.F.; Green, R.W.

    1990-01-01

    A single radiographic projection risks missing signs of lung disease. Four case reports of dogs are given to emphasize inadequate visualization with just one or two radiographs. It is advisable to take both right and left lateral views along with a dorsoventral view in a patient, that might have lung disease

  7. Prevention approaches in a preclinical canine model of Alzheimer’s disease: Benefits and challenges

    Directory of Open Access Journals (Sweden)

    Paulina R. Davis

    2014-03-01

    Full Text Available Aged dogs spontaneously develop many features of human aging and Alzheimer’s disease (AD including cognitive decline and neuropathology. In this review, we discuss age-dependent learning tasks, memory tasks, and functional measures that can be used in aged dogs for sensitive treatment outcome measures. Neuropathology that is linked to cognitive decline is described along with examples of treatment studies that show reduced neuropathology in aging dogs (dietary manipulations, behavioral enrichment, immunotherapy, and statins. Studies in canine show that multi-targeted approaches may be more beneficial than single pathway manipulations (e.g. antioxidants combined with behavioral enrichment. Aging canine studies show good predictive validity for human clinical trials outcomes (e.g. immunotherapy and several interventions tested in dogs strongly support a prevention approach (e.g. immunotherapy and statins. Further, dogs are ideally suited for prevention studies as they the age because onset of cognitive decline and neuropathology strongly support longitudinal interventions that can be completed within a 3-5 year period. Disadvantages to using the canine model are that they lengthy, use labor-intensive comprehensive cognitive testing, and involve costly housing (almost as high as that of nonhuman primates. However overall, using the dog as a preclinical model for testing preventive approaches for AD may complement work in rodents and nonhuman primates.

  8. Magnetic resonance findings of the corpus callosum in canine and feline lysosomal storage diseases.

    Directory of Open Access Journals (Sweden)

    Daisuke Hasegawa

    Full Text Available Several reports have described magnetic resonance (MR findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment of the corpus callosum in juvenile-onset gangliosidoses.

  9. Magnetic Resonance Findings of the Corpus Callosum in Canine and Feline Lysosomal Storage Diseases

    Science.gov (United States)

    Hasegawa, Daisuke; Tamura, Shinji; Nakamoto, Yuya; Matsuki, Naoaki; Takahashi, Kimimasa; Fujita, Michio; Uchida, Kazuyuki; Yamato, Osamu

    2013-01-01

    Several reports have described magnetic resonance (MR) findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats) and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment) of the corpus callosum in juvenile-onset gangliosidoses. PMID:24386203

  10. The Prevalence of Canine Oral Protozoa and Their Association with Periodontal Disease.

    Science.gov (United States)

    Patel, Niran; Colyer, Alison; Harris, Steve; Holcombe, Lucy; Andrew, Peter

    2017-05-01

    Periodontal disease is one of the most important health concerns for companion animals. Research into canine forms of periodontitis has focused on the identification and characterization of the bacterial communities present. However, other microorganisms are known to inhabit the oral cavity and could also influence the disease process. A novel, broad spectrum 18S PCR was developed and used, in conjunction with next-generation sequencing analyses to target the identification of protists. Trichomonas sp. and Entamoeba sp. were identified from 92 samples of canine plaque. The overall prevalence of trichomonads was 56.52% (52/92) and entamoebae was 4.34% (4/92). Next-generation sequencing of pooled healthy, gingivitis, early-stage periodontitis, and severe periodontitis samples revealed the proportion of trichomonad sequences to be 3.51% (health), 2.84% (gingivitis), 6.07% (early periodontitis), and 35.04% (severe periodontitis), respectively, and entamoebae to be 0.01% (health), 0.01% (gingivitis), 0.80% (early-stage periodontitis), and 7.91% (severe periodontitis) respectively. Both genera of protists were statistically associated with plaque from dogs with periodontal disease. These findings provide the first conclusive evidence for the presence of oral protozoa in dog plaque and suggest a possible role for protozoa in the periodontal disease process. © 2016 The Author(s) The Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  11. Canine stage 1 periodontal disease: a latent pathology.

    Science.gov (United States)

    Whyte, A; Bonastre, C; Monteagudo, L V; Les, F; Obon, J; Whyte, J; Tejedor, M T

    2014-07-01

    To evaluate the potential health issues associated with periodontal disease (PD) in dogs, 1004 teeth from 25 dogs were examined. The dogs were randomly selected, aged 2-14 years, and had at least 95% of their teeth at the first PD stage. Significant positive correlations between plaque grade (PG) and gum inflammation, gingival regression, periodontal pocket, age and serum alanine aminotransferase (ALT) activity were identified. In contrast, PG was negatively correlated to total platelet count. Altogether, these findings suggest that prevention and therapy at the first PD stages can have an important impact on the general health condition of dogs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Investigation of cell-free DNA in canine plasma and its relation to disease.

    Science.gov (United States)

    Burnett, Deborah L; Cave, Nicholas J; Gedye, Kristene R; Bridges, Janis P

    2016-09-01

    DNA is released from dying cells during apoptosis and necrosis. This cell-free DNA (cfDNA) diffuses into the plasma where it can be measured. In humans, an increase in cfDNA correlates with disease severity and prognosis. It was hypothesized that when DNA in canine plasma was measured by emission fluorometry without prior DNA extraction, the concentration of cfDNA would increase with disease severity. The diseased population consisted of 97 client-owned dogs. The clinically normal population consisted of nine client-owned dogs presenting for 'wellness screens', and 15 colony-owned Harrier Hounds. Plasma cfDNA was measured by fluorometry without prior DNA extraction. The effects of ex vivo storage conditions were evaluated in plasma from two clinically normal dogs. In all other dogs, plasma was separated within two hours of collection. The association between the cfDNA concentration in hospitalized dogs and a variety of clinical, clinicopathological and outcome variables was tested. The concentration of cfDNA was reliably measured when plasma was separated within two hours of blood collection. The diseased dogs had significantly higher cfDNA than clinically normal dogs (P Dogs that did not survive to discharge had significantly higher cfDNA concentrations than survivors (P = 0.02). Conclusions/Clinical Importance: The concentration of cfDNA in the plasma of diseased dogs is associated with disease severity and prognosis. Measurement of canine cfDNA could be a useful non-specific disease indicator and prognostic tool.

  13. Canine periodontal disease control using a clindamycin hydrochloride gel.

    Science.gov (United States)

    Johnston, Thomas P; Mondal, Pravakar; Pal, Dhananjay; MacGee, Scott; Stromberg, Arnold J; Alur, Hemant

    2011-01-01

    Stabilizing or reducing periodontal pocket depth can have a positive influence on the retention of teeth in dogs. A topical 2% clindamycin hydrochloride gel (CHgel) was evaluated for the treatment of periodontal disease in dogs. The CHgel formulation provides for the sustained erosion of the matrix, but also flows into the periodontal pocket as a viscous liquid, and then rapidly forms a gel that has mucoadhesive properties and also may function as a physical barrier to the introduction of bacteria. A professional teeth cleaning procedure including scaling and root planing was done in dogs with one group receiving CHgel following treatment. Periodontal health was determined before and after the procedure including measurement of periodontal pocket depth, gingival index, gingival bleeding sites, and number of suppurating sites. There was a statistically significant decrease in periodontal pocket depth (19%), gingival index (16%), and the number of bleeding sites (64%) at 90-days in dogs receiving CHgel. Additionally, the number of suppurating sites was lower (93%) at 90-days for the group receiving CHgel. The addition of CHgel effectively controlled the bacterial burden (e.g, Fusobacterium nucleatum) at both day 14 and 90. Gingival cells in culture were shown to rapidly incorporate clindamycin and attain saturation in approximately 20-minutes. In summary, a professional teeth cleaning procedure including root planning and the addition of CHgel improves the gingival index and reduces periodontal pocket depth.

  14. Histopathological retrospective study of canine renal disease in Korea, 2003~2008

    Science.gov (United States)

    Yhee, Ji-Young; Yu, Chi-Ho; Kim, Jong-Hyuk; Im, Keum-Soon; Chon, Seung-Ki

    2010-01-01

    Renal disease includes conditions affecting the glomeruli, tubules, interstitium, pelvis, and vasculature. Diseases of the kidney include glomerular diseases, diseases of the tubules and interstitium, diseases of renal pelvis, and developmental abnormalities. Renal tissue samples (n = 70) submitted to the Department of Veterinary Pathology of Konkuk University from 2003 to 2008 were included in this study. Tissue histopathology was performed using light microscopy with hematoxylin and eosin stains. Masson's trichrome, Congo Red, and Warthin starry silver staining were applied in several individual cases. Glomerular diseases (22.9%), tubulointerstitial diseases (8.6%), neoplastic diseases (8.6%), conditions secondary to urinary obstruction (24.3%), and other diseases (35.7%) were identified. Glomerulonephritis (GN) cases were classified as acute proliferative GN (5.7%), membranous GN (4.3%), membranoproliferative GN (4.3%), focal segmental GN (2.9%), and other GN (4.2%). The proportion of canine GN cases presently identified was not as high as the proportions identified in human studies. Conversely, urinary obstruction and end-stage renal disease cases were relatively higher in dogs than in human populations. PMID:21113095

  15. Temporal and Spatial Distribution of Tick-Borne Disease Cases among Humans and Canines in Illinois (2000-2009

    Directory of Open Access Journals (Sweden)

    John A. Herrmann

    2014-01-01

    Full Text Available Four tick-borne diseases (TBDs, anaplasmosis, ehrlichiosis, Lyme disease (LD, and Rocky Mountain spotted fever (RMSF, are endemic in Illinois. The prevalence of human and canine cases of all four TBDs rose over the study period with significant differences in geographic distribution within the state. Among human cases, there were associations between cases of RMSF and LD and total forest cover, seasonal precipitation, average mean temperature, racial-ethnic groups, and gender. Estimated annual prevalence of three canine TBDs exceeded human TBD cases significantly in each region. There was concordance in the number of human and canine cases by county of residence, in annual prevalence trends, and in time of year at which they were diagnosed. To account for multiple environmental risk factors and to facilitate early diagnosis of cases, integrated surveillance systems must be developed and communication between veterinarians, physicians, and public health agencies must be improved.

  16. Electrocardiography may be a useful tool in the diagnosis of early mild canine heartworm disease

    Directory of Open Access Journals (Sweden)

    Edward M. Onyango

    2011-01-01

    Full Text Available This study was carried out to determine the usefulness of standard electrocardiography for the diagnosis of early canine heartworm disease. Baseline electrocardiograms were recorded in 12 dogs. Thirty artificial Dirofilaria immitis worms were inserted in the pulmonary artery of each dog. New electrocardiograms were recorded on days 1-4, 7, 14, 21, 28 and 35 after insertion of worms. A significant attenuation of amplitude of Q wave in lead I was recorded on days 1-4, 7, 14, 21, 28 and 35; of R wave in lead II on days 21, 28 and 35; and of S wave in lead aVR on days 7, 14, 21, 28 and 35. Duration of the QRS complex in lead AVF was significantly prolonged on day 14. In 41.6% of the dogs, right axis deviation was recorded. These results suggest that for a dog whose normal baseline standard electrocardiogram is known, a comparison of the QRS complex of the baseline with those of subsequent standard electrocardiograms may suggest early canine heartworm disease when there is an attenuation of amplitude of Q wave in lead I, R wave in lead II and S wave in lead aVR. An additional indication can be right axis deviation.

  17. Characterization of a novel Canine distemper virus causing disease in wildlife.

    Science.gov (United States)

    Pope, Jenny P; Miller, Debra L; Riley, Matthew C; Anis, Eman; Wilkes, Rebecca P

    2016-09-01

    Canine distemper virus (CDV) is a common cause of a multisystemic disease in both domestic dogs and wildlife species, including raccoons and foxes. Outbreaks of CDV in domestic dogs in eastern Tennessee have occurred since 2012, and it was determined that these outbreaks resulted from a novel genotype of CDV. We hypothesized that this virus is also infecting area wildlife and may be a source of the virus for these outbreaks in dogs. From 2013 to 2014, autopsies were performed and tissues collected from raccoons (Procyon lotor; n = 50) and gray foxes (Urocyon cinereoargenteus; n = 8) for CDV testing. A real-time reverse transcription PCR was used to document the presence of CDV in tissue samples, and a portion of the virus was subsequently sequenced for phylogenetic analysis. A high percentage of wildlife, both with (86%) and without (55%) clinical signs, tested positive for CDV, with the majority (77%) testing positive for the novel genotype. Microscopic findings, including syncytia in the lungs and viral inclusion bodies in urothelium, astrocytes, neurons, and bronchiolar epithelium, were also consistent with canine distemper. Minimal inflammation in the central nervous system of affected animals was indicative of the acute neurologic form of the disease. Pneumonia and parasitism were also commonly found in CDV-infected animals. Based on these results, CDV appears to be prevalent in eastern Tennessee wildlife. Subclinical or clinically recovered shedders are a potential source of this novel genotype for domestic dogs, and this genotype is genetically distinct from vaccine strains. © 2016 The Author(s).

  18. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas

    2014-11-01

    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  19. Canine olfaction as an alternative to analytical instruments for disease diagnosis: understanding 'dog personality' to achieve reproducible results

    Science.gov (United States)

    Recent literature has touted the use of canine olfaction as a diagnostic tool for identifying pre-clinical disease status, especially cancer and infection from biological media samples. Studies have shown a wide range of outcomes, ranging from almost perfect discrimination, all t...

  20. Studies on the role of irradiated filarial parasites in inducing immunoprophylaxis against experimental filariasis. Part of a coordinated programme on the use of nuclear techniques in the preparation of vaccines against parasitic diseases

    International Nuclear Information System (INIS)

    Subrahamaniam, D.

    1979-01-01

    The effect of ionizing radiation at various doses on the growth of Litomosoides carinii infective third stage larvae and on the protection conferred by such larvae against filarial infections was studied in albino rats. At radiation doses of 30 K rads and below the larvae developed into adults in retarded and sterile forms. No such development was seen when the larvae were irradiated at doses of 38 K rads and above. A high degree of protection was observed when the animals were immunized with 3 doses of infective larvae attenuated with 38 or 40 K rads of radiation. This degree of protection was not observed with larvae irradiated at other dose levels nor when the number of immunizations were reduced to two. The concurrent injection with heat killed Coryne-bacterium parva at immunization increased the level of protection. This was not observed when the C. parva organisms were replaced with Freunds Complete Adjuvant. Protection was best demonstrated when the challenge was given more than 30 days following the last immunization. The immunized animals showed the presence of serum dependent cellular adhesion to microfilarial and this correlated well with protection

  1. Canine distemper virus: an emerging disease in wild endangered Amur tigers (Panthera tigris altaica).

    Science.gov (United States)

    Seimon, Tracie A; Miquelle, Dale G; Chang, Tylis Y; Newton, Alisa L; Korotkova, Irina; Ivanchuk, Galina; Lyubchenko, Elena; Tupikov, Andre; Slabe, Evgeny; McAloose, Denise

    2013-08-13

    Fewer than 500 Amur tigers (Panthera tigris altaica) remain in the wild. Due to low numbers and their solitary and reclusive nature, tiger sightings across their range in the Russian Far East and China are rare; sightings of sick tigers are rarer still. Serious neurologic disease observed in several wild tigers since 2001 suggested disease emergence in this endangered species. To investigate this possibility, histology, immunohistochemistry (IHC), in situ hybridization (ISH), and reverse transcription-PCR (RT-PCR) were performed on tissues from 5 affected tigers that died or were destroyed in 2001, 2004, or 2010. Our results reveal canine distemper virus (CDV) infection as the cause of neurologic disease in two tigers and definitively establish infection in a third. Nonsuppurative encephalitis with demyelination, eosinophilic nuclear viral inclusions, and positive immunolabeling for CDV by IHC and ISH were present in the two tigers with available brain tissue. CDV phosphoprotein (P) and hemagglutinin (H) gene products were obtained from brains of these two tigers by RT-PCR, and a short fragment of CDV P gene sequence was detected in lymph node tissue of a third tiger. Phylogenetically, Amur tiger CDV groups with an Arctic-like strain in Baikal seals (Phoca siberica). Our results, which include mapping the location of positive tigers and recognition of a cluster of cases in 2010, coupled with a lack of reported CDV antibodies in Amur tigers prior to 2000 suggest wide geographic distribution of CDV across the tiger range and recent emergence of CDV as a significant infectious disease threat to endangered Amur tigers in the Russian Far East. Recognition of disease emergence in wildlife is a rare occurrence. Here, for the first time, we identify and characterize a canine distemper virus (CDV), the second most common cause of infectious disease death in domestic dogs and a viral disease of global importance in common and endangered carnivores, as the etiology of

  2. [Climate change - a pioneer for the expansion of canine vector-borne diseases?].

    Science.gov (United States)

    Krämer, F; Mencke, N

    2011-01-01

    Vector-transmitted diseases are one of the major contributors to the global burden of disease in humans and animals. Climate change is consistently held responsible for the spread of parasitic acarid and insect vectors such as ticks, fleas, sand flies and mosquitoes, and their transmitted pathogens (in the case of the dog the so-called canine vector-borne diseases [CVBD]). Currently, there is only insufficient data available to prove whether climate change is a major driving force for vector and disease expansion, but the evidence is growing. Other reasons, such as ecological, demographic and socio-economic factors, e.g. pet travel into and pet import from endemic areas, also play a role in this development. Apart from all the controversial discussion of the factors leading to vector and disease expansion, preventative measures should include dog owners' education as they are responsible for individual parasite protection as well as for the minimisation of adverse risk behaviour, e.g. regarding pet travel. Broad-spectrum vector control should be practised by using parasiticides that repel and kill blood feeders in order to minimize the risk of CVBD-pathogen transmission.

  3. Does canine inflammatory bowel disease influence gut microbial profile and host metabolism?

    Science.gov (United States)

    Xu, Jia; Verbrugghe, Adronie; Lourenço, Marta; Janssens, Geert P J; Liu, Daisy J X; Van de Wiele, Tom; Eeckhaut, Venessa; Van Immerseel, Filip; Van de Maele, Isabel; Niu, Yufeng; Bosch, Guido; Junius, Greet; Wuyts, Brigitte; Hesta, Myriam

    2016-06-16

    Inflammatory bowel disease (IBD) refers to a diverse group of chronic gastrointestinal diseases, and gut microbial dysbiosis has been proposed as a modulating factor in its pathogenesis. Several studies have investigated the gut microbial ecology of dogs with IBD but it is yet unclear if this microbial profile can alter the nutrient metabolism of the host. The aim of the present study was to characterize the faecal bacterial profile and functionality as well as to determine host metabolic changes in IBD dogs. Twenty-three dogs diagnosed with IBD and ten healthy control dogs were included. Dogs with IBD were given a clinical score using the canine chronic enteropathy clinical activity index (CCECAI). Faecal short-chain fatty acids (SCFA) and ammonia concentrations were measured and quantitative PCR was performed. The concentration of plasma amino acids, acylcarnitines, serum folate, cobalamin, and indoxyl sulfate was determined. No significant differences in the abundance of a selection of bacterial groups and fermentation metabolites were observed between the IBD and control groups. However, significant negative correlations were found between CCECAI and the faecal proportion of Lactobacillus as well as between CCECAI and total SCFA concentration. Serum folate and plasma citrulline were decreased and plasma valine was increased in IBD compared to control dogs. Increased plasma free carnitine and total acylcarnitines were observed in IBD compared with control dogs, whereas short-chain acylcarnitines (butyrylcarnitine + isobutyrylcarnitine and, methylmalonylcarnitine) to free carnitine ratios decreased. Dogs with IBD had a higher 3-hydroxyisovalerylcarnitine + isovalerylcarnitine to leucine ratio compared to control dogs. Canine IBD induced a wide range of changes in metabolic profile, especially for the plasma concentrations of short-chain acylcarnitines and amino acids, which could have evolved from tissue damage and alteration in host metabolism. In

  4. Canine vector-borne diseases in India: a review of the literature and identification of existing knowledge gaps

    Directory of Open Access Journals (Sweden)

    Coleman Glen T

    2010-04-01

    Full Text Available Abstract Despite the combination of favourable climate for parasites and vectors, and large populations of stray dogs, information concerning the epidemiology, diagnosis and management of canine vector-borne diseases in India is limited. However, with the country's expanding economy and adaptation to western culture, higher expectations and demands are being placed on veterinary surgeons for improved knowledge of diseases and control. This review aims to provide an overview of the current state of knowledge of these diseases in India and identify existing knowledge gaps in the literature which need to be addressed. The available literature on this subject, although limited, suggests that a number of canine vector-borne diseases such as filariasis, babesiosis and ehrlichiosis are endemic throughout India, as diagnosed mostly by morphological methods. Detailed investigations of the epidemiology and zoonotic potential of these pathogens has been neglected. Further study is essential to develop a better understanding of the diversity of canine vector-borne diseases in India, and their significance for veterinary and public health.

  5. Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection.

    Science.gov (United States)

    Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas

    2016-01-01

    The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target.

  6. Expression Profiling of Circulating MicroRNAs in Canine Myxomatous Mitral Valve Disease

    Directory of Open Access Journals (Sweden)

    Qinghong Li

    2015-06-01

    Full Text Available MicroRNAs (miRNAs are small non-coding RNAs that have shown promise as noninvasive biomarkers in cardiac disease. This study was undertaken to investigate the miRNA expression profile in dogs with myxomatous mitral valve disease (MMVD. 277 miRNAs were quantified using RT-qPCR from six normal dogs (American College of Veterinary Internal Medicine Stage A, six dogs with MMVD mild to moderate cardiac enlargement (ACVIM Stage B1/B2 and six dogs with MMVD and congestive heart failure (ACVIM Stage C/D. Eleven miRNAs were differentially expressed (False Discovery Rate < 0.05. Dogs in Stage B1/B2 or C/D had four upregulated miRNAs, including three cfa-let-7/cfa-miR-98 family members, while seven others were downregulated, compared to Stage A. Expression of six of the 11 miRNAs also were significantly different between dogs in Stage C/D and those in Stage B1/B2. The expression changes were greater as disease severity increased. These miRNAs may be candidates for novel biomarkers and may provide insights into genetic regulatory pathways in canine MMVD.

  7. The heme biosynthetic pathway of the obligate Wolbachia endosymbiont of Brugia malayi as a potential anti-filarial drug target.

    Directory of Open Access Journals (Sweden)

    Bo Wu

    2009-07-01

    Full Text Available Filarial parasites (e.g., Brugia malayi, Onchocerca volvulus, and Wuchereria bancrofti are causative agents of lymphatic filariasis and onchocerciasis, which are among the most disabling of neglected tropical diseases. There is an urgent need to develop macro-filaricidal drugs, as current anti-filarial chemotherapy (e.g., diethylcarbamazine [DEC], ivermectin and albendazole can interrupt transmission predominantly by killing microfilariae (mf larvae, but is less effective on adult worms, which can live for decades in the human host. All medically relevant human filarial parasites appear to contain an obligate endosymbiotic bacterium, Wolbachia. This alpha-proteobacterial mutualist has been recognized as a potential target for filarial nematode life cycle intervention, as antibiotic treatments of filarial worms harboring Wolbachia result in the loss of worm fertility and viability upon antibiotic treatments both in vitro and in vivo. Human trials have confirmed this approach, although the length of treatments, high doses required and medical counter-indications for young children and pregnant women warrant the identification of additional anti-Wolbachia drugs.Genome sequence analysis indicated that enzymes involved in heme biosynthesis might constitute a potential anti-Wolbachia target set. We tested different heme biosynthetic pathway inhibitors in ex vivo B. malayi viability assays and report a specific effect of N-methyl mesoporphyrin (NMMP, which targets ferrochelatase (FC, the last step. Our phylogenetic analysis indicates evolutionarily significant divergence between Wolbachia heme genes and their human homologues. We therefore undertook the cloning, overexpression and analysis of several enzymes of this pathway alongside their human homologues, and prepared proteins for drug targeting. In vitro enzyme assays revealed a approximately 600-fold difference in drug sensitivities to succinyl acetone (SA between Wolbachia and human 5

  8. Adeno-Associated Virus-Mediated Correction of a Canine Model of Glycogen Storage Disease Type Ia

    OpenAIRE

    Weinstein, David A.; Correia, Catherine E.; Conlon, Thomas; Specht, Andrew; Verstegen, John; Onclin-Verstegen, Karine; Campbell-Thompson, Martha; Dhaliwal, Gurmeet; Mirian, Layla; Cossette, Holly; Falk, Darin J.; Germain, Sean; Clement, Nathalie; Porvasnik, Stacy; Fiske, Laurie

    2010-01-01

    This study by the groups of Drs. Barry Byrne and Cathryn Mah at the University of Florida examines the safety and efficacy of AAV-mediated gene delivery in a canine model of glycogen storage disease type Ia (GSDIa). The authors find that intraportal delivery of AAV8 encoding glucose-6-phosphatase-α (G6Pase) followed 20 weeks later by intraportal administration of AAV1 encoding G6Pase led to significant correction of the GSDIa phenotype.

  9. Gaucher disease: Physical, kinetic and immunologic investigations of human and canine acid β-glucosidase

    International Nuclear Information System (INIS)

    Fabbro, D.E.

    1988-01-01

    Kinetic and immunologic techniques were developed to investigate the nature of the acid β-glucosidase (β-Glc) defects which results in human and canine Gaucher disease (GD). Two new affinity columns, using the potent inhibitors of β-Glc (N-alkyl-deoxynojirimycins) as affinity ligands, were synthesized and methods were developed to obtain homogeneous β-Glc from normal human placenta. Polyclonal and monoclonal (representing 14 different epitopes from 18 clones) antibodies were produced to the pure normal β-Glc. Monospecific polyclonal IgG and tritiated-bromo-conduritol B epoxide ([ 3 H]Br-CBE), a specific covalent active site directed inhibitor of β-Glc, were used to quantitate the functional catalytic sites in normal and Type 1 Ashkenazi Jewish GD (AJGD) enzyme preparations: The k cat values for several new substrates with the mutant enzymes from spleen were about 1.5-fold less than the respective normal enzyme, indicating a nearly normal catalytic capacity of the mutant enzymes. Immunoblotting studies with polyclonal or several monoclonal antibodies indicated three molecular forms of β-Glc (M r = 67,000, 62,000 to 65,000 and 58,000) in fibroblast extracts from normals and Type 1 AJGD patients. In comparison, only one form of cross-reacting immunologic material (CRIM) was detected in fibroblast extracts from Types 2 and 3 or several non-Jewish Type 1 GD patients

  10. Canine and feline vector-borne diseases in Italy: current situation and perspectives

    Directory of Open Access Journals (Sweden)

    Dantas-Torres Filipe

    2010-01-01

    Full Text Available Abstract In Italy, dogs and cats are at risk of becoming infected by different vector-borne pathogens, including protozoa, bacteria, and helminths. Ticks, fleas, phlebotomine sand flies, and mosquitoes are recognized vectors of pathogens affecting cats and dogs, some of which (e.g., Anaplasma phagocytophilum, Borrelia burgdorferi, Dipylidium caninum, Leishmania infantum, Dirofilaria immitis, and Dirofilaria repens are of zoonotic concern. Recent studies have highlighted the potential of fleas as vectors of pathogens of zoonotic relevance (e.g., Rickettsia felis in this country. While some arthropod vectors (e.g., ticks and fleas are present in certain Italian regions throughout the year, others (e.g., phlebotomine sand flies are most active during the summer season. Accordingly, control strategies, such as those relying on the systematic use of acaricides and insecticides, should be planned on the basis of the ecology of both vectors and pathogens in different geographical areas in order to improve their effectiveness in reducing the risk of infection by vector-borne pathogens. This article reviews the current situation and perspectives of canine and feline vector-borne diseases in Italy.

  11. Heterogeneity in the spread and control of infectious disease: consequences for the elimination of canine rabies

    Science.gov (United States)

    Ferguson, Elaine A.; Hampson, Katie; Cleaveland, Sarah; Consunji, Ramona; Deray, Raffy; Friar, John; Haydon, Daniel T.; Jimenez, Joji; Pancipane, Marlon; Townsend, Sunny E.

    2015-12-01

    Understanding the factors influencing vaccination campaign effectiveness is vital in designing efficient disease elimination programmes. We investigated the importance of spatial heterogeneity in vaccination coverage and human-mediated dog movements for the elimination of endemic canine rabies by mass dog vaccination in Region VI of the Philippines (Western Visayas). Household survey data was used to parameterise a spatially-explicit rabies transmission model with realistic dog movement and vaccination coverage scenarios, assuming a basic reproduction number for rabies drawn from the literature. This showed that heterogeneous vaccination reduces elimination prospects relative to homogeneous vaccination at the same overall level. Had the three vaccination campaigns completed in Region VI in 2010-2012 been homogeneous, they would have eliminated rabies with high probability. However, given the observed heterogeneity, three further campaigns may be required to achieve elimination with probability 0.95. We recommend that heterogeneity be reduced in future campaigns through targeted efforts in low coverage areas, even at the expense of reduced coverage in previously high coverage areas. Reported human-mediated dog movements did not reduce elimination probability, so expending limited resources on restricting dog movements is unnecessary in this endemic setting. Enhanced surveillance will be necessary post-elimination, however, given the reintroduction risk from long-distance dog movements.

  12. A retrospective histopathological survey on canine and feline liver diseases at the University of Tokyo between 2006 and 2012.

    Science.gov (United States)

    Hirose, Naoki; Uchida, Kazuyuki; Kanemoto, Hideyuki; Ohno, Koichi; Chambers, James K; Nakayama, Hiroyuki

    2014-07-01

    To determine the incidence of hepatic diseases in dogs and cats in Japan, a retrospective study was performed using data of 463 canine and 71 feline liver biopsies at the Veterinary Medical Center of the University of Tokyo. The most common canine hepatic disease was microvascular dysplasia (MVD) and occupied 29.4% of all diagnoses. This terminology might contain "real" MVD and primary portal vein hypoplasia, because these two conditions were difficult to be clearly distinguished histopathologically. Parenchymal and interstitial hepatitis and primary hepatic tumors accounted for 23.5% and 21.0% of the diagnoses, respectively. Parenchymal and interstitial hepatitis occupied 34.1% of non-proliferative canine hepatic diseases, while hepatocellular adenoma and carcinoma were 26.6% and 24.5% of proliferative hepatic diseases, respectively. Breed-specificity was seen in MVD for Yorkshire terrier, Papillon and Toy poodle, in hepatitis for Doberman pinscher and Labrador retriever, in cholangiohepatitis for American cocker spaniel, Miniature schnauzer and Pomeranian, in hepatocellular adenoma for Golden retriever and Shiba and in hepatocellular carcinoma for Shih Tzu. The most common feline liver disease was parenchymal and interstitial hepatitis (45.1% of all diagnoses). Among feline hepatitis, neutrophilic cholangiohepatitis (23.9%), lymphocytic cholangiohepatitis (14.1%) and chronic hepatitis (5.6%) were recorded. Adult polycystic liver disease was 5.6%. Among proliferative diseases in the feline liver (11.3% of the all), lymphoma (4.2%) and primary epithelial tumors (4.2%) including hepatocellular carcinoma, cholangiocellular adenoma and cholangiocellular carcinoma were observed. Hepatic degeneration was 14.1%, and MVD was 12.7%, respectively.

  13. Parasitological, serological and clinical evidence for high prevalence of podoconiosis (non-filarial elephantiasis) in Midakegn district, central Ethiopia.

    Science.gov (United States)

    Geshere Oli, Geleta; Tekola Ayele, Fasil; Petros, Beyene

    2012-06-01

    To determine whether the elephantiasis in Midakegn district, central Ethiopia, is filarial or non-filarial (podoconiosis) using serological, parasitological and clinical examinations, and to estimate its prevalence. At house-to-house visits in 330 randomly selected households, all household members who had elephantiasis were interviewed and clinically examined at the nearby health centre to confirm the presence of elephantiasis, check the presence of scrotal swelling and rule out the other causes of lymphoedema. A midnight blood sample was obtained from each participant with elephantiasis for microscopic examination of Wuchereria bancrofti microfilaria. A daytime blood sample was obtained from half of the participants for serological confirmation using the immuno-chromatographic test card. Consistent with the features of podoconiosis, none of the elephantiasis cases had consistently worn shoes since childhood; 94.3% had bilateral swelling limited below the level of the knees; no individual had thigh or scrotal elephantiasis; parasitological test for microfilariae and serological tests for W. bancrofti antigen were negative in all samples. The prevalence of the disease was 7.4% and it peaked in the third decade of life, the most economically active age. Midakegn District has a high prevalence of podoconiosis and no filarial elephantiasis. Prevention, treatment and control of podoconiosis must be among the top priorities of public health programmes. © 2012 Blackwell Publishing Ltd.

  14. Disease Modeling and Gene Therapy of Copper Storage Disease in Canine Hepatic Organoids

    NARCIS (Netherlands)

    Nantasanti, Sathidpak; Spee, Bart; Kruitwagen, Hedwig S.; Chen, Chen; Geijsen, Niels; Oosterhoff, Loes A.; van Wolferen, Monique E.; Pelaez, Nicolas; Fieten, Hille; Wubbolts, Richard W.; Grinwis, Guy C.; Chan, Jefferson; Huch, Meritxell; Vries, Robert R. G.; Clevers, Hans; de Bruin, Alain; Rothuizen, Jan; Penning, Louis C.; Schotanus, Baukje A.

    2015-01-01

    The recent development of 3D-liver stem cell cultures (hepatic organoids) opens up new avenues for gene and/or stem cell therapy to treat liver disease. To test safety and efficacy, a relevant large animal model is essential but not yet established. Because of its shared pathologies and disease

  15. Identification of anti-filarial leads against aspartate semialdehyde dehydrogenase of Wolbachia endosymbiont of Brugia malayi: combined molecular docking and molecular dynamics approaches.

    Science.gov (United States)

    Amala, Mathimaran; Rajamanikandan, Sundaraj; Prabhu, Dhamodharan; Surekha, Kanagarajan; Jeyakanthan, Jeyaraman

    2018-02-06

    Lymphatic filariasis is a debilitating vector borne parasitic disease that infects human lymphatic system by nematode Brugia malayi. Currently available anti-filarial drugs are effective only on the larval stages of parasite. So far, no effective drugs are available for humans to treat filarial infections. In this regard, aspartate semialdehyde dehydrogenase (ASDase) in lysine biosynthetic pathway from Wolbachia endosymbiont Brugia malayi represents an attractive therapeutic target for the development of novel anti-filarial agents. In this present study, molecular modeling combined with molecular dynamics simulations and structure-based virtual screening were performed to identify potent lead molecules against ASDase. Based on Glide score, toxicity profile, binding affinity and mode of interactions with the ASDase, five potent lead molecules were selected. The molecular docking and dynamics results revealed that the amino acid residues Arg103, Asn133, Cys134, Gln161, Ser164, Lys218, Arg239, His246, and Asn321 plays a crucial role in effective binding of Top leads into the active site of ASDase. The stability of the ASDase-lead complexes was confirmed by running the 30 ns molecular dynamics simulations. The pharmacokinetic properties of the identified lead molecules are in the acceptable range. Furthermore, density functional theory and binding free energy calculations were performed to rank the lead molecules. Thus, the identified lead molecules can be used for the development of anti-filarial agents to combat the pathogenecity of Brugia malayi.

  16. Transcutaneous glomerular filtration rate measurement in a canine animal model of chronic kidney disease.

    Science.gov (United States)

    Mondritzki, Thomas; Steinbach, Sarah M L; Boehme, Philip; Hoffmann, Jessica; Kullmann, Maximilian; Schock-Kusch, Daniel; Vogel, Julia; Kolkhof, Peter; Sandner, Peter; Bischoff, Erwin; Hüser, Jörg; Dinh, Wilfried; Truebel, Hubert

    Quantitative assessment of renal function by measurement of glomerular filtration rate (GFR) is an important part of safety and efficacy evaluation in preclinical drug development. Existing methods are often time consuming, imprecise and associated with animal burden. Here we describe the comparison between GFR determinations with sinistrin (PS-GFR) and fluorescence-labelled sinistrin-application and its transcutaneous detection (TD-GFR) in a large animal model of chronic kidney disease (CKD). TD-GFR measurements compared to a standard method using i.v. sinistrin were performed in a canine model. Animals were treated with one-sided renal wrapping (RW) followed by renal artery occlusion (RO). Biomarker and remote hemodynamic measurements were performed. Plasma sinistrin in comparison to transcutaneous derived GFR data were determined during healthy conditions, after RW and RW+RO. RW alone did not led to any significant changes in renal function, neither with PS-GFR nor TD-GFR. Additional RO showed a rise in blood pressure (+68.0mmHg), plasma urea (+28.8mmol/l), creatinine (+224,4μmol/l) and symmetric dimethylarginine (SDMA™; +12.6μg/dl). Plasma sinistrin derived data confirmed the expected drop (-44.7%, p<0.0001) in GFR. The calculated transcutaneous determined Fluorescein Isothiocyanate (FITC)-sinistrin GFR showed no differences to plasma sinistrin GFR at all times. Both methods were equaly sensitive to diagnose renal dysfunction in the affected animals. Renal function assessment using TD-GFR is a valid method to improve preclinical drug discovery and development. Furthermore, TD-GFR method offers advantages in terms of reduced need for blood sampling and thus decreasing animal burden compared to standard procedures. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

    NARCIS (Netherlands)

    T.C. Harder (Timm); M.J.H. Kenter (Marcel); H. Vos; C.H.J. Siebelink (Kees); W. Huisman (Willem); C. Örvell; T. Barrett (Thomas); M.J.G. Appel (Max); A.D.M.E. Osterhaus (Albert); G. van Amerongen (Geert)

    1996-01-01

    textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated

  18. Exoemission of Ethiopian soils and the endemicity of non-filarial elephantiasis

    Energy Technology Data Exchange (ETDEWEB)

    Davies, J.E. (Birmingham Univ. (UK). Dept. of Anatomy); Townsend, P.D. (Sussex Univ., Brighton (UK))

    1983-01-01

    Non-filarial elephantiasis is an endemic disease in the bare-footed population of Ethiopia. The distribution of this condition is linked with that of local red clay soil. Recently, thermoluminescence has been successfully used to distinguish between endemic and non-endemic soils. Instrinsic lattice defects, frozen in during cooling of volcanic material, are considered to be responsible for characteristic thermoluminescence signals. However, the biological reactivity of the absorbed soil particles will depend upon their surface properties. Exoemission has therefore been studied in samples from both endemic (5 samples) and non-endemic (4 samples) areas. All samples from endemic areas, on first heating, demonstrate an emission peak at 75/sup 0/C. Post-irradiation storage of samples in a moist atmosphere tends to decrease emissivity while wetting irreversibly reduces the response to irradiation. In an hydrated biological environment, this surface reactivity may be linked to the pathogenicity of the soil particles.

  19. Exoemission of Ethiopian soils and the endemicity of non-filarial elephantiasis

    International Nuclear Information System (INIS)

    Davies, J.E.

    1983-01-01

    Non-filarial elephantiasis is an endemic disease in the bare-footed population of Ethiopia. The distribution of this condition is linked with that of local red clay soil. Recently, thermoluminescence has been successfully used to distinguish between endemic and non-endemic soils. Instrinsic lattice defects, frozen in during cooling of volcanic material, are considered to be responsible for characteristic thermoluminescence signals. However, the biological reactivity of the absorbed soil particles will depend upon their surface properties. Exoemission has therefore been studied in samples from both endemic (5 samples) and non-endemic (4 samples) areas. All samples from endemic areas, on first heating, demonstrate an emission peak at 75 0 C. Post-irradiation storage of samples in a moist atmosphere tends to decrease emissivity while wetting irreversibly reduces the response to irradiation. In an hydrated biological environement, this surface reactivity may be linked to the pathogenicity of the soil particles. (author)

  20. Adeno-Associated Virus-Mediated Correction of a Canine Model of Glycogen Storage Disease Type Ia

    Science.gov (United States)

    Weinstein, David A.; Correia, Catherine E.; Conlon, Thomas; Specht, Andrew; Verstegen, John; Onclin-Verstegen, Karine; Campbell-Thompson, Martha; Dhaliwal, Gurmeet; Mirian, Layla; Cossette, Holly; Falk, Darin J.; Germain, Sean; Clement, Nathalie; Porvasnik, Stacy; Fiske, Laurie; Struck, Maggie; Ramirez, Harvey E.; Jordan, Juan; Andrutis, Karl; Chou, Janice Y.; Byrne, Barry J.

    2010-01-01

    Abstract Glycogen storage disease type Ia (GSDIa; von Gierke disease; MIM 232200) is caused by a deficiency in glucose-6-phosphatase-α. Patients with GSDIa are unable to maintain glucose homeostasis and suffer from severe hypoglycemia, hepatomegaly, hyperlipidemia, hyperuricemia, and lactic acidosis. The canine model of GSDIa is naturally occurring and recapitulates almost all aspects of the human form of disease. We investigated the potential of recombinant adeno-associated virus (rAAV) vector-based therapy to treat the canine model of GSDIa. After delivery of a therapeutic rAAV2/8 vector to a 1-day-old GSDIa dog, improvement was noted as early as 2 weeks posttreatment. Correction was transient, however, and by 2 months posttreatment the rAAV2/8-treated dog could no longer sustain normal blood glucose levels after 1 hr of fasting. The same animal was then dosed with a therapeutic rAAV2/1 vector delivered via the portal vein. Two months after rAAV2/1 dosing, both blood glucose and lactate levels were normal at 4 hr postfasting. With more prolonged fasting, the dog still maintained near-normal glucose concentrations, but lactate levels were elevated by 9 hr, indicating that partial correction was achieved. Dietary glucose supplementation was discontinued starting 1 month after rAAV2/1 delivery and the dog continues to thrive with minimal laboratory abnormalities at 23 months of age (18 months after rAAV2/1 treatment). These results demonstrate that delivery of rAAV vectors can mediate significant correction of the GSDIa phenotype and that gene transfer may be a promising alternative therapy for this disease and other genetic diseases of the liver. PMID:20163245

  1. Recombinant Newcastle disease viral vector expressing hemagglutinin or fusion of canine distemper virus is safe and immunogenic in minks.

    Science.gov (United States)

    Ge, Jinying; Wang, Xijun; Tian, Meijie; Gao, Yuwei; Wen, Zhiyuan; Yu, Guimei; Zhou, Weiwei; Zu, Shulong; Bu, Zhigao

    2015-05-15

    Canine Distemper Virus (CDV) infects many carnivores and cause several high-mortality disease outbreaks. The current CDV live vaccine cannot be safely used in some exotic species, such as mink and ferret. Here, we generated recombinant lentogenic Newcastle disease virus (NDV) LaSota expressing either envelope glycoproyein, heamagglutinine (H) or fusion protein (F), named as rLa-CDVH and rLa-CDVF, respectively. The feasibility of these recombinant NDVs to serve as live virus-vectored CD vaccine was evaluated in minks. rLa-CDVH induced significant neutralization antibodies (NA) to CDV and provided solid protection against virulent CDV challenge. On the contrast, rLa-CDVF induced much lower NA to CDV and fail to protected mink from virulent CDV challenge. Results suggest that recombinant NDV expressing CDV H is safe and efficient candidate vaccine against CDV in mink, and maybe other host species. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Molecular detection of Setaria tundra (Nematoda: Filarioidea and an unidentified filarial species in mosquitoes in Germany

    Directory of Open Access Journals (Sweden)

    Czajka Christina

    2012-01-01

    Full Text Available Abstract Background Knowledge of the potential vector role of Culicidae mosquitoes in Germany is very scanty, and until recently it was generally assumed that they are not involved in the transmission of anthroponotic or zoonotic pathogens in this country. However, anticipated changes in the course of global warming and globalization may alter their status. Methods We conducted a molecular mass screening of mosquitoes for filarial parasites using mitochondrial 12S rRNA-based real-time PCR. Results No parasites causing disease in humans such as Dirofilaria spp. were detected in about 83,000 mosquitoes tested, which had been collected in 2009 and 2010 in 16 locations throughout Germany. However, minimum infection rates of up to 24 per 1000 mosquitoes were revealed, which could be attributed to mosquito infection with Setaria tundra and a yet unidentified second parasite. Setaria tundra was found to be widespread in southern Germany in various mosquito species, except Culex spp. In contrast, the unidentified filarial species was exclusively found in Culex spp. in northern Baden-Württemberg, and is likely to be a bird parasite. Conclusions Although dirofilariasis appears to be emerging and spreading in Europe, the absence of Dirofilaria spp. or other zoonotic filariae in our sample allows the conclusion that the risk of autochthonous infection in Germany is still very low. Potential vectors of S. tundra in Germany are Ochlerotatus sticticus, Oc. cantans, Aedes vexans and Anopheles claviger. Technically, the synergism between entomologists, virologists and parasitologists, combined with state-of-the-art methods allows a very efficient near-real-time monitoring of a wide spectrum of both human and veterinary pathogens, including new distribution records of parasite species and the incrimination of their potential vectors.

  3. Detection of circulating parasite-derived microRNAs in filarial infections.

    Directory of Open Access Journals (Sweden)

    Lucienne Tritten

    2014-07-01

    Full Text Available Filarial nematodes cause chronic and profoundly debilitating diseases in both humans and animals. Applications of novel technology are providing unprecedented opportunities to improve diagnosis and our understanding of the molecular basis for host-parasite interactions. As a first step, we investigated the presence of circulating miRNAs released by filarial nematodes into the host bloodstream. miRNA deep-sequencing combined with bioinformatics revealed over 200 mature miRNA sequences of potential nematode origin in Dirofilaria immitis-infected dog plasma in two independent analyses, and 21 in Onchocerca volvulus-infected human serum. Total RNA obtained from D. immitis-infected dog plasma was subjected to stem-loop RT-qPCR assays targeting two detected miRNA candidates, miR-71 and miR-34. Additionally, Brugia pahangi-infected dog samples were included in the analysis, as these miRNAs were previously detected in extracts prepared from this species. The presence of miR-71 and miR-34 discriminated infected samples (both species from uninfected samples, in which no specific miRNA amplification occurred. However, absolute miRNA copy numbers were not significantly correlated with microfilaraemia for either parasite. This may be due to the imprecision of mf counts to estimate infection intensity or to miRNA contributions from the unknown number of adult worms present. Nonetheless, parasite-derived circulating miRNAs are found in plasma or serum even for those species that do not live in the bloodstream.

  4. Genome Sequences of Three Vaccine Strains and Two Wild-Type Canine Distemper Virus Strains from a Recent Disease Outbreak in South Africa.

    Science.gov (United States)

    Loots, Angelika K; Du Plessis, Morné; Dalton, Desiré Lee; Mitchell, Emily; Venter, Estelle H

    2017-07-06

    Canine distemper virus causes global multihost infectious disease. This report details complete genome sequences of three vaccine and two new wild-type strains. The wild-type strains belong to the South African lineage, and all three vaccine strains to the America 1 lineage. This constitutes the first genomic sequences of this virus from South Africa. Copyright © 2017 Loots et al.

  5. Profiling extracellular vesicle release by the filarial nematode Brugia malayi reveals sex-specific differences in cargo and a sensitivity to ivermectin.

    Directory of Open Access Journals (Sweden)

    Hiruni Harischandra

    2018-04-01

    Full Text Available The filarial nematode Brugia malayi is an etiological agent of Lymphatic Filariasis. The capability of B. malayi and other parasitic nematodes to modulate host biology is recognized but the mechanisms by which such manipulation occurs are obscure. An emerging paradigm is the release of parasite-derived extracellular vesicles (EV containing bioactive proteins and small RNA species that allow secretion of parasite effector molecules and their potential trafficking to host tissues. We have previously described EV release from the infectious L3 stage B. malayi and here we profile vesicle release across all intra-mammalian life cycle stages (microfilariae, L3, L4, adult male and female worms. Nanoparticle Tracking Analysis was used to quantify and size EVs revealing discrete vesicle populations and indicating a secretory process that is conserved across the life cycle. Brugia EVs are internalized by murine macrophages with no preference for life stage suggesting a uniform mechanism for effector molecule trafficking. Further, the use of chemical uptake inhibitors suggests all life stage EVs are internalized by phagocytosis. Proteomic profiling of adult male and female EVs using nano-scale LC-MS/MS described quantitative and qualitative differences in the adult EV proteome, helping define the biogenesis of Brugia EVs and revealing sexual dimorphic characteristics in immunomodulatory cargo. Finally, ivermectin was found to rapidly inhibit EV release by all Brugia life stages. Further this drug effect was also observed in the related filarial nematode, the canine heartworm Dirofilaria immitis but not in an ivermectin-unresponsive field isolate of that parasite, highlighting a potential mechanism of action for this drug and suggesting new screening platforms for anti-filarial drug development.

  6. Lymphangiogenesis and lymphatic remodeling induced by filarial parasites: implications for pathogenesis.

    Directory of Open Access Journals (Sweden)

    Sasisekhar Bennuru

    2009-12-01

    Full Text Available Even in the absence of an adaptive immune system in murine models, lymphatic dilatation and dysfunction occur in filarial infections, although severe irreversible lymphedema and elephantiasis appears to require an intact adaptive immune response in human infections. To address how filarial parasites and their antigens influence the lymphatics directly, human lymphatic endothelial cells were exposed to filarial antigens, live parasites, or infected patient serum. Live filarial parasites or filarial antigens induced both significant LEC proliferation and differentiation into tube-like structures in vitro. Moreover, serum from patently infected (microfilaria positive patients and those with longstanding chronic lymphatic obstruction induced significantly increased LEC proliferation compared to sera from uninfected individuals. Differentiation of LEC into tube-like networks was found to be associated with significantly increased levels of matrix metalloproteases and inhibition of their TIMP inhibitors (Tissue inhibitors of matrix metalloproteases. Comparison of global gene expression induced by live parasites in LEC to parasite-unexposed LEC demonstrated that filarial parasites altered the expression of those genes involved in cellular organization and development as well as those associated with junction adherence pathways that in turn decreased trans-endothelial transport as assessed by FITC-Dextran. The data suggest that filarial parasites directly induce lymphangiogenesis and lymphatic differentiation and provide insight into the mechanisms underlying the pathology seen in lymphatic filariasis.

  7. Vaccines for canine leishmaniasis

    Directory of Open Access Journals (Sweden)

    Clarisa B. Palatnik-De-Sousa

    2012-04-01

    Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

  8. Diversity, Host Specialization, and Geographic Structure of Filarial Nematodes Infecting Malagasy Bats.

    Science.gov (United States)

    Ramasindrazana, Beza; Dellagi, Koussay; Lagadec, Erwan; Randrianarivelojosia, Milijaona; Goodman, Steven M; Tortosa, Pablo

    2016-01-01

    We investigated filarial infection in Malagasy bats to gain insights into the diversity of these parasites and explore the factors shaping their distribution. Samples were obtained from 947 individual bats collected from 52 sites on Madagascar and representing 31 of the 44 species currently recognized on the island. Samples were screened for the presence of micro- and macro-parasites through both molecular and morphological approaches. Phylogenetic analyses showed that filarial diversity in Malagasy bats formed three main groups, the most common represented by Litomosa spp. infecting Miniopterus spp. (Miniopteridae); a second group infecting Pipistrellus cf. hesperidus (Vespertilionidae) embedded within the Litomosoides cluster, which is recognized herein for the first time from Madagascar; and a third group composed of lineages with no clear genetic relationship to both previously described filarial nematodes and found in M. griveaudi, Myotis goudoti, Neoromicia matroka (Vespertilionidae), Otomops madagascariensis (Molossidae), and Paratriaenops furculus (Hipposideridae). We further analyzed the infection rates and distribution pattern of Litomosa spp., which was the most diverse and prevalent filarial taxon in our sample. Filarial infection was disproportionally more common in males than females in Miniopterus spp., which might be explained by some aspect of roosting behavior of these cave-dwelling bats. We also found marked geographic structure in the three Litomosa clades, mainly linked to bioclimatic conditions rather than host-parasite associations. While this study demonstrates distinct patterns of filarial nematode infection in Malagasy bats and highlights potential drivers of associated geographic distributions, future work should focus on their alpha taxonomy and characterize arthropod vectors.

  9. Genetics of Human and Canine Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Siobhan Simpson

    2015-01-01

    Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  10. Genetics of Human and Canine Dilated Cardiomyopathy.

    Science.gov (United States)

    Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

  11. Natural canine infection by Leishmania infantum and Leishmania amazonensis and their implications for disease control

    Directory of Open Access Journals (Sweden)

    Letícia da Cruz Sanches

    Full Text Available Abstract Leishmaniasis is a major public health problem worldwide. Because Leishmania can adapt to new hosts or vectors, knowledge concerning the current etiological agent in dogs is important in endemic areas. This study aimed to identify the Leishmania species detected in 103 samples of peripheral blood from dogs that were naturally infected with these protozoa. The diagnosis of leishmaniasis was determined through parasitological examination, the indirect enzyme-linked immunosorbent assay (ELISA and the polymerase chain reaction (PCR. The Leishmania species were identified by means of PCR-restriction fragment length polymorphism (PCR-RFLP. The samples were subjected to PCR using oligonucleotide primers that amplify the intergenic region ITS1 of the rRNA gene in order to identify the species. The amplified DNA was digested using the restriction enzyme HaeIII. A restriction profile identical to L. amazonensis was shown in 77/103 samples and the profile was similar to L. infantum in 17/103. However, a mixed profile was shown in 9/103 samples, which impeded species identification. In conclusion, the infection in these dogs was predominantly due to L. amazonensis, thus indicating that diagnosing of cases of canine leishmaniasis needs to be reexamined, since the causative agent identified is not restricted to L. infantum.

  12. Vector competence of Aedes aegypti mosquitoes for filarial nematodes is affected by age and nutrient limitation.

    Science.gov (United States)

    Ariani, Cristina V; Juneja, Punita; Smith, Sophia; Tinsley, Matthew C; Jiggins, Francis M

    2015-01-01

    Mosquitoes are one of the most important vectors of human disease. The ability of mosquitoes to transmit disease is dependent on the age structure of the population, as mosquitoes must survive long enough for the parasites to complete their development and infect another human. Age could have additional effects due to mortality rates and vector competence changing as mosquitoes senesce, but these are comparatively poorly understood. We have investigated these factors using the mosquito Aedes aegypti and the filarial nematode Brugia malayi. Rather than observing any effects of immune senescence, we found that older mosquitoes were more resistant, but this only occurred if they had previously been maintained on a nutrient-poor diet of fructose. Constant blood feeding reversed this decline in vector competence, meaning that the number of parasites remained relatively unchanged as mosquitoes aged. Old females that had been maintained on fructose also experienced a sharp spike in mortality after an infected blood meal ("refeeding syndrome") and few survived long enough for the parasite to develop. Again, this effect was prevented by frequent blood meals. Our results indicate that old mosquitoes may be inefficient vectors due to low vector competence and high mortality, but that frequent blood meals can prevent these effects of age. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. A mechanism for chronic filarial hydrocele with implications for its surgical repair.

    Directory of Open Access Journals (Sweden)

    Joaquim Norões

    Full Text Available BACKGROUND: Chronic hydrocele is the most common manifestation of bancroftian filariasis, an endemic disease in 80 countries. In a prospective study, we evaluated the occurrence of intrascrotal lymphangiectasia, gross appearance/consistency of the testis, and the efficacy of complete excision of hydrocele sac in patients living in a bancroftian filariasis endemic area who underwent hydrocelectomy at the Center for Teaching, Research and Tertiary Referral for Bancroftian Filariasis (NEPAF. METHODOLOGY/PRINCIPAL FINDINGS: A total of 968 patients with uni- or bilateral filarial hydrocele (Group-1 and a Comparison Group (CG of 218 patients from the same area who already had undergone hydrocele-sac-sparing hydrocelectomy elsewhere were enrolled at NEPAF. Twenty-eight patients from the Comparison Group with hydrocele recurrence were re-operated on at NEPAF and constitute Group-2. In Group-1 a total of 1,128 hydrocelectomies were performed (mean patient age of 30.3 yr and mean follow-up of 8.6 yr [range 5.3-12]. The hydrocele recurrence rates in Group-1 and in the Comparison Group (mean age of 31.5 yr were 0.3%, and 19.3%, respectively (p<0,001. There was no hydrocele recurrence in Group-2 (mean patient age of 25.1 yr and mean follow-up of 6 yr [range 5-6.9]. Per surgically leaking or leak-prone dilated lymphatic vessels were seen in the inner or outer surface of the hydrocele sac wall or in surrounding tissue, particularly in the retrotesticular area, in 30.9% and in 46.3% of patients in Group-1 and Group-2, respectively (p = 0.081. The testicles were abnormal in shape, volume, and consistency in 203/1,128 (18% and 10/28 (35.7% of patients from Group-1 and Group-2, respectively (p = 0,025. CONCLUSIONS/SIGNIFICANCE: Lymph fluid from ruptured dilated lymphatic vessels is an important component of chronic filarial hydrocele fluid that threatens the integrity of the testis in an adult population living in bancroftian filariasis endemic areas. To avoid

  14. Detection and molecular characterization of the mosquito-borne filarial nematode Setaria tundra in Danish roe deer (Capreolus capreolus)

    DEFF Research Database (Denmark)

    Enemark, Heidi Larsen; Oksanen, Antti; Chriél, Mariann

    2017-01-01

    Setaria tundra is a mosquito-borne filarial nematode of cervids in Europe. It has recently been associated with an emerging epidemic disease causing severe morbidity and mortality in reindeer and moose in Finland. Here, we present the first report of S. tundra in six roe deer (Capreolus capreolus...... Europe. Roe deer are generally considered as asymptomatic carriers and their numbers in Denmark have increased significantly in recent decades. In light of climatic changes which result in warmer, more humid weather in Scandinavia greater numbers of mosquitoes and, especially, improved conditions...... for development of parasite larvae in the mosquito vectors are expected, which may lead to increasing prevalence of S. tundra. Monitoring of this vector-borne parasite may thus be needed in order to enhance the knowledge of factors promoting its expansion and prevalence as well as predicting disease outbreaks. (C...

  15. Canine cutaneous leishmaniasis caused by neotropical Leishmania infantum despite of systemic disease: A case report.

    Science.gov (United States)

    Cavalcanti, Amanda; Lobo, Rogério; Cupolillo, Elisa; Bustamante, Fábio; Porrozzi, Renato

    2012-12-01

    Visceral leishmaniasis is an anthropozoonosis caused by a protozoan Leishmania infantum (syn. Leishmania chagasi). Here, we report a typical case of canine cutaneous leishmaniasis due to L. infantum infection without any other systemic symptom in one dog in the city of Rio de Janeiro, Brazil. A mongrel female dog was admitted in a veterinary clinic with reports of chronic wounds in the body. Physical examination revealed erosive lesions in the limbs, nasal ulcers, presence of ectoparasites and seborrheic dermatitis. Blood samples and fragments of healthy and injured skin were collected. The complete hemogram revealed aregenerative normocytic normochromic anemia and erythrocyte rouleaux, and biochemical analysis revealed normal renal and hepatic functions. Cytology of the muzzle and skin lesions suggested pyogranulomatous inflammatory process. The histopathology of a skin fragment was performed and revealed suspicion of protozoa accompanied by necrotizing dermatitis. The diagnosis of leishmaniasis was accomplished by positive serology, isolation of Leishmania from the skin lesion, and also by molecular test (PCR targeting the conserved region of Leishmania kDNA). Culture was positive for damaged skin samples. PCR targeting a fragment of Leishmania hsp70 gene was performed employing DNA extracted from damaged skin. RFLP of the amplified hsp70 fragment identified the parasite as L. infantum, instead of Leishmania braziliensis, the main agent of cutaneous leishmaniasis in Rio de Janeiro. Characterization of isolated promastigotes by five different enzymatic systems confirmed the species identification of the etiological agent. Serology was positive by ELISA and rapid test. This case warns to the suspicion of viscerotropic Leishmania in cases of chronic skin lesions and brings the discussion of the mechanisms involved in the parasite tissue tropism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  16. Epidemiology and clinical presentation of canine distemper disease in dogs and ferrets in Australia, 2006-2014.

    Science.gov (United States)

    Wyllie, S E; Kelman, M; Ward, M P

    2016-07-01

    To determine the status and distribution of distemper in Australian dogs and ferrets. Retrospective case series. Cases were identified via a national voluntary disease reporting system, veterinarian groups and a national laboratory database. The geographic distribution, seasonal distribution, signalment and clinical presentation of cases were described using maps and frequency distributions. A total of 48 individually affected dogs and ferrets in 27 case groups were identified, including eight confirmed case groups (> one individual). Confirmed cases were more common in summer and on the central coast of New South Wales and southern Victoria, and occurred exclusively in young, unvaccinated dogs. For dogs there was no obvious sex predilection. A mortality rate of 100% in ferrets and up to 77% in dogs was estimated. Neurological, gastrointestinal and respiratory were the most commonly reported systems affected in dogs and ferrets. There was no evidence that any large, unreported outbreaks occurred during the study period. Continuation of vaccination against canine distemper virus is justified within Australia, particularly for younger dogs. Veterinarians should continue to consider distemper in their differential diagnosis of cases with neurological, gastrointestinal and respiratory presentation. © 2016 Australian Veterinary Association.

  17. Experimental Model of Gene Transfection in Healthy Canine Myocardium: Perspectives of Gene Therapy for Ischemic Heart Disease

    Directory of Open Access Journals (Sweden)

    Renato A. K. Kalil

    2002-09-01

    Full Text Available OBJECTIVE: To assess the transfection of the gene that encodes green fluorescent protein (GFP through direct intramyocardial injection. METHODS: The pREGFP plasmid vector was used. The EGFP gene was inserted downstream from the constitutive promoter of the Rous sarcoma virus. Five male dogs were used (mean weight 13.5 kg, in which 0.5 mL of saline solution (n=1 or 0.5 mL of plasmid solution containing 0.5 µg of pREGFP/dog (n=4 were injected into the myocardium of the left ventricular lateral wall. The dogs were euthanized 1 week later, and cardiac biopsies were obtained. RESULTS: Fluorescence microscopy showed differences between the cells transfected and not transfected with pREGFP plasmid. Mild fluorescence was observed in the cardiac fibers that received saline solution; however, the myocardial cells transfected with pREGFP had overt EGFP expression. CONCLUSION: Transfection with the EGFP gene in healthy canine myocardium was effective. The reproduction of this efficacy using vascular endothelial growth factor (VEGF instead of EGFP aims at developing gene therapy for ischemic heart disease.

  18. Canine gastritis.

    Science.gov (United States)

    Webb, Craig; Twedt, David C

    2003-09-01

    Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

  19. Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper.

    Science.gov (United States)

    Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David

    2011-12-15

    Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Economic costs of endemic non-filarial elephantiasis in Wolaita Zone, Ethiopia.

    Science.gov (United States)

    Tekola, Fasil; Mariam, Damen H; Davey, Gail

    2006-07-01

    Endemic non-filarial elephantiasis or podoconiosis is a chronic and debilitating geochemical disease occurring in individuals exposed to red clay soil derived from alkalic volcanic rock. It is a major public health problem in countries in tropical Africa, Central America and North India. To estimate the direct and the average productivity cost attributable to podoconiosis, and to compare the average productivity time of podoconiosis patients with non-patients. Matched comparative cross sectional survey involving 702 study subjects (patients and non-patients) supplemented by interviews with key informants in Wolaita Zone, southern Ethiopia. Total direct costs of podoconiosis amounted to the equivalent of US$ 143 per patient per year. The total productivity loss for a patient amounted to 45% of the total working days per year, causing a monetary loss equivalent to US$ 63. In Wolaita zone, the overall cost of podoconiosis exceeds US$ 16 million per year. Podoconiosis has enormous economic impact in affected areas. Simple preventive measures (such as use of robust footwear) must be promoted by health policy makers.

  1. APPLICATION OF BIOTECHNOLOGY TO THE STUDY OF FILARIAL PARASITES AND THEIR VECTORS

    Directory of Open Access Journals (Sweden)

    A. C. Vickery

    2012-09-01

    Full Text Available Over 200 species of filarial parasites have been described, although the life cycle and nature of their obligate intermediate arthropod vectors have been identified for only about a quarter of them. Traditional methods of studying phylogenetic relationships between closely related parasite species have utilized morphologic, biochemical and biologic characteristics, usually of the microfilarial stage. Identification of competent vectors from among complexes of sibling species, has employed similar techniques, despite the fact that differences between geographical isolates may reflect environmental rather than genetically controlled factors. Studies of the prevalence and transmission of animal, human and zoonotic filarids, so important for vector identification and control, has lead to the examination of filarial parasites at the genetic level. Genomic DNA libraries are being constructed and screened for clones which are species specific. From this work, DNA probes which can accurately enumerate larval stages in vector squash preparations, and monoclonal antibodies specific for defined filarial antigens, are being prepared. The nucleotide sequences of rRNA are also being defined. The application of these technologies to the study of filarial parasites and their vectors, promises to not only allow the construction of accurate phylogenetic trees, but also to provide the data necessary for the identification and control of the vectors of filarial pathogens of animals and man.

  2. New therapeutic strategies for canine liver disease; Growth factors and liver progenitor cells

    NARCIS (Netherlands)

    Arends, B.

    2008-01-01

    The liver has the unique capacity to regulate its mass after loss of functional liver cells due to liver disease, injury, and/or toxicity. Unfortunately, in the course of chronic liver disease this meticulously regulated regeneration process is imbalanced resulting in a decreased regenerative

  3. Does canine inflammatory bowel disease influence gut microbial profile and host metabolism?

    NARCIS (Netherlands)

    Xu, Jia; Verbrugghe, Adronie; Lourenço, Marta; Janssens, Geert P.J.; Liu, Daisy J.X.; Wiele, Van de Tom; Eeckhaut, Venessa; Immerseel, Van Filip; Maele, Van de Isabel; Niu, Yufeng; Bosch, Guido; Junius, Greet; Wuyts, Brigitte; Hesta, Myriam

    2016-01-01

    Background: Inflammatory bowel disease (IBD) refers to a diverse group of chronic gastrointestinal diseases, and gut microbial dysbiosis has been proposed as a modulating factor in its pathogenesis. Several studies have investigated the gut microbial ecology of dogs with IBD but it is yet unclear

  4. Canine parvovirus: current perspective.

    Science.gov (United States)

    Nandi, S; Kumar, Manoj

    2010-06-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

  5. Does canine inflammatory bowel disease influence gut microbial profile and host metabolism?

    OpenAIRE

    Xu, Jia; Verbrugghe, Adronie; Louren?o, Marta; Janssens, Geert P. J.; Liu, Daisy J. X.; Van de Wiele, Tom; Eeckhaut, Venessa; Van Immerseel, Filip; Van de Maele, Isabel; Niu, Yufeng; Bosch, Guido; Junius, Greet; Wuyts, Brigitte; Hesta, Myriam

    2016-01-01

    Background Inflammatory bowel disease (IBD) refers to a diverse group of chronic gastrointestinal diseases, and gut microbial dysbiosis has been proposed as a modulating factor in its pathogenesis. Several studies have investigated the gut microbial ecology of dogs with IBD but it is yet unclear if this microbial profile can alter the nutrient metabolism of the host. The aim of the present study was to characterize the faecal bacterial profile and functionality as well as to determine host me...

  6. Diversity, Host Specialization, and Geographic Structure of Filarial Nematodes Infecting Malagasy Bats.

    Directory of Open Access Journals (Sweden)

    Beza Ramasindrazana

    Full Text Available We investigated filarial infection in Malagasy bats to gain insights into the diversity of these parasites and explore the factors shaping their distribution. Samples were obtained from 947 individual bats collected from 52 sites on Madagascar and representing 31 of the 44 species currently recognized on the island. Samples were screened for the presence of micro- and macro-parasites through both molecular and morphological approaches. Phylogenetic analyses showed that filarial diversity in Malagasy bats formed three main groups, the most common represented by Litomosa spp. infecting Miniopterus spp. (Miniopteridae; a second group infecting Pipistrellus cf. hesperidus (Vespertilionidae embedded within the Litomosoides cluster, which is recognized herein for the first time from Madagascar; and a third group composed of lineages with no clear genetic relationship to both previously described filarial nematodes and found in M. griveaudi, Myotis goudoti, Neoromicia matroka (Vespertilionidae, Otomops madagascariensis (Molossidae, and Paratriaenops furculus (Hipposideridae. We further analyzed the infection rates and distribution pattern of Litomosa spp., which was the most diverse and prevalent filarial taxon in our sample. Filarial infection was disproportionally more common in males than females in Miniopterus spp., which might be explained by some aspect of roosting behavior of these cave-dwelling bats. We also found marked geographic structure in the three Litomosa clades, mainly linked to bioclimatic conditions rather than host-parasite associations. While this study demonstrates distinct patterns of filarial nematode infection in Malagasy bats and highlights potential drivers of associated geographic distributions, future work should focus on their alpha taxonomy and characterize arthropod vectors.

  7. American Canine Hepatozoonosis

    Science.gov (United States)

    Ewing, S. A.; Panciera, R. J.

    2003-01-01

    American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

  8. Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations.

    Science.gov (United States)

    Riley, Matthew C; Wilkes, Rebecca P

    2015-12-18

    Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine

  9. Use of serologic tests to predict resistance to Canine distemper virus-induced disease in vaccinated dogs.

    Science.gov (United States)

    Jensen, Wayne A; Totten, Janet S; Lappin, Michael R; Schultz, Ronald D

    2015-09-01

    The objective of the current study was to determine whether detection of Canine distemper virus (CDV)-specific serum antibodies correlates with resistance to challenge with virulent virus. Virus neutralization (VN) assay results were compared with resistance to viral challenge in 2 unvaccinated Beagle puppies, 9 unvaccinated Beagle dogs (4.4-7.2 years of age), and 9 vaccinated Beagle dogs (3.7-4.7 years of age). Eight of 9 (89%) unvaccinated adult dogs exhibited clinical signs after virus challenge, and 1 (13%) dog died. As compared to adult dogs, the 2 unvaccinated puppies developed more severe clinical signs and either died or were euthanized after challenge. In contrast, no clinical signs were detected after challenge of the 9 adult vaccinated dogs with post-vaccination intervals of up to 4.4 years. In vaccinated dogs, the positive and negative predictive values of VN assay results for resistance to challenge were 100% and 0%, respectively. Results indicate that dogs vaccinated with modified live CDV can be protected from challenge for ≤4.4 years postvaccination and that detection of virus-specific antibodies is predictive of whether dogs are resistant to challenge with virulent virus. Results also indicate that CDV infection in unvaccinated dogs results in age-dependent morbidity and mortality. Knowledge of age-dependent morbidity and mortality, duration of vaccine-induced immunity, and the positive and negative predictive values of detection of virus-specific serum antibodies are useful in development of rational booster vaccination intervals for the prevention of CDV-mediated disease in adult dogs. © 2015 The Author(s).

  10. Characterization of a canine model of glycogen storage disease type IIIa

    Directory of Open Access Journals (Sweden)

    Haiqing Yi

    2012-11-01

    Glycogen storage disease type IIIa (GSD IIIa is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR. The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We characterized in detail the disease expression and progression in eight dogs from age 2 to 16 months. Monthly blood biochemistry revealed elevated and gradually increasing serum alanine transaminase (ALT, aspartate transaminase (AST and alkaline phosphatase (ALP activities; serum creatine phosphokinase (CPK activity exceeded normal range after 12 months. Analysis of tissue biopsy specimens at 4, 12 and 16 months revealed abnormally high glycogen contents in liver and muscle of all dogs. Fasting liver glycogen content increased from 4 months to 12 months, but dropped at 16 months possibly caused by extended fibrosis; muscle glycogen content continually increased with age. Light microscopy revealed significant glycogen accumulation in hepatocytes at all ages. Liver histology showed progressive, age-related fibrosis. In muscle, scattered cytoplasmic glycogen deposits were present in most cells at 4 months, but large, lake-like accumulation developed by 12 and 16 months. Disruption of the contractile apparatus and fraying of myofibrils was observed in muscle at 12 and 16 months by electron microscopy. In conclusion, the CCR dogs are an accurate model of GSD IIIa that will improve our understanding of the disease progression and allow opportunities to investigate treatment interventions.

  11. Lipoprotein biosynthesis as a target for anti-Wolbachia treatment of filarial nematodes

    Directory of Open Access Journals (Sweden)

    Slatko Barton E

    2010-10-01

    Full Text Available Abstract Background Lymphatic filariasis and onchocerciasis are debilitating diseases caused by filarial nematodes. Disease pathogenesis is induced by inflammatory responses following the death of the parasite. Wolbachia endosymbionts of filariae are potent inducers of innate and adaptive inflammation and bacterial lipoproteins have been identified as the ligands that bind toll-like receptors (TLR 2 and TLR6. Lipoproteins are important structural and functional components of bacteria and therefore enzymes involved in Wolbachia lipoprotein biosynthesis are potential chemotherapeutic targets. Results Globomycin, a signal peptidase II (LspA inhibitor, has activity against Gram-negative bacteria and a putative lspA gene has been identified from the Wolbachia genome of Brugia malayi (wBm. The amino acids required for function are strictly conserved and functionality was verified by complementation tests in a temperature-sensitive Escherichia coli lspA mutant. Also, transformation of wild type E. coli with Wolbachia lspA conferred significant globomycin resistance. A cell-based screen has been developed utilizing a Wolbachia-containing Aedes albopictus cell line to assay novel compounds active against Wolbachia. Globomycin was screened using this assay, which resulted in a dose-dependent reduction in Wolbachia load. Furthermore, globomycin was also effective in reducing the motility and viability of adult B. malayi in vitro. Conclusions These studies validate lipoprotein biosynthesis as a target in an organism for which no genetic tools are available. Further studies to evaluate drugs targeting this pathway are underway as part of the A-WOL drug discovery and development program.

  12. The owner-animal-environment triad in the treatment of canine periodontal disease.

    Science.gov (United States)

    Hale, Fraser A

    2003-06-01

    In a perfect world, all veterinarians and veterinary dental technicians would understand periodontal disease as well as the dental specialist. They would all be able to recognize the early signs of periodontal disease and recommend treatment to prevent its progression. The owners would have the financial resources, time, and desire to maintain their pet's oral health. The dogs would all be calm and compliant with home care and have no particular anesthetic risks. Unfortunately, this is not a perfect world. Some veterinarians do not understand periodontal disease any better that I understand cosmic string theory. Some owners have limited financial resources and are not particularly committed to their pet's oral health. Some animals will not tolerate any type or manner of home care. Given that animals, their mouths, and their owners come in an infinite variety of shapes and sizes (figuratively and literally), how can we talk about the treatment of periodontal disease as if it is a single condition with a single treatment, or even only a few treatment options? Each owner, animal, and its environment must be assessed on an individual basis to develop a treatment plan that is reasonable and attainable based on the unique circumstances of each case. So, what should be the goal when treating periodontal disease? Is it the preservation of all teeth at all costs? Is it the preservation of important teeth if the costs can be kept reasonable? I would suggest that the overriding goal of periodontal treatment should be the elimination and prevention of oral infection and oral pain. In the domestic environment, dogs have no real need to defend territory. They have no need to prehend and kill live prey animals. In short, the domesticated pet dog does not need teeth at all. This may seem like an odd statement for a veterinary dentist to make, but I feel quite strongly that a dog is far better off having no teeth than having bad teeth. My preference is that a dog should have a full

  13. Serum Ionized Calcium Quantification for Staging Canine Periodontal Disease: A Preliminary Study.

    Science.gov (United States)

    Miguel Carreira, L; Daniela, Dias; Pedro, Azevedo

    2015-06-01

    Periodontal diseases (PD) are infectious, inflammatory, progressive diseases of the oral cavity affecting people and dogs. PD takes 2 forms: gingivitis and periodontitis. Diagnosing or staging PD can be achieved only with dental x-rays and periodontal probing, both of which require the use of general anesthesia in dogs. This study aimed to determine whether serum ionized calcium ([iCa(2+)]) levels can be useful in preliminary PD staging in dogs. A sample of 40 dogs (n = 40) was divided into 4 groups (n = 10 each) based on the following PD stages: G1 (gingivitis), G2 (initial periodontitis), G3 (moderate periodontitis), and G4 (severe periodontitis). The groups were then subjected to [iCa(2+)] quantification. Statistically significant differences were observed between PD stages and [iCa(2+)] for all stages except G3 and G4. Therefore, this parameter can be used as an additional tool to establish and monitor preliminary PD status. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

    Science.gov (United States)

    Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

    2017-06-03

    Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

  15. Mapping of the disease locus and identification of ADAMTS10 as a candidate gene in a canine model of primary open angle glaucoma.

    Directory of Open Access Journals (Sweden)

    John Kuchtey

    2011-02-01

    Full Text Available Primary open angle glaucoma (POAG is a leading cause of blindness worldwide, with elevated intraocular pressure as an important risk factor. Increased resistance to outflow of aqueous humor through the trabecular meshwork causes elevated intraocular pressure, but the specific mechanisms are unknown. In this study, we used genome-wide SNP arrays to map the disease gene in a colony of Beagle dogs with inherited POAG to within a single 4 Mb locus on canine chromosome 20. The Beagle POAG locus is syntenic to a previously mapped human quantitative trait locus for intraocular pressure on human chromosome 19. Sequence capture and next-generation sequencing of the entire canine POAG locus revealed a total of 2,692 SNPs segregating with disease. Of the disease-segregating SNPs, 54 were within exons, 8 of which result in amino acid substitutions. The strongest candidate variant causes a glycine to arginine substitution in a highly conserved region of the metalloproteinase ADAMTS10. Western blotting revealed ADAMTS10 protein is preferentially expressed in the trabecular meshwork, supporting an effect of the variant specific to aqueous humor outflow. The Gly661Arg variant in ADAMTS10 found in the POAG Beagles suggests that altered processing of extracellular matrix and/or defects in microfibril structure or function may be involved in raising intraocular pressure, offering specific biochemical targets for future research and treatment strategies.

  16. Recombinant Brugia malayi pepsin inhibitor (rBm33) exploits host signaling events to regulate inflammatory responses associated with lymphatic filarial infections.

    Science.gov (United States)

    Sreenivas, Kirthika; Kalyanaraman, Haripriya; Babu, Subash; Narayanan, Rangarajan Badri

    2017-11-01

    Prolonged existence of filarial parasites and their molecules within the host modulate the host immune system to instigate their survival and induce inflammatory responses that contribute to disease progression. Recombinant Brugia malayi pepsin inhibitor (rBm33) modulates the host immune responses by skewing towards Th1 responses characterized by secretion of inflammatory molecules such as TNF-α, IL-6, nitric oxide (NO). Here we also specified the molecular signaling events triggered by rBm33 in peripheral blood mononuclear cells (PBMCs) of filarial endemic normals (EN). rBm33 predominantly enhanced the levels of nitric oxide in cultured PBMCs but did not result in oxidative stress to the host cells. Further, rBm33 treatment of human PBMCs resulted in higher GSH/GSSG levels. MYD88 dependent activation was found to be associated with rBm33 specific inflammatory cytokine production. rBm33 triggered intracellular signaling events also involved JNK activation in host PBMCs. In addition, c-Fos and not NF-κB was identified as the transcription factor regulating the expression of inflammatory cytokines in rBm33 stimulated PBMCs. rBm33 marked its role in filarial pathology by altered levels of growth factors but did not have a significant impact on matrix metalloproteinases (MMPs), tissue inhibitors of matrix metalloproteinases (TIMPs) activity of host PBMCs. Thus, the study outlines the signaling network of rBm33 induced inflammatory responses within the host immune cells. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Immunity to canine adenovirus respiratory disease: a comparison of attenuated CAV-1 and CAV-2 vaccines.

    Science.gov (United States)

    Cornwell, H J; Koptopoulos, G; Thompson, H; McCandlish, I A; Wright, N G

    1982-01-09

    Four litters of puppies were divided into three groups. One group was vaccinated with a live CAV-1 vaccine and another with a live CAV-2 vaccine. Throat swabs were collected from two dogs in each of these groups to monitor the possible excretion of vaccine virus, but none was found. Both groups, together with the third group of unvaccinated controls, were challenged 17 days later with an aerosol of virulent CAV-2. One dog from each group was killed on the third, fourth, seventh, ninth, 11th and 14th days after challenge. The unvaccinated dogs developed a clinical disease characterised by anorexia, dullness, coughing and tachypnoea. The lungs were consolidated and histological examination revealed the main lesion to be a severe necrotising bronchiolitis. Large amounts of virus were present in the respiratory tissues of these dogs and high titres of virus were isolated from throat swabs. In contrast, both groups of vaccinated dogs remained clinically almost normal with minimal lesions, present for a much shorter period of time. Virus was found on day 4 in the respiratory tissues of one dog vaccinated with CAV-1 but the other vaccinated animals contained little or no virus. In general, the degree of protection afforded by CAV-1 vaccine seemed similar to that provided by CAV-2 vaccine.

  18. Elephantiasis of non-filarial origin (podoconiosis) in the highlands of north-western Cameroon.

    Science.gov (United States)

    Wanji, S; Tendongfor, N; Esum, M; Che, J N; Mand, S; Tanga Mbi, C; Enyong, P; Hoerauf, A

    2008-09-01

    Lymphoedema, a condition of localized fluid retention, results from a compromised lymphatic system. Although one common cause in the tropics is infection with filarial worms, non-filarial lymphoedema, also known as podoconiosis, has been reported among barefoot farmers in volcanic highland zones of Africa, Central and South America and north-western India. There are conflicting reports on the causes of lymphoedema in the highland regions of Cameroon, where the condition is of great public-health importance. To characterise the focus of lymphoedema in the highlands of the North West province of Cameroon and investigate its real causes, a cross-sectional study was carried out on the adults (aged > or =15 years) living in the communities that fall within the Ndop and Tubah health districts. The subjects, who had to have lived in the study area for at least 10 years, were interviewed, examined clinically, and, when possible, checked for microfilaraemia. The cases of lymphoedema confirmed by ultrasonography and a random sample of the other subjects were also tested for filarial antigenaemia. The interviews, which explored knowledge, attitudes and perceptions (KAP) relating to lymphoedema, revealed that the condition was well known, with each study community having a local name for it. Of the 834 individuals examined clinically, 66 (8.1%) had lymphoedema of the lower limb, with all the clinical stages of this condition represented. None of the 792 individuals examined parasitologically, however, had microfilariae of W. bancrofti (or any other filarial parasite) in their peripheral blood, and only one (0.25%) of the 399 individuals tested for the circulating antigens of W. bancrofti gave a positive result. In addition, none of the 504 mosquitoes caught landing on human bait in the study area and dissected was found to harbour any stage of W. bancrofti. These findings indicate that the elephantiasis seen in the North West province of Cameroon is of non-filarial origin.

  19. Adjuvant effects of recombinant giant panda (Ailuropoda melanoleuca) IL-18 on the canine distemper disease vaccine in mice

    OpenAIRE

    YAN, Yue; NIU, Lili; DENG, Jiabo; WANG, Qiang; YU, Jianqiu; ZHANG, Yizheng; WANG, Jianxi; CHEN, Jiao; WEI, Changhe; TAN, Xuemei

    2014-01-01

    Canine distemper virus (CDV) is a morbillivirus known to cause morbidity and mortality in a broad range of animals. Giant pandas (Ailuropoda melanoleuca), especially captive ones, are susceptible to natural infection with CDV. Interleukin-18 (IL-18) is a powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. In this study, a giant panda IL-18 gene eukaryotic expression plasmid (pcAmIL-18) was constructed. Female BALB/c mice were muscular...

  20. Assessment of metabolic changes in the striatum of a MPTP-intoxicated canine model: in vivo ¹H-MRS study of an animal model for Parkinson's disease.

    Science.gov (United States)

    Choi, Chi-Bong; Kim, Sang-Young; Lee, Sung-Ho; Jahng, Geon-Ho; Kim, Hwi-Yool; Choe, Bo-Young; Ryu, Kyung-Nam; Yang, Dal-Mo; Yim, Sung-Vin; Choi, Woo-Suk

    2011-01-01

    Parkinson's disease (PD) is a neurodegenerative disorder characterized by the progressive loss of the dopaminergic neurons in the substantia nigra pars compacta, which projects to the striatum. We induced a selective loss of nigrostriatal dopamine neurons, by infusing the mitochondrial complex 1 inhibitor 1-methyl 4-phenyl 1,2,3,6-tetrahydropyridine (MPTP) into adult beagle dogs (N=5). Single voxel ¹H water suppressed magnetic resonance spectroscopy (¹H-MRS) at 3 T was used to assess the metabolic changes in the striatum of canine before and after MPTP intoxication. The metabolite spectra obtained from the striatum (voxel size: 2 cm³) showed a lower N-acetyl aspartate to total creatine (creatine+phosphocreatine) ratio after MPTP intoxication. There were no significant differences in other metabolite ratios such as glutamate+glutamine, choline-containing compounds (glycerophosphocholine+phophorylcholine and myo-inositol). Our findings indicated that ¹H-MRS is a sensitive, noninvasive measure of neural toxicity and biochemical alterations of the striatum in a canine model of PD, and further studies are needed to confirm brain metabolic changes in association with progression of MPTP-intoxication. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Canine babesiosis: from molecular taxonomy to control

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2009-03-01

    Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

  2. Characterization of the canine urinary proteome.

    Science.gov (United States)

    Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

    2014-06-01

    Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

  3. Approaches to canine health surveillance.

    Science.gov (United States)

    O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

    2014-01-01

    Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

  4. Limitations of the radioimmunoprecipitation polyethylene glycol assay (RIPEGA) for detection of filarial antigens in serum

    International Nuclear Information System (INIS)

    Hamilton, R.G.; Alexander, E.; Adkinson, N.F.

    1984-01-01

    The performance of the radioimmunoprecipitation polyethylene glycol assay (RIPEGA) was examined for quantitation of filarial antigens (Brugia malayi and Dirofilaria immitis) in serum from infected human and animal hosts and non-infected controls. Multiple PEG concentrations were employed to determine the level of non-specific binding (NSB) in non-exposed human sera (NEHS) containing no filarial antigen. The NSB observed when 3 different 125 I-labelled IgG antibodies were added to 26 NEHS varied 3-fold and was correlated significantly with total serum IgM (r = 0.80, P 2 fragment of the 125 I-labelled antibody was used, but the correlation of NSB with total serum IgM remained significant (r = 0.57, P < 0.01). The presence of rheumatoid factor in NEHS sera also significantly increased NSB by an average of 3-fold. These effects eliminated the assay's ability to detect in sera from infected hosts filarial antigen the presence of which could be readily demonstrated by an immunoradiometric assay. The RIPEGA's precision (intra-assay coefficient of variation (CV) = 21% at 35% Bsub(max)) and reproducibility (inter-assay CV = 29% at 35% Bsub(max)) are less satisfactory than many alternative immunoassays. (Auth.)

  5. Development and testing of a de novo clinical staging system for podoconiosis (endemic non-filarial elephantiasis).

    Science.gov (United States)

    Tekola, Fasil; Ayele, Zewdu; Mariam, Dereje Haile; Fuller, Claire; Davey, Gail

    2008-10-01

    To develop and test a robust clinical staging system for podoconiosis, a geochemical disease in individuals exposed to red clay soil. We adapted the Dreyer system for staging filarial lymphoedema and tested it in four re-iterative field tests conducted in an area of high-podoconiosis prevalence in Southern Ethiopia. The system has five stages according to proximal spread of disease and presence of dermal nodules, ridges and bands. We measured the 1-week repeatability and the inter-observer agreement of the final staging system. The five-stage system is readily understood by community workers with little health training. Kappa for 1-week repeatability was 0.88 (95% CI 0.80-0.96), for agreement between health professionals was 0.71 (95% CI 0.60-0.82), while that between health professionals and community podoconiosis agents without formal health training averaged 0.64 (95% CI 0.52-0.78). This simple staging system with good inter-observer agreement and repeatability can assist in the management and further study of podoconiosis.

  6. Life-long diseases need life-long treatment: long-term safety of ciclosporin in canine atopic dermatitis

    Science.gov (United States)

    Nuttall, Tim; Reece, Douglas; Roberts, Elizabeth

    2014-01-01

    Ciclosporin (Atopica; Novartis Animal Health) has been licensed for canine atopic dermatitis (AD) since 2002. Adverse events (AEs) have been reported in 55 per cent of 759 dogs in 15 clinical trials, but are rare in pharmacovigilance data (71.81 AEs/million capsules sold). Gastrointestinal reactions were most common, but were mild and rarely required intervention. Other AEs were rare (≤1 per cent in clinical trials; metabolism is not clinically significant for normal dogs. Concomitant treatment with most drugs is safe. Effects on cytochrome P450 and MDR1 P-glycoprotein activity may elevate plasma ciclosporin concentrations, but short-term changes are not clinically significant. Monitoring of complete blood counts, urinalysis or ciclosporin levels is not justified except with higher than recommended doses and/or long-term concurrent immunosuppressive drugs. Ciclosporin is not a contraindication for killed (including rabies) vaccines, but the licensed recommendation is that live vaccination is avoided during treatment. In conclusion, ciclosporin has a positive risk-benefit profile for the long-term management of canine AD. PMID:24682696

  7. Modelling environmental factors correlated with podoconiosis: a geospatial study of non-filarial elephantiasis.

    Science.gov (United States)

    Molla, Yordanos B; Wardrop, Nicola A; Le Blond, Jennifer S; Baxter, Peter; Newport, Melanie J; Atkinson, Peter M; Davey, Gail

    2014-06-20

    The precise trigger of podoconiosis - endemic non-filarial elephantiasis of the lower legs - is unknown. Epidemiological and ecological studies have linked the disease with barefoot exposure to red clay soils of volcanic origin. Histopathology investigations have demonstrated that silicon, aluminium, magnesium and iron are present in the lower limb lymph node macrophages of both patients and non-patients living barefoot on these clays. We studied the spatial variation (variations across an area) in podoconiosis prevalence and the associated environmental factors with a goal to better understanding the pathogenesis of podoconiosis. Fieldwork was conducted from June 2011 to February 2013 in 12 kebeles (administrative units) in northern Ethiopia. Geo-located prevalence data and soil samples were collected and analysed along with secondary geological, topographic, meteorological and elevation data. Soil data were analysed for chemical composition, mineralogy and particle size, and were interpolated to provide spatially continuous information. Exploratory, spatial, univariate and multivariate regression analyses of podoconiosis prevalence were conducted in relation to primary (soil) and secondary (elevation, precipitation, and geology) covariates. Podoconiosis distribution showed spatial correlation with variation in elevation and precipitation. Exploratory analysis identified that phyllosilicate minerals, particularly clay (smectite and kaolinite) and mica groups, quartz (crystalline silica), iron oxide, and zirconium were associated with podoconiosis prevalence. The final multivariate model showed that the quantities of smectite (RR = 2.76, 95% CI: 1.35, 5.73; p = 0.007), quartz (RR = 1.16, 95% CI: 1.06, 1.26; p = 0.001) and mica (RR = 1.09, 95% CI: 1.05, 1.13; p < 0.001) in the soil had positive associations with podoconiosis prevalence. More quantities of smectite, mica and quartz within the soil were associated with podoconiosis prevalence. Together with previous

  8. Vaccine-induced canine distemper in a lesser panda.

    Science.gov (United States)

    Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

    1976-11-01

    A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

  9. Canine thymoma

    International Nuclear Information System (INIS)

    Aronsohn, M.

    1985-01-01

    Thymoma is an uncommon canine neoplasm of thymic epithelial cells. It is seen in various breeds but may occur more frequently in German Shepherd Dogs. Middle-aged or older dogs can be affected and no sex predilection exists. A paraneoplastic syndrome of myasthenia gravis, nonthymic malignant tumors, and/or polymyositis occurs in a significant number of dogs with thymoma. Clinical signs are variable and are related to a space-occupying cranial mediastinal mass and/or manifestations of the paraneo-plastic syndrome. Dyspnea is the most common presenting clinical sign. Thoracic radiographs usually show a cranial mediastinal mass. Lymphoma is the main differential diagnosis. A definitive diagnosis may be made by closed biopsy but is more likely to be confirmed by thoracotomy. Thymomas may be completely contained within the thymic capsule or may spread by local invasion or metastasis. A staging system allows for an accurate prognosis and a therapeutic plan. Surgical removal of encapsulated thymomas may result in long-term survival or cure. Invasive or metastatic thymomas carry a guarded prognosis. Manifestations of the paraneoplastic syndrome complicate treatment. Adjuvant radiation and chemotherapy may be of value for advanced cases; however, adequate clinical trials have not been done in the dog

  10. Arginase-1 expressing microglia in close proximity to motor neurons were increased early in disease progression in canine degenerative myelopathy, a model of amyotrophic lateral sclerosis.

    Science.gov (United States)

    Toedebusch, Christine M; Snyder, John C; Jones, Maria R; Garcia, Virginia B; Johnson, Gayle C; Villalón, Eric L; Coates, Joan R; Garcia, Michael L

    2018-04-01

    Toxicity within superoxide dismutase-1 (SOD1)-associated familial amyotrophic lateral sclerosis (ALS) is non-cell autonomous with direct contribution from microglia. Microglia exhibit variable expression of neuroprotective and neurotoxic molecules throughout disease progression. The mechanisms regulating microglial phenotype within ALS are not well understood. This work presents a first study to examine the specific microglial phenotypic response in close association to motor neurons in a naturally occurring disease model of ALS, canine degenerative myelopathy (DM). Microglia closely associated with motor neurons were increased in all stages of DM progression, although only DM Late reached statistical significance. Furthermore, the number of arginase-1 expressing microglia per motor neuron were significantly increased in early stages of DM, whereas the number of inducible nitric oxide synthase (iNOS)-expressing microglia per motor neuron was indistinguishable from aged controls at all stages of disease. Fractalkine, a chemotactic molecule for microglia, was expressed in motor neurons, and the fractalkine receptor was specifically localized to microglia. However, we found no correlation between microglial response and lumbar spinal cord fractalkine levels. Taken together, these data suggest that arginase-1-expressing microglia are recruited to the motor neuron early in DM disease through a fractalkine-independent mechanism. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War

    Science.gov (United States)

    1981-06-05

    anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

  12. Health-seeking behaviors and self-care practices of people with filarial lymphoedema in Nepal: a qualitative study.

    Science.gov (United States)

    Adhikari, Ram Kumar; Sherchand, Jeevan Bahadur; Mishra, Shiva Raj; Ranabhat, Kamal; Pokharel, Amrit; Devkota, Pramila; Mishra, Durga; Ghimire, Yadu Chandra; Gelal, Khageshwor; Paudel, Rajan; Wagle, Rajendra Raj

    2015-01-01

    Background. Lymphatic filariasis is endemic in Nepal. This study aimed to investigate health-seeking behaviors and self-care practices of people with filarial Lymphoedema in Nepal. Methods. A cross-sectional study was conducted using qualitative methods in three endemic districts. Twenty-three patients with current Lymphoedema were recruited in the study. Results. Hydrocele was found to be a well-known condition and a major health problem in the studied communities. People with Lymphoedema primarily sought health care from traditional healers, whereas sometimes home-based care was their first treatment. Later Ayurvedic and allopathic hospital-based care were sought. Respondents reported various psychological problems such as difficulty in engaging in sexual intercourse, anxiety, worry and stress, depression, low self-esteem, feeling weak, fear of being abandoned, and fear of transmitting disease to the children. Standard foot care practices except washing were largely absent. Conclusions. Lymphoedema in the limbs and hydrocele were found to be major health problems. The traditional health care providers were the first contact of care for the majority of respondents. Only a few patients had been practicing standard foot care practices.

  13. Health-Seeking Behaviors and Self-Care Practices of People with Filarial Lymphoedema in Nepal: A Qualitative Study

    Directory of Open Access Journals (Sweden)

    Ram Kumar Adhikari

    2015-01-01

    Full Text Available Background. Lymphatic filariasis is endemic in Nepal. This study aimed to investigate health-seeking behaviors and self-care practices of people with filarial Lymphoedema in Nepal. Methods. A cross-sectional study was conducted using qualitative methods in three endemic districts. Twenty-three patients with current Lymphoedema were recruited in the study. Results. Hydrocele was found to be a well-known condition and a major health problem in the studied communities. People with Lymphoedema primarily sought health care from traditional healers, whereas sometimes home-based care was their first treatment. Later Ayurvedic and allopathic hospital-based care were sought. Respondents reported various psychological problems such as difficulty in engaging in sexual intercourse, anxiety, worry and stress, depression, low self-esteem, feeling weak, fear of being abandoned, and fear of transmitting disease to the children. Standard foot care practices except washing were largely absent. Conclusions. Lymphoedema in the limbs and hydrocele were found to be major health problems. The traditional health care providers were the first contact of care for the majority of respondents. Only a few patients had been practicing standard foot care practices.

  14. Radioresistant canine hematopoietic cells

    International Nuclear Information System (INIS)

    Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.

    1987-01-01

    Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

  15. Genetics of Human and Canine Dilated Cardiomyopathy

    OpenAIRE

    Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland

    2015-01-01

    Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...

  16. Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

    Science.gov (United States)

    Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

    2004-01-01

    The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

  17. A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.

    Directory of Open Access Journals (Sweden)

    Sandra J Laney

    2008-06-01

    Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.

  18. Altered T cell memory and effector cell development in chronic lymphatic filarial infection that is independent of persistent parasite antigen.

    Directory of Open Access Journals (Sweden)

    Cathy Steel

    2011-04-01

    Full Text Available Chronic lymphatic filarial (LF infection is associated with suppression of parasite-specific T cell responses that persist even following elimination of infection. While several mechanisms have been implicated in mediating this T cell specific downregulation, a role for alterations in the homeostasis of T effector and memory cell populations has not been explored. Using multiparameter flow cytometry, we investigated the role of persistent filarial infection on the maintenance of T cell memory in patients from the filarial-endemic Cook Islands. Compared to filarial-uninfected endemic normals (EN, microfilaria (mf positive infected patients (Inf had a reduced CD4 central memory (T(CM compartment. In addition, Inf patients tended to have more effector memory cells (T(EM and fewer effector cells (T(EFF than did ENs giving significantly smaller T(EFF:T(EM ratios. These contracted T(CM and T(EFF populations were still evident in patients previously mf+ who had cleared their infection (CLInf. Moreover, the density of IL-7Rα, necessary for T memory cell maintenance (but decreased in T effector cells, was significantly higher on memory cells of Inf and CLInf patients, although there was no evidence for decreased IL-7 or increased soluble IL7-Rα, both possible mechanisms for signaling defects in memory cells. However, effector cells that were present in Inf and CLInf patients had lower percentages of HLA-DR suggesting impaired function. These changes in T cell populations appear to reflect chronicity of infection, as filarial-infected children, despite the presence of active infection, did not show alterations in the frequencies of these T cell phenotypes. These data indicate that filarial-infected patients have contracted T(CM compartments and a defect in effector cell development, defects that persist even following clearance of infection. The fact that these global changes in memory and effector cell compartments do not yet occur in infected children

  19. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

    Science.gov (United States)

    McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

    2014-09-05

    Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  20. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-09-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  1. Adjuvant effects of recombinant giant panda (Ailuropoda melanoleuca) IL-18 on the canine distemper disease vaccine in mice.

    Science.gov (United States)

    Yan, Yue; Niu, Lili; Deng, Jiabo; Wang, Qiang; Yu, Jianqiu; Zhang, Yizheng; Wang, Jianxi; Chen, Jiao; Wei, Changhe; Tan, Xuemei

    2015-02-01

    Canine distemper virus (CDV) is a morbillivirus known to cause morbidity and mortality in a broad range of animals. Giant pandas (Ailuropoda melanoleuca), especially captive ones, are susceptible to natural infection with CDV. Interleukin-18 (IL-18) is a powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. In this study, a giant panda IL-18 gene eukaryotic expression plasmid (pcAmIL-18) was constructed. Female BALB/c mice were muscularly inoculated with the plasmids pcAmIL-18, pcDNA3.1 and PBS, respectively. They were subsequently injected with an attenuated CDV vaccine for dogs, and the induced humoral and cellular responses were evaluated. The results showed that pcAmIL-18 remarkably improved the level of specific antibody, IFN-γ and IL-2 in mice sera, the T lymphocyte proliferation index and the percentage of CD4(+) and CD8(+) cells. These data indicated that pcAmIL-18 is a potential adjuvant that promotes specific immunity.

  2. Glucosamine and chondroitin use in canines for osteoarthritis: A ...

    African Journals Online (AJOL)

    Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...

  3. Upregulation of CB2 receptors in reactive astrocytes in canine degenerative myelopathy, a disease model of amyotrophic lateral sclerosis

    Science.gov (United States)

    Fernández-Trapero, María; Espejo-Porras, Francisco; Rodríguez-Cueto, Carmen; Coates, Joan R.; Pérez-Díaz, Carmen; de Lago, Eva; Fernández-Ruiz, Javier

    2017-01-01

    ABSTRACT Targeting of the CB2 receptor results in neuroprotection in the SOD1G93A mutant mouse model of amyotrophic lateral sclerosis (ALS). The neuroprotective effects of CB2 receptors are facilitated by their upregulation in the spinal cord of the mutant mice. Here, we investigated whether similar CB2 receptor upregulation, as well as parallel changes in other endocannabinoid elements, is evident in the spinal cord of dogs with degenerative myelopathy (DM), caused by mutations in the superoxide dismutase 1 gene (SOD1). We used well-characterized post-mortem spinal cords from unaffected and DM-affected dogs. Tissues were used first to confirm the loss of motor neurons using Nissl staining, which was accompanied by glial reactivity (elevated GFAP and Iba-1 immunoreactivity). Next, we investigated possible differences in the expression of endocannabinoid genes measured by qPCR between DM-affected and control dogs. We found no changes in expression of the CB1 receptor (confirmed with CB1 receptor immunostaining) or NAPE-PLD, DAGL, FAAH and MAGL enzymes. In contrast, CB2 receptor levels were significantly elevated in DM-affected dogs determined by qPCR and western blotting, which was confirmed in the grey matter using CB2 receptor immunostaining. Using double-labelling immunofluorescence, CB2 receptor immunolabelling colocalized with GFAP but not Iba-1, indicating upregulation of CB2 receptors on astrocytes in DM-affected dogs. Our results demonstrate a marked upregulation of CB2 receptors in the spinal cord in canine DM, which is concentrated in activated astrocytes. Such receptors could be used as a potential target to enhance the neuroprotective effects exerted by these glial cells. PMID:28069688

  4. Upregulation of CB2 receptors in reactive astrocytes in canine degenerative myelopathy, a disease model of amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    María Fernández-Trapero

    2017-05-01

    Full Text Available Targeting of the CB2 receptor results in neuroprotection in the SOD1G93A mutant mouse model of amyotrophic lateral sclerosis (ALS. The neuroprotective effects of CB2 receptors are facilitated by their upregulation in the spinal cord of the mutant mice. Here, we investigated whether similar CB2 receptor upregulation, as well as parallel changes in other endocannabinoid elements, is evident in the spinal cord of dogs with degenerative myelopathy (DM, caused by mutations in the superoxide dismutase 1 gene (SOD1. We used well-characterized post-mortem spinal cords from unaffected and DM-affected dogs. Tissues were used first to confirm the loss of motor neurons using Nissl staining, which was accompanied by glial reactivity (elevated GFAP and Iba-1 immunoreactivity. Next, we investigated possible differences in the expression of endocannabinoid genes measured by qPCR between DM-affected and control dogs. We found no changes in expression of the CB1 receptor (confirmed with CB1 receptor immunostaining or NAPE-PLD, DAGL, FAAH and MAGL enzymes. In contrast, CB2 receptor levels were significantly elevated in DM-affected dogs determined by qPCR and western blotting, which was confirmed in the grey matter using CB2 receptor immunostaining. Using double-labelling immunofluorescence, CB2 receptor immunolabelling colocalized with GFAP but not Iba-1, indicating upregulation of CB2 receptors on astrocytes in DM-affected dogs. Our results demonstrate a marked upregulation of CB2 receptors in the spinal cord in canine DM, which is concentrated in activated astrocytes. Such receptors could be used as a potential target to enhance the neuroprotective effects exerted by these glial cells.

  5. Lymphatic filarial species differentiation using evolutionarily modified tandem repeats: generation of new genetic markers.

    Science.gov (United States)

    Sakthidevi, Moorthy; Murugan, Vadivel; Hoti, Sugeerappa Laxmanappa; Kaliraj, Perumal

    2010-05-01

    Polymerase chain reaction based methods are promising tools for the monitoring and evaluation of the Global Program for the Elimination of Lymphatic Filariasis. The currently available PCR methods do not differentiate the DNA of Wuchereria bancrofti or Brugia malayi by a single PCR and hence are cumbersome. Therefore, we designed a single step PCR strategy for differentiating Bancroftian infection from Brugian infection based on a newly identified gene from the W. bancrofti genome, abundant larval transcript-2 (alt-2), which is abundantly expressed. The difference in PCR product sizes generated from the presence or absence of evolutionarily altered tandem repeats in alt-2 intron-3 differentiated W. bancrofti from B. malayi. The analysis was performed on the genomic DNA of microfilariae from a number of patient blood samples or microfilariae positive slides from different Indian geographical regions. The assay gave consistent results, differentiating the two filarial parasite species accurately. This alt-2 intron-3 based PCR assay can be a potential tool for the diagnosis and differentiation of co-infections by lymphatic filarial parasites. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  6. Small RNAs and extracellular vesicles in filarial nematodes: From nematode development to diagnostics.

    Science.gov (United States)

    Quintana, J F; Babayan, S A; Buck, A H

    2017-02-01

    Parasitic nematodes have evolved sophisticated mechanisms to communicate with their hosts in order to survive and successfully establish an infection. The transfer of RNA within extracellular vesicles (EVs) has recently been described as a mechanism that could contribute to this communication in filarial nematodes. It has been shown that these EVs are loaded with several types of RNAs, including microRNAs, leading to the hypothesis that parasites could actively use these molecules to manipulate host gene expression and to the exciting prospect that these pathways could result in new diagnostic and therapeutic strategies. Here, we review the literature on the diverse RNAi pathways that operate in nematodes and more specifically our current knowledge of extracellular RNA (exRNA) and EVs derived from filarial nematodes in vitro and within their hosts. We further detail some of the issues and questions related to the capacity of RNA-mediated communication to function in parasite-host interactions and the ability of exRNA to enable us to distinguish and detect different nematode parasites in their hosts. © 2016 The Authors. Parasite Immunology published by John Wiley & Sons Ltd.

  7. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers: a new canine model for copper-metabolism disorders

    Directory of Open Access Journals (Sweden)

    Hille Fieten

    2016-01-01

    Full Text Available The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to Wilson disease, which is characterized by a predominantly hepatic copper accumulation. The low incidence and the phenotypic variability of human copper toxicosis hamper identification of causal genes or modifier genes involved in the disease pathogenesis. The Labrador retriever was recently characterized as a new canine model for copper toxicosis. Purebred dogs have reduced genetic variability, which facilitates identification of genes involved in complex heritable traits that might influence phenotype in both humans and dogs. We performed a genome-wide association study in 235 Labrador retrievers and identified two chromosome regions containing ATP7A and ATP7B that were associated with variation in hepatic copper levels. DNA sequence analysis identified missense mutations in each gene. The amino acid substitution ATP7B:p.Arg1453Gln was associated with copper accumulation, whereas the amino acid substitution ATP7A:p.Thr327Ile partly protected against copper accumulation. Confocal microscopy indicated that aberrant copper metabolism upon expression of the ATP7B variant occurred because of mis-localization of the protein in the endoplasmic reticulum. Dermal fibroblasts derived from ATP7A:p.Thr327Ile dogs showed copper accumulation and delayed excretion. We identified the Labrador retriever as the first natural, non-rodent model for ATP7B-associated copper toxicosis. Attenuation of copper accumulation by the ATP7A mutation sheds an interesting light on the interplay of copper transporters in body copper homeostasis and warrants a thorough investigation of ATP7A as a modifier gene in copper-metabolism disorders. The identification of two new functional

  8. Molecular characterization of canine distemper vi- rus circulating in ...

    African Journals Online (AJOL)

    2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

  9. Kinetic Characterisation of Phosphofructokinase Purified from Setaria cervi: A Bovine Filarial Parasite

    Directory of Open Access Journals (Sweden)

    Bechan Sharma

    2011-01-01

    Full Text Available Phosphofructokinase (PFK, a regulatory enzyme in glycolytic pathway, has been purified to electrophoretic homogeneity from adult female Setaria cervi and partially characterized. For this enzyme, the Lineweaver-Burk's double reciprocal plots of initial rates and D-fructose-6-phosphate (F-6-P or Mg-ATP concentrations for varying values of cosubstrate concentration gave intersecting lines indicating that Km values for F-6-P (1.05 mM and ATP (3 μM were independent of each other. S. cervi PFK, when assayed at inhibitory concentration of ATP (>0.1 mM, exhibited sigmoidal behavior towards binding with F-6-P with a Hill coefficient (n value equal to 1.8 and 1.7 at 1.0 and 0.33 mM ATP, respectively. D-fructose-1,6-diphosphate (FDP competitively inhibited the filarial enzyme: Ki and Hill coefficient values being 0.18 μM and 2.0, respectively. Phosphoenolpyruvate (PEP also inhibited the enzyme competitively with the Ki value equal to 0.8 mM. The Hill coefficient values (>1.5 for F-6-P (at inhibitory concentration of ATP and FDP suggested its positive cooperative kinetics towards F-6-P and FDP, showing presence of more than one binding sites for these molecules in enzyme protein and allosteric nature of the filarial enzyme. The product inhibition studies gave us the only compatible mechanism of random addition process with a probable orientation of substrates and products on the enzyme surface.

  10. The Unculturables: targeted isolation of bacterial species associated with canine periodontal health or disease from dental plaque.

    Science.gov (United States)

    Davis, Ian J; Bull, Christopher; Horsfall, Alexander; Morley, Ian; Harris, Stephen

    2014-08-01

    The current inability to culture the entirety of observed bacteria is well known and with the advent of ever more powerful molecular tools, that can survey bacterial communities at previously unattainable depth, the gap in our capacity to culture and define all of these species increases exponentially. This gap has essentially become the rate limiting step in determining how the knowledge of which species are present in a sample can be applied to understand the role of these species in an ecosystem or disease process. A case in point is periodontal disease, which is the most widespread oral disease in dogs. If untreated the disease results in significant pain, eventual loss of the dentition and potentially an increased risk of systemic diseases. Previous molecular based studies have identified the bacterial species associated with periodontal disease in dogs; however without cultured strains from many of these species it has not been possible to study whether they play a role in the disease process. Using a quantitative polymerase chain reaction (qPCR) directed approach a range of microbiological media were screened and optimized to enrich for previously uncultivated target species. A systematic screening methodology was then employed to isolate the species of interest. In cases where the target species were not cultivable in isolation, helper strains grown underneath a nitrocellulose membrane were used to provide the necessary growth factors. This guided media optimization approach enabled the purification of 14 species, 8 of which we had previously been unable to cultivate in isolation. It is also applicable to the targeted isolation of isolates from species that have previously been cultured (for example to study intra-species variation) as demonstrated by the successful isolation of 6 targeted isolates of already cultured species. To our knowledge this is the first time this combination of qPCR guided media optimization, strategic screening and helper strain

  11. Tooth fractures in canine clinical practice

    International Nuclear Information System (INIS)

    Capik, I.; Ledecky, V.; Sevcik, A.

    2001-01-01

    Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

  12. Canine distemper outbreak in rhesus monkeys, China.

    Science.gov (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang

    2011-08-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People's Republic of China. Approximately 10,000 animals were infected (25%-60% disease incidence); 5%-30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  13. Canine Distemper Outbreak in Rhesus Monkeys, China

    Science.gov (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang

    2011-01-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain. PMID:21801646

  14. Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

    DEFF Research Database (Denmark)

    Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold

    2014-01-01

    BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was

  15. Maternal Filarial Infection Influences the Development of Regulatory T Cells in Children from Infancy to Early Childhood.

    Directory of Open Access Journals (Sweden)

    Madhusmita Bal

    2016-11-01

    Full Text Available Children born from filarial infected mothers are comparatively more susceptible to filarial infection than the children born to uninfected mothers. But the mechanism of such increased susceptibility to infection in early childhood is not exactly known. Several studies have shown the association of active filarial infection with T cell hypo-responsiveness which is mediated by regulatory T cells (Tregs. Since the Tregs develop in the thymus from CD4+ CD25hi thymocytes at an early stage of the human fetus, it can be hypothesized that the maternal infection during pregnancy affects the development of Tregs in children at birth as well as early childhood. Hence the present study was designed to test the hypothesis by selecting a cohort of pregnant mothers and children born to them subsequently in a filarial endemic area of Odisha, India.A total number of 49 pregnant mothers and children born to them subsequently have been followed up (mean duration 4.4 years in an area where the microfilariae (Mf rate has come down to <1% after institution of 10 rounds of annual mass drug administration (MDA. The infection status of mother, cord and children were assessed through detection of microfilariae (Mf and circulating filarial antigen (CFA. Expression of Tregs cells were measured by flow cytometry. The levels of IL-10 were evaluated by using commercially available ELISA kit. A significantly high level of IL-10 and Tregs have been observed in children born to infected mother compared to children of uninfected mother at the time of birth as well as during early childhood. Moreover a positive correlation between Tregs and IL-10 has been observed among the children born to infected mother.From these observations we predict that early priming of the fetal immune system by filarial antigens modulate the development of Tregs, which ultimately scale up the production of IL-10 in neonates and creates a milieu for high rate of acquisition of infection in children born

  16. Canine oral melanoma.

    Science.gov (United States)

    Bergman, Philip J

    2007-05-01

    Melanoma is the most common oral malignancy in the dog. Oral and/or mucosal melanoma has been routinely considered an extremely malignant tumor with a high degree of local invasiveness and high metastatic propensity. Primary tumor size has been found to be extremely prognostic. The World Health Organization staging scheme for dogs with oral melanoma is based on size, with stage I = or = 4cm tumor and/or lymph node metastasis, and stage IV = distant metastasis. Median survival times for dogs with oral melanoma treated with surgery are approximately 17 to 18, 5 to 6, and 3 months with stage I, II, and III disease, respectively. Significant negative prognostic factors include stage, size, evidence of metastasis, and a variety of histologic criteria. Standardized treatments such as surgery, coarse-fractionation radiation therapy, and chemotherapy have afforded minimal to modest stage-dependent clinical benefits and death is usually due to systemic metastasis. Numerous immunotherapeutic strategies have been employed to date with limited clinical efficacy; however, the use of xenogeneic DNA vaccines may represent a leap forward in clinical efficacy. Oral melanoma is a spontaneous syngeneic cancer occurring in outbred, immunocompetent dogs and appears to be a more clinically faithful therapeutic model for human melanoma; further use of canine melanoma as a therapeutic model for human melanoma is strongly encouraged. In addition, the development of an expanded but clinically relevant staging system incorporating the aforementioned prognostic factors is also strongly encouraged.

  17. A comparison of the histopathologic pattern of the left atrium in canine dilated cardiomyopathy and chronic mitral valve disease.

    Science.gov (United States)

    Janus, Izabela; Noszczyk-Nowak, Agnieszka; Nowak, Marcin; Ciaputa, Rafał; Kandefer-Gola, Małgorzata; Pasławska, Urszula

    2016-01-05

    Dilated cardiomyopathy (DCM) and chronic mitral valve disease (CMVD) in dogs are associated with heart chamber enlargement, also of the left atrium. DCM is often accompanied by rhythm disturbances (mainly atrial fibrillation or ventricular arrhythmias). In CMVD, arrhythmias are observed less frequently. It is still unclear whether left atrial enlargement in these diseases results from volume overload or if it is also connected with other factors (e.g. rhythm disturbances). This study was conducted on the left atrial myocardial specimens from 31 dogs, including those from 16 dogs with clinically diagnosed DCM and 15 dogs with CMVD. After fixation and staining (using haematoxylin-eosin and Masson-Goldner trichrome stain), the specimens underwent evaluation. Parenchymal changes (fibrosis, fatty infiltration, and vessel narrowing), degenerative changes (loss of striation, changes in cardiomyocyte structure, and abnormal cell nuclei) and the presence of inflammatory infiltrates were assessed. More interstitial fibrosis (median 4 vs. 2.5 grid fields; p < 0.05) and less perivascular fibrosis (median score 1 vs. 2; p < 0.05) was observed in the DCM group compared to the CMVD group. Moreover, less distinct vessel narrowing was observed in the DCM group than in the CMVD group (median lumen area ratio 0.3 vs. 0.26 respectively; p < 0.05). Dogs with DCM showed more strongly defined degenerative changes than the CMVD dogs (median nuclei enlargement score 3 vs. 1, median loss of striation score 3 vs. 2 and median structural alterations score 3 vs. 2, respectively; p < 0.05). The obtained results indicate a different nature of changes occurring in the left atrial myocardium of dogs with DCM compared to dogs with mitral valve disease, including differences in vessel narrowing, cardiomyocyte degeneration and in the distribution of connective tissue.

  18. A novel bocavirus in canine liver

    Directory of Open Access Journals (Sweden)

    Li Linlin

    2013-02-01

    Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

  19. Podoconiosis, a neglected tropical disease

    NARCIS (Netherlands)

    Korevaar, D. A.; Visser, B. J.

    2012-01-01

    Podoconiosis or 'endemic non-filarial elephantiasis' is a tropical disease caused by exposure of bare feet to irritant alkaline clay soils. This causes an asymmetrical swelling of the feet and lower limbs due to lymphoedema. Podoconiosis has a curable pre-elephantiasic phase. However, once

  20. Cytokine production in BALB/c mice immunized with radiation attenuated third stage larvae of the filarial nematode, Brugia pahangi

    International Nuclear Information System (INIS)

    Bancroft, A.J.; Devaney, E.; Grencis, R.K.; Else, K.J.

    1993-01-01

    BALB/c mice immunized with radiation-attenuated third stage larvae of the filarial nematode Brugia pahangi are strongly immune to challenge infection. Investigation of the profile of cytokines secreted by spleen cells from immune mice stimulated in vitro with either parasite Ag or with Con A revealed high levels of IL-5 and IL-9 and moderate levels of IL-4. In contrast, secretion of IFN-γ by spleen cells from immune animals was negligible. Spleen cells from control mice secreted low levels of all cytokines assayed. Levels of parasite-specific IgE were significantly elevated in immune animals and a peripheral blood eosinophilia was observed, which exhibited a biphasic distribution. Our results are consistent with the preferential expansion of Th2 cells in immune animals and provide the basis for dissecting the means by which radiation-attenuated larvae of filarial nematodes stimulate immunity. 5l refs., 3 figs., 3 tabs

  1. In vitro, in silico and in vivo studies of ursolic acid as an anti-filarial agent.

    Directory of Open Access Journals (Sweden)

    Komal Kalani

    Full Text Available As part of our drug discovery program for anti-filarial agents from Indian medicinal plants, leaves of Eucalyptus tereticornis were chemically investigated, which resulted in the isolation and characterization of an anti-filarial agent, ursolic acid (UA as a major constituent. Antifilarial activity of UA against the human lymphatic filarial parasite Brugia malayi using in vitro and in vivo assays, and in silico docking search on glutathione-s-transferase (GST parasitic enzyme were carried out. The UA was lethal to microfilariae (mf; LC100: 50; IC50: 8.84 µM and female adult worms (LC100: 100; IC50: 35.36 µM as observed by motility assay; it exerted 86% inhibition in MTT reduction potential of the adult parasites. The selectivity index (SI of UA for the parasites was found safe. This was supported by the molecular docking studies, which showed adequate docking (LibDock scores for UA (-8.6 with respect to the standard antifilarial drugs, ivermectin (IVM -8.4 and diethylcarbamazine (DEC-C -4.6 on glutathione-s-transferase enzyme. Further, in silico pharmacokinetic and drug-likeness studies showed that UA possesses drug-like properties. Furthermore, UA was evaluated in vivo in B. malayi-M. coucha model (natural infection, which showed 54% macrofilaricidal activity, 56% female worm sterility and almost unchanged microfilaraemia maintained throughout observation period with no adverse effect on the host. Thus, in conclusion in vitro, in silico and in vivo results indicate that UA is a promising, inexpensive, widely available natural lead, which can be designed and developed into a macrofilaricidal drug. To the best of our knowledge this is the first ever report on the anti-filarial potential of UA from E. tereticornis, which is in full agreement with the Thomson Reuter's 'Metadrug' tool screening predictions.

  2. Prevention of inflammation-mediated bone loss in murine and canine periodontal disease via recruitment of regulatory lymphocytes.

    Science.gov (United States)

    Glowacki, Andrew J; Yoshizawa, Sayuri; Jhunjhunwala, Siddharth; Vieira, Andreia E; Garlet, Gustavo P; Sfeir, Charles; Little, Steven R

    2013-11-12

    The hallmark of periodontal disease is the progressive destruction of gingival soft tissue and alveolar bone, which is initiated by inflammation in response to an invasive and persistent bacterial insult. In recent years, it has become apparent that this tissue destruction is associated with a decrease in local regulatory processes, including a decrease of forkhead box P3-expressing regulatory lymphocytes. Accordingly, we developed a controlled release system capable of generating a steady release of a known chemoattractant for regulatory lymphocytes, C-C motif chemokine ligand 22 (CCL22), composed of a degradable polymer with a proven track record of clinical translation, poly(lactic-co-glycolic) acid. We have previously shown that this sustained presentation of CCL22 from a point source effectively recruits regulatory T cells (Tregs) to the site of injection. Following administration of the Treg-recruiting formulation to the gingivae in murine experimental periodontitis, we observed increases in hallmark Treg-associated anti-inflammatory molecules, a decrease of proinflammatory cytokines, and a marked reduction in alveolar bone resorption. Furthermore, application of the Treg-recruiting formulation (fabricated with human CCL22) in ligature-induced periodontitis in beagle dogs leads to reduced clinical measures of inflammation and less alveolar bone loss under severe inflammatory conditions in the presence of a diverse periodontopathogen milieu.

  3. Molecular-level evaluation of selected periodontal pathogens from subgingival regions in canines and humans with periodontal disease.

    Science.gov (United States)

    Gołyńska, Magdalena; Polkowska, Izabela; Bartoszcze-Tomaszewska, Małgorzata; Sobczyńska-Rak, Aleksandra; Matuszewski, Łukasz

    2017-03-30

    Dogs commonly serve as a model for various human conditions, including periodontal diseases. The aim of this study was to identify the anaerobic bacteria that colonize the subgingival areas in dogs and humans by using rapid real-time polymerase chain reaction (RT-PCR)-based tests and to compare the results obtained in each species. Bacterial microflora evaluations, both quantitative and qualitative, were performed by applying ready-made tests on twelve dogs and twelve humans. Five samples were collected from each subject's deepest gingival pockets and joined to form a collective sample. The results of the study revealed interspecies similarities in the prevalences of Porphyromonas ( P .) gingivalis, Treponema denticola, Tannerella forsythia , and Fusobacterium nucleatum . Red complex bacteria comprised the largest portion of the studied bacterial complexes in all study groups, with P. gingivalis being the most commonly isolated bacterium. The results show similarities in the prevalence of bacterial microflora in dogs and humans. Microbiological analysis of gingival pockets by using rapid real-time PCR-based tests in clinical practice, both veterinary and human, can facilitate the choice of appropriate pharmacological treatment and can provide a basis for subsequent verification of the treatment's effectiveness.

  4. Who Is Doing the Dance in Epididymis: The Principle of Moblile Echogenicities Without Filarial Infection: Case Report.

    Science.gov (United States)

    Wang, Zhu; Yang, Zheng; Lei, Yang-Yang; Zhang, Ya-Dong; Chen, Li-Da; Xie, Xiao-Yan; Lu, Ming-De; Wang, Wei

    2015-08-01

    The aim of this study was to explore the principle of moblile echogenicities in epididymis in patients with a history of postvasectomy or infertility, which were reported as the characteristic sonographic sign of filarial infection.We reported a 38-year-old man presented with a 3-year history of infertility after marriage. Ultrasound imaging revealed an enlarged body in the inner left epididymis along with innumerable punctate mobile echogenicities, which showed random to-and-fro movements in the left epididymis. This had previously been recognized as the sonographic filarial dance sign of live filarial worms or microfilaria. The patient subsequently underwent needle aspiration of the left epididymis.Histopathological examination confirmed that the mobile echogenicities were a large number of macrophages with phagocytized sperm or clumps of agglutinated sperm. Our report includes a video clip that will help familiarize readers with this phenomenon.Our case highlighted that moblile echogenicities should be an important sign for epididymal obstruction to initiate corresponding treatment.

  5. Canine disorder mirrors human disease: exonic deletion in HES7 causes autosomal recessive spondylocostal dysostosis in miniature Schnauzer dogs.

    Directory of Open Access Journals (Sweden)

    Cali E Willet

    Full Text Available Spondylocostal dysostosis is a congenital disorder of the axial skeleton documented in human families from diverse racial backgrounds. The condition is characterised by truncal shortening, extensive hemivertebrae and rib anomalies including malalignment, fusion and reduction in number. Mutations in the Notch signalling pathway genes DLL3, MESP2, LFNG, HES7 and TBX6 have been associated with this defect. In this study, spondylocostal dysostosis in an outbred family of miniature schnauzer dogs is described. Computed tomography demonstrated that the condition mirrors the skeletal defects observed in human cases, but unlike most human cases, the affected dogs were stillborn or died shortly after birth. Through gene mapping and whole genome sequencing, we identified a single-base deletion in the coding region of HES7. The frameshift mutation causes loss of functional domains essential for the oscillatory transcriptional autorepression of HES7 during somitogenesis. A restriction fragment length polymorphism test was applied within the immediate family and supported a highly penetrant autosomal recessive mode of inheritance. The mutation was not observed in wider testing of 117 randomly sampled adult miniature schnauzer and six adult standard schnauzer dogs; providing a significance of association of Praw = 4.759e-36 (genome-wide significant. Despite this apparently low frequency in the Australian population, the allele may be globally distributed based on its presence in two unrelated sires from geographically distant locations. While isolated hemivertebrae have been observed in a small number of other dog breeds, this is the first clinical and genetic diagnosis of spontaneously occurring spondylocostal dysostosis in a non-human mammal and offers an excellent model in which to study this devastating human disorder. The genetic test can be utilized by dog breeders to select away from the disease and avoid unnecessary neonatal losses.

  6. Canine disorder mirrors human disease: exonic deletion in HES7 causes autosomal recessive spondylocostal dysostosis in miniature Schnauzer dogs.

    Science.gov (United States)

    Willet, Cali E; Makara, Mariano; Reppas, George; Tsoukalas, George; Malik, Richard; Haase, Bianca; Wade, Claire M

    2015-01-01

    Spondylocostal dysostosis is a congenital disorder of the axial skeleton documented in human families from diverse racial backgrounds. The condition is characterised by truncal shortening, extensive hemivertebrae and rib anomalies including malalignment, fusion and reduction in number. Mutations in the Notch signalling pathway genes DLL3, MESP2, LFNG, HES7 and TBX6 have been associated with this defect. In this study, spondylocostal dysostosis in an outbred family of miniature schnauzer dogs is described. Computed tomography demonstrated that the condition mirrors the skeletal defects observed in human cases, but unlike most human cases, the affected dogs were stillborn or died shortly after birth. Through gene mapping and whole genome sequencing, we identified a single-base deletion in the coding region of HES7. The frameshift mutation causes loss of functional domains essential for the oscillatory transcriptional autorepression of HES7 during somitogenesis. A restriction fragment length polymorphism test was applied within the immediate family and supported a highly penetrant autosomal recessive mode of inheritance. The mutation was not observed in wider testing of 117 randomly sampled adult miniature schnauzer and six adult standard schnauzer dogs; providing a significance of association of Praw = 4.759e-36 (genome-wide significant). Despite this apparently low frequency in the Australian population, the allele may be globally distributed based on its presence in two unrelated sires from geographically distant locations. While isolated hemivertebrae have been observed in a small number of other dog breeds, this is the first clinical and genetic diagnosis of spontaneously occurring spondylocostal dysostosis in a non-human mammal and offers an excellent model in which to study this devastating human disorder. The genetic test can be utilized by dog breeders to select away from the disease and avoid unnecessary neonatal losses.

  7. Long-term safety and efficacy of AAV gene therapy in the canine model of glycogen storage disease type Ia.

    Science.gov (United States)

    Lee, Young Mok; Conlon, Thomas J; Specht, Andrew; Coleman, Kirsten E; Brown, Laurie M; Estrella, Ana M; Dambska, Monika; Dahlberg, Kathryn R; Weinstein, David A

    2018-05-25

    Viral mediated gene therapy has progressed after overcoming early failures, and gene therapy has now been approved for several conditions in Europe and the USA. Glycogen storage disease (GSD) type Ia, caused by a deficiency of glucose-6-phosphatase-α, has been viewed as an outstanding candidate for gene therapy. This follow-up report describes the long-term outcome for the naturally occurring GSD-Ia dogs treated with rAAV-GPE-hG6PC-mediated gene therapy. A total of seven dogs were treated with rAAV-GPE-hG6PC-mediated gene therapy. The first four dogs were treated at birth, and three dogs were treated between 2 and 6 months of age to assess the efficacy and safety in animals with mature livers. Blood and urine samples, radiographic studies, histological evaluation, and biodistribution were assessed. Gene therapy improved survival in the GSD-Ia dogs. With treatment, the biochemical studies normalized for the duration of the study (up to 7 years). None of the rAAV-GPE-hG6PC-treated dogs had focal hepatic lesions or renal abnormalities. Dogs treated at birth required a second dose of rAAV after 2-4 months; gene therapy after hepatic maturation resulted in improved efficacy after a single dose. rAAV-GPE-hG6PC treatment in GSD-Ia dogs was found to be safe and efficacious. GSD-Ia is an attractive target for human gene therapy since it is a monogenic disorder with limited tissue involvement. Blood glucose and lactate monitoring can be used to assess effectiveness and as a biomarker of success. GSD-Ia can also serve as a model for other hepatic monogenic disorders.

  8. Morgan line and its relationship with distraction index, angle of inclination and degenerative joint disease in the diagnosis of canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    F.G. Miranda

    2016-08-01

    Full Text Available ABSTRACT We evaluated 160 hip joint radiographs of 40 dogs of different large breeds (25 females and 15 males from the metropolitan area of Belo Horizonte, Minas Gerais, Brazil. The radiographs of each dog were obtained at two different stages: stage 1 (mean 7.23 months and stage 2 (mean 14.25. The conventional radiographic method (CRM and the radiographic distraction method (RDM were used, carried out in both stages. CRM measured the Norberg angle (NA, the angle of inclination (AI and evaluated the presence of degenerative joint disease (DJD. The MRD was performed to establish the distraction index (DI. The aims were to evaluate the presence of the Morgan line and other signs of DJD and correlate them with the degree of canine hip dysplasia (CHD and also check if the DI greater than 0.3 (first stage was associated with the presence of ML (second stage. It was found that DI, AI and changes of femoral neck and the formation of osteophytes were associated with the presence of ML. It was observed that if the DI is greater than 0.3 at the first stage, the chance of a positive outcome of ML in the second stage increases by 7.2 times. Thus, 49 joints showed DI > 0.3 at the first stage, in which 31 (63.3 % presented ML at the second stage. Of the 31 animals that showed DI ≤ 0.3 at first, six (19.4% had LM at the second stage. There has been a significant association between the presence of ML and the degree of CHD. The more severe the CHD, the higher the percentage of positive ML results. Thus, among the 24 (60 % animals that showed ML, 11 (45.83 % were classified as severe dysplastics, 5 (20.83% as moderate and 8 (33.33 % as mild. None of the animals classified as normal or borderline presented ML. Among the 8 animals classified as mild dysplastics, 5 showed only ML as DJD.

  9. First survey on canine leishmaniasis in a non classical area of the disease in Spain (Lleida, Catalonia) based on a veterinary questionnaire and a cross-sectional study.

    Science.gov (United States)

    Ballart, Cristina; Alcover, M Magdalena; Picado, Albert; Nieto, Javier; Castillejo, Soledad; Portús, Montserrat; Gállego, Montserrat

    2013-04-01

    The Spanish distribution of canine leishmaniasis (CanL) is heterogeneous and very few data are available for the north of the country, including the province of Lleida (Catalonia, Spain). This work describes the results obtained from a questionnaire sent to veterinarians throughout the province of Lleida. The majority of veterinarians (25/32, 78.1%) believed CanL cases were increasing and that the dogs had been infected locally (30/32, 93.8%). Also, a cross-sectional study was performed on the seroprevalence of CanL in kennel dogs, with and without compatible clinical signs, in the county of Pallars Sobirà (Pyrenees of Lleida), where an autochthonous case of CanL had been previously detected. Four serological tests were used (IFAT, ELISA, Western blot, ICF) and dogs that tested positive with at least two immunological methods were considered seropositive and probably infected. 33.1% (48/145) of the dogs were seropositive. The results of a mixed logistic regression model showed that the risk of seropositivity increased with age (OR=1.35, p-value=0.002), among dogs living in the southern part of Pallars Sobirà (OR=6.20, p-value=0.025) and among dogs whose owners considered their animals to be at risk of leishmaniasis infection (OR=1.26, p-value=0.024) and who were unaware of anti-sand fly preventive methods (OR=11.6, p-value=0.009). The risk decreased when dogs lived in an urban-periurban habitat (OR=0.17, p-value=0.002). The information gathered in the veterinary questionnaires helped us to define the knowledge, perception and awareness of the disease in a naïve region, supporting the hypothesis of an existing CanL focus in Pallars Sobirà, which was confirmed by the seroepidemiological survey. The seroprevalence study carried out on kennel dogs of local origin proved useful for detecting an autochthonous focus of leishmaniasis through the analysis of a small number of animals. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Pathogenesis of growth failure and partial reversal with gene therapy in murine and canine Glycogen Storage Disease type Ia.

    Science.gov (United States)

    Brooks, Elizabeth Drake; Little, Dianne; Arumugam, Ramamani; Sun, Baodong; Curtis, Sarah; Demaster, Amanda; Maranzano, Michael; Jackson, Mark W; Kishnani, Priya; Freemark, Michael S; Koeberl, Dwight D

    2013-06-01

    Glycogen Storage Disease type Ia (GSD-Ia) in humans frequently causes delayed bone maturation, decrease in final adult height, and decreased growth velocity. This study evaluates the pathogenesis of growth failure and the effect of gene therapy on growth in GSD-Ia affected dogs and mice. Here we found that homozygous G6pase (-/-) mice with GSD-Ia have normal growth hormone (GH) levels in response to hypoglycemia, decreased insulin-like growth factor (IGF) 1 levels, and attenuated weight gain following administration of GH. Expression of hepatic GH receptor and IGF 1 mRNAs and hepatic STAT5 (phospho Y694) protein levels are reduced prior to and after GH administration, indicating GH resistance. However, restoration of G6Pase expression in the liver by treatment with adeno-associated virus 8 pseudotyped vector expressing G6Pase (AAV2/8-G6Pase) corrected body weight, but failed to normalize plasma IGF 1 in G6pase (-/-) mice. Untreated G6pase (-/-) mice also demonstrated severe delay of growth plate ossification at 12 days of age; those treated with AAV2/8-G6Pase at 14 days of age demonstrated skeletal dysplasia and limb shortening when analyzed radiographically at 6 months of age, in spite of apparent metabolic correction. Moreover, gene therapy with AAV2/9-G6Pase only partially corrected growth in GSD-Ia affected dogs as detected by weight and bone measurements and serum IGF 1 concentrations were persistently low in treated dogs. We also found that heterozygous GSD-Ia carrier dogs had decreased serum IGF 1, adult body weights and bone dimensions compared to wild-type littermates. In sum, these findings suggest that growth failure in GSD-Ia results, at least in part, from hepatic GH resistance. In addition, gene therapy improved growth in addition to promoting long-term survival in dogs and mice with GSD-Ia. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

    Science.gov (United States)

    Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

    2013-01-01

    The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

  12. Comparative occurrence of diabetes in canine, feline, and few wild animals and their association with pancreatic diseases and ketoacidosis with therapeutic approach

    OpenAIRE

    Kamal Niaz; Faheem Maqbool; Fazlullah Khan; Fatima Ismail Hassan; Saeideh Momtaz; Mohammad Abdollahi

    2018-01-01

    Diabetes mellitus (DM) is a chronic metabolic disorder in which blood glucose level raises that can result in severe complications. However, the incidence increased mostly by obesity, pregnancy, persistent corpus luteum, and diestrus phase in humans and animals. This review has focused on addressing the possible understanding and pathogenesis of spontaneous DM in canine, feline, and few wild animals. Furthermore, pancreatic associated disorders, diabetic ketoacidosis, hormonal and drug intera...

  13. Stem Cell-Associated Marker Expression in Canine Hair Follicles.

    Science.gov (United States)

    Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J

    2016-03-01

    Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

  14. Evaluation of P16 expression in canine appendicular osteosarcoma.

    Science.gov (United States)

    Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K

    2017-06-20

    Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

  15. Detection of human filarial parasite Brugia malayi in dogs by histochemical staining and molecular techniques.

    Science.gov (United States)

    Ambily, V R; Pillai, Usha Narayana; Arun, R; Pramod, S; Jayakumar, K M

    2011-09-27

    Human filariasis caused by Brugia malayi is still a public health problem in many countries of Asia including India, Indonesia, Malaysia and Thailand. The World Health Organization (WHO) has targeted to eliminate filariasis by the year 2020 by Mass annual single dose Diethylcarbamazine Administration (MDA). Results of the MDA programme after the first phase was less satisfactory than expected. Malayan filariasis caused by B. malayi is endemic in the south of Thailand where domestic cat serves as the major reservoir host. There is no report about the occurrence of B. malayi in dogs. The present work was carried out to find out the incidence of microfilariasis in dogs and also to detect the presence of human filarial infection in dogs, if any. One hundred dogs above 6 months of age presented to the veterinary college Hospital, Mannuthy, Kerala, with clinical signs suggestive of microfilariasis - fever, anorexia, conjunctivitis, limb and scrotal oedema - were screened for microfilariae by wet film examination. Positive cases were subjected to Giemsa staining, histochemical staining and molecular techniques. Results of the study showed that 80% of dogs had microfilariasis; out of which 20% had sheathed microfilaria. Giemsa and histochemical staining character, PCR and sequencing confirmed it as B. malayi. High prevalence of B. malayi in dogs in this study emphasized the possible role of dogs in transmission of human filariasis. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Impact of climate change on filarial vector, Culex quinquefasciatus and control using bacterial pesticide, spinosad

    Directory of Open Access Journals (Sweden)

    Nareshkumar Arjunan

    2014-02-01

    Full Text Available Objective: To show the effect of temperature on the biology of Culex quinquefasciatus and also to show the effect of the bacterial pesticide, spinosad on developmental stages of the filarial vector. Methods: A laboratory colony of mosquito larvae was used for the larvicidal activity of temperature and spinosad. Twenty-five numbers of first, second, third, fourth instar larvae were introduced into the 500 mL glass beaker containing 250 mL of de-chlorinated water with desired temperatures (16 °C, 20 °C, 24 °C, 28 °C, 32 °C, 36 °C, similarly spinosad, at different concentrations. The development was observed for every 24 h. Results: The results showed that the rise in temperature acts as a growth inhibiting factor for mosquitoes. And no development was found in the temperature below 16 °C and above 36 °C. The hatchability was increased as the temperature was increased up to 32 °C, after which eclosion rates dropped gradually. Conclusions: 32 °C was obtained as the maximum sustainable temperature and after which the developmental rate was gradually reduced. The optimal temperature for development was lower than the temperatures at which development was quickest. The bacterial pesticide spinosad showed that it is an effective mosquito control agent and can be used for further integrated pest management programmes.

  17. Vaccines for Canine Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Faeze Foroughi-Parvar

    2014-01-01

    Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

  18. Canine Parvovirus: Current Perspective

    OpenAIRE

    Nandi, S.; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

  19. Cardiac involvement in canine babesiosis : review article

    Directory of Open Access Journals (Sweden)

    R.G. Lobetti

    2005-06-01

    Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

  20. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho

    2012-01-01

    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  1. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Science.gov (United States)

    Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo

    2012-01-01

    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

  2. Intracerebroventricular gene therapy that delays neurological disease progression is associated with selective preservation of retinal ganglion cells in a canine model of CLN2 disease.

    Science.gov (United States)

    Whiting, Rebecca E H; Jensen, Cheryl A; Pearce, Jacqueline W; Gillespie, Lauren E; Bristow, Daniel E; Katz, Martin L

    2016-05-01

    CLN2 disease is one of a group of lysosomal storage disorders called the neuronal ceroid lipofuscinoses (NCLs). The disease results from mutations in the TPP1 gene that cause an insufficiency or complete lack of the soluble lysosomal enzyme tripeptidyl peptidase-1 (TPP1). TPP1 is involved in lysosomal protein degradation, and lack of this enzyme results in the accumulation of protein-rich autofluorescent lysosomal storage bodies in numerous cell types including neurons throughout the central nervous system and the retina. CLN2 disease is characterized primarily by progressive loss of neurological functions and vision as well as generalized neurodegeneration and retinal degeneration. In children the progressive loss of neurological functions typically results in death by the early teenage years. A Dachshund model of CLN2 disease with a null mutation in TPP1 closely recapitulates the human disorder with a progression from disease onset at approximately 4 months of age to end-stage at 10-11 months. Delivery of functional TPP1 to the cerebrospinal fluid (CSF), either by periodic infusion of the recombinant protein or by a single administration of a TPP1 gene therapy vector to the CSF, significantly delays the onset and progression of neurological signs and prolongs life span but does not prevent the loss of vision or modest retinal degeneration that occurs by 11 months of age. In this study we found that in dogs that received the CSF gene therapy treatment, the degeneration of the retina and loss of retinal function continued to progress during the prolonged life spans of the treated dogs. Eventually the normal cell layers of the retina almost completely disappeared. An exception was the ganglion cell layer. In affected dogs that received TPP1 gene therapy to the CSF and survived an average of 80 weeks, ganglion cell axons were present in numbers comparable to those of normal Dachshunds of similar age. The selective preservation of the retinal ganglion cells suggests

  3. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias

    2016-07-01

    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  4. The Comparative Diagnostic Features of Canine and Human Lymphoma

    Directory of Open Access Journals (Sweden)

    Davis M. Seelig

    2016-06-01

    Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  5. The Comparative Diagnostic Features of Canine and Human Lymphoma.

    Science.gov (United States)

    Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A

    2016-06-01

    The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

  6. Radiation, chemotherapy and surgery for canine osteosarcoma

    International Nuclear Information System (INIS)

    Powers, B.E.; Withrow, S.J.; La Rue, S.M.; Straw, R.C.; Gillette, E.L.

    1987-01-01

    Spontaneous canine osteosarcomas is an excellent model for of human osterosarcoma. Twenty dogs with obsteorsarcoma were treated with intravenous or intraarterial cisplatin with or without radiation therapy. This treatment was given 3 weeks prior to limb sparing surgery involving excision of the tumor and allograft replacement. The excised tumor specimen was examined for complete removal and percentage of necrotic tumor measured by planimetry. Intraveneous and intraarterial cisplatin and radiation methods were compared. Data discussing rate of disease development and recurrences is given

  7. Molecular characterization of the canine HMGB1.

    Science.gov (United States)

    Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I

    2003-01-01

    Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel

  8. Galactolipids from Bauhinia racemosa as a new class of antifilarial agents against human lymphatic filarial parasite, Brugia malayi.

    Science.gov (United States)

    Sashidhara, Koneni V; Singh, Suriya P; Misra, Sweta; Gupta, Jyoti; Misra-Bhattacharya, Shailja

    2012-04-01

    Bioassay guided fractionation of ethanolic extract of the leaves of Bauhinia racemosa led to the isolation of galactolipid and catechin class of the compounds (1-7) from the most active n-butanol fraction (F4). Among the active galactolipids, 1 emerged as the lead molecule which was active on both forms of lymphatic filarial parasite, Brugia malayi. It was found to be better than the standard drug ivermectin and diethylcarbamazine (DEC) in terms of dose and efficacy. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  9. Seasonal and diurnal biting activities and zoonotic filarial infections of two Simulium species (Diptera: Simuliidae in northern Thailand

    Directory of Open Access Journals (Sweden)

    Ishii Y.

    2008-06-01

    Full Text Available Seasonal and daily biting activity patterns, and natural filarial infections of adult black flies attracted to human bait were investigated at Ban Pang Faen, a rural area in Chiang Mai Province in northern Thailand. Collections were carried out twice a month from 06-00 to 18-00 hours from January 2005 to February 2006. Among ten Simulium species collected, S. nodosum and S. asakoae were predominant occupying 57.3% and 37.2% of the total 16, 553 females, respectively. These two predominant species showed different patterns in seasonal abundance: majority of S. nodosum (86.7% were collected in hot season (from mid February to mid May, while most of S. asakoae (74.5% were collected in rainy season (from mid May to mid October. For the daily biting activity, S. nodosum had two patterns: the main one was unimodal with a peak from 17-00 to 18-00, and the other was bimodal and had the major peak from 16-00 to 18-00 and the minor one from 07-00 to 09-00. The pattern of S. asakoae was mostly unimodal with a peak from 06-00 to 10-00. The filarial larvae found in S. nodosum and S. asakoae were morphologically different from each other. The short and thick infective larvae found in S. asakoae differed from all known filarial larvae; it is suggested that they might be a bird parasite, Splendidofilariinae or Lemdaninae. The infection of the mammophilic S. nodosum with large Onchocerca type infective larvae was confirmed in this area. Natural filarial infections were found in each month (except December in either S. nodosum or S. asakoae or in both. Monthly infection rates with all stages of larvae were 0.6-5.0% for S. nodosum, and 1.0-4.0% for S. asakoae. It is suggested that people in this village are exposed to the risk of infection with zoonotic filariae throughout the year.

  10. How soil scientists help combat podoconiosis, a neglected tropical disease

    NARCIS (Netherlands)

    Visser, Benjamin Jelle

    2014-01-01

    Podoconiosis or "endemic non-filarial elephantiasis" is a tropical disease caused by prolonged exposure of bare feet to irritant alkaline clay soils of volcanic origin [1]. The name of the disease is derived from the Greek words for foot: podos, and dust: konos. Small mineral particles from irritant

  11. Current practices and research updates on diabetes mellitus in canine

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar

    2014-11-01

    Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.

  12. Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.

    Science.gov (United States)

    von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H

    2008-05-01

    Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.

  13. A compendium of canine normal tissue gene expression.

    Directory of Open Access Journals (Sweden)

    Joseph Briggs

    Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

  14. Increasing Incidence of Canine Leptospirosis in Switzerland

    Directory of Open Access Journals (Sweden)

    Andrea Major

    2014-07-01

    Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

  15. Attempts to Image the Early Inflammatory Response during Infection with the Lymphatic Filarial Nematode Brugia pahangi in a Mouse Model.

    Directory of Open Access Journals (Sweden)

    Elmarie Myburgh

    Full Text Available Helminth parasites remain a major constraint upon human health and well-being in many parts of the world. Treatment of these infections relies upon a very small number of therapeutics, most of which were originally developed for use in animal health. A lack of high throughput screening systems, together with limitations of available animal models, has restricted the development of novel chemotherapeutics. This is particularly so for filarial nematodes, which are long-lived parasites with a complex cycle of development. In this paper, we describe attempts to visualise the immune response elicited by filarial parasites in infected mice using a non-invasive bioluminescence imaging reagent, luminol, our aim being to determine whether such a model could be developed to discriminate between live and dead worms for in vivo compound screening. We show that while imaging can detect the immune response elicited by early stages of infection with L3, it was unable to detect the presence of adult worms or, indeed, later stages of infection with L3, despite the presence of worms within the lymphatic system of infected animals. In the future, more specific reagents that detect secreted products of adult worms may be required for developing screens based upon live imaging of infected animals.

  16. Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

    Science.gov (United States)

    Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

    2012-07-20

    Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. The potential effects of global warming on changes in canine leishmaniasis in a focus outside the classical area of the disease in southern France.

    Science.gov (United States)

    Dereure, Jacques; Vanwambeke, Sophie O; Malé, Pierre; Martinez, Susana; Pratlong, Francine; Balard, Yves; Dedet, Jean-Pierre

    2009-12-01

    In 1994, an ecoepidemiologic study was carried out in the mid-Ariège valley (French Pyrenees) where autochthonous cases of canine leishmaniasis had been previously reported. Serologic samples were collected from 336 dogs in two groups of villages. The seroprevalences were 11.67% in the valley villages and only 1.43% in the foothill villages. Five lymph node biopsies were taken from serologically positive dogs, and resultant isolates were identified as Leishmania infantum zymodeme MON-1. Phlebotomine sandflies were collected in five locations by CDC light traps. Both of the known French vectors, Phlebotomus ariasi and P. perniciosus, were identified. Bioclimatic and floristic studies showed that this area is an enclave of the supra-Mediterranean climatic zone, containing a typically xerothermophilic Mediterranean flora. The Pyrenees Mountains are usually considered to be outside of the endemic range of leishmaniasis in southern France, and so our demonstration of a microfocus of canine leishmaniasis in the northern foothills is noteworthy. A second serologic survey carried out in 2007 (216 dogs) showed an inversion of the seropositive rates between the two groups of villages compared with those of 1994: only 2.72% in the valley villages and 11.32% in the foothills villages. The decrease of seroprevalence in the first area (valley villages) can be related to a considerable use of deltamethrin collars during the transmission season. The increase of seroprevalence of the foothill villages could be related to climatic conditions, since there was an increase of about 1 degrees C in the mean annual temperature.

  18. Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.

    Science.gov (United States)

    Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D

    2014-12-01

    Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.

  19. Fitness Cost of Litomosoides sigmodontis Filarial Infection in Mite Vectors; Implications of Infected Haematophagous Arthropod Excretory Products in Host-Vector Interactions

    Directory of Open Access Journals (Sweden)

    Adélaïde Nieguitsila

    2013-01-01

    Full Text Available Filariae are a leading cause of infections which are responsible for serious dermatological, ocular, and vascular lesions. Infective third stage larvae (L3 are transmitted through the bite of a haematophagous vector. Litomosoides sigmodontis is a well-established model of filariasis in the mouse, with the vector being the mite Ornithonyssus bacoti. The aim of the study was to analyse the filarial infection in mites to determine the consequences of filarial infection in the blood-feeding and the reproduction of mites as well as in the regulation of vector-induced inflammation in the mouse skin. Firstly, L3 are unevenly distributed throughout the host population and the majority of the population harbours a moderate infection (1 to 6 L3. Filarial infection does not significantly affect the probing delay for blood feeding. The number of released protonymphs is lower in infected mites but is not correlated with the L3 burden. Finally, induced excreted proteins from infected mites but not from uninfected mites stimulate TNF-α and the neutrophil-chemoattractant KC production by antigen-presenting cells (APCs. Altogether, these results describe the modification of the mite behavior under filarial infection and suggest that the immunomodulatory capacity of the mite may be modified by the presence of the parasite, hindering its defensive ability towards the vertebrate host.

  20. Definition, Classification, and Pathophysiology of Canine Glaucoma.

    Science.gov (United States)

    Pizzirani, Stefano

    2015-11-01

    Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Bilateral supernumerary primary maxillary canines

    Directory of Open Access Journals (Sweden)

    Santanu Mukhopadhyay

    2018-01-01

    Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

  2. Feline and canine coronaviruses: common genetic and pathobiological features.

    Science.gov (United States)

    Le Poder, Sophie

    2011-01-01

    A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  3. Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

    Directory of Open Access Journals (Sweden)

    Sophie Le Poder

    2011-01-01

    Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

  4. Canine Intracranial Meningioma: Case report

    Directory of Open Access Journals (Sweden)

    José Ricardo Gomes de Carvalho

    2016-11-01

    Full Text Available ABSTRACT. Carvalho J.R.G., Vasconcellos C.H.C., Bastos I. P.B., Trajano F.L.C., Costa T.S. & Fernandes J.I [Canine Intracranial Meningioma: Case report.] Meningioma intracraniano canino: Relato de caso. Revista Brasileira de Medicina Veterinária, 38(supl. 3:1- 7, 2016. Programa de Pós-Graduação em Ciências Veterinária, Universidade Federal Rural do Rio de Janeiro, BR 465 Km 7, Seropédica, RJ 23.897-000, Brasil, E-mail: vetjulio@yahoo.com.br Intracranial neoplasms usually show their signals in a moderate way, revealing a long background of nonspecific signs, making the diagnosis more difficult. The meningioma is the most common intracranial neoplasm in dogs and cats. Along the years, the Veterinary Medicine has experienced important technological improvements, making it possible the diagnosis of a lot of diseases. Therefore, diseases considered not common in the past, started being diagnosed more frequently, for instance, brain lesions. The objective of this research is to report a case of intracranial meningioma in a Boxer dog that arrived at the Veterinary Hospital of the Federal Rural University of Rio de Janeiro, highlighting its clinical improvement, diagnosis and treatment.

  5. IQGAP1 is an oncogenic target in canine melanoma.

    Directory of Open Access Journals (Sweden)

    Becky H Lee

    Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.

  6. Spatial analysis of visceral leishmaniasis in the municipality of Rondonópolis, in the Brazilian State of Mato Grosso, from 2003 to 2012: human, canine and vector distribution in areas of disease transmission

    Directory of Open Access Journals (Sweden)

    Alexander Gonçalves Ferreira Guimarães

    2015-06-01

    Full Text Available INTRODUCTION: Visceral leishmaniasis (VL is a zoonosis of great importance to public health and is considered a neglected disease by the World Health Organization. The disease has expanded and become more prevalent in urban areas in Brazil. METHODS: Geospatial analyses were performed and thematic maps of the triad of the disease were produced for the study period (2003-2012 in the urban area of the municipality of Rondonópolis in the midwestern State of Mato Grosso (MT, Brazil, TerraView 4.2.2 software was used for the analyses. RESULTS: A total of 87.9% of the 186 confirmed human cases of VL were cured. Children between the ages of 1 and 4 were the most affected. Registered deaths were predominant among adults aged 60 years or older. The urban area of the municipality consists of eight strata and 12 census districts include 237 neighborhoods. All sectors had confirmed cases of VL. During the study period, human cases of the disease were recorded in 90 neighborhoods. The 23 deaths from the disease were distributed in 21 neighborhoods. Sandflies carrying the parasite were captured in 192 out of 200 neighborhoods evaluated for the presence of the VL vector. The presence of dogs carrying the parasite was confirmed in, 140 out of 154 surveyed neighborhoods. CONCLUSIONS: The data demonstrated the endemic nature of VL, with a high percentage of infected children, a high distribution of canine infection, and a wide adaptation and dispersal of the vectors in the urban environment. These results, illustrate the process of urbanization of VL in the municipality of Rondonópolis, MT, Brazil.

  7. A New MRI-Based Model of Heart Function with Coupled Hemodynamics and Application to Normal and Diseased Canine Left Ventricles

    Science.gov (United States)

    Choi, Young Joon; Constantino, Jason; Vedula, Vijay; Trayanova, Natalia; Mittal, Rajat

    2015-01-01

    A methodology for the simulation of heart function that combines an MRI-based model of cardiac electromechanics (CE) with a Navier–Stokes-based hemodynamics model is presented. The CE model consists of two coupled components that simulate the electrical and the mechanical functions of the heart. Accurate representations of ventricular geometry and fiber orientations are constructed from the structural magnetic resonance and the diffusion tensor MR images, respectively. The deformation of the ventricle obtained from the electromechanical model serves as input to the hemodynamics model in this one-way coupled approach via imposed kinematic wall velocity boundary conditions and at the same time, governs the blood flow into and out of the ventricular volume. The time-dependent endocardial surfaces are registered using a diffeomorphic mapping algorithm, while the intraventricular blood flow patterns are simulated using a sharp-interface immersed boundary method-based flow solver. The utility of the combined heart-function model is demonstrated by comparing the hemodynamic characteristics of a normal canine heart beating in sinus rhythm against that of the dyssynchronously beating failing heart. We also discuss the potential of coupled CE and hemodynamics models for various clinical applications. PMID:26442254

  8. Canine hypothyroidism. A diagnostic challenge?

    International Nuclear Information System (INIS)

    Boretti, Felicitos; Reusch, C.E.

    2010-01-01

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered ) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  9. Canine obesity: an overview.

    Science.gov (United States)

    Gossellin, J; Wren, J A; Sunderland, S J

    2007-08-01

    Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

  10. Peracute Infectious Canine Hepatitis

    Directory of Open Access Journals (Sweden)

    A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam

    2012-05-01

    Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

  11. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    Science.gov (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  12. Reference genes for reverse transcription quantitative PCR in canine brain tissue

    NARCIS (Netherlands)

    Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

    2015-01-01

    BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

  13. Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

    Science.gov (United States)

    Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

    2015-11-01

    Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

  14. Comparative studies on the biology and filarial susceptibility of selected blood-feeding and autogenous Aedes togoi sub-colonies

    Directory of Open Access Journals (Sweden)

    Anuluck Junkum

    2003-06-01

    Full Text Available Blood-feeding and autogenous sub-colonies were selected from a laboratory, stock colony of Aedes togoi, which was originally collected from Koh Nom Sao, Chanthaburi province, Southeast Thailand. Comparative biology and filarial susceptibility between the two sub-colonies (blood-feeding: F11, F13; autogeny: F38, F40 were investigated to evaluate their viability and vectorial capacity. The results of comparison on biology revealed intraspecific differences, i.e., the average egg deposition/gravid female (F11/F38; F13/F40, embryonation rate (F13/F40, hatchability rate (F11/F38; F13/F40, egg width (F11/F38, wing length of females (F13/F40, and wing length and width of males (F11/F38 in the blood-feeding sub-colony were significantly greater than that in the autogenous sub-colony; and egg length (F11/F38 and width (F13/F40, and mean longevity of adult females (F11/F38 and males (F13/F40 in the blood-feeding sub-colony were significantly less than that in the autogenous sub-colony. The results of comparison on filarial susceptibility demonstrated that both sub-colonies yielded similar susceptibilities to Brugia malayi [blood-feeding/autogeny = 56.7% (F11/53.3%(F38, 60%(F13/83.3%(F40] and Dirofilaria immitis [blood-feeding/autogeny = 85.7%(F11/75%(F38, 45%(F13/29.4%(F40], suggesting autogenous Ae. togoi sub-colony was an efficient laboratory vector in study of filariasis.

  15. Canine distemper spillover in domestic dogs from urban wildlife.

    Science.gov (United States)

    Kapil, Sanjay; Yeary, Teresa J

    2011-11-01

    Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.

  16. Canine distemper virus - a morbillivirus in search of new hosts?

    NARCIS (Netherlands)

    T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions

  17. Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts

    NARCIS (Netherlands)

    Van Den Bossche, Lindsay; Schoonenberg, Vivien A.C.; Burgener, Iwan A.; Penning, Louis C.; Schrall, Ingrid M.; Kruitwagen, Hedwig S.; Van Wolferen, Monique E.; Grinwis, Guy C.M.; Kummeling, Anne; Rothuizen, Jan; Van Velzen, Jeroen F.; Stathonikos, Nikolas; Molenaar, Martijn R.; Helms, Bernd J.; Brouwers, Jos F.H.M.; Spee, Bart; Van Steenbeek, Frank G.

    2017-01-01

    Non-alcoholic fatty liver disease (NAFLD) is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in

  18. Prognosis in canine idiopathic immune-mediated haemolytic anaemia

    NARCIS (Netherlands)

    Piek, C.J.

    2011-01-01

    Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and

  19. Clinical manifestations of canine distemper in Nigerian dogs ...

    African Journals Online (AJOL)

    Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...

  20. Genetic variant of canine distemper virus from clinical cases in ...

    African Journals Online (AJOL)

    Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...

  1. Canine distemper associated with generalized oedema in Nigerian ...

    African Journals Online (AJOL)

    Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...

  2. Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

    Science.gov (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

    2016-07-15

    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

  3. Canine parvovirus in asymptomatic feline carriers.

    Science.gov (United States)

    Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

    2012-05-25

    Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

  4. Comparative occurrence of diabetes in canine, feline, and few wild animals and their association with pancreatic diseases and ketoacidosis with therapeutic approach.

    Science.gov (United States)

    Niaz, Kamal; Maqbool, Faheem; Khan, Fazlullah; Hassan, Fatima Ismail; Momtaz, Saeideh; Abdollahi, Mohammad

    2018-04-01

    Diabetes mellitus (DM) is a chronic metabolic disorder in which blood glucose level raises that can result in severe complications. However, the incidence increased mostly by obesity, pregnancy, persistent corpus luteum, and diestrus phase in humans and animals. This review has focused on addressing the possible understanding and pathogenesis of spontaneous DM in canine, feline, and few wild animals. Furthermore, pancreatic associated disorders, diabetic ketoacidosis, hormonal and drug interaction with diabetes, and herbal remedies associated with DM are elucidated. Bibliographic search for the present review was done using PubMed, Scopus, and Google Scholar for articles on concurrent DM in small and wild animals. Persistent corpus luteal and pseudopregnancy in female dogs generate gestational DM (GDM). GDM can also be caused by extensive use of drugs/hormones such as glucocorticosteroids. Although many similarities are present between diabetic cats and diabetic humans which present islet amyloidosis, there was a progressive loss of β- and α-cells and the normal number of δ-cells. The most prominent similarity is the occurrence of islet amyloidosis in all cases of diabetic cat and over 90% of human non-insulin dependent DM Type-2. Acute pancreatic necrosis (APN) occurs due to predisposing factors such as insulin antagonism, insulin resistance, alteration in glucose tolerance, obesity, hyperadrenocorticism, and persistent usage of glucocorticoids, as these play a vital role in the progression of APN. To manage such conditions, it is important to deal with the etiological agent, risk factors, diagnosis of diabetes, and hormonal and drug interaction along with its termination with suitable therapy (herbal) protocols. It should be noted that the protocols used for the diagnosis and treatment of human DM are not appropriate for animals. Further investigations regarding diabetic conditions of pets and wild animals are required, which will benefit the health status of

  5. Comparative occurrence of diabetes in canine, feline, and few wild animals and their association with pancreatic diseases and ketoacidosis with therapeutic approach

    Directory of Open Access Journals (Sweden)

    Kamal Niaz

    2018-04-01

    Full Text Available Diabetes mellitus (DM is a chronic metabolic disorder in which blood glucose level raises that can result in severe complications. However, the incidence increased mostly by obesity, pregnancy, persistent corpus luteum, and diestrus phase in humans and animals. This review has focused on addressing the possible understanding and pathogenesis of spontaneous DM in canine, feline, and few wild animals. Furthermore, pancreatic associated disorders, diabetic ketoacidosis, hormonal and drug interaction with diabetes, and herbal remedies associated with DM are elucidated. Bibliographic search for the present review was done using PubMed, Scopus, and Google Scholar for articles on concurrent DM in small and wild animals. Persistent corpus luteal and pseudopregnancy in female dogs generate gestational DM (GDM. GDM can also be caused by extensive use of drugs/hormones such as glucocorticosteroids. Although many similarities are present between diabetic cats and diabetic humans which present islet amyloidosis, there was a progressive loss of β- and α-cells and the normal number of δ-cells. The most prominent similarity is the occurrence of islet amyloidosis in all cases of diabetic cat and over 90% of human non-insulin dependent DM Type-2. Acute pancreatic necrosis (APN occurs due to predisposing factors such as insulin antagonism, insulin resistance, alteration in glucose tolerance, obesity, hyperadrenocorticism, and persistent usage of glucocorticoids, as these play a vital role in the progression of APN. To manage such conditions, it is important to deal with the etiological agent, risk factors, diagnosis of diabetes, and hormonal and drug interaction along with its termination with suitable therapy (herbal protocols. It should be noted that the protocols used for the diagnosis and treatment of human DM are not appropriate for animals. Further investigations regarding diabetic conditions of pets and wild animals are required, which will benefit the

  6. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    Directory of Open Access Journals (Sweden)

    Mostfa Shahabi

    2017-09-01

    Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

  7. Podoplanin Expression in Canine Melanoma

    OpenAIRE

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-01-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

  8. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter

    2009-01-01

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...

  9. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

    Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  10. Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

    NARCIS (Netherlands)

    Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

    2011-01-01

    INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

  11. Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde.

    Science.gov (United States)

    Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis

    2014-04-23

    Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

  12. Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

    Directory of Open Access Journals (Sweden)

    Adina Coșarcă

    2014-02-01

    Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated

  13. FLT3 mutations in canine acute lymphocytic leukemia

    International Nuclear Information System (INIS)

    Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L

    2011-01-01

    FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

  14. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers: a new canine model for copper-metabolism disorders

    NARCIS (Netherlands)

    Fieten, Hille; Gill, Yadvinder; Martin, Alan J.; Concilli, Mafalda; Dirksen, Karen; van Steenbeek, Frank G.; Spee, Bart; van den Ingh, Ted S. G. A. M.; Martens, Ellen C. C. P.; Festa, Paola; Chesi, Giancarlo; van de Sluis, Bart; Houwen, Roderick H. J. H.; Watson, Adrian L.; Aulchenko, Yurii S.; Hodgkinson, Victoria L.; Zhu, Sha; Petris, Michael J.; Polishchuk, Roman S.; Leegwater, Peter A. J.; Rothuizen, Jan

    2016-01-01

    The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to

  15. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers : a new canine model for copper-metabolism disorders

    NARCIS (Netherlands)

    Fieten, Hille; Gill, Yadvinder; Martin, Alan J.; Concilli, Mafalda; Dirksen, Karen; van Steenbeek, Frank G.; Spee, Bart; van den Ingh, Ted S. G. A. M.; Martens, Ellen C. C. P.; Festa, Paola; Chesi, Giancarlo; Sluis, van de Bart; Houwen, Roderick H. J. H.; Watson, Adrian L.; Aulchenko, Yurii S.; Hodgkinson, Victoria L.; Zhu, Sha; Petris, Michael J.; Polishchuk, Roman S.; Leegwater, Peter A. J.; Rothuizen, Jan

    2016-01-01

    The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to

  16. Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

    OpenAIRE

    Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

    2017-01-01

    Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

  17. Recent advances in canine leptospirosis: focus on vaccine development

    Directory of Open Access Journals (Sweden)

    Klaasen HLBM

    2015-06-01

    Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis

  18. Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

    Directory of Open Access Journals (Sweden)

    Víctor Acero P

    2015-09-01

    Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

  19. Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

    2011-01-01

    Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

  20. Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis

    Directory of Open Access Journals (Sweden)

    Jill Narak

    2015-01-01

    Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.

  1. Current state of knowledge: the canine gastrointestinal microbiome.

    Science.gov (United States)

    Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S

    2012-06-01

    Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.

  2. Presence of ecto-protein tyrosine phosphatase activity is vital for survival of Setaria cervi, a bovine filarial parasite.

    Science.gov (United States)

    Singh, Neetu; Heneberg, Petr; Rathaur, Sushma

    2014-10-01

    The ecto protein tyrosine phosphatases (PTP) are known to play a crucial role in the pathogenesis and survival of the intracellular parasites. However, their presence and role in filarial parasites is still unknown. We found a significant amount of tyrosine phosphatase activity in the surface antigen fraction extracted from Setaria cervi (S. cervi), a bovine filarial parasite. An antibody designed against the conserved catalytic core of human protein tyrosine phosphatases, PTP1B cross reacted with a 63 kDa band in the surface antigen. We detected a significant amount of PTP activity in the intact S. cervi adult parasites as well as microfilariae in this study for the first time. This PTP may be localized on the surface of the parasite with an exposed active site available for the external substrates. The PTP activity was also inhibited by sodium orthovanadate and phenyl arsine oxide, specific inhibitors of PTP in both the life stages. The Km and Vmax for PTP in the adult parasites and microfilariae were determined to be 2.574 ± 0.14 mM; 206.3 ± 2.75 μM Pi/h/two parasites and 5.510 ± 0.59 mM; 62.27 ± 2.27 μM Pi/h/10(6) parasites respectively using O-P-L-Tyrosine as substrate. Interestingly, a positive correlation was observed between the inhibition in PTP activity and reduction in the motility/ viability of the parasites when they were subjected to the specific PTP inhibitors (Orthovanadate and Phenyl arsine oxide) for 4 h in the KRB maintenance medium. The activity was also significantly inhibited in the parasites exposed to antifilarial drug/compounds for e.g. Diethylcarbamazine, Acetylsalicylic Acid and SK7, a methyl chalcone. Therefore suggesting a possible role played by PTP in the survival of the parasite, its interaction with the host as well as in the screening of newly synthesized antifilarials/drugs.

  3. Emerging perspectives on hereditary glomerulopathies in canines

    Directory of Open Access Journals (Sweden)

    Littman MP

    2015-04-01

    Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

  4. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.

    2006-01-01

    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  5. An Update on Therapeutic Management of Canine Demodicosis

    Directory of Open Access Journals (Sweden)

    S. K. Singh

    2011-02-01

    Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44

  6. Podoplanin Expression in Canine Melanoma.

    Science.gov (United States)

    Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

    2016-12-01

    A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

  7. Molecular and phylogenetic analysis of the filarial nematode Micipsella numidica from the hare Lepus europaeus in Italy.

    Science.gov (United States)

    Gabrielli, S; Galuppi, R; Fraulo, M; Savini, F; Morandi, B; Cancrini, G; Poglayen, G

    2016-07-01

    The genus Micipsella comprises three species of filariae to date identified in lagomorphs only, whereas the other genera belonging to the subfamily Splendidofilariinae are described as parasites of birds, reptiles and mammals. In the present study seven specimens of Micipsella numidica (Seurat, 1917), collected from the hare Lepus europaeus in Italy, were characterized genetically by molecular amplification of the mitochondrial genes (12S rDNA; cox1) and the 5S rDNA gene spacer region. Phylogenetic trees inferred using available sequences from filariae and those identified in this study evidenced a close relationship between M. numidica and Splendidofilariinae of other mammals and reptiles (Rumenfilaria andersoni and Madathamugadia hiepei). The present findings, apart from adding new data about the hosts in Italy, support the taxonomic position of M. numidica and highlight the substantial biological and molecular differences existing between Splendidofilariinae and other Onchocercidae. The study also contributes to our knowledge of the molecular/genetic diagnosis of filarial parasites of veterinary and medical concern in any vertebrate or invertebrate host.

  8. Canine neosporosis: perspectives on pathogenesis and management

    Directory of Open Access Journals (Sweden)

    Silva RC

    2016-04-01

    Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

  9. Seroepidemiology of Canine parvovirus infection in dogs

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow

    2004-10-01

    Full Text Available Canine parvovirus is an acute and fatal viral disease in dogs. A total of 209 local, cross breed and breed dogs sera from Kodya Bogor, Kabupaten Bogor, Sukabumi, and Jakarta, had been tested using Haemagglutination Inhibition Test (HI with pig red blood cells. A total of 64 breed and cross breed dogs from Sukabumi and Kodya Bogor, were used as a sentinel dogs to study the epidemiology of Canine parvovirus (CPV infection and its immunological responses caused by vaccination. The results indicated that 78% (95 breed and cross bred dogs and 59% (51 local dogs had antibody to CPV. Sentinel dogs results indicated that dogs had been vaccinated showed antibody response with the varied titre dependant upon prevaccination titre. Low prevaccinated titre gave better response than protective level titre. From 19 puppies observed, Maternal antibodi were still detected until 5 weeks old puppies. First vaccination given at less than 3 months old, should be boosted after 3 months old puppied. Antibodi titre produced by natural infection will keep untill 2 years. These data concluded that the dog condition and time of vaccination will affect the optimum antibody response.

  10. Analyses of critical target cell responses during preclinical phases of evolving chronic radiation-induced myeloproliferative disease-exploitation of a unique canine model

    International Nuclear Information System (INIS)

    Seed, T.M.; Kaspar, L.V.; Tolle, D.V.; Fritz, T.E.; Frazier, M.E.

    1988-01-01

    This document briefly summarizes and highlights ongoing studies on the cellular and molecular processes involved in the induction and progression of myeloid leukemia in dogs chronically exposed to low daily doses of wholebody gamma irradiation. Under such conditions, select groups of dogs exhibit extremely high frequencies of myeloproliferative disease (MPD) (i.e., /congruent/50%) of which myeloid leukemia is most prominent. 2 figs

  11. Analyses of critical target cell responses during preclinical phases of evolving chronic radiation-induced myeloproliferative disease-exploitation of a unique canine model

    Energy Technology Data Exchange (ETDEWEB)

    Seed, T.M.; Kaspar, L.V.; Tolle, D.V.; Fritz, T.E.; Frazier, M.E.

    1988-01-01

    This document briefly summarizes and highlights ongoing studies on the cellular and molecular processes involved in the induction and progression of myeloid leukemia in dogs chronically exposed to low daily doses of wholebody gamma irradiation. Under such conditions, select groups of dogs exhibit extremely high frequencies of myeloproliferative disease (MPD) (i.e., /congruent/50%) of which myeloid leukemia is most prominent. 2 figs.

  12. Expression and function of survivin in canine osteosarcoma.

    Science.gov (United States)

    Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H

    2012-01-01

    Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.

  13. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    International Nuclear Information System (INIS)

    Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma

    2006-01-01

    Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

  14. Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

    Directory of Open Access Journals (Sweden)

    Emily J Shields

    Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

  15. Canine and feline colostrum.

    Science.gov (United States)

    Chastant-Maillard, S; Aggouni, C; Albaret, A; Fournier, A; Mila, H

    2017-04-01

    Puppy and kitten survival over the first weeks is particularly dependent on colostrum, a specific secretion of the mammary gland produced during the first 2 days post-partum. Colostrum is a source of nutrients and immunoglobulins. It also contributes to the digestive tract maturation. Colostrum differentiates from milk mainly based on its concentration in immunoglobulins G: 20-30 g/L in dog colostrum, 40-50 g/L in cats' vs <1 g/L in milk. IgG concentration rapidly drops after parturition (-50% in 24 hr). Immune quality of colostrum is highly variable between bitches, with no relationship with maternal blood IgG level, dam's age, breed size or litter size. In addition to systemic immune protection, colostrum also plays a major role for local digestive protection, due to IgA, lysozyme, lactoferrin, white blood cells and various cytokines. Energetic concentration of canine and feline colostrum is not superior to that of mature milk. It depends on colostrum fat concentration and is affected by breed size (higher in breeds <10 kg adult body weight). As puppies and kittens are almost agammaglobulinemic at birth, transfer of IgG from their digestive tract into their bloodstream is crucial for their survival, IgG absorption ending at 12-16 hr after birth. Energetic supply over the two first days of life, as evidenced by growth rate over the two first days of life, also affects risk of neonatal mortality. Early and sufficient suckling of colostrum is thus the very first care to be provided to newborns for their later health and survival. © 2016 Blackwell Verlag GmbH.

  16. Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

    Science.gov (United States)

    Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei

    2013-01-01

    Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666

  17. Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

    Directory of Open Access Journals (Sweden)

    Jiexia Wen

    2013-01-01

    Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.

  18. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  19. A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

    Directory of Open Access Journals (Sweden)

    S. Gur

    2009-05-01

    Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

  20. Surgical innovations in canine gonadectomy

    NARCIS (Netherlands)

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

  1. Immunohistochemical Characterization of Canine Lymphomas

    Directory of Open Access Journals (Sweden)

    Roxana CORA

    2017-11-01

    Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

  2. Urbanization impact on mosquito community and the transmission potential of filarial infection in central Europe

    Czech Academy of Sciences Publication Activity Database

    Čabanová, V.; Miterpáková, M.; Valentová, D.; Blažejová, Hana; Rudolf, Ivo; Stloukal, E.; Hurníková, Z.; Dzidová, M.

    2018-01-01

    Roč. 11, č. 1 (2018), č. článku 261. ISSN 1756-3305 Institutional support: RVO:68081766 Keywords : Culex pipiens complex * West Nile virus * Diptera Culicidae * Anopheles hyrcanus * Dirofilaria immitis * Aedes albopictus * endemic area * 1st record * Slovakia * vector * Dirofilaria * mosquito-borne diseases * Anopheles maculipennis complex * xenomonitoring Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology Impact factor: 3.080, year: 2016

  3. Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

    Directory of Open Access Journals (Sweden)

    Veneziano Vincenzo

    2006-09-01

    Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

  4. Ontogeny of canine dimorphism in extant hominoids.

    Science.gov (United States)

    Schwartz, G T; Dean, C

    2001-07-01

    Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

  5. Canine parvovirus effect on wolf population change and pup survival

    Science.gov (United States)

    Mech, L.D.; Goyal, S.M.

    1993-01-01

    Canine parvovirus infected wild canids more than a decade ago, but no population effect has been documented. In wild Minnesota wolves (Canis lupus) over a 12-yr period, the annual percent population increase and proportion of pups each were inversely related to the percentage of wolves serologically positive to the disease. Although these effects did not seem to retard this large extant population, similar relationships in more isolated wolf populations might hinder recovery of this endangered and threatened species.

  6. Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia

    OpenAIRE

    Saasa, Ngonda; Nalubamba, King Shimumbo; M’kandawire, Ethel; Siwila, Joyce

    2016-01-01

    Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibod...

  7. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  8. Guidelines for the diagnosis and antimicrobial therapy of canine superficial bacterial folliculitis (Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases)

    DEFF Research Database (Denmark)

    Hillier, Andrew; Lloyd, David H.; Weese, J. Scott

    2014-01-01

    from diplomates of the American and European Colleges of Veterinary Dermatology. They describe optimal methods for the diagnosis and management of SBF, including isolation of the causative organism, antimicrobial susceptibility testing, selection of antimicrobial drugs, therapeutic protocols and advice......BACKGROUND: Superficial bacterial folliculitis (SBF) is usually caused by Staphylococcus pseudintermedius and routinely treated with systemic antimicrobial agents. Infection is a consequence of reduced immunity associated with alterations of the skin barrier and underlying diseases that may...... be difficult to diagnose and resolve; thus, SBF is frequently recurrent and repeated treatment is necessary. The emergence of multiresistant bacteria, particularly meticillin-resistant S. pseudintermedius (MRSP), has focused attention on the need for optimal management of SBF. OBJECTIVES: Provision...

  9. The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia.

    Science.gov (United States)

    Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P

    2015-07-01

    The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. European Surveillance for Pantropic Canine Coronavirus

    Science.gov (United States)

    Cordonnier, Nathalie; Demeter, Zoltan; Egberink, Herman; Elia, Gabriella; Grellet, Aurélien; Le Poder, Sophie; Mari, Viviana; Martella, Vito; Ntafis, Vasileios; von Reitzenstein, Marcela; Rottier, Peter J.; Rusvai, Miklos; Shields, Shelly; Xylouri, Eftychia; Xu, Zach; Buonavoglia, Canio

    2013-01-01

    Highly virulent pantropic canine coronavirus (CCoV) strains belonging to subtype IIa were recently identified in dogs. To assess the distribution of such strains in Europe, tissue samples were collected from 354 dogs that had died after displaying systemic disease in France (n = 92), Hungary (n = 75), Italy (n = 69), Greece (n = 87), The Netherlands (n = 27), Belgium (n = 4), and Bulgaria (n = 1). A total of 124 animals tested positive for CCoV, with 33 of them displaying the virus in extraintestinal tissues. Twenty-four CCoV strains (19.35% of the CCoV-positive dogs) detected in internal organs were characterized as subtype IIa and consequently assumed to be pantropic CCoVs. Sequence and phylogenetic analyses of the 5′ end of the spike protein gene showed that pantropic CCoV strains are closely related to each other, with the exception of two divergent French viruses that clustered with enteric strains. PMID:23100349

  11. Pathophysiology, diagnosis, and treatment of canine hip dysplasia

    International Nuclear Information System (INIS)

    Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.

    1996-01-01

    Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education

  12. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  13. Development of lymphatic filarial parasite Wuchereria bancrofti (Spirurida: Onchocercidae) in mosquito species (Diptera: Culicidae) fed artificially on microfilaremic blood.

    Science.gov (United States)

    Paily, K P; Hoti, S L; Balaraman, K

    2006-11-01

    The efficiency of laboratory colonies of mosquitoes such as Anopheles stephensi Liston, Aedes aegypti (L.) Liverpool strain, Ae. aegypti wild type, Aedes albopictus (Skuse), Culex tritaeniorhynchus Giles, Culex sitiens Wiedemann, and Armigeres subalbatus Coquillett in supporting the development of Wuchereria bancrofti (Cobbold) (Spirurida: Onchocercidae) microfilariae to infective larvae was investigated. The mosquitoes were fed on heparinized microfilaremic human blood by using a membrane-feeding unit with Parafilm as membrane. The rate of infection, parasite development, and parasite burden were compared with that in the known vector mosquito Culex quinquefasciatus Say. Cx. quinquefasciatus showed the highest percentage of infection, followed by Ae. aegypti Liverpool strain and An. stephensi. The rate of development of the parasite was more or less similar in all the three species, and infective larvae were found on day 13. When the larvae were harvested on day 17, Cx. quinquefasciatus yielded the highest numbers, followed by Ae. aegypti Liverpool strain and An. stephensi. The percentage of infection was low, and the development was slow in Cx. tritaeniorhynchus compared with the other susceptible species. The parasite developed to second-stage larvae only by day 22 and to infective larvae by day 28. When 2-wk-old Cx. tritaeniorhynchus were fed on microfilaremic blood, they could develop the parasite to infective larvae by day 13 postfeeding. All other species of mosquitoes tested were found to be refractory to parasite development. It is shown that Cx. quinquefasciatus is the most suitable mosquito host for the production of infective larvae. However, Ae. aegypti Liverpool strain, which is commonly used for Brugia malayi filarial parasite, also can be used for generation of W. bancrofti infective larvae to circumvent the problem of maintaining two mosquito species.

  14. Efficacy of three-week oxytetracycline or rifampin monotherapy compared with a combination regimen against the filarial nematode Onchocerca ochengi.

    Science.gov (United States)

    Bah, Germanus S; Ward, Emma L; Srivastava, Abhishek; Trees, Alexander J; Tanya, Vincent N; Makepeace, Benjamin L

    2014-01-01

    Onchocerciasis (river blindness), caused by the filarial nematode Onchocerca volvulus, is a major cause of visual impairment and dermatitis in sub-Saharan Africa. As O. volvulus contains an obligatory bacterial symbiont (Wolbachia), it is susceptible to antibiotic chemotherapy, although current regimens are considered too prolonged for community-level control programs. The aim of this study was to compare the efficacies of oxytetracycline and rifampin, administered separately or in combination, against a close relative of O. volvulus (Onchocerca ochengi) in cattle. Six animals per group were treated with continuous or intermittent oxytetracycline regimens, and effects on adult worm viability, dermal microfilarial loads, and Wolbachia density in worm tissues were assessed. Subsequently, the efficacies of 3-week regimens of oxytetracycline and rifampin alone and a combination regimen were compared, and rifampin levels in plasma and skin were quantified. A 6-month regimen of oxytetracycline with monthly dosing was strongly adulticidal, while 3-week and 6-week regimens exhibited weaker adulticidal effects. However, all three regimens achieved >2-log reductions in microfilarial load. In contrast, rifampin monotherapy and oxytetracycline-rifampin duotherapy failed to induce substantive reductions in either adult worm burden or microfilarial load, although a borderline effect on Wolbachia density was observed following duotherapy. Dermal rifampin levels were maintained above the MIC for >24 h after a single intravenous dose. We conclude that oxytetracycline-rifampin duotherapy is less efficacious against O. ochengi than oxytetracycline alone. Further studies will be required to determine whether rifampin reduces oxytetracycline bioavailability in this system, as suggested by human studies using other tetracycline-rifampin combinations.

  15. New insights into the evolution of Wolbachia infections in filarial nematodes inferred from a large range of screened species.

    Directory of Open Access Journals (Sweden)

    Emanuele Ferri

    Full Text Available Wolbachia are intriguing symbiotic endobacteria with a peculiar host range that includes arthropods and a single nematode family, the Onchocercidae encompassing agents of filariases. This raises the question of the origin of infection in filariae. Wolbachia infect the female germline and the hypodermis. Some evidences lead to the theory that Wolbachia act as mutualist and coevolved with filariae from one infection event: their removal sterilizes female filariae; all the specimens of a positive species are infected; Wolbachia are vertically inherited; a few species lost the symbiont. However, most data on Wolbachia and filaria relationships derive from studies on few species of Onchocercinae and Dirofilariinae, from mammals.We investigated the Wolbachia distribution testing 35 filarial species, including 28 species and 7 genera and/or subgenera newly screened, using PCR, immunohistochemical staining, whole mount fluorescent analysis, and cocladogenesis analysis. (i Among the newly screened Onchocercinae from mammals eight species harbour Wolbachia but for some of them, bacteria are absent in the hypodermis, or in variable density. (ii Wolbachia are not detected in the pathological model Monanema martini and in 8, upon 9, species of Cercopithifilaria. (iii Supergroup F Wolbachia is identified in two newly screened Mansonella species and in Cercopithifilaria japonica. (iv Type F Wolbachia infect the intestinal cells and somatic female genital tract. (v Among Oswaldofilariinae, Waltonellinae and Splendidofilariinae, from saurian, anuran and bird respectively, Wolbachia are not detected.The absence of Wolbachia in 63% of onchocercids, notably in the ancestral Oswaldofilariinae estimated 140 mya old, the diverse tissues or specimens distribution, and a recent lateral transfer in supergroup F Wolbachia, modify the current view on the role and evolution of the endosymbiont and their hosts. Further genomic analyses on some of the newly sampled species

  16. Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

    Science.gov (United States)

    Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

    2011-04-09

    Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

  17. Lack of Ubiquitin Specific Protease 8 (USP8) Mutations in Canine Corticotroph Pituitary Adenomas

    NARCIS (Netherlands)

    Sbiera, Silviu; Tryfonidou, Marianna A; Weigand, Isabel; Grinwis, Guy C M; Broeckx, Bart; Herterich, Sabine; Allolio, Bruno; Deutschbein, Timo; Fassnacht, Martin; Meij, Björn P

    2016-01-01

    PURPOSE: Cushing's disease (CD), also known as pituitary-dependent hyperadrenocorticism, is caused by adrenocorticotropic hormone (ACTH)-secreting pituitary tumours. Affected humans and dogs have similar clinical manifestations, however, the incidence of the canine disease is thousand-fold higher.

  18. Cryopreservation of microencapsulated canine sperm.

    Science.gov (United States)

    Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu

    2011-03-01

    The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Surgical innovations in canine gonadectomy

    OpenAIRE

    Van Goethem, Bart

    2016-01-01

    In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

  20. Canine hepatozoonosis in Brazil: description of eight naturally occurring cases.

    Science.gov (United States)

    Gondim, L F; Kohayagawa, A; Alencar, N X; Biondo, A W; Takahira, R K; Franco, S R

    1998-01-31

    Eight cases of canine hepatozoonosis were diagnosed at the Veterinary Hospital (Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista, Campus de Botucatu), between October 1993 and April 1994. Clinical signs included anorexia, pale mucous membranes, weight loss, pain, diarrhoea, vomit, gait abnormalities, fever, polyuria and polydipsia. Haematologic findings revealed anaemia in seven cases, leucocytosis with neutrophilia in three cases, lymphopenia in three cases and monocytosis in four cases. Serum biochemistries included alterations in many parameters. The micrometry of Hepatozoon canis gametocytes ranged from 6.8 x 4.0 microns to 7.5 x 4.5 microns. Parasitaemia ranged from less than 0.5% to 2%. In all the cases reported other concurrent diseases were present. Diagnosis of canine hepatozoonosis was made by identifying H. canis gametocytes within leucocytes in stained blood smears.

  1. Glucosamine and chondroitin use in canines for osteoarthritis: A review

    Directory of Open Access Journals (Sweden)

    Angel Bhathal

    2017-02-01

    Full Text Available Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine’s quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and conflicting evidence, the natural products glucosamine hydrochloride (HCl and chondroitin sulfate are commonly recommended by veterinarians for treating osteoarthritis in dogs. There is a paucity of well-designed clinical veterinary studies investigating the true treatment effect of glucosamine and chondroitin. The purposes of this review article are to provide a brief background on glucosamine and chondroitin use in canine osteoarthritis and to critically review the available literature on the role of these products for improving clinical outcomes. Based on critical review, recommendations for practice are suggested and a future study design is proposed.

  2. Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells

    Directory of Open Access Journals (Sweden)

    Michelle G. Ritt

    2015-04-01

    Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.

  3. Rabies, canine distemper, and canine parvovirus exposure in large carnivore communities from two Zambian ecosystems.

    Science.gov (United States)

    Berentsen, Are R; Dunbar, Mike R; Becker, Matthew S; M'soka, Jassiel; Droge, Egil; Sakuya, Nicholas M; Matandiko, Wigganson; McRobb, Rachel; Hanlon, Cathleen A

    2013-09-01

    Disease transmission within and among wild and domestic carnivores can have significant impacts on populations, particularly for threatened and endangered species. We used serology to evaluate potential exposure to rabies virus, canine distemper virus (CDV), and canine parvovirus (CPV) for populations of African lions (Panthera leo), African wild dogs (Lycaon pictus), and spotted hyenas (Crocuta crocuta) in Zambia's South Luangwa National Park (SLNP) and Liuwa Plain National Park (LPNP) as well as community lands bordering these areas. In addition, domestic dogs in the study region were evaluated for exposure to CDV and rabies. We provide the first comprehensive disease exposure data for these species in these ecosystems. Twenty-one lions, 20 hyenas, 13 wild dogs, and 38 domestic dogs were sampled across both regions from 2009 to 2011. Laboratory results show 10.5% of domestic dogs, 5.0% of hyenas, and 7.7% of wild dogs sampled were positive for CDV exposure. All lions were negative. Exposure to CPV was 10.0% and 4.8% for hyenas and lions, respectively. All wild dogs were negative, and domestic dogs were not tested due to insufficient serum samples. All species sampled were negative for rabies virus neutralizing antibodies except lions. Forty percent of lions tested positive for rabies virus neutralizing antibodies. Because these lions appeared clinically healthy, this finding is consistent with seroconversion following exposure to rabies antigen. To our knowledge, this finding represents the first ever documentation of rabies virus neutralizing antibodies consistent with rabies exposure that did not lead to clinical disease in free-ranging African lions from this region. With ever-increasing human pressure on these ecosystems, understanding disease transmission dynamics is essential for proper management and conservation of these carnivore species.

  4. Black flies (Diptera : Simuliidae attracted to humans and water buffalos and natural infections with filarial larvae, probably Onchocerca sp., in northern Thailand

    Directory of Open Access Journals (Sweden)

    Takaoka H.

    2003-03-01

    Full Text Available Several Simulium species were investigated as to their biting habits and natural infections with filarial larvae at Ban Pan Fan, Chiang Mai Province, in northern Thailand. Female adults flies landing on or flighting around a human and a water buffalo were collected during the daytime from 06.00 to 19.00 hours on 22 June 2001. As a result, 217 S. nodosum, 86 S. asakoae and two S. nigrogilvum were obtained from a human attractant, and 416 S. nodosum, 25 S. nakhonense, 16 S. asakoae, four 5. fenestratum and two S. nigrogilvum, from a water buffalo. The blood-feeding was confirmed only for S. nodosum and S. nigrogilvum on humans, and for S. nodosum and S. nakhonense on water buffalos. Dissections of these simuliids showed that S. nodosum was naturally infected with developing filarial larvae. Two types of microfilariae were distinguished but only one type of infective larvae. These larvae resembled Onchocerca suzukii, a parasite from a wild Japanese bovid, suggesting that an unknown Onchocerca species from ruminants was transmitted in Thailand. Infection rates with all stages of larvae and third-stage larvae were 2.3 % (14/608 and 1 .0 % (6/608, respectively. This is the first report of natural infections of black flies with Onchocerca larvae in Southeast Asia, and the involved black fly species is shown to be not only anthropophilic but also zoophilic in this region.

  5. Filarial lymphedema is characterized by antigen-specific Th1 and th17 proinflammatory responses and a lack of regulatory T cells.

    Directory of Open Access Journals (Sweden)

    Subash Babu

    Full Text Available Lymphatic filariasis can be associated with development of serious pathology in the form of lymphedema, hydrocele, and elephantiasis in a subset of infected patients.To elucidate the role of CD4(+ T cell subsets in the development of lymphatic pathology, we examined specific sets of cytokines in individuals with filarial lymphedema in response to parasite antigen (BmA and compared them with responses from asymptomatic infected individuals. We also examined expression patterns of Toll-like receptors (TLR1-10 and Nod-like receptors (Nod1, Nod2, and NALP3 in response to BmA. BmA induced significantly higher production of Th1-type cytokines-IFN-gamma and TNF-alpha-in patients with lymphedema compared with asymptomatic individuals. Notably, expression of the Th17 family of cytokines-IL-17A, IL-17F, IL-21, and IL-23-was also significantly upregulated by BmA stimulation in lymphedema patients. In contrast, expression of Foxp3, GITR, TGFbeta, and CTLA-4, known to be expressed by regulatory T cells, was significantly impaired in patients with lymphedema. BmA also induced significantly higher expression of TLR2, 4, 7, and 9 as well Nod1 and 2 mRNA in patients with lymphedema compared with asymptomatic controls.Our findings implicate increased Th1/Th17 responses and decreased regulatory T cells as well as regulation of Toll- and Nod-like receptors in pathogenesis of filarial lymphedema.

  6. Towards immunotherapy with redirected T cells in a large animal model: Ex vivo activation, expansion, and genetic modification of canine T cells

    Science.gov (United States)

    Mata, Melinda; Vera, Juan; Gerken, Claudia; Rooney, Cliona M.; Miller, Tasha; Pfent, Catherine; Wang, Lisa L.; Wilson-Robles, Heather M.; Gottschalk, Stephen

    2014-01-01

    Adoptive transfer of T cells expressing chimeric antigen receptors (CARs) has shown promising anti-tumor activity in early phase clinical studies, especially for hematological malignancies. However, most preclinical models do not reliably mimic human disease. We reasoned that developing an adoptive T-cell therapy approach for spontaneous osteosarcoma (OS) occurring in dogs would more closely reproduce the condition in human cancer. To generate CAR-expressing canine T cells we developed expansion and transduction protocols that allow for the generation of sufficient numbers of CAR-expressing canine T cells for future clinical studies in dogs within 2 weeks of ex vivo culture. To evaluate the functionality of CAR-expressing canine T cells we targeted HER2-positive OS. We demonstrate that canine OS is positive for HER2, and that canine T cells expressing a HER2-specific CAR with human-derived transmembrane and CD28.ζ signaling domains recognize and kill HER2-positive canine OS cell lines in an antigen-dependent manner. To reduce the potential immunogenicity of the CAR we evaluated a CAR with canine-derived transmembrane and signaling domains, and found no functional difference between human and canine CARs. Hence, we have successfully developed a strategy to generate CAR-expressing canine T cells for future preclinical studies in dogs. Testing T-cell therapies in an immunocompetent, outbred animal model may improve our ability to predict their safety and efficacy prior to conducting studies in humans. PMID:25198528

  7. Detection and genetic characterization of Canine parvovirus and Canine coronavirus strains circulating in district of Tirana in Albania.

    Science.gov (United States)

    Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola

    2014-07-01

    An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.

  8. Spread of Canine Flu

    Centers for Disease Control (CDC) Podcasts

    2018-04-05

    Dr. Colin Parrish, a Professor of Virology at the College of Veterinary Medicine, Cornell University, discusses the spread of influenza among dogs.  Created: 4/5/2018 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 4/5/2018.

  9. Canine leishmaniosis in the Old and New Worlds: unveiled similarities and differences.

    Science.gov (United States)

    Dantas-Torres, Filipe; Solano-Gallego, Laia; Baneth, Gad; Ribeiro, Vitor Marcio; de Paiva-Cavalcanti, Milena; Otranto, Domenico

    2012-12-01

    Canine leishmaniosis is a potentially life-threatening disease which is spreading geographically in the Old and New Worlds, where different diagnostic procedures, treatments, and control strategies are currently in place. This Opinion article outlines the similarities and differences between canine leishmaniosis in the Old and New Worlds, with emphasis on South America and Europe. Finally, it calls the attention of veterinary and public health authorities to standardize and improve practices for diagnosing, treating, and preventing the disease. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Histamine 1 Receptor Blockade Enhances Eosinophil-Mediated Clearance of Adult Filarial Worms.

    Directory of Open Access Journals (Sweden)

    Ellen Mueller Fox

    Full Text Available Filariae are tissue-invasive nematodes that cause diseases such as elephantiasis and river blindness. The goal of this study was to characterize the role of histamine during Litomosoides sigmodontis infection of BALB/c mice, a murine model of filariasis. Time course studies demonstrated that while expression of histidine decarboxylase mRNA increases throughout 12 weeks of infection, serum levels of histamine exhibit two peaks-one 30 minutes after primary infection and one 8 weeks later. Interestingly, mice treated with fexofenadine, a histamine receptor 1 inhibitor, demonstrated significantly reduced worm burden in infected mice compared to untreated infected controls. Although fexofenadine-treated mice had decreased antigen-specific IgE levels as well as lower splenocyte IL-5 and IFNγ production, they exhibited a greater than fourfold rise in eosinophil numbers at the tissue site where adult L. sigmodontis worms reside. Fexofenadine-mediated clearance of L. sigmodontis worms was dependent on host eosinophils, as fexofenadine did not decrease worm burdens in eosinophil-deficient dblGATA mice. These findings suggest that histamine release induced by tissue invasive helminths may aid parasite survival by diminishing eosinophilic responses. Further, these results raise the possibility that combining H1 receptor inhibitors with current anthelmintics may improve treatment efficacy for filariae and other tissue-invasive helminths.

  11. Canine sporotrichosis: report of 15 advanced cases

    Directory of Open Access Journals (Sweden)

    Mariana B. Mascarenhas

    Full Text Available ABSTRACT: Sporotrichosis is a chronic, granulomatous and usually lymphocutaneous infection of animals and humans, caused by a dimorphic fungus, Sporothrix schenckii complex. The disease in dogs is considered rare, however, in the last years a crescent registration of cases was observed in Brazil, especially in the city of Rio de Janeiro. Fifteen dogs with ulcerated cutaneous lesions were seen at the Dermatology Service in the Small Animal’s Hospital at Universidade Federal Rural do Rio de Janeiro, between January 2014 and October 2015. Most lesions were located on the head, mainly the nose. Lesions were even seen on the chest, disseminated on the body and on the limbs. Three dogs (20% exhibited the cutaneous-lymphatic form, with lesions initially on the distal aspect of one leg and ascending via lymphatics up the leg to the trunk and head. It was not ruled out the disseminated form in at least 3 dogs (20%. They had consistent signs of generalized or disseminated disease exhibiting respiratory symptoms (nasal discharge, sneezing, stertorous breathing, anorexia and weight loss. Draining tracts and cellulitis were very common. Some had large areas of skin necrosis with exposure of muscle and bone. Definitive diagnosis was obtained by cytological examination of exudates, histological examination, and/or isolation of S. schenckii complex by fungal culture. Because of the severity of the lesions that mimic other disorders like neoplasms or autoimmune skin diseases, and due to the difficulties of getting an accurate diagnosis, this study describes 15 advanced cases of canine sporotrichosis.

  12. [Diagnostic tools for canine parvovirus infection].

    Science.gov (United States)

    Proksch, A L; Hartmann, K

    2015-01-01

    Canine parvovirus (CPV) infection is one of the most important and common infectious diseases in dogs, in particular affecting young puppies when maternal antibodies have waned and vaccine-induced antibodies have not yet developed. The mortality rate remains high. Therefore, a rapid and safe diagnostic tool is essential to diagnose the disease to 1) provide intensive care treatment and 2) to identify virus-shedding animals and thus prevent virus spread. Whilst the detection of antibodies against CPV is considered unsuitable to diagnose the disease, there are several different methods to directly detect complete virus, virus antigen or DNA. Additionally, to test in commercial laboratories, rapid in-house tests based on ELISA are available worldwide. The specificity of the ELISA rapid in-house tests is reported to be excellent. However, results on sensitivity vary and high numbers of false-negative results are commonly reported, which potentially leads to misdiagnosis. Polymerase chain reaction (PCR) is a very sensitive and specific diagnostic tool. It also provides the opportunity to differentiate vaccine strains from natural infection when sequencing is performed after PCR.

  13. Ultrasonography and surgery of canine biliary diseases.

    Science.gov (United States)

    Vörös, K; Németh, T; Vrabély, T; Manczur, F; Tóth, J; Magdus, M; Perge, E

    2001-01-01

    Findings of hepatic and gallbladder ultrasonography were analyzed in 12 dogs with gallbladder and/or extrahepatic biliary tract obstruction and compared with the results of exploratory laparotomy. Hepatic ultrasonography demonstrated normal liver in 2 dogs and hepatic abnormalities in 10 animals. The following ultrasonographic diagnoses were established compared to surgical findings: gallbladder obstruction caused by bile sludge (correct/incorrect: 1/2, surgical diagnosis: choleliths in one case), gallbladder obstruction caused by neoplasm (0/1, surgical diagnosis: mucocele), gallbladder and extrahepatic biliary tract obstruction due to choleliths (3/3), extrahepatic biliary tract obstruction caused by pancreatic mass (1/1) and small intestinal volvulus (1/1). Bile peritonitis caused by gallbladder rupture (4/4) was correctly diagnosed by ultrasound, aided with ultrasonographically-guided abdominocentesis and peritoneal fluid analysis. Rupture of the gallbladder should be suspected in the presence of a small, echogenic gallbladder or in the absence of the organ together with free abdominal fluid during ultrasonography. Laparotomy was correctly indicated by ultrasonography in all cases. However, the direct cause of obstruction could not be determined in 2 of the 12 dogs by ultrasonography alone.

  14. Canine and feline megaesophagus

    International Nuclear Information System (INIS)

    Mears, E.A.; Jenkins, C.C.

    1997-01-01

    Megaesophagus is rare in cats and occurs as a congenital or secondary acquired disorder. In dogs, megaesophagus can occur as a congenital disorder, as a secondary acquired disorder, or as an adult-onset idiopathic disease. This article reviews the anatomy, pathogenesis, causes, clinical signs, diagnosis, and management of megaesophagus. Pathogenesis includes experimental evidence that evaluates the neural pathway of affected patients. The many disease that can cause megaesophagus are delineated. Discussion focuses on the most common causes-myasthenia gravis, hypoadrenocorticism and possibly hypothyroidism, and the obstructive lesions of the esophagus (vascular ring anomalies, tumors, granulomas, strictures, and foreign bodies). The most common clinical sign associated with megaesophagus is regurgitation. Traditional as well as newer techniques (i.e., manometry and nuclear scintigraphy) for evaluating esophageal motility are presented. Definitive diagnosis requires identification of a dilated esophagus on survey thoracic radiographs or a barium esophagogram. Medical management, including alternative feeding methods and the role of prokinetic drugs, is discussed

  15. An integrated in vitro imaging platform for characterizing filarial parasite behavior within a multicellular microenvironment.

    Directory of Open Access Journals (Sweden)

    Timothy Kassis

    2014-11-01

    Full Text Available Lymphatic Filariasis, a Neglected Tropical Disease, is caused by thread-like parasitic worms, including B. malayi, which migrate to the human lymphatic system following transmission. The parasites reside in collecting lymphatic vessels and lymph nodes for years, often resulting in lymphedema, elephantiasis or hydrocele. The mechanisms driving worm migration and retention within the lymphatics are currently unknown. We have developed an integrated in vitro imaging platform capable of quantifying B. malayi migration and behavior in a multicellular microenvironment relevant to the initial site of worm injection by incorporating the worm in a Polydimethylsiloxane (PDMS microchannel in the presence of human dermal lymphatic endothelial cells (LECs and human dermal fibroblasts (HDFs. The platform utilizes a motorized controllable microscope with CO2 and temperature regulation to allow for worm tracking experiments with high resolution over large length and time scales. Using post-acquisition algorithms, we quantified four parameters: 1 speed, 2 thrashing intensity, 3 percentage of time spent in a given cell region and 4 persistence ratio. We demonstrated the utility of our system by quantifying these parameters for L3 B. malayi in the presence of LECs and HDFs. Speed and thrashing increased in the presence of both cell types and were altered within minutes upon exposure to the anthelmintic drug, tetramisole. The worms displayed no targeted migration towards either cell type for the time course of this study (3 hours. When cells were not present in the chamber, worm thrashing correlated directly with worm speed. However, this correlation was lost in the presence of cells. The described platform provides the ability to further study B. malayi migration and behavior.

  16. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

  17. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

  18. Canine scent detection of canine cancer: a feasibility study

    Directory of Open Access Journals (Sweden)

    Dorman DC

    2017-10-01

    Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

  19. First autochthonous case of canine visceral leishmaniasis in Volta Redonda, Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Monique Paiva de Campos

    Full Text Available In Brazil, American visceral leishmaniasis (AVL is caused byLeishmania (Leishmania chagasi and its main vector isLutzomyia longipalpis. Cases of canine visceral leishmaniasis (CVL in non-endemic areas have been reported over the last few years throughout the country. The objective of this research note is to describe an autochthonous case of CVL that occurred in the municipality of Volta Redonda, state of Rio de Janeiro, an area where the disease is not endemic, alerting veterinarians and the scientific community to the expansion of this important zoonosis and advising veterinary practitioners on how to deal with a suspicion of CVL. Canine visceral leishmaniasis can be misdiagnosed within a broad spectrum of canine diseases based on clinical and laboratory findings. Therefore, knowledge of its clinical manifestations, specific and sensitive laboratory diagnostic tests and parasitological procedures are of the utmost importance for rapid confirmation and notification of a case, thus contributing directly to the control of a focus.

  20. Expression, Purification and Characterization of Recombinant Canine FGF21 in Escherichia coli.

    Science.gov (United States)

    Zheng, Zhong; Yang, Chengjun; Yin, Ruofeng; Jiang, Jinxi; He, Haiting; Wang, Xinxin; Kan, Mujie; Xiao, Yechen

    2016-01-01

    The canine metabolic diseases, such as obesity and diabetes, have become a worldwide problem. Fibroblast growth factor 21 (FGF21) is a potent regulator which has many biological functions relative to metabolism regulation. It suggests that FGF21 plays important roles in regulating canine metabolic diseases. To acquire the recombinant canine FGF21 (rcFGF21) in Escherichia coli, the recombinant bacteria were induced by 0.5 mM IPTG for 16 hours at 16 °C, and the rcFGF21 protein was purified by Ni-NTA. 8 mg rcFGF21 was acquired from one liter bacteria. The rcFGF21 protein has specific immunoblot reactivity against anti-FGF21 and anti-His antibody. The in vivo experimental result showed that rcFGF21 can significantly reduce plasma glucose of STZ-induced diabetic mice.

  1. When the Nose Doesn’t Know: Canine Olfactory Function Associated With Health, Management, and Potential Links to Microbiota

    Science.gov (United States)

    Jenkins, Eileen K.; DeChant, Mallory T.; Perry, Erin B.

    2018-01-01

    The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines. PMID:29651421

  2. When the Nose Doesn’t Know: Canine Olfactory Function Associated With Health, Management, and Potential Links to Microbiota

    Directory of Open Access Journals (Sweden)

    Eileen K. Jenkins

    2018-03-01

    Full Text Available The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.

  3. When the Nose Doesn't Know: Canine Olfactory Function Associated With Health, Management, and Potential Links to Microbiota.

    Science.gov (United States)

    Jenkins, Eileen K; DeChant, Mallory T; Perry, Erin B

    2018-01-01

    The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.

  4. Comparison of 2 electrophoretic methods and a wet-chemistry method in the analysis of canine lipoproteins.

    Science.gov (United States)

    Behling-Kelly, Erica

    2016-03-01

    The evaluation of lipoprotein metabolism in small animal medicine is hindered by the lack of a gold standard method and paucity of validation data to support the use of automated chemistry methods available in the typical veterinary clinical pathology laboratory. The physical and chemical differences between canine and human lipoproteins draw into question whether the transference of some of these human methodologies for the study of canine lipoproteins is valid. Validation of methodology must go hand in hand with exploratory studies into the diagnostic or prognostic utility of measuring specific lipoproteins in veterinary medicine. The goal of this study was to compare one commercially available wet-chemistry method to manual and automated lipoprotein electrophoresis in the analysis of canine lipoproteins. Canine lipoproteins from 50 dogs were prospectively analyzed by 2 electrophoretic methods, one automated and one manual method, and one wet-chemistry method. Electrophoretic methods identified a higher proportion of low-density lipoproteins than the wet-chemistry method. Automated electrophoresis occasionally failed to identify very low-density lipoproteins. Wet-chemistry methods designed for evaluation of human lipoproteins are insensitive to canine low-density lipoproteins and may not be applicable to the study of canine lipoproteins. Automated electrophoretic methods will likely require significant modifications if they are to be used in the analysis of canine lipoproteins. Studies aimed at determining the impact of a disease state on lipoproteins should thoroughly investigate the selected methodology prior to the onset of the study. © 2016 American Society for Veterinary Clinical Pathology.

  5. Recent developments in Canine Cognitive Dysfunction Syndrome

    Directory of Open Access Journals (Sweden)

    Alejandro Seisdedos Benzal

    2016-04-01

    Full Text Available Canine Cognitive Dysfunction Syndrome (CCD is a neurodegenerative disease affecting aging dogs. CCD is an underdiagnosed disease that involves at least 14% of geriatric dogs, but apparently less than 2% of diseased dogs are diagnosed. There are several physiopathological similarities between Alzheimer disease (AD and CCD, developing amyloid-β deposits in brain parenchyma and blood vessels, brain atrophy and neuronal loss. The clinical signs lead to behavioural changes. They are unspecific and could appear as soon as seven years of age, but are more relevant in senior dogs. The abnormal behaviour could be classified following the acronym DISHA: Disorientation in the immediate environment; altered Interactions with humans and other animals; Sleep-wake cycle disturbances; House-soiling; and changes in Activity levels. There is no specific diagnostic test or biomarker to demonstrate the presence of CCD; therefore, it is often assessed by ruling out other diseases that may cause similar behavioural changes. Veterinarians have to be able to make an accurate account of veterinary history asking for abnormal behaviour that could be misreported by the owners. CCD is a neurodegenerative disorder that cannot be cured. It is possible to delay the progression of the clinical signs and improve the quality of life of patients, but like in AD, the progression of the illness will depend on the individual. There are three treatment pathways, which could be used in combination: drug therapy to improve cognition and reduce anxiety, antioxidant diet and nutraceutical supplements to reduce the progression of the illness, and finally, environmental enrichment to maintain brain activity. The aim of this review article is to contribute to the knowledge of the illness, presenting recent advances in the pathophysiology, diagnosis and treatment of the disease

  6. Penetration of ASM 981 in canine skin: a comparative study.

    Science.gov (United States)

    Gutzwiller, Meret E Ricklin; Reist, Martin; Persohn, Elke; Peel, John E; Roosje, Petra J

    2006-01-01

    ASM 981 has been developed for topical treatment of inflammatory skin diseases. It specifically inhibits the production and release of pro-inflammatory cytokines. We measured the skin penetration of ASM 981 in canine skin and compared penetration in living and frozen skin. To make penetration of ASM 981 visible in dog skin, tritium labelled ASM 981 was applied to a living dog and to defrosted skin of the same dog. Using qualitative autoradiography the radioactive molecules were detected in the lumen of the hair follicles until the infundibulum, around the superficial parts of the hair follicles and into a depth of the dermis of 200 to 500 microm. Activity could not be found in deeper parts of the hair follicles, the dermis or in the sebaceous glands. Penetration of ASM 981 is low in canine skin and is only equally spread in the upper third of the dermis 24 hours after application. Penetration in frozen skin takes even longer than in living canine skin but shows the same distribution.

  7. T cell cytokine gene polymorphisms in canine diabetes mellitus.

    Science.gov (United States)

    Short, Andrea D; Catchpole, Brian; Kennedy, Lorna J; Barnes, Annette; Lee, Andy C; Jones, Chris A; Fretwell, Neale; Ollier, William E R

    2009-03-15

    Insulin-deficiency diabetes in dogs shares some similarities with human latent autoimmune diabetes of adults (LADA). Canine diabetes is likely to have a complex pathogenesis with multiple genes contributing to overall susceptibility and/or disease progression. An association has previously been shown between canine diabetes and MHC class II genes, although other genes are also likely to contribute to the genetic risk. Potential diabetes susceptibility genes include immuno-regulatory TH1/TH2 cytokines such as IFNgamma, IL-12, IL-4 and IL-10. We screened these candidate genes for single nucleotide polymorphisms (SNPs) in a range of different dog breeds using dHPLC analysis and DNA sequencing. Thirty-eight of the SNPs were genotyped in crossbreed dogs and seven other breed groups (Labrador Retriever, West Highland White Terrier, Collie, Schnauzer, Cairn Terrier, Samoyed and Cavalier King Charles Spaniel), which demonstrated substantial intra-breed differences in allele frequencies. When SNPs were examined for an association with diabetes by case:control analysis significant associations were observed for IL-4 in three breeds, the Collie, Cairn Terrier and Schnauzer and for IL-10 in the Cavalier King Charles Spaniel. These results suggest that canine cytokine genes regulating the TH1/TH2 immune balance might play a contributory role in determining susceptibility to diabetes in some breeds.

  8. A modified live canine parvovirus vaccine. II. Immune response.

    Science.gov (United States)

    Carmichael, L E; Joubert, J C; Pollock, R V

    1983-01-01

    The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

  9. Adjuvant therapy with carboplatin and pamidronate for canine appendicular osteosarcoma.

    Science.gov (United States)

    Kozicki, A R; Robat, C; Chun, R; Kurzman, I D

    2015-09-01

    Amputation and chemotherapy are the mainstay of treatment for canine appendicular osteosarcoma (OSA). In vitro studies have demonstrated anti-tumour activity of pamidronate against canine OSA. The purpose of this study was to assess the safety of adding pamidronate to standard post-operative carboplatin chemotherapy in 17 dogs with appendicular OSA treated with limb amputation. Median disease-free interval (DFI) and median survival time (MST) were evaluated as secondary endpoints. Incidence of side effects and treatment outcomes were compared to 14 contemporary control patients treated with carboplatin alone. There were no identified side effects to the pamidronate treatment. The median DFI for the study group was 185 days compared to 172 days for the control group (P = 0.90). The MST of the study group was 311 days compared to 294 days for the control group (P = 0.89). Addition of pamidronate to carboplatin chemotherapy for the treatment of canine appendicular OSA is safe and does not impair efficacy of standard carboplatin treatment. © 2013 Blackwell Publishing Ltd.

  10. Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.

    Science.gov (United States)

    Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F

    2015-03-01

    We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.

  11. Does contemporary canine diet cause cancer? ; A review

    Directory of Open Access Journals (Sweden)

    Joseph B Gentzel

    2013-07-01

    Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer

  12. Canine Dirofilaria infections in two uninvestigated areas of Serbia: epidemiological and genetic aspects.

    Science.gov (United States)

    Tasić, Aleksandar; Tasić-Otašević, Suzana; Gabrielli, Simona; Miladinović-Tasić, Nataša; Ignjatović, Aleksandra; Dorđević, Jovana; Dimitrijević, Sanda; Cancrini, Gabriella

    2012-12-01

    In 2009 canine filarial infections were investigated in two northern areas of Serbia (Pančevo and Veliko Gradište), applying morphometry, biochemical staining, and immunological kit to detect Dirofilaria immitis antigens, and two home-made ELISAs to detect antibodies to D. repens and D. immitis somatic/metabolic polyproteins. Moreover, molecular tools were applied to analyze the phylogenetic relationships of the isolates. The microfilariae detected in 21/122 dogs (17.2%) were identified as D. repens (n=21) and D. immitis (n=2). D. immitis antigens were found in another 13 animals with occult infection. All of the 15 heartworm-positive dogs also had antibodies to this parasite, which were detected in another 13 subjects, indicating an overall D. immitis seroprevalence rate of 22.9%. Serology for D. repens revealed evidence of antibodies in 42.6% of the dogs, but was negative for 4 microfilaremic dogs. As for the two different areas, the prevalence of microfilariae and/or D. immitis antigens, mainly due to D. repens microfilaremic animals, was not significantly higher in Veliko Gradište (33.3%) than in Pančevo (22%). However, serology showed a different epidemiological picture. Heartworm infection occurred more often in both areas, and antibodies to dirofilarial nematodes were detected in 72.9% of dogs living in Pančevo, a rate higher than in those living in Veliko Gradište (57.1%). No risk factors for infection were found, confirming the uselessness of prophylactic drugs against D. repens, and suggesting the presence in these areas of sunrise- or sunset-biting mosquitoes as important vectors. The results indicate the need for both appropriate entomological studies and further research on the intra-species variability shown by D. repens.

  13. Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Nozyechi Ngulube Chidumayo

    2018-02-01

    Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.

  14. MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

    Directory of Open Access Journals (Sweden)

    Cecilia M Lopez

    Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

  15. MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

    Science.gov (United States)

    Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M

    2018-01-01

    Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

  16. Canine sterile nodular panniculitis: a retrospective study of 39 dogs.

    Science.gov (United States)

    Contreary, Caitlin L; Outerbridge, Catherine A; Affolter, Verena K; Kass, Philip H; White, Stephen D

    2015-12-01

    Canine sterile nodular panniculitis (SNP) is an inflammatory disease of the panniculus that is typically managed with immunomodulatory or immunosuppressive treatments. It has been reported to be a cutaneous marker of an underlying systemic disease. To assess the presence or absence of concurrent systemic diseases associated with canine SNP and to document breed predispositions. Thirty nine dogs presented to a veterinary teaching hospital from 1990 to 2012 which met inclusion criteria. Inclusion in this retrospective study required a diagnosis of SNP via histopathological analysis and negative special stains for infectious organisms. Breed distributions of affected dogs were compared to all other dogs examined at this hospital during the study period. Correlations between the histological pattern of panniculitis and the histological presence of dermatitis, clinical presentation of lesions, dog breed and therapeutic outcomes were assessed. Australian shepherd dogs, Brittany spaniels, Dalmatians, Pomeranians and Chihuahuas were significantly over-represented, but correlations between inflammatory patterns of panniculitis and other histological and clinical factors were not identified. Based on the information available in medical records, 32 dogs (82.1%) had no concurrent systemic diseases identified. Four dogs had concurrent polyarthritis, which may be related to SNP through unknown mechanisms. This study identified several novel breed predilections for SNP; it failed to find any clear correlations with associated systemic diseases other than polyarthritis. The histological inflammatory pattern of SNP does not predict therapeutic outcome. © 2015 ESVD and ACVD.

  17. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

    1974-01-01

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  18. Nodular Epiescleritis Granulomatous Canine. Case Report

    Directory of Open Access Journals (Sweden)

    Camilo Guarín Patarroyo

    2011-12-01

    Full Text Available Granulomatous epiescleritis nodular disease in canines is a very unusual presentation that affects or external fibrous tunic of the eyeball and conjunctiva, which was an increase similar to a unilateral or bilateral tumor. Suspected immune-mediated disease due to lack of identification of an etiologic agent and the response to treatment with immunosuppressive drugs (Couto, 1992. The ideal therapy is the application of steroids via intralesional, topical or systemic, or other immunosuppressants such as cyclosporine and azathioprine; it is still advisable to apply antibiotic is the ideal combination of tetracycline and neomycin (Gilger & Whitley, 1999. The diagnostic method of episcleritis is made by histopathology, which is evident in changes similar to chronic granulomatous inflammation. Are claiming a racial bias in Alsatian, Shepherd Collie Shetland Shepherd, Coker Spaniel, Rottweiler and Labrador Retriever (Gough & Thomas, 2004. The following case is a report of a nodular epiescleritis affecting the cornea, sclera, and the corneoscleral limbus, which describes the diagnosis, signology and treatment.

  19. Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.

    Directory of Open Access Journals (Sweden)

    Michelle E White

    Full Text Available Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests. After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13 was evident between a region of canine chromosome 13 (CFA13 and alanine aminotransferase (ALT, explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.

  20. Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.

    Science.gov (United States)

    White, Michelle E; Hayward, Jessica J; Stokol, Tracy; Boyko, Adam R

    2015-01-01

    Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS) at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests). After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13) was evident between a region of canine chromosome 13 (CFA13) and alanine aminotransferase (ALT), explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.

  1. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

    OpenAIRE

    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

    2002-01-01

    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  2. Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.

    Science.gov (United States)

    Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L

    2016-02-19

    Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.

  3. Radioimmunoassay of canine growth hormone

    International Nuclear Information System (INIS)

    Eigenmann, J.E.; Eigenmann, R.Y.

    1981-01-01

    A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)

  4. Risk Assessment of Canine Distemper in the Distribution Area of Giant Panda in Sichuan, Shaanxi and Gansu Provinces, China

    Directory of Open Access Journals (Sweden)

    Weigeng Shao

    2017-11-01

    Full Text Available Giant panda is the world-class precious endangered species, facing the canine distemper and other important infectious diseases on its wild and captive population of a serious threat. In this study, we used MaxEnt model and combined with ArcGIS analysis to predict the potential risk of canine distemper to giant panda habitat in Sichuan, Gansu and Shaanxi Provinces, China. The results showed that 35.05% and 19.47% of the distribution areas of the giant pandas were in the high risk and medium risk of canine distemper, respectively. The canine distemper pose a great risk to the healthy survival of giant pandas in China. In future, epidemic prevention, vaccine development and application of wild animals should be enhanced so as to effectively protect the giant panda.

  5. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53.

    Science.gov (United States)

    York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B

    2017-09-01

    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

  6. Occurrence of severe gastroenteritis in pups after canine parvovirus vaccine administration: a clinical and laboratory diagnostic dilemma.

    Science.gov (United States)

    Decaro, Nicola; Desario, Costantina; Elia, Gabriella; Campolo, Marco; Lorusso, Alessio; Mari, Viviana; Martella, Vito; Buonavoglia, Canio

    2007-01-26

    A total of 29 faecal samples collected from dogs with diarrhoea following canine parvovirus (CPV) vaccination were tested by minor groove binder (MGB) probe assays for discrimination between CPV vaccine and field strains and by diagnostic tests for detection of other canine pathogens. Fifteen samples tested positive only for CPV field strains; however, both vaccine and field strains were detected in three samples. Eleven samples were found to contain only the vaccine strain, although eight of them tested positive for other pathogens of dogs. Only three samples were found to contain the vaccine strain without evidence of canine pathogens. The present study confirms that most cases of parvovirus-like disease occurring shortly after vaccination are related to infection with field strains of canine parvovirus type 2 (CPV-2) rather than to reversion to virulence of the modified live virus contained in the vaccine.

  7. COMPARATIVE STUDIES ON MAN-BITING POPULATION OF FILARIAL VECTOR Cx. quinquefasciatus (Diptera: Culicidae BETWEEN TRIBAL AND NON-TRIBAL AREAS OF BANKURA DISTRICT, WEST BENGAL INDIA

    Directory of Open Access Journals (Sweden)

    G. Chandra

    2012-10-01

    Full Text Available West Bengal, India is endemic for filariasis and the number of patients infected with bancroftian filariasis is increasing. There are no observation on the potential vector of filariasis from the tribal areas that make up considerable part in this state. This study investigate population of Cx. quinquefasciatus in tribal and non-tribal areas of Bankura district. Species composition of mosquitoes, per man-hour density, hourly densities of night biting Cx. quinquefasciatus, number of Cx. quinquefasciatus biting per man per day and per man per night. Preferential biting site and peak period of filarial transmission were recorded from both the study areas. Infection rate, infectivity rate of man-landing vector population and annual transmission potential were observed to be 0.31%, 0.00% and 0.00 in tribal areas and 0.73%, 0.23% and 359.71 in non-tribal areas respectively.

  8. Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny

    Directory of Open Access Journals (Sweden)

    Jane Megid

    2013-02-01

    Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.

  9. Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production

    OpenAIRE

    Nuno Carinhas; Daniel A. M. Pais; Alexey Koshkin; Paulo Fernandes; Ana S. Coroadinha; Manuel J. T. Carrondo; Paula M. Alves; Ana P. Teixeira

    2016-01-01

    Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-13C]glucose and [U-13C]glutamine, we apply for the first time 13C-Metabolic flux analysis (13C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells meta...

  10. Comparative Aspects of Human, Canine, and Feline Obesity and Factors Predicting Progression to Diabetes

    OpenAIRE

    Margarethe Hoenig

    2014-01-01

    Obesity and diabetes mellitus are common diseases in humans, dogs and cats and their prevalence is increasing. Obesity has been clearly identified as a risk factor for type 2 diabetes in humans and cats but recent data are missing in dogs, although there is evidence that the unprecedented rise in canine obesity in the last decade has led to a rise in canine diabetes of similar magnitude. The insulin resistance of obesity has often been portrayed as major culprit in the loss of glucose control...

  11. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

    2015-01-01

    Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...

  12. The role of osteonecrosis in canine coronoid dysplasia: Arthroscopic and histopathological findings

    NARCIS (Netherlands)

    Mariee, I.C.; Gröne, A.; Theyse, L.F.H.

    2014-01-01

    Coronoid dysplasia (CD) or medial coronoid disease is part of canine elbowdysplasia and eventually results in osteoarthrosis. Although CDwas originally attributed to disturbed endochondral ossification,more recent data point to the subchondral bone. The objective of this study was to assess

  13. Effects of Carbenoxolone on the Canine Pituitary-Adrenal Axis.

    Science.gov (United States)

    Teshima, Takahiro; Matsumoto, Hirotaka; Okusa, Tomoko; Nakamura, Yumi; Koyama, Hidekazu

    2015-01-01

    Cushing's disease caused by pituitary corticotroph adenoma is a common endocrine disease in dogs. A characteristic biochemical feature of corticotroph adenomas is their relative resistance to suppressive negative feedback by glucocorticoids. The abnormal expression of 11beta-hydroxysteroid dehydrogenase (11HSD), which is a cortisol metabolic enzyme, is found in human and murine corticotroph adenomas. Our recent studies demonstrated that canine corticotroph adenomas also have abnormal expression of 11HSD. 11HSD has two isoforms in dogs, 11HSD type1 (HSD11B1), which converts cortisone into active cortisol, and 11HSD type2 (HSD11B2), which converts cortisol into inactive cortisone. It has been suggested that glucocorticoid resistance in corticotroph tumors is related to the overexpression of HSD11B2. Therefore it was our aim to investigate the effects of carbenoxolone (CBX), an 11HSD inhibitor, on the healthy dog's pituitary-adrenal axis. Dogs were administered 50 mg/kg of CBX twice each day for 15 days. During CBX administration, no adverse effects were observed in any dogs. The plasma adrenocorticotropic hormone (ACTH), and serum cortisol and cortisone concentrations were significantly lower at day 7 and 15 following corticotropin releasing hormone stimulation. After completion of CBX administration, the HSD11B1 mRNA expression was higher, and HSD11B2 mRNA expression was significantly lower in the pituitaries. Moreover, proopiomelanocortin mRNA expression was lower, and the ratio of ACTH-positive cells in the anterior pituitary was also significantly lower after CBX treatment. In adrenal glands treated with CBX, HSD11B1 and HSD11B2 mRNA expression were both lower compared to normal canine adrenal glands. The results of this study suggested that CBX inhibits ACTH secretion from pituitary due to altered 11HSD expressions, and is potentially useful for the treatment of canine Cushing's disease.

  14. Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.

    Science.gov (United States)

    Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J

    2014-03-01

    Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.

  15. Colorimetric tests for diagnosis of filarial infection and vector surveillance using non-instrumented nucleic acid loop-mediated isothermal amplification (NINA-LAMP.

    Directory of Open Access Journals (Sweden)

    Catherine B Poole

    Full Text Available Accurate detection of filarial parasites in humans is essential for the implementation and evaluation of mass drug administration programs to control onchocerciasis and lymphatic filariasis. Determining the infection levels in vector populations is also important for assessing transmission, deciding when drug treatments may be terminated and for monitoring recrudescence. Immunological methods to detect infection in humans are available, however, cross-reactivity issues have been reported. Nucleic acid-based molecular assays offer high levels of specificity and sensitivity, and can be used to detect infection in both humans and vectors. In this study we developed loop-mediated isothermal amplification (LAMP tests to detect three different filarial DNAs in human and insect samples using pH sensitive dyes for enhanced visual detection of amplification. Furthermore, reactions were performed in a portable, non-instrumented nucleic acid amplification (NINA device that provides a stable heat source for LAMP. The efficacy of several strand displacing DNA polymerases were evaluated in combination with neutral red or phenol red dyes. Colorimetric NINA-LAMP assays targeting Brugia Hha I repeat, Onchocerca volvulus GST1a and Wuchereria bancrofti LDR each exhibit species-specificity and are also highly sensitive, detecting DNA equivalent to 1/10-1/5000th of one microfilaria. Reaction times varied depending on whether a single copy gene (70 minutes, O. volvulus or repetitive DNA (40 min, B. malayi and W. bancrofti was employed as a biomarker. The NINA heater can be used to detect multiple infections simultaneously. The accuracy, simplicity and versatility of the technology suggests that colorimetric NINA-LAMP assays are ideally suited for monitoring the success of filariasis control programs.

  16. Biology, diagnosis and treatment of canine appendicular osteosarcoma: similarities and differences with human osteosarcoma.

    Science.gov (United States)

    Morello, Emanuela; Martano, Marina; Buracco, Paolo

    2011-09-01

    Osteosarcoma (OSA) is the most common primary bone tumour in dogs. The appendicular locations are most frequently involved and large to giant breed dogs are commonly affected, with a median age of 7-8 years. OSA is a locally invasive neoplasm with a high rate of metastasis, mostly to the lungs. Due to similarities in biology and treatment of OSA in dogs and humans, canine OSA represents a valid and important tumour model. Differences between canine and human OSAs include the age of occurrence (OSA is most commonly an adolescent disease in humans), localisation (the stifle is the most common site of localisation in humans) and limited use of neoadjuvant chemotherapy in canine OSA. Copyright © 2010 Elsevier Ltd. All rights reserved.

  17. Comparative review of human and canine osteosarcoma: morphology, epidemiology, prognosis, treatment and genetics.

    Science.gov (United States)

    Simpson, Siobhan; Dunning, Mark David; de Brot, Simone; Grau-Roma, Llorenç; Mongan, Nigel Patrick; Rutland, Catrin Sian

    2017-10-24

    Osteosarcoma (OSA) is a rare cancer in people. However OSA incidence rates in dogs are 27 times higher than in people. Prognosis in both species is relatively poor, with 5 year OSA survival rates in people not having improved in decades. For dogs, 1 year survival rates are only around ~ 45%. Improved and novel treatment regimens are urgently required to improve survival in both humans and dogs with OSA. Utilising information from genetic studies could assist in this in both species, with the higher incidence rates in dogs contributing to the dog population being a good model of human disease. This review compares the clinical characteristics, gross morphology and histopathology, aetiology, epidemiology, and genetics of canine and human OSA. Finally, the current position of canine OSA genetic research is discussed and areas for additional work within the canine population are identified.

  18. Milk C-reactive protein in canine mastitis.

    Science.gov (United States)

    Vasiu, Iosif; Dąbrowski, Roman; Martinez-Subiela, Silvia; Ceron, Jose J; Wdowiak, Anna; Pop, Raul Alexandru; Brudaşcă, Florinel Gheorghe; Pastor, Josep; Tvarijonaviciute, Asta

    2017-04-01

    Presence of mastitis in lactating bitches can become life threatening for both the bitch and pups. The aim of the present study was to evaluate a possible utility of C-reactive protein (CRP) in both milk and serum for canine mastitis diagnosis. Our study showed that milk CRP levels ranged between 0.1 and 4.9μg/mL and from 0.3 to 40.0μg/mL in healthy and diseased bitches (Pcanine mastitis. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Extrusion processing : effects on dry canine diets

    NARCIS (Netherlands)

    Tran, Q.D.

    2008-01-01

    Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.

    Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the

  20. Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.

    Science.gov (United States)

    Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D

    2000-12-01

    To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

  1. CANINE BUTTERFLY GLIOBLASTOMAS: A NEURORADIOLOGICAL REVIEW

    Directory of Open Access Journals (Sweden)

    John Henry Rossmeisl

    2016-05-01

    Full Text Available In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a ‘butterfly’ glioma (BG. While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here we describe the magnetic resonance imaging (MRI characteristics of BG in three dogs, and review the potential differential diagnoses based on neuroimaging findings. All dogs presented with generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3 or symmetrical (1/3, bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes and associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and FLAIR signal intensities, variable contrast enhancement (2/3, and mass effect. All tumors demonstrated classical histopathological features of glioblastoma (GBM including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation, as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.

  2. Varied clinico-radiological presentations of transmigrated canines

    Directory of Open Access Journals (Sweden)

    Ishita Gupta

    2015-01-01

    Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.

  3. Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

    Science.gov (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

    2014-12-01

    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

  4. [Nonsurgical endodontic treatment of an invaginated canine].

    Science.gov (United States)

    Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

    1989-01-01

    We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

  5. Treatment modalities of palatal impacted canines

    OpenAIRE

    Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona

    2012-01-01

    Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

  6. Orthodontic Traction of Impacted Canine Using Cantilever

    OpenAIRE

    Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé

    2016-01-01

    The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...

  7. Canine babesiosis: a perspective on clinical complications, biomarkers, and treatment

    Directory of Open Access Journals (Sweden)

    Köster LS

    2015-04-01

    Full Text Available Liza S Köster,1 Remo G Lobetti,2 Patrick Kelly1 1Department of Clinical Sciences, One Health Center for Zoonoses and Tropical Veterinary Medicine, Ross University School of Veterinary Medicine, St Kitts, West Indies; 2Bryanston Veterinary Hospital, Bryanston, South Africa Abstract: Canine babesiosis is a common tick transmitted disease of dogs worldwide. A number of Babesia sp. can infect dogs and the spectrum is increasing as molecular methods are developed to differentiate organisms. Clinical signs are generally attributed to hemolysis caused by the organisms in the erythrocytes but in some animals with some Babesia spp. there can be an immune mediated component to the anemia and/or a severe inflammatory reaction associated. This complicated form of canine babesiosis is associated with high morbidity and mortality. A variety of clinical markers has been investigated to enable clinicians to provide more accurate prognoses and adapt their treatments which vary according to the infecting species. In this review, we discuss the taxonomy, clinical signs, diagnostic imaging, clinical biomarkers, treatment, and prophylaxis of one of the most common and important diseases of dogs worldwide. Keywords: babesiosis, vector-borne disease, dog

  8. A new method for rapid Canine retraction

    Directory of Open Access Journals (Sweden)

    "Khavari A

    2001-06-01

    Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

  9. Platelets Inhibit Migration of Canine Osteosarcoma Cells.

    Science.gov (United States)

    Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C

    2017-01-01

    The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

  10. Clinical and Statistical Study on Canine Impaction

    Directory of Open Access Journals (Sweden)

    Adina-Simona Coșarcă

    2013-08-01

    Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

  11. CANINE: a robotic mine dog

    Science.gov (United States)

    Stancil, Brian A.; Hyams, Jeffrey; Shelley, Jordan; Babu, Kartik; Badino, Hernán.; Bansal, Aayush; Huber, Daniel; Batavia, Parag

    2013-01-01

    Neya Systems, LLC competed in the CANINE program sponsored by the U.S. Army Tank Automotive Research Development and Engineering Center (TARDEC) which culminated in a competition held at Fort Benning as part of the 2012 Robotics Rodeo. As part of this program, we developed a robot with the capability to learn and recognize the appearance of target objects, conduct an area search amid distractor objects and obstacles, and relocate the target object in the same way that Mine dogs and Sentry dogs are used within military contexts for exploration and threat detection. Neya teamed with the Robotics Institute at Carnegie Mellon University to develop vision-based solutions for probabilistic target learning and recognition. In addition, we used a Mission Planning and Management System (MPMS) to orchestrate complex search and retrieval tasks using a general set of modular autonomous services relating to robot mobility, perception and grasping.

  12. Ultrasonography of the canine pancreas

    Directory of Open Access Journals (Sweden)

    Michelle L Avante

    2018-01-01

    Full Text Available This study describes the ultrasonographic techniques currently used in the evaluation of the canine pancreas. Ultrasonography was the first method to enable direct visualization of the pancreas in humans and it has been subsequently applied to animals. Currently, it is the method of choice for pancreatic evaluation and is essential as a diagnostic tool in the detection of abnormalities, especially tumors. Innovative equipment technology has led to the emergence of techniques complementary to B-mode ultrasound; such as Doppler, elastography, and contrast-enhanced ultrasonography, which have enabled more accurate diagnosis. Doppler provides information on vascular architecture and the hemodynamic aspect of blood vessels in multiple organs. ARFI elastography provides detailed images of the alterations detected by conventional examination (qualitative method and assists in differentiating between benign and malignant processes (quantitative method. Microbubble contrast agents determine parameters related to homogeneous and heterogeneous filling of organs with microbubbles, mainly nodular areas, thus defining high and low intensity patterns.

  13. Identification of a new genotype of canine distemper virus circulating in America.

    Science.gov (United States)

    Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón

    2011-08-01

    Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.

  14. Culling dogs in scenarios of imperfect control: realistic impact on the prevalence of canine visceral leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Danielle N C C Costa

    Full Text Available BACKGROUND: Visceral leishmaniasis belongs to the list of neglected tropical diseases and is considered a public health problem worldwide. Spatial correlation between the occurrence of the disease in humans and high rates of canine infection suggests that in the presence of the vector, canine visceral leishmaniasis is the key factor for triggering transmission to humans. Despite the control strategies implemented, such as the sacrifice of infected dogs being put down, the incidence of American visceral leishmaniasis remains high in many Latin American countries. METHODOLOGY/PRINCIPAL FINDINGS: Mathematical models were developed to describe the transmission dynamics of canine leishmaniasis and its control by culling. Using these models, imperfect control scenarios were implemented to verify the possible factors which alter the effectiveness of controlling this disease in practice. CONCLUSIONS/SIGNIFICANCE: A long-term continuous program targeting both asymptomatic and symptomatic dogs should be effective in controlling canine leishmaniasis in areas of low to moderate transmission (R0 up to 1.4. However, the indiscriminate sacrifice of asymptomatic dogs with positive diagnosis may jeopardize the effectiveness of the control program, if tests with low specificity are used, increasing the chance of generating outrage in the population, and leading to lower adherence to the program. Therefore, culling must be planned accurately and implemented responsibly and never as a mechanical measure in large scale. In areas with higher transmission, culling alone is not an effective control strategy.

  15. Prognostic factors in canine appendicular osteosarcoma - a meta-analysis.

    Science.gov (United States)

    Boerman, Ilse; Selvarajah, Gayathri T; Nielen, Mirjam; Kirpensteijn, Jolle

    2012-05-15

    Appendicular osteosarcoma is the most common malignant primary canine bone tumor. When treated by amputation or tumor removal alone, median survival times (MST) do not exceed 5 months, with the majority of dogs suffering from metastatic disease. This period can be extended with adequate local intervention and adjuvant chemotherapy, which has become common practice. Several prognostic factors have been reported in many different studies, e.g. age, breed, weight, sex, neuter status, location of tumor, serum alkaline phosphatase (SALP), bone alkaline phosphatase (BALP), infection, percentage of bone length affected, histological grade or histological subtype of tumor. Most of these factors are, however, only reported as confounding factors in larger studies. Insight in truly significant prognostic factors at time of diagnosis may contribute to tailoring adjuvant therapy for individual dogs suffering from osteosarcoma. The objective of this study was to systematically review the prognostic factors that are described for canine appendicular osteosarcoma and validate their scientific importance. A literature review was performed on selected studies and eligible data were extracted. Meta-analyses were done for two of the three selected possible prognostic factors (SALP and location), looking at both survival time (ST) and disease free interval (DFI). The third factor (age) was studied in a qualitative manner. Both elevated SALP level and the (proximal) humerus as location of the primary tumor are significant negative prognostic factors for both ST and DFI in dogs with appendicular osteosarcoma. Increasing age was associated with shorter ST and DFI, however, was not statistically significant because information of this factor was available in only a limited number of papers. Elevated SALP and proximal humeral location are significant negative prognosticators for canine osteosarcoma.

  16. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

  17. Data base management system for lymphatic filariasis--a neglected tropical disease.

    Science.gov (United States)

    Upadhyayula, Suryanaryana Murty; Mutheneni, Srinivasa Rao; Kadiri, Madhusudhan Rao; Kumaraswamy, Sriram; Nelaturu, Sarat Chandra Babu

    2012-01-01

    Researchers working in the area of Public Health are being confronted with large volumes of data on various aspects of entomology and epidemiology. To obtain the relevant information out of these data requires particular database management system. In this paper, we have described about the usages of our developed database on lymphatic filariasis. This database application is developed using Model View Controller (MVC) architecture, with MySQL as database and a web based interface. We have collected and incorporated the data on filariasis in the database from Karimnagar, Chittoor, East and West Godavari districts of Andhra Pradesh, India. The importance of this database is to store the collected data, retrieve the information and produce various combinational reports on filarial aspects which in turn will help the public health officials to understand the burden of disease in a particular locality. This information is likely to have an imperative role on decision making for effective control of filarial disease and integrated vector management operations.

  18. Evaluation of post-vaccination immunity to canine distemper and ...

    African Journals Online (AJOL)

    SERVER

    2007-08-20

    Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

  19. Advances in canine distemper virus pathogenesis research: a wildlife perspective.

    Science.gov (United States)

    Loots, Angelika K; Mitchell, Emily; Dalton, Desiré L; Kotzé, Antoinette; Venter, Estelle H

    2017-03-01

    Canine distemper virus (CDV) has emerged as a significant disease of wildlife, which is highly contagious and readily transmitted between susceptible hosts. Initially described as an infectious disease of domestic dogs, it is now recognized as a global multi-host pathogen, infecting and causing mass mortalities in a wide range of carnivore species. The last decade has seen the effect of numerous CDV outbreaks in various wildlife populations. Prevention of CDV requires a clear understanding of the potential hosts in danger of infection as well as the dynamic pathways CDV uses to gain entry to its host cells and its ability to initiate viral shedding and disease transmission. We review recent research conducted on CDV infections in wildlife, including the latest findings on the causes of host specificity and cellular receptors involved in distemper pathogenesis.

  20. New developments in canine hepatozoonosis in North America: a review

    Science.gov (United States)

    Little, Susan E; Allen, Kelly E; Johnson, Eileen M; Panciera, Roger J; Reichard, Mason V; Ewing, Sidney A

    2009-01-01

    Canine hepatozoonosis is caused by Hepatozoon canis and Hepatozoon americanum, apicomplexan parasites transmitted to dogs by ingestion of infectious stages. Although the two agents are phylogenetically related, specific aspects, including characteristics of clinical disease and the natural history of the parasites themselves, differ between the two species. Until recently, H. canis infections had not been clearly documented in North America, and autochthonous infection with H. americanum has yet to be reported outside of the southern United States. However, recent reports demonstrate H. canis is present in areas of North America where its vector tick, Rhipicephalus sanguineus, has long been endemic, and that the range of H. americanum is likely expanding along with that of its vector tick, Amblyomma maculatum; co-infections with the two organisms have also been identified. Significant intraspecific variation has been reported in the 18S rRNA gene sequence of both Hepatozoon spp.-infecting dogs, suggesting that each species may represent a complex of related genogroups rather than well-defined species. Transmission of H. americanum to dogs via ingestion of cystozoites in muscle of infected vertebrates was recently demonstrated, supporting the concept of predation as a means of natural transmission. Although several exciting advances have occurred in recent years, much remains to be learned about patterns of infection and the nature of clinical disease caused by the agents of canine hepatozoonosis in North America. PMID:19426444

  1. The immuno-pathological conversions of canine demodicosis.

    Science.gov (United States)

    Singh, Shanker K; Dimri, Umesh

    2014-06-16

    Canine demodicosis is a common but exigent noncontagious parasitic dermatosis caused by overpopulation of the host-specific follicular mites of various Demodex species. Receptivity of dogs to demodicosis and progression of the clinical disease are influenced by numerous factors including; genetic defect, alteration of skin's structure and biochemistry, immunological disorders, hormonal status, breed, age, nutritional status, oxidative stress, length of hair coat, stage of oestrus cycle, parturition, endoparasitism and debilitating diseases. Of these, the immune status is thought to be the most significant. Thus, in the present review we intended to edify the immuno-pathological conversions of canine demodicosis. Generalized demodicosis requires a cutaneous environment that is ecologically and immunologically favorable for extreme colonization of demodectic mites. Demodex canis mites can down regulate the CD4+ T cells; possibly by an increased rate of apoptosis or immunological exhaustion of CD4+ T cells. An increased apoptosis of peripheral leukocytes confers progression of the clinical manifestations. Mites induced elevation of TGF-β and inhibition of TNF-α mRNA expression might be a key factor for revealing the difference in the mechanism of onset between localized and generalized demodicosis. Moreover, an elevated serum level of IL-10 could be accountable for the recurrence as well as occurrence of demodicosis in dogs. Over production of reactive oxygen species can corroborate immunological discrepancies in dogs with demodicosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts.

    Directory of Open Access Journals (Sweden)

    Lindsay Van den Bossche

    Full Text Available Non-alcoholic fatty liver disease (NAFLD is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in this large animal model. Hepatic lipid accumulation, gene-expression analysis and HPLC-MS of neutral lipids and phospholipids in extrahepatic (EHPSS and intrahepatic portosystemic shunts (IHPSS was compared to healthy control dogs. Liver organoids of diseased dogs and healthy control dogs were incubated with palmitic- and oleic-acid, and lipid accumulation was quantified using LD540. In histological slides of shunt livers, a 12-fold increase of lipid content was detected compared to the control dogs (EHPSS P<0.01; IHPSS P = 0.042. Involvement of lipid-related genes to steatosis in portosystemic shunting was corroborated using gene-expression profiling. Lipid analysis demonstrated different triglyceride composition and a shift towards short chain and omega-3 fatty acids in shunt versus healthy dogs, with no difference in lipid species composition between shunt types. All organoids showed a similar increase in triacylglycerols after free fatty acids enrichment. This study demonstrates that steatosis is probably secondary to canine portosystemic shunts. Unravelling the pathogenesis of this hepatic steatosis might contribute to a better understanding of steatosis in NAFLD.

  3. Aberrant hepatic lipid storage and metabolism in canine portosystemic shunts.

    Science.gov (United States)

    Van den Bossche, Lindsay; Schoonenberg, Vivien A C; Burgener, Iwan A; Penning, Louis C; Schrall, Ingrid M; Kruitwagen, Hedwig S; van Wolferen, Monique E; Grinwis, Guy C M; Kummeling, Anne; Rothuizen, Jan; van Velzen, Jeroen F; Stathonikos, Nikolas; Molenaar, Martijn R; Helms, Bernd J; Brouwers, Jos F H M; Spee, Bart; van Steenbeek, Frank G

    2017-01-01

    Non-alcoholic fatty liver disease (NAFLD) is a poorly understood multifactorial pandemic disorder. One of the hallmarks of NAFLD, hepatic steatosis, is a common feature in canine congenital portosystemic shunts. The aim of this study was to gain detailed insight into the pathogenesis of steatosis in this large animal model. Hepatic lipid accumulation, gene-expression analysis and HPLC-MS of neutral lipids and phospholipids in extrahepatic (EHPSS) and intrahepatic portosystemic shunts (IHPSS) was compared to healthy control dogs. Liver organoids of diseased dogs and healthy control dogs were incubated with palmitic- and oleic-acid, and lipid accumulation was quantified using LD540. In histological slides of shunt livers, a 12-fold increase of lipid content was detected compared to the control dogs (EHPSS Plipid-related genes to steatosis in portosystemic shunting was corroborated using gene-expression profiling. Lipid analysis demonstrated different triglyceride composition and a shift towards short chain and omega-3 fatty acids in shunt versus healthy dogs, with no difference in lipid species composition between shunt types. All organoids showed a similar increase in triacylglycerols after free fatty acids enrichment. This study demonstrates that steatosis is probably secondary to canine portosystemic shunts. Unravelling the pathogenesis of this hepatic steatosis might contribute to a better understanding of steatosis in NAFLD.

  4. Activation of the Canonical Wnt/β-Catenin Signalling Pathway is Rare in Canine Malignant Melanoma Tissue and Cell Lines

    Science.gov (United States)

    Chon, E.; Thompson, V.; Schmid, S.; Stein, T. J.

    2012-01-01

    Summary Canine malignant melanoma is a highly aggressive tumour associated with a poor overall survival rate due to both local disease recurrence and its highly metastatic nature. Similar to advanced melanoma in man, canine oral melanoma is poorly responsive to conventional anti-cancer therapies. The lack of sustainable disease control warrants investigation of novel therapies, preferably targeting features specific to the tumour and different from normal cells. The Wnt signalling pathway is known to contribute to melanocytic lineage development in vertebrates and perturbation of the Wnt/β-catenin pathway has been implicated in numerous cancer types. Alterations of the Wnt/β-catenin pathway are suggested to occur in a subset of human melanomas, although the precise role of the Wnt/β-catenin pathway in melanoma is yet to be defined. This study investigates the activation status of the canonical Wnt/β-catenin pathway in canine malignant melanoma and its potential as a therapeutic target for treating this disease. The data indicate canonical Wnt/β-catenin pathway activation is a rare event in canine oral malignant melanoma tissue and canine malignant melanoma cell lines. PMID:22901430

  5. Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

    Science.gov (United States)

    Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

    2004-10-13

    Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

  6. 6-methylmercaptopurine riboside, a thiopurine nucleoside with antiviral activity against canine distemper virus in vitro

    OpenAIRE

    de Carvalho, Ot?vio Val?rio; F?lix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, M?rcia Rog?ria; Bressan, Gustavo Costa; Pena, Lindomar Jos?; Silva-J?nior, Abelardo

    2017-01-01

    Background Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic stra...

  7. Inactivated Recombinant Rabies Viruses Displaying Canine Distemper Virus Glycoproteins Induce Protective Immunity against Both Pathogens

    OpenAIRE

    da Fontoura Budaszewski, Renata; Hudacek, Andrew; Sawatsky, Bevan; Krämer, Beate; Yin, Xiangping; Schnell, Matthias J.; von Messling, Veronika

    2017-01-01

    The development of multivalent vaccines is an attractive methodology for the simultaneous prevention of several infectious diseases in vulnerable populations. Both canine distemper virus (CDV) and rabies virus (RABV) cause lethal disease in wild and domestic carnivores. While RABV vaccines are inactivated, the live-attenuated CDV vaccines retain residual virulence for highly susceptible wildlife species. In this study, we developed recombinant bivalent vaccine candidates based on recombinant ...

  8. Corrective surgery for canine patellar luxation in 75 cases (107 limbs): landmark for block recession

    OpenAIRE

    Mitsuhiro Isaka; Masahiko Befu; Nami Matsubara; Mayuko Ishikawa; Yurie Arase; Toshiyuki Tsuyama; Akiko Doi; Shinichi Namba

    2014-01-01

    Canine medial patellar luxation (MPL) is a very common orthopedic disease in small animals. Because the pathophysiology of this disease involves various pathways, the surgical techniques and results vary according to the veterinarian. Further, the landmark for block recession is not completely clear. We retrospectively evaluated 75 dogs (107 limbs) with MPL in whom our landmark for block recession was used from July 2008 to May 2013. Information regarding the breed, age, sex, body weight, bod...

  9. Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management

    OpenAIRE

    Wakshlag, Joseph J; Loftus,John

    2014-01-01

    John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is...

  10. 9 CFR 113.317 - Parvovirus Vaccine (Canine).

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...

  11. 9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

    Science.gov (United States)

    2010-01-01

    ... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

  12. Development of the canine tooth in the beagle

    International Nuclear Information System (INIS)

    Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.

    1993-01-01

    The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

  13. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    Science.gov (United States)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  14. Focos de dirofilariose canina na Ilha do Marajó: um fator de risco para a saúde humana Focus of canine heartworm disease in Marajó Island, North of Brazil: a risk factor for human health

    Directory of Open Access Journals (Sweden)

    Lourdes Maria Garcez

    2006-08-01

    Full Text Available A ocorrência de dirofilariose pulmonar humana relaciona-se com a prevalência de infecção por Dirofilaria immitis na população canina. Várias espécies de mosquitos são vetores desse nematóide. Analisaram-se amostras de sangue canino coletados nas vilas Pingo d'Água e União, município de Salvaterra (Ilha do Marajó, PA, em junho, 2004 (n=34 e abril, 2005 (N=90. Os diagnósticos parasitológico e imunológico (ELISA - kit SNAP® 3DX™, Biobrasil foram comparados (chi2, alfa=0,05 no exame de 34 amostras. A prevalência na população (N=90 foi avaliada pelo ELISA. O ELISA revelou mais positivos (25/34; 73,5% que a gota espessa (23/34, 67,6% e o Knott (21/34, 61,8%, mas a diferença não foi significativa (p>0,05. A freqüência de infecção por D. immitis na faixa de 0 a 2 anos foi 58%, enquanto em cães mais velhos foi 100%. A prevalência da dirofilariose canina em Pingo d'Água e Vila União foi alta (53,5%, indicando risco de transmissão do parasito às pessoas nessa área.The occurrence of human pulmonary dirofilariasis maintains a relation with the prevalence of Dirofilaria immitis infection in the canine population. Several mosquito species are vectors of this nematode. Canine blood samples collected in Pingo d'Água and União villages, Salvaterra municipality (Marajó Island, Pará, in June, 2004 (n=34 and April, 2005 (N=90 were analyzed. Parasitological and immunological (ELISA - kit SNAP® 3DX™, Biobrasil diagnoses were compared following the examination of 34 samples. The prevalence in the population (N=90 was evaluated by means of ELISA. ELISA revealed more positive samples (25/34; 73.5% than thick smears (23/34, 67.6% or Knott (21/34, 61.8%, but the differences were not significant (p>0.05. The frequency of D. immitis infection was 58% in dogs ranging from 0-2 years old, whereas in older dogs it was 100%. The prevalence of canine dirofilariasis was high in Pingo d'Água and Vila União (53.5%, indicating the risk of

  15. Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

    2011-09-01

    Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

  16. Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki

    2012-08-01

    Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  17. Orthodontic Traction of Impacted Canine Using Cantilever

    Directory of Open Access Journals (Sweden)

    Cláudia Nakandakari

    2016-01-01

    Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.

  18. Transmigration of mandibular canine – case report

    International Nuclear Information System (INIS)

    Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia

    2014-01-01

    Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

  19. Characterization of canine osteosarcoma by array comparative genomic hybridization and RT-qPCR: signatures of genomic imbalance in canine osteosarcoma parallel the human counterpart.

    Science.gov (United States)

    Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew

    2011-11-01

    Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.

  20. Canine hypothyroidism. A diagnostic challenge?; Die canine Hypothyreose. Eine diagnostische Herausforderung?

    Energy Technology Data Exchange (ETDEWEB)

    Boretti, Felicitos; Reusch, C.E. [Klinik fuer Kleintiermedizin, Vetsuisse Fakultaet Zuerich, Univ. Zuerich (Switzerland)

    2010-03-15

    Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen {sup registered}) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high

  1. Long-term effects of canine parvovirus infection in dogs.

    Science.gov (United States)

    Kilian, Elena; Suchodolski, Jan S; Hartmann, Katrin; Mueller, Ralf S; Wess, Gerhard; Unterer, Stefan

    2018-01-01

    Canine parvovirus (CPV) is the most important viral cause of acute canine enteritis leading to severe damage of the intestinal barrier. It has been speculated that dogs might develop chronic disorders after surviving CPV infection. However, no studies regarding the long-term implications of CPV infection have been published to date. The aim of this study was to evaluate whether dogs that have survived CPV infection will have an increased risk for developing chronic gastroenteritis, atopic dermatitis, or cardiac disease. Dogs that had been treated at the Clinic of Small Animal Medicine, LMU Munich, for CPV infection for which a follow-up of at least 12 months was available, were included in the study. Owners completed a questionnaire on the presence of chronic gastrointestinal and cutaneous signs, cardiac disease, and other potential disorders. An identical questionnaire was sent to owners of matched control dogs during the same time period. Seventy-one questionnaires of dogs with CPV infection and 67 of control dogs were analyzed. Significantly more CPV-infected dogs (30/71) compared to control dogs (8/67) had developed chronic gastrointestinal signs later in their lives (P < 0.001). No significant differences were observed regarding skin diseases (P = 1), cardiac problems (P = 0.160), or any other diseases (P = 0.173) later in life. Results of this study suggest that dogs that survive CPV infection have a significantly higher risk (odds ratio = 5.33) for developing a chronic gastrointestinal disease. Further prospective studies to identify the trigger for the development of chronic diarrhoea and possible targeted treatment strategies are needed.

  2. Ultrasonographic description of canine mastitis.

    Science.gov (United States)

    Trasch, Katja; Wehrend, Axel; Bostedt, Hartwig

    2007-01-01

    Ultrasonographic images were acquired of the mammary glands of 40 bitches with physiologically lactating (n = 20) or inflamed glands (n = 20). Echogenicity, structure, homogeneity, thickness, and distinguishability of each tissue layer were assessed. Additionally, overall echogenicity was noted. In the normal lactating gland, different tissues could be differentiated easily. The parenchyma was, without exception, separated from adjacent tissues and was visible as medium echogenic tissue with a coarse-grained structure. The tissue always had some echogenic lines and anechoic areas and was slightly heterogeneous. The loss of distinct layering of the tissue was characteristic of an inflamed mammary gland and inflamed regions had reduced echogenicity. Additionally in five bitches with mastitis, the ultrasound examination was repeated five times for documentation of the progress of the illness and associated changes, supplemented with a color Doppler sonogram to assess changes in blood vessel density. Information from the examinations carried out via B-mode did not allow treatment success to be predicted. Two bitches with reduced blood vessel density centrally had a poor outcome whereas three bitches with increased blood vessel density had a good outcome. Thus, Doppler sonography might be a useful tool to obtain information of the prognosis in acute canine mastitis.

  3. Duration of immunity in red wolves (Canis rufus) following vaccination with a modified live parvovirus and canine distemper vaccine.

    Science.gov (United States)

    Anderson, Kadie; Case, Allison; Woodie, Kathleen; Waddell, William; Reed, Holly H

    2014-09-01

    There is growing information available regarding duration of immunity for core vaccines in both domestic and nondomestic species. Vaccination protocols in nondomestic canids have frequently followed guidelines developed for the domestic dog; however, these protocols can be inappropriate for nondomestic canids such as the African wild dog (Lycaon pictus), leaving some animals susceptible to infectious disease and others at risk for contracting vaccine-induced disease. In this study, red wolves (Canis rufus) were vaccinated against canine distemper virus (CDV) and canine parvovirus (CPV) and vaccination titers were followed annually for 3 yr. One hundred percent of wolves developed and maintained a positive titer to CDV for 3 yr and 96.9% of wolves developed and maintained a positive titer to CPV for 3 yr. Seroconversion for canine adenovirus was sporadic. The results of this study support decreasing the frequency of vaccine administration in the red wolf population to a triennial basis.

  4. Overexpression of vimentin in canine prostatic carcinoma

    DEFF Research Database (Denmark)

    Rodrigues, M M P; Rema, A; Gärtner, F

    2011-01-01

    Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

  5. Canine urothelial carcinoma: genomically aberrant and comparatively relevant.

    Science.gov (United States)

    Shapiro, S G; Raghunath, S; Williams, C; Motsinger-Reif, A A; Cullen, J M; Liu, T; Albertson, D; Ruvolo, M; Bergstrom Lucas, A; Jin, J; Knapp, D W; Schiffman, J D; Breen, M

    2015-06-01

    Urothelial carcinoma (UC), also referred to as transitional cell carcinoma (TCC), is the most common bladder malignancy in both human and canine populations. In human UC, numerous studies have demonstrated the prevalence of chromosomal imbalances. Although the histopathology of the disease is similar in both species, studies evaluating the genomic profile of canine UC are lacking, limiting the discovery of key comparative molecular markers associated with driving UC pathogenesis. In the present study, we evaluated 31 primary canine UC biopsies by oligonucleotide array comparative genomic hybridization (oaCGH). Results highlighted the presence of three highly recurrent numerical aberrations: gain of dog chromosome (CFA) 13 and 36 and loss of CFA 19. Regional gains of CFA 13 and 36 were present in 97 % and 84 % of cases, respectively, and losses on CFA 19 were present in 77 % of cases. Fluorescence in situ hybridization (FISH), using targeted bacterial artificial chromosome (BAC) clones and custom Agilent SureFISH probes, was performed to detect and quantify these regions in paraffin-embedded biopsy sections and urine-derived urothelial cells. The data indicate that these three aberrations are potentially diagnostic of UC. Comparison of our canine oaCGH data with that of 285 human cases identified a series of shared copy number aberrations. Using an informatics approach to interrogate the frequency of copy number aberrations across both species, we identified those that had the highest joint probability of association with UC. The most significant joint region contained the gene PABPC1, which should be considered further for its role in UC progression. In addition, cross-species filtering of genome-wide copy number data highlighted several genes as high-profile candidates for further analysis, including CDKN2A, S100A8/9, and LRP1B. We propose that these common aberrations are indicative of an evolutionarily conserved mechanism of pathogenesis and harbor genes

  6. An update on the treatment of canine atopic dermatitis

    Directory of Open Access Journals (Sweden)

    Marsella R

    2012-08-01

    Full Text Available Rosanna MarsellaDepartment of Small Animal Clinical Sciences, College of Veterinary Medicine, University of Florida Gainesville, FL, USAAbstract: Remarkable progress has been made in recent years concerning our understanding of the pathogenesis of canine atopic dermatitis (AD. As our understanding improves, the therapeutic approach evolves. Of utmost importance is the documentation of skin barrier impairment in canine AD: ceramides deficiency leads to increased permeability and increased allergen penetration and sensitization. It is currently unknown whether this dysfunction is primary and genetically inherited or secondary to inflammation but it is accepted that skin barrier deficiency plays an important role in either starting or minimally exacerbating canine AD. Thus, the therapeutic approach has changed from focusing on the control of the inflammation to a combined approach that includes therapies aimed at skin barrier repair. The issue of skin barrier repair has been addressed both with oral administration of essential fatty acids and the topical application of products containing a combination of ceramides and fatty acids. These strategies are most helpful as adjunctive treatments and would be best used in young patients that have not developed chronic skin changes. Importantly, treatment for canine AD is multimodal and tailored to the individual patient, the age, and the duration of the disease. Client education plays an important role in explaining the importance of a long-term approach to minimize flare-ups and, in this context, topical therapy to correct skin barrier can be of great benefit. This is an area still in infancy and much work is needed to identify the best formulation. In human medicine, long-term use of moisturizers can have a profound effect on skin barrier and gene expression of proteins involved in skin barrier. This effect is variable depending on the formulation used. It is reasonable to speculate that the same may be

  7. Treatment of canine benign prostatic hyperplasia with medroxyprogesterone acetate

    International Nuclear Information System (INIS)

    Bamberg-Thalen, B.; Linde-Forsberg, C.

    1993-01-01

    Nineteen dogs with clinical signs of benign prostatic hyperplasia (BPH) were given a subcutaneous injection of medroxyprogesterone acetate (MPA). At the first follow-up four to six weeks after treatment, 16 (84%) showed no signs of prostatic disease, and in 10 (53%) radiography revealed that the prostate had decreased in size. The dogs were followed for an average of 17 months. Twelve (64%) showed no signs of prostatic disease for at least 10 months. Relapses occurred in 10 between 10 and 24 months after treatment. Based on the results of this study and an earlier study on the effects of estrogen on BPH, it was concluded that MPA was a good alternative for treatment of canine BPH

  8. Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia.

    Science.gov (United States)

    Saasa, Ngonda; Nalubamba, King Shimumbo; M'kandawire, Ethel; Siwila, Joyce

    2016-01-01

    Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibodies to CPV were detected in 100% of dogs (unvaccinated or vaccinated). The titres ranged from 160 to 10240 with a median of 1280. Vaccinated dogs had significantly higher antibody titres compared to unvaccinated ( p vaccination status were significant predictors of antibody titres. The presence of antibody in all dogs suggests that the CPV infection is ubiquitous and the disease is endemic, hence the need for research to determine the protection conferred by vaccination and natural exposure to the virus under local conditions.

  9. Evaluation of a commercial kit of chromatographic immunoassay for detection of canine distemper antigen in dogs with systemic or neurologic signs of the diseaseAvaliação de um kit de imunoensaio cromatográfico para detecção do antígeno do vírus da cinomose em cães com sinais sistêmicos ou neurológicos da doença

    Directory of Open Access Journals (Sweden)

    Murilo Cézar Curti

    2012-12-01

    Full Text Available The canine distemper is a multisystemic disease highly contagious which can lead to serious consequences and even to death. Different types of tests can be used for the ante mortem diagnosis of canine distemper, however, due to unpredictable course of the disease, the final diagnosis remains uncertain in some cases. We evaluated in 33 dogs with suspected canine distemper, the effectiveness of a commercial test for detection of antigen (Ag of canine distemper, still comparing the frequency of clinical and neurological signs among positive and negative dogs. In 27/33 dogs the material was collected from the ocular mucosa, in 5/33 dogs the test was performed with CSF and in one animal material was collected from the ocular mucosa and CSF. In 14 dogs was performed also the RT-PCR technique. The Ag test was positive in 7/13 confirmed cases of canine distemper, all of them with systemic signs, but in dogs that had only neurologic signs, the antigen test was negative. In six dogs the antigen test was negative, however the RT-PCR was positive. The results of this study showed that the antigen test did not help for the canine distemper diagnosis in many cases with systemic and neurologic signs, still allowing that several cases had false-negative results. A cinomose é uma doença multisistêmica altamente contagiosa, que pode levar a graves sequelas e até ao óbito. Diferentes tipos de exames podem ser usados para o diagnóstico ante mortem da cinomose, entretanto, devido ao curso imprevisível da doença, o diagnóstico final permanece incerto em alguns casos. O objetivo deste trabalho foi avaliar a eficácia do teste comercial de imunoensaio cromatográfico para detecção de antígeno (Ag da cinomose em 33 cães com suspeita de cinomose canina, comparandose ainda a frequência dos sinais clínicos e neurológicos entre cães positivos e negativos. Em 27/33 o material foi coletado da mucosa ocular, em 5/33 foi coletado do LCR e em um animal o

  10. Reliability of mandibular canines as indicators for sexual dichotomy.

    Science.gov (United States)

    Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa

    2013-02-01

    Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

  11. Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.

    Directory of Open Access Journals (Sweden)

    David Kovacevic

    Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.

  12. Duchenne Muscular Dystrophy Gene Therapy in the Canine Model

    Science.gov (United States)

    2015-01-01

    Abstract Duchenne muscular dystrophy (DMD) is an X-linked lethal muscle disease caused by dystrophin deficiency. Gene therapy has significantly improved the outcome of dystrophin-deficient mice. Yet, clinical translation has not resulted in the expected benefits in human patients. This translational gap is largely because of the insufficient modeling of DMD in mice. Specifically, mice lacking dystrophin show minimum dystrophic symptoms, and they do not respond to the gene therapy vector in the same way as human patients do. Further, the size of a mouse is hundredfolds smaller than a boy, making it impossible to scale-up gene therapy in a mouse model. None of these limitations exist in the canine DMD (cDMD) model. For this reason, cDMD dogs have been considered a highly valuable platform to test experimental DMD gene therapy. Over the last three decades, a variety of gene therapy approaches have been evaluated in cDMD dogs using a number of nonviral and viral vectors. These studies have provided critical insight for the development of an effective gene therapy protocol in human patients. This review discusses the history, current status, and future directions of the DMD gene therapy in the canine model. PMID:25710459

  13. Canine parvovirus: the worldwide occurrence of antigenic variants.

    Science.gov (United States)

    Miranda, Carla; Thompson, Gertrude

    2016-09-01

    The most important enteric virus infecting canids is canine parvovirus type 2 (CPV-2). CPV is the aetiologic agent of a contagious disease, mainly characterized by clinical gastroenteritis signs in younger dogs. CPV-2 emerged as a new virus in the late 1970s, which could infect domestic dogs, and became distributed in the global dog population within 2 years. A few years later, the virus's original type was replaced by a new genetic and antigenic variant, called CPV-2a. Around 1984 and 2000, virus variants with the single change to Asp or Glu in the VP2 residue 426 were detected (sometimes termed CPV-2b and -2c). The genetic and antigenic changes in the variants have also been correlated with changes in their host range; in particular, in the ability to replicate in cats and also host range differences in canine and other tissue culture cells. CPV-2 variants have been circulating among wild carnivores and have been well-documented in several countries around the world. Here, we have reviewed and summarized the current information about the worldwide distribution and evolution of CPV-2 variants since they emerged, as well as the host ranges they are associated with.

  14. The immunotherapy of canine osteosarcoma: a historical and systematic review.

    Science.gov (United States)

    Wycislo, K L; Fan, T M

    2015-01-01

    Osteosarcoma is a malignant mesenchymal neoplasm that accounts for the majority of primary bone tumors in dogs and shares biological and clinical similarities with osteosarcoma in humans. Despite dose intensification with conventional cytotoxic therapies, survival times for dogs and humans diagnosed with high-grade osteosarcoma have not changed in the past 20 years, with the principal cause of mortality being the development of pulmonary metastases. Given the therapeutic plateau reached for delaying metastatic progression with cytotoxic agents, exploration of alterative adjuvant therapies for improving management of osteosarcoma micrometastases is clinically justified. Evidence suggests that osteosarcoma is an immunogenic tumor, and development of immunotherapies for the treatment of microscopic lung metastases might improve long-term outcomes. In this review, the history and foundational knowledge of immune interactions to canine osteosarcoma are highlighted. In parallel, immunotherapeutic strategies that have been explored for the treatment of canine osteosarcoma are summarized. With a greater understanding and awareness for how the immune system might be redirected toward combating osteosarcoma metastases, the rational development of diverse immune strategies for managing osteosarcoma holds substantial promise for transforming the therapeutic landscape and improving disease management in both dogs and human beings. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  15. Isolation and phylogenetic characterization of Canine distemper virus from India.

    Science.gov (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek

    2015-09-01

    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.

  16. Nasolacrimal obstruction caused by root abscess of the upper canine in a cat.

    Science.gov (United States)

    Anthony, James M G; Sandmeyer, Lynne S; Laycock, Amanda R

    2010-03-01

    A 10-year-old, castrated male domestic short hair cat was presented to the Small Animal Clinic at the Western College of Veterinary Medicine with a presenting complaint of chronic, ocular discharge from the left eye. Ocular examination confirmed epiphora and mucopurulent discharge but there were no apparent reasons for the ocular discharge, and nasolacrimal obstruction was suspected. The cat had swelling of the left side of the face, severe periodontal disease and a fractured upper left canine tooth with pulpal exposure. Dacryocystorhinography revealed narrowing of the nasolacrimal duct above the root of the fractured upper left canine and dental radiographs showed a severe periapical lucency at the apex of the upper left canine tooth. The fractured canine tooth was removed. Subsequently, the ocular discharge and facial swelling resolved. After 2 years, the epiphora has never reoccurred. This is a noteworthy case because a suspected root abscess resulted in extralumenal compression of the nasolacrimal duct, which shows the importance of a thorough oral examination when nasolacrimal obstruction is evident.

  17. Urine neutrophil gelatinase-associated lipocalin (NGAL as a biomarker for acute canine kidney injury

    Directory of Open Access Journals (Sweden)

    Lee Ya-Jane

    2012-12-01

    Full Text Available Abstract Background Biomarkers for the early prediction of canine acute kidney injury (AKI are clinically important. Recently, neutrophil gelatinase-associated lipocalin (NGAL was found to be a sensitive biomarker for the prediction of human AKI at a very early stage and the development of AKI after surgery. However, NGAL has not yet been studied with respect to dog kidney diseases. The application of NGAL canine AKI was investigated in this study. Results The canine NGAL gene was successfully cloned and expressed. Polyclonal antibodies against canine NGAL were generated and used to develop an ELISA for measuring NGAL protein in serum and urine samples that were collected from 39 dogs at different time points after surgery. AKI was defined by the standard method, namely a serum creatinine increase of greater than or equal to 26.5 μmol/L from baseline within 48 h. At 12 h after surgery, compared to the group without AKI (12 dogs, the NGAL level in the urine of seven dogs with AKI was significantly increased (median 178.4 pg/mL vs. 88.0 pg/mL, and this difference was sustained to 72 h. Conclusion As the increase in NGAL occurred much earlier than the increase in serum creatinine, urine NGAL seems to be able to serve as a sensitive and specific biomarker for the prediction of AKI in dogs.

  18. Segmentation of the Canine Corpus Callosum using Diffusion Tensor Imaging Tractography

    Science.gov (United States)

    Pierce, T.T.; Calabrese, E.; White, L.E.; Chen, S.D.; Platt, S.R.; Provenzale, J.M.

    2014-01-01

    Background We set out to determine functional white matter (WM) connections passing through the canine corpus callosum useful for subsequent studies of canine brains that serve as models for human WM pathway disease. Based on prior studies, we anticipated that the anterior corpus callosum would send projections to the anterior cerebral cortex while progressively posterior segments would send projections to more posterior cortex. Methods A post mortem canine brain was imaged using a 7T MRI producing 100 micron isotropic resolution DTI analyzed by tractography. Using ROIs within cortical locations, which were confirmed by a Nissl stain that identified distinct cortical architecture, we successfully identified 6 important WM pathways. We also compared fractional anisotropy (FA), apparent diffusion coefficient (ADC), radial diffusivity (RD), and axial diffusivity (AD) in tracts passing through the genu and splenium. Results Callosal fibers were organized based upon cortical destination, i.e. fibers from the genu project to the frontal cortex. Histologic results identified the motor cortex based on cytoarchitectonic criteria that allowed placement of ROIs to discriminate between frontal and parietal lobes. We also identified cytoarchitecture typical of the orbital frontal, anterior frontal, and occipital regions and placed ROIs accordingly. FA, ADC, RD and AD values were all higher in posterior corpus callosum fiber tracts. Conclusions Using 6 cortical ROIs, we identified 6 major white matter tracts that reflect major functional divisions of the cerebral hemispheres and we derived quantitative values that can be used for study of canine models of human WM pathological states. PMID:24370161

  19. Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

    Science.gov (United States)

    Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

    2009-12-10

    Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

  20. In vivo electrical conductivity imaging of a canine brain using a 3 T MREIT system

    International Nuclear Information System (INIS)

    Kim, Hyung Joong; Oh, Tong In; Kim, Young Tae; Lee, Byung Il; Woo, Eung Je; Lee, Soo Yeol; Seo, Jin Keun; Kwon, Ohin; Park, Chunjae; Kang, Byeong Teck; Park, Hee Myung

    2008-01-01

    Magnetic resonance electrical impedance tomography (MREIT) aims at producing high-resolution cross-sectional conductivity images of an electrically conducting object such as the human body. Following numerous phantom imaging experiments, the most recent study demonstrated successful conductivity image reconstructions of postmortem canine brains using a 3 T MREIT system with 40 mA imaging currents. Here, we report the results of in vivo animal imaging experiments using 5 mA imaging currents. To investigate any change of electrical conductivity due to brain ischemia, canine brains having a regional ischemic model were scanned along with separate scans of canine brains having no disease model. Reconstructed multi-slice conductivity images of in vivo canine brains with a pixel size of 1.4 mm showed a clear contrast between white and gray matter and also between normal and ischemic regions. We found that the conductivity value of an ischemic region decreased by about 10–14%. In a postmortem brain, conductivity values of white and gray matter decreased by about 4–8% compared to those in a live brain. Accumulating more experience of in vivo animal imaging experiments, we plan to move to human experiments. One of the important goals of our future work is the reduction of the imaging current to a level that a human subject can tolerate. The ability to acquire high-resolution conductivity images will find numerous clinical applications not supported by other medical imaging modalities. Potential applications in biology, chemistry and material science are also expected

  1. [Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

    Science.gov (United States)

    Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

  2. The elevated serum urea:creatinine ratio in canine babesiosis in South Africa is not of renal origin.

    Science.gov (United States)

    de Scally, M P; Leisewitz, A L; Lobetti, R G; Thompson, P N

    2006-12-01

    Pigmented serum, usually due to free haemoglobin and/or bilirubin, is a common finding in dogs with babesiosis, resulting in interference with all biochemical tests that rely on photochemistry. This is particularly true of urea and creatinine determinations, complicating the diagnosis of acute renal failure, which is a serious complication of babesiosis. A disproportionately raised serum urea concentration of unknown origin occurs in severely anaemic canine babesiosis patients and gives rise to an increased serum urea:creatinine ratio. The assay for cystatin-C, an excellent measure of glomerular filtration rate, is unaffected by free serum haemoglobin, and due to its different intrinsic origins, is free of influence by the metabolic derangements and organ pathology, other than renal disease, encountered in canine babesiosis. Serum cystatin-C was used to compare the concentrations of serum urea and serum creatinine in dogs with the severely anaemic form of canine babesiosis as well as a canine babesiosis-free reference group. Mean serum urea and mean serum urea:creatinine ratio were significantly elevated in the babesia-infected group relative to the reference population in this study. Mean serum creatinine and mean serum cystatin-C were within the reference ranges. Therefore an elevated urea:creatinine ratio in canine babesiosis in the presence of a normal serum creatinine concentration is considered to be caused by an elevated serum urea concentration and is most likely of non-renal origin. Serum creatinine was therefore as specific a measure of renal function as serum cystatin-C in canine babesiosis in this study. The sensitivity of serum creatinine as a measure of renal function was not established by this study. Serum urea, however, proved to be of little use compared to serum cystatin-C and serum creatinine. Serum urea should therefore not be used to diagnose renal failure in canine babesiosis.

  3. Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA.

    Science.gov (United States)

    Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb

    2017-07-01

    Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.

  4. Canine trypanosomosis: Clinical observations and morphological ...

    African Journals Online (AJOL)

    Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...

  5. Molecular Epidemiology of Canine Parvovirus, Europe

    Science.gov (United States)

    Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio

    2007-01-01

    Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097

  6. Prostate histotripsy for BPH: initial canine results

    Science.gov (United States)

    Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.

    2009-02-01

    Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.

  7. Canine specific ELISA for coagulation factor VII

    DEFF Research Database (Denmark)

    Knudsen, Tom; Kjelgaard-Hansen, Mads; Tranholm, Mikael

    2011-01-01

    available to date. In this study, a canine specific ELISA for measurement of FVII:Ag in plasma was developed and validated. The FVII:Ag ELISA correctly diagnosed homozygous and heterozygous hereditary FVII deficiency. Together with activity based assays, such as FVII:C, the FVII:Ag ELISA should be valuable...

  8. [Podoconiosis, a society and medical community neglected disease].

    Science.gov (United States)

    Prieto-Pérez, Laura; Soriano Cea, Juan José; Górgolas Hernández-Mora, Miguel

    2015-11-20

    Podoconiosis, mossy foot or endemic non-filarial elephantiasis, is a geochemical disease that causes lower limb lymphedema; it is directly related to walking barefoot over soils of volcanic origin, in areas with a high pluviometric annual index. It has a specific geographical distribution, affecting around 5% population in areas where it is endemic. It is debilitating and disfiguring disease, which frequently leads to social margination. Podoconiosis is totally preventable and, once a diagnosis is established, it may improve with simple therapeutic measures. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  9. Vaccination of harbour seals (Phoca vitulina) against phocid distemper with two different inactivated canine distemper virus (CDV) vaccines.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); M.W.G. van de Bildt (Marco); H.N. Brugge; P.J.H. Reijnders; E.J. Vedder (Lies); J. Kuiper; P. de Vries (Petra); J. Groen (Jan); H.C. Walvoort; F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)

    1989-01-01

    textabstractTwo inactivated canine distemper virus (CDV) vaccines--an adjuvanted whole inactivated virus and a subunit ISCOM preparation--were tested for their ability to induce protective immunity in harbour seals (Phoca vitulina) against phocid distemper, a disease that recently killed greater

  10. Wildlife Reservoirs of Canine Distemper Virus Resulted in a Major Outbreak in Danish Farmed Mink (Neovison vison)

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Chriél, Mariann; Struve, Tina

    2014-01-01

    A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus...

  11. The Canine Sand Maze: An Appetitive Spatial Memory Paradigm Sensitive to Age-Related Change in Dogs

    Science.gov (United States)

    Salvin, Hannah E.; McGreevy, Paul D.; Sachdev, Perminder S.; Valenzuela, Michael J.

    2011-01-01

    Aged dogs exhibit a spectrum of cognitive abilities including a syndrome similar to Alzheimer's disease. A major impediment to research so far has been the lack of a quick and accurate test of visuospatial memory appropriate for community-based animals. We therefore report on the development and validation of the Canine Sand Maze. A 4.5-m-diameter…

  12. Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

    Science.gov (United States)

    Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

    2012-12-01

    To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

  13. Canine degenerative myelopathy: biochemical characterization of superoxide dismutase 1 in the first naturally occurring non-human amyotrophic lateral sclerosis model.

    Science.gov (United States)

    Crisp, Matthew J; Beckett, Jeffrey; Coates, Joan R; Miller, Timothy M

    2013-10-01

    Mutations in canine superoxide dismutase 1 (SOD1) have recently been shown to cause canine degenerative myelopathy, a disabling neurodegenerative disorder affecting specific breeds of dogs characterized by progressive motor neuron loss and paralysis until death, or more common, euthanasia. This discovery makes canine degenerative myelopathy the first and only naturally occurring non-human model of amyotrophic lateral sclerosis (ALS), closely paralleling the clinical, pathological, and genetic presentation of its human counterpart, SOD1-mediated familial ALS. To further understand the biochemical role that canine SOD1 plays in this disease and how it may be similar to human SOD1, we characterized the only two SOD1 mutations described in affected dogs to date, E40K and T18S. We show that a detergent-insoluble species of mutant SOD1 is present in spinal cords of affected dogs that increases with disease progression. Our in vitro results indicate that both canine SOD1 mutants form enzymatically active dimers, arguing against a loss of function in affected homozygous animals. Further studies show that these mutants, like most human SOD1 mutants, have an increased propensity to form aggregates in cell culture, with 10-20% of cells possessing visible aggregates. Creation of the E40K mutation in human SOD1 recapitulates the normal enzymatic activity but not the aggregation propensity seen with the canine mutant. Our findings lend strong biochemical support to the toxic role of SOD1 in canine degenerative myelopathy and establish close parallels for the role mutant SOD1 plays in both canine and human disorders. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas

    OpenAIRE

    Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin

    2017-01-01

    In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenu...

  15. Parasitological detection and molecular evidence of Hepatozoon canis from canines in Manila, Philippines

    OpenAIRE

    Baticados, Waren; Baticados,Waren; Carlos,; Villarba,; Subiaga,; Carlos Sr.,Enrique; Baticados,Abigail

    2011-01-01

    Abigail M Baticados1, Waren N Baticados1, Enrique T Carlos2, Sixto MEAS Carlos2, Lorelie A Villarba1, Sherlyn G Subiaga1, Jomarte M Magcalas11Department of Veterinary Paraclinical Sciences, College of Veterinary Medicine, University of the Philippines Los Baños, Laguna, Philippines; 2Makati Dog and Cat Hospital (MDCH), Makati City, PhilippinesAbstract: Hepatozoon canis infection in canines is allegedly an underreported disease in the Philippines. In over the past four decades, ther...

  16. Theoretical analysis of alendronate and risedronate effects on canine vertebral remodeling and microdamage

    OpenAIRE

    Wang, Xiang; Erickson, Antonia M.; Allen, Matthew R.; Burr, David B.; Martin, R. Bruce; Hazelwood, Scott J.

    2009-01-01

    Bisphosphonates suppress bone remodeling activity, increase bone volume, and significantly reduce fracture risk in individuals with osteoporosis and other metabolic bone diseases. The objectives of the current study were to develop a mathematical model that simulates control and 1 year experimental results following bisphosphonate treatment (alendronate or risedronate) in the canine fourth lumbar vertebral body, validate the model by comparing simulation predictions to 3 year experimental res...

  17. A rapid method for establishment of a reverse genetics system for canine parvovirus.

    Science.gov (United States)

    Yu, Yongle; Su, Jun; Wang, Jigui; Xi, Ji; Mao, Yaping; Hou, Qiang; Zhang, Xiaomei; Liu, Weiquan

    2017-12-01

    Canine parvovirus (CPV) is an important and highly prevalent pathogen of dogs that causes acute hemorrhagic enteritis disease. Here, we describe a rapid method for the construction and characterization of a full-length infectious clone (rCPV) of CPV. Feline kidney (F81) cells were transfected with rCPV incorporating an engineered EcoR I site that served as a genetic marker. The rescued virus was indistinguishable from that of wild-type virus in its biological properties.

  18. Comparative cytogenetic characterization of primary canine melanocytic lesions using array CGH and fluorescence in situ hybridization

    OpenAIRE

    Poorman, Kelsey; Borst, Luke; Moroff, Scott; Roy, Siddharth; Labelle, Philippe; Motsinger-Reif, Alison; Breen, Matthew

    2014-01-01

    Melanocytic lesions originating from the oral mucosa or cutaneous epithelium are common in the general dog population, with up to 100,000 diagnoses each year in the USA. Oral melanoma is the most frequent canine neoplasm of the oral cavity, exhibiting a highly aggressive course. Cutaneous melanocytomas occur frequently, but rarely develop into a malignant form. Despite the differential prognosis, it has been assumed that subtypes of melanocytic lesions represent the same disease. To address t...

  19. A predictive model for canine dilated cardiomyopathy-a meta-analysis of Doberman Pinscher data.

    Science.gov (United States)

    Simpson, Siobhan; Edwards, Jennifer; Emes, Richard D; Cobb, Malcolm A; Mongan, Nigel P; Rutland, Catrin S

    2015-01-01

    Dilated cardiomyopathy is a prevalent and often fatal disease in humans and dogs. Indeed dilated cardiomyopathy is the third most common form of cardiac disease in humans, reported to affect approximately 36 individuals per 100,000 individuals. In dogs, dilated cardiomyopathy is the second most common cardiac disease and is most prevalent in the Irish Wolfhound, Doberman Pinscher and Newfoundland breeds. Dilated cardiomyopathy is characterised by ventricular chamber enlargement and systolic dysfunction which often leads to congestive heart failure. Although multiple human loci have been implicated in the pathogenesis of dilated cardiomyopathy, the identified variants are typically associated with rare monogenic forms of dilated cardiomyopathy. The potential for multigenic interactions contributing to human dilated cardiomyopathy remains poorly understood. Consistent with this, several known human dilated cardiomyopathy loci have been excluded as common causes of canine dilated cardiomyopathy, although canine dilated cardiomyopathy resembles the human disease functionally. This suggests additional genetic factors contribute to the dilated cardiomyopathy phenotype.This study represents a meta-analysis of available canine dilated cardiomyopathy genetic datasets with the goal of determining potential multigenic interactions relating the sex chromosome genotype (XX vs. XY) with known dilated cardiomyopathy associated loci on chromosome 5 and the PDK4 gene in the incidence and progression of dilated cardiomyopathy. The results show an interaction between known canine dilated cardiomyopathy loci and an unknown X-linked locus. Our study is the first to test a multigenic contribution to dilated cardiomyopathy and suggest a genetic basis for the known sex-disparity in dilated cardiomyopathy outcomes.

  20. A predictive model for canine dilated cardiomyopathy—a meta-analysis of Doberman Pinscher data

    Directory of Open Access Journals (Sweden)

    Siobhan Simpson

    2015-03-01

    Full Text Available Dilated cardiomyopathy is a prevalent and often fatal disease in humans and dogs. Indeed dilated cardiomyopathy is the third most common form of cardiac disease in humans, reported to affect approximately 36 individuals per 100,000 individuals. In dogs, dilated cardiomyopathy is the second most common cardiac disease and is most prevalent in the Irish Wolfhound, Doberman Pinscher and Newfoundland breeds. Dilated cardiomyopathy is characterised by ventricular chamber enlargement and systolic dysfunction which often leads to congestive heart failure. Although multiple human loci have been implicated in the pathogenesis of dilated cardiomyopathy, the identified variants are typically associated with rare monogenic forms of dilated cardiomyopathy. The potential for multigenic interactions contributing to human dilated cardiomyopathy remains poorly understood. Consistent with this, several known human dilated cardiomyopathy loci have been excluded as common causes of canine dilated cardiomyopathy, although canine dilated cardiomyopathy resembles the human disease functionally. This suggests additional genetic factors contribute to the dilated cardiomyopathy phenotype.This study represents a meta-analysis of available canine dilated cardiomyopathy genetic datasets with the goal of determining potential multigenic interactions relating the sex chromosome genotype (XX vs. XY with known dilated cardiomyopathy associated loci on chromosome 5 and the PDK4 gene in the incidence and progression of dilated cardiomyopathy. The results show an interaction between known canine dilated cardiomyopathy loci and an unknown X-linked locus. Our study is the first to test a multigenic contribution to dilated cardiomyopathy and suggest a genetic basis for the known sex-disparity in dilated cardiomyopathy outcomes.

  1. Novel region of interest interrogation technique for diffusion tensor imaging analysis in the canine brain.

    Science.gov (United States)

    Li, Jonathan Y; Middleton, Dana M; Chen, Steven; White, Leonard; Ellinwood, N Matthew; Dickson, Patricia; Vite, Charles; Bradbury, Allison; Provenzale, James M

    2017-08-01

    Purpose We describe a novel technique for measuring diffusion tensor imaging metrics in the canine brain. We hypothesized that a standard method for region of interest placement could be developed that is highly reproducible, with less than 10% difference in measurements between raters. Methods Two sets of canine brains (three seven-week-old full-brains and two 17-week-old single hemispheres) were scanned ex-vivo on a 7T small-animal magnetic resonance imaging system. Strict region of interest placement criteria were developed and then used by two raters to independently measure diffusion tensor imaging metrics within four different white-matter regions within each specimen. Average values of fractional anisotropy, radial diffusivity, and the three eigenvalues (λ1, λ2, and λ3) within each region in each specimen overall and within each individual image slice were compared between raters by calculating the percentage difference between raters for each metric. Results The mean percentage difference between raters for all diffusion tensor imaging metrics when pooled by each region and specimen was 1.44% (range: 0.01-5.17%). The mean percentage difference between raters for all diffusion tensor imaging metrics when compared by individual image slice was 2.23% (range: 0.75-4.58%) per hemisphere. Conclusion Our results indicate that the technique described is highly reproducible, even when applied to canine specimens of differing age, morphology, and image resolution. We propose this technique for future studies of diffusion tensor imaging analysis in canine brains and for cross-sectional and longitudinal studies of canine brain models of human central nervous system disease.

  2. Early canine plaque biofilms: characterization of key bacterial interactions involved in initial colonization of enamel.

    Directory of Open Access Journals (Sweden)

    Lucy J Holcombe

    Full Text Available Periodontal disease (PD is a significant problem in dogs affecting between 44% and 63.6% of the population. The main etiological agent for PD is plaque, a microbial biofilm that colonizes teeth and causes inflammation of the gingiva. Understanding how this biofilm initiates on the tooth surface is of central importance in developing interventions against PD. Although the stages of plaque development on human teeth have been well characterized little is known about how canine plaque develops. Recent studies of the canine oral microbiome have revealed distinct differences between the canine and human oral environments and the bacterial communities they support, particularly with respect to healthy plaque. These differences mean knowledge about the nature of plaque formation in humans may not be directly translatable to dogs. The aim of this study was to identify the bacterial species important in the early stages of canine plaque formation in vivo and then use isolates of these species in a laboratory biofilm model to develop an understanding of the sequential processes which take place during the initial colonization of enamel. Supra-gingival plaque samples were collected from 12 dogs at 24 and 48 hour time points following a full mouth descale and polish. Pyrosequencing of the 16S rDNA identified 134 operational taxonomic units after statistical analysis. The species with the highest relative abundance were Bergeyella zoohelcum, Neisseria shayeganii and a Moraxella species. Streptococcal species, which tend to dominate early human plaque biofilms, had very low relative abundance. In vitro testing of biofilm formation identified five primary colonizer species, three of which belonged to the genus Neisseria. Using these pioneer bacteria as a starting point, viable two and three species communities were developed. Combining in vivo and in vitro data has led us to construct novel models of how the early canine plaque biofilm develops.

  3. DNA vaccine encoding nucleocapsid and surface proteins of wild type canine distemper virus protects its natural host against distemper.

    Science.gov (United States)

    Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A

    2000-07-01

    Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.

  4. Canine parvovirus (CPV-2) variants circulating in Nigerian dogs

    Science.gov (United States)

    Apaa, T. T.; Daly, J. M.; Tarlinton, R. E.

    2016-01-01

    Canine parvovirus type 2 (CPV-2) is a highly contagious viral disease with three variants (CPV-2a, CPV-2b and CPV-2c) currently circulating in dogs worldwide. The main aim of this study was to determine the prevalent CPV-2 variant in faecal samples from 53 dogs presenting with acute gastroenteritis suspected to be and consistent with CPV-2 to Nigerian Veterinary Clinics in 2013–2014. Seventy-five per cent of these dogs tested positive for CPV-2 in a commercial antigen test and/or by PCR. Partial sequencing of the VP2 gene of six of these demonstrated them to be CPV-2a. Most of the dogs (60 per cent) were vaccinated, with 74 per cent of them puppies less than six months old. PMID:27933190

  5. Genetic characterization of canine parvovirus from dogs in Pakistan.

    Science.gov (United States)

    Shabbir, M Z; Sohail, M U; Chaudhary, U N; Yaqub, W; Rashid, I; Saleem, M H; Munir, M

    Canine parvoviruses (CPV) exist as antigenic variants with varying frequencies and genetic variabilities across the globe. Given the endemicity and high prevalence in Pakistan, we characterized the CPVs originating from dogs-population to elucidate viral diversity and evolution. Fecal samples from clinically diseased pups (n = 17) of different breeds and age (2-6 months) were processed for hemagglutination assay (HA), and later for partial amplification of VP2 gene sequence and amino acid analysis. A total of 11 samples (64.71%) were found positive both in hemagglutination and PCR assays. Phylogenetic and evolutionary analysis demonstrated higher genetic heterogeneity in studied strains and constituted seven clusters within the CPV-2a group, however, they shared high level of identity with Chinese strains. Further studies are necessary to elucidate genetic analysis and epidemiology of CPV variants across a wide geographical area of the country.

  6. Evidence supporting the conceptual framework of cancer chemoprevention in canines.

    Science.gov (United States)

    Kondratyuk, Tamara P; Adrian, Julie Ann Luiz; Wright, Brian; Park, Eun-Jung; van Breemen, Richard B; Morris, Kenneth R; Pezzuto, John M

    2016-05-24

    As with human beings, dogs suffer from the consequences of cancer. We investigated the potential of a formulation comprised of resveratrol, ellagic acid, genistein, curcumin and quercetin to modulate biomarkers indicative of disease prevention. Dog biscuits were evaluated for palatability and ability to deliver the chemopreventive agents. The extent of endogenous DNA damage in peripheral blood lymphocytes from dogs given the dietary supplement or placebo showed no change. However, H2O2-inducible DNA damage was significantly decreased after consumption of the supplement. The expression of 11 of 84 genes related to oxidative stress was altered. Hematological parameters remained in the reference range. The concept of chemoprevention for the explicit benefit of the canine is compelling since dogs are an important part of our culture. Our results establish a proof-of-principle and provide a framework for improving the health and well-being of "man's best friend".

  7. Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management

    Directory of Open Access Journals (Sweden)

    Loftus JP

    2014-12-01

    Full Text Available John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is associated with dermatological issues, diabetes mellitus, neoplasia, and urolithiasis. The health issues appear to be slightly different across the two species, which may be due to some inherent differences in the hormonal milieu involved in obesity that differs between the dog and the cat. In this review, we discuss the complicated nature of the pathogenesis of obesity, the hormonal stimulus for orexigenic and anorexigenic behavior, adipose tissue as an endocrine organ, and most importantly, clinical management of the number one disease in canine and feline medicine.Keywords: obesity, canine, feline, veterinary

  8. Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

    2017-08-15

    Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

  9. Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

    Science.gov (United States)

    Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

    2018-05-14

    Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

  10. Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.

    Science.gov (United States)

    Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H

    2016-06-01

    Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.

  11. Chemical and canine analysis as complimentary techniques for the identification of active odors of the invasive fungus, Raffaelea lauricola.

    Science.gov (United States)

    Simon, Alison G; Mills, DeEtta K; Furton, Kenneth G

    2017-06-01

    Raffaelea lauricola, a fungus causing a vascular wilt (laurel wilt) in Lauraceae trees, was introduced into the United States in the early 2000s. It has devastated forests in the Southeast and has now moved into the commercial avocado groves in southern Florida. Trained detection canines are currently one of the few successful methods for early detection of pre-symptomatic diseased trees. In order to achieve the universal and frequent training required to have successful detection canines, it is desirable to create accessible, safe, and long-lasting training aids. However, identification of odorants and compounds is limited by several factors, including both the availability of chemicals and the need to present chemicals individually and in combination to detection canines. A method for the separation and identification of volatile organic compounds (VOCs) from environmental substances for the creation of such a canine training aid is presented here. Headspace solid phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) was used to identify the odors present in avocado trees infected with the R. lauricola phytopathogen. Twenty-eight compounds were detected using this method, with nine present in greater than 80% of samples. The majority of these compounds were not commercially available as standard reference materials, and a canine trial was designed to identify the active odors without the need of pure chemical compounds. To facilitate the creation of a canine training aid, the VOCs above R. lauricola were separated by venting a 0.53mm ID solgel-wax gas chromatography column to the atmosphere. Ten minute fractions of the odor profile were collected on cotton gauze in glass vials and presented to the detection canines in a series of field trials. The canines alerted to the VOCs from the vials that correspond to a portion of the chromatogram containing the most volatile species from R. lauricola. This innovative fractionation and collection

  12. Circulating filarial antigen in the hydrocele fluid from individuals living in a bancroftian filariasis area - Recife, Brazil: detected by the monoclonal antibody Og4C3-assay

    Directory of Open Access Journals (Sweden)

    Abraham Rocha

    2004-02-01

    Full Text Available The purpose of this study was to examine the circulating filarial antigen (CFA detected by the monoclonal antibody (mAb Og4C3-ELISA in paired samples of serum and hydrocele fluid from 104 men with hydrocele, living in an endemic area of Wuchereria bancrofti. Nocturnal blood specimens were filtered and examined for microfilariae (MF and ultrasound was used in order to identify the presence of adult worms (the filaria dance sign - FDS in the lymphatic vessels of the scrotal area. Four groups were selected according to their parasitological status: group I - 71 MF- and FDS-; group II - 21 MF+ and FDS+; group III - 10 MF- and FDS+ and group IV- 2 MF+ and FDS-. CFA was identified simultaneously (fluid and serum in 11 (15.5%, 21 (100%, 3 (30%, and 1 (50% in groups I, II, III, and IV, respectively. In despite of high CFA+ level (antigen Og4C3 units/ml, the Geometrical Mean (GM = 2696 in the sera of these 36/104 paired samples, when compared to the hydrocele fluid, (GM = 1079, showed a very good correlation between the CFA level in the serum and CFA level in the fluid (r = 0.731. CFA level in the serum of the 23 microfilaremics (groups II and IV was extremely high (GM = 4189 and was correlated with MF density (r = 0.442. These findings report for the first time the potential alternative use of the hydrocele fluid to investigate CFA using the mAb Og4C3-ELISA.

  13. European canine lymphoma network consensus recommendations for reporting flow cytometry in canine hematopoietic neoplasms.

    Science.gov (United States)

    Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W

    2017-09-01

    Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

  14. Prevalence of serum antibody titers against canine distemper virus and canine parvovirus in dogs hospitalized in an intensive care unit.

    Science.gov (United States)

    Mahon, Jennifer L; Rozanski, Elizabeth A; Paul, April L

    2017-06-15

    OBJECTIVE To determine the prevalence of dogs hospitalized in an intensive care unit (ICU) with serum antibody titers against canine distemper virus (CDV) and canine parvovirus (CPV). DESIGN Prospective observational study. ANIMALS 80 dogs. PROCEDURES Dogs hospitalized in an ICU for > 12 hours between February 1 and June 1, 2015, that had at least 0.25 mL of serum left over from diagnostic testing were eligible for study inclusion. Dogs with serum antibody titers > 1:32 (as determined by serum neutralization) and > 1:80 (as determined by hemagglutination inhibition) were considered seropositive for CDV and CPV, respectively. The date of last vaccination was obtained from the medical record of each dog. RESULTS Of the 80 dogs, 40 (50%) and 65 (81%) dogs were seropositive for CDV and CPV, respectively. Of the 40 dogs that were seronegative for CDV, 27 had been vaccinated against CDV within 3 years prior to testing. Of the 15 dogs that were seronegative for CPV, 3 had been vaccinated against CPV within 3 years prior to testing. Ten dogs were seronegative for both CDV and CPV. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated the prevalence of dogs hospitalized in an ICU that were seropositive for CDV and CPV was lower than expected given the high vaccination rate reported for dogs. Although the antibody titer necessary to prevent disease caused by CDV or CPV in critically ill dogs is unknown, adherence to infectious disease control guidelines is warranted when CDV- or CPV-infected dogs are treated in an ICU.

  15. Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

    Science.gov (United States)

    Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

    2017-06-01

    Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

  16. Canine Detection of Illict Drugs: Sensory Apparatus Technology

    National Research Council Canada - National Science Library

    Morrison, Edward

    2000-01-01

    This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...

  17. Neglected tropical diseases, neglected data sources, and neglected issues.

    Directory of Open Access Journals (Sweden)

    Burton H Singer

    Full Text Available BACKGROUND: Lymphatic filariasis (LF is a so-called neglected tropical disease, currently overshadowed by higher-profile efforts to address malaria, tuberculosis, and HIV/AIDS. Despite recent successes in arresting transmission, some 40 million people who already have the disease have been largely neglected. This study aims to increase understanding of how this vulnerable, neglected group can be helped. METHODS: We used purposive sampling to select 60 men and women with filarial lymphoedema (45 with filarial elephantiasis and 15 men with filarial hydrocoele from the south of Sri Lanka in 2004-2005. Participants were selected to give a balance of men and women and poor and nonpoor, and a range of stages of the disease. Participants' experiences and the consequences of their disease for the household were explored with in-depth qualitative, semistructured interviews. FINDINGS: LF was extremely debilitating to participants over long periods of time. The stigma attached to the condition caused social isolation and emotional distress, and delayed diagnosis and treatment, resulting in undue advancement of the disease. Free treatment services at government clinics were avoided because the participants' condition would be identifiable in public. Loss of income due to the condition was reported by all households in the sample, not just the poorest. Households that were already on low incomes were pushed into near destitution, from which it was almost impossible to escape. Affected members of low-income households also had less opportunity to obtain appropriate treatment from distant clinics, and had living and working conditions that made hygiene and compliance difficult. SIGNIFICANCE: This highly vulnerable category of patients has low visibility, thus becoming marginalized and forgotten. With an estimated 300,000 total cases of elephantiasis and/or oedema in Sri Lanka, and around 300,000 men with filarial hydrocoele, the affected households will need

  18. Antigenic typing Polish isolates of canine parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)

    1995-12-31

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

  19. Coryneform bacteria associated with canine otitis externa

    DEFF Research Database (Denmark)

    Aalbæk, Bent; Bemis, David A.; Schjærff, Mette

    2010-01-01

    This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

  20. Nonsurgical, nonextraction management of impacted maxillary canine

    Directory of Open Access Journals (Sweden)

    Jasneet Singh

    2018-01-01

    Full Text Available NS, a 12 year 2 months old female patient, presented with the chief complaint of irregular teeth. Diagnosis revealed skeletal Class II jaw base relation, with average (toward vertical growth pattern, dentoalveolar angles Class I molar relationship with severe crowding in upper and moderate crowding in the lower arch, normally positioned maxillary incisors but proclined lower incisors, “V” shape constricted maxillary arch with first premolar in crossbite, overretained deciduous molar and a high placed buccoversion canine in the first quadrant and an impacted canine in the second quadrant, constricted mandibular arch with first premolar blocked out in the third quadrant. Treatment with a nonsurgical, nonextraction treatment plan by expansion of the upper arch and taking advantage of natural eruptive forces of the tooth was planned. The final outcome solved the patient's complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

  1. Impacted canines: Etiology, diagnosis, and orthodontic management

    Directory of Open Access Journals (Sweden)

    Ranjit Manne

    2012-01-01

    Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.

  2. Antigenic typing Polish isolates of canine parvovirus

    International Nuclear Information System (INIS)

    Mizak, B.; Plucienniczak, A.

    1995-01-01

    Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs

  3. Consensus Recommendations for the Diagnostic Investigation of Dogs with Suspected Glomerular Disease

    NARCIS (Netherlands)

    Littman, M.P.; Daminet, S.; Grauer, G.F.; Lees, G.E.; van Dongen, A.M.|info:eu-repo/dai/nl/097672637

    2013-01-01

    Background The International Renal Interest Society (IRIS) offers guidelines for chronic kidney disease and acute kidney injury. As dogs with glomerular disease may present differently and require different treatment than those with whole nephron or tubular disease, the IRIS Canine

  4. Expression of nociceptive ligands in canine osteosarcoma.

    Science.gov (United States)

    Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M

    2015-01-01

    Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

  5. Leishmania (infantum) chagasi in canine urinary sediment

    OpenAIRE

    Mendonça, Ivete Lopes de; Batista, Joilson Ferreira; Alves, Leucio Camara

    2015-01-01

    Canine visceral leishmaniasis (CVL) is difficult to diagnosis, mainly due to the presence of asymptomatic animals, the diversity of clinical symptoms and the difficulty in obtaining diagnostic evidence of high sensitivity and specificity. The purpose of this study was to diagnose CVL in urinary sediment of 70 dogs of different breeds, sexes and ages from the veterinary hospital of the Federal University of Piauí and Zoonosis Control Center of Teresina, Brazil. The serological tests were TR DP...

  6. Remote detection of explosives using trained canines

    International Nuclear Information System (INIS)

    Smith, J.C.

    1983-03-01

    Use of dogs is a search method which combines high probability of detection, speed of search, and low cost. It was concluded that the canine could be used for explosive screening of personnel, but that it was imperative that the dog be in a position remote from employees and employee traffic. A study was made of the design of booths and air flow for this purpose. Results of tests and conclusions are given and discussed

  7. In-vitro antiviral efficacy of ribavirin and interferon-alpha against canine distemper virus.

    Science.gov (United States)

    Carvalho, Otávio V; Saraiva, Giuliana L; Ferreira, Caroline G T; Felix, Daniele M; Fietto, Juliana L R; Bressan, Gustavo C; Almeida, Márcia R; Silva Júnior, Abelardo

    2014-10-01

    Canine distemper is a highly contagious disease with high incidence and lethality in the canine population. The objective of this study was to evaluate the efficacy of antiviral action with ribavirin (RBV), interferon-alpha (IFNα), and combinations of RBV and IFNα against canine distemper virus (CDV). Vero cells inoculated with CDV were treated with RBV, IFNα, and combinations of these drugs. The efficacy to inhibit viral replication was evaluated by adding the compounds at different times to determine which step of the viral replicative process was affected. Both drugs were effective against CDV in vitro. The IFNα was the most active compound, with an average IC50 (50% inhibitory concentration) value lower than the IC50 of the RBV. Ribavirin (RBV) was more selective than IFNα, however, and neither drug showed extracellular antiviral activity. The combination of RBV and IFNα exhibited antiviral activity for the intra- and extracellular stages of the replicative cycle of CDV, although the intracellular viral inhibition was higher. Both RBV and IFNα showed high antiviral efficacy against CDV, and furthermore, RBV + IFNα combinations have shown greater interference range in viral infectivity. These compounds could potentially be used to treat clinical disease associated with CDV infection.

  8. Association of canine juvenile generalized demodicosis with the dog leukocyte antigen system.

    Science.gov (United States)

    It, V; Barrientos, L; López Gappa, J; Posik, D; Díaz, S; Golijow, C; Giovambattista, G

    2010-07-01

    Demodectic mange is a well-known parasitic skin disease characterized by the presence of a larger than normal number of Demodex mites (Demodex canis) in the skin of dogs. Recent research has suggested that major histocompatibility complex (MHC) class II expression is higher in the skin of dogs suffering from demodicosis than in normal ones. We have investigated whether canine Dog Leukocyte Antigen (DLA) class II alleles are associated with canine juvenile generalized demodicosis (JGD). In the present study, the analysis of microsatellite markers (FH2202, FH2975 and FH2054) linked to DLA was made in Boxer, Argentinean Mastiff and mixed breed dogs. DNA samples from 56 dogs affected with the disease and 60 breed-matched controls collected in Argentina were analysed. A highly significant association, in some of the analysed markers, in all breeds with the presence of demodicosis was observed with P or =5. The results of this study suggest that an underlying DLA association exists with demodicosis in dogs and that this may represent an important immunological risk factor in the aetiology of this condition. This information could be used in the future to develop diagnostic tests to prevent canine JGD.

  9. Evaluation of protective efficacy of three novel H3N2 canine influenza vaccines.

    Science.gov (United States)

    Tu, Liqing; Zhou, Pei; Li, Lutao; Li, Xiuzhen; Hu, Renjun; Jia, Kun; Sun, Lingshuang; Yuan, Ziguo; Li, Shoujun

    2017-11-17

    Canine influenza virus (CIV) has the potential risk to spread in different areas and dog types. Thus, there is a growing need to develop an effective vaccine to control CIV disease. Here, we developed three vaccine candidates: 1) a recombinant pVAX1 vector expressing H3N2 CIV hemagglutinin (pVAX1-HA); 2) a live attenuated canine adenovirus type 2 expressing H3N2 CIV hemagglutinin (rCAV2-HA); and 3) an inactivated H3N2 CIV (A/canine/Guangdong/01/2006 (H3N2)). Mice received an initial intramuscular immunization that followed two booster injections at 2 and 4 weeks post-vaccination (wpv). The splenic lymphocytes were collected to assess the immune responses at 6 wpv. The protective efficacy was evaluated by challenging H3N2 CIV after vaccination (at 6 wpv). Our results demonstrated that all three vaccine candidates elicited cytokine and antibody responses in mice. The rCAV2-HA vaccine and the inactivated vaccine generated efficient protective efficacy in mice, whereas limited protection was provided by the pVAX1-HA DNA vaccine. Therefore, both the rCAV2-HA live recombinant virus and the inactivated CIV could be used as potential novel vaccines against H3N2CIV. This study provides guidance for choosing the most appropriate vaccine for the prevention and control of CIV disease.

  10. The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

    Science.gov (United States)

    Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

    2017-05-01

    Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. 6-methylmercaptopurine riboside, a thiopurine nucleoside with antiviral activity against canine distemper virus in vitro.

    Science.gov (United States)

    de Carvalho, Otávio Valério; Félix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, Márcia Rogéria; Bressan, Gustavo Costa; Pena, Lindomar José; Silva-Júnior, Abelardo

    2017-06-26

    Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic strategies synergizing with vaccine programs for effectively controlling canine distemper. 6-methylmercaptopurine riboside (6MMPr) is a modified thiopurine nucleoside with known antiviral properties against certain RNA viruses. We tested the inhibitory effects of 6MMPr against a wild-type CDV strain infection in cell culture. We measured infectious particle production and viral RNA levels in treated and untreated CDV-infected cells. Ribavirin (RIB) was used as a positive control. Here, we report for the first time the antiviral effects of 6MMPr against canine distemper virus (CDV) in vitro. 6MMPr was able to reduce viral RNA levels and to inhibit the production of infectious CDV particles. The therapeutic selectivity of 6MMPr was approximately six times higher than that of ribavirin. Our results indicate that 6MMPr has high anti-CDV potential and warrants further testing against other paramyxoviruses, as well as clinical testing of the compound against CDV.

  12. Identification of the rostral migratory stream in the canine and feline brain.

    Directory of Open Access Journals (Sweden)

    Saafan Z Malik

    Full Text Available In the adult rodent brain, neural progenitor cells migrate from the subventricular zone of the lateral ventricle towards the olfactory bulb in a track known as the rostral migratory stream (RMS. To facilitate the study of neural progenitor cells and stem cell therapy in large animal models of CNS disease, we now report the location and characteristics of the normal canine and feline RMS. The RMS was found in Nissl-stained sagittal sections of adult canine and feline brains as a prominent, dense, continuous cellular track beginning at the base of the anterior horn of the lateral ventricle, curving around the head of the caudate nucleus and continuing laterally and ventrally to the olfactory peduncle before entering the olfactory tract and bulb. To determine if cells in the RMS were proliferating, the thymidine analog 5-bromo-2-deoxyuridine (BrdU was administered and detected by immunostaining. BrdU-immunoreactive cells were present throughout this track. The RMS was also immunoreactive for markers of proliferating cells, progenitor cells and immature neurons (Ki-67 and doublecortin, but not for NeuN, a marker of mature neurons. Luxol fast blue and CNPase staining indicated that myelin is closely apposed to the RMS along much of its length and may provide guidance cues for the migrating cells. Identification and characterization of the RMS in canine and feline brain will facilitate studies of neural progenitor cell biology and migration in large animal models of neurologic disease.

  13. Apoptotic intrinsic pathway proteins predict survival in canine cutaneous mast cell tumours.

    Science.gov (United States)

    Barra, C N; Macedo, B M; Cadrobbi, K G; Pulz, L H; Huete, G C; Kleeb, S R; Xavier, J G; Catão-Dias, J L; Nishiya, A T; Fukumasu, H; Strefezzi, R F

    2018-03-01

    Mast cell tumours (MCTs) are the most frequent canine round cell neoplasms and show variable biological behaviours with high metastatic and recurrence rates. The disease is treated surgically and wide margins are recommended. Adjuvant chemotherapy and radiotherapy used in this disease cause DNA damage in neoplastic cells, which is aimed to induce apoptotic cell death. Resisting cell death is a hallmark of cancer, which contributes to the development and progression of tumours. The aim of this study was to investigate the expression of the proteins involved in the apoptotic intrinsic pathway and to evaluate their potential use as prognostic markers for canine cutaneous MCTs. Immunohistochemistry for BAX, BCL2, APAF1, Caspase-9, and Caspase-3 was performed in 50 canine cases of MCTs. High BAX expression was associated with higher mortality rate and shorter survival. BCL2 and APAF1 expressions offered additional prognostic information to the histopathological grading systems. The present results indicate that variations in the expression of apoptotic proteins are related to malignancy of cutaneous MCTs in dogs. © 2017 John Wiley & Sons Ltd.

  14. MiR-9 is overexpressed in spontaneous canine osteosarcoma and promotes a metastatic phenotype including invasion and migration in osteoblasts and osteosarcoma cell lines.

    Science.gov (United States)

    Fenger, Joelle M; Roberts, Ryan D; Iwenofu, O Hans; Bear, Misty D; Zhang, Xiaoli; Couto, Jason I; Modiano, Jaime F; Kisseberth, William C; London, Cheryl A

    2016-10-10

    MicroRNAs (miRNAs) regulate the expression of networks of genes and their dysregulation is well documented in human malignancies; however, limited information exists regarding the impact of miRNAs on the development and progression of osteosarcoma (OS). Canine OS exhibits clinical and molecular features that closely resemble the corresponding human disease and it is considered a well-established spontaneous animal model to study OS biology. The purpose of this study was to investigate miRNA dysregulation in canine OS. We evaluated miRNA expression in primary canine OS tumors and normal canine osteoblast cells using the nanoString nCounter system. Quantitative PCR was used to validate the nanoString findings and to assess miR-9 expression in canine OS tumors, OS cell lines, and normal osteoblasts. Canine osteoblasts and OS cell lines were stably transduced with pre-miR-9 or anti-miR-9 lentiviral constructs to determine the consequences of miR-9 on cell proliferation, apoptosis, invasion and migration. Proteomic and gene expression profiling of normal canine osteoblasts with enforced miR-9 expression was performed using 2D-DIGE/tandem mass spectrometry and RNA sequencing and changes in protein and mRNA expression were validated with Western blotting and quantitative PCR. OS cell lines were transduced with gelsolin (GSN) shRNAs to investigate the impact of GSN knockdown on OS cell invasion. We identified a unique miRNA signature associated with primary canine OS and identified miR-9 as being significantly overexpressed in canine OS tumors and cell lines compared to normal osteoblasts. Additionally, high miR-9 expression was demonstrated in tumor-specific tissue obtained from primary OS tumors. In normal osteoblasts and OS cell lines transduced with miR-9 lentivirus, enhanced invasion and migration were observed, but miR-9 did not affect cell proliferation or apoptosis. Proteomic and transcriptional profiling of normal canine osteoblasts overexpressing miR-9 identified

  15. Low Titers of Canine Distemper Virus Antibody in Wild Fishers (Martes pennanti) in the Eastern USA.

    Science.gov (United States)

    Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L

    2016-01-01

    Canine distemper virus (CDV) infects species in the order Carnivora. Members of the family Mustelidae are among the species most susceptible to CDV and have a high mortality rate after infection. Assessing an animal's pathogen or disease load prior to any reintroduction project is important to help protect the animal being reintroduced, as well as the wildlife and livestock in the area of relocation. We screened 58 fishers for CDV antibody prior to their release into Pennsylvania, US, as part of a reintroduction program. Five of the 58 (9%) fishers had a weak-positive reaction for CDV antibody at a dilution of 1:16. None of the fishers exhibited any clinical sign of canine distemper while being held prior to release.

  16. Expert Opinion to Identify High-Risk Entry Routes of Canine Rabies into Papua New Guinea.

    Science.gov (United States)

    Brookes, V J; Ward, M P

    2017-03-01

    The proximity of Papua New Guinea (PNG) to canine rabies-endemic countries in South-East Asia presents a risk of incursion of this disease into PNG and the rest of the Oceanic region. The objective of this study was to identify the highest risk routes for entry of dogs - associated with movement of people - into PNG from canine rabies-endemic countries. A structured, in-country expert-elicitation workshop was used, and 20 entry routes were identified. The highest risk routes were three land routes from Papua, Indonesia (hunters, traditional border crossers and unregulated, unchecked 'shopper-crossers') and two sea routes (fishing and logging). These results will be used to direct more detailed risk assessments to develop surveillance strategies and incursion response plans. © 2016 Blackwell Verlag GmbH.

  17. Analysis of the full-length VP2 protein of canine parvoviruses circulating in Hungary.

    Science.gov (United States)

    Cságola, Attila; Varga, Szilvia; Lőrincz, Márta; Tuboly, Tamás

    2014-09-01

    In recent years, the number of cases of disease caused by canine parvovirus 2 (CPV-2) in vaccinated dogs has increased. The aim of the present study was to identify CPV-2 strains present in Hungary. Forty-two out of 50 faecal specimens examined were positive, and 25 VP2 sequences were determined and analysed. Based on the current classification, the Hungarian viruses belong to New CPV-2a type, except two viruses that are recombinants of vaccine viruses and CPV-2a strains. The Tyr324Ile alteration was detected for the first time in Europe, and a "Hungarian-specific" substitution (Ala516Thr) was also identified in this study. The immunologically important parts of the currently spreading canine parvoviruses were examined and found to differ greatly from the vaccine strains that are widely used in Hungary.

  18. Ultrasonographic evaluation of the canine shoulder.

    Science.gov (United States)

    Long, C D; Nyland, T G

    1999-01-01

    The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.

  19. Laparoscopic radical prostatectomy in the canine model.

    Science.gov (United States)

    Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M

    1996-12-01

    The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.

  20. Genomic prediction of traits related to canine hip dysplasia

    Directory of Open Access Journals (Sweden)

    Enrique eSanchez-Molano

    2015-03-01

    Full Text Available Increased concern for the welfare of pedigree dogs has led to development of selection programs against inherited diseases. An example is canine hip dysplasia (CHD, which has a moderate heritability and a high prevalence in some large-sized breeds. To date, selection using phenotypes has led to only modest improvement, and alternative strategies such as genomic selection may prove more effective. The primary aims of this study were to compare the performance of pedigree- and genomic-based breeding against CHD in the UK Labrador retriever population and to evaluate the performance of different genomic selection methods. A sample of 1179 Labrador Retrievers evaluated for CHD according to the UK scoring method (hip score, HS was genotyped with the Illumina CanineHD BeadChip. Twelve functions of HS and its component traits were analyzed using different statistical methods (GBLUP, Bayes C and Single-Step methods, and results were compared with a pedigree-based approach (BLUP using cross-validation. Genomic methods resulted in similar or higher accuracies than pedigree-based methods with training sets of 944 individuals for all but the untransformed HS, suggesting that genomic selection is an effective strategy. GBLUP and Bayes C gave similar prediction accuracies for HS and related traits, indicating a polygenic architecture. This conclusion was also supported by the low accuracies obtained in additional GBLUP analyses performed using only the SNPs with highest test statistics, also indicating that marker-assisted selection would not be as effective as genomic selection. A Single-Step method that combines genomic and pedigree information also showed higher accuracy than GBLUP and Bayes C for the log-transformed HS, which is currently used for pedigree based evaluations in UK. In conclusion, genomic selection is a promising alternative to pedigree-based selection against CHD, requiring more phenotypes with genomic data to improve further the accuracy

  1. Surgical construction of a novel simulated carotid siphon in canines

    International Nuclear Information System (INIS)

    Tan Huaqiao; Li Minghua; Zhu Yueqi; Fang Chun; Wang Jue; Wu Chungen; Cheng Yingsheng; Xie Jian; Zhang He

    2008-01-01

    Objective: To develop in vivo carotid siphon models by surgical method using the shaped devices for testing the performance of covered stent specially designed for intracranial vascular diseases. Methods: Six carotid siphon-shaped devices were established using stereolithographic biomodeling and the lost-wax technique. Six canines underwent surgery to expose and isolate bilateral CCA. The right CCA origin was ligated and incised distal to the ligation point after the distal right CCA was temporarily closed. The distal left CCA was ligated and incised proximal to the ligation point after the left CCA origin was closed. The proximal isolated left CCA was passed through the shaped device. The distal isolated right CCA and the proximal isolated left CCA were anastomosed end-to-end. Finally, the shaped device of carotid siphon was fixed with suture and embedded in the left neck. The intraarterial DSA was performed on postprocedural 7 days, 2 weeks and 1 month. The morphological characteristics of carotid siphon models were visually evaluated by two observers. The patency of siphon model and the stenosis of anastomotic stoma were followed-up. Results: All animals tolerated the surgical procedure well with mean model time construction of 90 minutes. The morphological characteristics of siphon models were similar to those in human. The anastomotic stoma stenosis occurred in 2 siphon models, and thrombosis of anastomotic stoma in 1, but all siphons of these models were patent on post-procedural follow-up angiography. Conclusion: Surgical construction of an in vivo carotid siphon model of canine with shaped device is practically feasible. This model can be used for testing neurovascular devices. (authors)

  2. Therapeutic potential of bleomycin plus suicide or interferon-β gene transfer combination for spontaneous feline and canine melanoma

    Science.gov (United States)

    Agnetti, Lucrecia; Fondello, Chiara; Villaverde, Marcela S.; Glikin, Gerardo C.; Finocchiaro, Liliana M. E.

    2017-01-01

    We originated and characterized melanoma cell lines derived from tumors of two feline and two canine veterinary patients. These lines reestablished the morphology, physiology and cell heterogeneity of their respective parental tumors. We evaluated the cytotoxicity of bleomycin (BLM) alone, or combined with interferon-β (IFN-β) or HSVtk/GCV suicide gene (SG) lipofection on these cells. Although the four animals presented stage III disease (WHO system), SG treated feline tumors displayed stable disease in vivo, while the canine ones exhibited partial response. Their derived cell lines reflected this behavior. Feline were significantly more sensitive than canine cells to IFN-β gene transfer. BLM improved the antitumor effects of both genes. The higher levels of reactive oxygen species (ROS) significantly correlated with membrane and DNA damages, emphasizing ROS intervention in apoptotic and necrotic cell death. After 3 days of BLM alone or combined with gene treatments, the colony forming capacity of two canine and one feline treatments survivor cells almost disappeared. Taken together, these results suggest that the treatments eradicated tumor initiating cells and support the clinical potential of the tested combinations. PMID:29344558

  3. Canine Copper-Associated Hepatitis

    NARCIS (Netherlands)

    Dirksen, Karen; Fieten, Hille

    2017-01-01

    Copper-associated hepatitis is recognized with increasing frequency in dogs. The disease is characterized by centrolobular hepatic copper accumulation, leading to hepatitis and eventually cirrhosis. The only way to establish the diagnosis is by histologic assessment of copper distribution and copper

  4. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)

    2014-04-15

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  5. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

    International Nuclear Information System (INIS)

    Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.

    2014-01-01

    Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

  6. Pharmacological targeting of valosin containing protein (VCP) induces DNA damage and selectively kills canine lymphoma cells

    International Nuclear Information System (INIS)

    Nadeau, Marie-Ève; Rico, Charlène; Tsoi, Mayra; Vivancos, Mélanie; Filimon, Sabin; Paquet, Marilène; Boerboom, Derek

    2015-01-01

    Valosin containing protein (VCP) is a critical mediator of protein homeostasis and may represent a valuable therapeutic target for several forms of cancer. Overexpression of VCP occurs in many cancers, and often in a manner correlating with malignancy and poor outcome. Here, we analyzed VCP expression in canine lymphoma and assessed its potential as a therapeutic target for this disease. VCP expression in canine lymphomas was evaluated by immunoblotting and immunohistochemistry. The canine lymphoma cell lines CLBL-1, 17–71 and CL-1 were treated with the VCP inhibitor Eeyarestatin 1 (EER-1) at varying concentrations and times and were assessed for viability by trypan blue exclusion, apoptosis by TUNEL and caspase activity assays, and proliferation by propidium iodide incorporation and FACS. The mechanism of EER-1 action was determined by immunoblotting and immunofluorescence analyses of Lys48 ubiquitin and markers of ER stress (DDIT3), autophagy (SQSTM1, MAP1LC3A) and DNA damage (γH2AFX). TRP53/ATM-dependent signaling pathway activity was assessed by immunoblotting for TRP53 and phospho-TRP53 and real-time RT-PCR measurement of Cdkn1a mRNA. VCP expression levels in canine B cell lymphomas were found to increase with grade. EER-1 treatment killed canine lymphoma cells preferentially over control peripheral blood mononuclear cells. EER-1 treatment of CLBL-1 cells was found to both induce apoptosis and cell cycle arrest in G1. Unexpectedly, EER-1 did not appear to act either by inducing ER stress or inhibiting the aggresome-autophagy pathway. Rather, a rapid and dramatic increase in γH2AFX expression was noted, indicating that EER-1 may act by promoting DNA damage accumulation. Increased TRP53 phosphorylation and Cdkn1a mRNA levels indicated an activation of the TRP53/ATM DNA damage response pathway in response to EER-1, likely contributing to the induction of apoptosis and cell cycle arrest. These results correlate VCP expression with malignancy in canine B cell

  7. Prevalence of protective antibody titers for canine distemper virus and canine parvovirus in dogs entering a Florida animal shelter.

    Science.gov (United States)

    Lechner, Elizabeth S; Crawford, P Cynda; Levy, Julie K; Edinboro, Charlotte H; Dubovi, Edward J; Caligiuri, Randy

    2010-06-15

    To determine the proportion of dogs entering an animal shelter with protective antibody titers (PATs) for canine distemper virus (CDV) and canine parvovirus (CPV) and identify factors associated with having a PAT. Cross-sectional study. 431 dogs admitted to an open-admission municipal animal shelter in north central Florida with a history of infectious disease outbreaks. Blood was collected from dogs on the day of admission to the shelter. Antibody titers for CDV and CPV were measured by virus neutralization and hemagglutination inhibition, respectively. Age, sex, neuter status, address of origin, source (stray or previously owned), health status (healthy or not healthy), and outcome (adoption, euthanasia, or reclaimed by owner) data were also collected. Overall, 64.5% (278/431) of dogs had insufficient titers for antibodies against CDV, CPV, or both. A total of 153 (35.5%) dogs had PATs for both CDV and CPV, 33 (7.7%) had PATs for CDV but not CPV, 136 (31.5%) had PATs for CPV but not CDV, and 109 (25.3%) did not have PATs for either virus. Older dogs were more likely to have PATs for CDV and CPV. Neutered dogs were more likely to have PATs for CDV. Factors not associated with having a PAT included source, health status, and type of community from which the dog originated. Most dogs had insufficient antibody titers for CDV, CPV, or both at the time of admission to the animal shelter. Findings support current guidelines recommending vaccination of all dogs immediately upon admission to shelters, regardless of source or physical condition.

  8. Canine tooth size and fitness in male mandrills (Mandrillus sphinx).

    Science.gov (United States)

    Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean

    2008-07-01

    Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.

  9. Management of an impacted and transposed maxillary canine

    Directory of Open Access Journals (Sweden)

    Deepti A

    2010-03-01

    Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.

  10. The Ondersteport Canine distemper virus strain and measles ...

    African Journals Online (AJOL)

    Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

  11. Canine parvovirus in vaccinated dogs: a field study.

    Science.gov (United States)

    Miranda, C; Thompson, G

    2016-04-16

    The authors report a field study that investigated the canine parvovirus (CPV) strains present in dogs that developed the disease after being vaccinated. Faecal samples of 78 dogs that have been vaccinated against CPV and later presented with clinical signs suspected of parvovirus infection were used. Fifty (64.1 per cent) samples tested positive by PCR for CPV. No CPV vaccine type was detected. The disease by CPV-2b occurred in older and female dogs when compared with that by CPV-2c. The clinical signs presented by infected dogs were similar when any of both variants were involved. In most cases of disease, the resulting infection by field variants occurred shortly after CPV vaccination. Two dogs that had been subjected to a complete vaccination schedule and presented with clinical signs after 10 days of vaccination, had the CPV-2c variant associated. The phylogenetic studies showed a close relationship of the isolates in vaccinated dogs to European field strains. Despite the limited sample size in this study, the findings point to the significance of the continuous molecular typing of the virus as a tool to monitor the prevalent circulating CPV strains and access the efficacy of current vaccines. Adjustments on the vaccine types to be used may have to be evaluated again according to each epidemiological situation in order to achieve the dog's optimal immune protection against CPV.

  12. Status of therapeutic gene transfer to treat canine dilated cardiomyopathy in dogs.

    Science.gov (United States)

    Sleeper, Meg M; Bish, Lawrence T; Sweeney, H Lee

    2010-07-01

    Therapeutic gene transfer holds promise as a way to treat dilated cardiomyopathy from any underlying cause because the approach attempts to address metabolic disturbances that occur at the molecular level of the failing heart. Calcium-handling abnormalities and increased rates of apoptosis are abnormalities that occur in many types of heart disease, and gene therapies that target these metabolic defects have proven to be beneficial in numerous rodent models of heart disease. The authors are currently evaluating this approach to treat canine idiopathic dilated cardiomyopathy.

  13. Stage-Specific Transcriptome and Proteome Analyses of the Filarial Parasite Onchocerca volvulus and Its Wolbachia Endosymbiont

    Science.gov (United States)

    Bennuru, Sasisekhar; Cotton, James A.; Ribeiro, Jose M. C.; Grote, Alexandra; Harsha, Bhavana; Holroyd, Nancy; Mhashilkar, Amruta; Molina, Douglas M.; Randall, Arlo Z.; Shandling, Adam D.; Unnasch, Thomas R.; Ghedin, Elodie; Berriman, Matthew

    2016-01-01

    ABSTRACT Onchocerciasis (river blindness) is a neglected tropical disease that has been successfully targeted by mass drug treatment programs in the Americas and small parts of Africa. Achieving the long-term goal of elimination of onchocerciasis, however, requires additional tools, including drugs, vaccines, and biomarkers of infection. Here, we describe the transcriptome and proteome profiles of the major vector and the human host stages (L1, L2, L3, molting L3, L4, adult male, and adult female) of Onchocerca volvulus along with the proteome of each parasitic stage and of its Wolbachia endosymbiont (wOv). In so doing, we have identified stage-specific pathways important to the parasite’s adaptation to its human host during its early development. Further, we generated a protein array that, when screened with well-characterized human samples, identified novel diagnostic biomarkers of O. volvulus infection and new potential vaccine candidates. This immunomic approach not only demonstrates the power of this postgenomic discovery platform but also provides additional tools for onchocerciasis control programs. PMID:27881553

  14. Survey of Borreliae in ticks, canines, and white-tailed deer from Arkansas, U.S.A.

    Directory of Open Access Journals (Sweden)

    Fryxell Rebecca T

    2012-07-01

    . lonestari sequences: 281 of the 296 sequenced ticks, 3 canines, and 27 deer. Only 22 deer, 7 canines, and 15 tick flaB amplicons (12 I. scapularis, 2 A. maculatum, and 1 Amblyomma species were homologous with B. burgdorferi sequences. Conclusions Data from this study identified multiple Borreliae genotypes in Arkansas ticks, canines and deer including B. burgdorferi and B. lonestari; however, B. lonestari was significantly more prevalent in the tick population than B. burgdorferi. Results from this study suggest that the majority of tick-borne diseases in Arkansas are not B. burgdorferi.

  15. Rhizome extracts of Curcuma zedoaria Rosc induce caspase dependant apoptosis via generation of reactive oxygen species in filarial parasite Setaria digitata in vitro.

    Science.gov (United States)

    Senathilake, K S; Karunanayake, E H; Samarakoon, S R; Tennekoon, K H; de Silva, E D

    2016-08-01

    Human lymphatic filariasis (LF) is mainly caused by filarial parasite Wuchereria bancrofti and is the second leading cause of long term and permanent disability in tropical countries. To date, incapability to eliminate long lived adult parasites by current drugs remains the major challenge in the elimination of LF. Hence, in the current study, the efficacy of rhizome extracts of Curcuma zedoaria (a plant traditionally used in Sri Lanka in the management of LF) was evaluated as an effective filaricide in vitro. Sequential solvent extracts of C. zedoaria rhizomes were screened for in vitro antifilarial activity at 0.01-1 mg/mL concentrations by motility inhibition assay and 3-(4, 5 dimethylthiazol-2-yl)-2, 5 diphenyl tetrazolium bromide (MTT) reduction assay using cattle parasite Setaria digitata as a model organism. Exposure of parasites to hexane and chloroform extracts of C. zedoaria caused a dose dependant reduction in motility and viability of microfilariae (IC50 = 72.42 μg/mL for hexane extract, 191.14 μg/mL for chloroform extract) and adult parasites (IC50 = 77.07 μg/mL for hexane extract, 259.87 μg/mL for chloroform extract). Both extracts were less toxic to human peripheral blood mononuclear cells when compared to filariae. A dose dependant increase in caspase 3/CED 3 and a decrease in total protein content, cyclooxygenase (COX) and protein tyrosine phosphatase (PTP) activities were observed in adult parasites treated with hexane or chloroform extract. A significant degree of chromatin condensation and apoptotic body formation were also observed in these worms by Hoechst 33342 and terminal deoxynucleotidyl transferase-mediated dUTP biotin nick end labeling (TUNEL) staining respectively. Dose dependant chromosomal DNA laddering was observed in treated adult worms but not in microfilariae in response to both extracts. Oxidative stress parameters such as reduction in reduced glutathione (GSH) levels and increase in glutathione s transferase (GST

  16. Surgical considerations and management of bilateral labially impacted canines

    Directory of Open Access Journals (Sweden)

    Yu-Shan Huang

    2016-06-01

    Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.

  17. Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

    Science.gov (United States)

    Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

    2016-11-01

    The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

  18. Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review

    Directory of Open Access Journals (Sweden)

    Parviz Torkzaban

    2016-09-01

    Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.

  19. Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.

    Science.gov (United States)

    Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka

    2016-07-01

    Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.

  20. Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup

    OpenAIRE

    Headley,Selwyn Arlington; Saito,Taís Berelli

    2003-01-01

    Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

  1. Why is Southern African canine babesiosis so virulent? An evolutionary perspective

    Directory of Open Access Journals (Sweden)

    Penzhorn Barend L

    2011-04-01

    Full Text Available Abstract Canine babesiosis is a common, highly virulent disease in Southern Africa with even pups and juveniles being severely affected. This contrasts with bovine babesiosis, for example, where host, parasite and vector co-evolved and young animals develop immunity after infection without showing clinical signs. Babesia rossi, the main causative organism of canine babesiosis in sub-Saharan Africa, was first described from a side-striped jackal (Canis adustus in Kenya. Although data are meagre, there is evidence that indigenous African canids, such as jackals and wild dogs (Lycaon pictus, can harbour the parasite without showing untoward effects. Dogs are not indigenous to Africa. The vast majority of dogs presented at veterinary facilities in South Africa represent recently introduced European, Asian or American breeds. The contention is that B. rossi is a new challenge to which these dogs have not adapted. With intensive treatment of clinical cases, natural selection is effectively negated and the status quo will probably be maintained indefinitely. It is postulated that Babesia vogeli, which frequently results in unapparent infections or mild manifestations in dogs, represents or is closely related to the ancestral form of the canine parasite, possibly originating from wolves (Canis lupus.

  2. Canine distemper in Siberian tiger cubs from Zagreb ZOO: case report

    Directory of Open Access Journals (Sweden)

    Dean Konjević

    2011-01-01

    Full Text Available Canine distemper is a contagious, potentially lethal disease of mainly domestic and wild canids, but also of many other mammalian species including large felids. In February 2004, two Siberian tiger (Panthera tigris altaica cubs at the age of six months died at the Zagreb ZOO. The animals were presented for necropsy with two days history of severe digestive disorders, characterized mainly by haemathemesis. Dissections revealed catarrhal to pseudomembranous gastroenteritis (depending on the animal accompanied with haemorrhagic oedema of the lungs. Necrotic tonsillitis and disseminated depletion of the lymphocytes were the most prominent histological findings in both examined animals, while intranuclear and intracytoplasmatic inclusion bodies were found in the samples of the tongues and intestines. Representative portions of the livers, intestines, tonsils and lymph nodes were submitted for bacteriological and mycological analysis. The presence of Clostridium spp., Campylobacter coli and Escherichia coli was detected in gut samples, coli-like bacteria were found in samples of liver, tonsils and lymph nodes, while Candida sp. was found in the gut and pharynx samples. Toxicological analysis excluded anticoagulant and organophosphorous intoxication as the cause of death. Immunohistochemical analysis was positive for canine distemper virus. Based on all this, epizootiological, clinical and additional findings, canine distemper was recognized as the cause of the observed condition in these animals.

  3. The recombinant EHV-1 vector producing CDV hemagglutinin as potential vaccine against canine distemper.

    Science.gov (United States)

    Pan, Zihao; Liu, Jin; Ma, Jiale; Jin, Qiuli; Yao, Huochun; Osterrieder, Nikolaus

    2017-10-01

    Canine distemper virus (CDV), is a pantropic agent of morbillivirus that causes fetal disease in dogs. Base on a broad host rang of CDV, the continued vaccines inoculation is unavoidable to pose gene recombination risk in vaccine virus and wild virus. The current study presents the construction of novel vectors, using equine herpesvirus type 1 (EHV-1) expressing the canine distemper virus (CDV). The recent field strain hemagglutinin protein and nucleoprotein were used for the construction of the viral vector vaccines. Based on the Bacterial artificial chromosome (BAC) genomes of EHV-1 RacH strain, the recombinant EHV-1 vaccine virus encoding CDV hemagglutinin protein (EHV-H) or CDV nucleoprotein (EHV-N) was constructed separately. The constructed BACs were rescued after 72 h post infection, and the expression of H or N in the recombinant viruses was confirmed by western-blotting. Furthermore, high levels of neutralizing antibodies were induced persistently following vaccination in the groups EHV-H&EHV-N and EHV-H, but the EHV-N group. The groups of vaccinated EHV-H and EHV-H&EHV-N pups were monitored for clinical signs, whereas the vaccinated EHV-N group developed moderate symptoms. The present study demonstrated that EHV-1 based recombinant virus carrying CDV H could be a promising vaccine candidate against canine distemper. Copyright © 2017. Published by Elsevier Ltd.

  4. Canine distemper outbreak in pet store puppies linked to a high-volume dog breeder.

    Science.gov (United States)

    Schumaker, Brant A; Miller, Myrna M; Grosdidier, Paul; Cavender, Jacqueline L; Montgomery, Donald L; Cornish, Todd E; Farr, Robert M; Driscoll, Michael; Maness, Lori J; Gray, Tangney; Petersen, Dana; Brown, William L; Logan, Jim; O'Toole, Donal

    2012-11-01

    Canine distemper is uncommon in the pet trade in the United States, in large part due to effective vaccines against Canine distemper virus (CDV). This is a report of CDV affecting 24 young dogs of multiple breeds shortly after sale by 2 pet stores in Wyoming during August-October 2010. Cases were diagnosed over 37 days. Diagnosis was established by a combination of fluorescent antibody staining, reverse transcription polymerase chain reaction, negative stain electron microscopy, and necropsy with histopathology. Viral hemagglutinin gene sequences were analyzed from 2 affected dogs and were identical (GenBank accession no. JF283477). Sequences were distinct from those in a contemporaneous unrelated case of CDV in a Wyoming dog (JF283476) that had no contact with the pet store dogs. The breeding property from which the puppies originated was quarantined by the Kansas Animal Health Department. Puppies intended for sale were tested for CDV. Canine distemper was diagnosed on site in November 2010. At that point 1,466 dogs were euthanized to eliminate dispersal of the disease through commercial channels. The investigation underscores the risks inherent in large-scale dog breeding when vaccination and biosecurity practices are suboptimal.

  5. Studies on manifestations of canine distemper virus infection in an urban dog population.

    Science.gov (United States)

    Blixenkrone-Møller, M; Svansson, V; Have, P; Orvell, C; Appel, M; Pedersen, I R; Dietz, H H; Henriksen, P

    1993-10-01

    An upsurge of canine distemper was recognized at the beginning of 1991 in the urban dog population of the Copenhagen area. The outbreak had the characteristics of a virulent morbillivirus introduction in a partly immune population, where the disease primarily was manifested in young individuals. Testing of single serum samples for the presence of canine distemper virus (CDV) IgM antibodies using an IgM ELISA confirmed current and recent CDV infections in an urban dog population, where the use of attenuated CDV vaccines was widespread. In 49 out of 66 sera from clinical cases suspected of canine distemper we detected CDV IgM antibodies, as compared to the detection of viral antigen by indirect immunofluorescence in 27 of 65 specimens of conjunctival cells. The antigenic make-up of isolates from acute and subacute clinical cases was investigated with a panel of 51 monoclonal antibodies directed against CDV and the related phocine distemper virus. The isolates exhibited an homogeneous reaction pattern and shared overall antigenic characteristics of the CDV prototype. The majority of cases were diagnosed among unvaccinated dogs and individuals with unknown or obscure vaccination record. However, severe clinical cases were also diagnosed in vaccinated individuals.

  6. Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.

    Science.gov (United States)

    Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P

    2016-03-23

    Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.

  7. Successful Treatment of Canine Sporotrichosis with Terbinafine: Case Reports and Literature Review.

    Science.gov (United States)

    Viana, Paula Gonçalves; Figueiredo, Anna Barreto Fernandes; Gremião, Isabella Dib Ferreira; de Miranda, Luisa Helena Monteiro; da Silva Antonio, Isabela Maria; Boechat, Jéssica Sepulveda; de Sá Machado, Ana Caroline; de Oliveira, Manoel Marques Evangelista; Pereira, Sandro Antonio

    2018-04-01

    Sporotrichosis occurs worldwide, and the metropolitan region of Rio de Janeiro, Brazil, is a main endemic area, with a large number of human and animal cases in the last 19 years. This mycosis is more frequently described in cats rather than in dogs. There are a limited number of oral antifungal agents for the treatment of sporotrichosis in animals. In this context, the effectiveness of terbinafine in the treatment of sporotrichosis in humans, as well as the promising results of in vitro susceptibility tests, inspired us to use this drug in the therapy of this mycosis in dogs. We reported for the first time the use of terbinafine in the treatment of two dogs with sporotrichosis caused by Sporothrix brasiliensis. Moreover, we provided an overview of therapeutic features of canine sporotrichosis cases reported since the 1960s. One of the dogs presented the fixed cutaneous form of the disease, while the other patient presented hyperemia of the nasal mucosa and respiratory signs only. Terbinafine showed high antifungal activity in vitro against the canine Sporothrix isolates. The dogs were successfully treated with terbinafine, with remission of all clinical signs initially presented. The current reports indicate that this drug can emerge as a therapeutic option for canine sporotrichosis.

  8. CANINE VISCERAL LEISHMANIASIS CASE INVESTIGATION IN THE JACARE REGION OF NITEROI, RIO DE JANEIRO, BRAZIL

    Directory of Open Access Journals (Sweden)

    Amanda Codeço de OLIVEIRA

    2015-08-01

    Full Text Available SUMMARY American visceral leishmaniasis is a vector-borne zoonosis in expansion in Brazil. Dogs are the main urban reservoir. Departing from a case of canine visceral leishmaniasis (CVL in Jacaré, Niterói, Rio de Janeiro State, an epidemiological canine and entomological study was performed to assess the extension of the disease at the location. Sample was collected around the case and the dogs identified by serological tests (rapid double platform immunochromatographic exams, immunoenzymatic assay/ELISA, indirect immunofluorescence/IFAT. The parasitological diagnosis was performed in animals positive in at least one of these tests. The entomological study was carried out by using light traps and manual collection. The associations between canine variables and outcome (ELISA and IFAT reagents were assessed by the chi-square test and adjusted by multivariate logistic regression for those associations with p < 0.1 in the bivariate analysis. Seventeen cases of CVL were detected among 110 evaluated dogs (prevalence of 15.5%. Presence of ectoparasites (OR 6.5; 95% CI 1.1-37.4, animals with clinical signs (OR 9.5; 95% CI 1.2-76.6, and previous cases of CVL in the same house (OR 17.9; 95% CI 2.2-147.1 were associated with the outcome. Lutzomyia longipalpiswas not detected. Our results are indicative of an ongoing transmission in the area.

  9. Isolation and characterization of canine parvovirus type 2c (CPV-2c from symptomatic puppies

    Directory of Open Access Journals (Sweden)

    R Puentes

    2012-09-01

    Full Text Available Canine parvovirus type 2 (CPV-2 is a leading cause of diarrhea in puppies in several parts of the world. In this study CPV-2 was detected and recovered from puppies showing clinical disease from Montevideo, Uruguay. Samples were processed and used to infect CRFK and MDCK cells in order to isolate the virus. Out of twelve, two samples were positive for CPV-2. A genomic region of 583 bp was amplified and the molecular characterization was performed by sequencing, phylogenetic analysis and Restriction Fragment Length Polymorphism (RFLP. Two isolated viruses (UY1 and UY2 were CPV-2c-like viruses. The comparison between the cytophatic effect (CPE of CPV-2 (vaccinal virus and CPV-2c (isolated virus on primary canine cells cultures and on CRFK line cells, demonstrated that CPV-2c is less citopathogenic in CRFK than in primary cultures. Our study represents the first report on isolation and characterization of canine parvovirus type 2c (CPV-2c in cell cultures from South American dogs.

  10. Mast cells in Canine parvovirus-2-associated enteritis with crypt abscess.

    Science.gov (United States)

    Woldemeskel, M W; Saliki, J T; Blas-Machado, U; Whittington, L

    2013-11-01

    The role of mast cells (MCs) in allergic reactions and parasitic infections is well established. Their involvement in host immune response against bacterial and viral infections is reported. In this study, investigation is made to determine if MCs are associated with Canine parvovirus-2 (CPV-2)-induced enteritis with crypt abscess (ECA). Mast cell count (MCC) was made on toluidine blue-stained intestinal sections from a total of 34 dogs. These included 16 dogs exhibiting ECA positive for CPV-2 and negative for Canine distemper virus and Canine coronavirus by immunohistochemistry and fluorescent antibody test, 12 dogs with inflammatory bowel disease (IBD), and 6 non-ECA/non-IBD (control) dogs. The average total MCC per high-power field in ECA (40.8 ± 2.2) and IBD (24.7 ± 2.1) was significantly higher (P .05), MCC was also higher in ECA than in IBD. The present study for the first time has documented significantly increased MCs in CPV-2-associated ECA as was previously reported for IBD, showing that MCs may also play an important role in CPV-2-associated ECA. Further studies involving more CPV-infected dogs are recommended to substantiate the findings.

  11. Antitumor effects of celecoxib in COX-2 expressing and non-expressing canine melanoma cell lines.

    Science.gov (United States)

    Seo, Kyoung-Won; Coh, Ye-Rin; Rebhun, Robert B; Ahn, Jin-Ok; Han, Sei-Myung; Lee, Hee-Woo; Youn, Hwa-Young

    2014-06-01

    Cyclooxygenase-2 (COX-2) is a potential target for chemoprevention and cancer therapy. Celecoxib, a selective COX-2 inhibitor, inhibits cell growth of various types of human cancer including malignant melanoma. In dogs, oral malignant melanoma represents the most common oral tumor and is often a fatal disease. Therefore, there is a desperate need to develop additional therapeutic strategies. The purpose of this study was to investigate the anticancer effects of celecoxib on canine malignant melanoma cell lines that express varying levels of COX-2. Celecoxib induced a significant anti-proliferative effect in both LMeC and CMeC-1 cells. In the CMeC cells, treatment of 50 μM celecoxib caused an increase in cells in the G0/G1 and a decreased proportion of cells in G-2 phase. In the LMeC cells, 50 μM of celecoxib led to an increase in the percentage of cells in the sub-G1 phase and a significant activation of caspase-3 when compared to CMeC-1 cells. In conclusion, these results demonstrate that celecoxib exhibits antitumor effects on canine melanoma LMeC and CMeC-1 cells by induction of G1-S cell cycle arrest and apoptosis. Our data suggest that celecoxib might be effective as a chemotherapeutic agent against canine malignant melanoma. Copyright © 2014. Published by Elsevier Ltd.

  12. Frequency and Clinical Epidemiology of Canine Monocytic Ehrlichiosis in Dogs Infested with Ticks from Sinaloa, Mexico

    Directory of Open Access Journals (Sweden)

    Carolina Guadalupe Sosa-Gutierrez

    2013-01-01

    Full Text Available Ehrlichia canis is a rickettsial intracellular obligate bacterial pathogen and agent of canine monocytic ehrlichiosis. The prevalence of this disease in veterinary medicine can vary depending on the diagnostic method used and the geographic location. One hundred and fifty-two canine blood samples from six veterinary clinics and two shelters from Sinaloa State (Mexico were analyzed in this study. All animals were suspected of having Canine Monocytic Ehrlichiosis (CME. The diagnostic methods used were the ELISA (Snap4Dx, IDEXX together with blood smear and platelet count. From all dogs blood samples analyzed, 74.3% were positive to E. canis by ELISA and 40.1% were positive by blood smear. The sensitivity and specificity observed in the ELISA test were 78.8% and 86.7%. In addition, thrombocytopenia was presented in 87.6% of positive dogs. The predominant clinical manifestations observed were fever, anorexia, depression, lethargy, and petechiae. Consequently, this is the first report in which the morulae were visualized in the blood samples, and E. canis-specific antibodies were detected in dogs from Sinaloa, Northwest of Mexico.

  13. Biological and immunogenic properties of rabies virus glycoprotein expressed by canine herpesvirus vector.

    Science.gov (United States)

    Xuan, X; Tuchiya, K; Sato, I; Nishikawa, Y; Onoderaz, Y; Takashima, Y; Yamamoto, A; Katsumata, A; Iwata, A; Ueda, S; Mikami, T; Otsuka, H

    1998-01-01

    In order to evaluate whether canine herpesvirus (CHV) could be used as a live vector for the expression of heterologous immunogenes, we constructed a recombinant canine herpesvirus (CHV) expressing glycoprotein (G protein) of rabies virus (RV). The gene of G protein was inserted within the thymidine kinase gene of CHV YP11mu strain under the control of the human cytomegalovirus immediate early promoter. The G protein expressed by the recombinant CHV was processed and transported to the cell surface as in RV infected cells, and showed the same biological activities such as low pH dependent cell fusion and hemadsorption. The antigenic authenticity of the recombinant G protein was confirmed by a panel of monoclonal antibodies specific for G protein. Dogs inoculated intransally with the recombinant CHV produced higher titres of virus neutralizing antibodies against RV than those inoculated with a commercial, inactivated rabies vaccine. These results suggest that the CHV recombinant expressing G protein can be used as a vaccine to control canine rabies and that CHV may be useful as a vector to develop live recombinant against other infectious diseases in dogs.

  14. Homologous recombination is a force in the evolution of canine distemper virus.

    Science.gov (United States)

    Yuan, Chaowen; Liu, Wenxin; Wang, Yingbo; Hou, Jinlong; Zhang, Liguo; Wang, Guoqing

    2017-01-01

    Canine distemper virus (CDV) is the causative agent of canine distemper (CD) that is a highly contagious, lethal, multisystemic viral disease of receptive carnivores. The prevalence of CDV is a major concern in susceptible animals. Presently, it is unclear whether intragenic recombination can contribute to gene mutations and segment reassortment in the virus. In this study, 25 full-length CDV genome sequences were subjected to phylogenetic and recombinational analyses. The results of phylogenetic analysis, intragenic recombination, and nucleotide selection pressure indicated that mutation and recombination occurred in the six individual genes segment (H, F, P, N, L, M) of the CDV genome. The analysis also revealed pronounced genetic diversity in the CDV genome according to the geographically distinct lineages (genotypes), namely Asia-1, Asia-2, Asia-3, Europe, America-1, and America-2. The six recombination events were detected using SimPlot and RDP programs. The analysis of selection pressure demonstrated that a majority of the nucleotides in the CDV individual gene were under negative selection. Collectively, these data suggested that homologous recombination acts as a key force driving the genetic diversity and evolution of canine distemper virus.

  15. Safety and efficacy of targeted hyperthermia treatment utilizing gold nanorod therapy in spontaneous canine neoplasia.

    Science.gov (United States)

    Schuh, Elizabeth M; Portela, Roberta; Gardner, Heather L; Schoen, Christian; London, Cheryl A

    2017-10-02

    Hyperthermia is an established anti-cancer treatment but is limited by tolerance of adjacent normal tissues. Parenteral administration of gold nanorods (NRs) as a photosensitizer amplifies the effects of hyperthermia treatment while sparing normal tissues. This therapy is well tolerated and has demonstrated anti-tumor effects in mouse models. The purpose of this phase 1 study was to establish the safety and observe the anti-tumor impact of gold NR enhanced (plasmonic) photothermal therapy (PPTT) in client owned canine patients diagnosed with spontaneous neoplasia. Seven dogs underwent gold NR administration and subsequent NIR PPTT. Side effects were mild and limited to local reactions to NIR laser. All of the dogs enrolled in the study experienced stable disease, partial remission or complete remission. The overall response rate (ORR) was 28.6% with partial or complete remission of tumors at study end. PPTT utilizing gold nanorod therapy can be safely administered to canine patients. Further studies are needed to determine the true efficacy in a larger population of canine cancer patients and to and identify those patients most likely to benefit from this therapy.