Medicinal Plants used for Dogs in Trinidad and Tobago

NARCIS (Netherlands)

Lans, C.; Harper, T.; Georges, K.; Bridgewater, K.

2000-01-01

This paper documents ethnoveterinary medicines used to treat dogs in Trinidad and Tobago. In 1995, a 4-stage process was used to conduct the research and document the ethnoveterinary practices. Twenty-eight ethnoveterinary respondents were identified using the school-essay method, which is a

Animal-based medicines used in ethnoveterinary practices in the semi-arid region of Northeastern Brazil

Directory of Open Access Journals (Sweden)

Wedson M.S. Souto

2012-09-01

Full Text Available This work documents the zootherapeutic practices in Ethnoveterinary medicine (EVM of Pedra Lavrada (6°45'S, 36°28'W, Northeastern Brazil. We interviewed 23 people (22 men and 1 woman, who provided information on animal species used as remedies, body parts used to prepare the remedies, and illnesses for which the remedies were prescribed. We calculated the use-value to determine the most important species. Interviewees cited 11 animal taxa. The main species mentioned were ram - Ovis aries (UV=0.89, crab-eating fox - Cerdocyon thous (UV=0.79, common green iguana - Iguana iguana (UV=0.79, and South American rattlesnake - Caudisona durissa (Linnaeus, 1758 (UV=0.74. The most frequently cited treatments concerned to inflammatory and dermatological ailments or conditions, as well as to obstetric disorders. Similar to other studies, local ethnoveterinary establishes connections with human ethnomedicine. The results suggest that similarities in the repertoire of medicinal resources chosen by local residents reflect the local accessibility/availability of the resources. Our results help to preserve ethnoveterinary knowledge, which is important in enhancing our understanding on the relationship among humans, society and nature, and also to elaborate more effective strategies for conserving natural resources. Other studies for scientific validation of the effects and side effects of these zootherapeutic products are needed before they can be recommended or not for use.Este trabalho registra as práticas zooterapêuticas na medicina etnoveterinária no município de Pedra Lavrada, Nordeste do Brasil. Entrevistaram-se 23 pessoas (22 homens e uma mulher os quais forneceram informações sobre as espécies usadas como remédios, as partes do corpo usadas para preparar os remédios e as doenças tratadas. Calculou-se o Valor de Uso a fim de determinar quais espécies eram mais importantes. Os entrevistados reportaram 11 animais usados medicinalmente. As

Documentation of ethnoveterinary practices used in family poultry in Botswana

Directory of Open Access Journals (Sweden)

John Cassius Moreki

2013-02-01

Full Text Available Aim: To document the use of indigenous plants used by family poultry rearers to treat and control diseases and parasites in 15 villages of Botswana. Materials and Methods: A total of 1000 family poultry rearers in 15 villages were interviewed using a structured questionnaire. Data were also collected through direct observation, village walks, interview of passers-by, group interviews, and meetings with key informants (i.e., traditional leaders, extension agents and chairpersons of village development committees. Results: The ethnoveterinary practices in 15 villages of Botswana were identified and documented. Nineteen plant species representing 15 families were used by family poultry rearers to treat and control poultry diseases and parasites. Most frequently used plants were from Fabaceae, Asteraceae and Liliaceae. Both human and veterinary medications (e.g., vicks, disprin and Compral tablets, blue stones, potassium permanganate, veterinary drugs and vaccines were used in health management. Sixty-six percent of the respondents said they used traditional remedies to control and treat diseases, 19% did not use vaccines or remedies, 2% used vaccines while 13% used drugs to control and treat diseases. Conclusions: Ethnoveterinary medicine predominates in family poultry healthcare. Scientific investigations should be carried out to ascertain the effectiveness of identified plant species used in health management of family poultry. [Vet World 2013; 6(1.000: 18-21

Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.

Science.gov (United States)

Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D

2014-12-01

Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.

The Use of Herbal Drugs in Organic Animal Production: The Case of Ethnoveterinary Medicine in Central Anatolia Region

Directory of Open Access Journals (Sweden)

Çağrı Çağlar Sinmez

2017-12-01

Full Text Available Organic animal production is a natural breeding system in which animal health is protected by giving priority to alternative medicines and treatment as needed by applying appropriate management and feeding methods based on the physiological requirements of animals. Increasing numbers of strains resistant to antibiotics and antiparasitic drugs used in animal breeding have brought about the search for alternative herbal remedies that lead to drug residues in animal products and lead to important health problems in people consuming these products. In this study, it was aimed to evaluate the therapeutic and protective effects of herbal drugs used in organic animal production in ethnoveterinary medicine in the Central Anatolia Region. The material of the study collected as written and declared facts as well as visual data were obtained from animal breeders in the Central Anatolia Region. The results indicated that 30 herbal drugs were used for the treatment of internal diseases, surgical diseases, obstetric and gynecological problems and parasitic diseases in cattle, sheep, horse, poultry, bee, and dog species. Based on the evaluation of the facts that the use of all kinds of synthetic drugs, especially antibiotics, is prohibited or restricted in organic livestock, it can be said that natural herbal drugs instead of artificial substances will provide positive contributions in the protection and treatment of herd health.

Ethnoveterinary Medicine: The prospects of integrating medicinal ...

African Journals Online (AJOL)

Medicinal plants products are part of the natural products that have been in use in traditional medicine and also a source of novel drugs. Therefore, the use of medicinal plant products would be a rational alternative to synthetic drugs. Ethnobotanical surveys carried out in many parts of Kenya have revealed a lot of plants ...

Ethnoveterinary survey of tradomedical importance of Bos taurus L ...

African Journals Online (AJOL)

ethnoveterinary uses of B. taurus by-products by traditional practitioners in Nigeria and South Africa. Conclusion: There ... Moreover, there are over 60 species of bacteria, about 100 species ..... bioremediation of pharmaceutical, pesticides and.

Traditional uses of medicinal plants used by Indigenous communities for veterinary practices at Bajaur Agency, Pakistan.

Science.gov (United States)

Aziz, Muhammad Abdul; Khan, Amir Hasan; Adnan, Muhammad; Ullah, Habib

2018-01-29

The pastoral lifestyle of Indigenous communities of Bajaur Agency is bringing them close to natural remedies for treating their domestic animals. Several studies have been conducted across the globe describing the importance of traditional knowledge in veterinary care. Therefore, this study was planned with the aim to record knowledge on ethnoveterinary practices from the remote areas and share sit with other communities through published literature. Data was gathered from community members through semi-structured interviews and analyzed through informant consensus factor (Fic) to evaluate the consent of current ethnoveterinary practices among the local people. In total, 73 medicinal plants were recorded under the ethnoveterinary practices. Most widely used medicinal plants with maximum use reports (URs) were Visnaga daucoides Gaertn., Foeniculum vulgare Mill., Solanum virginianum L., Withania somnifera (L.) Dunal, Glycyrrhiza glabra L., and Curcuma longa L. New medicinal values were found with confidential level of citations for species including Heracleum candicans and Glycerhiza glabra. Family Apiaceae was the utmost family with high number (7 species) of medicinal plants. Maximum number of medicinal plants (32) was used for gastric problems. High Fic was recorded for dermatological (0.97) followed by reproductive (0.93) and gastrointestinal disorders (0.92). The main route of remedies administration was oral. Current study revealed that the study area has sufficient knowledge on ethnoveterinary medicinal plants. This knowledge is in the custody of nomadic grazers, herders, and aged community members. Plants with new medicinal uses need to be validated phytochemically and pharmacologically for the development of new alternative drugs for veterinary purposes.

Ethnoveterinary Application of Morinda Citrifolia Fruit Puree on a ...

African Journals Online (AJOL)

Ethnoveterinary Application of Morinda Citrifolia Fruit Puree on a Commercial Heifer Rearing Facility with Endemic Salmonellosis. VJ Brooks, TJ De Wolfe, TJ Paulus, J Xu, J Cai, NS Keuler, RG Godbee, SF Peek, SM McGuirk, BJ Dariena ...

Traditional Arabic Palestinian ethnoveterinary practices in animal health care: A field survey in the West Bank (Palestine).

Science.gov (United States)

Ali-Shtayeh, Mohammed S; Jamous, Rana M; Jamous, Rania M

2016-04-22

In Palestine, medicinal plants have continued to play a vital role in fulfilling animal healthcare needs of rural communities. However, these valuable resources are being depleted mainly due to over-harvesting, inappropriate agricultural practices (e.g., over use of herbicides), agricultural expansion, and over-grazing. Therefore, immediate action is required to conserve these resources and document the associated knowledge. The purpose of this study was, thus, to document and analyze information associated with medicinal plants that are used in managing animal health problems in the West Bank, Palestine. Ethnobotanical data were collected from Apr 2012 to Feb 2014 mainly using semi-structured interviews with informants sampled using purposive sampling technique and through field observations. The study revealed the use of 138 medicinal plant species in the West Bank for the treatment of several livestock diseases, of these 75 species representing 70 genera and 33 families were reported by 3 independent informants or above. Classification of the ethnoveterinary plant species cited by three informants or above used in a rank-order priority (ROP) based on their claimed relative healing potential has demonstrated that the following are the plants with the highest efficacy: Camellia sinenses, Teucrium capitatum, and Salvia fruticosa with ROPs of 97.1, 93.2, and 91.4, respectively, are used primarily to relieve gastric disorders. Gastrointestinal disorders is the disease group in the study area that scored the highest Informant consensus factor (ICF) value (0.90), followed by urinary, and reproductive disorders (0.89). Our study provided evidence that medicinal plants are still playing important role in the management of livestock diseases, and showed that ethnoveterinary plants used in animal health care in Palestine have been also recorded in human Traditional Arabic Palestinian Herbal Medicine (TAPHM), and demonstrated a strong link between human and veterinary

In-vitro antimicrobial activity screening of some ethnoveterinary medicinal plants traditionally used against mastitis, wound and gastrointestinal tract complication in Tigray Region, Ethiopia.

Science.gov (United States)

Kalayou, Shewit; Haileselassie, Mekonnen; Gebre-Egziabher, Gebremedhin; Tiku'e, Tsegay; Sahle, Samson; Taddele, Habtamu; Ghezu, Mussie

2012-07-01

To screen the antibacterial activity of nine ethnoveterinary plants traditionally used for the treatment of mastitis, wound and gastrointestinal complications. Hydroalcoholic exctracts of medicinal plants namely, Achyranthes aspera (A. aspera) L. (Family Asparagaceae), Ficus caria (F. caria) (Family Moraceae), Malvi parviflora (M. parviflora) (Family Malvaceae), Vernonia species (V. species) (local name Alakit, Family Asteraceae), Solanum hastifolium (S. hastifolium) (Family Solanaceae), Calpurinia aurea (C. aurea) (Ait) Benth (Family Fabaceae), Nicotiana tabacum (N. tabacum) L. (Family Solanaceae), Ziziphus spina-christi (Z. spina-christi) (Family Rhamnaceae), Croton macrostachys (C. macrostachys) (Family Euphorbiaceae), were screened against clinical bacterial isolates of veterinary importance from October 2007 to April 2009. The antibacterial activity was tested using disc diffusion at two concentrations (200 mg/mL and 100 mg/mL) and broth dilution methods using 70% methanol macerated leaf extracts. With the exception of S. hastifolium all plant extracts exhibited antibacterial activity. Among the medicinal plants tested C. aurea, C. macrostachyus, A. aspera, N. tabacum and vernonia species (Alakit) showed the most promising antimicrobial properties. It can be concluded that many of the tested plants have antibacterial activity and supports the traditional usage of the plants for mastitis, wound and gastrointestinal complications treatment. Further studies into their toxicity and phytochemistry is advocated.

Ethnoveterinary treatments by dromedary camel herders in the Suleiman Mountainous Region in Pakistan: an observation and questionnaire study.

Science.gov (United States)

Raziq, Abdul; de Verdier, Kerstin; Younas, Muhammad

2010-06-21

The Suleiman mountainous region is an important cradle of animal domestication and the habitat of many indigenous livestock breeds. The dromedary camel is a highly appreciated and valued animal and represents an important genetic resource. Camel herders, living in remote areas, have developed their own ways to treat diseases in camels, based on a long time of experience. Information about the diseases and the ethnoveterinary practices performed was collected from a total of 90 herders and healers by interviews and participant observations. The respondents classified the diseased in major and minor fractions. Clinical signs were given in detail. Mange followed by trypanosomosis and orf were considered the most prevalent diseases, and also caused the greatest economic losses. Orf was regarded the most complex disease. The season was considered to have great influence on the occurrence of the diseases. A variety of different treatments were described, such as medicinal plants, cauterization, odorant/fly repellents, pesticides, larvicides, cold drink, yogurt and supportive therapy (hot food, hot drink). There is paramount need to document and validate the indigenous knowledge about animal agriculture in general and ethnoveterinary practices in particular. This knowledge is rapidly disappearing and represents a cultural heritage as well as a valuable resource for attaining food security and sovereignty.

Perception of ethno-veterinary practices in selected villages in Ogun ...

African Journals Online (AJOL)

The study was designed to examine perception of ethno-veterinary practices and information gathering among rural dwellers in selected villages in two local government areas (LGAs) of Ogun state, Nigeria. The aim was to assess the involvement of rural poultry farmers in the use of herbs as alternatives to antibiotics.

Uses of plants, animal and mineral substances in Mediterranean ethno-veterinary practices for the care of small ruminants.

Science.gov (United States)

Piluzza, G; Virdis, S; Serralutzu, F; Bullitta, S

2015-06-20

The cultural heritage of Sardinian shepherds is rapidly vanishing and survives in the memory of elderly people. The objective of our study was not only to report the usage of plants and their preparation for administration but also the use of other remedies of different origin arising from traditional ethno-veterinary knowledge, as Sardinian shepherds were used to employ plants, animals, minerals and combinations of several substances to prepare remedies for prophylaxis or therapy on their animals. The work was carried out in rural areas of the island of Sardinia (Italy) by interviewing shepherds and filling questionnaires in order to record ethno-veterinary practices traditionally used for animal health care. Ethno-veterinary remedies traditionally utilised for treatments of small ruminants against ecto-and endo-parasites, gastrointestinal diseases, viral and bacterial diseases, wounds, sprains and bruises were identified. Non herbal remedies outnumbered the herbal ones, as usually plant species were mainly used for the care of cattle and equines. A total of 150 ethno-veterinary uses were documented for the treatment of 33 animal conditions, a detailed account of the formulations and their administration to sheep and goats was provided. Herbal remedies involved the use of twenty two spontaneous species and seven cultivated species. This study identifies remedies used in ethno-veterinary practices for small ruminants care in Sardinia, the second major Mediterranean island which has agro-pastoral activities dating back to Neolithic. Moreover, the danger of losing oral traditions, and the increasing attention towards traditional remedies as potential sources of natural products for improving animal health and welfare, support the interest of our survey. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Medicinal plants used to control internal and external parasites in goats

Directory of Open Access Journals (Sweden)

Marcia Sanhokwe

2016-04-01

Full Text Available The use of medicinal plants plays a major role in the primary health care of animals in South Africa. A survey was conducted to document medicinal plants used to control parasites in goats in Kwezi and Ntambethemba villages in the Eastern Cape Province, South Africa. Information from 50 farmers and 3 herbalists was obtained through the use of a structured questionnaire, and a snowball sampling technique was used to identify key informants. The obtained data were analysed using PROC FREQ of SAS (2003, and fidelity level values were determined to estimate the healing potential of the mentioned plants. The survey revealed nine plant species belonging to eight families that were used to control parasites in goats. Asphodelaceae (22.22% was the most frequently used plant family. Leaves were the most used plant parts, constituting 60.38%. They were prepared either as infusions or decoctions of single plants or in mixtures. Aloe ferox, Acokanthera oppositifolia and Elephantorrhiza elephantina were the plants having the highest fidelity level for their use to control parasites, each scoring 100%, followed by Albuca setosa (83.33%. The study revealed low knowledge about ethnoveterinary medicine in the study area. It also revealed that information on ethno-veterinary medicine in this area is mostly confined to older people and there is danger that this knowledge can be lost before being passed on to other generations. Therefore, there is an urgent need to document information on these plant species so that the future generation can benefit. Further investigation should be carried out to validate the efficacy and safety of the above-mentioned plants so as to provide cheap alternative ways of controlling parasites. Keywords: ailments; ethno-veterinary practices; small ruminant; traditional medicine

Ethnoveterinary plants for the treatment of camels in Shiwalik regions of Kathua district of Jammu & Kashmir, India.

Science.gov (United States)

Sharma, R; Manhas, R K

2015-07-01

Camel is an important mode of transportation in the hot and hilly tracts of Shiwaliks of Kathua districts. The camel owners of the region lack the modern veterinary facilities and therefore depend heavily upon local treatments for the animal. This ethnoveterinary knowledge of plants is acquired by them from their forefathers and generally moves from one generation to another orally. The oral mode of transferring this valuable knowledge is vulnerable to erosion with the passage of time and generations. Ethnoveterinary information was collected by interviewing 38 camel keepers and traditional healers as per the questionnaire. The data collected was analysed quantitatively using three indices viz. use-value (UV), informant consensus factor (ICF), and fidelity level (Fl %). A total of 41 plants were found to be of ethnoveterinary importance in the present study. Herbs and trees (41.5% each) were the most used life forms. The most used plant part was fruit (27.9%). Rhizome, root and whole plant parts collectively contributed to 18.6%. Most of the ethnoveterinary practices (65.9%) used oral mode of medication. The values of UV and Fl (%) shows that the most important species for curing the ailing camels were Curcuma longa, Trachyspermum ammi, Brassica campestris, Tamarindus indica, Phyllanthus emblica, Cassia fistula, Eruca sativa, Plumbago zeylanica etc. The high values of ICF (0.91-0.99) show that the informants share the knowledge for the treatment of camels amongst themselves on regular basis. A good number of plants are utilised by the informants to cure camels. Most of the preparations used fruits and leaves. Only 18.6% of the practices required destructive collection and such species need sustainable use and conservation. Some of the species like Tamarindus indica, Cassia fistula, Eruca sativa, Albizia lebbeck and Citrus medica require further phytochemical and pharmacological studies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Use of traditional veterinary medicine in Nhema communal area of ...

African Journals Online (AJOL)

This study documents the use of ethno-veterinary medicine to treat livestock in Nhema communal area in the Midlands province of Zimbabwe. This study employed oral interviews and detailed discussions with 69 smallholder farmers and 3 traditional healers. The local people use 23 plant species belonging to 16 families ...

Canine gastritis.

Science.gov (United States)

Webb, Craig; Twedt, David C

2003-09-01

Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.

Mechanisms of cell death in canine parvovirus-infected cells provide intuitive insights to developing nanotools for medicine

Directory of Open Access Journals (Sweden)

Jonna Nykky

2010-06-01

Full Text Available Jonna Nykky, Jenni E Tuusa, Sanna Kirjavainen, Matti Vuento, Leona GilbertNanoscience Center and Department of Biological and Environmental Science, University of Jyväskylä, FinlandAbstract: Viruses have great potential as nanotools in medicine for gene transfer, targeted gene delivery, and oncolytic cancer virotherapy. Here we have studied cell death mechanisms of canine parvovirus (CPV to increase the knowledge on the CPV life cycle in order to facilitate the development of better parvovirus vectors. Morphological studies of CPV-infected Norden laboratory feline kidney (NLFK cells and canine fibroma cells (A72 displayed characteristic apoptotic events. Apoptosis was further confirmed by activation of caspases and cellular DNA damage. However, results from annexin V-propidium iodide (PI labeling and membrane polarization assays indicated disruption of the plasma membrane uncommon to apoptosis. These results provide evidence that secondary necrosis followed apoptosis. In addition, two human cancer cell lines were found to be infected by CPV. This necrotic event over apoptotic cell death and infection in human cells provide insightful information when developing CPV as a nanotool for cancer treatments.Keywords: canine parvovirus, apoptosis, necrosis, nanoparticle, virotherapy

Ethnoveterinary practices and Potential Herbal Materials for the Treatment of Ticks in North Gondar

Directory of Open Access Journals (Sweden)

Achenef Melaku

2013-04-01

Full Text Available Aim: Ticks are obligate blood feeding ectoparasites of vertebrates and induce huge production loss in livestock industry and creating serious public health problems in the world. This study was conducted to explore ethnoveterinary practices that are performed by livestock owners to control tick infestation in some districts of North Gondar, Ethiopia and to identify potential herbal materials used to control tick infestation in livestock. Materials and methods: Three districts of the zone were selected from each agroecological zones. The data were collected using semi-structured questionnaire and field observation. Sixty randomly selected livestock owners were used as the source of information. Results: Tick infestation is prevalent in all districts. Loss of body condition, disease transmission and damage on the skin were most commonly mentioned effects of tick infestation on the animals. The most commonly used tick control methods were use of acaricides and manual removal, however, use of herbs, washing with soap and cutting with sharp materials were also mentioned by respondents. Nine potential medicinal plants were identified that could be used to kill or repel ticks. Conclusion: Tick infestation is the problem in the districts. Livestock owners use different techniques to remove tick from the animals and their effectiveness has to be evaluated. [J Intercult Ethnopharmacol 2013; 2(2.000: 85-90

Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

Directory of Open Access Journals (Sweden)

Patil Sandeep S

2012-01-01

Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

Electroencephalography as a diagnostic technique for canine neurological diseases

Directory of Open Access Journals (Sweden)

Wrzosek Marcin

2016-06-01

Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.

Surgical innovations in canine gonadectomy

NARCIS (Netherlands)

Van Goethem, Bart

2016-01-01

In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated

Non-experimental validation of ethnoveterinary plants and indigenous knowledge used for backyard pigs and chickens in Trinidad and Tobago.

Science.gov (United States)

Lans, C; Georges, K; Brown, G

2007-06-01

This paper presents the findings of an exploratory study on ethnoveterinary medicines used for backyard pigs and backyard chickens in Trinidad and Tobago. Research data was collected from 1995 to September 2000. Six plants are used for backyard pigs. Crushed leaves of immortelle (Erythrina pallida, E. micropteryx) are used to remove dead piglets from the uterus. Leaf decoctions of bois canôt (Cecropia peltata) and bamboo (Bambusa vulgaris) are used for labour pains or leaves are fed as a postpartum cleanser. Boiled green papaya fruit (Carica papaya) is fed to pigs to induce milk let-down. The leaves and flowers of male papaya plants (Carica papaya) are fed to deworm pigs. Sour orange juice (Citrus aurantium) is given to pigs to produce lean meat, and coffee grounds are used for scours. Eyebright and plantain leaves (Plantago major) are used for eye injuries of backyard chickens. Worm grass (Chenopodium ambrosioides) and cotton bush (Gossypium species) are used as anthelmintics. Aloe gel (Aloe vera) is used for internal injuries and the yellow sap from the cut Aloe vera leaf or the juice of Citrus limonia is used to purge the birds. A literature review revealed few toxicity concerns and the potential usefulness of the plants.

European canine lymphoma network consensus recommendations for reporting flow cytometry in canine hematopoietic neoplasms.

Science.gov (United States)

Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W

2017-09-01

Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

Ethnoveterinary medicines used for ruminants in British Columbia, Canada

Science.gov (United States)

Lans, Cheryl; Turner, Nancy; Khan, Tonya; Brauer, Gerhard; Boepple, Willi

2007-01-01

Background The use of medicinal plants is an option for livestock farmers who are not allowed to use allopathic drugs under certified organic programs or cannot afford to use allopathic drugs for minor health problems of livestock. Methods In 2003 we conducted semi-structured interviews with 60 participants obtained using a purposive sample. Medicinal plants are used to treat a range of conditions. A draft manual prepared from the data was then evaluated by participants at a participatory workshop. Results There are 128 plants used for ruminant health and diets, representing several plant families. The following plants are used for abscesses: Berberis aquifolium/Mahonia aquifolium Echinacea purpurea, Symphytum officinale, Bovista pila, Bovista plumbea, Achillea millefolium and Usnea longissima. Curcuma longa L., Salix scouleriana and Salix lucida are used for caprine arthritis and caprine arthritis encephalitis.Euphrasia officinalis and Matricaria chamomilla are used for eye problems. Wounds and injuries are treated with Bovista spp., Usnea longissima, Calendula officinalis, Arnica sp., Malva sp., Prunella vulgaris, Echinacea purpurea, Berberis aquifolium/Mahonia aquifolium, Achillea millefolium, Capsella bursa-pastoris, Hypericum perforatum, Lavandula officinalis, Symphytum officinale and Curcuma longa. Syzygium aromaticum and Pseudotsuga menziesii are used for coccidiosis. The following plants are used for diarrhea and scours: Plantago major, Calendula officinalis, Urtica dioica, Symphytum officinale, Pinus ponderosa, Potentilla pacifica, Althaea officinalis, Anethum graveolens, Salix alba and Ulmus fulva. Mastitis is treated with Achillea millefolium, Arctium lappa, Salix alba, Teucrium scorodonia and Galium aparine. Anethum graveolens and Rubus sp., are given for increased milk production.Taraxacum officinale, Zea mays, and Symphytum officinale are used for udder edema. Ketosis is treated with Gaultheria shallon, Vaccinium sp., and Symphytum officinale. Hedera

Ethnoveterinary medicines used for ruminants in British Columbia, Canada

Directory of Open Access Journals (Sweden)

Brauer Gerhard

2007-02-01

Full Text Available Abstract Background The use of medicinal plants is an option for livestock farmers who are not allowed to use allopathic drugs under certified organic programs or cannot afford to use allopathic drugs for minor health problems of livestock. Methods In 2003 we conducted semi-structured interviews with 60 participants obtained using a purposive sample. Medicinal plants are used to treat a range of conditions. A draft manual prepared from the data was then evaluated by participants at a participatory workshop. Results There are 128 plants used for ruminant health and diets, representing several plant families. The following plants are used for abscesses: Berberis aquifolium/Mahonia aquifolium Echinacea purpurea, Symphytum officinale, Bovista pila, Bovista plumbea, Achillea millefolium and Usnea longissima. Curcuma longa L., Salix scouleriana and Salix lucida are used for caprine arthritis and caprine arthritis encephalitis.Euphrasia officinalis and Matricaria chamomilla are used for eye problems. Wounds and injuries are treated with Bovista spp., Usnea longissima, Calendula officinalis, Arnica sp., Malva sp., Prunella vulgaris, Echinacea purpurea, Berberis aquifolium/Mahonia aquifolium, Achillea millefolium, Capsella bursa-pastoris, Hypericum perforatum, Lavandula officinalis, Symphytum officinale and Curcuma longa. Syzygium aromaticum and Pseudotsuga menziesii are used for coccidiosis. The following plants are used for diarrhea and scours: Plantago major, Calendula officinalis, Urtica dioica, Symphytum officinale, Pinus ponderosa, Potentilla pacifica, Althaea officinalis, Anethum graveolens, Salix alba and Ulmus fulva. Mastitis is treated with Achillea millefolium, Arctium lappa, Salix alba, Teucrium scorodonia and Galium aparine. Anethum graveolens and Rubus sp., are given for increased milk production.Taraxacum officinale, Zea mays, and Symphytum officinale are used for udder edema. Ketosis is treated with Gaultheria shallon, Vaccinium sp., and

Immunohistochemical Characterization of Canine Lymphomas

Directory of Open Access Journals (Sweden)

Roxana CORA

2017-11-01

Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.

Expression of nociceptive ligands in canine osteosarcoma.

Science.gov (United States)

Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M

2015-01-01

Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.

Diospyros lycioides Desf.: Review of its botany, medicinal uses, pharmacological activities and phytochemistry

Directory of Open Access Journals (Sweden)

Alfred Maroyi

2018-01-01

Full Text Available Diospyros lycioides Desf. (D. lycioides is traditionally used as herbal medicine against various human and animal ailments in tropical Africa. The present paper reviewed information on botany, medicinal uses, phytochemistry and pharmacological activities of D. lycioides. This review was compiled using scientific literature from electronic search engine such as PubMed, Scopus, ScienceDirect, Springerlink, BioMed Central, Scielo, Medline and Science domain. Additional literatures were obtained from book chapters, books, dissertations, websites and other scientific publications. D. lycioides is used as traditional medicine in 50% of the countries where the species is native in tropical Africa. This study recorded 22 medicinal uses of D. lycioides which included abdominal pains, infertility in women, sexually transmitted infections, and used as chewing sticks (or mouthwash, toothbrushes and ethnoveterinary medicine. D. lycioides extracts demonstrated anti-adhesive, anti-inflammatory, antimetastatic, antioxidant, antifungal, antiproliferative, mutagenicity and antibacterial activities. Future research should focus on the pharmacological properties, phytochemistry, clinical trials and pharmacokinetics of D. lycioides which will enhance the therapeutic potential of the species.

Canine neosporosis: perspectives on pathogenesis and management

Directory of Open Access Journals (Sweden)

Silva RC

2016-04-01

Full Text Available Rodrigo C Silva,1 Gustavo P Machado2 1Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Starkville, MS, USA; 2Department of Internal Medicine and Surgery of Small Animals, Dr Munhoz Veterinary Hospital, Itápolis, Brazil Abstract: Canine neosporosis is a worldwide disease caused by the obligate intracellular parasite protozoan Neospora caninum, manifesting mainly neurological symptoms. N. caninum has a heteroxenous life cycle and affects a wide range of warm-blooded animals. The domestic and wild canids are the definitive host of the parasite. They shed oocysts after ingestion of tissue cysts from infected intermediate hosts (ovine, equine, bovine, canine, and many other species, containing bradyzoites, or oocyst-contaminated water and food. The presence of dogs in farms is considered a risk factor for production animals. A wide range of diagnostic methods are currently available, but the most used is serology, ie, indirect fluorescent antibody test specific to the antibody detection in blood serum samples. No vaccine is available, but control strategies should be focused on the vertical and horizontal transmission of the parasite, ie, avoid feeding dogs with raw or undercooked meat, and taking care with water for human and animal consumption. No medicines to control the transplacental transmission are available yet. Keywords: neosporosis, Neospora caninum, pathogenesis, management, dogs

Ethnoveterinary medicinal plants used by the Maale and Ari ethnic communities in southern Ethiopia

NARCIS (Netherlands)

Kidane, B.; Maesen, van der L.J.G.; Andel, van T.; Asfaw, Z.

2014-01-01

Ethnopharmacological relevance: Livestock production is an integral part of the agricultural system in Ethiopia. Medicinal plants are used and are important for rural communities for the treatment of livestock diseases. We studied and analysed the traditional medicinal plants used for the treatment

Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management

Directory of Open Access Journals (Sweden)

Loftus JP

2014-12-01

Full Text Available John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is associated with dermatological issues, diabetes mellitus, neoplasia, and urolithiasis. The health issues appear to be slightly different across the two species, which may be due to some inherent differences in the hormonal milieu involved in obesity that differs between the dog and the cat. In this review, we discuss the complicated nature of the pathogenesis of obesity, the hormonal stimulus for orexigenic and anorexigenic behavior, adipose tissue as an endocrine organ, and most importantly, clinical management of the number one disease in canine and feline medicine.Keywords: obesity, canine, feline, veterinary

Surgical innovations in canine gonadectomy

OpenAIRE

Van Goethem, Bart

2016-01-01

In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated negative consequences (lengthy placement, impaired wound healing around bulky knots, and the effect of unsightly knots on cosmetics). A study in 9 dogs found that celiotomy closure was easily achiev...

Ethnopharmacological Assessment of Medicinal Plants Used against Livestock Infections by the People Living around Indus River

Directory of Open Access Journals (Sweden)

Sakina Mussarat

2014-01-01

Full Text Available The present study was aimed to document detailed ethnopharmacological knowledge of medicinal plants against livestock infections of an unexplored remote region of Pakistan. Semistructured questionnaires were used for data collection. Total 43 plants belonging to 26 families were found to be used in ethnoveterinary practices. Seeds (29% were found to be the most frequent plant part used followed by leaves (22%. Ethnoveterinary recipes were mostly prepared in the form of decoction and powdering. Informant consensus factor (Fic results revealed high consensus for gastrointestinal (0.81, mastitis (0.82, and dermatological infections (0.80. Curcuma longa ranked first with highest fidelity level (FL value (66% followed by Trachyspermum ammi that ranked second (58%. Preference ranking (PR results showed that Zingiber officinale, Punica granatum, Triticum aestivum, Gossypium hirsutum, and Withania coagulans were the most preferred species for the treatment of diarrhea. Direct matrix ranking (DMR results showed that Morus alba, Melia azedarach, Withania coagulans, Cassia fistula, Azadirachta indica, and Tamarix aphylla were the multipurpose species of the region. We invite the attention of pharmacologists and chemists for further exploration of plants having high Fic, FL, and PR values in the present study. Conservation strategies should be adopted for the protection of multipurpose plant species.

Soft tissue artifact in canine kinematic gait analysis

NARCIS (Netherlands)

Schwencke, M.; Smolders, L.A.; Bergknut, N.; Gustas, P.; Meij, B.P.; Hazewinkel, H.A.W.

2012-01-01

Vet Surg. 2012 Oct;41(7):829-37. doi: 10.1111/j.1532-950X.2012.01021.x. Soft tissue artifact in canine kinematic gait analysis. Schwencke M, Smolders LA, Bergknut N, Gustås P, Meij BP, Hazewinkel HA. Source Department of Clinical Sciences of Companion Animals,, Faculty of Veterinary Medicine,

Comparison of 2 electrophoretic methods and a wet-chemistry method in the analysis of canine lipoproteins.

Science.gov (United States)

Behling-Kelly, Erica

2016-03-01

The evaluation of lipoprotein metabolism in small animal medicine is hindered by the lack of a gold standard method and paucity of validation data to support the use of automated chemistry methods available in the typical veterinary clinical pathology laboratory. The physical and chemical differences between canine and human lipoproteins draw into question whether the transference of some of these human methodologies for the study of canine lipoproteins is valid. Validation of methodology must go hand in hand with exploratory studies into the diagnostic or prognostic utility of measuring specific lipoproteins in veterinary medicine. The goal of this study was to compare one commercially available wet-chemistry method to manual and automated lipoprotein electrophoresis in the analysis of canine lipoproteins. Canine lipoproteins from 50 dogs were prospectively analyzed by 2 electrophoretic methods, one automated and one manual method, and one wet-chemistry method. Electrophoretic methods identified a higher proportion of low-density lipoproteins than the wet-chemistry method. Automated electrophoresis occasionally failed to identify very low-density lipoproteins. Wet-chemistry methods designed for evaluation of human lipoproteins are insensitive to canine low-density lipoproteins and may not be applicable to the study of canine lipoproteins. Automated electrophoretic methods will likely require significant modifications if they are to be used in the analysis of canine lipoproteins. Studies aimed at determining the impact of a disease state on lipoproteins should thoroughly investigate the selected methodology prior to the onset of the study. © 2016 American Society for Veterinary Clinical Pathology.

Canine scent detection of canine cancer: a feasibility study

Directory of Open Access Journals (Sweden)

Dorman DC

2017-10-01

Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of

Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations

Directory of Open Access Journals (Sweden)

Steiner JM

2014-10-01

Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test

One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

Science.gov (United States)

Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

2018-01-23

To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.

Science.gov (United States)

Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J

2014-03-01

Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.

Experimental tumor growth of canine osteosarcoma cell line on chick embryo chorioallantoic membrane (in vivo studies).

Science.gov (United States)

Walewska, Magdalena; Dolka, Izabella; Małek, Anna; Wojtalewicz, Anna; Wojtkowska, Agata; Żbikowski, Artur; Lechowski, Roman; Zabielska-Koczywąs, Katarzyna

2017-05-12

The chick embryo chorioallantoic membrane (CAM) model is extensively used in human medicine in preclinical oncological studies. The CAM model has several advantages: low cost, simple experimental approach, time saving and following "3R principles". Research has shown that the human osteosarcoma cell lines U2OS, MMNG-HOS, and SAOS can form tumors on the CAM. In veterinary medicine, this has been described only for feline fibrosarcomas, feline mammary carcinomas and canine osteosarcomas. However, in case of canine osteosarcomas, it has been shown that only non-adherent osteosarcoma stem cells isolated from KTOSA5 and CSKOS cell lines have the ability to form microtumors on the CAM after an incubation period of 5 days, in contrast to adherent KTOSA5 and CSKOS cells. In the presented study, we have proven that the commercial adherent canine osteosarcoma cell line (D-17) can form vascularized tumors on the CAM after the incubation period of 10 days.

Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.

Science.gov (United States)

Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D

2000-12-01

To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.

Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

Directory of Open Access Journals (Sweden)

Mostfa Shahabi

2017-09-01

Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.

The effects of baicalein on canine osteosarcoma cell proliferation and death.

Science.gov (United States)

Helmerick, E C; Loftus, J P; Wakshlag, J J

2014-12-01

Flavonoids are a group of modified triphenolic compounds from plants with medicinal properties. Baicalein, a specific flavone primarily isolated from plant roots (Scutellaria baicalensis), is commonly used in Eastern medicine for its anti-inflammatory and antineoplastic properties. Previous research shows greater efficacy for baicalein than most flavonoids; however, there has been little work examining their effects on sarcoma cells, let alone canine cells. Three canine osteosarcoma cell lines (HMPOS, D17 and OS 2.4) were treated with baicalein to examine cell viability, cell cycle kinetics, anchorage-independent growth and apoptosis. Results showed that osteosarcoma cells were sensitive to baicalein at concentrations from approximately 1 to 25 μM. Modest cell cycle changes were observed in one cell line. Baicalein was effective in inducing apoptosis and did not prevent doxorubicin cell proliferation inhibition in all the cell lines. The mechanism for induction of apoptosis has not been fully elucidated; however, changes in mitochondrial permeability supersede the apoptotic response. © 2012 Blackwell Publishing Ltd.

Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

NARCIS (Netherlands)

Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos

Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers

NARCIS (Netherlands)

Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.

2011-01-01

INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the

Ethnoveterinary herbal remedies used by farmers in four north-eastern Swiss cantons (St. Gallen, Thurgau, Appenzell Innerrhoden and Appenzell Ausserrhoden).

Science.gov (United States)

Disler, Monika; Ivemeyer, Silvia; Hamburger, Matthias; Vogl, Christian R; Tesic, Anja; Klarer, Franziska; Meier, Beat; Walkenhorst, Michael

2014-03-31

Very few ethnoveterinary surveys have been conducted in central Europe. However, traditional knowledge on the use of medicinal plants might be an option for future concepts in treatment of livestock diseases. Therefore the aim of this study was to document and analyse the traditional knowledge and use of homemade herbal remedies for livestock by farmers in four Swiss cantons. Research was conducted in 2012. Fifty farmers on 38 farms were interviewed with the aid of semistructured interviews. Detailed information about the plants used and their mode of preparation were documented as well as dosage, route of administration, category of use, origin of knowledge, frequency of use, and satisfaction with the treatment. In total, 490 homemade remedies were collected. Out of these, 315 homemade remedies contained only one plant species (homemade single species herbal remedies, HSHR), which are presented in this paper. Seventy six species from 44 botanical families were mentioned. The most HSHR were quoted for the families of Asteraceae, Polygonaceae and Urticaceae. The plant species with the highest number of HSHRs were Matricaria recutita L., Calendula officinalis L., Rumex obtusifolius L. and Urtica dioica L. For each HSHR, one to eight different applications were enumerated. A total of 428 applications were documented, the majority of which were used to treat cattle. The main applications were in treatment of skin afflictions and sores, followed by gastrointestinal disorders and metabolic dysfunctions. Topical administration was most frequently used, followed by oral administration. In nearly half of the cases the knowledge on preparing and using herbal remedies was from forefathers and relatives. More than one third of the applications were used more than ten times during the last five years, and in about sixty percent of the cases, the last application was during the last year preceding the interviews. Traditional knowledge of farmers about the use of medicinal plants

An update on the treatment of canine atopic dermatitis

Directory of Open Access Journals (Sweden)

Marsella R

2012-08-01

Full Text Available Rosanna MarsellaDepartment of Small Animal Clinical Sciences, College of Veterinary Medicine, University of Florida Gainesville, FL, USAAbstract: Remarkable progress has been made in recent years concerning our understanding of the pathogenesis of canine atopic dermatitis (AD. As our understanding improves, the therapeutic approach evolves. Of utmost importance is the documentation of skin barrier impairment in canine AD: ceramides deficiency leads to increased permeability and increased allergen penetration and sensitization. It is currently unknown whether this dysfunction is primary and genetically inherited or secondary to inflammation but it is accepted that skin barrier deficiency plays an important role in either starting or minimally exacerbating canine AD. Thus, the therapeutic approach has changed from focusing on the control of the inflammation to a combined approach that includes therapies aimed at skin barrier repair. The issue of skin barrier repair has been addressed both with oral administration of essential fatty acids and the topical application of products containing a combination of ceramides and fatty acids. These strategies are most helpful as adjunctive treatments and would be best used in young patients that have not developed chronic skin changes. Importantly, treatment for canine AD is multimodal and tailored to the individual patient, the age, and the duration of the disease. Client education plays an important role in explaining the importance of a long-term approach to minimize flare-ups and, in this context, topical therapy to correct skin barrier can be of great benefit. This is an area still in infancy and much work is needed to identify the best formulation. In human medicine, long-term use of moisturizers can have a profound effect on skin barrier and gene expression of proteins involved in skin barrier. This effect is variable depending on the formulation used. It is reasonable to speculate that the same may be

Nasolacrimal obstruction caused by root abscess of the upper canine in a cat.

Science.gov (United States)

Anthony, James M G; Sandmeyer, Lynne S; Laycock, Amanda R

2010-03-01

A 10-year-old, castrated male domestic short hair cat was presented to the Small Animal Clinic at the Western College of Veterinary Medicine with a presenting complaint of chronic, ocular discharge from the left eye. Ocular examination confirmed epiphora and mucopurulent discharge but there were no apparent reasons for the ocular discharge, and nasolacrimal obstruction was suspected. The cat had swelling of the left side of the face, severe periodontal disease and a fractured upper left canine tooth with pulpal exposure. Dacryocystorhinography revealed narrowing of the nasolacrimal duct above the root of the fractured upper left canine and dental radiographs showed a severe periapical lucency at the apex of the upper left canine tooth. The fractured canine tooth was removed. Subsequently, the ocular discharge and facial swelling resolved. After 2 years, the epiphora has never reoccurred. This is a noteworthy case because a suspected root abscess resulted in extralumenal compression of the nasolacrimal duct, which shows the importance of a thorough oral examination when nasolacrimal obstruction is evident.

Documentation of Ethnoveterinary Practices for Mastitis in Dairy Animals in Pakistan

Directory of Open Access Journals (Sweden)

S. M. Raihan Dilshad, N. U. Rehman*, Nazir Ahmad and A. Iqbal1

2010-07-01

Full Text Available This study was aimed to document the ethnoveterinary practices (EVPs used for the control and treatment of mastitis in cattle and buffaloes in the Sargodha district, Pakistan. The information was collected using rapid and participatory rural appraisal techniques through interviews and focused group discussions with 217 traditional veterinary healers (TVHs over a period of 16 months from September 2005 to December 2006. Thus, 25 different plant species belonging to 20 different families were documented from the study area for the treatment and prophylaxis of mastitis in bovines (cattle and bubalines (dairy buffalo, Bubalus bubalis. The most frequently reported (≥10 times plant species were Capsicum annuum L. (n = 32, Lepidium sativum L. (n =31, Allium sativum L. (n = 28, Sesamum indicum L. (n = 24, Citrus limon (L. Burm. f (n = 22, Zingiber officinale Roscoe (n = 18, Citrullus colocynthis (L. Schrad (n = 18, Curcuma longa L. (n = 16, Cuminum cyminum L. (n = 14, Rosa indica L. (n = 13, Centratherum anthelmisticum L. (n = 12, Triticum aestivum L (n = 11, Nigella sativa L. (n = 11 and Peganum harmala L. (n = 11. All the documented plant species were indigenous to the study area. Materials other than plants used for the treatment of this problem included ammonium chloride. The richness of EVPs in the study area and extensive variation in the doses, methods of preparation, indications, and claims regarding efficacy of plants for mastitis merit controlled studies for their validation.

Canine babesiosis: a perspective on clinical complications, biomarkers, and treatment

Directory of Open Access Journals (Sweden)

Köster LS

2015-04-01

Full Text Available Liza S Köster,1 Remo G Lobetti,2 Patrick Kelly1 1Department of Clinical Sciences, One Health Center for Zoonoses and Tropical Veterinary Medicine, Ross University School of Veterinary Medicine, St Kitts, West Indies; 2Bryanston Veterinary Hospital, Bryanston, South Africa Abstract: Canine babesiosis is a common tick transmitted disease of dogs worldwide. A number of Babesia sp. can infect dogs and the spectrum is increasing as molecular methods are developed to differentiate organisms. Clinical signs are generally attributed to hemolysis caused by the organisms in the erythrocytes but in some animals with some Babesia spp. there can be an immune mediated component to the anemia and/or a severe inflammatory reaction associated. This complicated form of canine babesiosis is associated with high morbidity and mortality. A variety of clinical markers has been investigated to enable clinicians to provide more accurate prognoses and adapt their treatments which vary according to the infecting species. In this review, we discuss the taxonomy, clinical signs, diagnostic imaging, clinical biomarkers, treatment, and prophylaxis of one of the most common and important diseases of dogs worldwide. Keywords: babesiosis, vector-borne disease, dog

Root Length and Anatomy of Impacted Maxillary Canines in Patients with Unilateral Maxillary Canine Impaction

OpenAIRE

Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch

2017-01-01

Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...

Prospective molecular profiling of canine cancers provides a clinically relevant comparative model for evaluating personalized medicine (PMed trials.

Directory of Open Access Journals (Sweden)

Melissa Paoloni

Full Text Available Molecularly-guided trials (i.e. PMed now seek to aid clinical decision-making by matching cancer targets with therapeutic options. Progress has been hampered by the lack of cancer models that account for individual-to-individual heterogeneity within and across cancer types. Naturally occurring cancers in pet animals are heterogeneous and thus provide an opportunity to answer questions about these PMed strategies and optimize translation to human patients. In order to realize this opportunity, it is now necessary to demonstrate the feasibility of conducting molecularly-guided analysis of tumors from dogs with naturally occurring cancer in a clinically relevant setting.A proof-of-concept study was conducted by the Comparative Oncology Trials Consortium (COTC to determine if tumor collection, prospective molecular profiling, and PMed report generation within 1 week was feasible in dogs. Thirty-one dogs with cancers of varying histologies were enrolled. Twenty-four of 31 samples (77% successfully met all predefined QA/QC criteria and were analyzed via Affymetrix gene expression profiling. A subsequent bioinformatics workflow transformed genomic data into a personalized drug report. Average turnaround from biopsy to report generation was 116 hours (4.8 days. Unsupervised clustering of canine tumor expression data clustered by cancer type, but supervised clustering of tumors based on the personalized drug report clustered by drug class rather than cancer type.Collection and turnaround of high quality canine tumor samples, centralized pathology, analyte generation, array hybridization, and bioinformatic analyses matching gene expression to therapeutic options is achievable in a practical clinical window (<1 week. Clustering data show robust signatures by cancer type but also showed patient-to-patient heterogeneity in drug predictions. This lends further support to the inclusion of a heterogeneous population of dogs with cancer into the preclinical

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

Science.gov (United States)

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

When Veterinarians Support Canine Therapy: Bidirectional Benefits for Clinics and Therapy Programs

Directory of Open Access Journals (Sweden)

John-Tyler Binfet

2018-01-01

Full Text Available This paper proposes a mutually beneficial model of collaboration between veterinarians and canine therapy programs. Veterinarians and the clinics for whom they work routinely establish collaborations with multiple and varied stakeholders. This might include a laboratory for processing samples and the corresponding courier company needed to deliver samples to the lab or a partnership with a local dog rescue organization for whom discounted rates are offered. One community partnership that stands to benefit both the clinic and the community agency, is for veterinarians to work in tandem with a local canine-assisted therapy program. The benefits to such an alliance are multifold and address aspects of veterinary medicine including client recruitment, community education, and access to a network of devoted dog enthusiasts.

Validation of commercially available automated canine-specific immunoturbidimetric method for measuring canine C-reactive protein

DEFF Research Database (Denmark)

Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold

2014-01-01

BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was

Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

International Nuclear Information System (INIS)

Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.

2011-01-01

Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology

Canine Mammary Cancer Stem Cells are Radio- and Chemo-Resistant and Exhibit an Epithelial-Mesenchymal Transition Phenotype

Energy Technology Data Exchange (ETDEWEB)

Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)

2011-03-30

Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.

Distinct fermentation and antibiotic sensitivity profiles exist in salmonellae of canine and human origin.

Science.gov (United States)

Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C

2018-02-26

Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.

Cathepsin K expression and activity in canine osteosarcoma.

Science.gov (United States)

Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M

2012-01-01

Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.

Expression and activity of the urokinase plasminogen activator system in canine primary brain tumors

Directory of Open Access Journals (Sweden)

Rossmeisl JH

2017-04-01

Full Text Available John H Rossmeisl,1–3 Kelli Hall-Manning,4 John L Robertson,1,3,5 Jamie N King,1,2 Rafael V Davalos,3,5 Waldemar Debinski,3 Subbiah Elankumaran6,† 1Veterinary and Comparative Neuro-Oncology Laboratory, 2Department of Small Animal Clinical Sciences, 3The Brain Tumor Center of Excellence, Wake Forest Baptist Medical Center Comprehensive Cancer Center, Winston-Salem, NC, 4Virginia Tech Animal Laboratory Services, Virginia-Maryland College of Veterinary Medicine, 5Department of Biomedical Engineering and Mechanics, Virginia Tech-Wake Forest University School of Biomedical Engineering and Sciences, Virginia Tech, 6Department of Biomedical Sciences and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Blacksburg, VA, USA†The authors regret to advise of the passing of Dr Subbiah Elankumaran prior to publicationBackground: The expression of the urokinase plasminogen activator receptor (uPAR, a glycosylphosphatidylinositol-anchored protein family member, and the activity of its ligand, urokinase-type plasminogen activator (uPA, have been associated with the invasive and metastatic potentials of a variety of human brain tumors through their regulation of extracellular matrix degradation. Domesticated dogs develop naturally occurring brain tumors that share many clinical, phenotypic, molecular, and genetic features with their human counterparts, which has prompted the use of the dogs with spontaneous brain tumors as models to expedite the translation of novel brain tumor therapeutics to humans. There is currently little known regarding the role of the uPA system in canine brain tumorigenesis. The objective of this study was to characterize the expression of uPAR and the activity of uPA in canine brain tumors as justification for the development of uPAR-targeted brain tumor therapeutics in dogs.Methods: We investigated the expression of uPAR in 37 primary canine brain tumors using immunohistochemistry, Western blotting, real

Comparative oncology: Integrating human and veterinary medicine ...

African Journals Online (AJOL)

Cancer constitutes the major health problem both in human and veterinary medicine. Comparative oncology as an integrative approach offers to learn more about naturally occurring cancers across different species. Canine models have many advantages as they experience spontaneous disease, have many genes similar ...

Three-year serologic immunity against canine parvovirus type 2 and canine adenovirus type 2 in dogs vaccinated with a canine combination vaccine.

Science.gov (United States)

Larson, L J; Schultz, R D

2007-01-01

A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.

Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

Directory of Open Access Journals (Sweden)

Anna McRee

2014-09-01

Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

Science.gov (United States)

McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

2014-09-05

Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

Evidence-based integrative medicine in clinical veterinary oncology.

Science.gov (United States)

Raditic, Donna M; Bartges, Joseph W

2014-09-01

Integrative medicine is the combined use of complementary and alternative medicine with conventional or traditional Western medicine systems. The demand for integrative veterinary medicine is growing, but evidence-based research on its efficacy is limited. In veterinary clinical oncology, such research could be translated to human medicine, because veterinary patients with spontaneous tumors are valuable translational models for human cancers. An overview of specific herbs, botanics, dietary supplements, and acupuncture evaluated in dogs, in vitro canine cells, and other relevant species both in vivo and in vitro is presented for their potential use as integrative therapies in veterinary clinical oncology. Published by Elsevier Inc.

Varied clinico-radiological presentations of transmigrated canines

Directory of Open Access Journals (Sweden)

Ishita Gupta

2015-01-01

Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.

Ethiopian Veterinary Journal - Vol 20, No 1 (2016)

African Journals Online (AJOL)

Survey of ethno-veterinary medicinal plants at selected districts of Harari Regional State, Eastern Ethiopia · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Akil Usmane, Tadesse Birhanu, Mohammed Redwan, Edao Sado, Dereje Abera, 1-22.

Development of the canine tooth in the beagle

International Nuclear Information System (INIS)

Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.

1993-01-01

The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla

Ontogeny of canine dimorphism in extant hominoids.

Science.gov (United States)

Schwartz, G T; Dean, C

2001-07-01

Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.

The immunotherapy of canine osteosarcoma: a historical and systematic review.

Science.gov (United States)

Wycislo, K L; Fan, T M

2015-01-01

Osteosarcoma is a malignant mesenchymal neoplasm that accounts for the majority of primary bone tumors in dogs and shares biological and clinical similarities with osteosarcoma in humans. Despite dose intensification with conventional cytotoxic therapies, survival times for dogs and humans diagnosed with high-grade osteosarcoma have not changed in the past 20 years, with the principal cause of mortality being the development of pulmonary metastases. Given the therapeutic plateau reached for delaying metastatic progression with cytotoxic agents, exploration of alterative adjuvant therapies for improving management of osteosarcoma micrometastases is clinically justified. Evidence suggests that osteosarcoma is an immunogenic tumor, and development of immunotherapies for the treatment of microscopic lung metastases might improve long-term outcomes. In this review, the history and foundational knowledge of immune interactions to canine osteosarcoma are highlighted. In parallel, immunotherapeutic strategies that have been explored for the treatment of canine osteosarcoma are summarized. With a greater understanding and awareness for how the immune system might be redirected toward combating osteosarcoma metastases, the rational development of diverse immune strategies for managing osteosarcoma holds substantial promise for transforming the therapeutic landscape and improving disease management in both dogs and human beings. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Three-year duration of immunity in dogs following vaccination against canine adenovirus type-1, canine parvovirus, and canine distemper virus.

Science.gov (United States)

Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

2005-01-01

A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.

Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki

2012-08-01

Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

Bilateral supernumerary primary maxillary canines

Directory of Open Access Journals (Sweden)

Santanu Mukhopadhyay

2018-01-01

Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.

9 CFR 113.306 - Canine Distemper Vaccine.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

Study of the Artroscopic Anatomy of the Knee in Canine Cadavers Using 2.4 Mm Diameter Lens

Directory of Open Access Journals (Sweden)

Gabriel Oswaldo Alonso Cuéllar

2013-05-01

Full Text Available Mainly by a limited access to new techniques and technologies, veterinary medicine in developing countries, has been far behind from the human medicine. One of the causes is the limited access to technology and specific techniques. Moreover, it is clear that many new technologies have proven their benefits in the two disciplines, making necessary and almost mandatory their massive implementation in humans and animals. The possibility to use human elements for veterinary techniques would improve the technology access and veterinarians training, at lower costs. The purpose of this study is to verify the feasibility to perform a knee arthroscopy in dogs with small human joints arthroscopic lenses. Under protocols established in veterinary 12 knee arthroscopies were performed in canine cadaver, using a wrist and ankle arthroscope human of 2.4 mm in diameter and 30° of angulation. All the structures reported in the literature were possible to visualize using a 2.4 mm arthroscope. In this sense, it is possible to develop training activities and subsequent implementation of endoscopic techniques in canine femorotibiopatellar joint, using a lens of small joints of human medicine.

Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

OpenAIRE

J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

2002-01-01

Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

Characterization of the canine urinary proteome.

Science.gov (United States)

Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E

2014-06-01

Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

The Association of Endothelin-1 Signaling with Bone Alkaline Phosphatase Expression and Protumorigenic Activities in Canine Osteosarcoma.

Science.gov (United States)

Neumann, Z L; Pondenis, H C; Masyr, A; Byrum, M L; Wycislo, K L; Fan, T M

2015-01-01

Canine osteosarcoma (OS) is an aggressive sarcoma characterized by pathologic skeletal resorption and pulmonary metastases. A number of negative prognostic factors, including bone alkaline phosphatase, have been identified in dogs with OS, but the underlying biologic factors responsible for such observations have not been thoroughly investigated. Endothelin-1-mediated signaling is active during bone repair, and is responsible for osteoblast migration, survival, proliferation, and bone alkaline phosphatase expression. The endothelin-1 signaling axis is active in canine OS cells, and this pathway is utilized by malignant osteoblasts for promoting cellular migration, survival, proliferation, and bone alkaline phosphatase activities. 45 dogs with appendicular OS. The expressions of endothelin-1 and endothelin A receptor were studied in OS cell lines and in samples from spontaneously occurring tumors. Activities mediated by endothelin-1 signaling were investigated by characterizing responses in 3 OS cell lines. In 45 dogs with OS, bone alkaline phosphatase concentrations were correlated with primary tumor osteoproductivity. Canine OS cells express endothelin-1 and endothelin A receptor, and this signaling axis mediates OS migration, survival, proliferation, and bone alkaline phosphatase activities. In OS-bearing dogs, circulating bone alkaline phosphatase activities were positively correlated with primary tumor relative bone mineral densities. Canine OS cells express endothelin-1 and functional endothelin A receptors, with the potential for a protumorigenic signaling loop. Increases in bone alkaline phosphatase activity are associated with osteoblastic OS lesions, and might be an epiphenomenon of active endothelin-1 signaling or excessive osteoproduction within the localized bone microenvironment. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

Science.gov (United States)

Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

2012-12-01

To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

2011-09-01

Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

Canine and feline obesity: a review of pathophysiology, epidemiology, and clinical management

OpenAIRE

Wakshlag, Joseph J; Loftus,John

2014-01-01

John P Loftus, Joseph J Wakshlag Cornell University College of Veterinary Medicine, Veterinary Medical Center, Ithaca, NY, USAAbstract: Canine and feline obesity rates have reached pandemic proportions and are similar to those in humans, with approximately 30%–40% of dogs and cats being overweight to obese. Obesity has been associated with other health problems, including osteoarthritis, renal disease, skin disease, insulin resistance, and neoplasia in dogs, while in cats obesity is...

Exercise-induced hyperthermia syndrome (canine stress syndrome in four related male English springer spaniels

Directory of Open Access Journals (Sweden)

Thrift E

2017-09-01

Full Text Available Elizabeth Thrift,1 Justin A Wimpole,2 Georgina Child,2 Narelle Brown,1 Barbara Gandolfi,3 Richard Malik4 1Animal Referral Hospital, 2Small Animal Specialist Hospital, Sydney, NSW, Australia; 3Veterinary Medicine and Surgery, College of Veterinary Medicine, University of Missouri, Columbia, MO, USA; 4Centre for Veterinary Education, University of Sydney, Sydney, NSW, Australia Objective: This retrospective study describes the signalment, clinical presentation, diagnostic findings, and mode of inheritance in four young male English springer spaniel dogs with presumptive canine stress syndrome.Materials and methods: Appropriate cases were located through medical searches of medical records of two large private referral centers. Inclusion criteria comprised of English springer spaniel dogs with tachypnea and hyperthermia that subsequently developed weakness or collapse, with or without signs of hemorrhage, soon after a period of mild-to-moderate exercise. The pedigrees of the four affected dogs, as well as eleven related English springer spaniels, were then analyzed to determine a presumptive mode of genetic inheritance.Results: Four dogs met the inclusion criteria. All four were male, suggesting the possibility of a recessive sex-linked heritable disorder. Pedigree analysis suggests that more dogs may be potentially affected, although these dogs may have never had the concurrent triggering drug/activity/event to precipitate the clinical syndrome. There was complete resolution of clinical signs in three of the four dogs with aggressive symptomatic and supportive therapy, with one dog dying during treatment.Conclusion: Dogs with canine stress syndrome have the potential for rapid recovery if treated aggressively and the complications of the disease (eg, coagulopathy are anticipated. All four dogs were male, suggesting the possibility of a recessive sex-linked mode of inheritance. Further genetic analyses should be strongly considered by those

In vitro evaluation of canine leukocytes radiolabeled in whole blood with 99mTc stannous colloid

International Nuclear Information System (INIS)

Abushhiwa, Mohamed H.; Salehi, Nouria S.; Whitton, Robert C.; Charles, Jennifer A.; Finnin, Peter J.; Lording, Peter M.; Caple, Ivan W.; Parry, Bruce W.

2008-01-01

Introduction: Technetium-99m stannous colloid ( 99m TcSnC)-labeled leukocytes are used to investigate a variety of inflammatory diseases in human medicine. The present study investigates the in vitro behavior of canine leukocytes labeled in whole blood with 99m TcSnC. Methods: Blood samples from 10 healthy dogs were labeled with 99m TcSnC using a standard procedure. The distribution of radioactivity among blood components (plasma, leukocyte layers and erythrocytes) was measured following separation of the radiolabeled samples across Histopaque density gradients. Phagocytic function of labeled and unlabeled leukocytes was estimated using zymosan particles. Labeling retention by leukocytes was determined at 1, 3, 4 and 7 h postlabeling. Results: The mean±standard error percentage of radioactivity associated with plasma, erythrocyte and leukocyte fractions was 2.0±0.21%, 55.5±0.60% and 42.5±0.54%, respectively (the last comprising 70.2±0.83% in polymorphonuclear leukocytes and 29.8±0.83% in mononuclear leukocytes). Labeled canine leukocytes had a phagocytic activity of 91.3±0.28% (control, 91.7±0.26%). The radiolabeled canine leukocytes retained 94.1±0.30% of radioactivity at 7 h postlabeling. Conclusions: Radiolabeling of canine leukocytes in whole blood with 99m TcSnC has minor adverse effect on their phagocytic function. The radiolabeled canine leukocytes retained a large percentage of radioactivity for at least 7 h postlabeling

Diagnosis, prevention, and management of canine hip dysplasia: a review

Directory of Open Access Journals (Sweden)

Schachner ER

2015-05-01

Full Text Available Emma R Schachner, Mandi J Lopez Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA, USA Abstract: Canine hip dysplasia (CHD is a polygenic and multifactorial developmental disorder characterized by coxofemoral (hip joint laxity, degeneration, and osteoarthritis (OA. Current diagnostic techniques are largely subjective measures of joint conformation performed at different stages of development. Recently, measures on three-dimensional images generated from computed tomography scans predicted the development of OA associated with CHD. Continued refinement of similar imaging methods may improve diagnostic imaging techniques to identify dogs predisposed to degenerative hip joint changes. By current consensus, joint changes consistent with CHD are influenced by genetic predisposition as well as environmental and biomechanical factors; however, despite decades of work, the relative contributions of each to the development and extent of CHD signs remain elusive. Similarly, despite considerable effort to decipher the genetic underpinnings of CHD for selective breeding programs, relevant genetic loci remain equivocal. As such, prevention of CHD within domestic canine populations is marginally successful. Conservative management is often employed to manage signs of CHD, with lifelong maintenance of body mass as one of the most promising methods. Surgical intervention is often employed to prevent joint changes or restore joint function, but there are no gold standards for either goal. To date, all CHD phenotypes are considered as a single entity in spite of recognized differences in expression and response to environmental conditions and treatment. Identification of distinct CHD phenotypes and targeting evidence-based conservative and invasive treatments for each may significantly advance prevention and management of a prevalent, debilitating condition in canine companions. Keywords: canine

New and emerging pathogens in canine infectious respiratory disease.

Science.gov (United States)

Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J

2014-03-01

Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.

Genetics of Human and Canine Dilated Cardiomyopathy.

Science.gov (United States)

Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S

2015-01-01

Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

Directory of Open Access Journals (Sweden)

J. Van Heerden

2002-07-01

Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies.

Science.gov (United States)

van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E

2002-03-01

Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

9 CFR 113.317 - Parvovirus Vaccine (Canine).

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...

Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

Science.gov (United States)

Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

2016-11-01

The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

Genetics of Human and Canine Dilated Cardiomyopathy

Directory of Open Access Journals (Sweden)

Siobhan Simpson

2015-01-01

Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.

Mite allergoids coupled to nonoxidized mannan from Saccharomyces cerevisae efficiently target canine dendritic cells for novel allergy immunotherapy in veterinary medicine.

Science.gov (United States)

Soria, Irene; Alvarez, Javier; Manzano, Ana I; López-Relaño, Juan; Cases, Bárbara; Mas-Fontao, Ana; Cañada, F Javier; Fernández-Caldas, Enrique; Casanovas, Miguel; Jiménez-Barbero, Jesús; Palomares, Oscar; Viñals-Flórez, Luis M; Subiza, José L

2017-08-01

We have recently reported that grass pollen allergoids conjugated with nonoxidized mannan of Saccharomyces cerevisae using glutaraldehyde results in a novel hypoallergenic mannan-allergen complex with improved properties for allergen vaccination. Using this approach, human dendritic cells show a better allergen uptake and cytokine profile production (higher IL-10/IL-4 ratio) for therapeutic purposes. Here we aim to address whether a similar approach can be extended to dogs using canine dendritic cells. Six healthy Spanish Greyhound dogs were used as blood donors to obtain canine dendritic cells (DC) derived from peripheral blood monocytes. Allergens from Dermatophagoides farinae mite were polymerized and conjugated with nonoxidized mannan. Nuclear magnetic resonance (NMR), gel electrophoresis (SDS-PAGE), immunoblotting and IgE-ELISA inhibition studies were conducted to evaluate the main characteristics of the allergoid obtained. Mannan-allergen conjugate and controls were assayed in vitro for canine DC uptake and production of IL-4 and IL-10. The results indicate that the conjugation of D. farinae allergens with nonoxidized mannan was feasible using glutaraldehyde. The resulting product was a polymerized structure showing a high molecular weight as detected by NMR and SDS-PAGE analysis. The mannan-allergen conjugate was hypoallergenic with a reduced reactivity with specific dog IgE. An increase in both allergen uptake and IL-10/IL-4 ratio was obtained when canine DCs were incubated with the mannan-allergen conjugate, as compared with the control allergen preparations (unmodified D. farinae allergens and oxidized mannan-allergen conjugate). We conclude that hypoallergenic D. farinae allergens coupled to nonoxidized mannan is a novel allergen preparation suitable for canine allergy immunotherapy targeting dendritic cells. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Kinetics of canine dental calculus crystallization: an in vitro study on the influence of inorganic components of canine saliva.

Science.gov (United States)

Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H

2014-07-01

This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

Frequency and Clinical Epidemiology of Canine Monocytic Ehrlichiosis in Dogs Infested with Ticks from Sinaloa, Mexico

Directory of Open Access Journals (Sweden)

Carolina Guadalupe Sosa-Gutierrez

2013-01-01

Full Text Available Ehrlichia canis is a rickettsial intracellular obligate bacterial pathogen and agent of canine monocytic ehrlichiosis. The prevalence of this disease in veterinary medicine can vary depending on the diagnostic method used and the geographic location. One hundred and fifty-two canine blood samples from six veterinary clinics and two shelters from Sinaloa State (Mexico were analyzed in this study. All animals were suspected of having Canine Monocytic Ehrlichiosis (CME. The diagnostic methods used were the ELISA (Snap4Dx, IDEXX together with blood smear and platelet count. From all dogs blood samples analyzed, 74.3% were positive to E. canis by ELISA and 40.1% were positive by blood smear. The sensitivity and specificity observed in the ELISA test were 78.8% and 86.7%. In addition, thrombocytopenia was presented in 87.6% of positive dogs. The predominant clinical manifestations observed were fever, anorexia, depression, lethargy, and petechiae. Consequently, this is the first report in which the morulae were visualized in the blood samples, and E. canis-specific antibodies were detected in dogs from Sinaloa, Northwest of Mexico.

Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.

Science.gov (United States)

Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S

2017-06-03

Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.

Reliability of mandibular canines as indicators for sexual dichotomy.

Science.gov (United States)

Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa

2013-02-01

Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.

Approaches to canine health surveillance.

Science.gov (United States)

O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C

2014-01-01

Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.

The Effect of Using a Modified Dentoalveolar Distractor on Canine Angulation following Rapid Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

Science.gov (United States)

Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y

2016-01-01

New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.

Platelets Inhibit Migration of Canine Osteosarcoma Cells.

Science.gov (United States)

Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C

2017-01-01

The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.

Parasitological detection and molecular evidence of Hepatozoon canis from canines in Manila, Philippines

OpenAIRE

Baticados, Waren; Baticados,Waren; Carlos,; Villarba,; Subiaga,; Carlos Sr.,Enrique; Baticados,Abigail

2011-01-01

Abigail M Baticados1, Waren N Baticados1, Enrique T Carlos2, Sixto MEAS Carlos2, Lorelie A Villarba1, Sherlyn G Subiaga1, Jomarte M Magcalas11Department of Veterinary Paraclinical Sciences, College of Veterinary Medicine, University of the Philippines Los Baños, Laguna, Philippines; 2Makati Dog and Cat Hospital (MDCH), Makati City, PhilippinesAbstract: Hepatozoon canis infection in canines is allegedly an underreported disease in the Philippines. In over the past four decades, ther...

9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

Science.gov (United States)

Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

2012-07-20

Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War

Science.gov (United States)

1981-06-05

anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges

Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

Science.gov (United States)

Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

2013-01-01

The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

Acute and sub-chronic toxicity studies of three plants used in Cameroonian ethnoveterinary medicine: Aloe vera (L.) Burm. f. (Xanthorrhoeaceae) leaves, Carica papaya L. (Caricaceae) seeds or leaves, and Mimosa pudica L. (Fabaceae) leaves in Kabir chicks.

Science.gov (United States)

Nghonjuyi, Ndaleh Wozerou; Tiambo, Christian Keambou; Taïwe, Germain Sotoing; Toukala, Jean Paul; Lisita, Frederico; Juliano, Raquel Soares; Kimbi, Helen Kuokuo

2016-02-03

Aloe vera (L.) Burm. f. (Xanthorrhoeaceae), Carica papaya L. (Caricaceae) and Mimosa pudica L. (Fabaceae) are widely used in the Cameroonian ethnoveterinary medicine as a panacea, and specifically for gastrointestinal disorders as well as an anthelmintic and antibacterial. The present study evaluated the potential toxicity of the hydroalcoholic extracts of Aloe vera leaves, Carica papaya leaves or seeds, and Mimosa pudica leaves after acute and sub-chronic administration in chicks. For the acute toxicity test a single administration of each of the four hydroalcoholic extracts was given orally at doses ranging from 40 to 5120 mg/kg (n=5/group/sex). In the sub-chronic study, these extracts were given orally as a single administration to chicks at doses of 80, 160, 320 and 640 mg/kg/day for 42 days. The anti-angiogenic properties of these extracts (5-320 µg/mg) were investigated in the chick chorioallantoic membrane in vivo. In the acute toxicity test, none of the four studied hydroalcoholic extracts induced mortality or significant behavioural changes. The sub-acute treatment with the four plant extracts did not alter either the body weight gain or the food and water consumption. However, the results indicated that Aloe vera leaf extract acute treatment by oral route at doses up to 2560 mg/kg did not produce death in 50% (5/10) of chicks during 24h or 14 days of observation, but 20% (2/10) chicks died. The haematological and biochemical analyses did not show significant differences in any of the parameters examined in female or male groups, with the exception of a transient rise in white blood cell counts at high doses (640 mg/kg). Additionally, these extracts did not have the potential for anti-angiogenic effects through the inhibition of neo-angiogenesis in the chick chorioallantoic membrane in vivo. The results showed that the therapeutic use of the hydroalcoholic extracts of Aloe vera leaves, Carica papaya leaves or seeds and Mimosa pudica leaves had very low

Canine Visceral Leishmaniasis in Wild Canines (Fox, Jackal, and Wolf in Northeastern Iran Using Parasitological, Serological, and Molecular Methods

Directory of Open Access Journals (Sweden)

Mehdi Mohebali

2016-10-01

Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.

Clinical and Statistical Study on Canine Impaction

Directory of Open Access Journals (Sweden)

Adina-Simona Coșarcă

2013-08-01

Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic

Podoplanin Expression in Canine Melanoma.

Science.gov (United States)

Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-12-01

A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.

Relationship between analytic values and canine obesity.

Science.gov (United States)

Peña, C; Suárez, L; Bautista, I; Montoya, J A; Juste, M C

2008-06-01

The objective of this study was to assess the relationship between canine body condition and metabolic parameters like serum lipids, blood glucose and alanine aminotransferase (ALT) concentrations. We selected 127 dogs (42 males and 85 females) that were taken to our veterinary medicine service during routine visits. The mean age was 6.67 +/- 5.24 years. Body condition (BC) was measured by Laflamme scale and dogs were considered as obese when BC score was over 6. The following variables were collected: total cholesterol, high-density lipoprotein cholesterol, triglycerides, basal glucose and ALT. 66.1% of the dog cohort were obese. Total cholesterol and triglycerides were found to be higher (p obese dogs with respect to normal weight dogs. In conclusion, obesity in dogs is associated with higher serum lipid levels.

Vaccines for canine leishmaniasis

Directory of Open Access Journals (Sweden)

Clarisa B. Palatnik-De-Sousa

2012-04-01

Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans

Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

Science.gov (United States)

Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

2014-12-01

A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

MicroRNAs as tumour suppressors in canine and human melanoma cells and as a prognostic factor in canine melanomas.

Science.gov (United States)

Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y

2013-06-01

Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.

Local knowledge held by farmers in Eastern Tyrol (Austria) about the use of plants to maintain and improve animal health and welfare.

Science.gov (United States)

Vogl, Christian R; Vogl-Lukasser, Brigitte; Walkenhorst, Michael

2016-09-12

The sustainable management of animal health and welfare is of increasing importance to consumers and a key topic in the organic farming movement. Few systematic studies have been undertaken investigating farmers' local knowledge related to this issue. Ethnoveterinary medicine (EVM) is a discipline focusing on local knowledge and folk methods in veterinary medicine, however most ethnoveterinarian studies primarily address the treatment of animal diseases. Very few studies have explored prophylactic methods. An ethnoveterinary research project in Eastern Tyrol (Austria) was conducted in 2004 and 2005 to gather information about local knowledge of animal husbandry from 144 informants, with the emphasis on plants that maintain livestock health and welfare. Informants mentioned a total of 87 plants and 22 plant-based generic terms in the context of maintaining and improving livestock health and welfare. The most important preventive measures for maintaining and improving animal health and welfare were practices related to "fodder" and "feeding". In this category the plants mentioned could be grouped according to three different perceptions about their effect on animals: "Good or bad fodder", "Functional fodder" and "Fodder medicine". In addition to fodder, environmental management, the human-animal relationship, household remedies and cultural/religious activities were also mentioned. When asked about practices in the past that maintained animal health and well-being, interviewees mentioned, for example, the importance of the diversity of sources that used to be available to obtain feed and fodder. The informants' approach that feeding is central to livestock welfare is in line with the standard scientific literature on animal health, including in organic farming. Various scientific studies into common fodder evaluate the nutritive and dietary value, efficiency and safety of fodder. Future studies also have to consider the evaluation of traditional, local fodder

Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells.

Science.gov (United States)

Rici, Rose Eli Grassi; Alcântara, Dayane; Fratini, Paula; Wenceslau, Cristiane Valverde; Ambrósio, Carlos Eduardo; Miglino, Maria Angelica; Maria, Durvanei Augusto

2012-02-22

The bone morphogenetic proteins (BMPs) belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs) and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST) cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs) and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP) stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p53. We propose that rhBMP-2 has great

Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review

Directory of Open Access Journals (Sweden)

Parviz Torkzaban

2016-09-01

Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.

9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

Science.gov (United States)

2010-01-01

... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

Effect of bevacizumab on angiogenesis and growth of canine osteosarcoma cells xenografted in athymic mice.

Science.gov (United States)

Scharf, Valery F; Farese, James P; Coomer, Alastair R; Milner, Rowan J; Taylor, David P; Salute, Marc E; Chang, Myron N; Neal, Dan; Siemann, Dietmar W

2013-05-01

Objective-To investigate the effects of bevacizumab, a human monoclonal antibody against vascular endothelial growth factor, on the angiogenesis and growth of canine osteosarcoma cells xenografted in mice. Animals-27 athymic nude mice. Procedures-To each mouse, highly metastasizing parent osteosarcoma cells of canine origin were injected into the left gastrocnemius muscle. Each mouse was then randomly allocated to 1 of 3 treatment groups: high-dose bevacizumab (4 mg/kg, IP), low-dose bevacizumab (2 mg/kg, IP), or control (no treatment). Tumor growth (the number of days required for the tumor to grow from 8 to 13 mm), vasculature, histomorphology, necrosis, and pulmonary metastasis were evaluated. Results-Mice in the high-dose bevacizumab group had significantly delayed tumor growth (mean ± SD, 13.4 ± 3.8 days; range, 9 to 21 days), compared with that for mice in the low-dose bevacizumab group (mean ± SD, 9.4 ± 1.5 days; range, 7 to 11 days) or control group (mean ± SD, 7. 2 ± 1.5 days; range, 4 to 9 days). Mice in the low-dose bevacizumab group also had significantly delayed tumor growth, compared with that for mice in the control group. Conclusions and Clinical Relevance-Results indicated that bevacizumab inhibited growth of canine osteosarcoma cells xenografted in mice, which suggested that vascular endothelial growth factor inhibitors may be clinically useful for the treatment of osteosarcoma in dogs. Impact for Human Medicine-Canine osteosarcoma is used as a research model for human osteosarcoma; therefore, bevacizumab may be clinically beneficial for the treatment of osteosarcoma in humans.

Orthodontic Traction of Impacted Canine Using Cantilever

Directory of Open Access Journals (Sweden)

Cláudia Nakandakari

2016-01-01

Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.

Transmigration of mandibular canine – case report

International Nuclear Information System (INIS)

Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia

2014-01-01

Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation

Canine Parvovirus: Current Perspective

OpenAIRE

Nandi, S.; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...

Evaluation of P16 expression in canine appendicular osteosarcoma.

Science.gov (United States)

Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K

2017-06-20

Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

Cone beam computed tomography findings of impacted upper canines

Energy Technology Data Exchange (ETDEWEB)

Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)

2014-12-15

To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

Cone beam computed tomography findings of impacted upper canines

International Nuclear Information System (INIS)

Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio

2014-01-01

To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.

The Effects of Orthodontic Forces during Canine Retraction Using Self-ligating Brackets on Gingival Crevicular Fluid Enzyme Activity, Canine Movement and Root Resorption

International Nuclear Information System (INIS)

Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin

2015-01-01

Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)

Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.

Science.gov (United States)

Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano

2004-10-01

This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.

Skeletal maturity assessment using mandibular canine calcification stages

Directory of Open Access Journals (Sweden)

Vildana Džemidžić

2016-11-01

Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.

A new method for rapid Canine retraction

Directory of Open Access Journals (Sweden)

"Khavari A

2001-06-01

Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.

Ethnoveterinary uses of medicinal plants among traditional herbal ...

African Journals Online (AJOL)

The people of far-flung rural areas still depend to a large extent upon plants and household remedies for curing veterinary ailments. ... The paper deals with 34 ailments commonly found in nine different categories of livestock/animals (i e. buffalo, cow, oxen, sheep, goat, horse, mule, dog and cat) and their treatment with 73 ...

Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup

OpenAIRE

Headley,Selwyn Arlington; Saito,Taís Berelli

2003-01-01

Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

The Effectiveness of a 3D Computerized Tutorial to Enhance Learning of the Canine Larynx and Hyoid Apparatus.

Science.gov (United States)

Nemanic, Sarah; Mills, Serena; Viehdorfer, Matt; Clark, Terri; Bailey, Mike

Teaching the anatomy of the canine larynx and hyoid apparatus is challenging because dissection disassembles and/or damages these structures, making it difficult to understand their three-dimensional (3D) anatomy and spatial interrelationships. This study assessed the effectiveness of an interactive, computerized 3D tutorial for teaching the anatomy of the canine larynx and hyoid apparatus using a randomized control design with students enrolled in the first-year professional program at Oregon State University College of Veterinary Medicine. All first-year students from 2 consecutive years were eligible. All students received the traditional methods of didactic teaching and dissection to learn the anatomy of the canine larynx and hyoid apparatus, after which they were divided into two statistically equal groups based on their cumulative anatomy test scores from the prior term. The tutorial group received an interactive, computerized tutorial developed by the investigators containing 3D images of the canine larynx and hyoid apparatus, while the control group received the same 3D images without the computerized tutorial. Both groups received the same post-learning assessment and survey. Sixty-three first-year students participated in the study, 28 in the tutorial group, and 35 in the control group. Post-learning assessment and survey scores were both significantly higher among students in the computerized tutorial group than those in the control group. This study demonstrates that a 3D computerized tutorial is more effective in teaching the anatomy of the canine hyoid apparatus and larynx than 3D images without a tutorial. Students likewise rated their learning experience higher when using the 3D computerized tutorial.

Novel canine circovirus strains from Thailand: Evidence for genetic recombination.

Science.gov (United States)

Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E

2018-05-14

Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.

Podoplanin Expression in Canine Melanoma

OpenAIRE

Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-01-01

A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...

Finite element analysis of rapid canine retraction through reducing resistance and distraction

Directory of Open Access Journals (Sweden)

Junjie XUE

2014-01-01

Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.

Functionalized carbon nanotubes as suitable scaffold materials for proliferation and differentiation of canine mesenchymal stem cells

Directory of Open Access Journals (Sweden)

Das K

2017-04-01

Full Text Available Kinsuk Das,1 AP Madhusoodan,1 Bhabesh Mili,1 Ajay Kumar,2 AC Saxena,3 Kuldeep Kumar,1 Mihir Sarkar,1 Praveen Singh,4 Sameer Srivastava,5 Sadhan Bag1 1Division of Physiology and Climatology, 2Biochemistry and Food Science Section, 3Division of Surgery, 4Biophysics, Electron Microscopy and Instrumentation Section, 5Division of Veterinary Biotechnology, Indian Council of Agricultural Research – Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh, India Abstract: In the field of regenerative medicine, numerous potential applications of mesenchymal stem cells (MSCs can be envisaged, due to their ability to differentiate into a range of tissues on the basis of the substrate on which they grow. With the advances in nanotechnology, carbon nanotubes (CNTs have been widely explored for use as cell culture substrate in tissue engineering applications. In this study, canine bone marrow-derived MSCs were considered as the cellular model for an in vitro study to elucidate the collective cellular processes, using three different varieties of thin films of functionalized carbon nanotubes (COOH-single-walled CNTs [SWCNTs], COOH-multiwalled CNTs [MWCNTs] and polyethylene glycol [PEG]-SWCNTs, which were spray dried onto preheated cover slips. Cells spread out better on the CNT films, resulting in higher cell surface area and occurrence of filopodia, with parallel orientation of stress fiber bundles. Canine MSCs proliferated at a slower rate on all types of CNT substrates compared to the control, but no decline in cell number was noticed during the study period. Expression of apoptosis-associated genes decreased on the CNT substrates as time progressed. On flow cytometry after AnnexinV-fluorescein isothiocyanate/propidium iodide (PI staining, total number of apoptotic and necrotic cells remained lower in COOH-functionalized films compared to PEG-functionalized ones. Collectively, these results indicate that COOH-MWCNT substrate provided an

Environmental tobacco smoke and canine urinary cotinine level

International Nuclear Information System (INIS)

Bertone-Johnson, Elizabeth R.; Procter-Gray, Elizabeth; Gollenberg, Audra L.; Ryan, Michele B.; Barber, Lisa G.

2008-01-01

Epidemiologic studies of companion animals such as dogs have been established as models for the relationship between exposure to environmental tobacco smoke (ETS) and cancer risk in humans. While results from these studies are provocative, pet owner report of a dog's ETS exposure has not yet been validated. We have evaluated the relationship between dog owner's report of household smoking by questionnaire and dog's urinary cotinine level. Between January and October 2005, dog owners presenting their pet for non-emergency veterinary care at the Foster Hospital for Small Animals at Cummings School of Veterinary Medicine, Tufts University, were asked to complete a 10-page questionnaire measuring exposure to household ETS in the previous 24 h and other factors. A free-catch urine sample was also collected from dogs. Urinary cotinine level was assayed for 63 dogs, including 30 whose owners reported household smoking and 33 unexposed dogs matched on age and month of enrollment. Urinary cotinine level was significantly higher in dogs exposed to household smoking in the 24 h before urine collection compared to unexposed dogs (14.6 ng/ml vs. 7.4 ng/ml; P=0.02). After adjustment for other factors, cotinine level increased linearly with number of cigarettes smoked by all household members (P=0.004). Other canine characteristics including age, body composition and nose length were also associated with cotinine level. Findings from our study suggest that household smoking levels as assessed by questionnaire are significantly associated with canine cotinine levels

Comparative trial of the canine parvovirus, canine distemper virus and canine adenovirus type 2 fractions of two commercially available modified live vaccines.

Science.gov (United States)

Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G

2006-11-25

The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.

Emerging perspectives on hereditary glomerulopathies in canines

Directory of Open Access Journals (Sweden)

Littman MP

2015-04-01

Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic

Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

Science.gov (United States)

Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

2004-01-01

The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

A rare case of canine anomaly - a possible algorithm for treating it.

Science.gov (United States)

Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore

2014-01-01

Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.

Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

Science.gov (United States)

Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

2017-06-01

Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

Surgical considerations and management of bilateral labially impacted canines

Directory of Open Access Journals (Sweden)

Yu-Shan Huang

2016-06-01

Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.

Mesenchymal stem cells with rhBMP-2 inhibits the growth of canine osteosarcoma cells

Directory of Open Access Journals (Sweden)

Grassi Rici Rose

2012-02-01

Full Text Available Abstract Background The bone morphogenetic proteins (BMPs belong to a unique group of proteins that includes the growth factor TGF-β. BMPs play important roles in cell differentiation, cell proliferation, and inhibition of cell growth. They also participate in the maturation of several cell types, depending on the microenvironment and interactions with other regulatory factors. Depending on their concentration gradient, the BMPs can attract various types of cells and act as chemotactic, mitogenic, or differentiation agents. BMPs can interfere with cell proliferation and the formation of cartilage and bone. In addition, BMPs can induce the differentiation of mesenchymal progenitor cells into various cell types, including chondroblasts and osteoblasts. The aim of this study was to analyze the effects of treatment with rhBMP-2 on the proliferation of canine mesenchymal stem cells (cMSCs and the tumor suppression properties of rhBMP-2 in canine osteocarcoma (OST cells. Osteosarcoma cell lines were isolated from biopsies and excisions of animals with osteosarcoma and were characterized by the Laboratory of Biochemistry and Biophysics, Butantan Institute. The mesenchymal stem cells were derived from the bone marrow of canine fetuses (cMSCs and belong to the University of São Paulo, College of Veterinary Medicine (FMVZ-USP stem cell bank. After expansion, the cells were cultured in a 12-well Transwell system; cells were treated with bone marrow mesenchymal stem cells associated with rhBMP2. Expression of the intracytoplasmic and nuclear markers such as Caspase-3, Bax, Bad, Bcl-2, Ki-67, p53, Oct3/4, Nanog, Stro-1 were performed by flow citometry. Results We evaluated the regenerative potential of in vitro treatment with rhBMP-2 and found that both osteogenic induction and tumor regression occur in stem cells from canine bone marrow. rhBMP-2 inhibits the proliferation capacity of OST cells by mechanisms of apoptosis and tumor suppression mediated by p

Stem Cell-Associated Marker Expression in Canine Hair Follicles.

Science.gov (United States)

Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J

2016-03-01

Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

Chlamydia in canine or feline coronary arteriosclerotic lesions

Directory of Open Access Journals (Sweden)

Grabarevic Zeljko

2011-09-01

Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

Chlamydia in canine or feline coronary arteriosclerotic lesions.

Science.gov (United States)

Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas

2011-09-09

There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.

Medicinal plants from the genus Acalypha (Euphorbiaceae)--a review of their ethnopharmacology and phytochemistry.

Science.gov (United States)

Seebaluck, R; Gurib-Fakim, A; Mahomoodally, F

2015-01-15

Acalypha is the fourth largest genus of the Euphorbiaceae family with approximately 450-570 species. Several Acalypha species are used as medicinal plants in Africa and in the Mascarene Islands. Almost every part of the plant including the leaves, stem and roots are used as traditional remedies to treat and manage a panoply of ailments. However, there is no updated compilation of traditionally important medicinal plants from the Acalypha genus. The present review therefore, endeavors to provide for the first time an updated compilation of documented ethnopharmacological information in relation to the ethnomedicinal, ethnoveterinary, zoopharmacognosy, phytochemistry and biological activities of medicinal plants from the Acalypha genus which can subsequently open new perspectives for further pharmacological research. A literature search was performed on Acalypha species using ethnobotanical text books and scientific databases such as Pubmed, Scopus, EBSCO, Google Scholar and other web sources such as records from PROTA, PROSEA, and Botanical Dermatology Database. The Plant List, International Plant Name index and Kew Botanical Garden Plant name databases were used to validate scientific names. Plants from Acalypha genus are traditionally used in the treatment and/or management of diverse ailments such as diabetes, jaundice, hypertension, fever, liver inflammation, schistosomiasis, dysentery, respiratory problems including bronchitis, asthma and pheumonia as well as skin conditions such as scabies, eczema and mycoses. Approximately 124 species were listed in ethnobotanical studies with some botanical description and others mentioned from different web sources. However, only 40 species have been included in the present review due to the unavailability of ethnopharmacological data on the remaining species. Among the 40 cited species, 30 were traditionally used for the treatment and/or management of approximately 70 human diseases or health conditions. Two species

A novel bocavirus in canine liver

Directory of Open Access Journals (Sweden)

Li Linlin

2013-02-01

Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.

A compendium of canine normal tissue gene expression.

Directory of Open Access Journals (Sweden)

Joseph Briggs

Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.

Interventional Closure of a Patent Ductus Arteriosus Using an Amplatz Canine Duct Occluder in an Alpaca Cria.

Science.gov (United States)

Chapel, E C; Lozier, J; Lakritz, J; Schober, K E

2017-07-01

A 6-month old female alpaca cria presented to The Ohio State University for evaluation of a cardiac murmur. Echocardiography revealed a left-to-right shunting patent ductus arteriosus, a restrictive left-to-right shunting perimembranous ventricular septal defect, and secondary moderate left atrial and ventricular dilation. Aortic root angiography demonstrated a type IIA patent ductus arteriosus (PDA). Interventional closure of the PDA was successfully performed, without complication, using an Amplatz canine duct occluder. This case report describes the materials and methods used for interventional closure of a PDA in an alpaca cria. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Genomic instability and telomere fusion of canine osteosarcoma cells.

Directory of Open Access Journals (Sweden)

Junko Maeda

Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.

Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.

Science.gov (United States)

Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H

2016-06-01

Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.

Canine index – A tool for sex determination

Directory of Open Access Journals (Sweden)

Shankar M. Bakkannavar

2015-12-01

Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.

Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.

Science.gov (United States)

Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara

2018-04-01

Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.

Rate of retraction of anterior teeth after canine distraction

Directory of Open Access Journals (Sweden)

Litesh Singla

2017-01-01

Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.

Canine tooth size and fitness in male mandrills (Mandrillus sphinx).

Science.gov (United States)

Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean

2008-07-01

Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.

Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature

Directory of Open Access Journals (Sweden)

Gaurav Sharma

2011-01-01

Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.

Asymmetry in development (mineralisation of permanent mandibular canine roots

Directory of Open Access Journals (Sweden)

Burić Mirjana V.

2012-01-01

Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.

Pro-tumorigenic effects of transforming growth factor beta 1 in canine osteosarcoma.

Science.gov (United States)

Portela, R F; Fadl-Alla, B A; Pondenis, H C; Byrum, M L; Garrett, L D; Wycislo, K L; Borst, L B; Fan, T M

2014-01-01

Transforming growth factor beta 1 (TGFβ1) is a pleiotropic cytokine that contributes to reparative skeletal remodeling by inducing osteoblast proliferation, migration, and angiogenesis. Organic bone matrix is the largest bodily reservoir for latent TGFβ1, and active osteoblasts express cognate receptors for TGFβ1 (TGFβRI and TGFβRII). During malignant osteolysis, TGFβ1 is liberated from eroded bone matrix and promotes local progression of osteotropic solid tumors by its mitogenic and prosurvival activities. Canine osteosarcoma (OS) cells will possess TGFβ1 signaling machinery. Blockade of TGFβ1 signaling will attenuate pro-tumorigenic activities in OS cells. Naturally occurring primary OS samples will express cognate TGFβ1 receptors; and in dogs with OS, focal malignant osteolysis will contribute to circulating TGFβ1 concentrations. Thirty-three dogs with appendicular OS. Expression of TGFβ1 and its cognate receptors, as well as the biologic effects of TGFβ1 blockade, was characterized in OS cells. Ten spontaneous OS samples were characterized for TGFβRI/II expressions by immunohistochemistry. In 33 dogs with OS, plasma TGFβ1 concentrations were quantified and correlated with bone resorption. Canine OS cells secrete TGFβ1, express cognate receptors, and TGFβ1 signaling blockade decreases proliferation, migration, and vascular endothelial growth factor secretion. Naturally occurring OS samples abundantly and uniformly express TGFβRI/II, and in OS-bearing dogs, circulating TGFβ1 concentrations correlate with urine N-telopeptide excretion. Canine OS cells possess TGFβ1 signaling machinery, potentially allowing for the establishment of an autocrine and paracrine pro-tumorigenic signaling loop. As such, TGFβ1 inhibitors might impede localized OS progression in dogs. Copyright © 2014 by the American College of Veterinary Internal Medicine.

Orthodontic management of buccally erupted ectopic canine with two case reports

Directory of Open Access Journals (Sweden)

Avesh Sachan

2012-01-01

Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.

Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel

International Nuclear Information System (INIS)

Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.

2005-01-01

Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old

Wild canids as sentinels of ecological health: a conservation medicine perspective.

Science.gov (United States)

Aguirre, A Alonso

2009-03-26

The extinction of species across the globe is accelerating, directly or indirectly due to human activities. Biological impoverishment, habitat fragmentation, climate change, increasing toxification, and the rapid global movement of people and other living organisms have worked synergistically to diminish ecosystem function. This has resulted in unprecedented levels of disease emergence, driven by human-induced environmental degradation, which poses a threat to the survival and health of biodiversity. The emerging discipline of conservation medicine addresses these concerns through the following entities: humans; global climate; habitat destruction and alteration; biodiversity, including wildlife populations; domestic animals; and pathogens, parasites and pollutants. Furthermore, conservation medicine focuses on explicit linkages between these entities. As a crisis discipline, the usefulness of conservation medicine ultimately will depend on its applicability to solving problems. The perspectives and scientific findings of conservation medicine provide input into biomedical education; and policy and management of ecosystems, habitats and imperiled species. A sentinel species is one that has presented itself, or has been selected, to provide insight into the state (health) of an ecosystem, based on user-defined (e.g., researchers, conservationists or policymakers) objectives (e.g., disease, parasites, toxics, climate change, habitat destruction), coupled with the utility and vulnerability of this species to the perceived stress. The scientific information generated by the sentinel species should empower stakeholders and decision-makers to take mitigative action or support predictive capabilities; the "utility" of the species selected should consider its value and relevance to conservationists and to society at large (e.g., education and outreach; social sciences). Wild canids may serve as excellent sentinel species of emerging canine vector-borne diseases. Several

Canine parvovirus: current perspective.

Science.gov (United States)

Nandi, S; Kumar, Manoj

2010-06-01

Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.

Consequences of crown shortening canine teeth in Greenland sled dogs

DEFF Research Database (Denmark)

Kortegaard, H E; Anthony Knudsen, T; Dahl, S

2015-01-01

OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...

Dental anomalies associated with buccally- and palatally-impacted maxillary canines.

Science.gov (United States)

Sajnani, Anand K; King, Nigel M

2014-08-01

The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.

SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

Science.gov (United States)

Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

2017-10-01

Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

Overexpression of vimentin in canine prostatic carcinoma

DEFF Research Database (Denmark)

Rodrigues, M M P; Rema, A; Gärtner, F

2011-01-01

Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....

Vaccines for Canine Leishmaniasis

Directory of Open Access Journals (Sweden)

Faeze Foroughi-Parvar

2014-01-01

Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.

Upper canine inclination influences the aesthetics of a smile.

Science.gov (United States)

Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S

2015-02-01

This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.

Treatment modalities of palatal impacted canines

OpenAIRE

Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona

2012-01-01

Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...

Health of periodontal tissues and resorption status after orthodontic treatment of impacted maxillary canines.

Science.gov (United States)

Oz, A Z; Ciger, S

2018-03-01

The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.

Comprehensive characterization of commercially available canine training aids.

Science.gov (United States)

Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A

2014-09-01

Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine

The relationship between the Southern Oscillation Index, rainfall and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia.

Science.gov (United States)

Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P

2015-07-01

The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

OpenAIRE

Povey, C.

1982-01-01

A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...

Evaluation of post-vaccination immunity to canine distemper and ...

African Journals Online (AJOL)

SERVER

2007-08-20

Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

Canine as a biomedical research model: immunological, hematological, and oncological aspects

International Nuclear Information System (INIS)

Shifrine, M.; Wilson, F.D.

1980-01-01

The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies

Molecular detection of canine parvovirus in flies (Diptera) at open and closed canine facilities in the eastern United States.

Science.gov (United States)

Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan

2014-06-01

More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year

Identification of quantitative trait loci (QTL for canine hip dysplasia and canine elbow dysplasia in Bernese mountain dogs.

Directory of Open Access Journals (Sweden)

Sophia Pfahler

Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.

Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).

Science.gov (United States)

Christiansen, Per

2008-07-01

The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.

Canine length in wild male baboons: maturation, aging and social dominance rank.

Directory of Open Access Journals (Sweden)

Jordi Galbany

Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.

Effects of body weight on antibody titers against canine parvovirus type 2, canine distemper virus, and canine adenovirus type 1 in vaccinated domestic adult dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki

2012-10-01

The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.

IQGAP1 is an oncogenic target in canine melanoma.

Directory of Open Access Journals (Sweden)

Becky H Lee

Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.

Activity, specificity, and titer of naturally occurring canine anti-DEA 7 antibodies.

Science.gov (United States)

Spada, Eva; Proverbio, Daniela; Baggiani, Luciana; Canzi, Ilaria; Perego, Roberta

2016-11-01

The reported prevalence of naturally occurring anti-dog erythrocyte antigen (DEA) 7 antibodies in DEA 7-negative dogs is as high as 50%. Characterization of these antibodies may better define their importance in canine transfusion medicine. We determined in vitro activity, specificity, and titer of anti-DEA 7 antibodies in DEA 7-negative dogs. Plasma samples from 317 DEA 7-negative dogs were cross-matched with DEA 7-positive red blood cells (RBCs) using gel column technology. Agglutination occurred with DEA 7-positive RBCs but not with DEA 7-negative RBCs in 73 samples (23%), which were hence classified as containing anti-DEA 7 antibodies. These samples were evaluated for hemolytic and agglutinating activity, strength of agglutination, and antibody specificity and titers. All samples showed agglutination but none showed hemolysis. Gel agglutination was graded as 1+ for 20 samples (27%), 2+ for 49 samples (67%), 3+ for 4 samples (6%); no samples were graded 4+. The agglutination titer was DEA 7 antibodies were found in 23% of DEA 7-negative dogs. The presence of naturally occurring anti-DEA 7 antibodies suggests that cross-matching of canine blood recipients is advisable, even at first transfusion, to minimize delayed transfusion reactions. © 2016 The Author(s).

Expression and function of survivin in canine osteosarcoma.

Science.gov (United States)

Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H

2012-01-01

Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.

American Canine Hepatozoonosis

Science.gov (United States)

Ewing, S. A.; Panciera, R. J.

2003-01-01

American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294

National clinical guidelines for management of the palatally ectopic maxillary canine.

Science.gov (United States)

Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M

2012-08-01

This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.

Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.

Science.gov (United States)

Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka

2016-07-01

Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.

Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.

Directory of Open Access Journals (Sweden)

Emily J Shields

Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.

Severe canine distemper outbreak in unvaccinated dogs in Mozambique

Directory of Open Access Journals (Sweden)

Julieta Zacarias

2016-07-01

Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

Management of an Unusual Ectopic Eruption of Maxillary Canine.

Science.gov (United States)

Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula

2017-05-01

Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.

Cardiac involvement in canine babesiosis : review article

Directory of Open Access Journals (Sweden)

R.G. Lobetti

2005-06-01

Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.

The Ondersteport Canine distemper virus strain and measles ...

African Journals Online (AJOL)

Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

Management of an impacted and transposed maxillary canine

Directory of Open Access Journals (Sweden)

Deepti A

2010-03-01

Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.

Aspects and clinical procedures of eruptive changes of permanent upper canines

Directory of Open Access Journals (Sweden)

Sheila Marcia Francisco

2012-04-01

Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.

A randomized clinical study of two interceptive approaches to palatally displaced canines.

Science.gov (United States)

Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela

2008-08-01

This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.

Binding of 125I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

International Nuclear Information System (INIS)

Meyers, K.M.; Boehme, M.; Inbar, O.

1982-01-01

Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed

Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.

Science.gov (United States)

Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul

2017-02-01

The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

Canine detection of free-ranging brown treesnakes on Guam

Science.gov (United States)

Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.

2011-01-01

We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.

Cryopreservation of microencapsulated canine sperm.

Science.gov (United States)

Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu

2011-03-01

The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.

Medicinal plants--prophylactic and therapeutic options for gastrointestinal and respiratory diseases in calves and piglets? A systematic review.

Science.gov (United States)

Ayrle, Hannah; Mevissen, Meike; Kaske, Martin; Nathues, Heiko; Gruetzner, Niels; Melzig, Matthias; Walkenhorst, Michael

2016-06-06

Gastrointestinal and respiratory diseases in calves and piglets lead to significant economic losses in livestock husbandry. A high morbidity has been reported for diarrhea (calves ≤ 35%; piglets ≤ 50%) and for respiratory diseases (calves ≤ 80%; piglets ≤ 40%). Despite a highly diverse etiology and pathophysiology of these diseases, treatment with antimicrobials is often the first-line therapy. Multi-antimicrobial resistance in pathogens results in international accordance to strengthen the research in novel treatment options. Medicinal plants bear a potential as alternative or additional treatment. Based on the versatile effects of their plant specific multi-component-compositions, medicinal plants can potentially act as 'multi-target drugs'. Regarding the plurality of medicinal plants, the aim of this systematic review was to identify potential medicinal plant species for prevention and treatment of gastrointestinal and respiratory diseases and for modulation of the immune system and inflammation in calves and piglets. Based on nine initial sources including standard textbooks and European ethnoveterinary studies, a total of 223 medicinal plant species related to the treatment of gastrointestinal and respiratory diseases was identified. A defined search strategy was established using the PRISMA statement to evaluate 30 medicinal plant species starting from 20'000 peer-reviewed articles published in the last 20 years (1994-2014). This strategy led to 418 references (257 in vitro, 84 in vivo and 77 clinical trials, thereof 48 clinical trials in veterinary medicine) to evaluate effects of medicinal plants and their efficacy in detail. The findings indicate that the most promising candidates for gastrointestinal diseases are Allium sativum L., Mentha x piperita L. and Salvia officinalis L.; for diseases of the respiratory tract Echinacea purpurea (L.) MOENCH, Thymus vulgaris L. and Althea officinalis L. were found most promising, and Echinacea purpurea (L

Three-year rabies duration of immunity in dogs following vaccination with a core combination vaccine against canine distemper virus, canine adenovirus type-1, canine parvovirus, and rabies virus.

Science.gov (United States)

Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

2006-01-01

Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.

Management of impacted all canines with surgical exposure and alignment by orthodontic treatment

Directory of Open Access Journals (Sweden)

Radha Katiyar

2013-01-01

Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.

Long-term effects of canine parvovirus infection in dogs.

Science.gov (United States)

Kilian, Elena; Suchodolski, Jan S; Hartmann, Katrin; Mueller, Ralf S; Wess, Gerhard; Unterer, Stefan

2018-01-01

Canine parvovirus (CPV) is the most important viral cause of acute canine enteritis leading to severe damage of the intestinal barrier. It has been speculated that dogs might develop chronic disorders after surviving CPV infection. However, no studies regarding the long-term implications of CPV infection have been published to date. The aim of this study was to evaluate whether dogs that have survived CPV infection will have an increased risk for developing chronic gastroenteritis, atopic dermatitis, or cardiac disease. Dogs that had been treated at the Clinic of Small Animal Medicine, LMU Munich, for CPV infection for which a follow-up of at least 12 months was available, were included in the study. Owners completed a questionnaire on the presence of chronic gastrointestinal and cutaneous signs, cardiac disease, and other potential disorders. An identical questionnaire was sent to owners of matched control dogs during the same time period. Seventy-one questionnaires of dogs with CPV infection and 67 of control dogs were analyzed. Significantly more CPV-infected dogs (30/71) compared to control dogs (8/67) had developed chronic gastrointestinal signs later in their lives (P < 0.001). No significant differences were observed regarding skin diseases (P = 1), cardiac problems (P = 0.160), or any other diseases (P = 0.173) later in life. Results of this study suggest that dogs that survive CPV infection have a significantly higher risk (odds ratio = 5.33) for developing a chronic gastrointestinal disease. Further prospective studies to identify the trigger for the development of chronic diarrhoea and possible targeted treatment strategies are needed.

FLT3 mutations in canine acute lymphocytic leukemia

International Nuclear Information System (INIS)

Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L

2011-01-01

FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

Vaccine-induced canine distemper in a lesser panda.

Science.gov (United States)

Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

1976-11-01

A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

International Nuclear Information System (INIS)

Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

1974-01-01

Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

Canine hip dysplasia: significance of early bony spurring

International Nuclear Information System (INIS)

Morgan, J.P.

1987-01-01

It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head

Radiographic assessment of dental anomalies in patients with ectopic maxillary canines

DEFF Research Database (Denmark)

Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul

2008-01-01

dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...

Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.

Directory of Open Access Journals (Sweden)

Da-Wei Yao

2014-06-01

Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.

The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D

Directory of Open Access Journals (Sweden)

MarkéŽta Vaňkov‡á

2016-01-01

Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.

Survey of ethno-veterinary medicinal plants in Melkabello District ...

African Journals Online (AJOL)

An ethno botanical survey was conducted from November 2014 to April 2015 in ... (27.9%) were the most commonly used habits of the plants by traditional healers. .... summarized using descriptive statistical methods such as frequency and.

Orthodontic-surgical treatment of bilateral maxillary canine impaction

Directory of Open Access Journals (Sweden)

Sumitra

2012-01-01

Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.

Prostate histotripsy for BPH: initial canine results

Science.gov (United States)

Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.

2009-02-01

Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.

Difficulties in estimating the human burden of canine rabies.

Science.gov (United States)

Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H

2017-01-01

Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Binding of /sup 125/I-labeled endotoxin to bovine, canine, and equine platelets and endotoxin-induced agglutination of canine platelets

Energy Technology Data Exchange (ETDEWEB)

Meyers, K.M.; Boehme, M.; Inbar, O.

1982-10-01

Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.

Headspace concentrations of explosive vapors in containers designed for canine testing and training: theory, experiment, and canine trials.

Science.gov (United States)

Lotspeich, Erica; Kitts, Kelley; Goodpaster, John

2012-07-10

It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

Science.gov (United States)

Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

2009-12-10

Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

Apoptotic response of irradiated T-Lymphocytes. An epidemiologic study in canine radiotherapy patients

International Nuclear Information System (INIS)

Stankeova, S.; Kaser-Hotz, B.; Crompton, N.E.A.; Blattmann, H.; Theiler, P.; Emery, G.C.; Roos, M.

2003-01-01

Background: Evaluation of radiation-induced apoptosis in T-lymphocytes was developed for human medicine in order to predict the sensitivity of individual patients to radiation therapy and has regular use in cases of suspected hypersensitivity. A major goal of the present study was to evaluate the usefulness of the apoptosis assay in veterinary medicine for application in radiation sensitivity testing. The main goal was to examine potential changes in sensitivity of T-lymphocytes to radiation-induced apoptosis during the course of radiation treatment. This is a clear example of the advantageous use of spontaneous canine tumors to augment human cancer research. Material and Methods: Blood was collected in heparin tubes, diluted 1:10 in RPMI medium, irradiated with X-rays and incubated for 48 h. T-lymphocytes were labeled using FITC-conjugated antibodies, erythrocytes were lysed, and DNA stained with propidium iodide. For cell analysis, a Becton Dickinson FACScan flow cytometer was used. Radiation-induced apoptosis in T-lymphocytes was quantified. Blood samples from tumor-bearing dogs were taken before the first fraction and at the end of radiation therapy. Results: Apoptosis in lymphocytes is dependent on donor age and donor weight. Tumor-bearing dogs when compared with healthy dogs showed no significant differences in levels of induced apoptosis. No significant changes were seen in the levels of radiation-induced apoptosis in blood taken before, during, or after radiation therapy. Conclusion: The leukocyte apoptosis assay can be successfully applied to canine patients, and a wide spectrum of sensitivities to radiation-induced apoptosis is observed. The sensitivity of a patient's peripheral blood T-lymphocytes to radiation-induced apoptosis does not change as a result of the trauma of radiotherapy during the course of tumor treatment. (orig.)

Topographical variation of the elastic properties of articular cartilage in the canine knee.

Science.gov (United States)

Jurvelin, J S; Arokoski, J P; Hunziker, E B; Helminen, H J

2000-06-01

Equilibrium response of articular cartilage to indentation loading is controlled by the thickness (h) and elastic properties (shear modulus, mu, and Poisson's ratio, nu) of the tissue. In this study, we characterized topographical variation of Poisson's ratio of the articular cartilage in the canine knee joint (N=6). Poisson's ratio was measured using a microscopic technique. In this technique, the shape change of the cartilage disk was visualized while the cartilage was immersed in physiological solution and compressed in unconfined geometry. After a constant 5% axial strain, the lateral strain was measured during stress relaxation. At equilibrium, the lateral-to-axial strain ratio indicates the Poisson's ratio of the tissue. Indentation (equilibrium) data from our prior study (Arokoski et al., 1994. International Journal of Sports Medicine 15, 254-260) was re-analyzed using the Poisson's ratio results at the test site to derive values for shear and aggregate moduli. The lowest Poisson's ratio (0.070+/-0.016) located at the patellar surface of femur (FPI) and the highest (0.236+/-0.026) at the medial tibial plateau (TMI). The stiffest cartilage was found at the patellar groove of femur (micro=0.964+/-0.189MPa, H(a)=2.084+/-0. 409MPa) and the softest at the tibial plateaus (micro=0.385+/-0. 062MPa, H(a)=1.113+/-0.141MPa). Comparison of the mechanical results and the biochemical composition of the tissue (Jurvelin et al., 1988. Engineering in Medicine 17, 157-162) at the matched sites of the canine knee joint indicated a negative correlation between the Poisson's ratio and collagen-to-PG content ratio. This is in harmony with our previous findings which suggested that, in unconfined compression, the degree of lateral expansion in different tissue zones is related to collagen-to-PG ratio of the zone.

Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).

Science.gov (United States)

Glickman, L T; Appel, M J

1981-08-01

Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.

Current practices and research updates on diabetes mellitus in canine

Directory of Open Access Journals (Sweden)

Pankaj Kumar

2014-11-01

Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.

Eruption of the maxillary canines in relation to skeletal maturity.

Science.gov (United States)

Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica

2008-05-01

Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.

Citizen science: a new direction in canine behavior research.

Science.gov (United States)

Hecht, Julie; Spicer Rice, Eleanor

2015-01-01

Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.

Antiviral effect of lithium chloride on infection of cells by canine parvovirus.

Science.gov (United States)

Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun

2015-11-01

Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.

Canine angiostrongylosis: recent advances in diagnosis, prevention, and treatment

Directory of Open Access Journals (Sweden)

Di Cesare A

2014-12-01

Full Text Available Angela Di Cesare, Donato Traversa Faculty of Veterinary Medicine, University of Teramo, Teramo, Italy Abstract: Angiostrongylus vasorum is a parasitic nematode affecting the heart and pulmonary arteries of wild (eg, foxes and domestic canids. The parasite has an indirect life cycle in which slugs and snails act as intermediate hosts. In the last few years the parasite has spread outside the traditional endemic foci, and there is a rise of documented cases of canine angiostrongylosis across Europe. Angiostrongylus vasorum causes cardiopulmonary disorders and coagulopathies, along with different nonspecific clinical signs. Fatal infections are frequently reported. Given the severity of the infection and the recent geographic spreading of the parasite, this article reviews and discusses the current knowledge of A. vasorum, with a special focus on recent insights on diagnosis, prevention, and treatment of dog angiostrongylosis. Keywords: Angiostrongylus vasorum, dog, epidemiology, diagnostic approaches, control, therapy

Age estimation by canines' pulp/tooth ratio in an Iranian population using digital panoramic radiography.

Science.gov (United States)

Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe

2018-04-01

Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.

Ultrasonographic evaluation of the canine shoulder.

Science.gov (United States)

Long, C D; Nyland, T G

1999-01-01

The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.

The Comparative Diagnostic Features of Canine and Human Lymphoma

Directory of Open Access Journals (Sweden)

Davis M. Seelig

2016-06-01

Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

The Comparative Diagnostic Features of Canine and Human Lymphoma.

Science.gov (United States)

Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A

2016-06-01

The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.

Establishment of sexual dimorphism in north indian population by odontometric study of permanent maxillary canine teeth

Directory of Open Access Journals (Sweden)

Shalini Gupta

2014-01-01

Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.

[Nonsurgical endodontic treatment of an invaginated canine].

Science.gov (United States)

Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P

1989-01-01

We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.

Canine babesiosis: from molecular taxonomy to control

Directory of Open Access Journals (Sweden)

Irwin Peter J

2009-03-01

Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.

Genetic characterization of canine influenza A virus (H3N2) in Thailand.

Science.gov (United States)

Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn

2014-02-01

In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.

Canine Intracranial Meningioma: Case report

Directory of Open Access Journals (Sweden)

José Ricardo Gomes de Carvalho

2016-11-01

Full Text Available ABSTRACT. Carvalho J.R.G., Vasconcellos C.H.C., Bastos I. P.B., Trajano F.L.C., Costa T.S. & Fernandes J.I [Canine Intracranial Meningioma: Case report.] Meningioma intracraniano canino: Relato de caso. Revista Brasileira de Medicina Veterinária, 38(supl. 3:1- 7, 2016. Programa de Pós-Graduação em Ciências Veterinária, Universidade Federal Rural do Rio de Janeiro, BR 465 Km 7, Seropédica, RJ 23.897-000, Brasil, E-mail: vetjulio@yahoo.com.br Intracranial neoplasms usually show their signals in a moderate way, revealing a long background of nonspecific signs, making the diagnosis more difficult. The meningioma is the most common intracranial neoplasm in dogs and cats. Along the years, the Veterinary Medicine has experienced important technological improvements, making it possible the diagnosis of a lot of diseases. Therefore, diseases considered not common in the past, started being diagnosed more frequently, for instance, brain lesions. The objective of this research is to report a case of intracranial meningioma in a Boxer dog that arrived at the Veterinary Hospital of the Federal Rural University of Rio de Janeiro, highlighting its clinical improvement, diagnosis and treatment.

Glucosamine and chondroitin use in canines for osteoarthritis: A ...

African Journals Online (AJOL)

Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...

A case of unusual root morphology: Maxillary canine with two roots

Directory of Open Access Journals (Sweden)

Nagesh Bolla

2009-01-01

Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.

Purification and partial characterization of canine S100A12.

Science.gov (United States)

Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M

2010-12-01

Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the

Impacted maxillary canines and root resorption of adjacent teeth: A retrospective observational study.

Science.gov (United States)

Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E

2016-11-01

The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of

Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.

Science.gov (United States)

von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H

2008-05-01

Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.

Orthodontic Traction of Impacted Canine Using Cantilever

OpenAIRE

Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé

2016-01-01

The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...

Comparison of the dental anomalies found in maxillary canine-first premolar transposition cases with those in palatally displaced canine cases.

Science.gov (United States)

Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon

2016-02-01

To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Detection of canine pneumovirus in dogs with canine infectious respiratory disease.

Science.gov (United States)

Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe

2013-12-01

Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.

Vertical periodontal ligament distraction--a new method for aligning ankylosed and displaced canines.

Science.gov (United States)

Wilmes, Benedict; Drescher, Dieter

2009-05-01

In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.

CSF-1R as an inhibitor of apoptosis and promoter of proliferation, migration and invasion of canine mammary cancer cells

Science.gov (United States)

2013-01-01

Background Tumor-associated macrophages (TAMs) have high impact on the cancer development because they can facilitate matrix invasion, angiogenesis, and tumor cell motility. It gives cancer cells the capacity to invade normal tissues and metastasize. The signaling of colony-stimulating factor-1 receptor (CSF-1R) which is an important regulator of proliferation and differentiation of monocytes and macrophages regulates most of the tissue macrophages. However, CSF-1R is expressed also in breast epithelial tissue during some physiological stages i.g.: pregnancy and lactation. Its expression has been also detected in various cancers. Our previous study has showed the expression of CSF-1R in all examined canine mammary tumors. Moreover, it strongly correlated with grade of malignancy and ability to metastasis. This study was therefore designed to characterize the role of CSF-1R in canine mammary cancer cells proliferation, apoptosis, migration, and invasion. As far as we know, the study presented hereby is a pioneering experiment in this field of veterinary medicine. Results We showed that csf-1r silencing significantly increased apoptosis (Annexin V test), decreased proliferation (measured as Ki67 expression) and decreased migration (“wound healing” assay) of canine mammary cancer cells. Treatment of these cells with CSF-1 caused opposite effect. Moreover, csf-1r knock-down changed growth characteristics of highly invasive cell lines on Matrigel matrix, and significantly decreased the ability of these cells to invade matrix. CSF-1 treatment increased invasion of cancer cells. Conclusion The evidence of the expression and functional role of the CSF-1R in canine mammary cancer cells indicate that CSF-1R targeting may be a good therapeutic approach. PMID:23561040

Genetics of Human and Canine Dilated Cardiomyopathy

OpenAIRE

Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland

2015-01-01

Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...

Orthodontic treatment of a complete transposed impacted maxillary canine

Directory of Open Access Journals (Sweden)

Pi-Huei Liu

2015-03-01

Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.

Tooth fractures in canine clinical practice

International Nuclear Information System (INIS)

Capik, I.; Ledecky, V.; Sevcik, A.

2001-01-01

Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients

Canine faecal contamination and parasitic risk in the city of Naples (southern Italy

Directory of Open Access Journals (Sweden)

Veneziano Vincenzo

2006-09-01

Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between

Current state of knowledge: the canine gastrointestinal microbiome.

Science.gov (United States)

Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S

2012-06-01

Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.

Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde.

Science.gov (United States)

Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis

2014-04-23

Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease.

Science.gov (United States)

Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio

2016-08-30

A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study

Directory of Open Access Journals (Sweden)

Zeeshan Iqbal Bhat

2013-01-01

Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.

Validation of anti-FXR1 antibodies in the canine species and application to an immunohistochemical study of canine oral melanomas

Directory of Open Access Journals (Sweden)

Laura Nordio

2017-05-01

Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.

Models of experimental saccular aneurysms of carotid arteries in canine

International Nuclear Information System (INIS)

Zhang Haixia; Cheng Yingsheng; Li Minghua

2006-01-01

Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)

Testosterone biotransformation by the isolated perfused canine pancreas

International Nuclear Information System (INIS)

Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.

1991-01-01

There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis

Testosterone biotransformation by the isolated perfused canine pancreas

Energy Technology Data Exchange (ETDEWEB)

Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))

1991-01-01

There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.

Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.

Science.gov (United States)

Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H

2006-02-01

The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.

Orthodontic-surgical treatment of bilateral maxillary canine impaction

OpenAIRE

Sumitra

2012-01-01

A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...

Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

Science.gov (United States)

Povey, C.

1982-01-01

A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811

MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

Science.gov (United States)

Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M

2018-01-01

Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.

Directory of Open Access Journals (Sweden)

Cecilia M Lopez

Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.

Homologous radioimmunoassay for canine prolactin and its application in various physiological states

International Nuclear Information System (INIS)

Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.

1977-01-01

The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)

Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus

Directory of Open Access Journals (Sweden)

Lourdes M. B. Pessoa

2016-01-01

Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)

OpenAIRE

Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de

2016-01-01

The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.

PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.

Science.gov (United States)

Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari

2016-10-01

Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.

Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

Science.gov (United States)

Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

2016-07-15

Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

Prospective molecular profiling of canine cancers provides a clinically relevant comparative model for evaluating personalized medicine (PMed) trials.

Science.gov (United States)

Paoloni, Melissa; Webb, Craig; Mazcko, Christina; Cherba, David; Hendricks, William; Lana, Susan; Ehrhart, E J; Charles, Brad; Fehling, Heather; Kumar, Leena; Vail, David; Henson, Michael; Childress, Michael; Kitchell, Barbara; Kingsley, Christopher; Kim, Seungchan; Neff, Mark; Davis, Barbara; Khanna, Chand; Trent, Jeffrey

2014-01-01

Molecularly-guided trials (i.e. PMed) now seek to aid clinical decision-making by matching cancer targets with therapeutic options. Progress has been hampered by the lack of cancer models that account for individual-to-individual heterogeneity within and across cancer types. Naturally occurring cancers in pet animals are heterogeneous and thus provide an opportunity to answer questions about these PMed strategies and optimize translation to human patients. In order to realize this opportunity, it is now necessary to demonstrate the feasibility of conducting molecularly-guided analysis of tumors from dogs with naturally occurring cancer in a clinically relevant setting. A proof-of-concept study was conducted by the Comparative Oncology Trials Consortium (COTC) to determine if tumor collection, prospective molecular profiling, and PMed report generation within 1 week was feasible in dogs. Thirty-one dogs with cancers of varying histologies were enrolled. Twenty-four of 31 samples (77%) successfully met all predefined QA/QC criteria and were analyzed via Affymetrix gene expression profiling. A subsequent bioinformatics workflow transformed genomic data into a personalized drug report. Average turnaround from biopsy to report generation was 116 hours (4.8 days). Unsupervised clustering of canine tumor expression data clustered by cancer type, but supervised clustering of tumors based on the personalized drug report clustered by drug class rather than cancer type. Collection and turnaround of high quality canine tumor samples, centralized pathology, analyte generation, array hybridization, and bioinformatic analyses matching gene expression to therapeutic options is achievable in a practical clinical window (strategies may aid cancer drug development.

[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].

Science.gov (United States)

Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng

2009-09-01

To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.

Cellular endocytic compartment localization of expressed canine CD1 molecules

DEFF Research Database (Denmark)

Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.

2016-01-01

CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....

Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.

Science.gov (United States)

Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna

2015-01-01

Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.

Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines

Directory of Open Access Journals (Sweden)

Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman

2011-01-01

Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.

Orthodontic management of bilaterally impacted mandibular canines in a growing patient

Directory of Open Access Journals (Sweden)

Rajaganesh J Gautam

2016-01-01

Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.

OpenAIRE

McMaster, G K; Tratschin, J D; Siegl, G

1981-01-01

The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.

Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

Directory of Open Access Journals (Sweden)

Sudarisman

2006-03-01

Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

Comparative photoelastic study of dental and skeletal anchorages in the canine retraction

Directory of Open Access Journals (Sweden)

Cristiane Aparecida de Assis Claro

2014-01-01

Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.

Permanent maxillary canines - review of eruption pattern and local etiological factors leading to impaction.

Science.gov (United States)

Sajnani, Anand K

2015-02-01

The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.

Tumor microvessel density–associated mast cells in canine nodal lymphoma

Science.gov (United States)

Mann, Elizabeth; Whittington, Lisa

2014-01-01

Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752

Tumor microvessel density–associated mast cells in canine nodal lymphoma

Directory of Open Access Journals (Sweden)

Moges Woldemeskel

2014-11-01

Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.

How far is the root apex of a unilateral impacted canine from the root apices' arch form?

Science.gov (United States)

Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il

2017-02-01

The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American

The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

Science.gov (United States)

Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

2015-04-17

Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Automated tru-cut imaging-guided core needle biopsy of canine ...

African Journals Online (AJOL)

The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...

Biochemical characterization of prostate-specific membrane antigen from canine prostate carcinoma cells.

Science.gov (United States)

Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E

2014-05-01

Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1)  mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50  = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly

Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

International Nuclear Information System (INIS)

Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma

2006-01-01

Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

Feline and canine coronaviruses: common genetic and pathobiological features.

Science.gov (United States)

Le Poder, Sophie

2011-01-01

A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

The use of zootherapeutics in folk veterinary medicine in the district of Cubati, Paraíba State, Brazil

Directory of Open Access Journals (Sweden)

da S Mourão José

2007-09-01

Full Text Available Abstract Background The present work addresses the use of zootherapy in folk veterinary medicine (ethnoveterinary by the residents of the municipal district of Cubati, microregion of Seridó, Paraíba State, Brazil. It sought to identify the principal animals used as medicinal sources for zootherapeutics and to contribute to the preservation and sustainability of this traditional knowledge. Methods Field research was undertaken on a weekly or biweekly basis during the period November, 2006, to January, 2007. Free, semi-structured, and open interviews were made with local residents of the municipal district of Cubati (in both urban and rural settings as well as with venders in public markets. A total of 25 individuals of both sexes were interviewed (with ages varying from 26 to 78 years although only 16 were finally chosen as informants as these people demonstrated the greatest degree of knowledge concerning zootherapeutics. Graphs and percentages were generated using Microsoft© Excel 2007 software, and the species were identified by photographic registration and subsequent bibliographical surveys. Results Mammals constitute the main medicinal zootherapeutic source for folk veterinary medicines in the studied area, both in terms of the total number of species used and the frequency of their citation. Sheep (Ovis aries, pigs (Sus scrofa, cattle (Bos taurus, and foxes (Cerdocyon thous were mentioned by 62.5, 43.75, 37.5, and 31.25% of the informants, respectively, as being used in folk veterinary medicine. Additionally, chameleons (Iguana iguana, chickens (Gallus domesticus, and rattlesnakes (Crotalus durissus were mentioned by 75, 43.75, and 31.25% of the informants, respectively. Relatively simple animal illnesses, such as furuncles, or injuries resulting from embedded thorns or skin eruptions are responsible for the largest number of zootherapeutic treatment, while, diseases of greater complexity, such as rabies and brucellosis, were not even

Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma.

Science.gov (United States)

Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

2016-01-01

Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

Directory of Open Access Journals (Sweden)

Otávio Valério Carvalho

2012-01-01

Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

Science.gov (United States)

Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo

2012-01-01

Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia

Directory of Open Access Journals (Sweden)

Víctor Acero P

2015-09-01

Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.

Compensatory canine angulation in angle Class II and III patients

Directory of Open Access Journals (Sweden)

Mauro Carlos Agner Busato

2009-09-01

Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.

European surveillance of emerging pathogens associated with canine infectious respiratory disease.

Science.gov (United States)

Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe

2017-12-01

Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.

Rethinking Heat Injury in the SOF Multipurpose Canine: A Critical Review.

Science.gov (United States)

Baker, Janice L; Hollier, Paul J; Miller, Laura; Lacy, Ward A

2012-01-01

Heat injury is a significant concern of the Special Operations Forces Multipurpose Canine (SOF MPC). The unique athletic abilities and working environment of the SOF MPC differ from that of companion dogs or even conventional military working dogs. This should be considered in the prevention, diagnosis, and treatment of heat injury of the SOF MPC. A critical review of the literature on canine heat injury as it pertains to working dogs demonstrates limited scientific evidence on best practices for immediate clinical management of heat injury in SOF MPCs. A majority of management guidelines for heat injury in veterinary reference books and journals are based on review articles or professional opinion of the author vs. evidence from original research. In addition, guidelines are written primarily for companion animal populations vs. SOF MPCs and focus on measures to be undertaken in a clinical setting vs. point of injury. The phenomenon of ?circular referencing? is also prevalent in the heat injury literature. Current guidelines supported by review articles and textbooks often provide no citation or cite other review articles for clinical standards such as normal temperature ranges, treatment methods, and recurrence of heat injury. This ?circular referencing? phenomenon misrepresents anecdotal evidence and professional opinion as scientifically validated, reinforcing concepts and recommendations that are not truly supported by the evidence. Further study is needed to fully understand heat injury in SOF MPCs and how this applies to prevention, diagnosis and treatment guidelines. In order to provide SOF canine programs with best clinical advice and care, SOF Veterinarians must make clinical judgments based on evaluation of the most accurate and valid information possible. Clinical guidelines are fluid and should be reviewed regularly for relevance to the defined population in question. Clinical Guidelines should also be utilized as guiding principles in conjunction with

Canine obesity: an overview.

Science.gov (United States)

Gossellin, J; Wren, J A; Sunderland, S J

2007-08-01

Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.

Peracute Infectious Canine Hepatitis

Directory of Open Access Journals (Sweden)

A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam

2012-05-01

Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.

Radioresistant canine hematopoietic cells

International Nuclear Information System (INIS)

Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.

1987-01-01

Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells

Maxillary canine displacement and genetically determined predisposition to disturbed development of the dentition.

Science.gov (United States)

Stahl, Franka; Grabowski, Rosemarie

2003-05-01

The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.

Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features

Directory of Open Access Journals (Sweden)

Sophie Le Poder

2011-01-01

Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.

THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY

NARCIS (Netherlands)

HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ

1993-01-01

A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of

Laparoscopic radical prostatectomy in the canine model.

Science.gov (United States)

Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M

1996-12-01

The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.

Characterization of canine osteosarcoma by array comparative genomic hybridization and RT-qPCR: signatures of genomic imbalance in canine osteosarcoma parallel the human counterpart.

Science.gov (United States)

Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew

2011-11-01

Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.

Detection and genetic characterization of Canine parvovirus and Canine coronavirus strains circulating in district of Tirana in Albania.

Science.gov (United States)

Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola

2014-07-01

An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.

Monoclonal Antibodies 13A4 and AC133 Do Not Recognize the Canine Ortholog of Mouse and Human Stem Cell Antigen Prominin-1 (CD133.

Directory of Open Access Journals (Sweden)

Kristina Thamm

Full Text Available The pentaspan membrane glycoprotein prominin-1 (CD133 is widely used in medicine as a cell surface marker of stem and cancer stem cells. It has opened new avenues in stem cell-based regenerative therapy and oncology. This molecule is largely used with human samples or the mouse model, and consequently most biological tools including antibodies are directed against human and murine prominin-1. Although the general structure of prominin-1 including its membrane topology is conserved throughout the animal kingdom, its primary sequence is poorly conserved. Thus, it is unclear if anti-human and -mouse prominin-1 antibodies cross-react with their orthologs in other species, especially dog. Answering this issue is imperative in light of the growing number of studies using canine prominin-1 as an antigenic marker. Here, we address this issue by cloning the canine prominin-1 and use its overexpression as a green fluorescent protein fusion protein in Madin-Darby canine kidney cells to determine its immunoreactivity with antibodies against human or mouse prominin-1. We used immunocytochemistry, flow cytometry and immunoblotting techniques and surprisingly found no cross-species immunoreactivity. These results raise some caution in data interpretation when anti-prominin-1 antibodies are used in interspecies studies.

Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.

Science.gov (United States)

Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L

2016-02-19

Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.

Functional Characterization of Canine Interferon-Lambda

Science.gov (United States)

Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun

2014-01-01

In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142

Maxillary canine impactions related to impacted central incisors: two case reports.

Science.gov (United States)

Bayram, Mehmet; Ozer, Mete; Sener, Ismail

2007-09-01

The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by

Orthodontic treatment of a stubborn palatally ectopic canine: a case report.

Science.gov (United States)

Al-Musfir, Tumadher M; Morris, David O

2014-03-01

This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.

Successful experimental challenge of dogs with canine parvovirus-2.

OpenAIRE

Carman, S; Povey, C

1982-01-01

Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...

Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

OpenAIRE

Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan

2014-01-01

Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...

Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.

Science.gov (United States)

Kemoli, Arthur Musakulu; Junior, Thomas Munyao

2017-01-01

Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

Ethnoveterinary survey of tradomedical importance of Bos taurus L ...

African Journals Online (AJOL)

taurus L urine, bile and dung in Nigeria and South Africa. Mariam O ... traditional health care systems are still in use by majority of the people ..... improving memory, enhancing the function of the liver, slowing ... standard guidelines and database be made available to ... WHO, Traditional and Modern Medicine: Harmonishing.

Recent advances in canine leptospirosis: focus on vaccine development

Directory of Open Access Journals (Sweden)

Klaasen HLBM

2015-06-01

Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis

Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.

Science.gov (United States)

Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K

2017-07-01

This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.

Impacted canines: Etiology, diagnosis, and orthodontic management

Directory of Open Access Journals (Sweden)

Ranjit Manne

2012-01-01

Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.

A re-evaluation of subspecific variation and canine dimorphism in woolly spider monkeys (Brachyteles arachnoides).

Science.gov (United States)

Leigh, S R; Jungers, W L

1994-12-01

A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.

Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.

Science.gov (United States)

Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P

2014-01-21

The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Identification and function analysis of canine stimulator of interferon gene (STING).

Science.gov (United States)

Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong

2017-12-01

Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population

Directory of Open Access Journals (Sweden)

Fouad Ayoub

2014-01-01

Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.

Increasing Incidence of Canine Leptospirosis in Switzerland

Directory of Open Access Journals (Sweden)

Andrea Major

2014-07-01

Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.

NCR1 Expression Identifies Canine Natural Killer Cell Subsets with Phenotypic Similarity to Human Natural Killer Cells

Directory of Open Access Journals (Sweden)

Jennifer Ann Foltz

2016-11-01

Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.

Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers

NARCIS (Netherlands)

van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.

2012-01-01

In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic

78 FR 29698 - Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA

Science.gov (United States)

2013-05-21

...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...

Functional Characterization of the Canine Heme-Regulated eIF2α Kinase: Regulation of Protein Synthesis

Directory of Open Access Journals (Sweden)

Kimon C. Kanelakis

2009-01-01

Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.

The Effect of Using Self-ligating Brackets on Maxillary Canine Retraction: A Split-mouth Design Randomized Controlled Trial.

Science.gov (United States)

Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S

2016-06-01

The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.

Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.

Science.gov (United States)

Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F

2015-03-01

We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.

An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.

Science.gov (United States)

Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A

2011-12-01

To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.

Bilateral second premolars agenesia together with a unilateral canine radiculomegaly

Directory of Open Access Journals (Sweden)

Arthur Musakulu Kemoli

2017-01-01

Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.

In vitro development of canine somatic cell nuclear transfer embryos in different culture media.

Science.gov (United States)

Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea

2015-01-01

The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.

Canine spontaneous head and neck squamous cell carcinomas represent their human counterparts at the molecular level.

Directory of Open Access Journals (Sweden)

Deli Liu

2015-06-01

Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.

Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis

Directory of Open Access Journals (Sweden)

Jill Narak

2015-01-01

Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.

Molecular biological and immunohistological characterization of canine dermal papilla cells and the evaluation of culture conditions.

Science.gov (United States)

Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu

2011-10-01

The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

Orthodontic tooth movement after extraction of previously autotransplanted maxillary canines and ridge augmentation.

Science.gov (United States)

Collett, A R; Fletcher, B

2000-12-01

A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.

"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.

Science.gov (United States)

Kranz, William D; Strange, Nicholas A; Goodpaster, John V

2014-12-01

Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.

Morphological study of maxillary canine region based on CT

International Nuclear Information System (INIS)

Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi

2010-01-01

The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)

Pathophysiology, diagnosis, and treatment of canine hip dysplasia

International Nuclear Information System (INIS)

Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.

1996-01-01

Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education

Does contemporary canine diet cause cancer? ; A review

Directory of Open Access Journals (Sweden)

Joseph B Gentzel

2013-07-01

Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer

Three-dimensional localization of impacted canines and root resorption assessment using cone beam computed tomography.

Science.gov (United States)

Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing

2014-06-01

The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.

Canine parvovirus in asymptomatic feline carriers.

Science.gov (United States)

Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D

2012-05-25

Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog

Canine distemper virus detection in asymptomatic and non vaccinated dogs

Directory of Open Access Journals (Sweden)

Helen L. Del Puerto

2010-02-01

Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model

International Nuclear Information System (INIS)

Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na

2009-01-01

Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)

A survey of canine tick-borne diseases in India

Directory of Open Access Journals (Sweden)

Coleman Glen T

2011-07-01

Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.

New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins

Directory of Open Access Journals (Sweden)

J. Michael Plavcan

2012-03-01

Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.

Molecular characterization of the canine HMGB1.

Science.gov (United States)

Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I

2003-01-01

Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel

Comparative analysis of the surface exposed proteome of two canine osteosarcoma cell lines and normal canine osteoblasts.

Science.gov (United States)

Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I

2013-06-13

Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data

Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

Science.gov (United States)

Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei

2013-01-01

Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666

Soluble Form of Canine Transferrin Receptor Inhibits Canine Parvovirus Infection In Vitro and In Vivo

Directory of Open Access Journals (Sweden)

Jiexia Wen

2013-01-01

Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.

3D enamel thickness in Neandertal and modern human permanent canines.

Science.gov (United States)

Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano

2017-12-01

Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

Science.gov (United States)

Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

2011-04-09

Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

Distribution and activity levels of matrix metalloproteinase 2 and 9 in canine and feline osteosarcoma

OpenAIRE

Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid

2016-01-01

Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Suppression of vascular endothelial growth factor expression by cannabinoids in a canine osteosarcoma cell line

Directory of Open Access Journals (Sweden)

Figueiredo AS

2013-07-01

Full Text Available Andreza S Figueiredo,1 Hiram J García-Crescioni,1 Sandra C Bulla,1 Matthew K Ross,2 Chelsea McIntosh,1 Kari Lunsford,3 Camilo Bulla11Department of Pathobiology and Population Medicine, 2Department of Basic Sciences, 3Department of Clinical Sciences and Animal Health Center, College of Veterinary Medicine, Mississippi State University, Mississippi State, MS, USAAbstract: Vascular endothelial growth factor (VEGF is a key regulator in both physiologic and pathologic angiogenesis, and cannabinoids decrease VEGF release in human and murine cancer cells. The aim of this study was to assess the in vitro effects of a synthetic cannabinoid, WIN-55,212-2, on the expression of the proangiogenic factor VEGF-A in the canine osteosarcoma cell line 8. After analysis of gene expression by quantitative real-time polymerase chain reaction, the compound decreased VEGF-A expression by 35% ± 10% (P < 0.0001 as compared with the control. This synthetic cannabinoid shows promise as a potential inhibitor of angiogenesis, and further studies are warranted to investigate its in vivo effects and to explore the potential of this and related compounds as adjuvant cancer therapy in the dog.Keywords: dog, cancer, angiogenesis, cannabinoids

DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.

Science.gov (United States)

Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O

2018-01-01

Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.

DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA

Science.gov (United States)

Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O

2018-01-01

Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647

Canine Detection of Illict Drugs: Sensory Apparatus Technology

National Research Council Canada - National Science Library

Morrison, Edward

2000-01-01

This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...

Coryneform bacteria associated with canine otitis externa

DEFF Research Database (Denmark)

Aalbæk, Bent; Bemis, David A.; Schjærff, Mette

2010-01-01

This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...

Antigenic typing Polish isolates of canine parvovirus

Energy Technology Data Exchange (ETDEWEB)

Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)

1995-12-31

Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.

Antigenic typing Polish isolates of canine parvovirus

International Nuclear Information System (INIS)

Mizak, B.; Plucienniczak, A.

1995-01-01

Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs

Assessment of periodontal status following the alignment of impacted permanent maxillary canine teeth.

Science.gov (United States)

Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A

2006-01-01

The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.

An assessment of the relationship between cervical vertebrae maturation index and eruption of permanent maxillary canines

Directory of Open Access Journals (Sweden)

D S Kothavade

2012-01-01

Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.

Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa

Directory of Open Access Journals (Sweden)

Nozyechi Ngulube Chidumayo

2018-02-01

Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.

Canine trypanosomosis: Clinical observations and morphological ...

African Journals Online (AJOL)

Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...

The unerupted maxillary canine - a post-surgical review.

LENUS (Irish Health Repository)

O'Dowling, Ian

2009-10-01

The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

The unerupted maxillary canine--a post-surgical review.

Science.gov (United States)

O'Dowling, Ian

2009-01-01

The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.

Canine distemper spillover in domestic dogs from urban wildlife.

Science.gov (United States)

Kapil, Sanjay; Yeary, Teresa J

2011-11-01

Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.

Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction

Directory of Open Access Journals (Sweden)

Anísio Bueno de Carvalho

2012-12-01

Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS�

Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis

International Nuclear Information System (INIS)

Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.

1988-01-01

Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)

Panoramic radiological study to identify locally displaced maxillary canines in Bangladeshi population

International Nuclear Information System (INIS)

Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq

2011-01-01

This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.

A comparative study between mixed-type tumours from human salivary and canine mammary glands

International Nuclear Information System (INIS)

Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D

2007-01-01

In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations

Immunohistochemical expression study of proapoptotic BH3-only protein bad in canine nonneoplastic tissues and canine lymphomas.

Science.gov (United States)

Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F

2013-09-01

The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.

Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

Science.gov (United States)

Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

1995-06-01

For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.

Science.gov (United States)

Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M

2013-09-01

Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.

In vitro inhibition of canine distemper virus by flavonoids and phenolic acids: implications of structural differences for antiviral design.

Science.gov (United States)

Carvalho, O V; Botelho, C V; Ferreira, C G T; Ferreira, H C C; Santos, M R; Diaz, M A N; Oliveira, T T; Soares-Martins, J A P; Almeida, M R; Silva, A

2013-10-01

Infection caused by canine distemper virus (CDV) is a highly contagious disease with high incidence and lethality in the canine population. Antiviral activity of flavonoids quercetin, morin, rutin and hesperidin, and phenolic cinnamic, trans-cinnamic and ferulic acids were evaluated in vitro against the CDV using the time of addition assay to determine which step of the viral replicative cycle was affected. All flavonoids displayed great viral inhibition when they were added at the times 0 (adsorption) and 1h (penetration) of the viral replicative cycle. Both quercetin and hesperidin presented antiviral activity at the time 2h (intracellular). In the other hand, cinnamic acid showed antiviral activity at the times 0 and 2h while trans-cinnamic acid showed antiviral effect at the times -1h (pre-treatment) and 0 h. Ferulic acid inhibited CDV replicative cycle at the times 0 and 1h. Our study revealed promising candidates to be considered in the treatment of CDV. Structural differences among compounds and correlation to their antiviral activity were also explored. Our analysis suggest that these compounds could be useful in order to design new antiviral drugs against CDV as well as other viruses of great meaning in veterinary medicine. Copyright © 2013 Elsevier Ltd. All rights reserved.

Mechanical properties of canine osteosarcoma-affected antebrachia.

Science.gov (United States)

Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M

2017-05-01

To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.

Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro

Directory of Open Access Journals (Sweden)

Cintia Xavier de Mello

2014-12-01

Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.

Assessment of Periodontal Status of Surgically Exposed and Orthodontically Aligned Impacted Maxillary Canines

Directory of Open Access Journals (Sweden)

Adina Coșarcă

2014-02-01

Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated

Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs

OpenAIRE

McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel

1985-01-01

Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Science.gov (United States)

Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

2015-01-01

BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution

NARCIS (Netherlands)

van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.

2009-01-01

An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact

Assessment of Growth Using Mandibular Canine Calcification Stages and Its Correlation with Modified MP3 Stages.

Science.gov (United States)

Nayak, Reshma; Nayak, Us Krishna; Hegde, Gautam

2010-01-01

Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs (80 males and 80 females), of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation between the developmental stages of MP3 and the mandibular right canine in male and female groups, is of high statistical significance (p = 0.001). The correlation coefficient between MP3 stages and developmental stages of mandibular canine and chronological age in male and females was found to be not significant. The correlation between the mandibular canine calcification stages and MP3 stages was found to be significant. The developmental stages of the mandibular canine could be used very reliably as a sole indicator for assessment of skeletal maturity.

A CBCT Investigation of the Association between Sella-Turcica Bridging and Maxillary Palatal Canine Impaction

Directory of Open Access Journals (Sweden)

Pamela M. Ortiz

2018-01-01

Full Text Available Objectives. To investigate the association between unilateral/bilateral maxillary canine impaction and sella-turcica bridging using CBCT imaging. Methods. This retrospective comparative study analyzed 76 CBCT images of the craniofacial complex including sella-turcica. The impacted cuspid group consisted of thirty-eight subjects (7 males, 31 females; mean age, 14.6 ± 3.2 years diagnosed with unilateral (left n=14, right n=11 or bilateral (n=13 palatal canine impaction. The control group included thirty-eight subjects matched by sex (7 males, 31 females; mean age, 19.5 ± 3.6 years with no impaction. Multinomial logistic regression analysis was used to determine the association between unilateral/bilateral canine impaction and right and left sella-turcica bridging. Results. The prevalence of sella-turcica bridging was 59.3% and 50% in the impacted canine and control groups, respectively. Although the odds for unilateral canine impaction were increased in the right and left sella-turcica bridging groups compared to the controls, the difference was not statistically significant. The risk of bilateral impaction was different between the two sides of sella-turcica bridging, but, again, the findings were not statistically significant. Conclusion. Contrary to previous 2D studies, there is no statistically significant association between unilateral/bilateral palatal canine impaction and sella-turcica bridging when using 3D CBCT.

Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells

Directory of Open Access Journals (Sweden)

Michelle G. Ritt

2015-04-01

Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.

Automation of gender determination in human canines using artificial intelligence

Directory of Open Access Journals (Sweden)

F. Fidya

2017-09-01

Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.

Experimental research of covered stent implanted in canine hepatic artery

International Nuclear Information System (INIS)

Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde

2007-01-01

Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)

Extrusion processing : effects on dry canine diets

NARCIS (Netherlands)

Tran, Q.D.

2008-01-01

Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.

Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the

Effect of rapid maxillary expansion and transpalatal arch treatment associated with deciduous canine extraction on the eruption of palatally displaced canines: A 2-center prospective study.

Science.gov (United States)

Sigler, Lauren M; Baccetti, Tiziano; McNamara, James A

2011-03-01

Our aim was to investigate the effect of rapid maxillary expansion and transpalatal arch therapy combined with deciduous canine extraction on the eruption rate of palatally displaced canines (PDCs) in patients in the late mixed dentition in a 2-center prospective study. Seventy subjects were enrolled based on PDCs diagnosed on panoramic radiographs. The treatment group (TG, 40 subjects) underwent RME followed by TPA therapy and extraction of the deciduous canines. The control group (CG, 30 subjects) received no orthodontic treatment. At the start of the trial, panoramic radiographs and dental casts were compared between the TG and the CG with the Mann-Whitney U test (P anomalies was reported. No statistically significant difference was found for any measurement at the start of the trial between the 2 groups. The prevalence rates of eruption of the maxillary canines were 80% for the TG and 28% in the CG, a statistically significant difference (chi-square =16.26, P mixed dentition with PDCs. Pretreatment variables indicating success of treatment on the eruption of PDCs were less severe sectors of displacement, prepubertal stages of skeletal maturity, and open root apices of PDCs. Several dental anomalies were associated significantly with PDCs, thus confirming the genetic etiology of this eruption disturbance. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

DEFF Research Database (Denmark)

Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

2008-01-01

Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age.

Science.gov (United States)

Malik, Pooja; Rana, Vivek; Rehani, Usha

2012-01-01

The purpose of this study was to assess skeletal age and establish relationship between mandibular canine calcification and skeletal age. The study included 147 females aged 10 to 13 years. The subjects were divided into three groups: Group I-comprising of 10 to 11 years old female; Group II-comprising of 11 to 12 years old female; Group III-12 to 13 years female. OPG and hand and wrist radiographs of left side for each subject were taken with prior consent of their parents. The calcification status of canine was evaluated from orthopantomograms according to scores given in Demirjian's method. The stages of ossification of various carpal bones were evaluated using radiographic atlas of Greulich-Pyle and skeletal age was calculated. Data collected was statistically analyzed. The results drawn from this study showed that a strong correlation was observed for canine calcification stage F for 10 to 11 years and for stage G in 11 to 12 years and 12 to 13 years respectively. How to cite this article: Malik P, Rana V, Rehani U. To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age. Int J Clin Pediatr Dent 2012;5(1): 14-19.

Identification of a new genotype of canine distemper virus circulating in America.

Science.gov (United States)

Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón

2011-08-01

Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.

Histologic prognosticators in feline osteosarcoma: a comparison with phenotypically similar canine osteosarcoma.

Science.gov (United States)

Dimopoulou, Maria; Kirpensteijn, Jolle; Moens, Hester; Kik, Marja

2008-07-01

To investigate the histologic characteristics of feline osteosarcoma (OS) and compare the histologic data with phenotypically comparable canine OS. The effects of histologic and clinical variables on survival statistics were evaluated. Retrospective study. Cats (n=62) and dogs (22). Medical records of 62 cats with OS were reviewed for clinically relevant data. Clinical outcome was obtained by telephone interview. Histologic characteristics of OS were classified using a standardized grading system. Histologic characteristics in 22 feline skeletal OS were compared with 22 canine skeletal OS of identical location and subtype. Prognostic variables for clinical outcome were determined using multivariate analysis. Feline OS was characterized by moderate to abundant cellular pleomorphism, low mitotic index, small to moderate amounts of matrix, high cellularity, and a moderate amount of necrosis. There was no significant difference between histologic variables in feline and canine OS. Histologic grade, surgery, and mitotic index significantly influenced clinical outcome as determined by multivariate analysis. Tumor invasion into vessels was not identified as a significant prognosticator. Feline and canine skeletal OS have similar histologic but different prognostic characteristics. Prognosis for cats with OS is related to histologic grade and mitotic index of the tumor.

Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013.

Science.gov (United States)

Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina

2015-09-30

During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be

A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article

Directory of Open Access Journals (Sweden)

S. Gur

2009-05-01

Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.

The effects of sulforaphane on canine osteosarcoma proliferation and invasion.

Science.gov (United States)

Rizzo, V L; Levine, C B; Wakshlag, J J

2017-09-01

Recent evidence in in vitro and in vivo models suggests that sulforaphane (SFN), found in raw cruciferous vegetables, may have utility in chemoprevention, as an antineoplastic agent and as a free radical scavenger. The effects of SFN alone or with doxorubicin on cell viability were examined, as well as cell cycle kinetics, invasion capabilities and apoptosis in three canine osteosarcoma cell line (D17, OS 2.4 and HMPOS). Results showed that SFN could not induce cell death at potentially physiological concentrations (canine osteosarcoma. © 2016 John Wiley & Sons Ltd.

Construct canine intracranial aneurysm model by endovascular technique

International Nuclear Information System (INIS)

Liang Xiaodong; Liu Yizhi; Ni Caifang; Ding Yi

2004-01-01

Objective: To construct canine bifurcation aneurysms suitable for evaluating the exploration of endovascular devices for interventional therapy by endovascular technique. Methods: The right common carotid artery of six dogs was expanded with a pliable balloon by means of endovascular technique, then embolization with detached balloon was taken at their originations DAS examination were performed on 1, 2, 3 d after the procedurse. Results: 6 aneurysm models were created in six dogs successfully with the mean width and height of the aneurysms decreasing in 3 days. Conclusions: This canine aneurysm model presents the virtue in the size and shape of human cerebral bifurcation saccular aneurysms on DSA image, suitable for developing the exploration of endovascular devices for aneurismal therapy. The procedure is quick, reliable and reproducible. (authors)

Survey of ethno-veterinary medicinal plants at se- lected districts of ...

African Journals Online (AJOL)

of choice, cultural acceptability, efficacy against certain diseases and ... healers who varied with age, sex, marital status, occupation, educational level .... Abortion. 2 (6.12%). Ceccebsahumna. Arthritis. 1 (3.12%). Lamsheysa ..... Pune, India.

Creole remedies : case studies of ethnoveterinary medicine in Trinidad and Tobago

NARCIS (Netherlands)

Lans, C.

2001-01-01

Context

The popular pharmacopoeia of Trinidad and Tobago is the result of a Creole pan-Caribbean culture, closely linked to history, and the result of a South American Indian, African, European and Asian heritage (Lans, 1996; Moodie-Kublalsingh, 1994; Littlewood, 1988;

Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

Energy Technology Data Exchange (ETDEWEB)

Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)

2014-04-15

Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment

International Nuclear Information System (INIS)

Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.

2014-01-01

Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated

Canine periodontitis: the dog as an important model for periodontal studies.

Science.gov (United States)

Albuquerque, Carlos; Morinha, Francisco; Requicha, João; Martins, Teresa; Dias, Isabel; Guedes-Pinto, Henrique; Bastos, Estela; Viegas, Carlos

2012-03-01

Periodontal disease (PD) refers to a group of inflammatory diseases caused by bacterial plaque in the periodontium and ranges from an early stage (gingivitis) to an advanced stage (periodontitis). It is a multifactorial disease that results from the interaction of the host defence mechanisms with the plaque microorganisms. Early detection, diagnosis and treatment are essential in the control of this disease. PD has an enormous impact on human and veterinary medicine due to its high prevalence. The most common animal PD models use dogs and non-human primates, although other animals (rats, mice, hamsters, rabbits, miniature pigs, ferrets, and sheep) have also been employed. Dog models have contributed significantly to the current understanding of periodontology. The most important clinical aspects of canine PD are considered in this review and the various animal models are examined with an emphasis on the role of the dog as the most useful approach for understanding human PD and in the development of new therapeutic and preventive measures. Copyright © 2011 Elsevier Ltd. All rights reserved.

Optimisation of a double-centrifugation method for preparation of canine platelet-rich plasma.

Science.gov (United States)

Shin, Hyeok-Soo; Woo, Heung-Myong; Kang, Byung-Jae

2017-06-26

Platelet-rich plasma (PRP) has been expected for regenerative medicine because of its growth factors. However, there is considerable variability in the recovery and yield of platelets and the concentration of growth factors in PRP preparations. The aim of this study was to identify optimal relative centrifugal force and spin time for the preparation of PRP from canine blood using a double-centrifugation tube method. Whole blood samples were collected in citrate blood collection tubes from 12 healthy beagles. For the first centrifugation step, 10 different run conditions were compared to determine which condition produced optimal recovery of platelets. Once the optimal condition was identified, platelet-containing plasma prepared using that condition was subjected to a second centrifugation to pellet platelets. For the second centrifugation, 12 different run conditions were compared to identify the centrifugal force and spin time to produce maximal pellet recovery and concentration increase. Growth factor levels were estimated by using ELISA to measure platelet-derived growth factor-BB (PDGF-BB) concentrations in optimised CaCl 2 -activated platelet fractions. The highest platelet recovery rate and yield were obtained by first centrifuging whole blood at 1000 g for 5 min and then centrifuging the recovered platelet-enriched plasma at 1500 g for 15 min. This protocol recovered 80% of platelets from whole blood and increased platelet concentration six-fold and produced the highest concentration of PDGF-BB in activated fractions. We have described an optimised double-centrifugation tube method for the preparation of PRP from canine blood. This optimised method does not require particularly expensive equipment or high technical ability and can readily be carried out in a veterinary clinical setting.

Canine and incisor microwear in pitheciids and Ateles reflects documented patterns of tooth use.

Science.gov (United States)

Delezene, Lucas K; Teaford, Mark F; Ungar, Peter S

2016-09-01

Platyrrhine species differ in the extent to and the manner in which they use their incisors and canines during food ingestion. For example, Ateles uses its anterior teeth to process mechanically nondemanding soft fruits, while the sclerocarp-harvesting pitheciids rely extensively on these teeth to acquire and process more demanding foods. Pitheciids themselves vary in anterior tooth use, with the pitheciines (Cacajao, Chiropotes, and Pithecia) noted to use their robust canines in a variety of ways to predate seeds, while Callicebus, which rarely predates seeds, uses its incisors and exceptionally short canines to scrape tough mesocarp from fruits. To investigate the relationship between tooth use and dental wear, microwear textures were investigated for the anterior teeth of these five genera of platyrrhine primates. Using a white light confocal microscope, 12 microwear texture attributes that reflect feature size, anisotropy, density, and complexity were recorded from high-resolution epoxy casts of the incisors and canines of adult wild-collected Brazilian specimens of Ateles, Callicebus, Cacajao, Chiropotes, and Pithecia. Pitheciine canines tend to have deep microwear features and complex, anisotropic microwear textures, while Ateles anterior teeth tend to have very small features, low feature density, and less complex and anisotropic surfaces. Callicebus incisor and canine microwear is generally intermediate in size and complexity between those extremes. These findings align with expectations from reported field observations of tooth use and illustrate the potential for using microwear texture analysis to infer patterns of anterior tooth use in extinct primates. Am J Phys Anthropol 161:6-25, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.

Directory of Open Access Journals (Sweden)

David Kovacevic

Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.

Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.

Science.gov (United States)

Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H

2007-07-01

Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.

Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.

Directory of Open Access Journals (Sweden)

Kinga Majchrzak

Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs

Detection of Ammonium Nitrate Variants by Canine: A Study of Generalization between Like Substances

Science.gov (United States)

2018-04-30

Memorandum Report Homemade explosive Detector dog Canine behavior/ learning Ammonium nitrate Canine training 61-4687-08 Office...varying temperatures and humidities...presence of contaminants, the form in which the AN is found (i.e. prill, ground, or crystalline), and environmental conditions (i.e. temperature and

Characterization of STAT3 activation and expression in canine and human osteosarcoma

Directory of Open Access Journals (Sweden)

Li Pui-Kai

2009-03-01

Full Text Available Abstract Background Dysregulation of signal transducer and activator of transcription 3 (STAT3 has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. Methods To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656 or STAT3 (LLL3 inhibitors and cell proliferation (CyQUANT, caspase 3/7 activity (ELISA, apoptosis (Western blotting for PARP cleavage and/or viability (Wst-1 were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Results Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known

Characterization of STAT3 activation and expression in canine and human osteosarcoma

International Nuclear Information System (INIS)

Fossey, Stacey L; Liao, Albert T; McCleese, Jennifer K; Bear, Misty D; Lin, Jiayuh; Li, Pui-Kai; Kisseberth, William C; London, Cheryl A

2009-01-01

Dysregulation of signal transducer and activator of transcription 3 (STAT3) has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA) tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656) or STAT3 (LLL3) inhibitors and cell proliferation (CyQUANT), caspase 3/7 activity (ELISA), apoptosis (Western blotting for PARP cleavage) and/or viability (Wst-1) were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known transcriptional targets of STAT3. These data

Orthodontic and surgical approach to the treatment of bilaterally impacted maxillary canines: a case report.

Science.gov (United States)

Ertan Erdinc, Aslihan M

2008-01-01

Impaction of maxillary canines is a common orthodontic anomaly that causes facial and dentoalveolar system problems, both functional and esthetic. A combination of surgery and orthodontics is important in bringing impacted canines to their ideal position in the dental arch. In this case report of a 14-year-old patient with impacted right and left maxillary canines, the crowns of these teeth were surgically exposed, brackets were bonded, and light orthodontic forces were delivered for 2 years to align the teeth in the dental arch.

Influence of chemotherapy for lymphoma in canine parvovirus DNA distribution and specific humoral immunity.

Science.gov (United States)

Elias, M A; Duarte, A; Nunes, T; Lourenço, A M; Braz, B S; Vicente, G; Henriques, J; Tavares, L

2014-12-01

In man, the combination of cancer and its treatment increases patients' susceptibility to opportunistic infections, due to immune system impairment. In veterinary medicine little information is available concerning this issue. In order to evaluate if a similar dysfunction is induced in small animals undergoing chemotherapy, we assessed the complete blood count, leukocytic, plasma and fecal canine parvovirus (CPV) viral load, and anti-CPV protective antibody titers, in dogs with lymphoma treated with CHOP (cyclophosphamide, doxorubicin, vincristine and prednisolone) protocol, before and during chemotherapy. There was no evidence of decreased immune response, either at admission or after two chemotherapy cycles, indicating that the previously established immunity against CPV was not significantly impaired, supporting the idea that immunosuppression as a result of hematopoietic neoplasms and their treatment in dogs requires further investigation and conclusions cannot be extrapolated from human literature. Copyright © 2014 Elsevier Ltd. All rights reserved.

Biomechanical characteristics of self-ligating brackets in a vertically displaced canine model: a finite element analysis.

Science.gov (United States)

Kim, S-J; Kwon, Y-H; Hwang, C-J

2016-05-01

The objective of this study was to compare the biomechanical characteristics between two types of self-ligating brackets and conventional metal brackets using finite element analysis of a vertically displaced canine model focusing on the desired force on the canine and undesirable forces on adjacent teeth. Three-dimensional finite element models of the maxillary dentition with 1-mm, 2-mm, and 3-mm vertically displaced canines were constructed. Two different self-ligating brackets (In-Ovation C and Smart clip) and a conventional metal bracket (Micro-arch) were modeled. After a 0.016-inch NiTi (0.40 mm, round) wire was engaged, the displacement of each tooth was calculated using x-, y-, and z-coordinates, and the tensile and compressive stresses were calculated. The extrusion and maximal tensile stress of the canine differed little between the three brackets, but the intrusion and minimal compressive stress values of the adjacent teeth differed considerably and were highest in the Smart clip and least in the In-Ovation C. The extrusion and maximal tensile stress of the canine in the 3-mm displacement model was less than that in the 2-mm displacement model, and the intrusion and minimal compressive stress of the adjacent teeth increased with the degree of displacement. Self-ligating brackets were not superior to conventional brackets in leveling a vertically displaced canine. A continuous arch wire may not be recommended for leveling of severely displaced canines whether using self-ligating or conventional brackets. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A comparison of Helicobacter pylori and non-Helicobacter pylori Helicobacter spp. Binding to canine gastric mucosa with defined gastric glycophenotype.

Science.gov (United States)

Amorim, Irina; Freitas, Daniela P; Magalhães, Ana; Faria, Fátima; Lopes, Célia; Faustino, Augusto M; Smet, Annemieke; Haesebrouck, Freddy; Reis, Celso A; Gärtner, Fátima

2014-08-01

The gastric mucosa of dogs is often colonized by non-Helicobacter pylori helicobacters (NHPH), while H. pylori is the predominant gastric Helicobacter species in humans. The colonization of the human gastric mucosa by H. pylori is highly dependent on the recognition of host glycan receptors. Our goal was to define the canine gastric mucosa glycophenotype and to evaluate the capacity of different gastric Helicobacter species to adhere to the canine gastric mucosa. The glycosylation profile in body and antral compartments of the canine gastric mucosa, with focus on the expression of histo-blood group antigens was evaluated. The in vitro binding capacity of FITC-labeled H. pylori and NHPH to the canine gastric mucosa was assessed in cases representative of the canine glycosylation pattern. The canine gastric mucosa lacks expression of type 1 Lewis antigens and presents a broad expression of type 2 structures and A antigen, both in the surface and glandular epithelium. Regarding the canine antral mucosa, H. heilmannii s.s. presented the highest adhesion score whereas in the body region the SabA-positive H. pylori strain was the strain that adhered more. The canine gastric mucosa showed a glycosylation profile different from the human gastric mucosa suggesting that alternative glycan receptors may be involved in Helicobacter spp. binding. Helicobacter pylori and NHPH strains differ in their ability to adhere to canine gastric mucosa. Among the NHPH, H. heilmannii s.s. presented the highest adhesion capacity in agreement with its reported colonization of the canine stomach. © 2014 John Wiley & Sons Ltd.

uPAR EXPRESSION IN CANINE NORMAL PROSTATE AND WITH PROLIFERATIVE DISORDERS

Directory of Open Access Journals (Sweden)

Mariana Rodrigues Faleiro

2013-06-01

Full Text Available Prostatic lesions such as prostatic intraepithelial neoplasia (PIN and proliferative inflammatory atrophy (PIA are studied in human and canine species due to their malignance potential. The plasminogen activator (PA system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC was evaluated by immunohistochemistry in a tissue microarray (TMA slide to establish the role of this enzyme in extracellular matrix (ECM remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1% normal prostates, 46 (13.0% with BPH, 128 (36.1% with PIA, 74 (20.8% with PIN and 71 (20.0% with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.

Penetration of ASM 981 in canine skin: a comparative study.

Science.gov (United States)

Gutzwiller, Meret E Ricklin; Reist, Martin; Persohn, Elke; Peel, John E; Roosje, Petra J

2006-01-01

ASM 981 has been developed for topical treatment of inflammatory skin diseases. It specifically inhibits the production and release of pro-inflammatory cytokines. We measured the skin penetration of ASM 981 in canine skin and compared penetration in living and frozen skin. To make penetration of ASM 981 visible in dog skin, tritium labelled ASM 981 was applied to a living dog and to defrosted skin of the same dog. Using qualitative autoradiography the radioactive molecules were detected in the lumen of the hair follicles until the infundibulum, around the superficial parts of the hair follicles and into a depth of the dermis of 200 to 500 microm. Activity could not be found in deeper parts of the hair follicles, the dermis or in the sebaceous glands. Penetration of ASM 981 is low in canine skin and is only equally spread in the upper third of the dermis 24 hours after application. Penetration in frozen skin takes even longer than in living canine skin but shows the same distribution.

Adjuvant therapy with carboplatin and pamidronate for canine appendicular osteosarcoma.

Science.gov (United States)

Kozicki, A R; Robat, C; Chun, R; Kurzman, I D

2015-09-01

Amputation and chemotherapy are the mainstay of treatment for canine appendicular osteosarcoma (OSA). In vitro studies have demonstrated anti-tumour activity of pamidronate against canine OSA. The purpose of this study was to assess the safety of adding pamidronate to standard post-operative carboplatin chemotherapy in 17 dogs with appendicular OSA treated with limb amputation. Median disease-free interval (DFI) and median survival time (MST) were evaluated as secondary endpoints. Incidence of side effects and treatment outcomes were compared to 14 contemporary control patients treated with carboplatin alone. There were no identified side effects to the pamidronate treatment. The median DFI for the study group was 185 days compared to 172 days for the control group (P = 0.90). The MST of the study group was 311 days compared to 294 days for the control group (P = 0.89). Addition of pamidronate to carboplatin chemotherapy for the treatment of canine appendicular OSA is safe and does not impair efficacy of standard carboplatin treatment. © 2013 Blackwell Publishing Ltd.

Surgical treatments of the impacted canine tooth in young dogs

International Nuclear Information System (INIS)

Amimoto, A.; Iwamoto, S.; Hachimura, H.; Sasaki, K.; Taura, Y.; Nakama, S.; Yamanouchi, T.

1993-01-01

Surgical treatments of the impacted canine tooth were carried out in 8 young dogs, and the results were successful in 12 out of 14 cases (85.7%). The treatments consisting of surgical correction by immediate tipping movement, fenestration of the gingiva, and removal of the impacted tooth, were applied to 14 cases radiographically showing the immature tooth root and no abnormalities in the tooth root or alveolar bone. Impacted teeth were seen in 8 regions of the maxilla and 6 regions of the mandible. Mesioversion was seen in almost all maxillary impacted teeth, while linguoversion or lingual mesioversion in all mandibular cases. Surgical correction was carried out by immediate tipping movement after removal of the retained deciduous canine with or without resection of the alveolar bone. Fixation of the moved teeth was done using a wedge made from the deciduous canine root, which was driven into the vacant alveolar cavity after moving. An additional fixation using a steel wire and/or self-curing resin was done, if necessary

Nonsurgical, nonextraction management of impacted maxillary canine

Directory of Open Access Journals (Sweden)

Jasneet Singh

2018-01-01

Full Text Available NS, a 12 year 2 months old female patient, presented with the chief complaint of irregular teeth. Diagnosis revealed skeletal Class II jaw base relation, with average (toward vertical growth pattern, dentoalveolar angles Class I molar relationship with severe crowding in upper and moderate crowding in the lower arch, normally positioned maxillary incisors but proclined lower incisors, “V” shape constricted maxillary arch with first premolar in crossbite, overretained deciduous molar and a high placed buccoversion canine in the first quadrant and an impacted canine in the second quadrant, constricted mandibular arch with first premolar blocked out in the third quadrant. Treatment with a nonsurgical, nonextraction treatment plan by expansion of the upper arch and taking advantage of natural eruptive forces of the tooth was planned. The final outcome solved the patient's complaints and achieved an esthetically pleasing and functionally adequate occlusal result.

Measurement of lower canine clinical crown index in male and female for gender identification

Directory of Open Access Journals (Sweden)

Rita Dewi Handayani

2007-11-01

Full Text Available The purpose of this research was to acquire the value index of clinical crown lower jaw canine male and female, and to prove whether the index of male's canine is bigger than female's. The samples of the research was the students of Faculty of Dentistry Universitas Padjadjaran class of 1998 until 2001 by using proportional random sampling method according to the criteria and also adjust with the numbers of male and female composition in per class. The characteristic of the research was analytical descriptive with survey technique. The result of t test statistic measurement was that index of clinical crown tower jaw canine of mate was 1.50 and female was 1.21, by using reliance 95%. The inference of the research showed that the index of clinical crown lower jaw canine of male was significantly bigger than female's. The result of the research can be used as auxiliary data from the techniques to process gender identification in odontology forensic.

Apical root resorption of incisors after orthodontic treatment of impacted maxillary canines: a radiographic study.

Science.gov (United States)

Brusveen, Elin Marie Gravdal; Brudvik, Pongsri; Bøe, Olav Egil; Mavragani, Maria

2012-04-01

The purpose of the study was to evaluate impacted maxillary canines as risk factor for orthodontic apical root resorption. The sample comprised 66 patients treated with fixed appliances. Thirty-two patients with a unilateral impacted maxillary canine, which was distanced from the roots of the incisors at a preliminary phase of treatment before bonding, formed the impaction group, and 34 patients without impactions served as the controls. Root shortening was calculated by using pretreatment and posttreatment intraoral radiographs. Inclination of the eruption path of the impacted canine relative to the midline, axis of the lateral incisor, and nasal line, root development, and the medial and vertical positions of the impacted tooth were recorded on orthopantomograms and lateral cephalometric films. The follicle/tooth ratio was evaluated by using periapical radiographs. No significant difference in apical resorption of the maxillary incisors was detected between the impaction and control groups, or between the incisors of the impacted and contralateral sides in the same subject. Likewise, no difference in the severity of root resorption was found between the incisors of impacted side alone and the incisors of the control group. Mesial and vertical inclinations of the impacted canines were negatively related to a lateral incisor's root resorption. No correlations were found between resorption and medial or vertical position of the crown of the canine. The follicle/tooth ratio was significantly related to the mesial inclination of the impacted canine, but not to root resorption. An impacted maxillary canine, after being distanced from the incisor roots, does not seem to be a risk factor for apical root resorption during orthodontic treatment. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Directory of Open Access Journals (Sweden)

Mehdi Hayat Shahi

Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Intracellular Route of Canine Parvovirus Entry

Science.gov (United States)

Vihinen-Ranta, Maija; Kalela, Anne; Mäkinen, Päivi; Kakkola, Laura; Marjomäki, Varpu; Vuento, Matti

1998-01-01

The present study was designed to investigate the endocytic pathway involved in canine parvovirus (CPV) infection. Reduced temperature (18°C) or the microtubule-depolymerizing drug nocodazole was found to inhibit productive infection of canine A72 cells by CPV and caused CPV to be retained in cytoplasmic vesicles as indicated by immunofluorescence microscopy. Consistent with previously published results, these data indicate that CPV enters a host cell via an endocytic route and further suggest that microtubule-dependent delivery of CPV to late endosomes is required for productive infection. Cytoplasmic microinjection of CPV particles was used to circumvent the endocytosis and membrane fusion steps in the entry process. Microinjection experiments showed that CPV particles which were injected directly into the cytoplasm, thus avoiding the endocytic pathway, were unable to initiate progeny virus production. CPV treated at pH 5.0 prior to microinjection was unable to initiate virus production, showing that factors of the endocytic route other than low pH are necessary for the initiation of infection by CPV. PMID:9420290

Canine urothelial carcinoma: genomically aberrant and comparatively relevant.

Science.gov (United States)

Shapiro, S G; Raghunath, S; Williams, C; Motsinger-Reif, A A; Cullen, J M; Liu, T; Albertson, D; Ruvolo, M; Bergstrom Lucas, A; Jin, J; Knapp, D W; Schiffman, J D; Breen, M

2015-06-01

Urothelial carcinoma (UC), also referred to as transitional cell carcinoma (TCC), is the most common bladder malignancy in both human and canine populations. In human UC, numerous studies have demonstrated the prevalence of chromosomal imbalances. Although the histopathology of the disease is similar in both species, studies evaluating the genomic profile of canine UC are lacking, limiting the discovery of key comparative molecular markers associated with driving UC pathogenesis. In the present study, we evaluated 31 primary canine UC biopsies by oligonucleotide array comparative genomic hybridization (oaCGH). Results highlighted the presence of three highly recurrent numerical aberrations: gain of dog chromosome (CFA) 13 and 36 and loss of CFA 19. Regional gains of CFA 13 and 36 were present in 97 % and 84 % of cases, respectively, and losses on CFA 19 were present in 77 % of cases. Fluorescence in situ hybridization (FISH), using targeted bacterial artificial chromosome (BAC) clones and custom Agilent SureFISH probes, was performed to detect and quantify these regions in paraffin-embedded biopsy sections and urine-derived urothelial cells. The data indicate that these three aberrations are potentially diagnostic of UC. Comparison of our canine oaCGH data with that of 285 human cases identified a series of shared copy number aberrations. Using an informatics approach to interrogate the frequency of copy number aberrations across both species, we identified those that had the highest joint probability of association with UC. The most significant joint region contained the gene PABPC1, which should be considered further for its role in UC progression. In addition, cross-species filtering of genome-wide copy number data highlighted several genes as high-profile candidates for further analysis, including CDKN2A, S100A8/9, and LRP1B. We propose that these common aberrations are indicative of an evolutionarily conserved mechanism of pathogenesis and harbor genes

Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology.

Science.gov (United States)

Fenger, Joelle M; London, Cheryl A; Kisseberth, William C

2014-01-01

Osteosarcoma (OSA) is the most common form of malignant bone cancer in children and dogs, although the disease occurs in dogs approximately 10 times more frequently than in people. Multidrug chemotherapy and aggressive surgical techniques have improved survival; however, new therapies for OSA are critical, as little improvement in survival times has been achieved in either dogs or people over the past 15 years, even with significant efforts directed at the incorporation of novel therapeutic approaches. Both clinical and molecular evidence suggests that human and canine OSA share many key features, including tumor location, presence of microscopic metastatic disease at diagnosis, development of chemotherapy-resistant metastases, and altered expression/activation of several proteins (e.g. Met, ezrin, phosphatase and tensin homolog, signal transducer and activator of transcription 3), and p53 mutations, among others. Additionally, canine and pediatric OSA exhibit overlapping transcriptional profiles and shared DNA copy number aberrations, supporting the notion that these diseases are similar at the molecular level. This review will discuss the similarities between pediatric and canine OSA with regard to histology, biologic behavior, and molecular genetic alterations that indicate canine OSA is a relevant, spontaneous, large animal model of the pediatric disease and outline how the study of naturally occurring OSA in dogs will offer additional insights into the biology and future treatment of this disease in both children and dogs. © The Author 2014. Published by Oxford University Press on behalf of the Institute for Laboratory Animal Research. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Long-lived immunity to canine core vaccine antigens in UK dogs as assessed by an in-practice test kit.

Science.gov (United States)

Killey, R; Mynors, C; Pearce, R; Nell, A; Prentis, A; Day, M J

2018-01-01

To determine the utility of an in-practice test kit to detect protective serum antibody against canine distemper virus, canine adenovirus and canine parvovirus type 2 in a sample of the UK dog population. Serum samples from 486 dogs, last vaccinated between less than 1 month and 124 months previously, were tested with the VacciCheck™ test kit for protective antibodies against distemper, adenovirus and parvovirus type 2. A high proportion of the dogs tested (93·6%) had protective antibody against all three of the core vaccine antigens: 95·7% of the dogs were seropositive against canine distemper virus, 97·3% against canine adenovirus and 98·5% against canine parvovirus type 2. The small number of dogs that were seronegative for one or more of the antigens (n = 31) may have had waning of previous serum antibody or may have been rare genetic non-responders to that specific antigen. UK veterinarians can be reassured that triennial revaccination of adult dogs with core vaccines provides long-lived protective immunity. In-practice serological test kits are a valuable tool for informing decision-making about canine core revaccination. © 2017 British Small Animal Veterinary Association.

High-dose antibiotic therapy is superior to a 3-drug combination of prostanoids and lipid A derivative in protecting irradiated canines

International Nuclear Information System (INIS)

Kumar, K.S.; Srinivasan, V.; Toles, R.E.; Miner, V.L.; Jackson, W.E.; Seed, T.M.

2002-01-01

There is an urgent need to develop non-toxic radioprotectors. We tested the efficacy of a 3-drug combination (3-DC) of iloprost, misoprostol, and 3D-MPL (3-deacylated monophosphoryl lipid A) and the effects of postirradiation clinical support with high doses of antibiotics and blood transfusion. Canines were given 3-DC or the vehicle and exposed to 3.4 Gy or 4.1 Gy of 60 Co radiation. Canines irradiated at 4.1 Gy were also given clinical support, which consisted of blood transfusion and antibiotics (gentamicin, and cefoxitin or cephalexin). Peripheral blood cell profile and 60-day survival were used as indices of protection. At 3.4 Gy, 3-DC- or vehicle-treated canines without postirradiation clinical support survived only for 10 to 12 days. Fifty percent of the canines treated with 3-DC or vehicle and provided postirradiation clinical support survived 4.1-Gy irradiation. Survival of canines treated with vehicle before irradiation significantly correlated with postirradiation antibiotic treatments, but not with blood transfusion. The recovery profile of peripheral blood cells in 4.1 Gy-irradiated canines treated with vehicle and antibiotics was better than drug-treated canines. These results indicate that therapy with high doses of intramuscular aminoglycoside antibiotic (gentamicin) and an oral cephalosporin (cephalexin) enhanced survival of irradiated canines. Although blood transfusion correlated with survival of 3-DC treated canines, there were no additional survivors with 3-DC treated canines than the controls. (author)

Pharmacological characterization of canine melancortin-4 receptor and its natural variant V213F.

Science.gov (United States)

Yan, J; Tao, Y-X

2011-08-01

Dogs have become one of the most important companion animals in modern society. However, it is estimated that 20% to 40% of owned dogs are obese, suggesting that obesity has become one of the most important canine health problem. In addition, obesity in dogs also leads to type II diabetes. Because the melanocortin-4 receptor (MC4R) has been shown to be essential in maintaining energy homeostasis in several different species, including rodents and humans, we initiated studies toward elucidating the roles of MC4R in obesity pathogenesis in dogs. Canine MC4R has been cloned, and a missense variant V213F was identified. We designed primers and successfully cloned canine MC4R and generated the variant V213F by site-directed mutagenesis. The objective of this study was to investigate the pharmacological properties of canine MC4R and its natural variant V213F. We measured ligand binding and signaling properties with the use of both natural and synthetic ligands. Human MC4R was also included in the experiments for comparison. Both wild-type canine MC4R and its natural variant V213F functioned normally in terms of binding and signaling. Of the ligands we used, [Nle(4), D-Phe(7)]-α-melanocyte-stimulating hormone is the most potent ligand. We conclude that the cloned canine MC4R is a functional receptor, and the natural variant V213F does not have any functional defect and therefore is not likely to cause obesity in dogs. Copyright © 2011 Elsevier Inc. All rights reserved.

Influence of Radiographic Positioning on Canine Sacroiliac and Lumbosacral Angle Measurements.

Science.gov (United States)

Jones, Susan; Savage, Mason; Naughton, Brian; Singh, Susheela; Robertson, Ian; Roe, Simon C; Marcellin-Little, Denis J; Mathews, Kyle G

2018-01-01

 To evaluate the influence of radiographic malpositioning on canine sacroiliac and lumbosacral inclination angles.  Using canine cadavers, lateral pelvic radiographs were acquired with the radiographic beam in a neutral position and then rotated 5, 10 and 15° to mimic rotational malpositioning. The focal point of the beam was then focused over the abdomen and again over mid-diaphysis of the femur to mimic an abdominal or femoral radiographic study.  Five degrees of rotational malpositioning did not influence measurements of sacroiliac or lumbosacral inclination, but malpositioning by more than 5° led to a significant decrease in both sacroiliac and lumbosacral angles. Moving the focal point to the femur significantly decreased the measured lumbosacral angle. Abdominally centred radiographs had no effect on lumbosacral and sacroiliac angle measurements.  When evaluating canine lumbosacral and sacroiliac angles radiographically, pelvic rotation of more than 5° should be avoided as should the use of lateral radiographs centred over the femur. Schattauer GmbH Stuttgart.

Characterization and modulation of canine mast cell derived eicosanoids

Science.gov (United States)

Lin, Tzu-Yin; London, Cheryl A.

2013-01-01

Mast cells play an important role in both innate and acquired immunity as well as several pathological conditions including allergy, arthritis and neoplasia. They influence these processes by producing a variety of mediators including cytokines, chemokines and eicosanoids. Very little is currently known about the spectrum of inflammatory mediators, particularly eicosanoids (prostaglandins and leukotrienes), produced by canine mast cells. This is important since modulating mast cell derived eicosanoids may help in the treatment of autoimmune and inflammatory disorders. The purpose of this study was to investigate the spectrum of eicosanoids produced by normal canine mast cells and to evaluate the effects of cytokines and non-steroidal anti-inflammatory mediators (NSAIDS) on eicosanoid production and release. Canine bone marrow derived cultured mast cells (cBMCMCs) expressed COX-1, COX-2, and 5-LOX and synthesized and released PGD2, PGE2, LTB4, and LTC4 following activation by a variety of stimuli. The selective COX-2 NSAIDs carprofen (Rimadyl®) and deracoxib (Deramaxx®) inhibited PGD2 and PGE2 production but only slightly inhibited LTB4 and LTC4. The mixed COX-1/COX-2 inhibitor piroxicam blocked PGD2 and PGE2 production, but upregulated LTC4 following treatment while tepoxilan (Zubrin®), a pan COX/LOX inhibitor, markedly reduced the production of all eicosanoids. The LOX inhibitor nordihydroguaiaretic acid (NDGA) prevented LTB4/LTC4 release and BMBMC degranulation. Pre-incubation of cBMCMCs with IL-4 and SCF sensitized these cells to degranulation in response to substance P. In conclusion, canine BMCMCs produce an array of eicosanoids similar to those produced by mast cells from other species. Tepoxilan appeared to be the most effective NSAID for blocking eicosanoid production and thus may be useful for modulating mast cell mediated responses in dogs. PMID:20036014

Association between absolute tumor burden and serum bone-specific alkaline phosphatase in canine appendicular osteosarcoma.

Science.gov (United States)

Sternberg, R A; Pondenis, H C; Yang, X; Mitchell, M A; O'Brien, R T; Garrett, L D; Helferich, W G; Hoffmann, W E; Fan, T M

2013-01-01

In dogs with appendicular osteosarcoma (OSA), increased pretreatment serum bone-specific alkaline phosphatase (BALP) activity is a negative prognostic factor, associated with shorter disease-free intervals and survival times, but a biologic basis for observed differential serum BALP activities in canine OSA patients remains incompletely defined. Serum BALP activity will correlate with absolute tumor burden in dogs with OSA. This study included 96 client-owned dogs with appendicular OSA. In canine OSA cell lines, the expression and membranous release of BALP was evaluated in vitro. The correlation between serum BALP activity and radiographic primary tumor size was evaluated in OSA-bearing dogs. In dogs developing visceral OSA metastases, serial changes in serum BALP activities were evaluated in relation to progression of macroscopic metastases, and visceral metastatic OSA cells were evaluated for BALP expression. In vitro, BALP expression was not associated with either tumorigenic or metastatic phenotype, rather the quantity of membranous BALP released was proportional with cell density. In dogs devoid of macroscopic metastases, there was a positive correlation between serum BALP activity and absolute primary tumor size. In dogs with progressive OSA metastases, serum BALP activity increased and coincided with the development of macroscopic metastases. OSA cells derived from visceral metastatic lesions retained BALP expression. Tumor burden is a determinant of serum BALP activity in dogs with appendicular OSA. The association between increased pretreatment BALP activity and negative clinical prognosis may simply be attributed to greater initial tumor burden, and consequently more advanced tumor stage. Copyright © 2013 by the American College of Veterinary Internal Medicine.

Molecular Epidemiology of Canine Parvovirus, Europe

Science.gov (United States)

Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio

2007-01-01

Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097

Extraction of maxillary canines: Esthetic perceptions of patient smiles among dental professionals and laypeople.

Science.gov (United States)

Thiruvenkatachari, Badri; Javidi, Hanieh; Griffiths, Sarah Elizabeth; Shah, Anwar A; Sandler, Jonathan

2017-10-01

Maxillary canines are generally considered important both cosmetically and functionally. Most claims on the importance of maxillary canines, however, have been based on expert opinions and clinician-based studies. There are no scientific studies in the literature reporting on their cosmetic importance or how laypeople perceive a smile treated by maxillary canine extractions. Our objective was to investigate whether there is any difference in the perceptions of patients' smiles treated by extracting either maxillary canines or first premolars, as judged by orthodontists, dentists, and laypeople. This retrospective study included 24 participants who had unilateral or bilateral extraction of maxillary permanent canines and fixed appliances in the maxillary and mandibular arches to comprehensively correct the malocclusion, selected from orthodontic patients treated at Chesterfield Royal Hospital NHS trust in the United Kingdom over the last 20 years. The control group of patients had extraction of maxillary first premolars followed by fixed appliances and finished to an extremely high standard judged by the requirement that they had been submitted for the Membership in Orthodontics examination. The finished Peer Assessment Rating scores for this group were less than 5. The end-of-treatment frontal extraoral smiling and frontal intraoral views were presented for both groups. The photographs were blinded for extraction choice and standardized for size and brightness using computer software (Adobe Photoshop CC version 14.0; Adobe Systems, San Jose, Calif). The work file was converted to an editable pdf file and e-mailed to the assessors. The assessor panel consisted of 30 members (10 orthodontists, 10 dentists, and 10 laypeople), who were purposely selected. The measures were rated on a 10-point Likert scale. The attractiveness ratings were not statistically significantly different between the canine extraction and premolar extraction groups, with a mean difference of 0

Dentigerous Cyst Associated with Ectopic Canine and a ...

African Journals Online (AJOL)

ankylosis, cystic or neoplastic lesion or trauma may be the local factors ... After clinical and radiographic examination, a provisional diagnosis of ... bone along with the impacted teeth (permanent ectopic canine ... [7] Panoramic radiograph and ...

Expression, Purification and Characterization of Recombinant Canine FGF21 in Escherichia coli.

Science.gov (United States)

Zheng, Zhong; Yang, Chengjun; Yin, Ruofeng; Jiang, Jinxi; He, Haiting; Wang, Xinxin; Kan, Mujie; Xiao, Yechen

2016-01-01

The canine metabolic diseases, such as obesity and diabetes, have become a worldwide problem. Fibroblast growth factor 21 (FGF21) is a potent regulator which has many biological functions relative to metabolism regulation. It suggests that FGF21 plays important roles in regulating canine metabolic diseases. To acquire the recombinant canine FGF21 (rcFGF21) in Escherichia coli, the recombinant bacteria were induced by 0.5 mM IPTG for 16 hours at 16 °C, and the rcFGF21 protein was purified by Ni-NTA. 8 mg rcFGF21 was acquired from one liter bacteria. The rcFGF21 protein has specific immunoblot reactivity against anti-FGF21 and anti-His antibody. The in vivo experimental result showed that rcFGF21 can significantly reduce plasma glucose of STZ-induced diabetic mice.

Establishment of Demodex canis on canine skin engrafted onto scid-beige mice.

Science.gov (United States)

Caswell, J L; Yager, J A; Barta, J R; Parker, W

1996-12-01

A small animal model of canine demodicosis is described. Normal canine skin was engrafted onto scid (severe combined immunodeficient)-beige mice, which lack functional B and T lymphocytes and have reduced natural killer cell activity. The xenografts were later infected with Demodex canis collected from a dog with demodicosis. At 30-112 days following infection, mites were seen histologically in the canine hair follicles of the engrafted skin. Demodex canis adults, nymphs, larvae, and eggs were present in samples macerated in sodium hydroxide. Mite infestations could not be demonstrated in the mouse skin, nor were mites passed from the infected graft to uninfected skin grafts on in-contact mice. This model may be utilized to assess the efficacy of miticidal treatments, to evaluate the importance of specific components of the immune response, and to study the biology of D. canis.

Potential hazard of zoonotic parasites present in canine feces in Puerto Escondido, Oaxaca

Directory of Open Access Journals (Sweden)

León Vélez-Hernández

2014-11-01

Full Text Available Objective. To estimate the zoonotic parasites prevalence in feral dog feces in Puerto Escondido. Material and methods. The fecalism frecuency was estimated in ten zones. To identify the parasites parasitological flotation and direct smear methods were used. The parasitic prevalence was estimated in the canine feces. Results. All the zones presented canine fecalism. The parasitic prevalence in the feces was 73.33%. The parasites with the highest prevalence were Toxocara canis (47.78%, Ancylostoma caninum (17.88%, and Dipylidium caninum (13.89%. Conclusion. Canine fecalism comes from strayed and owned dogs. 66.66% of the parasites found in the dog feces are zoonotics. The factors associated to this problem are the suburban habitat, waste mishandling and nil tenure of stray dogs.

Radioimmunoassay of canine growth hormone

International Nuclear Information System (INIS)

Eigenmann, J.E.; Eigenmann, R.Y.

1981-01-01

A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)

An evaluation of the histological effects of intra-articular methadone in the canine model.

Science.gov (United States)

Jones, Timothy A; Hand, Walter R; Ports, Michael D; Unger, Daniel V; Herbert, Daniel; Pellegrini, Joseph E

2003-02-01

Methadone hydrochloride is an opiate that has pharmacodynamic and pharmacokinetic properties that suggest it may provide longer analgesia than morphine when administered via the intra-articular route. However, no studies to date have been conducted examining the effects of intra-articular methadone hydrochloride on local tissues. Therefore, the purpose of this study was to determine the histopathologic effects of intra-articular methadone hydrochloride on local tissues in the canine knee. Nine canines, 1 to 4 years old, weighing between 20 kg and 23 kg were used. All canines had their knees randomized to receive either bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 5 mg methadone hydrochloride (0.5 mL) for the study knee, or bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 0.5 mL normal saline for the control knee. Serum methadone hydrochloride levels were obtained on all canines at 6 and 24 hours. Canines were randomly assigned to 1 of 3 groups to be euthanized at either 24 hours, 14 days, or 28 days. Following euthanization and necropsy, synovial fluid levels and tissue samples were obtained and examined for histopathologic changes. Synovial fluid samples noted a few white blood cells at 24 hours and none at 14 and 28 days. Tissue samples showed no histopathologic changes, and serum concentration levels of methadone hydrochloride were negligible.

Military veterans and canine assistance for post-traumatic stress disorder: A narrative review of the literature.

Science.gov (United States)

Krause-Parello, Cheryl A; Sarni, Sarah; Padden, Eleni

2016-12-01

Veterans with post-traumatic stress disorder (PTSD) are a vulnerable population at high risk for depression, isolation, and suicide. A substantial body of anecdotal evidence exists supporting the use of canines as an effective adjunct treatment for this population. However, a comprehensive review of its use based on scientific literature has thus far not been conducted. A narrative literature review was conducted to examine the current state of the science on canine assistance for veterans diagnosed with PTSD in order to synthesize current empirical knowledge on the subject. Articles were retrieved among the small body of recent literature using computerized database searches. Inclusion criteria included peer-reviewed journal publications published through October 1st, 2015. Only originally published articles that examined the outcomes of canine assistance on veterans with PTSD were examined. Additionally, each included article was specific to veterans, dogs, and, PTSD in combination rather than article that discuss the concepts separately. Exclusion criteria included symposia and conference material, dissertations, media articles, and no mention of canines as a treatment modality. 563 articles were retrieved; 6 met the criteria. When evaluating data, information and themes were extracted into an Excel table; this table was employed in the synthesis of information into manuscript form. The following themes were explored within the selected publications: What is Canine Assistance; Why Use Canine Assistance for PTSD in Veterans; Concerns; and Future Directions. The literature endorsed canine assistance for PTSD in veterans as a promising modality. Authors also raised concerns about lack of protocols, cost and availability barriers, and animal welfare calling for additional, rigorous research to advance its use as a treatment for veterans with PTSD. PTSD continues to pose significant psychological, health, and welfare challenges to veterans and the multi

Orthodontic tooth movement of total buccally blocked-out canine: a case report

OpenAIRE

Alkhal, Hessa M; Rabie, Bakr; Wong, Ricky W K

2009-01-01

Orthodontic tooth movement of total buccally blocked-out canine is usually difficult as it is related with the problems of severe crowding, midline deviation, involvement of long root movement and risk of gingival recession. A case report was presented to illustrate the treatment principles. It demonstrated with careful planning in extraction sequence and orthodontic mechanics to deliver light, controlled force, condition of totally blocked out canine could be corrected with good results.

T cell cytokine gene polymorphisms in canine diabetes mellitus.

Science.gov (United States)

Short, Andrea D; Catchpole, Brian; Kennedy, Lorna J; Barnes, Annette; Lee, Andy C; Jones, Chris A; Fretwell, Neale; Ollier, William E R

2009-03-15

Insulin-deficiency diabetes in dogs shares some similarities with human latent autoimmune diabetes of adults (LADA). Canine diabetes is likely to have a complex pathogenesis with multiple genes contributing to overall susceptibility and/or disease progression. An association has previously been shown between canine diabetes and MHC class II genes, although other genes are also likely to contribute to the genetic risk. Potential diabetes susceptibility genes include immuno-regulatory TH1/TH2 cytokines such as IFNgamma, IL-12, IL-4 and IL-10. We screened these candidate genes for single nucleotide polymorphisms (SNPs) in a range of different dog breeds using dHPLC analysis and DNA sequencing. Thirty-eight of the SNPs were genotyped in crossbreed dogs and seven other breed groups (Labrador Retriever, West Highland White Terrier, Collie, Schnauzer, Cairn Terrier, Samoyed and Cavalier King Charles Spaniel), which demonstrated substantial intra-breed differences in allele frequencies. When SNPs were examined for an association with diabetes by case:control analysis significant associations were observed for IL-4 in three breeds, the Collie, Cairn Terrier and Schnauzer and for IL-10 in the Cavalier King Charles Spaniel. These results suggest that canine cytokine genes regulating the TH1/TH2 immune balance might play a contributory role in determining susceptibility to diabetes in some breeds.

Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013

DEFF Research Database (Denmark)

Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted

2015-01-01

During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit...... distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine...... distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case...

Evaluation of the biological differences of canine and human factor VIII in gene delivery: Implications in human hemophilia treatment

Science.gov (United States)

The canine is the most important large animal model for testing novel hemophilia A(HA) treatment. It is often necessary to use canine factor VIII (cFIII) gene or protein for the evaluation of HA treatment in the canine model. However, the different biological properties between cFVIII and human FVII...

Root length and alveolar bone level of impacted canines and adjacent teeth after orthodontic traction: a long-term evaluation

Science.gov (United States)

da SILVA, Aldir Cordeiro; CAPISTRANO, Anderson; de ALMEIDA-PEDRIN, Renata Rodrigues; CARDOSO, Maurício de Almeida; CONTI, Ana Cláudia de Castro Ferreira; CAPELOZZA, Leopoldino

2017-01-01

Abstract Objective The aim of this retrospective study was to evaluate the long-term effects of orthodontic traction on root length and alveolar bone level in impacted canines and adjacent teeth. Material and Methods Sample consisted of 16 patients (nine males and seven females), mean initial age 11 years and 8 months presenting with unilaterally maxillary impacted canines, palatally displaced, treated with the same surgical and orthodontic approach. Teeth from the impacted-canine side were assigned as Group I (GI), and contralateral teeth as control, Group II (GII). The mean age of patients at the end of orthodontic treatment was 14 years and 2 months and the mean post-treatment time was 5 years and 11 months. Both contralateral erupted maxillary canines and adjacent teeth served as control. Root length and alveolar bone level (buccal and palatal) were evaluated on cone-beam computed tomography (CBCT) images. The comparison of root length and alveolar bone level changes between groups were assessed by applying paired t-test, at a significance level of 5% (p<0.05). Results There were no statistically significant differences in root length and buccal and palatal bone levels of canines and adjacent teeth among groups. Conclusions Impacted canine treatment by closed-eruption technique associated with canine crown perforation, has a minimal effect on root length and buccal and palatal alveolar bone level in both canine and adjacent teeth, demonstrating that this treatment protocol has a good long-term prognosis. PMID:28198979

Orthodontic management of a dilacerated central incisor and partially impacted canine with unilateral extraction - A case report.

Science.gov (United States)

Felicita, A Sumathi

2017-10-01

To align a dilacerated maxillary central incisor and partially impacted canine with unilateral extraction in a young patient with skeletal deep bite. A 14 year old male patient reported to the hospital with skeletal deep bite (basal plane angle-17°), severe horizontal pattern of growth (Go-Gn to Sn -22°), upright maxillary incisors (U1 to NA -26°) and retroclined lower incisors (L1 to NB -11°). The maxillary left central incisor was dilacerated, and the maxillary left canine was partially impacted. Unilateral extraction of the left maxillary premolar and left mandibular central incisor was done. A canine disimpaction spring was used to align the impacted canine. An anterior bite plane was given to open the bite. Superimposition of lateral cephalogram (T1, T2) revealed bite opening, normal overjet and overbite. There was backward rotation of the mandible and increase in lower anterior facial height. There was no evidence of root resorption or loss of vitality in the dilacerated tooth. Clinically the canine was well aligned in the arch. Orthodontic management of a dilacerated incisor can be done without root resorption or loss of vitality. The partially impacted canine was well aligned in the arch. Unilateral extraction can produce good treatment results.

In vitro anti-tubulin effects of mebendazole and fenbendazole on canine glioma cells.

Science.gov (United States)

Lai, S R; Castello, S A; Robinson, A C; Koehler, J W

2017-12-01

Benzimidazole anthelmintics have reported anti-neoplastic effects both in vitro and in vivo. The purpose of this study was to evaluate the in vitro chemosensitivity of three canine glioma cell lines to mebendazole and fenbendazole. The mean inhibitory concentration (IC 50 ) (±SD) obtained from performing the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay after treating J3T, G06-A, and SDT-3G cells for 72 h with mebendazole were 0.030 ± 0.003, 0.080 ± 0.015 and 0.030 ± 0.006 μM respectively, while those for fenbendazole were 0.550  ± 0.015, 1.530 ± 0.159 and 0.690 ± 0.095 μM; treatment of primary canine fibroblasts for 72 h at IC 50 showed no significant effect. Immunofluorescence studies showed disruption of tubulin after treatment. Mebendazole and fenbendazole are cytotoxic in canine glioma cell lines in vitro and may be good candidates for treatment of canine gliomas. Further in vivo studies are required. © 2017 John Wiley & Sons Ltd.

Proof of concept of a workflow methodology for the creation of basic canine head anatomy veterinary education tool using augmented reality.

Directory of Open Access Journals (Sweden)

Roxie Christ

Full Text Available Neuroanatomy can be challenging to both teach and learn within the undergraduate veterinary medicine and surgery curriculum. Traditional techniques have been used for many years, but there has now been a progression to move towards alternative digital models and interactive 3D models to engage the learner. However, digital innovations in the curriculum have typically involved the medical curriculum rather than the veterinary curriculum. Therefore, we aimed to create a simple workflow methodology to highlight the simplicity there is in creating a mobile augmented reality application of basic canine head anatomy. Using canine CT and MRI scans and widely available software programs, we demonstrate how to create an interactive model of head anatomy. This was applied to augmented reality for a popular Android mobile device to demonstrate the user-friendly interface. Here we present the processes, challenges and resolutions for the creation of a highly accurate, data based anatomical model that could potentially be used in the veterinary curriculum. This proof of concept study provides an excellent framework for the creation of augmented reality training products for veterinary education. The lack of similar resources within this field provides the ideal platform to extend this into other areas of veterinary education and beyond.

Proof of concept of a workflow methodology for the creation of basic canine head anatomy veterinary education tool using augmented reality.

Science.gov (United States)

Christ, Roxie; Guevar, Julien; Poyade, Matthieu; Rea, Paul M

2018-01-01

Neuroanatomy can be challenging to both teach and learn within the undergraduate veterinary medicine and surgery curriculum. Traditional techniques have been used for many years, but there has now been a progression to move towards alternative digital models and interactive 3D models to engage the learner. However, digital innovations in the curriculum have typically involved the medical curriculum rather than the veterinary curriculum. Therefore, we aimed to create a simple workflow methodology to highlight the simplicity there is in creating a mobile augmented reality application of basic canine head anatomy. Using canine CT and MRI scans and widely available software programs, we demonstrate how to create an interactive model of head anatomy. This was applied to augmented reality for a popular Android mobile device to demonstrate the user-friendly interface. Here we present the processes, challenges and resolutions for the creation of a highly accurate, data based anatomical model that could potentially be used in the veterinary curriculum. This proof of concept study provides an excellent framework for the creation of augmented reality training products for veterinary education. The lack of similar resources within this field provides the ideal platform to extend this into other areas of veterinary education and beyond.

Effects of the canine rattlesnake vaccine in moderate to severe cases of canine crotalid envenomation

Directory of Open Access Journals (Sweden)

Leonard MJ

2014-10-01

Full Text Available McGee J Leonard,1 Catherine Bresee,2 Andrew Cruikshank1 1Animal Specialty and Emergency Center, Los Angeles, CA, USA; 2The Biostatistics and Bioinformatics Research Center, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: This is a retrospective multicenter study (2006–2012 examining a population of dogs with moderate to severe crotalid envenomation for protective effects of the canine rattlesnake vaccine. Five nonacademic emergency and referral veterinary hospitals in Southern California were involved in the study and contributed records regarding a total of 82 client-owned dogs that were treated for naturally occurring rattlesnake envenomation. All dogs received antivenin (Crotalidae polyvalent, with dosages ranging from one to three vials (mean: 1.3±0.6. Fourteen dogs (17% had a history of prior vaccination against crotalid venom. In univariate logistic regression modeling, cases with lower body weight (P=0.0001 or higher snakebite severity scores (P<0.0001 were associated with greater morbidity. No statistically significant difference in morbidity or mortality between vaccinated and unvaccinated dogs was found. The findings of this study did not identify a significantly protective effect of previous vaccination in the cases of moderate to severe rattlesnake envenomation that require treatment with antivenin. Keywords: rattlesnake envenomation, vaccine, antivenin, canine

Assessment of radiographic factors affecting surgical exposure and orthodontic alignment of impacted canines of the palate: a 15-year retrospective study.

Science.gov (United States)

Motamedi, Mohammad Hosein Kalantar; Tabatabaie, Fataneh Alavi; Navi, Fina; Shafeie, Hasan Ali; Fard, Behnam Khosravani; Hayati, Zahra

2009-06-01

Impacted canines require a combination of both surgical and orthodontic management. In this study, patients treated for bone-impacted canines of the hard palatal were evaluated to assess which radiographic factors influenced the feasibility to move impacted maxillary permanent canines from the hard palate into the alveolar arch. Eighty patients aged 12 to 24 (average 16 years) were treated surgically and orthodontically to align 146 bone-impacted canines of the hard palate (from 1994 to 2008). Factors such as age, sex, angulation of the canine to the midline (CAM), anomaly of the canine root (RA), overlap of the adjacent lateral incisor root (OALIR), and ratio of root formation (RRF) upon treatment were documented. Radiographic records and demographic data were assessed. The following radiographic measurements of canine position were made from the orthopantomogram (OPG): (1) angulation to the midline, (2) anteroposterior position of the root, (3) overlap of the adjacent incisor. RA or dilaceration was assessed from the OPG, maxillary occlusal (MO), and periapical (PA) radiographs. Whether the impacted canine had responded to surgical exposure and was orthodontically aligned, or surgically removed and discarded was also recorded. The data were analyzed to assess and correlate significance. Eighty patients aged 12 to 24 (19 males and 61 females) with 146 bone-impacted permanent canines of the hard palatal were treated. One hundred and three teeth (70.54%) had responded to surgical exposure and orthodontic alignment within 9 to 12 months. Forty-three impacted canine teeth (29.46%) had to be surgically removed because of ankylosis and no movement after 8 to 9 months using 50 to 60 g of traction force via elastic chains. Data analysis via chi-square and Pearson correlation tests showed that as the CAM increased (> 45 degrees), the canine was more likely to be unresponsive to treatment (P half the root) of the adjacent lateral incisor root (OALIR) via the canine crown