WorldWideScience

Sample records for canine distemper virus

  1. 9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

  2. Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

    Science.gov (United States)

    Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

    2017-06-01

    Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

  3. The Ondersteport Canine distemper virus strain and measles ...

    African Journals Online (AJOL)

    Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

  4. Canine distemper virus-associated hypocalcemia.

    Science.gov (United States)

    Weisbrode, S E; Krakowka, S

    1979-01-01

    A retrospective study was done to correlate serum calcium concentrations and parathyroid gland ultrastructure to clinical, immunologic, and pathologic changes experimentally induced in gnotobiotic dogs by canine distemper virus (CDV). Dogs infected with CDV had significantly reduced serum calcium concentrations associated with ultrastructural evidence of parathyroid gland inactivity, degeneration, and viral inclusions. Although CDV-infected dogs exhibited neurologic signs, minimal lesions were present in the central nervous system. It is suggested that viral-induced parathyroid dysfunction may contribute to neutrologic disturbance of CDV infection.

  5. Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

    Science.gov (United States)

    Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

    2016-11-01

    The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

  6. Recombinant canine distemper virus serves as bivalent live vaccine against rabies and canine distemper.

    Science.gov (United States)

    Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao

    2012-07-20

    Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Canine distemper virus in Lake Baikal seals (Phoca sibirica).

    NARCIS (Netherlands)

    L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)

    1996-01-01

    textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates

  8. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Directory of Open Access Journals (Sweden)

    Otávio Valério Carvalho

    2012-01-01

    Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

  9. Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

    Science.gov (United States)

    Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo

    2012-01-01

    Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

  10. Canine distemper virus - a morbillivirus in search of new hosts?

    NARCIS (Netherlands)

    T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions

  11. Genetic variant of canine distemper virus from clinical cases in ...

    African Journals Online (AJOL)

    Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...

  12. Canine distemper virus detection in asymptomatic and non vaccinated dogs

    Directory of Open Access Journals (Sweden)

    Helen L. Del Puerto

    2010-02-01

    Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

  13. DNA vaccine encoding nucleocapsid and surface proteins of wild type canine distemper virus protects its natural host against distemper.

    Science.gov (United States)

    Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A

    2000-07-01

    Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.

  14. Vaccination of harbour seals (Phoca vitulina) against phocid distemper with two different inactivated canine distemper virus (CDV) vaccines.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); M.W.G. van de Bildt (Marco); H.N. Brugge; P.J.H. Reijnders; E.J. Vedder (Lies); J. Kuiper; P. de Vries (Petra); J. Groen (Jan); H.C. Walvoort; F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)

    1989-01-01

    textabstractTwo inactivated canine distemper virus (CDV) vaccines--an adjuvanted whole inactivated virus and a subunit ISCOM preparation--were tested for their ability to induce protective immunity in harbour seals (Phoca vitulina) against phocid distemper, a disease that recently killed greater

  15. Occurrence of different Canine distemper virus lineages in Italian dogs.

    Science.gov (United States)

    Balboni, Andrea; De Lorenzo Dandola, Giorgia; Scagliarini, Alessandra; Prosperi, Santino; Battilani, Mara

    2014-01-01

    This study describes the sequence analysis of the H gene of 7 Canine distemper virus (CDV) strains identified in dogs in Italy between years 2002-2012. The phylogenetic analysis showed that the CDV strains belonged to 2 clusters: 6 viruses were identified as Arctic-like lineage and 1 as Europe 1 lineage. These data show a considerable prevalence of Arctic-like-CDVs in the analysed dogs. The dogs and the 3 viruses more recently identified showed 4 distinctive amino acid mutations compared to all other Arctic CDVs.

  16. Canine distemper virus ISCOMS induce protection in harbour seals (Phoca vitulina) against phocid distemper but still allow subsequent infection with phocid distemper virus-1.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); E.J. Vedder (Lies); C. Örvell; T. Barrett (Thomas); A.D.M.E. Osterhaus (Albert); M.W.G. van de Bildt (Marco)

    1992-01-01

    textabstractA candidate canine distemper virus (CDV) ISCOM vaccine has been shown to be effective in protecting harbour seals (Phoca vitulina) from phocid distemper in 1988. However, of the 35 harbour seals receiving this vaccine upon admission to a seal rehabilitation and research centre

  17. Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane

    Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission of the virus...

  18. 9 CFR 113.306 - Canine Distemper Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

  19. Advances in canine distemper virus pathogenesis research: a wildlife perspective.

    Science.gov (United States)

    Loots, Angelika K; Mitchell, Emily; Dalton, Desiré L; Kotzé, Antoinette; Venter, Estelle H

    2017-03-01

    Canine distemper virus (CDV) has emerged as a significant disease of wildlife, which is highly contagious and readily transmitted between susceptible hosts. Initially described as an infectious disease of domestic dogs, it is now recognized as a global multi-host pathogen, infecting and causing mass mortalities in a wide range of carnivore species. The last decade has seen the effect of numerous CDV outbreaks in various wildlife populations. Prevention of CDV requires a clear understanding of the potential hosts in danger of infection as well as the dynamic pathways CDV uses to gain entry to its host cells and its ability to initiate viral shedding and disease transmission. We review recent research conducted on CDV infections in wildlife, including the latest findings on the causes of host specificity and cellular receptors involved in distemper pathogenesis.

  20. Isolation and phylogenetic characterization of Canine distemper virus from India.

    Science.gov (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek

    2015-09-01

    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.

  1. Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny

    Directory of Open Access Journals (Sweden)

    Jane Megid

    2013-02-01

    Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.

  2. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy

    DEFF Research Database (Denmark)

    Martella, V.; Cirone, F.; Elia, G.

    2006-01-01

    Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...

  3. Canine distemper virus (CDV) in another big cat: should CDV be renamed carnivore distemper virus?

    Science.gov (United States)

    Terio, Karen A; Craft, Meggan E

    2013-09-17

    One of the greatest threats to the conservation of wild cat populations may be dogs or, at least, one of their viruses. Canine distemper virus (CDV), a single-stranded RNA virus in the Paramyxoviridae family and genus Morbillivirus, infects and causes disease in a variety of species, not just canids. An outbreak of CDV in wild lions in the Serengeti, Tanzania, in 1994 was a wake-up call for conservationists, as it demonstrated that an infectious disease could swiftly impact a previously healthy felid population. To understand how this virus causes disease in noncanid hosts, researchers have focused on specific mutations in the binding site of the CDV hemagglutinin gene. Now, Seimon et al. provide information on CDV in its latest feline victim, the endangered wild Amur tiger (Panthera tigris altaica) [T. A. Seimon et al., mBio 4(4):e00410-13, 2013, doi:10.1128/mBio.00410-13]. Their findings of CDV strains infecting tigers, in combination with recent information from other felids, paints a different picture, one in which CDV strains from a variety of geographic lineages and with a variety of amino acid residues in the hemagglutinin gene binding site can infect cats and cause disease. Although CDV has been known as a multihost disease since its discovery in domestic dogs in 1905, perhaps it is time to reconsider whether these noncanid species are not just incidental or "spillover" hosts but, rather, a normal part of the complex ecology of this infectious disease.

  4. Prevalence of antibodies against canine distemper virus among red foxes in Luxembourg

    NARCIS (Netherlands)

    B.C. Damien; S. Losch; J. Mossong; C.P. Muller (Claude); A.D.M.E. Osterhaus (Albert); B.E.E. Martina (Byron)

    2002-01-01

    textabstractCanine distemper virus (CDV) has a wide host spectrum, and during the past years, distemper has been observed in species that were previously not considered to be susceptible. In this study, we investigated the prevalence of CDV-specific antibodies in red foxes (Vulpes vulpes) sampled

  5. Prevalence of antibodies against canine distemper virus among red foxes in Luxembourg.

    NARCIS (Netherlands)

    B.C. Damien; B.E.E. Martina (Byron); S. Losch; A.D.M.E. Osterhaus (Albert); C.P. Muller (Claude)

    2002-01-01

    textabstractCanine distemper virus (CDV) has a wide host spectrum, and during the past years, distemper has been observed in species that were previously not considered to be susceptible. In this study, we investigated the prevalence of CDV-specific antibodies in red foxes (Vulpes vulpes) sampled

  6. Epizootic canine distemper virus infection among wild mammals.

    Science.gov (United States)

    Kameo, Yuki; Nagao, Yumiko; Nishio, Yohei; Shimoda, Hiroshi; Nakano, Hitoshi; Suzuki, Kazuo; Une, Yumi; Sato, Hiroshi; Shimojima, Masayuki; Maeda, Ken

    2012-01-27

    In the spring of 2007, seven raccoon dogs and a weasel were captured near the city of Tanabe in Wakayama prefecture, Japan. The causative agent of the animals' death 1-2 days after capture was identified as canine distemper virus (CDV) by virus isolation, immunostaining with an anti-CDV polyclonal antibody, and a commercially available CDV antigen-detection kit. Sequence analysis of hemagglutinin genes indicated the isolated viruses belong to genotype Asia-1 and possess the substitution from tyrosine (Y) to histidine (H) at position 549 that is associated with the spread of CDV to non-canine hosts. A serosurvey for CDV was then conducted among wild animals in the region. The animals assayed consisted of 104 raccoons, 41 wild boars, 19 raccoon dogs, five Sika deer, two badgers, one weasel, one marten, one Siberian weasel and one fox. Virus-neutralization (VN) tests showed that, except for fox and weasel, all of the species assayed had VN antibodies to CDV. Interestingly, 11 of the 41 wild boars (27%) and two of the five Sika deer assayed possessed VN antibodies to CDV. These findings indicate that CDV infection was widespread among wild mammals during this epizootic. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  8. A canine distemper model of virus-induced anergy.

    Science.gov (United States)

    Mangi, R J; Munyer, T P; Krakowka, S; Jacoby, R O; Kantor, F S

    1976-05-01

    For development of an animal model of virus-induced anergy, the effect of canine distemper virus (CDV) upon cell-mediated immunity in dogs was investigated. First, canine cutaneous reactions and in vitro lymphocyte responses to soluble protein antigens were characterized. Dogs immunized with picryl guinea pig albumin and with keyhole limpet hemocyanin (both in complete Freund's adjuvant) responded reproducibly to intracutaneous challenge with these antigens. Reactivity peaked in 20-40 days (maximal induration, 6-50 mm). Lymphocytes from these animals responded in vitro to stimulation with keyhole limpet hemocyanin or purified protein derivative. This stimulation was antigen-specific and was maximal on day 6 of culture. Infection with CDV depressed cutaneous reactivity and lymphocyte response in vitro to antigens and mitogens. This effect was transient in animals previously vaccinated with attenuated CDV; however, gnotobiotic puppies (susceptible to CDV) had prolonged depression of cell-mediated immunity and lymphopenia. Some of these animals developed neurologic symptoms and died. The findings indicate that CDV infection is a potentially useful model for study of virus-induced depression of T (thymus)-cell responses and support the hypothesis that there is more than one mechanism responsible for this phenomenon.

  9. Early life DNA vaccination with the H gene of Canine distemper virus induces robust protection against distemper

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

    2009-01-01

    Young mink kits (n = 8)were vaccinated withDNA plasmids encoding the viral haemagglutinin protein (H) of a vaccine strain of Canine distemper virus (CDV). Virus neutralising (VN) antibodieswere induced after 2 immunisations and after the third immunisation all kits had high VN antibody titres...

  10. Canine Distemper Virus (CDV) in Another Big Cat: Should CDV Be Renamed Carnivore Distemper Virus?

    Science.gov (United States)

    Terio, Karen A.; Craft, Meggan E.

    2013-01-01

    ABSTRACT One of the greatest threats to the conservation of wild cat populations may be dogs or, at least, one of their viruses. Canine distemper virus (CDV), a single-stranded RNA virus in the Paramyxoviridae family and genus Morbillivirus, infects and causes disease in a variety of species, not just canids. An outbreak of CDV in wild lions in the Serengeti, Tanzania, in 1994 was a wake-up call for conservationists, as it demonstrated that an infectious disease could swiftly impact a previously healthy felid population. To understand how this virus causes disease in noncanid hosts, researchers have focused on specific mutations in the binding site of the CDV hemagglutinin gene. Now, Seimon et al. provide information on CDV in its latest feline victim, the endangered wild Amur tiger (Panthera tigris altaica) [T. A. Seimon et al., mBio 4(4):e00410-13, 2013, doi:10.1128/mBio.00410-13]. Their findings of CDV strains infecting tigers, in combination with recent information from other felids, paints a different picture, one in which CDV strains from a variety of geographic lineages and with a variety of amino acid residues in the hemagglutinin gene binding site can infect cats and cause disease. Although CDV has been known as a multihost disease since its discovery in domestic dogs in 1905, perhaps it is time to reconsider whether these noncanid species are not just incidental or “spillover” hosts but, rather, a normal part of the complex ecology of this infectious disease. PMID:24045642

  11. Fatal canine distemper virus infection of giant pandas in China.

    Science.gov (United States)

    Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

    2016-06-16

    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species.

  12. Fatal canine distemper virus infection of giant pandas in China

    Science.gov (United States)

    Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

    2016-01-01

    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species. PMID:27310722

  13. Failure of attenuated canine distemper virus (Rockborn strain) to suppress lymphocyte blastogenesis in dogs.

    Science.gov (United States)

    Schultz, R D

    1976-01-01

    The attenuated Rockborn strain of canine distemper virus is commonly used in commercial vaccines. Since immunosuppression is a common feature of virulent (Snyder Hill) distemper virus infection of the dog, an evaluation of the cellular immune functions of dogs given inoculums of the less virulent Rockborn strain was done using lymphocyte blastogenesis responses to various mitogens. Unlike the viruslent Snyder Hill strain, the attenuated distemper virus did not alter lymphocyte blastogenesis responses to phytohemaglutinin (PHA) and pokeweed mitogen (PWM) which are considered in vitro correlates of T and B cell immunity.

  14. Inactivated Recombinant Rabies Viruses Displaying Canine Distemper Virus Glycoproteins Induce Protective Immunity against Both Pathogens

    OpenAIRE

    da Fontoura Budaszewski, Renata; Hudacek, Andrew; Sawatsky, Bevan; Krämer, Beate; Yin, Xiangping; Schnell, Matthias J.; von Messling, Veronika

    2017-01-01

    The development of multivalent vaccines is an attractive methodology for the simultaneous prevention of several infectious diseases in vulnerable populations. Both canine distemper virus (CDV) and rabies virus (RABV) cause lethal disease in wild and domestic carnivores. While RABV vaccines are inactivated, the live-attenuated CDV vaccines retain residual virulence for highly susceptible wildlife species. In this study, we developed recombinant bivalent vaccine candidates based on recombinant ...

  15. Serosurvey for canine distemper virus exposure in dogs in communal lands in Zimbabwe

    Directory of Open Access Journals (Sweden)

    P.J. Kelly

    2005-06-01

    Full Text Available Sera from 173 apparently healthy, unvaccinated dogs from 4 widely separated communal lands in Zimbabwe were tested by ELISA for antibodies against canine distemper virus. Overall, 82 % were positive with high prevalences found in each communal land. The highest seroprevalence was in dogs between 1 and 2 years of age (91 %; 49/54. These results show dogs in the communal lands of Zimbabwe are commonly exposed to canine distemper virus and that a substantial number survive infection. The role that the virus might play in the high mortality rate of the dog population on communal land warrants further investigation.

  16. Canine Distemper Virus in Wild Felids of Costa Rica.

    Science.gov (United States)

    Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea

    2016-04-28

    Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores.

  17. Fatal vaccine-induced canine distemper virus infection in black-footed ferrets

    Science.gov (United States)

    Carpenter, J.W.; Appel, M.J.G.; Erickson, R.C.; Novilla, M.N.

    1976-01-01

    Four black-footed ferrets that were live-trapped in South Dakota and transported to the Patuxent Wildlife Research Center died within 21 days after vaccination with modified live canine distemper virus. Immunofluorescence, European ferret inoculation, virus isolation attempts, and serum-neutralization tests indicated insufficient attenuation of the vaccine for this species.

  18. Measles vaccination of nonhuman primates provides partial protection against infection with canine distemper virus

    NARCIS (Netherlands)

    R.D. de Vries (Rory); M. Ludlow (Martin); R.J. Verbugh (Joyce); G. van Amerongen (Geert); S. Yüksel (Selma); D.T. Nguyen (Tien); S. McQuaid (Stephen); A.D.M.E. Osterhaus (Albert); W.P. Duprex (Paul); R.L. de Swart (Rik)

    2014-01-01

    textabstractMeasles virus (MV) is being considered for global eradication, which would likely reduce compliance with MV vaccination. As a result, children will grow up without MV-specific immunity, creating a potential niche for closely related animal morbilliviruses such as canine distemper virus

  19. Frequency of Virus Coinfection in Raccoons ( Procyon lotor) and Striped Skunks ( Mephitis mephitis) During a Concurrent Rabies and Canine Distemper Outbreak.

    Science.gov (United States)

    Jardine, Claire M; Buchanan, Tore; Ojkic, Davor; Campbell, G Douglas; Bowman, Jeff

    2018-03-08

    Rabies and canine distemper virus infections in wildlife share similar presenting signs. Canine distemper virus was detected using real-time PCR of conjunctival swabs in rabies positive raccoons (22/32) and skunks (7/34) during a concurrent rabies and canine distemper outbreak in Ontario, Canada in 2015-2016. Coinfections with both viruses should be considered, particularly in distemper endemic areas that are at risk of rabies incursion.

  20. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter

    2009-01-01

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...

  1. Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

    Science.gov (United States)

    Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

    2004-01-01

    The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

  2. Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

    Directory of Open Access Journals (Sweden)

    Sudarisman

    2006-03-01

    Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

  3. A recombinant canine distemper virus expressing a modified rabies virus glycoprotein induces immune responses in mice.

    Science.gov (United States)

    Li, Zhili; Wang, Jigui; Yuan, Daoli; Wang, Shuang; Sun, Jiazeng; Yi, Bao; Hou, Qiang; Mao, Yaping; Liu, Weiquan

    2015-06-01

    Canine distemper virus (CDV) and rabies virus (RV) are two important pathogens of the dog. CDV, a member of the morbillivirus genus, has shown promise as an expression vector. The glycoprotein from RV is a main contributor to protective immunity and capable of eliciting the production of virus-neutralizing antibodies. In this study, we recovered an attenuated strain of canine distemper virus and constructed a recombinant virus, rCDV-RV-G, expressing a modified (R333Q) rabies virus glycoprotein (RV-G) of RV Flury strain LEP. RV-G expression by the recombinant viruses was confirmed. Furthermore, G was proved to be incorporated into the surface of CDV particles. While replication of the recombinant virus was slightly reduced compared with the parental CDV, it stably expressed the RV-G over ten serial passages. Inoculation of mice induced specific neutralizing antibodies against both RV-G and CDV. Therefore, the rCDV-RV-G has the potential as a vaccine that may be used to control rabies virus infection in dogs and other animals.

  4. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

    2015-01-01

    Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...

  5. Optic neuritis caused by canine distemper virus in a Jack Russell terrier

    Science.gov (United States)

    Richards, Tara R.; Whelan, Nick C.; Pinard, Chantale L.; Alcala, Fernanda Castillo; Wolfe, Katheryn C.

    2011-01-01

    An atypical case of canine distemper (CD) was diagnosed in a vaccinated healthy adult dog. The patient was presented circling, seizuring, and blind. Postmortem examination resulted in a diagnosis of CD. Optic neuritis was diagnosed, a finding not previously described in the context of CD virus infection presenting solely with neurological signs. PMID:21731093

  6. Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

    NARCIS (Netherlands)

    T.C. Harder (Timm); M.J.H. Kenter (Marcel); H. Vos; C.H.J. Siebelink (Kees); W. Huisman (Willem); C. Örvell; T. Barrett (Thomas); M.J.G. Appel (Max); A.D.M.E. Osterhaus (Albert); G. van Amerongen (Geert)

    1996-01-01

    textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated

  7. Complete Genomic Sequence of Canine Distemper Virus from an Ethiopian Wolf.

    Science.gov (United States)

    Marston, Denise A; Watson, Jemma; Wise, Emma L; Ellis, Richard J; Bedin, Eric; Ayalew, Girma; Abute, Muktar; de Lamballerie, Xavier; Fooks, Anthony R; Sillero-Zubiri, Claudio; Banyard, Ashley C

    2017-07-20

    Canine distemper virus (CDV) has been implicated in population declines of wildlife, including many threatened species. Here we present the full genome of CDV from an Ethiopian wolf, Canis simensis , the world's rarest and most endangered canid. © Crown copyright 2017.

  8. Recombinant canine distemper virus strain snyder hill expressing green or red fluorescent proteins causes meningoencephalitis in the ferret

    NARCIS (Netherlands)

    M. Ludlow (Martin); D.T. Nguyen (Tien); D. Silin; O. Lyubomska; R.D. de Vries (Rory); V. von Messling; S. McQuaid (Stephen); R.L. de Swart (Rik); W.P. Duprex (Paul)

    2012-01-01

    textabstractThe propensity of canine distemper virus (CDV) to spread to the central nervous system is one of the primary features of distemper. Therefore, we developed a reverse genetics system based on the neurovirulent Snyder Hill (SH) strain of CDV (CDVSH) and show that this virus rapidly

  9. Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

    2011-09-01

    Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

  10. Detection of intracellular canine distemper virus antigen in mink inoculated with an attenuated or a virulent strain of canine distemper virus.

    Science.gov (United States)

    Blixenkrone-Møller, M

    1989-09-01

    Using an indirect immunofluorescence technique, the distribution of viral antigen in various tissues and blood mononuclear leukocytes was studied in wild mink, either vaccinated with an attenuated vaccine strain of canine distemper virus (CDV) or experimentally inoculated with the virulent Snyder-Hill strain of CDV. Viral antigen was detected in cells of the lymphoid system 6 to 12 days after vaccination. From 2 to 3 days after inoculation with the virulent strain, CDV antigen was demonstrated in cells of the lymphoid system and, during the incubation period, the antigen had spread to the epithelia and brain at days 6 and 12, respectively. In clinical cases of acute fatal canine distemper, the viral antigen was detected in a wide variety of tissues, including the cells of the lymphoid system, epithelial cells of skin, mucous membranes, lung, kidney, and cells of the CNS. The diagnostic importance of CDV antigen detection is discussed on the basis of these findings.

  11. Lights and shades on an historical vaccine canine distemper virus, the Rockborn strain

    DEFF Research Database (Denmark)

    Martella, V.; Blixenkrone-Møller, Merete; Elia, G.

    2011-01-01

    Both egg- and cell-adapted canine distemper virus (CDV) vaccines are suspected to retain residual virulence, especially if administered to immuno-suppressed animals, very young pups or to highly susceptible animal species. In the early 1980s, post-vaccine encephalitis was reported in dogs from...... in the sequence databases. Also, Rockborn-like strains were identified in two vaccines currently in the market. These findings indicate that Rockborn-like viruses may be recovered from dogs or other carnivores with distemper, suggesting cases of residual virulence of vaccines, or circulation of vaccine...

  12. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  13. Canine distemper virus infection in fennec fox (Vulpes zerda).

    Science.gov (United States)

    Woo, Gye-Hyeong; Jho, Yeon-Sook; Bak, Eun-Jung

    2010-08-01

    Fifteen 8-month-old fennec foxes imported from Sudan showed fever, mucopurulent ocular discharge, diarrhea, severe emaciation, seizures, and generalized ataxia, and died. Three of the 15 animals were presented for diagnostic investigation. Severe dehydration, brain congestion, and gastric ulcers were observed in all animals. In one animal, the lungs had failed to collapse and were multifocally dark red in appearance. Histopathologically, there were lymphohistiocytic meningoencephalitis with malacia, mild interstitial pneumonia, lymphoid depletion of lymphoid tissues and organs, and intestinal villous atrophy with intralesional coccidia. There were many intracytoplasmic and/or intranuclear inclusion bodies in the epithelial cells of the medullary velum, lungs, liver, kidneys, trachea, pancreas, stomach, gall bladder, urinary bladder, and ureters, and in macrophages of malacia foci and lymphocytes and macrophages of lymphoid organs. Additionally, intestinal coccidia were confirmed to be Isospora species by a fecal test. To our knowledge, this is the first report of canine distemper with intestinal coccidiosis in fennec fox.

  14. Unusual Necrotizing Encephalitis in Raccoons and Skunks Concurrently Infected With Canine Distemper Virus and Sarcocystis sp.

    Science.gov (United States)

    Kubiski, S V; Sisó, S; Church, M E; Cartoceti, A N; Barr, B; Pesavento, P A

    2016-05-01

    Canine distemper virus commonly infects free-ranging, terrestrial mesopredators throughout the United States. Due to the immunosuppressive effects of the virus, concurrent opportunistic infections are also common. Among these, secondary systemic protozoal infections have been described in a number of species. We report an unusual presentation of necrotizing encephalitis associated withSarcocystissp in four raccoons and one skunk concurrently infected with canine distemper virus. Lesions were characterized by variably sized necrotizing cavitations composed of abundant mineral admixed with inflammatory cells and protozoa.Sarcocystissp was confirmed via immunohistochemistry using a monoclonal antibody toSarcocystis neurona The pathologic changes are similar to lesions in human AIDS patients infected withToxoplasma gondii. © The Author(s) 2015.

  15. Recombinant rabies virus expressing the H protein of canine distemper virus protects dogs from the lethal distemper challenge.

    Science.gov (United States)

    Wang, Feng-Xue; Zhang, Shu-Qin; Zhu, Hong-Wei; Yang, Yong; Sun, Na; Tan, Bin; Li, Zhen-Guang; Cheng, Shi-Peng; Fu, Zhen F; Wen, Yong-Jun

    2014-12-05

    The rabies virus (RV) vector LBNSE expressing foreign antigens have shown considerable promise as vaccines against viral and bacteria diseases, which is effective and safe. We produced a new RV-based vaccine vehicle expressing 1.824 kb hemagglutinin (H) gene of the canine distemper virus (CDV) by reverse genetics technology. The recombinant virus LBNSE-CDV-H retained growth properties similar to those of vector LBNSE both in BSR and mNA cell culture. The H gene of CDV was expressed and detected by immunostaining. To compare the immunogenicity of LBNSE-CDV-H, dogs were immunized with each of these recombinant viruses by intramuscular (i.m.). The dogs were bled at third weeks after the immunization for the measurement of virus neutralizing antibody (VNA) and then challenged with virulent virus (ZJ 7) at fourth weeks. The parent virus (LBNSE) without expression of any foreign molecules was included for comparison. Dogs inoculated with LBNSE-CDV-H showed no any signs of disease and exhibited seroconversion against both RV and CDV H protein. The LBNSE-CDV-H did not cause disease in dogs and conferred protection from challenge with a lethal wild type CDV strain, demonstrating its potential value for wildlife conservation efforts. Together, these studies suggest that recombinant RV expressing H protein from CDV stimulated high levels of adaptive immune responses (VNA), and protected all dogs challenge infection. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Studies on manifestations of canine distemper virus infection in an urban dog population.

    Science.gov (United States)

    Blixenkrone-Møller, M; Svansson, V; Have, P; Orvell, C; Appel, M; Pedersen, I R; Dietz, H H; Henriksen, P

    1993-10-01

    An upsurge of canine distemper was recognized at the beginning of 1991 in the urban dog population of the Copenhagen area. The outbreak had the characteristics of a virulent morbillivirus introduction in a partly immune population, where the disease primarily was manifested in young individuals. Testing of single serum samples for the presence of canine distemper virus (CDV) IgM antibodies using an IgM ELISA confirmed current and recent CDV infections in an urban dog population, where the use of attenuated CDV vaccines was widespread. In 49 out of 66 sera from clinical cases suspected of canine distemper we detected CDV IgM antibodies, as compared to the detection of viral antigen by indirect immunofluorescence in 27 of 65 specimens of conjunctival cells. The antigenic make-up of isolates from acute and subacute clinical cases was investigated with a panel of 51 monoclonal antibodies directed against CDV and the related phocine distemper virus. The isolates exhibited an homogeneous reaction pattern and shared overall antigenic characteristics of the CDV prototype. The majority of cases were diagnosed among unvaccinated dogs and individuals with unknown or obscure vaccination record. However, severe clinical cases were also diagnosed in vaccinated individuals.

  17. Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

    Science.gov (United States)

    Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

    2011-04-09

    Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

  18. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    International Nuclear Information System (INIS)

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  19. Monitoring of Antibodies Titre Against Canine Distemper Virus in Ferrets Vaccinated with a Live Modified Vaccine

    OpenAIRE

    L. Pavlačík; V. Celer, Jr.; V. Kajerová; V. Jekl; Z. Knotek; I. Literák

    2007-01-01

    A group of five ferrets vaccinated against the canine distemper virus (CDV) was evaluated as to the onset of anti-CDV antibody production and the serum levels of the animals were monitored for one year. The ferrets were immunized with a live attenuated vaccine. The vaccination pattern was as follows: primary vaccination at the age of 6 weeks, fi rst revaccination at 30 days after primary vaccination, and second revaccination after another 30 days. Blood samples were taken prior to primary vac...

  20. Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas

    OpenAIRE

    Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin

    2017-01-01

    In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenu...

  1. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

    Science.gov (United States)

    McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

    2014-09-05

    Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  2. Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

    Directory of Open Access Journals (Sweden)

    Anna McRee

    2014-09-01

    Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

  3. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

    Science.gov (United States)

    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

    2015-04-17

    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Homologous recombination is a force in the evolution of canine distemper virus.

    Science.gov (United States)

    Yuan, Chaowen; Liu, Wenxin; Wang, Yingbo; Hou, Jinlong; Zhang, Liguo; Wang, Guoqing

    2017-01-01

    Canine distemper virus (CDV) is the causative agent of canine distemper (CD) that is a highly contagious, lethal, multisystemic viral disease of receptive carnivores. The prevalence of CDV is a major concern in susceptible animals. Presently, it is unclear whether intragenic recombination can contribute to gene mutations and segment reassortment in the virus. In this study, 25 full-length CDV genome sequences were subjected to phylogenetic and recombinational analyses. The results of phylogenetic analysis, intragenic recombination, and nucleotide selection pressure indicated that mutation and recombination occurred in the six individual genes segment (H, F, P, N, L, M) of the CDV genome. The analysis also revealed pronounced genetic diversity in the CDV genome according to the geographically distinct lineages (genotypes), namely Asia-1, Asia-2, Asia-3, Europe, America-1, and America-2. The six recombination events were detected using SimPlot and RDP programs. The analysis of selection pressure demonstrated that a majority of the nucleotides in the CDV individual gene were under negative selection. Collectively, these data suggested that homologous recombination acts as a key force driving the genetic diversity and evolution of canine distemper virus.

  5. Antibody study in canine distemper virus nucleocapsid protein gene-immunized mice.

    Science.gov (United States)

    Yuan, B; Li, X Y; Zhu, T; Yuan, L; Hu, J P; Chen, J; Gao, W; Ren, W Z

    2015-04-10

    The gene for the nucleocapsid (N) protein of canine distemper virus was cloned into the pMD-18T vector, and positive recombinant plasmids were obtained by enzyme digestion and sequencing. After digestion by both EcoRI and KpnI, the plasmid was directionally cloned into the eukaryotic expression vector pcDNA; the positive clone pcDNA-N was screened by electrophoresis and then transfected into COS-7 cells. Immunofluorescence analysis results showed that the canine distemper virus N protein was expressed in the cytoplasm of transfected COS-7 cells. After emulsification in Freund's adjuvant, the recombinant plasmid pcDNA-N was injected into the abdominal cavity of 8-week-old BABL/c mice, with the pcDNA original vector used as a negative control. Mice were immunized 3 times every 2 weeks. The blood of immunized mice was drawn 2 weeks after completing the immunizations to measure titer levels. The antibody titer in the pcDNA-N test was 10(1.62 ± 0.164), while in the control group this value was 10(0.52 ± 0.56), indicating that specific humoral immunity was induced in canine distemper virus nucleocapsid protein-immunized mice.

  6. Canine Distemper Virus (CDV) immune-stimulating complexes (iscoms), but not measles virus iscoms, protect dogs against CDV infection.

    NARCIS (Netherlands)

    P. de Vries (Petra); F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)

    1988-01-01

    textabstractThe potential of immune-stimulating complexes (iscoms), a novel form of antigenic presentation, for the induction of protective immunity against morbillivirus infection was shown by immunizing dogs with canine distemper virus (CDV) iscoms, which contained the fusion (F) protein and a

  7. Identification of a new genotype of canine distemper virus circulating in America.

    Science.gov (United States)

    Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón

    2011-08-01

    Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.

  8. Low Titers of Canine Distemper Virus Antibody in Wild Fishers (Martes pennanti) in the Eastern USA.

    Science.gov (United States)

    Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L

    2016-01-01

    Canine distemper virus (CDV) infects species in the order Carnivora. Members of the family Mustelidae are among the species most susceptible to CDV and have a high mortality rate after infection. Assessing an animal's pathogen or disease load prior to any reintroduction project is important to help protect the animal being reintroduced, as well as the wildlife and livestock in the area of relocation. We screened 58 fishers for CDV antibody prior to their release into Pennsylvania, US, as part of a reintroduction program. Five of the 58 (9%) fishers had a weak-positive reaction for CDV antibody at a dilution of 1:16. None of the fishers exhibited any clinical sign of canine distemper while being held prior to release.

  9. 6-methylmercaptopurine riboside, a thiopurine nucleoside with antiviral activity against canine distemper virus in vitro.

    Science.gov (United States)

    de Carvalho, Otávio Valério; Félix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, Márcia Rogéria; Bressan, Gustavo Costa; Pena, Lindomar José; Silva-Júnior, Abelardo

    2017-06-26

    Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic strategies synergizing with vaccine programs for effectively controlling canine distemper. 6-methylmercaptopurine riboside (6MMPr) is a modified thiopurine nucleoside with known antiviral properties against certain RNA viruses. We tested the inhibitory effects of 6MMPr against a wild-type CDV strain infection in cell culture. We measured infectious particle production and viral RNA levels in treated and untreated CDV-infected cells. Ribavirin (RIB) was used as a positive control. Here, we report for the first time the antiviral effects of 6MMPr against canine distemper virus (CDV) in vitro. 6MMPr was able to reduce viral RNA levels and to inhibit the production of infectious CDV particles. The therapeutic selectivity of 6MMPr was approximately six times higher than that of ribavirin. Our results indicate that 6MMPr has high anti-CDV potential and warrants further testing against other paramyxoviruses, as well as clinical testing of the compound against CDV.

  10. Morbillivirus Experimental Animal Models: Measles Virus Pathogenesis Insights from Canine Distemper Virus.

    Science.gov (United States)

    da Fontoura Budaszewski, Renata; von Messling, Veronika

    2016-10-11

    Morbilliviruses share considerable structural and functional similarities. Even though disease severity varies among the respective host species, the underlying pathogenesis and the clinical signs are comparable. Thus, insights gained with one morbillivirus often apply to the other members of the genus. Since the Canine distemper virus (CDV) causes severe and often lethal disease in dogs and ferrets, it is an attractive model to characterize morbillivirus pathogenesis mechanisms and to evaluate the efficacy of new prophylactic and therapeutic approaches. This review compares the cellular tropism, pathogenesis, mechanisms of persistence and immunosuppression of the Measles virus (MeV) and CDV. It then summarizes the contributions made by studies on the CDV in dogs and ferrets to our understanding of MeV pathogenesis and to vaccine and drugs development.

  11. Short communication. Occurrence of different Canine distemper virus lineages in Italian dogs

    Directory of Open Access Journals (Sweden)

    Andrea Balboni

    2014-09-01

    Full Text Available This study describes the sequence analysis of the H gene of 7 Canine distemper virus (CDV strains identified in dogs in Italy between years 2002-2012. The phylogenetic analysis showed that the CDV strains belonged to 2 clusters: 6 viruses were identified as Arctic‑like lineage and 1 as Europe 1 lineage. These data show a considerable prevalence of Arctic‑like‑CDVs in the analysed dogs. The dogs and the 3 viruses more recently identified showed 4 distinctive amino acid mutations compared to all other Arctic CDVs.

  12. Inactivated Recombinant Rabies Viruses Displaying Canine Distemper Virus Glycoproteins Induce Protective Immunity against Both Pathogens.

    Science.gov (United States)

    da Fontoura Budaszewski, Renata; Hudacek, Andrew; Sawatsky, Bevan; Krämer, Beate; Yin, Xiangping; Schnell, Matthias J; von Messling, Veronika

    2017-04-15

    The development of multivalent vaccines is an attractive methodology for the simultaneous prevention of several infectious diseases in vulnerable populations. Both canine distemper virus (CDV) and rabies virus (RABV) cause lethal disease in wild and domestic carnivores. While RABV vaccines are inactivated, the live-attenuated CDV vaccines retain residual virulence for highly susceptible wildlife species. In this study, we developed recombinant bivalent vaccine candidates based on recombinant vaccine strain rabies virus particles, which concurrently display the protective CDV and RABV glycoprotein antigens. The recombinant viruses replicated to near-wild-type titers, and the heterologous glycoproteins were efficiently expressed and incorporated in the viral particles. Immunization of ferrets with beta-propiolactone-inactivated recombinant virus particles elicited protective RABV antibody titers, and animals immunized with a combination of CDV attachment protein- and fusion protein-expressing recombinant viruses were protected from lethal CDV challenge. However, animals that were immunized with only a RABV expressing the attachment protein of CDV vaccine strain Onderstepoort succumbed to infection with a more recent wild-type strain, indicating that immune responses to the more conserved fusion protein contribute to protection against heterologous CDV strains. IMPORTANCE Rabies virus and canine distemper virus (CDV) cause high mortality rates and death in many carnivores. While rabies vaccines are inactivated and thus have an excellent safety profile and high stability, live-attenuated CDV vaccines can retain residual virulence in highly susceptible species. Here we generated recombinant inactivated rabies viruses that carry one of the CDV glycoproteins on their surface. Ferrets immunized twice with a mix of recombinant rabies viruses carrying the CDV fusion and attachment glycoproteins were protected from lethal CDV challenge, whereas all animals that received

  13. Detection of canine distemper virus serum neutralizing antibodies in captive U.S. phocids.

    Science.gov (United States)

    Clancy, Meredith M; Gamble, Kathryn C; Travis, Dominic A

    2013-03-01

    Antibodies to morbilliviruses have been documented in free-ranging pinnipeds throughout populations in the Atlantic and Arctic Oceans, but not from the Pacific Ocean. As a symbolic geographic barrier between the exposed Atlantic and naive Pacific populations, the captive phocid population in North America had undocumented serologic status. In this study, canine distemper virus (CDV) serum neutralization assays were used to assess the prevalence of antibodies in this population with participation of 25 U.S. institutions from grey seals (Halichoerus grypus, n = 6) and harbor seals (Phoca vitulina, n = 108). Historic and environmental risk factors associated with the epidemiology of distemper virus were collected by survey. Based on antibodies to canine distemper virus, the prevalence of exposure in this population was 25.5%, with 28 seals (grey, n = 2; harbor, n = 26) demonstrating antibody titers > or = 1:16, and positive titers ranged from 1:4 to 1:1,536. By survey analysis, strong associations with seropositive status were identified for captive origin (P = 0.013) and movement among institutions (P = 0.024). Size of population has positive correlation with likelihood of seropositive seals at an institution (P = 0.020). However, no major husbandry or enclosure-based risk factors were identified in institutions with seropositive seals, and no interaction between individual or institutional risk factors was identified. Previously undocumented prior to this study, CDV antibodies were measured in harbor seals (n = 2) recently stranded from the Pacific coast.

  14. The V protein of canine distemper virus is required for virus replication in human epithelial cells.

    Directory of Open Access Journals (Sweden)

    Noriyuki Otsuki

    Full Text Available Canine distemper virus (CDV becomes able to use human receptors through a single amino acid substitution in the H protein. In addition, CDV strains possessing an intact C protein replicate well in human epithelial H358 cells. The present study showed that CDV strain 007Lm, which was isolated from lymph node tissue of a dog with distemper, failed to replicate in H358 cells, although it possessed an intact C protein. Sequence analyses suggested that a cysteine-to-tyrosine substitution at position 267 of the V protein caused this growth defect. Analyses using H358 cells constitutively expressing the CDV V protein showed that the V protein with a cysteine, but not that with a tyrosine, at this position effectively blocked the interferon-stimulated signal transduction pathway, and supported virus replication of 007Lm in H358 cells. Thus, the V protein as well as the C protein appears to be functional and essential for CDV replication in human epithelial cells.

  15. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    Science.gov (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  16. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  17. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  18. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Canine distemper virus induces apoptosis in cervical tumor derived cell lines

    Directory of Open Access Journals (Sweden)

    Rajão Daniela S

    2011-06-01

    Full Text Available Abstract Apoptosis can be induced or inhibited by viral proteins, it can form part of the host defense against virus infection, or it can be a mechanism for viral spread to neighboring cells. Canine distemper virus (CDV induces apoptotic cells in lymphoid tissues and in the cerebellum of dogs naturally infected. CDV also produces a cytopathologic effect, leading to apoptosis in Vero cells in tissue culture. We tested canine distemper virus, a member of the Paramyxoviridae family, for the ability to trigger apoptosis in HeLa cells, derived from cervical cancer cells resistant to apoptosis. To study the effect of CDV infection in HeLa cells, we examined apoptotic markers 24 h post infection (pi, by flow cytometry assay for DNA fragmentation, real-time PCR assay for caspase-3 and caspase-8 mRNA expression, and by caspase-3 and -8 immunocytochemistry. Flow cytometry showed that DNA fragmentation was induced in HeLa cells infected by CDV, and immunocytochemistry revealed a significant increase in the levels of the cleaved active form of caspase-3 protein, but did not show any difference in expression of caspase-8, indicating an intrinsic apoptotic pathway. Confirming this observation, expression of caspase-3 mRNA was higher in CDV infected HeLa cells than control cells; however, there was no statistically significant change in caspase-8 mRNA expression profile. Our data suggest that canine distemper virus induced apoptosis in HeLa cells, triggering apoptosis by the intrinsic pathway, with no participation of the initiator caspase -8 from the extrinsic pathway. In conclusion, the cellular stress caused by CDV infection of HeLa cells, leading to apoptosis, can be used as a tool in future research for cervical cancer treatment and control.

  20. Wildlife Reservoirs of Canine Distemper Virus Resulted in a Major Outbreak in Danish Farmed Mink (Neovison vison)

    DEFF Research Database (Denmark)

    Trebbien, Ramona; Chriél, Mariann; Struve, Tina

    2014-01-01

    A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus...

  1. Genotyping of canine distemper virus strains circulating in Brazil from 2008 to 2012.

    Science.gov (United States)

    Budaszewski, Renata da Fontoura; Pinto, Luciane Dubina; Weber, Matheus Nunes; Caldart, Eloiza Teles; Alves, Christian Diniz Beduschi Travassos; Martella, Vito; Ikuta, Nilo; Lunge, Vagner Ricardo; Canal, Cláudio Wageck

    2014-02-13

    Canine distemper virus (CDV) is a major pathogen of dogs and represents a serious threat to both unvaccinated and vaccinated animals. This study surveyed dogs with or without clinical signs related to canine distemper from different regions of Brazil from 2008 to 2012. A total of 155 out of 386 animals were found to be CDV positive by RT-PCR; 37 (23.8%) dogs were asymptomatic at the time of sampling, and 90 (58%) displayed clinical signs suggestive of distemper. Nineteen (12.2%) dogs had a record of complete vaccination, 15 (9.6%) had an incomplete vaccination protocol, and 76 (49%) had no vaccination record. Based on the sequence analysis of the complete hemagglutinin gene of 13 samples, 12 of the strains were characterized as Genotype South America-I/Europe. Considering criteria of at least 95% nucleotide identity to define a genotype and 98% to define a subgenotype, South America-I/Europe sequences segregated into eight different phylogenetically well-defined clusters that circulated or co-circulated in distinct geographical areas. Together, these findings highlight the relevance of CDV infection in Brazilian dogs, demonstrate the predominance of one genotype in Brazil and support the need to intensify the current control measures. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Cross-species transmission of canine distemper virus-an update.

    Science.gov (United States)

    Beineke, Andreas; Baumgärtner, Wolfgang; Wohlsein, Peter

    2015-12-01

    Canine distemper virus (CDV) is a pantropic morbillivirus with a worldwide distribution, which causes fatal disease in dogs. Affected animals develop dyspnea, diarrhea, neurological signs and profound immunosuppression. Systemic CDV infection, resembling distemper in domestic dogs, can be found also in wild canids (e.g. wolves, foxes), procyonids (e.g. raccoons, kinkajous), ailurids (e.g. red pandas), ursids (e.g. black bears, giant pandas), mustelids (e.g. ferrets, minks), viverrids (e.g. civets, genets), hyaenids (e.g. spotted hyenas), and large felids (e.g. lions, tigers). Furthermore, besides infection with the closely related phocine distemper virus, seals can become infected by CDV. In some CDV outbreaks including the mass mortalities among Baikal and Caspian seals and large felids in the Serengeti Park, terrestrial carnivores including dogs and wolves have been suspected as vectors for the infectious agent. In addition, lethal infections have been described in non-carnivore species such as peccaries and non-human primates demonstrating the remarkable ability of the pathogen to cross species barriers. Mutations affecting the CDV H protein required for virus attachment to host-cell receptors are associated with virulence and disease emergence in novel host species. The broad and expanding host range of CDV and its maintenance within wildlife reservoir hosts considerably hampers disease eradication.

  3. Characterization of a novel Canine distemper virus causing disease in wildlife.

    Science.gov (United States)

    Pope, Jenny P; Miller, Debra L; Riley, Matthew C; Anis, Eman; Wilkes, Rebecca P

    2016-09-01

    Canine distemper virus (CDV) is a common cause of a multisystemic disease in both domestic dogs and wildlife species, including raccoons and foxes. Outbreaks of CDV in domestic dogs in eastern Tennessee have occurred since 2012, and it was determined that these outbreaks resulted from a novel genotype of CDV. We hypothesized that this virus is also infecting area wildlife and may be a source of the virus for these outbreaks in dogs. From 2013 to 2014, autopsies were performed and tissues collected from raccoons (Procyon lotor; n = 50) and gray foxes (Urocyon cinereoargenteus; n = 8) for CDV testing. A real-time reverse transcription PCR was used to document the presence of CDV in tissue samples, and a portion of the virus was subsequently sequenced for phylogenetic analysis. A high percentage of wildlife, both with (86%) and without (55%) clinical signs, tested positive for CDV, with the majority (77%) testing positive for the novel genotype. Microscopic findings, including syncytia in the lungs and viral inclusion bodies in urothelium, astrocytes, neurons, and bronchiolar epithelium, were also consistent with canine distemper. Minimal inflammation in the central nervous system of affected animals was indicative of the acute neurologic form of the disease. Pneumonia and parasitism were also commonly found in CDV-infected animals. Based on these results, CDV appears to be prevalent in eastern Tennessee wildlife. Subclinical or clinically recovered shedders are a potential source of this novel genotype for domestic dogs, and this genotype is genetically distinct from vaccine strains. © 2016 The Author(s).

  4. Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

    Science.gov (United States)

    Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

    2012-12-01

    To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

  5. Characterization of a new dog isolate of canine distemper virus from China.

    Science.gov (United States)

    Qiao, J; Meng, Q; Chen, C; Xia, X; Cai, X; Ren, Y; Zhang, H

    2011-01-01

    Canine distemper virus (CDV) is a highly contagious pathogen of dogs. Vaccination is an effective way to protect dogs from CDV infection, but occasionally fails. In the present study, a wild type (wt) CDV, named XJ2, was isolated from a dead vaccinated dog. The hemagglutinin (H) gene of the XJ2 was amplified and analyzed for the molecular characteristics including N-glycosylation sites, phylogenesis, hydrophobicity and epitopes. The data indicated that XJ2 was a genetic variant strain of CDV. CDV-sero-negative dogs were inoculated intranasally with XJ2, developed severe clinical symptoms and died, suggesting high virulence.

  6. Measles and canine distemper virus antibodies in patients with multiple sclerosis determined by radioimmunoassay

    International Nuclear Information System (INIS)

    Arnadottir, T.

    1980-01-01

    Antibodies against measles virus (MV) and canine distemper virus (CDV) were measured by solid-phase radioimmunoassay (RIA) of sera and cerebrospinal fluid (CSF) from 28 patients with multiple sclerosis (MS) and matched neurological controls. When the groups were compared for MV antibody titers and CDV antibody titers of sera and MV/CDV serum antibody titer ratios, no significant difference was found. The CDV antibody titers and the MV antibody titers were in good correlation. CDV antibodies showed RIA titration curves typical of low avidity antibodies. In tests for MV antibodies in CSF, 82% of the MS patients and 19% of the controls were positive, whereas 36% of the MS patients and 4% of the controls were positive in CDV RIA. The correlation between MV and CDV antibody levels, the low avidity of CDV antibodies and the fact that absorption of the specimens with MV antigen abolished all CDV antibody activity suggest that the CDV antibodies are MV antibodies cross-reacting with CDV. It is concluded that canine distemper virus is unlikely to be involved in the etiology of multiple sclerosis. (author)

  7. Epidemiology of canine distemper virus in wild raccoon dogs (Nyctereutes procyonoides) from South Korea.

    Science.gov (United States)

    Cha, Se-Yeoun; Kim, Eun-Ju; Kang, Min; Jang, Sang-Ho; Lee, Hae-Beom; Jang, Hyung-Kwan

    2012-09-01

    Raccoon dogs (Nyctereutes procyonoides) are widespread and common in South Korea. In 2011, we obtained serum samples from 102 wild raccoon dogs to survey their exposure to canine distemper virus (CDV). Forty-five of the 102 animals (44.1%) were seropositive. Field cases of canine distemper in wild raccoon dogs from 2010 to 2011 were investigated. Fourteen cases of CDV infection were identified by a commercially available CDV antigen detection kit. These cases were used for virus isolation and molecular analysis. Sequence analysis of hemagglutinin genes indicated that all viruses isolated belonged to the Asia-2 genotype. H protein residues which are related to the receptor and host specificity (residues 530 and 549) were analyzed. A glutamic acid (E) residue is present at 530 in all isolates. At 549, a histidine (H) residue was found in five isolates and tyrosine (Y) residue was found in 6 isolates. Our study demonstrated that CDV infection was widespread in wild raccoon dogs in South Korea. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats

    Science.gov (United States)

    Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A.; DuBovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D.; Davies, Angela J.; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4–271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7–299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0–289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76–80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats. PMID:23826322

  9. In-vitro antiviral efficacy of ribavirin and interferon-alpha against canine distemper virus.

    Science.gov (United States)

    Carvalho, Otávio V; Saraiva, Giuliana L; Ferreira, Caroline G T; Felix, Daniele M; Fietto, Juliana L R; Bressan, Gustavo C; Almeida, Márcia R; Silva Júnior, Abelardo

    2014-10-01

    Canine distemper is a highly contagious disease with high incidence and lethality in the canine population. The objective of this study was to evaluate the efficacy of antiviral action with ribavirin (RBV), interferon-alpha (IFNα), and combinations of RBV and IFNα against canine distemper virus (CDV). Vero cells inoculated with CDV were treated with RBV, IFNα, and combinations of these drugs. The efficacy to inhibit viral replication was evaluated by adding the compounds at different times to determine which step of the viral replicative process was affected. Both drugs were effective against CDV in vitro. The IFNα was the most active compound, with an average IC50 (50% inhibitory concentration) value lower than the IC50 of the RBV. Ribavirin (RBV) was more selective than IFNα, however, and neither drug showed extracellular antiviral activity. The combination of RBV and IFNα exhibited antiviral activity for the intra- and extracellular stages of the replicative cycle of CDV, although the intracellular viral inhibition was higher. Both RBV and IFNα showed high antiviral efficacy against CDV, and furthermore, RBV + IFNα combinations have shown greater interference range in viral infectivity. These compounds could potentially be used to treat clinical disease associated with CDV infection.

  10. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    Science.gov (United States)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  11. Coinfection with Hepatozoon sp. and Canine Distemper Virus in a Yellow-throated Marten ( Martes flavigula koreana) in Korea.

    Science.gov (United States)

    Park, Surim; Choi, Ul Soo; Kim, Eun Ju; Lee, Jong Hyun; Lee, Hae Beom; Cho, Ho Seong; Kim, Wonil; Lim, Chae Woong; Kim, Bumseok

    2016-04-28

    We describe coinfection with Hepatozoon sp. and canine distemper virus (CDV) in a yellow-throated marten ( Martes flavigula koreana). We found Hepatozoon cysts in muscular tissue and viral inclusion bodies in the brain. Hepatozoon sp., and CDV was confirmed in blood and brain, respectively, by PCR.

  12. Lymphotropism and host responses during acute wild-type canine distemper virus infections in a highly susceptible natural host

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Jensen, Trine Hammer

    2009-01-01

    The mechanisms behind the in vivo virulence of immunosuppressive wild-type Morbillivirus infections are still not fully understood. To investigate lymphotropism and host responses we have selected the natural host model of canine distemper virus (CDV) infection in mink. This model displays...

  13. The V domain of dog PVRL4 (nectin-4) mediates canine distemper virus entry and virus cell-to-cell spread.

    Science.gov (United States)

    Delpeut, Sebastien; Noyce, Ryan S; Richardson, Christopher D

    2014-04-01

    The entry of canine distemper virus (CDV) is a multistep process that involves the attachment of CDV hemagglutinin (H) to its cellular receptor, followed by fusion between virus and cell membranes. Our laboratory recently identified PVRL4 (nectin-4) to be the epithelial receptor for measles and canine distemper viruses. In this study, we demonstrate that the V domain of PVRL4 is critical for CDV entry and virus cell-to-cell spread. Furthermore, four key amino acid residues within the V domain of dog PVRL4 and two within the CDV hemagglutinin were shown to be essential for receptor-mediated virus entry. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Detection of Arctic and European cluster of canine distemper virus in north and center of Iran.

    Science.gov (United States)

    Namroodi, Somayeh; Rostami, Amir; Majidzadeh-Ardebili, Keyvan; Ghalyanchi Langroudi, Arash; Morovvati, Abbas

    2015-01-01

    Canine distemper virus (CDV) creates a very contagious viral multi-systemic canine distemper (CD) disease that affects most species of Carnivora order. The virus is genetically heterogeneous, particularly in section of the hemagglutinin (H) gene. Sequence analysis of the H gene can be useful to investigate distinction of various lineages related to geographical distribution and CDV molecular epidemiology. Since vaccination program is conducted only in large cities of Iran, CD still remains as one of the major causes of death in dogs in this country. In order to monitor H gene, CDV has been detected in 14 out of 19 sampled dogs through the amplification of nucleoprotein (NP) gene in nested-PCR assay. In the next step 665 bp of H gene was amplified in 9 out of 14 NP-gene positive dogs. Phylogenetic analysis distinguished two distinct CDV genotypes in Iran. JN941238 has been embedded in European cluster and JN941239 has been embedded in Arctic cluster. Nucleic analysis has been shown high difference among both Iranian CDV lineages with CDV vaccine strains.

  15. Influence of vaccine strains on the evolution of canine distemper virus.

    Science.gov (United States)

    da Fontoura Budaszewski, Renata; Streck, André Felipe; Nunes Weber, Matheus; Maboni Siqueira, Franciele; Muniz Guedes, Rafael Lucas; Wageck Canal, Cláudio

    2016-07-01

    Canine distemper virus (CDV) is a major dog pathogen belonging to the genus Morbillivirus of the family Paramyxoviridae. CDV causes disease and high mortality in dogs and wild carnivores. Although homologous recombination has been demonstrated in many members of Paramyxoviridae, these events have rarely been reported for CDV. To detect potential recombination events, the complete CDV genomes available in GenBank up to June 2015 were screened using distinct algorithms to detect genetic conversions and incongruent phylogenies. Eight putative recombinant viruses derived from different CDV genotypes and different hosts were detected. The breakpoints of the recombinant strains were primarily located on fusion and hemagglutinin glycoproteins. These results suggest that homologous recombination is a frequent phenomenon in morbillivirus populations under natural replication, and CDV vaccine strains might play an important role in shaping the evolution of this virus.

  16. Canine distemper virus utilizes different receptors to infect chicken embryo fibroblasts and vero cells.

    Science.gov (United States)

    Chen, Jun; Liang, Xiu; Chen, Pei-fu

    2011-04-01

    Inducing animal viruses to adapt to chicken embryos or chicken embryo fibroblasts (CEF) is a common method to develop attenuated live vaccines with full security. Canine distemper virus (CDV) also does this, but the mechanisms and particular receptors remain unclear. Virus overlay protein blot assays were carried out on CEF membrane proteins, which were extracted respectively with a Mem-PER™ kit, a radioimmunoprecipitation assay buffer or a modified co-immunoprecipitation method, and revealed a common 57 kDa positive band that differed from the 42-kDa positive band in Vero cells and also from those receptors reported in lymphocytes and 293 cells, indicating a receptor diversity of CDV and the possibility of the 57-kDa protein acting as a receptor that is involved in adaptive infection of CDV Kunming strain to CEF.

  17. SEROLOGIC RESPONSE TO CANINE DISTEMPER VACCINATION IN CAPTIVE LINNAEUS'S TWO-TOED SLOTHS ( CHOLOEPUS DIDACTYLUS) AFTER A FATAL CANINE DISTEMPER VIRUS OUTBREAK.

    Science.gov (United States)

    Sheldon, Julie D; Cushing, Andrew C; Wilkes, Rebecca P; Anis, Eman; Dubovi, Edward J

    2017-12-01

    Canine distemper virus (CDV) affects many wild and captive, nondomestic species worldwide but has not been previously reported in Xenarthra. Paucity of information on vaccination safety and efficacy presents challenges for disease prevention in captive collections. CDV infections and subsequent mortalities in five captive Linnaeus's two-toed sloths ( Choloepus didactylus) in eastern Tennessee are reported. Clinical signs included oculonasal discharge, oral ulcerations, and diarrhea, and the diagnosis was confirmed by necropsy, histopathology, immunohistochemistry, virus isolation, and polymerase chain reaction. Viral sequencing identified the strain to be consistent with a new CDV lineage currently affecting domestic dogs and wildlife in Tennessee. Seven sloths were examined and vaccinated using a recombinant CDV vaccine on days 0 and 21. Subsequent blood samples showed increased titers in 3/4 sloths. Based on the outbreak and serologic findings postvaccination without adverse effects, the authors recommend recombinant CDV vaccination in sloths exposed to known carriers of CDV.

  18. Lights and shades on an historical vaccine canine distemper virus, the Rockborn strain.

    Science.gov (United States)

    Martella, V; Blixenkrone-Møller, M; Elia, G; Lucente, M S; Cirone, F; Decaro, N; Nielsen, L; Bányai, K; Carmichael, L E; Buonavoglia, C

    2011-02-01

    Both egg- and cell-adapted canine distemper virus (CDV) vaccines are suspected to retain residual virulence, especially if administered to immuno-suppressed animals, very young pups or to highly susceptible animal species. In the early 1980s, post-vaccine encephalitis was reported in dogs from various parts of Britain after administration of a particular batch of combined CDV Rockborn strain/canine adenovirus type-1 vaccine, although incrimination of the Rockborn strain was subsequently retracted. Notwithstanding, this, and other reports, led to the view that the Rockborn strain is less attenuated and less safe than other CDV vaccines, and the Rockborn strain was officially withdrawn from the markets in the mid 1990s. By sequencing the H gene of the strain Rockborn from the 46th laboratory passage, and a commercial vaccine (Candur(®) SH+P, Hoechst Rousell Vet GmbH), the virus was found to differ from the commonly used vaccine strain, Onderstepoort (93.0% nt and 91.7% aa), and to resemble more closely (99.6% nt and 99.3% aa) a CDV strain detected in China from a Lesser Panda (Ailurus fulgens). An additional four CDV strains matching (>99% nt identity) the Rockborn virus were identified in the sequence databases. Also, Rockborn-like strains were identified in two vaccines currently in the market. These findings indicate that Rockborn-like viruses may be recovered from dogs or other carnivores with distemper, suggesting cases of residual virulence of vaccines, or circulation of vaccine-derived Rockborn-like viruses in the field. Copyright © 2010 Elsevier Ltd. All rights reserved.

  19. In vitro antiviral efficacy of caffeic acid against canine distemper virus.

    Science.gov (United States)

    Wu, Zong-Mei; Yu, Zhen-Jiang; Cui, Zhen-Qiang; Peng, Lu-Yuan; Li, Hao-Ran; Zhang, Chun-Lei; Shen, Hai-Qing; Yi, Peng-Fei; Fu, Ben-Dong

    2017-09-01

    Canine distemper (CD) is a highly contagious disease caused by the canine distemper virus (CDV), and mortality can be as high as 100%. However, there is no specific treatment for CD. In this study, the antiviral activity of the caffeic acid against CDV was evaluated in vitro. The results showed that the IC 50 of the caffeic acid against CDV at 1 and 2 h post infection (PI) is 23.3 and 32.3 μg/mL, respectively. Consistently, at 1 and 2 h PI, the caffeic acid exhibited a reduced (23.3-57.0% and 37.2-38.1%) viral inhibitory effect in vero cells. Furthermore, the caffeic acid plus Ribavirin (RBV) has greater antiviral activity against CDV than the caffeic acid or RBV individually. In addition, the caffeic acid reduced the total viral RNA synthesis by 59-86% at 24-72 h. Therefore, our data provided the experimental evidence that the caffeic acid effectively inhibited CDV infection in vero cells, which may potentially be used to treat clinical disease associated with CDV infection. Copyright © 2017. Published by Elsevier Ltd.

  20. Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China.

    Science.gov (United States)

    Li, Weike; Li, Tiansong; Liu, Yuxiu; Gao, Yuwei; Yang, Songtao; Feng, Na; Sun, Heting; Wang, Shengle; Wang, Lei; Bu, Zhigao; Xia, Xianzhu

    2014-08-01

    Canine distemper (CD) is a highly contagious, often fatal, multisystemic, and incurable disease in dogs and other carnivores, which is caused by canine distemper virus (CDV). Although vaccines have been used as the principal means of controlling the disease, CD has been reported in vaccinated animals. The hemoagglutinin (H) protein is one of the most important antigens for inducing protective immunity against CD, and antigenic variation of recent CDV strains may explain vaccination failure. In this study, a new CDV isolate (TM-CC) was obtained from a Tibetan Mastiff that died of distemper, and its genome was characterized. Phylogenetic analysis of the H gene revealed that the CDV-TM-CC strain is unique among 20 other CDV strains and can be classified into the Asia-1 group with the Chinese strains, Hebei and HLJ1-06, and the Japanese strain, CYN07-hV. The H gene of CDV-TM-CC shows low identity (90.4 % nt and 88.9 % aa) with the H gene of the classical Onderstepoort vaccine strain, which may explain the inability of the Tibetan Mastiff to mount a protective immune response. We also performed a comprehensive phylogenetic analysis of the N, P, and F protein sequences, as well as potential N-glycosylation sites and cysteine residues. This analysis shows that an N-glycosylation site at aa 108-110 within the F protein of CDV-TM-CC is specific for the wild-type strains (5804P, A75/17, and 164071) and the Asia-1 group strains, and may be another important factor for the poor immune response. These results provide important information for the design of CD vaccines in the China region and elsewhere.

  1. CANINE DISTEMPER VIRUS ANTIBODY TITERS IN DOMESTIC CATS AFTER DELIVERY OF A LIVE ATTENUATED VIRUS VACCINE.

    Science.gov (United States)

    Ramsay, Edward; Sadler, Ryan; Rush, Robert; Seimon, Tracie; Tomaszewicz, Ania; Fleetwood, Ellen A; McAloose, Denise; Wilkes, Rebecca P

    2016-06-01

    Three methods for delivering a live attenuated canine distemper virus (CDV) vaccine to domestic cats ( Felis catus ) were investigated, as models for developing vaccination protocols for tigers (Panthera tigris). Twenty domestic cats were randomly divided into four treatment groups: saline injection (negative controls); and oral, intranasal, and subcutaneous vaccinates. Cats were injected with saline or a CDV vaccine (Nobivac DP, Merck) at wk 0 and 4. Blood and nasal swabs were collected at wk 0 (prior to the initial vaccination) and weekly thereafter for 9 wk. Urine samples were collected on wk 1 to 9 after initial vaccination. Forty-nine weeks following the initial vaccination series, three cats from the subcutaneous group and three cats from the intranasal group were revaccinated. Blood was collected immediately prior, and 7 and 21 days subsequent to revaccination. Nasal swabs and urine samples were collected from each cat prior to wk 49 revaccination and daily for 7 days thereafter. Nasal swabs and urine were analyzed by quantitative PCR for vaccine virus presence. Sera were tested for CDV antibodies by virus neutralization. All cats were sero-negative for CDV antibodies at the beginning of the study, and saline-injected cats remained sero-negative throughout the study. A dramatic anamnestic response was seen following wk 4 subcutaneous vaccinations, with titers peaking at wk 6 (geometric mean = 2,435.5). Following wk 49 revaccination, subcutaneous vaccinates again mounted impressive titers (wk 52 geometric mean = 2,048). Revaccination of the intranasal group cats at wk 49 produced a small increase in titers (wk 52 geometric mean = 203). CDV viral RNA was detected in six nasal swabs but no urine samples, demonstrating low viral shedding postvaccination. The strong antibody response to subcutaneous vaccination and the lack of adverse effects suggest this vaccine is safe and potentially protective against CDV infection in domestic cats.

  2. Three-year duration of immunity in dogs following vaccination against canine adenovirus type-1, canine parvovirus, and canine distemper virus.

    Science.gov (United States)

    Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

    2005-01-01

    A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.

  3. SLAM- and nectin-4-independent noncytolytic spread of canine distemper virus in astrocytes.

    Science.gov (United States)

    Alves, Lisa; Khosravi, Mojtaba; Avila, Mislay; Ader-Ebert, Nadine; Bringolf, Fanny; Zurbriggen, Andreas; Vandevelde, Marc; Plattet, Philippe

    2015-05-01

    Measles and canine distemper viruses (MeV and CDV, respectively) first replicate in lymphatic and epithelial tissues by using SLAM and nectin-4 as entry receptors, respectively. The viruses may also invade the brain to establish persistent infections, triggering fatal complications, such as subacute sclerosis pan-encephalitis (SSPE) in MeV infection or chronic, multiple sclerosis-like, multifocal demyelinating lesions in the case of CDV infection. In both diseases, persistence is mediated by viral nucleocapsids that do not require packaging into particles for infectivity but are directly transmitted from cell to cell (neurons in SSPE or astrocytes in distemper encephalitis), presumably by relying on restricted microfusion events. Indeed, although morphological evidence of fusion remained undetectable, viral fusion machineries and, thus, a putative cellular receptor, were shown to contribute to persistent infections. Here, we first showed that nectin-4-dependent cell-cell fusion in Vero cells, triggered by a demyelinating CDV strain, remained extremely limited, thereby supporting a potential role of nectin-4 in mediating persistent infections in astrocytes. However, nectin-4 could not be detected in either primary cultured astrocytes or the white matter of tissue sections. In addition, a bioengineered "nectin-4-blind" recombinant CDV retained full cell-to-cell transmission efficacy in primary astrocytes. Combined with our previous report demonstrating the absence of SLAM expression in astrocytes, these findings are suggestive for the existence of a hitherto unrecognized third CDV receptor expressed by glial cells that contributes to the induction of noncytolytic cell-to-cell viral transmission in astrocytes. While persistent measles virus (MeV) infection induces SSPE in humans, persistent canine distemper virus (CDV) infection causes chronic progressive or relapsing demyelination in carnivores. Common to both central nervous system (CNS) infections is that

  4. Isolation and phylogenetic analysis of canine distemper virus among domestic dogs in Vietnam.

    Science.gov (United States)

    Nguyen, Dung Van; Suzuki, Junko; Minami, Shohei; Yonemitsu, Kenzo; Nagata, Nao; Kuwata, Ryusei; Shimoda, Hiroshi; Vu, Chien Kim; Truong, Thuy Quoc; Maeda, Ken

    2017-01-20

    Canine distemper virus (CDV) is one of the most serious pathogens found in many species of carnivores, including domestic dogs. In this study, hemagglutinin (H) genes were detected in five domestic Vietnamese dogs with diarrhea, and two CDVs were successfully isolated from dogs positive for H genes. The complete genome of one isolate, CDV/dog/HCM/33/140816, was determined. Phylogenetic analysis showed that all Vietnamese CDVs belonged to the Asia-1 genotype. In addition, the H proteins of Vietnamese CDV strains were the most homologous to those of Chinese CDVs (98.4% to 99.3% identity). These results indicated that the Asia-1 genotype of CDV was the predominant genotype circulating among the domestic dog population in Vietnam and that transboundary transmission of CDV has occurred between Vietnam and China.

  5. Phylogenetic analysis of canine distemper virus in domestic dogs in Nanjing, China.

    Science.gov (United States)

    Bi, Zhenwei; Wang, Yongshan; Wang, Xiaoli; Xia, Xingxia

    2015-02-01

    Canine distemper virus (CDV) infects a broad range of carnivores, including wild and domestic Canidae. The hemagglutinin gene, which encodes the attachment protein that determines viral tropism, has been widely used to determine the relationship between CDV strains of different lineages circulating worldwide. We determined the full-length H gene sequences of seven CDV field strains detected in domestic dogs in Nanjing, China. A phylogenetic analysis of the H gene sequences of CDV strains from different geographic regions and vaccine strains was performed. Four of the seven CDV strains were grouped in the same cluster of the Asia-1 lineage to which the vast majority of Chinese CDV strains belong, whereas the other three were clustered within the Asia-4 lineage, which has never been detected in China. This represents the first record of detection of strains of the Asia-4 lineage in China since this lineage was reported in Thailand in 2013.

  6. Measles vaccination of nonhuman primates provides partial protection against infection with canine distemper virus.

    Science.gov (United States)

    de Vries, Rory D; Ludlow, Martin; Verburgh, R Joyce; van Amerongen, Geert; Yüksel, Selma; Nguyen, D Tien; McQuaid, Stephen; Osterhaus, Albert D M E; Duprex, W Paul; de Swart, Rik L

    2014-04-01

    Measles virus (MV) is being considered for global eradication, which would likely reduce compliance with MV vaccination. As a result, children will grow up without MV-specific immunity, creating a potential niche for closely related animal morbilliviruses such as canine distemper virus (CDV). Natural CDV infection causing clinical signs has never been reported in humans, but recent outbreaks in captive macaques have shown that CDV can cause disease in primates. We studied the virulence and tropism of recombinant CDV expressing enhanced green fluorescent protein in naive and measles-vaccinated cynomolgus macaques. In naive animals CDV caused viremia and fever and predominantly infected CD150(+) lymphocytes and dendritic cells. Virus was reisolated from the upper and lower respiratory tracts, but infection of epithelial or neuronal cells was not detectable at the time points examined, and the infections were self-limiting. This demonstrates that CDV readily infects nonhuman primates but suggests that additional mutations are necessary to achieve full virulence in nonnatural hosts. Partial protection against CDV was observed in measles-vaccinated macaques, as demonstrated by accelerated control of virus replication and limited shedding from the upper respiratory tract. While neither CDV infection nor MV vaccination induced detectable cross-reactive neutralizing antibodies, MV-specific neutralizing antibody levels of MV-vaccinated macaques were boosted by CDV challenge infection, suggesting that cross-reactive VN epitopes exist. Rapid increases in white blood cell counts in MV-vaccinated macaques following CDV challenge suggested that cross-reactive cellular immune responses were also present. This study demonstrates that zoonotic morbillivirus infections can be controlled by measles vaccination. Throughout history viral zoonoses have had a substantial impact on human health. Given the drive toward global eradication of measles, it is essential to understand the

  7. Monitoring of Antibodies Titre Against Canine Distemper Virus in Ferrets Vaccinated with a Live Modified Vaccine

    Directory of Open Access Journals (Sweden)

    L. Pavlačík

    2007-01-01

    Full Text Available A group of five ferrets vaccinated against the canine distemper virus (CDV was evaluated as to the onset of anti-CDV antibody production and the serum levels of the animals were monitored for one year. The ferrets were immunized with a live attenuated vaccine. The vaccination pattern was as follows: primary vaccination at the age of 6 weeks, fi rst revaccination at 30 days after primary vaccination, and second revaccination after another 30 days. Blood samples were taken prior to primary vaccination and then at 30-day intervals (sampling 1 to 12. The whole experimental cycle covered the period of one year from primary vaccination (till the age of 1 year and 6 weeks. Serum samples were analysed for anti-CDV virus-neutralisation antibodies using a virus-neutralisation test using the Onderstepoort CDV strain. All ferrets had zero virus-neutralisation antibody titres before primary vaccination. Two ferrets produced virus-neutralisation antibodies as a response to first revaccination. A stable antibody level (titre 256 was maintained between months 4 and 11 after primary vaccination and a sudden increase in antibody titre (titres 512 and 1024 - 2048 occurred in both animals in months 11 and 12. The reason for the abrupt rise in antibody titres in the two animals remains unclear. No anti-CDV seroconversion was observed in the three remaining animals. Regarding the results obtained in this study we do not consider commonly recommended vaccination with a live attenuated anti-CDV vaccine as an effective method of antibodies induction against distemper in young ferrets.

  8. The quest for a safe and effective canine distemper virus vaccine for black-footed ferrets

    Science.gov (United States)

    Wimsatt, Jeffrey; Biggins, Dean E.; Williams, Elizabeth S.; Becerra, Victor M.

    2006-01-01

    Canine distemper virus (CDV) causes a systemic disease that is highly virulent to mustelids and other carnivore (Order Carnivora) species and is found worldwide. Endemic canine distemper in wild and domestic carnivores in the United States has made reintroduction of endangered black-footed ferrets (Mustela nigripes) difficult in the absence of safe and effective CDV vaccines and vaccination practices. Toward this end, researchers have explored appropriate animal models and vaccine preparations in highly susceptible species. Published studies involving domestic ferrets (M. putorius furo) using Galaxy-D® and evaluating a recombinant canarypox-vectored vaccine for oral administration are reviewed. In addition, we present new findings in domestic and black-footed ferrets and Siberian polecats (M. eversmannii) that have extended our understanding of CDV in the black-footed ferret and other at-risk carnivore species. Original research presented here includes trials that determined an effective challenge dose (by route) of virulent CDV in domestic ferrets and Siberian polecats; the low likelihood of collateral vaccination with Galaxy-D; the adverse effect of modified-live virus boostering in black-footed ferrets receiving killed vaccine previously and the response of Siberian polecats receiving canarypoxvectored recombinant CDV vaccine (reCDV); the absence of an effect of reCDV vaccination on conception, pregnancy, and neonatal growth in Siberian polecats; and the apparent inefficacy of active reCDV vaccination during the period of passive immunity in young Siberian polecats. In the final section, we discuss emerging concerns and avenues for disease intervention that may present new opportunities to solve problems in vaccine safety, vaccine availability, field vaccine delivery, and other therapeutic modalities.

  9. Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

    2017-08-15

    Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

  10. Detection of Canine Distemper Virus Nucleoprotein RNA by Reverse Transcription-PCR Using Serum, Whole Blood, and Cerebrospinal Fluid from Dogs with Distemper

    Science.gov (United States)

    Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.

    1999-01-01

    Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566

  11. Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup

    OpenAIRE

    Headley,Selwyn Arlington; Saito,Taís Berelli

    2003-01-01

    Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

  12. Molecular characterization of canine distemper vi- rus circulating in ...

    African Journals Online (AJOL)

    2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

  13. Ribavirin and boceprevir are able to reduce Canine distemper virus growth in vitro.

    Science.gov (United States)

    Lanave, Gianvito; Cavalli, Alessandra; Martella, Vito; Fontana, Tommaso; Losappio, Ruggero; Tempesta, Maria; Decaro, Nicola; Buonavoglia, Domenico; Camero, Michele

    2017-10-01

    Canine distemper virus (CDV) is a major infectious disease of dogs. Although vaccines were successful to control CDV spread in canine population, the disease is still common and may pose a threat to unvaccinated dogs. In the attempt to develop specific anti-viral therapeutic tools, the efficacy of several molecules against CDV has been investigated in vitro. In this study the antiviral efficacy in vitro against CDV of ribavirin and boceprevir alone or in combination was evaluated. CDV growth in VERO cells was inhibited by ribavirin, by boceprevir and by a combination of the two molecules at non-cytotoxic concentrations, as evaluated by end-point viral titration in cell monolayers and by quantification of viral RNA using quantitative RT-PCR. By end-point titration, a statistically significant reduction in CDV replication was observed only using ribavirin and boceprevir in combination. By quantitative RT-PCR, a significant reduction of viral growth was observed either in cells treated with ribavirin or boceprevir or with both the two molecules. The association of ribavirin or boceprevir was able to decrease CDV growth by up to 3.4458 logs with respect to untreated infected cells, chiefly at the highest virus dilutions. The results obtained in this study may constitute an important basis for the development of CDV therapies. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus

    OpenAIRE

    Wong Min-Liang; Hsu Tien-Huan; Lin Fong-Yuan; Lin Kuan-Hsun; Chiou Shyan-Song; Wang Chi-Young; Lee Min-Shiuh; Chulakasian Songkhla; Chang Tien-Jye; Hsu Wei-Li

    2010-01-01

    Abstract Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hen...

  15. Canine distemper outbreak in rhesus monkeys, China.

    Science.gov (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang; Hu, Rongliang

    2011-08-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People's Republic of China. Approximately 10,000 animals were infected (25%-60% disease incidence); 5%-30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain.

  16. Canine Distemper Outbreak in Rhesus Monkeys, China

    Science.gov (United States)

    Qiu, Wei; Zheng, Ying; Zhang, Shoufeng; Fan, Quanshui; Liu, Hua; Zhang, Fuqiang; Wang, Wei; Liao, Guoyang

    2011-01-01

    Since 2006, canine distemper outbreaks have occurred in rhesus monkeys at a breeding farm in Guangxi, People’s Republic of China. Approximately 10,000 animals were infected (25%–60% disease incidence); 5%–30% of infected animals died. The epidemic was controlled by vaccination. Amino acid sequence analysis of the virus indicated a unique strain. PMID:21801646

  17. Molecular phylogeography of canine distemper virus: Geographic origin and global spreading.

    Science.gov (United States)

    Panzera, Yanina; Sarute, Nicolás; Iraola, Gregorio; Hernández, Martín; Pérez, Ruben

    2015-11-01

    Canine distemper virus (CDV) (Paramyxoviridae-Morbillivirus) is a worldwide spread virus causing a fatal systemic disease in a broad range of carnivore hosts. In this study we performed Bayesian inferences using 208 full-length hemagglutinin gene nucleotide sequences isolated in 16 countries during 37 years (1975-2011). The estimated time to the most recent common ancestor suggested that current CDV strains emerged in the United States in the 1880s. This ancestor diversified through time into two ancestral clades, the current America 1 lineage that recently spread to Asia, and other ancestral clade that diversified and spread worldwide to originate the remaining eight lineages characterized to date. The spreading of CDV was characterized by several migratory events with posterior local differentiation, and expansion of the virus host range. A significant genetic flow between domestic and wildlife hosts is displayed; being domestic hosts the main viral reservoirs worldwide. This study is an extensive and integrative description of spatio/temporal population dynamics of CDV lineages that provides a novel evolutionary paradigm about the origin and dissemination of the current strains of the virus. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Viral Oncolysis — Can Insights from Measles Be Transferred to Canine Distemper Virus?

    Directory of Open Access Journals (Sweden)

    Stefanie Lapp

    2014-06-01

    Full Text Available Neoplastic diseases represent one of the most common causes of death among humans and animals. Currently available and applied therapeutic options often remain insufficient and unsatisfactory, therefore new and innovative strategies and approaches are highly needed. Periodically, oncolytic viruses have been in the center of interest since the first anecdotal description of their potential usefulness as an anti-tumor treatment concept. Though first reports referred to an incidental measles virus infection causing tumor regression in a patient suffering from lymphoma several decades ago, no final treatment concept has been developed since then. However, numerous viruses, such as herpes-, adeno- and paramyxoviruses, have been investigated, characterized, and modified with the aim to generate a new anti-cancer treatment option. Among the different viruses, measles virus still represents a highly interesting candidate for such an approach. Numerous different tumors of humans including malignant lymphoma, lung and colorectal adenocarcinoma, mesothelioma, and ovarian cancer, have been studied in vitro and in vivo as potential targets. Moreover, several concepts using different virus preparations are now in clinical trials in humans and may proceed to a new treatment option. Surprisingly, only few studies have investigated viral oncolysis in veterinary medicine. The close relationship between measles virus (MV and canine distemper virus (CDV, both are morbilliviruses, and the fact that numerous tumors in dogs exhibit similarities to their human counterpart, indicates that both the virus and species dog represent a highly interesting translational model for future research in viral oncolysis. Several recent studies support such an assumption. It is therefore the aim of the present communication to outline the mechanisms of morbillivirus-mediated oncolysis and to stimulate further research in this potentially expanding field of viral oncolysis in a highly

  19. Viral Oncolysis — Can Insights from Measles Be Transferred to Canine Distemper Virus?

    Science.gov (United States)

    Lapp, Stefanie; Pfankuche, Vanessa M.; Baumgärtner, Wolfgang; Puff, Christina

    2014-01-01

    Neoplastic diseases represent one of the most common causes of death among humans and animals. Currently available and applied therapeutic options often remain insufficient and unsatisfactory, therefore new and innovative strategies and approaches are highly needed. Periodically, oncolytic viruses have been in the center of interest since the first anecdotal description of their potential usefulness as an anti-tumor treatment concept. Though first reports referred to an incidental measles virus infection causing tumor regression in a patient suffering from lymphoma several decades ago, no final treatment concept has been developed since then. However, numerous viruses, such as herpes-, adeno- and paramyxoviruses, have been investigated, characterized, and modified with the aim to generate a new anti-cancer treatment option. Among the different viruses, measles virus still represents a highly interesting candidate for such an approach. Numerous different tumors of humans including malignant lymphoma, lung and colorectal adenocarcinoma, mesothelioma, and ovarian cancer, have been studied in vitro and in vivo as potential targets. Moreover, several concepts using different virus preparations are now in clinical trials in humans and may proceed to a new treatment option. Surprisingly, only few studies have investigated viral oncolysis in veterinary medicine. The close relationship between measles virus (MV) and canine distemper virus (CDV), both are morbilliviruses, and the fact that numerous tumors in dogs exhibit similarities to their human counterpart, indicates that both the virus and species dog represent a highly interesting translational model for future research in viral oncolysis. Several recent studies support such an assumption. It is therefore the aim of the present communication to outline the mechanisms of morbillivirus-mediated oncolysis and to stimulate further research in this potentially expanding field of viral oncolysis in a highly suitable

  20. Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

    Science.gov (United States)

    Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

    1995-06-01

    For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

  1. Prevalence of antibodies to canine parvovirus and distemper virus in wolves in the Canadian Rocky Mountains.

    Science.gov (United States)

    Nelson, Brynn; Hebblewhite, Mark; Ezenwa, Vanessa; Shury, Todd; Merrill, Evelyn H; Paquet, Paul C; Schmiegelow, Fiona; Seip, Dale; Skinner, Geoff; Webb, Nathan

    2012-01-01

    Wild carnivores are often exposed to diseases via contact with peridomestic host species that travel through the wildland-urban interfaces. To determine the antibody prevalences and relationships to human activity for two common canid pathogens, we sampled 99 wolves (Canis lupus) from 2000 to 2008 for antibodies to canine parvovirus (CPV) and canine distemper virus (CDV) in Banff and Jasper National Parks and surrounding areas of the Canadian Rockies. This population was the source for wolves reintroduced into the Northern Rockies of the US. Of 99 wolves sampled, 94 had detectable antibody to CPV (95%), 24 were antibody-positive for CDV (24%), and 24 had antibodies to both pathogens (24%). We tested whether antibody prevalences for CPV and CDV were higher closer to human activity (roads, town sites, First Nation reserves) and as a function of sex and age class. Wolves ≥2 yr old were more likely to be have antibodies to CPV. For CDV, male wolves, wolves ≥2 yr, and those closer to First Nation reserves were more likely to have antibodies. Overall, however, we found minimal support for human influence on antibody prevalence for CDV and CPV. The similarity between our antibody prevalence results and results from recent studies in Yellowstone National Park suggests that at least in the case of CDV, and perhaps CPV, these could be important pathogens with potential effects on wolf populations.

  2. Characteristics of a Canine Distemper Virus Outbreak in Dichato, Chile Following the February 2010 Earthquake

    Directory of Open Access Journals (Sweden)

    Gerardo Acosta-Jamett

    2013-08-01

    Full Text Available Following the earthquake and tsunami disaster in Chile in February 2010, residents of Dichato reported high morbidity and mortality in dogs, descriptions of which resembled canine distemper virus (CDV. To assess the situation, free vaccine clinics were offered in April and May. Owner information, dog history and signalment were gathered; dogs received physical examinations and vaccines protecting against CDV, and other common canine pathogens. Blood was collected to screen for IgM antibodies to CDV. In total, 208 dogs received physical exams and vaccines were given to 177. IgM antibody titres to CDV were obtained for 104 dogs. Fifty-four dogs (51.9% tested positive for CDV at the cut off titre of >1:50, but a total of 91.4% of dogs had a detectable titre >1:10. Most of the positive test results were in dogs less than 2 years of age; 33.5% had been previously vaccinated against CDV, and owners of 84 dogs (42.2% reported clinical signs characteristic of CDV in their dogs following the disaster. The presence of endemic diseases in dog populations together with poor pre-disaster free-roaming dog management results in a potential for widespread negative effects following disasters. Creation of preparedness plans that include animal welfare, disease prevention and mitigation should be developed.

  3. Expression of canine distemper virus receptor nectin-4 in the central nervous system of dogs.

    Science.gov (United States)

    Pratakpiriya, Watanyoo; Ping Teh, Angeline Ping; Radtanakatikanon, Araya; Pirarat, Nopadon; Thi Lan, Nguyen; Takeda, Makoto; Techangamsuwan, Somporn; Yamaguchi, Ryoji

    2017-03-23

    Canine distemper virus (CDV) exhibits lymphotropic, epitheliotropic, and neurotropic nature, and causes a severe systemic infection in susceptible animals. Initially, signaling lymphocyte activation molecule (SLAM) expressed on immune cells has been identified as a crucial cellular receptor for CDV. Currently, nectin-4 expressed in epithelia has been shown to be another receptor for CDV. Our previous study demonstrated that neurons express nectin-4 and are infected with CDV. In this study, we investigated the distribution pattern of nectin-4 in various cell types in the canine central nervous system and showed its relation to CDV infection to further clarify the pathology of disease. Histopathological, immunohistochemical and immunofluorescent analyses were done using formalin-fixed paraffin-embedded tissues of CDV-infected dogs. Dual staining of nectin-4 and CDV antigen or nectin-4 and brain cell markers was performed. Nectin-4 was detected in ependymal cells, epithelia of choroid plexus, meningeal cells, neurons, granular cells, and Purkinje's cells. CDV antigens were detected in these nectin-4-positive cells, further suggesting contribution of nectin-4 for the CDV neurovirulence. On the other hand, astrocytes did not express nectin-4, although they were frequently infected with CDV. Since astrocytes are negative for SLAM expression, they must express an unidentified CDV receptor, which also contributes to CDV neurovirulence.

  4. Characteristics of a Canine Distemper Virus Outbreak in Dichato, Chile Following the February 2010 Earthquake.

    Science.gov (United States)

    Garde, Elena; Pérez, Guillermo; Acosta-Jamett, Gerardo; Bronsvoort, Barend Mark

    2013-08-27

    Following the earthquake and tsunami disaster in Chile in February 2010, residents of Dichato reported high morbidity and mortality in dogs, descriptions of which resembled canine distemper virus (CDV). To assess the situation, free vaccine clinics were offered in April and May. Owner information, dog history and signalment were gathered; dogs received physical examinations and vaccines protecting against CDV, and other common canine pathogens. Blood was collected to screen for IgM antibodies to CDV. In total, 208 dogs received physical exams and vaccines were given to 177. IgM antibody titres to CDV were obtained for 104 dogs. Fifty-four dogs (51.9%) tested positive for CDV at the cut off titre of >1:50, but a total of 91.4% of dogs had a detectable titre >1:10. Most of the positive test results were in dogs less than 2 years of age; 33.5% had been previously vaccinated against CDV, and owners of 84 dogs (42.2%) reported clinical signs characteristic of CDV in their dogs following the disaster. The presence of endemic diseases in dog populations together with poor pre-disaster free-roaming dog management results in a potential for widespread negative effects following disasters. Creation of preparedness plans that include animal welfare, disease prevention and mitigation should be developed.

  5. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies.

    Science.gov (United States)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent; Pertoldi, Cino; Blixenkrone-Møller, Merete

    2015-03-10

    Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits with CDV DNA vaccines. Virus neutralising (VN) antibody responses were induced in mink kits vaccinated with a plasmid encoding the haemaglutinin protein (H) of CDV (n=5, pCDV-H) or a combination of the H, fusion (F) and nucleoprotein (N) of CDV (n=5, pCDV-HFN). These DNA vaccinated kits were protected against virulent experimental infection with field strains of CDV. The pCDV-H was more efficient in inducing protective immunity in the presence of maternal antibodies compared to the pCDV-HFN. The results show that DNA vaccination with the pCDV-H or pCDV-HFN (n=4) only given once at 5 days of age induces virus specific immune response in neonatal mink and protection against virulent CDV exposure later in life. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Phylogenetic evidence of a new canine distemper virus lineage among domestic dogs in Colombia, South America.

    Science.gov (United States)

    Espinal, Maria A; Díaz, Francisco J; Ruiz-Saenz, Julian

    2014-08-06

    Canine distemper virus (CDV) is a highly contagious viral disease of carnivores affecting both wild and domestic populations. The hemagglutinin gene, encoding for the attachment protein that determines viral tropism, shows high heterogeneity among strains, allowing for the distinction of ten different lineages distributed worldwide according to a geographic pattern. We obtained the sequences of the full-length H gene of 15 wild-type CDV strains circulating in domestic dog populations from the Aburrá Valley, Colombia. A phylogenetic analysis of H gene nucleotide sequences from Colombian CDV viruses along with field isolates from different geographic regions and vaccine strains was performed. Colombian wild-type viruses formed a distinct monophyletic cluster clearly separated from the previously identified wild-type and vaccine lineages, suggesting that a novel genetic variant, quite different from vaccines and other lineages, is circulating among dog populations in the Aburrá Valley. We propose naming this new lineage as "South America 3". This information indicates that there are at least three different CDV lineages circulating in domestic and wild carnivore populations in South America. The first one, renamed Europe/South America 1, circulates in Brazil and Uruguay; the second, South America 2, appears to be restricted to Argentina; and the third, South America 3, which comprises all the strains characterized in this study, may also be circulating in other northern countries of South America. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Identification of amino acid substitutions with compensational effects in the attachment protein of canine distemper virus.

    Science.gov (United States)

    Sattler, Ursula; Khosravi, Mojtaba; Avila, Mislay; Pilo, Paola; Langedijk, Johannes P; Ader-Ebert, Nadine; Alves, Lisa A; Plattet, Philippe; Origgi, Francesco C

    2014-07-01

    The hemagglutinin (H) gene of canine distemper virus (CDV) encodes the receptor-binding protein. This protein, together with the fusion (F) protein, is pivotal for infectivity since it contributes to the fusion of the viral envelope with the host cell membrane. Of the two receptors currently known for CDV (nectin-4 and the signaling lymphocyte activation molecule [SLAM]), SLAM is considered the most relevant for host susceptibility. To investigate how evolution might have impacted the host-CDV interaction, we examined the functional properties of a series of missense single nucleotide polymorphisms (SNPs) naturally accumulating within the H-gene sequences during the transition between two distinct but related strains. The two strains, a wild-type strain and a consensus strain, were part of a single continental outbreak in European wildlife and occurred in distinct geographical areas 2 years apart. The deduced amino acid sequence of the two H genes differed at 5 residues. A panel of mutants carrying all the combinations of the SNPs was obtained by site-directed mutagenesis. The selected mutant, wild type, and consensus H proteins were functionally evaluated according to their surface expression, SLAM binding, fusion protein interaction, and cell fusion efficiencies. The results highlight that the most detrimental functional effects are associated with specific sets of SNPs. Strikingly, an efficient compensational system driven by additional SNPs appears to come into play, virtually neutralizing the negative functional effects. This system seems to contribute to the maintenance of the tightly regulated function of the H-gene-encoded attachment protein. Importance: To investigate how evolution might have impacted the host-canine distemper virus (CDV) interaction, we examined the functional properties of naturally occurring single nucleotide polymorphisms (SNPs) in the hemagglutinin gene of two related but distinct strains of CDV. The hemagglutinin gene encodes the

  8. A chimeric measles virus with canine distemper envelope protects ferrets from lethal distemper challenge.

    Science.gov (United States)

    Rouxel, Ronan Nicolas; Svitek, Nicholas; von Messling, Veronika

    2009-08-06

    CDV infects a broad range of carnivores, and over the past decades it has caused outbreaks in a variety of wild carnivore populations. Since the currently available live-attenuated vaccine is not sufficiently safe in these highly susceptible species, we produced a chimeric virus combining the replication complex of the measles Moraten vaccine strain with the envelope of a recent CDV wild type isolate. The resulting virus did not cause disease or immunosuppression in ferrets and conferred protection from challenge with a lethal wild type strain, demonstrating its potential value for wildlife conservation efforts.

  9. Development and characterization of neutralizing monoclonal antibodies against canine distemper virus hemagglutinin protein.

    Science.gov (United States)

    Bi, Zhenwei; Xia, Xingxia; Wang, Yongshan; Mei, Yongjie

    2015-04-01

    Canine distemper virus (CDV) causes a serious multisystemic disease in dogs and other carnivora. Hemagglutinin (H) protein-specific antibodies are mainly responsible for protective immunity against CDV infection. In the present study, six neutralizing MAbs to the H protein of CDV were newly obtained and characterized by immunizing BALB/c mice with a recent Chinese field isolate. Competitive binding inhibition assay revealed that they recognized four distinct antigenic regions of the H protein. Immunofluorescence assay and western blotting showed that all MAbs recognize the conformational rather than the linear epitopes of the H protein. Furthermore, in immunofluorescence and virus neutralization assays, two of the MAbs were found to react only with the recent Chinese field isolate and not with older CDV strains, including vaccine strain Onderstepoort, indicating there are neutralization-related antigenic variations between the recent Chinese field isolate and the older CDV strains examined in this study. The newly established MAbs are useful for differentiating the expanding CDV strains and could be used in immunotherapy and immunodiagnosis against infection with CDV. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.

  10. Frequency of exposure of endangered Caspian seals to Canine distemper virus, Leptospira interrogans, and Toxoplasma gondii.

    Directory of Open Access Journals (Sweden)

    Somayeh Namroodi

    Full Text Available Canine distemper virus (CDV, Leptospira interrogans, and Toxoplasma gondii are potentially lethal pathogens associated with decline in marine mammal populations. The Caspian Sea is home for the endangered Caspian seal (Pusa caspica. In the late 1990s and early 2000s, CDV caused a series of mortality events involving at least several thousand Caspian seals. To assess current infection status in Caspian seals, we surveyed for antibodies to three pathogens with potential to cause mortality in marine mammals. During 2015-2017, we tested serum samples from 36, apparently healthy, Caspian seals, accidentally caught in fishing nets in the Caspian Sea off Northern Iran, for antibodies to CDV, L. interrogans, and T. gondii, by virus neutralization, microscopic agglutination, and modified agglutination, respectively. Twelve (33%, 6 (17%, and 30 (83% samples were positive for CDV, L. interrogans and T. gondii antibodies, respectively. The highest titers of CDV, L. interrogans, and T. gondii antibodies were 16, 400, and 50, respectively. Frequencies of antibody to these pathogens were higher in seals >1 year old compared to seals <1 year old. Two serovars of L. interrogans (Pomona and Canicola were detected. Our results suggest a need for additional studies to clarify the impact of these pathogens on Caspian seal population decline and the improvement of management programs, including systematic screening to detect and protect the remaining population from disease outbreaks.

  11. Propagation of Asian isolates of canine distemper virus (CDV in hamster cell lines

    Directory of Open Access Journals (Sweden)

    Yamaguchi Ryoji

    2009-10-01

    Full Text Available Abstract Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains and by observing the development of cytopathic effect (CPE in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically.

  12. Lethal canine distemper virus outbreak in cynomolgus monkeys in Japan in 2008.

    Science.gov (United States)

    Sakai, Kouji; Nagata, Noriyo; Ami, Yasushi; Seki, Fumio; Suzaki, Yuriko; Iwata-Yoshikawa, Naoko; Suzuki, Tadaki; Fukushi, Shuetsu; Mizutani, Tetsuya; Yoshikawa, Tomoki; Otsuki, Noriyuki; Kurane, Ichiro; Komase, Katsuhiro; Yamaguchi, Ryoji; Hasegawa, Hideki; Saijo, Masayuki; Takeda, Makoto; Morikawa, Shigeru

    2013-01-01

    Canine distemper virus (CDV) has recently expanded its host range to nonhuman primates. A large CDV outbreak occurred in rhesus monkeys at a breeding farm in Guangxi Province, China, in 2006, followed by another outbreak in rhesus monkeys at an animal center in Beijing in 2008. In 2008 in Japan, a CDV outbreak also occurred in cynomolgus monkeys imported from China. In that outbreak, 46 monkeys died from severe pneumonia during a quarantine period. A CDV strain (CYN07-dV) was isolated in Vero cells expressing dog signaling lymphocyte activation molecule (SLAM). Phylogenic analysis showed that CYN07-dV was closely related to the recent CDV outbreaks in China, suggesting continuing chains of CDV infection in monkeys. In vitro, CYN07-dV uses macaca SLAM and macaca nectin4 as receptors as efficiently as dog SLAM and dog nectin4, respectively. CYN07-dV showed high virulence in experimentally infected cynomolgus monkeys and excreted progeny viruses in oral fluid and feces. These data revealed that some of the CDV strains, like CYN07-dV, have the potential to cause acute systemic infection in monkeys.

  13. Canine distemper virus infection among wildlife before and after the epidemic.

    Science.gov (United States)

    Suzuki, Junko; Nishio, Yohei; Kameo, Yuki; Terada, Yutaka; Kuwata, Ryusei; Shimoda, Hiroshi; Suzuki, Kazuo; Maeda, Ken

    2015-11-01

    In 2007-2008, a canine distemper virus (CDV) epidemic occurred among wild animals in Wakayama Prefecture, Japan, and many mammals, including the wild boar and deer, were infected. In this study, CDV prevalence among wild animals was surveyed before and after the epidemic. At first, an enzyme-linked immunosorbent assay (ELISA) with horseradish peroxidase-conjugated protein A/G was established to detect CDV antibodies in many mammalian species. This established ELISA was available for testing dogs, raccoons and raccoon dogs as well as virus-neutralization test. Next, a serological survey of wild mammalians was conducted, and it was indicated that many wild mammalians, particularly raccoons, were infected with CDV during the epidemic, but few were infected before and after the epidemic. On the other hand, many raccoon dogs died during the epidemic, but CDV remained prevalent in the remaining population, and a small epidemic occurred in raccoon dogs in 2012-2013. These results indicated that the epidemic of 2007-2008 may have been intensified by transmission to raccoons.

  14. CANINE DISTEMPER VIRUS IN A WILD FAR EASTERN LEOPARD ( PANTHERA PARDUS ORIENTALIS).

    Science.gov (United States)

    Sulikhan, Nadezhda S; Gilbert, Martin; Blidchenko, Ekaterina Yu; Naidenko, Sergei V; Ivanchuk, Galina V; Gorpenchenko, Tatiana Yu; Alshinetskiy, Mikhail V; Shevtsova, Elena I; Goodrich, John M; Lewis, John C M; Goncharuk, Mikhail S; Uphyrkina, Olga V; Rozhnov, Vyatcheslav V; Shedko, Sergey V; McAloose, Denise; Miquelle, Dale G

    2018-01-01

    The critically endangered population of Far Eastern leopards ( Panthera pardus orientalis) may number as few as 60 individuals and is at risk from stochastic processes such as infectious disease. During May 2015, a case of canine distemper virus (CDV) was diagnosed in a wild leopard exhibiting severe neurologic disease in the Russian territory of Primorskii Krai. Amplified sequences of the CDV hemagglutinin gene and phosphoprotein gene aligned within the Arctic-like clade of CDV, which includes viruses from elsewhere in Russia, China, Europe, and North America. Histologic examination of cerebral tissue revealed perivascular lymphoid cuffing and demyelination of the white matter consistent with CDV infection. Neutralizing antibodies against CDV were detected in archived serum from two wild Far Eastern leopards sampled during 1993-94, confirming previous exposure in the population. This leopard population is likely too small to maintain circulation of CDV, suggesting that infections arise from spillover from more-abundant domestic or wild carnivore reservoirs. Increasing the population size and establishment of additional populations of leopards would be important steps toward securing the future of this subspecies and reducing the risk posed by future outbreaks of CDV or other infectious diseases.

  15. Frequency of exposure of endangered Caspian seals to Canine distemper virus, Leptospira interrogans, and Toxoplasma gondii.

    Science.gov (United States)

    Namroodi, Somayeh; Shirazi, Amir S; Khaleghi, Seyyed Reza; N Mills, James; Kheirabady, Vahid

    2018-01-01

    Canine distemper virus (CDV), Leptospira interrogans, and Toxoplasma gondii are potentially lethal pathogens associated with decline in marine mammal populations. The Caspian Sea is home for the endangered Caspian seal (Pusa caspica). In the late 1990s and early 2000s, CDV caused a series of mortality events involving at least several thousand Caspian seals. To assess current infection status in Caspian seals, we surveyed for antibodies to three pathogens with potential to cause mortality in marine mammals. During 2015-2017, we tested serum samples from 36, apparently healthy, Caspian seals, accidentally caught in fishing nets in the Caspian Sea off Northern Iran, for antibodies to CDV, L. interrogans, and T. gondii, by virus neutralization, microscopic agglutination, and modified agglutination, respectively. Twelve (33%), 6 (17%), and 30 (83%) samples were positive for CDV, L. interrogans and T. gondii antibodies, respectively. The highest titers of CDV, L. interrogans, and T. gondii antibodies were 16, 400, and 50, respectively. Frequencies of antibody to these pathogens were higher in seals >1 year old compared to seals <1 year old. Two serovars of L. interrogans (Pomona and Canicola) were detected. Our results suggest a need for additional studies to clarify the impact of these pathogens on Caspian seal population decline and the improvement of management programs, including systematic screening to detect and protect the remaining population from disease outbreaks.

  16. Evidence of Two Cocirculating Canine Distemper Virus Strains in Mesocarnivores from Northern Colorado.

    Science.gov (United States)

    Wostenberg, Darren J; Walker, Nikki; Fox, Karen A; Spraker, Terry R; Piaggio, Antoinette J; Gilbert, Amy

    2018-03-02

    Canine distemper virus (CDV) is a highly contagious pathogen that principally infects wildlife and domestic carnivores. Peridomestic species such as raccoons ( Procyon lotor) experience outbreaks with high mortality. Clinical signs of infection include anorexia, fever, respiratory infection, and neurologic complications. Although not zoonotic, CDV poses a high risk to unvaccinated domestic animals and the conservation of endangered species. During 2013-2016, we opportunistically collected wild and domestic carnivore specimens through a rabies surveillance program in northern Colorado. Brainstem and cerebellar tissue samples were independently tested for rabies and CDV by fluorescent antibody test. We tested a total of 478 animals for CDV, comprised of 10 wild and domestic carnivore species. A total of 24% (71/300) raccoons and 4% (1/26) coyotes ( Canis latrans) tested positive for CDV, but coinfection with rabies virus was not observed among CDV-positive animals. We extracted RNA from positive tissues, and a reverse-transcription PCR was used to create complementary DNA. We amplified and sequenced the hemagglutinin gene from 60 CDV-positive tissues, and a median joining network and maximum likelihood phylogenetic tree revealed two major lineages among samples. Phylogenetic analysis indicated that our sequences were most similar to: 1) the America-2 ( n=55) and 2) the America-3 ( n=5) CDV lineages circulating in North America. Our results indicated two distinct and distantly related clades of CDV overlapping geographically and temporally among raccoon populations in northern Colorado.

  17. Canine distemper virus: an emerging disease in wild endangered Amur tigers (Panthera tigris altaica).

    Science.gov (United States)

    Seimon, Tracie A; Miquelle, Dale G; Chang, Tylis Y; Newton, Alisa L; Korotkova, Irina; Ivanchuk, Galina; Lyubchenko, Elena; Tupikov, Andre; Slabe, Evgeny; McAloose, Denise

    2013-08-13

    Fewer than 500 Amur tigers (Panthera tigris altaica) remain in the wild. Due to low numbers and their solitary and reclusive nature, tiger sightings across their range in the Russian Far East and China are rare; sightings of sick tigers are rarer still. Serious neurologic disease observed in several wild tigers since 2001 suggested disease emergence in this endangered species. To investigate this possibility, histology, immunohistochemistry (IHC), in situ hybridization (ISH), and reverse transcription-PCR (RT-PCR) were performed on tissues from 5 affected tigers that died or were destroyed in 2001, 2004, or 2010. Our results reveal canine distemper virus (CDV) infection as the cause of neurologic disease in two tigers and definitively establish infection in a third. Nonsuppurative encephalitis with demyelination, eosinophilic nuclear viral inclusions, and positive immunolabeling for CDV by IHC and ISH were present in the two tigers with available brain tissue. CDV phosphoprotein (P) and hemagglutinin (H) gene products were obtained from brains of these two tigers by RT-PCR, and a short fragment of CDV P gene sequence was detected in lymph node tissue of a third tiger. Phylogenetically, Amur tiger CDV groups with an Arctic-like strain in Baikal seals (Phoca siberica). Our results, which include mapping the location of positive tigers and recognition of a cluster of cases in 2010, coupled with a lack of reported CDV antibodies in Amur tigers prior to 2000 suggest wide geographic distribution of CDV across the tiger range and recent emergence of CDV as a significant infectious disease threat to endangered Amur tigers in the Russian Far East. Recognition of disease emergence in wildlife is a rare occurrence. Here, for the first time, we identify and characterize a canine distemper virus (CDV), the second most common cause of infectious disease death in domestic dogs and a viral disease of global importance in common and endangered carnivores, as the etiology of

  18. Prevalence of protective antibody titers for canine distemper virus and canine parvovirus in dogs entering a Florida animal shelter.

    Science.gov (United States)

    Lechner, Elizabeth S; Crawford, P Cynda; Levy, Julie K; Edinboro, Charlotte H; Dubovi, Edward J; Caligiuri, Randy

    2010-06-15

    To determine the proportion of dogs entering an animal shelter with protective antibody titers (PATs) for canine distemper virus (CDV) and canine parvovirus (CPV) and identify factors associated with having a PAT. Cross-sectional study. 431 dogs admitted to an open-admission municipal animal shelter in north central Florida with a history of infectious disease outbreaks. Blood was collected from dogs on the day of admission to the shelter. Antibody titers for CDV and CPV were measured by virus neutralization and hemagglutination inhibition, respectively. Age, sex, neuter status, address of origin, source (stray or previously owned), health status (healthy or not healthy), and outcome (adoption, euthanasia, or reclaimed by owner) data were also collected. Overall, 64.5% (278/431) of dogs had insufficient titers for antibodies against CDV, CPV, or both. A total of 153 (35.5%) dogs had PATs for both CDV and CPV, 33 (7.7%) had PATs for CDV but not CPV, 136 (31.5%) had PATs for CPV but not CDV, and 109 (25.3%) did not have PATs for either virus. Older dogs were more likely to have PATs for CDV and CPV. Neutered dogs were more likely to have PATs for CDV. Factors not associated with having a PAT included source, health status, and type of community from which the dog originated. Most dogs had insufficient antibody titers for CDV, CPV, or both at the time of admission to the animal shelter. Findings support current guidelines recommending vaccination of all dogs immediately upon admission to shelters, regardless of source or physical condition.

  19. Dynamic changes of Foxp3(+) regulatory T cells in spleen and brain of canine distemper virus-infected dogs.

    Science.gov (United States)

    Qeska, V; Barthel, Y; Iseringhausen, M; Tipold, A; Stein, V M; Khan, M A; Baumgärtner, W; Beineke, A

    2013-12-15

    Canine distemper virus (CDV) infection causes immunosuppression and demyelinating leukoencephalitis in dogs. In viral diseases, an ambiguous function of regulatory T cells (Treg), with both beneficial effects by reducing immunopathology and detrimental effects by inhibiting antiviral immunity, has been described. However, the role of Treg in the pathogenesis of canine distemper remains unknown. In order to determine the effect of CDV upon immune homeostasis, the amount of Foxp3(+) Treg in spleen and brain of naturally infected dogs has been determined by immunohistochemistry. In addition, splenic cytokine expression has been quantified by reverse transcriptase polymerase chain reaction. Splenic depletion of Foxp3(+) Treg was associated with an increased mRNA-expression of tumor necrosis factor and decreased transcription of interleukin-2 in the acute disease phase, indicative of disturbed immunological counter regulation in peripheral lymphoid organs. In the brain, a lack of Foxp3(+) Treg in predemyelinating and early demyelinating lesions and significantly increased infiltrations of Foxp3(+) Treg in chronic demyelinating lesions were observed. In conclusion, disturbed peripheral and CNS immune regulation associated with a reduction of Treg represents a potential prerequisite for excessive neuroinflammation and early lesion development in canine distemper leukoencephalitis. © 2013 Elsevier B.V. All rights reserved.

  20. Infectious Progression of Canine Distemper Virus from Circulating Cerebrospinal Fluid into the Central Nervous System.

    Science.gov (United States)

    Takenaka, Akiko; Sato, Hiroki; Ikeda, Fusako; Yoneda, Misako; Kai, Chieko

    2016-10-15

    In the current study, we generated recombinant chimeric canine distemper viruses (CDVs) by replacing the hemagglutinin (H) and/or phosphoprotein (P) gene in an avirulent strain expressing enhanced green fluorescent protein (EGFP) with those of a mouse-adapted neurovirulent strain. An in vitro experimental infection indicated that the chimeric CDVs possessing the H gene derived from the mouse-adapted CDV acquired infectivity for neural cells. These cells lack the CDV receptors that have been identified to date (SLAM and nectin-4), indicating that the H protein defines infectivity in various cell lines. The recombinant viruses were administered intracerebrally to 1-week-old mice. Fatal neurological signs of disease were observed only with a recombinant CDV that possessed both the H and P genes of the mouse-adapted strain, similar to the parental mouse-adapted strain, suggesting that both genes are important to drive virulence of CDV in mice. Using this recombinant CDV, we traced the intracerebral propagation of CDV by detecting EGFP. Widespread infection was observed in the cerebral hemispheres and brainstems of the infected mice. In addition, EGFP fluorescence in the brain slices demonstrated a sequential infectious progression in the central nervous system: CDV primarily infected the neuroependymal cells lining the ventricular wall and the neurons of the hippocampus and cortex adjacent to the ventricle, and it then progressed to an extensive infection of the brain surface, followed by the parenchyma and cortex. In the hippocampal formation, CDV spread in a unidirectional retrograde pattern along neuronal processes in the hippocampal formation from the CA1 region to the CA3 region and the dentate gyrus. Our mouse model demonstrated that the main target cells of CDV are neurons in the acute phase and that the virus spreads via neuronal transmission pathways in the hippocampal formation. CDV is the etiological agent of distemper in dogs and other carnivores, and in

  1. Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs.

    Directory of Open Access Journals (Sweden)

    Ryuichi Miura

    Full Text Available Canine distemper virus (CDV vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV-LACK, rCDV-TSA, and rCDV-LmSTI1, respectively. Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV-LACK showed markedly smaller nodules without ulceration. Although the rCDV-TSA- and rCDV-LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV-LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs.

  2. Sandwich-dot enzyme-linked immunosorbent assay for the detection of canine distemper virus

    Science.gov (United States)

    Li, Zhi; Zhang, Yanlong; Wang, Huiguo; Jin, Jinhua; Li, Wenzhe

    2013-01-01

    A sandwich-dot enzyme-linked immunosorbent assay (dot ELISA) was developed for the detection of canine distemper virus (CDV). In 56 dogs suspected to have CD the rates of detection of CDV antigen in samples of blood lymphocytes and palpebral conjunctiva by dot ELISA and ELISA were, respectively, 91% (49/54) and 81% (44/54) for the lymphocyte samples and 88% (28/32) and 75% (24/32) for the conjunctival samples. The CDV detection limits were 10 ng/50 μL for dot ELISA and 40 ng/50 μL for ELISA. The reliability of dot ELISA relative to electron microscopy was 96% with 22 samples: all 21 samples in which CDV particles were observed by electron microscopy yielded positive results with dot ELISA; the single sample in which particles were not observed yielded false-positive results with dot ELISA. The results indicate that the dot ELISA developed can serve as a reliable rapid diagnostic test in suspected cases of CD and also be useful for epidemiologic surveillance of the disease. PMID:24124274

  3. Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs.

    Science.gov (United States)

    Miura, Ryuichi; Kooriyama, Takanori; Yoneda, Misako; Takenaka, Akiko; Doki, Miho; Goto, Yasuyuki; Sanjoba, Chizu; Endo, Yasuyuki; Fujiyuki, Tomoko; Sugai, Akihiro; Tsukiyama-Kohara, Kyoko; Matsumoto, Yoshitsugu; Sato, Hiroki; Kai, Chieko

    2015-01-01

    Canine distemper virus (CDV) vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV-LACK, rCDV-TSA, and rCDV-LmSTI1, respectively). Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears) with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV-LACK showed markedly smaller nodules without ulceration. Although the rCDV-TSA- and rCDV-LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV-LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs.

  4. Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas.

    Science.gov (United States)

    Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin

    2017-08-15

    In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenuated combination CDV vaccine was used among almost all carnivore animals except for red pandas in which another recombinant combination CDV vaccine was used. However, about two months later, CDV re-emerged and caused the death among red pandas. Based on the vaccination records, the live combination vaccine could be considered an ideal weapon against CDV in zoo carnivore animals. Although the recombinant combination CDV vaccine was safe for red pandas, its protection effectiveness remains to be further investigated. Moreover, according to the outbreak interval time and sequence characterization, we suspected that stray cats circulating in the zoo were the intermediate host, which contributed to CDV spread from stray dogs to zoo animals. This study revealed the importance of vaccination and biosecurity for zoo animals.

  5. 6-methylmercaptopurine riboside, a thiopurine nucleoside with antiviral activity against canine distemper virus in vitro

    OpenAIRE

    de Carvalho, Ot?vio Val?rio; F?lix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, M?rcia Rog?ria; Bressan, Gustavo Costa; Pena, Lindomar Jos?; Silva-J?nior, Abelardo

    2017-01-01

    Background Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic stra...

  6. Genome Sequences of Three Vaccine Strains and Two Wild-Type Canine Distemper Virus Strains from a Recent Disease Outbreak in South Africa.

    Science.gov (United States)

    Loots, Angelika K; Du Plessis, Morné; Dalton, Desiré Lee; Mitchell, Emily; Venter, Estelle H

    2017-07-06

    Canine distemper virus causes global multihost infectious disease. This report details complete genome sequences of three vaccine and two new wild-type strains. The wild-type strains belong to the South African lineage, and all three vaccine strains to the America 1 lineage. This constitutes the first genomic sequences of this virus from South Africa. Copyright © 2017 Loots et al.

  7. Dimerization Efficiency of Canine Distemper Virus Matrix Protein Regulates Membrane-Budding Activity.

    Science.gov (United States)

    Bringolf, Fanny; Herren, Michael; Wyss, Marianne; Vidondo, Beatriz; Langedijk, Johannes P; Zurbriggen, Andreas; Plattet, Philippe

    2017-08-15

    Paramyxoviruses rely on the matrix (M) protein to orchestrate viral assembly and budding at the plasma membrane. Although the mechanistic details remain largely unknown, structural data suggested that M dimers and/or higher-order oligomers may facilitate membrane budding. To gain functional insights, we employed a structure-guided mutagenesis approach to investigate the role of canine distemper virus (CDV) M protein self-assembly in membrane-budding activity. Three six-alanine-block (6A-block) mutants with mutations located at strategic oligomeric positions were initially designed. While the first one includes residues potentially residing at the protomer-protomer interface, the other two display amino acids located within two distal surface-exposed α-helices proposed to be involved in dimer-dimer contacts. We further focused on the core of the dimeric interface by mutating asparagine 138 (N138) to several nonconservative amino acids. Cellular localization combined with dimerization and coimmunopurification assays, performed under various denaturing conditions, revealed that all 6A-block mutants were impaired in self-assembly and cell periphery accumulation. These phenotypes correlated with deficiencies in relocating CDV nucleocapsid proteins to the cell periphery and in virus-like particle (VLP) production. Conversely, all M-N138 mutants remained capable of self-assembly, though to various extents, which correlated with proper accumulation and redistribution of nucleocapsid proteins at the plasma membrane. However, membrane deformation and VLP assays indicated that the M-N138 variants exhibiting the most reduced dimerization propensity were also defective in triggering membrane remodeling and budding, despite proper plasma membrane accumulation. Overall, our data provide mechanistic evidence that the efficiency of CDV M dimerization/oligomerization governs both cell periphery localization and membrane-budding activity. IMPORTANCE Despite the availability of

  8. Canine Distemper Virus Fusion Activation: Critical Role of Residue E123 of CD150/SLAM.

    Science.gov (United States)

    Khosravi, Mojtaba; Bringolf, Fanny; Röthlisberger, Silvan; Bieringer, Maria; Schneider-Schaulies, Jürgen; Zurbriggen, Andreas; Origgi, Francesco; Plattet, Philippe

    2016-02-01

    Measles virus (MeV) and canine distemper virus (CDV) possess tetrameric attachment proteins (H) and trimeric fusion proteins, which cooperate with either SLAM or nectin 4 receptors to trigger membrane fusion for cell entry. While the MeV H-SLAM cocrystal structure revealed the binding interface, two distinct oligomeric H assemblies were also determined. In one of the conformations, two SLAM units were sandwiched between two discrete H head domains, thus spotlighting two binding interfaces ("front" and "back"). Here, we investigated the functional relevance of both interfaces in activating the CDV membrane fusion machinery. While alanine-scanning mutagenesis identified five critical regulatory residues in the front H-binding site of SLAM, the replacement of a conserved glutamate residue (E at position 123, replaced with A [E123A]) led to the most pronounced impact on fusion promotion. Intriguingly, while determination of the interaction of H with the receptor using soluble constructs revealed reduced binding for the identified SLAM mutants, no effect was recorded when physical interaction was investigated with the full-length counterparts of both molecules. Conversely, although mutagenesis of three strategically selected residues within the back H-binding site of SLAM did not substantially affect fusion triggering, nevertheless, the mutants weakened the H-SLAM interaction recorded with the membrane-anchored protein constructs. Collectively, our findings support a mode of binding between the attachment protein and the V domain of SLAM that is common to all morbilliviruses and suggest a major role of the SLAM residue E123, located at the front H-binding site, in triggering the fusion machinery. However, our data additionally support the hypothesis that other microdomain(s) of both glycoproteins (including the back H-binding site) might be required to achieve fully productive H-SLAM interactions. A complete understanding of the measles virus and canine distemper virus

  9. Evaluation of a Direct Immunofluorescent Assay and/or Conjunctival Cytology for Detection of Canine Distemper Virus Antigen.

    Science.gov (United States)

    Athanasiou, Labrini V; Kantere, Maria C; Kyriakis, Constantinos S; Pardali, Dimitra; Adamama Moraitou, Katerina; Polizopoulou, Zoe S

    2018-04-01

    Canine distemper is a common and potentially lethal multisystemic disease caused by the Canine distemper virus (CDV). We evaluated the diagnostic performance of direct immunofluorescent assay (FA) and cytology to detect CDV antigen in conjunctival cells compared with an established polymerase chain reaction (PCR) detection assay used as a gold standard for CDV diagnosis. Samples were collected from 57 young dogs presenting with central nervous system signs compatible with distemper disease. Exfoliative epithelial cells were collected from the right and left conjunctiva of each animal using nylon-bristled cytobrushes for cytology and cotton swabs for FA and PCR. For the direct FA, samples were stained with anti-CDV polyclonal antiserum conjugated to fluorescein isothiocyanate and imaged using a fluorescent microscope. Out of 57 dogs tested, 19 were PCR positive (15 positive in direct FA and 4 positive in cytology, including one that was negative by PCR), whereas 37 dogs were negative in all methods. A good agreement was observed between the FA and PCR, with a κ-value of 0.833 (95% CI: 0.678-0.989). Meanwhile, there was poor agreement between cytology and PCR (κ-value of 0.164; 95% CI: -0.045 to 0.373) and a fair agreement between FA and cytology (κ-value of 0.231; 95% CI: -0.026 to 0.487). Our results indicated a poor performance of cytology for the detection of CDV antigen. In contrast, FA is a 100% specific and an adequately sensitive assay (sensitivity: 78.95%, negative likelihood ratio: 0.21, 95% CI: 0.09-0.50) for antemortem diagnosis of canine distemper.

  10. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  11. The V domain of dog PVRL4 (nectin-4) mediates canine distemper virus entry and virus cell-to-cell spread

    International Nuclear Information System (INIS)

    Delpeut, Sebastien; Noyce, Ryan S.; Richardson, Christopher D.

    2014-01-01

    The entry of canine distemper virus (CDV) is a multistep process that involves the attachment of CDV hemagglutinin (H) to its cellular receptor, followed by fusion between virus and cell membranes. Our laboratory recently identified PVRL4 (nectin-4) to be the epithelial receptor for measles and canine distemper viruses. In this study, we demonstrate that the V domain of PVRL4 is critical for CDV entry and virus cell-to-cell spread. Furthermore, four key amino acid residues within the V domain of dog PVRL4 and two within the CDV hemagglutinin were shown to be essential for receptor-mediated virus entry. - Highlights: • PVRL4 (nectin-4) is the epithelial cell receptor for measles and canine distemper viruses. • V domain of PVRL4 is critical for CDV entry, cell-to-cell spread, and syncytia formation. • Chimeric PVRL1 backbone substituted with the V domain of PVRL4 can function as a receptor. • Amino acids (F132/P133/A134/G135) within the V domain are essential for PVRL4 receptor activity. • Amino acids (P493/Y539) within CDV H protein are essential for PVRL4 receptor interaction

  12. The V domain of dog PVRL4 (nectin-4) mediates canine distemper virus entry and virus cell-to-cell spread

    Energy Technology Data Exchange (ETDEWEB)

    Delpeut, Sebastien; Noyce, Ryan S. [The Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); IWK Health Centre, Canadian Center for Vaccinology, Goldbloom Pavilion, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); Richardson, Christopher D., E-mail: chris.richardson@dal.ca [The Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); IWK Health Centre, Canadian Center for Vaccinology, Goldbloom Pavilion, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); The Department of Pediatrics, Dalhousie University, Halifax, Nova Scotia (Canada)

    2014-04-15

    The entry of canine distemper virus (CDV) is a multistep process that involves the attachment of CDV hemagglutinin (H) to its cellular receptor, followed by fusion between virus and cell membranes. Our laboratory recently identified PVRL4 (nectin-4) to be the epithelial receptor for measles and canine distemper viruses. In this study, we demonstrate that the V domain of PVRL4 is critical for CDV entry and virus cell-to-cell spread. Furthermore, four key amino acid residues within the V domain of dog PVRL4 and two within the CDV hemagglutinin were shown to be essential for receptor-mediated virus entry. - Highlights: • PVRL4 (nectin-4) is the epithelial cell receptor for measles and canine distemper viruses. • V domain of PVRL4 is critical for CDV entry, cell-to-cell spread, and syncytia formation. • Chimeric PVRL1 backbone substituted with the V domain of PVRL4 can function as a receptor. • Amino acids (F132/P133/A134/G135) within the V domain are essential for PVRL4 receptor activity. • Amino acids (P493/Y539) within CDV H protein are essential for PVRL4 receptor interaction.

  13. Prevalence of serum antibody titers against canine distemper virus and canine parvovirus in dogs hospitalized in an intensive care unit.

    Science.gov (United States)

    Mahon, Jennifer L; Rozanski, Elizabeth A; Paul, April L

    2017-06-15

    OBJECTIVE To determine the prevalence of dogs hospitalized in an intensive care unit (ICU) with serum antibody titers against canine distemper virus (CDV) and canine parvovirus (CPV). DESIGN Prospective observational study. ANIMALS 80 dogs. PROCEDURES Dogs hospitalized in an ICU for > 12 hours between February 1 and June 1, 2015, that had at least 0.25 mL of serum left over from diagnostic testing were eligible for study inclusion. Dogs with serum antibody titers > 1:32 (as determined by serum neutralization) and > 1:80 (as determined by hemagglutination inhibition) were considered seropositive for CDV and CPV, respectively. The date of last vaccination was obtained from the medical record of each dog. RESULTS Of the 80 dogs, 40 (50%) and 65 (81%) dogs were seropositive for CDV and CPV, respectively. Of the 40 dogs that were seronegative for CDV, 27 had been vaccinated against CDV within 3 years prior to testing. Of the 15 dogs that were seronegative for CPV, 3 had been vaccinated against CPV within 3 years prior to testing. Ten dogs were seronegative for both CDV and CPV. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated the prevalence of dogs hospitalized in an ICU that were seropositive for CDV and CPV was lower than expected given the high vaccination rate reported for dogs. Although the antibody titer necessary to prevent disease caused by CDV or CPV in critically ill dogs is unknown, adherence to infectious disease control guidelines is warranted when CDV- or CPV-infected dogs are treated in an ICU.

  14. Pathogenesis of canine distemper virus in experimentally infected raccoon dogs, foxes, and minks.

    Science.gov (United States)

    Zhao, Jianjun; Shi, Ning; Sun, Yangang; Martella, Vito; Nikolin, Veljko; Zhu, Chunsheng; Zhang, Hailing; Hu, Bo; Bai, Xue; Yan, Xijun

    2015-10-01

    Canine distemper virus (CDV) infects a broad range of carnivores and causes a highly contagious disease with severe immunosuppression. The disease severity markedly varies in different species. To investigate the pathogenesis of CDV in raccoon dog (Nyctereutes procyonoides), fox (Vulpes vulpes) and mink (Neovison vison) species, three groups of CDV sero-negative animals were infected with CDV strain LN(10)1. This CDV strain belongs to the Asia-1 genotype, which is epidemiologically predominant in carnivores in China. CDV infection provoked marked differences in virulence in the three species that were studied. Raccoon dogs developed fever, severe conjunctivitis, and pathological lesions, with 100% (5/5) mortality and with high viral RNA loads in organs within 15 days post infection (dpi). In infected foxes, the onset of the disease was delayed, with 40% (2/5) mortality by 21 dpi. Infected minks developed only mild clinical signs and pathological lesions, and mortality was not observed. Raccoon dogs and foxes showed more severe immune suppression (lymphopenia, decreased lymphocyte proliferation, viremia and low-level virus neutralizing antibodies) than minks. We also observed a distinct pattern of cytokine mRNA transcripts at different times after infection. Decreased IFN-γ and IL-4 mRNA responses were evident in the animals with fatal disease, while up-regulation of these cytokines was observed in the animals surviving the infection. Increased TNF-α response was detected in animals with mild or severe clinical signs. Based on the results, we could distinguish three different patterns of disease after experimental CDV infection, e.g. a mild form in minks, a moderate form in foxes and a severe disease in raccoon dogs. The observed differences in susceptibility to CDV could be related to distinct host cytokine profiles. Comparative evaluation of CDV pathogenesis in various animal species is pivotal to generate models suitable for the evaluation of CDV

  15. Canine distemper virus in the Serengeti ecosystem: molecular adaptation to different carnivore species.

    Science.gov (United States)

    Nikolin, Veljko M; Olarte-Castillo, Ximena A; Osterrieder, Nikolaus; Hofer, Heribert; Dubovi, Edward; Mazzoni, Camila J; Brunner, Edgar; Goller, Katja V; Fyumagwa, Robert D; Moehlman, Patricia D; Thierer, Dagmar; East, Marion L

    2017-04-01

    Was the 1993/1994 fatal canine distemper virus (CDV) epidemic in lions and spotted hyaenas in the Serengeti ecosystem caused by the recent spillover of a virulent domestic dog strain or one well adapted to these noncanids? We examine this question using sequence data from 13 'Serengeti' strains including five complete genomes obtained between 1993 and 2011. Phylogenetic and haplotype network analyses reveal that strains from noncanids during the epidemic were more closely related to each other than to those from domestic or wild canids. All noncanid 'Serengeti' strains during the epidemic encoded: (1) one novel substitution G134S in the CDV-V protein; and (2) the rare amino acid combination 519I/549H at two sites under positive selection in the region of the CDV-H protein that binds to SLAM (CD 150) host cell receptors. Worldwide, only a few noncanid strains in the America II lineage encode CDV-H 519I/549H. All canid 'Serengeti' strains during the epidemic coded CDV-V 134G, and CDV-H 519R/549Y, or 519R/549H. A functional assay of cell entry revealed the highest performance by CDV-H proteins encoding 519I/549H in cells expressing lion SLAM receptors, and the highest performance by proteins encoding 519R/549Y, typical of dog strains worldwide, in cells expressing dog SLAM receptors. Our findings are consistent with an epidemic in lions and hyaenas caused by CDV variants better adapted to noncanids than canids, but not with the recent spillover of a dog strain. Our study reveals a greater complexity of CDV molecular epidemiology in multihost environments than previously thought. © 2016 John Wiley & Sons Ltd.

  16. Canine distemper virus as a threat to wild tigers in Russia and across their range.

    Science.gov (United States)

    Gilbert, Martin; Soutyrina, Svetlana V; Seryodkin, Ivan V; Sulikhan, Nadezhda; Uphyrkina, Olga V; Goncharuk, Mikhail; Matthews, Louise; Cleaveland, Sarah; Miquelle, Dale G

    2015-07-01

    Canine distemper virus (CDV) has recently been identified in populations of wild tigers in Russia and India. Tiger populations are generally too small to maintain CDV for long periods, but are at risk of infections arising from more abundant susceptible hosts that constitute a reservoir of infection. Because CDV is an additive mortality factor, it could represent a significant threat to small, isolated tiger populations. In Russia, CDV was associated with the deaths of tigers in 2004 and 2010, and was coincident with a localized decline of tigers in Sikhote-Alin Biosphere Zapovednik (from 25 tigers in 2008 to 9 in 2012). Habitat continuity with surrounding areas likely played an important role in promoting an ongoing recovery. We recommend steps be taken to assess the presence and the impact of CDV in all tiger range states, but should not detract focus away from the primary threats to tigers, which include habitat loss and fragmentation, poaching and retaliatory killing. Research priorities include: (i) recognition and diagnosis of clinical cases of CDV in tigers when they occur; and (ii) collection of baseline data on the health of wild tigers. CDV infection of individual tigers need not imply a conservation threat, and modeling should complement disease surveillance and targeted research to assess the potential impact to tiger populations across the range of ecosystems, population densities and climate extremes occupied by tigers. Describing the role of domestic and wild carnivores as contributors to a local CDV reservoir is an important precursor to considering control measures. © 2015 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and Wiley Publishing Asia Pty Ltd.

  17. Transcriptional changes in canine distemper virus-induced demyelinating leukoencephalitis favor a biphasic mode of demyelination.

    Directory of Open Access Journals (Sweden)

    Reiner Ulrich

    Full Text Available Canine distemper virus (CDV-induced demyelinating leukoencephalitis in dogs (Canis familiaris is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms "viral replication" and "humoral immune response" as well as down-regulated genes functionally related to "metabolite and energy

  18. Molecular analysis of the N gene of canine distemper virus in dogs in Brazil

    Directory of Open Access Journals (Sweden)

    J.G. Castilho

    2007-06-01

    Full Text Available Eleven central-nervous-system samples collected from stray dogs between 2000 and 2004 were found positive by RT-PCR, which amplified a 480bp fragment of the N gene of canine distemper virus (CDV. Phylogenetic analysis based on partial N-gene sequences showed four major clusters. All dog strains segregated into cluster I, with a mean nucleotide identity of 95.8% and 95.6% with the Onderstepoort and Lederle vaccine strains, respectively. Cluster II contained all the raccoon-related strains, cluster III Orient strains and Cluster IV the Onderstepoort and Lederle vaccine strains, with a mean nucleotide identity of 99.7% between them. This is the first report of phylogenetic analysis of CDV strains in Brazil.Onze amostras de sistema nervoso central de cães coletados entre 2000 e 2004 foram positivas pela RT-PCR, a qual amplificou um fragmento de 480pb do gene N do vírus da cinomose canina (VCC. A análise filogenética baseada na seqüência parcial do gene N mostrou quatro principais agrupamentos genéticos. Todas as amostras de cães segregaram no agrupamento I, com identidade média de nucleotídeos de 95,8% e 95,6% com as amostras vacinais Onderstepoort e Lederle, respectivamente. O agrupamento II agregou todas as amostras relacionadas aos guaxinins. O agrupamento III agregou amostras orientais e o agrupamento IV agregou as amostras vacinais Onderstepoort e Lederle, com identidade média de nucleotídeos de 99,7% entre elas. Este é o primeiro relato de análise filogenética de amostras de VCC no Brasil.

  19. EVALUATION OF TWO CANINE DISTEMPER VIRUS VACCINES IN CAPTIVE TIGERS (PANTHERA TIGRIS).

    Science.gov (United States)

    Sadler, Ryan A; Ramsay, Edward; McAloose, Denise; Rush, Robert; Wilkes, Rebecca P

    2016-06-01

    Canine distemper virus (CDV) has caused clinical disease and death in nondomestic felids in both captive settings and in the wild. Outbreaks resulting in high mortality rates in tigers (Panthera tigris) have prompted some zoos to vaccinate tigers for CDV. In this study, six tigers received a recombinant canarypox-vectored CDV vaccine (1 ml s.c.) and were revaccinated with 3 ml s.c. (mean) 39 days later. Blood collection for CDV antibody detection via serum neutralization was performed on (mean) days 0, 26, and 66 post-initial vaccination. No tigers had detectable antibodies at days 0 or 26, and only two tigers had low (16 and 32) antibody titers at day 66. Eight additional tigers received a live, attenuated CDV vaccine (1 ml s.c.) on day 0 and were revaccinated with 1 ml s.c. (mean) 171 days later. Blood collection for CDV antibody detection via serum neutralization was performed on (mean) days 0, 26, 171, and 196. Seven of eight tigers receiving the live, attenuated vaccine had no detectable titers prior to vaccination, but all animals had titers of >128 (range 128-1,024) at day 26. At 171 days, all tigers still had detectable titers (geometric mean 69.8, range 16-256), and at 196 days (2 wk post-revaccination) all but two showed an increase to >128 (range 32-512). To determine safety, an additional 41 tigers were vaccinated with 2 ml of a recombinant vaccine containing only CDV components, and an additional 38 tigers received 1 ml of the live, attenuated vaccine, administered either subcutaneously or intramuscularly; no serious adverse effects were noted. Although both vaccines appear safe, the live, attenuated vaccine produced a stronger and more consistent serologic response in tigers.

  20. Transcriptional changes in canine distemper virus-induced demyelinating leukoencephalitis favor a biphasic mode of demyelination.

    Science.gov (United States)

    Ulrich, Reiner; Puff, Christina; Wewetzer, Konstantin; Kalkuhl, Arno; Deschl, Ulrich; Baumgärtner, Wolfgang

    2014-01-01

    Canine distemper virus (CDV)-induced demyelinating leukoencephalitis in dogs (Canis familiaris) is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms "viral replication" and "humoral immune response" as well as down-regulated genes functionally related to "metabolite and energy generation".

  1. Diversity of susceptible hosts in canine distemper virus infection: a systematic review and data synthesis.

    Science.gov (United States)

    Martinez-Gutierrez, Marlen; Ruiz-Saenz, Julian

    2016-05-12

    Canine distemper virus (CDV) is the etiological agent of one of the most infectious diseases of domestic dogs, also known as a highly prevalent viral infectious disease of carnivores and posing a conservation threat to endangered species around the world. To get a better panorama of CDV infection in different Orders, a retrospective and documental systematic review of the role of CDV in different non-dog hosts was conducted. The bibliographical data were collected from MedLine/PubMed and Scopus databases. Data related to Order, Family, Genus and Species of the infected animals, the presence or absence of clinical signs, mortality, serological, molecular or antigenic confirmation of CDV infection, geographic location, were collected and summarized. Two hundred seventeen scientific articles were considered eligible which includes reports of serological evaluation, and antigenic or genomic confirmation of CDV infection in non-dog hosts. CDV infects naturally and experimentally different members of the Orders Carnivora (in 12 Families), Rodentia (four Families), Primates (two Families), Artiodactyla (three Families) and Proboscidea (one Family). The Order Carnivora (excluding domestic dogs) accounts for the vast majority (87.5%) of the records. Clinical disease associated with CDV infection was reported in 51.8% of the records and serological evidence of CDV infection in apparently healthy animals was found in 49.5% of the records. High mortality rate was showed in some of the recorded infections in Orders different to Carnivora. In non-dog hosts, CDV has been reported all continents with the exception of Australasia and in 43 different countries. The results of this systematic review demonstrate that CDV is able to infect a very wide range of host species from many different Orders and emphasizes the potential threat of infection for endangered wild species as well as raising concerns about potential zoonotic threats following the cessation of large-scale measles

  2. Phylogenetic features of hemagglutin gene in canine distemper virus strains from different genetic lineages.

    Science.gov (United States)

    Liao, Peng; Guo, Li; Wen, Yongjun; Yang, Yangling; Cheng, Shipeng

    2015-01-01

    In the present study, the genotype of two Canine distemper virus (CDV) strains, namely, ZJJ-SD and ZJJ-LN, were investigated, based on the whole hemagglutinin (HA) gene. The CDV strains were obtained from two foxes in Shandong Province and Liaoning Province in 2011. Phylogenetic analyses were carried out for 260 CDV strains worldwide, and a statistical analysis was performed in the amino acid substitutions at positions 530 and 549 of the HA protein. Phylogenetic analyses revealed that the two strains, ZJJ-SD and ZJJ-LN, belonged to the CDV Asia I lineage. Site 530 of HA protein was found to be relatively conserved within CDV lineages in different host species by combining the genetic sequence data with the published data from 260 CDV strains worldwide. The data analysis showed a bias toward the predicted substitution Y549H for the non-dog strains in Asia I and Europe lineages. The ratio of site 549 genetic drift in the HA gene were significantly different between dogs and non-dogs in the two lineages. The strain ZJJ-SD, from wild canid, has an Y549H substitution. It is one of three Y549H substitution for wild canids in Asia I lineages. Site 530 of HA protein was not immediately relative to CDV genetic drift from dogs to non-dogs. Statistical analysis indicated that non-dog strains have a high probability to contain Y549H than dog strains in Asia I and Europe lineages. Thus, site 549 is considered important in genetic drift from dogs to non-dogs, at least in Asia I and Europe lineages.

  3. Transcriptional Changes in Canine Distemper Virus-Induced Demyelinating Leukoencephalitis Favor a Biphasic Mode of Demyelination

    Science.gov (United States)

    Ulrich, Reiner; Puff, Christina; Wewetzer, Konstantin; Kalkuhl, Arno; Deschl, Ulrich; Baumgärtner, Wolfgang

    2014-01-01

    Canine distemper virus (CDV)-induced demyelinating leukoencephalitis in dogs (Canis familiaris) is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms “viral replication” and “humoral immune response” as well as down-regulated genes functionally related to “metabolite and energy

  4. Effects of body weight on antibody titers against canine parvovirus type 2, canine distemper virus, and canine adenovirus type 1 in vaccinated domestic adult dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki

    2012-10-01

    The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.

  5. Comparative trial of the canine parvovirus, canine distemper virus and canine adenovirus type 2 fractions of two commercially available modified live vaccines.

    Science.gov (United States)

    Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G

    2006-11-25

    The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.

  6. Isolation and sequence analysis of a canine distemper virus from a raccoon dog in Jilin Province, China.

    Science.gov (United States)

    Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua

    2015-10-01

    Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.

  7. Recombinant canine distemper virus strain Snyder Hill expressing green or red fluorescent proteins causes meningoencephalitis in the ferret.

    Science.gov (United States)

    Ludlow, M; Nguyen, D T; Silin, D; Lyubomska, O; de Vries, R D; von Messling, V; McQuaid, S; De Swart, R L; Duprex, W P

    2012-07-01

    The propensity of canine distemper virus (CDV) to spread to the central nervous system is one of the primary features of distemper. Therefore, we developed a reverse genetics system based on the neurovirulent Snyder Hill (SH) strain of CDV (CDV(SH)) and show that this virus rapidly circumvents the blood-brain and blood-cerebrospinal fluid (CSF) barriers to spread into the subarachnoid space to induce dramatic viral meningoencephalitis. The use of recombinant CDV(SH) (rCDV(SH)) expressing enhanced green fluorescent protein (EGFP) or red fluorescent protein (dTomato) facilitated the sensitive pathological assessment of routes of virus spread in vivo. Infection of ferrets with these viruses led to the full spectrum of clinical signs typically associated with distemper in dogs during a rapid, fatal disease course of approximately 2 weeks. Comparison with the ferret-adapted CDV(5804P) and the prototypic wild-type CDV(R252) showed that hematogenous infection of the choroid plexus is not a significant route of virus spread into the CSF. Instead, viral spread into the subarachnoid space in rCDV(SH)-infected animals was triggered by infection of vascular endothelial cells and the hematogenous spread of virus-infected leukocytes from meningeal blood vessels into the subarachnoid space. This resulted in widespread infection of cells of the pia and arachnoid mater of the leptomeninges over large areas of the cerebral hemispheres. The ability to sensitively assess the in vivo spread of a neurovirulent strain of CDV provides a novel model system to study the mechanisms of virus spread into the CSF and the pathogenesis of acute viral meningitis.

  8. Development of a novel real-time qPCR assay for the dual detection of canine and phocine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Linette Buxbom; Hjulsager, Charlotte Kristiane; Larsen, Helene

    conventional PCR assays with real-time PCR assays to obtain a uniform assay palette. The present work describes the development of a novel real-time RT-qPCR assay for the dual detection of canine and phocine distemper virus. The assay is relevant for the future detection of outbreaks of canine distemper virus...... in e.g. in farmed mink and wildlife and phocine distemper in seals. A set of primers and dual labelled probe was designed based on an alignment of distemper sequences in GenBank from various species and in-house sequences from recent outbreaks in Danish farmed mink. The assay amplifies a segment of 151...... bp in the Phosphoprotein (P) gene of the distemper virus genome. The dynamic range and PCR efficiency (E) was experimentally determined using 10-fold dilutions of a specially designed distemper DNA-oligo in addition to extracted RNA from clinical samples. E of the real-time assay was shown to range...

  9. Utility of two modified-live virus canine distemper vaccines in wild-caught fishers (Martes pennanti).

    Science.gov (United States)

    Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L

    2016-12-01

    Canine distemper virus (CDV) infects families in the order Carnivora. As a preventive measure, vaccinations against CDV are frequently given to mustelids in captive environments. Our objectives were to compare the utility between two modified-live virus canine distemper vaccines (MLV CDV's), Fervac-D® (no longer manufactured) and Galaxy-D® (now manufactured by MSD Animal Health as part of a multivalent vaccine), in developing an immune response in wild-caught fishers. The Pennsylvania Fisher Reintroduction Project (PFRP) used 14 wild-caught fishers during one year of the project to evaluate the utility of vaccinations against CDV as part of any reintroduction project. Fishers were injected subcutaneously in the nape of the neck with their designated vaccine. Fervac-D® did not effectively stimulate development of a serologic antibody response, whereas Galaxy-D® had adequate seroconversion or rise of titer levels to suggest that the general use of MLV CDV may be suitable in fishers pending further studies. We recommend that future studies be conducted, evaluating the use of currently produced vaccines in fishers. Future research should also focus on the length of days required between administration of primary and booster vaccines to achieve sufficient immune response. If only primary doses are required, then hard-release reintroduction projects for fishers could be recommended. If primary and booster vaccines are required then soft-release reintroduction projects should be recommended that include captive management periods, allowing for appropriate vaccination intervals needed to maximize the probability of protection against CDV.

  10. Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China

    Science.gov (United States)

    2013-01-01

    Background Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. PMID:23566727

  11. Elements in the canine distemper virus M 3' UTR contribute to control of replication efficiency and virulence.

    Directory of Open Access Journals (Sweden)

    Danielle E Anderson

    Full Text Available Canine distemper virus (CDV is a negative-sense, single-stranded RNA virus within the genus Morbillivirus and the family Paramyxoviridae. The Morbillivirus genome is composed of six transcriptional units that are separated by untranslated regions (UTRs, which are relatively uniform in length, with the exception of the UTR between the matrix (M and fusion (F genes. This UTR is at least three times longer and in the case of CDV also highly variable. Exchange of the M-F region between different CDV strains did not affect virulence or disease phenotype, demonstrating that this region is functionally interchangeable. Viruses carrying the deletions in the M 3' UTR replicated more efficiently, which correlated with a reduction of virulence, suggesting that overall length as well as specific sequence motifs distributed throughout the region contribute to virulence.

  12. Recombinant Newcastle disease viral vector expressing hemagglutinin or fusion of canine distemper virus is safe and immunogenic in minks.

    Science.gov (United States)

    Ge, Jinying; Wang, Xijun; Tian, Meijie; Gao, Yuwei; Wen, Zhiyuan; Yu, Guimei; Zhou, Weiwei; Zu, Shulong; Bu, Zhigao

    2015-05-15

    Canine Distemper Virus (CDV) infects many carnivores and cause several high-mortality disease outbreaks. The current CDV live vaccine cannot be safely used in some exotic species, such as mink and ferret. Here, we generated recombinant lentogenic Newcastle disease virus (NDV) LaSota expressing either envelope glycoproyein, heamagglutinine (H) or fusion protein (F), named as rLa-CDVH and rLa-CDVF, respectively. The feasibility of these recombinant NDVs to serve as live virus-vectored CD vaccine was evaluated in minks. rLa-CDVH induced significant neutralization antibodies (NA) to CDV and provided solid protection against virulent CDV challenge. On the contrast, rLa-CDVF induced much lower NA to CDV and fail to protected mink from virulent CDV challenge. Results suggest that recombinant NDV expressing CDV H is safe and efficient candidate vaccine against CDV in mink, and maybe other host species. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Identification of Key Residues in Virulent Canine Distemper Virus Hemagglutinin That Control CD150/SLAM-Binding Activity▿

    Science.gov (United States)

    Zipperle, Ljerka; Langedijk, Johannes P. M.; Örvell, Claes; Vandevelde, Marc; Zurbriggen, Andreas; Plattet, Philippe

    2010-01-01

    Morbillivirus cell entry is controlled by hemagglutinin (H), an envelope-anchored viral glycoprotein determining interaction with multiple host cell surface receptors. Subsequent to virus-receptor attachment, H is thought to transduce a signal triggering the viral fusion glycoprotein, which in turn drives virus-cell fusion activity. Cell entry through the universal morbillivirus receptor CD150/SLAM was reported to depend on two nearby microdomains located within the hemagglutinin. Here, we provide evidence that three key residues in the virulent canine distemper virus A75/17 H protein (Y525, D526, and R529), clustering at the rim of a large recessed groove created by β-propeller blades 4 and 5, control SLAM-binding activity without drastically modulating protein surface expression or SLAM-independent F triggering. PMID:20631152

  14. Molecular characterization of complete genome of a canine distemper virus associated with fatal infection in dogs in Gabon, Central Africa.

    Science.gov (United States)

    Maganga, Gael D; Labouba, Ingrid; Ngoubangoye, Barthélémy; Nkili-Meyong, Andriniaina A; Obame Ondo, Daniel; Leroy, Eric M; Berthet, Nicolas

    2018-03-02

    Canine distemper (CD) is the most deadly disease in dogs with mortality rates reaching 50%. The pathological agent, the CD virus (CDV), generally causes a severe systemic disease, although the nervous form can coexist with the acute catarrhal form in the same individual. In this study, we describe an outbreak of 18 cases of CD that occurred in 2015 in a German Shepherd dog population in northwestern Gabon. In addition, we determined the sequence of the CDV genotype associated with this fatal distemper infection in Gabon and compared it with other published CDV sequences. The CDV was detected using RT-PCR on cDNA from RNA of harvested brains and other organs. The identification was confirmed by sequencing amplicons. Moreover, we obtained the whole genome sequence using high-throughput sequencing. Phylogenetic analysis revealed that Gabonese CDV strain clustered with European strains belonging to the Europe genotype. This study provided the first molecular detection of the CDV strain associated with this fatal distemper infection in Central Africa region. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Canine distemper virus (CDV) infection of ferrets as a model for testing Morbillivirus vaccine strategies: NYVAC- and ALVAC-based CDV recombinants protect against symptomatic infection.

    OpenAIRE

    Stephensen, C B; Welter, J; Thaker, S R; Taylor, J; Tartaglia, J; Paoletti, E

    1997-01-01

    Canine distemper virus (CDV) infection of ferrets causes an acute systemic disease involving multiple organ systems, including the respiratory tract, lymphoid system, and central nervous system (CNS). We have tested candidate CDV vaccines incorporating the fusion (F) and hemagglutinin (HA) proteins in the highly attenuated NYVAC strain of vaccinia virus and in the ALVAC strain of canarypox virus, which does not productively replicate in mammalian hosts. Juvenile ferrets were vaccinated twice ...

  16. BLACK-BACKED JACKAL EXPOSURE TO RABIES VIRUS, CANINE DISTEMPER VIRUS, AND BACILLUS ANTHRACIS IN ETOSHA NATIONAL PARK, NAMIBIA

    Science.gov (United States)

    Bellan, Steve E.; Cizauskas, Carrie A.; Miyen, Jacobeth; Ebersohn, Karen; Küsters, Martina; Prager, Katie; Van Vuuren, Moritz; Sabeta, Claude; Getz, Wayne M.

    2017-01-01

    Canine distemper virus (CDV) and rabies virus (RABV) occur worldwide in wild carnivore and domestic dog populations and pose threats to wildlife conservation and public health. In Etosha National Park (ENP), Namibia, anthrax is endemic and generates carcasses frequently fed on by an unusually dense population of black-backed jackals (Canis mesomelas). Using serology and phylogenetic analyses (on samples obtained from February, 2009 to July, 2010), and historical mortality records (1975–2011), we assessed jackal exposure to Bacillus anthracis (BA; the causal bacterial agent of anthrax), CDV, and RABV. Seroprevalence to all three pathogens was relatively high with 95% (n = 86), 73% (n = 86), and 9% (n = 81) of jackals exhibiting antibodies to BA, CDV, and RABV, respectively. Exposure to BA, as assessed with an anti-Protective Antigen ELISA test, increased significantly with age and all animals >1 yr old tested positive. Seroprevalence of exposure to CDV also increased significantly with age, with similar age-specific trends during both years of the study. No significant effect of age was found on RABV seroprevalence. Three of the seven animals exhibiting immunity to RABV were monitored for more than one year after sampling and did not succumb to the disease. Mortality records revealed that rabid animals are destroyed nearly every year inside the ENP tourist camps. Phylogenetic analyses demonstrated that jackal RABV in ENP is part of the same transmission cycle as other dog-jackal RABV cycles in Namibia. PMID:22493112

  17. Construction of an expression system for bioactive IL-18 and generation of recombinant canine distemper virus expressing IL-18.

    Science.gov (United States)

    Liu, Yuxiu; Sato, Hiroki; Hamana, Masahiro; Moonan, Navita Anisia; Yoneda, Misako; Xia, Xianzhu; Kai, Chieko

    2014-09-01

    Interleukin 18 (IL-18) plays an important role in the T-helper-cell type 1 immune response against intracellular parasites, bacteria and viral infections. It has been widely used as an adjuvant for vaccines and as an anticancer agent. However, IL-18 protein lacks a typical signal sequence and requires cleavage into its mature active form by caspase 1. In this study, we constructed mammalian expression vectors carrying cDNA encoding mature canine IL-18 (cIL-18) or mouse IL-18 (mIL-18) fused to the human IL-2 (hIL-2) signal sequence. The expressed proIL-18 proteins were processed to their mature forms in the cells. The supernatants of cells transfected with these plasmids induced high interferon-γ production in canine peripheral blood mononuclear cells or mouse splenocytes, respectively, indicating the secretion of bioactive IL-18. Using reverse genetics, we also generated a recombinant canine distemper virus that expresses cIL-18 or mIL-18 fused to the hIL-2 signal sequence. As expected, both recombinant viruses produced mature IL-18 in the infected cells, which secreted bioactive IL-18. These results indicate that the signal sequence from hIL-2 is suitable for the secretion of mature IL-18. These recombinant viruses can also potentially be used as immunoadjuvants and agents for anticancer therapies in vivo.

  18. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Science.gov (United States)

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  19. Persistence of canine distemper virus in the Greater Yellowstone ecosystem's carnivore community.

    Science.gov (United States)

    Almberg, Emily S; Cross, Paul C; Smith, Douglas W

    2010-10-01

    Canine distemper virus (CDV) is an acute, highly immunizing pathogen that should require high densities and large populations of hosts for long-term persistence, yet CDV persists among terrestrial carnivores with small, patchily distributed groups. We used CDV in the Greater Yellowstone ecosystem's (GYE) wolves (Canis lupus) and coyotes (Canis latrans) as a case study for exploring how metapopulation structure, host demographics, and multi-host transmission affect the critical community size and spatial scale required for CDV persistence. We illustrate how host spatial connectivity and demographic turnover interact to affect both local epidemic dynamics, such as the length and variation in inter-epidemic periods, and pathogen persistence using stochastic, spatially explicit susceptible-exposed-infectious-recovered simulation models. Given the apparent absence of other known persistence mechanisms (e.g., a carrier or environmental state, densely populated host, chronic infection, or a vector), we suggest that CDV requires either large spatial scales or multi-host transmission for persistence. Current GYE wolf populations are probably too small to support endemic CDV. Coyotes are a plausible reservoir host, but CDV would still require 50000-100000 individuals for moderate persistence (> 50% over 10 years), which would equate to an area of 1-3 times the size of the GYE (60000-200000 km2). Coyotes, and carnivores in general, are not uniformly distributed; therefore, this is probably a gross underestimate of the spatial scale of CDV persistence. However, the presence of a second competent host species can greatly increase the probability of long-term CDV persistence at much smaller spatial scales. Although no management of CDV is currently recommended for the GYE, wolf managers in the region should expect periodic but unpredictable CDV-related population declines as often as every 2-5 years. Awareness and monitoring of such outbreaks will allow corresponding adjustments

  20. Persistence of canine distemper virus in the Greater Yellowstone Ecosystem's carnivore community

    Science.gov (United States)

    Almberg, E.S.; Cross, P.C.; Smith, D.W.

    2010-01-01

    Canine distemper virus (CDV) is an acute, highly immunizing pathogen that should require high densities and large populations of hosts for long-term persistence, yet CDV persists among terrestrial carnivores with small, patchily distributed groups. We used CDV in the Greater Yellowstone ecosystem's (GYE) wolves (Canis lupus) and coyotes (Canis latrans) as a case study for exploring how metapopulation structure, host demographics, and multi-host transmission affect the critical community size and spatial scale required for CDV persistence. We illustrate how host spatial connectivity and demographic turnover interact to affect both local epidemic dynamics, such as the length and variation in inter-epidemic periods, and pathogen persistence using stochastic, spatially explicit susceptible-exposed-infectious-recovered simulation models. Given the apparent absence of other known persistence mechanisms (e.g., a carrier or environmental state, densely populated host, chronic infection, or a vector), we suggest that CDV requires either large spatial scales or multi-host transmission for persistence. Current GYE wolf populations are probably too small to support endemic CDV. Coyotes are a plausible reservoir host, but CDV would still require 50 000-100 000 individuals for moderate persistence (>50% over 10 years), which would equate to an area of 1-3 times the size of the GYE (60000-200000 km2). Coyotes, and carnivores in general, are not uniformly distributed; therefore, this is probably a gross underestimate of the spatial scale of CDV persistence. However, the presence of a second competent host species can greatly increase the probability of long-term CDV persistence at much smaller spatial scales. Although no management of CDV is currently recommended for the GYE, wolf managers in the region should expect periodic but unpredictable CDV-related population declines as often as every 2-5 years. Awareness and monitoring of such outbreaks will allow corresponding

  1. A negative search of acute canine distemper virus infection in DogSLAM transgenic C57BL/6 mice

    Directory of Open Access Journals (Sweden)

    Somporn Techangamsuwan

    2010-12-01

    Full Text Available Canine distemper is a highly contagious and immunosuppressive viral disease caused by canine distemper virus(CDV, an enveloped RNA virus of the family Paramyxoviridae. The susceptible host spectrum of CDV is broad andincludes all families of the order Carnivora. To accomplish the infection, CDV requires an expression of signaling lymphocyteactivation molecule (SLAM functioning as a cellular receptor which generally presents in a variety of different lymphoid cellsubpopulations, including immature thymocytes, primary B cells, activated T cells, memory T cells, macrophages and maturedendritic cells. The distribution of SLAM-presenting cells is in accordance with the lymphotropism and immunosuppressionfollowing morbillivirus infection. In the present study, the C57BL/6 mice engrafted with dog-specific SLAM sequence(DogSLAM were used. The weanling (3-week-old transgenic offspring C57BL/6 mice were infected with CDV Snyder Hill(CDV-SH strain via the intranasal (n=6, intracerebral (n=6 and intraperitoneal (n=5 routes. Clinical signs, hematology,histopathology, immunohistochemistry, virus isolation and RT-PCR were observed for two weeks post infection. Resultsshowed that CDV-SH-inoculated transgenic mice displayed mild-to-moderate congestion of various organs (brain, lung,spleen, kidney, lymph node, and adrenal gland. By means of immunohistochemistry, virus isolation and RT-PCR, CDV couldnot be detected. The evidence of CDV infection in this study could not be demonstrated in acute phase. Even though thetransgenic mouse is not a suitable animal model for CDV, or a longer incubation period is prerequisite, it needs to be clarifiedin a future study.

  2. Wildlife Reservoirs of Canine Distemper Virus Resulted in a Major Outbreak in Danish Farmed Mink (Neovison vison)

    Science.gov (United States)

    Trebbien, Ramona; Chriel, Mariann; Struve, Tina; Hjulsager, Charlotte Kristiane; Larsen, Gitte; Larsen, Lars Erik

    2014-01-01

    A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus full-length sequencing of the receptor binding surface protein hemagglutinin (H) was performed on 26 CDV's collected from mink and 10 CDV's collected from wildlife species. Subsequent phylogenetic analyses showed that the virus circulating in the mink farms and wildlife were highly identical with an identity at the nucleotide level of 99.45% to 100%. The sequences could be grouped by single nucleotide polymorphisms according to geographical distribution of mink farms and wildlife. The signaling lymphocytic activation molecule (SLAM) receptor binding region in most viruses from both mink and wildlife contained G at position 530 and Y at position 549; however, three mink viruses had an Y549H substitution. The outbreak viruses clustered phylogenetically in the European lineage and were highly identical to wildlife viruses from Germany and Hungary (99.29% – 99.62%). The study furthermore revealed that fleas (Ceratophyllus sciurorum) contained CDV and that vertical transmission of CDV occurred in a wild ferret. The study provides evidence that wildlife species, such as foxes, play an important role in the transmission of CDV to farmed mink and that the virus may be maintained in the wild animal reservoir between outbreaks. PMID:24454897

  3. Wildlife reservoirs of canine distemper virus resulted in a major outbreak in Danish farmed mink (Neovison vison.

    Directory of Open Access Journals (Sweden)

    Ramona Trebbien

    Full Text Available A major outbreak of canine distemper virus (CDV in Danish farmed mink (Neovison vison started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus full-length sequencing of the receptor binding surface protein hemagglutinin (H was performed on 26 CDV's collected from mink and 10 CDV's collected from wildlife species. Subsequent phylogenetic analyses showed that the virus circulating in the mink farms and wildlife were highly identical with an identity at the nucleotide level of 99.45% to 100%. The sequences could be grouped by single nucleotide polymorphisms according to geographical distribution of mink farms and wildlife. The signaling lymphocytic activation molecule (SLAM receptor binding region in most viruses from both mink and wildlife contained G at position 530 and Y at position 549; however, three mink viruses had an Y549H substitution. The outbreak viruses clustered phylogenetically in the European lineage and were highly identical to wildlife viruses from Germany and Hungary (99.29% - 99.62%. The study furthermore revealed that fleas (Ceratophyllus sciurorum contained CDV and that vertical transmission of CDV occurred in a wild ferret. The study provides evidence that wildlife species, such as foxes, play an important role in the transmission of CDV to farmed mink and that the virus may be maintained in the wild animal reservoir between outbreaks.

  4. Antagonistic pleiotropy and fitness trade-offs reveal specialist and generalist traits in strains of canine distemper virus.

    Directory of Open Access Journals (Sweden)

    Veljko M Nikolin

    Full Text Available Theoretically, homogeneous environments favor the evolution of specialists whereas heterogeneous environments favor generalists. Canine distemper is a multi-host carnivore disease caused by canine distemper virus (CDV. The described cell receptor of CDV is SLAM (CD150. Attachment of CDV hemagglutinin protein (CDV-H to this receptor facilitates fusion and virus entry in cooperation with the fusion protein (CDV-F. We investigated whether CDV strains co-evolved in the large, homogeneous domestic dog population exhibited specialist traits, and strains adapted to the heterogeneous environment of smaller populations of different carnivores exhibited generalist traits. Comparison of amino acid sequences of the SLAM binding region revealed higher similarity between sequences from Canidae species than to sequences from other carnivore families. Using an in vitro assay, we quantified syncytia formation mediated by CDV-H proteins from dog and non-dog CDV strains in cells expressing dog, lion or cat SLAM. CDV-H proteins from dog strains produced significantly higher values with cells expressing dog SLAM than with cells expressing lion or cat SLAM. CDV-H proteins from strains of non-dog species produced similar values in all three cell types, but lower values in cells expressing dog SLAM than the values obtained for CDV-H proteins from dog strains. By experimentally changing one amino acid (Y549H in the CDV-H protein of one dog strain we decreased expression of specialist traits and increased expression of generalist traits, thereby confirming its functional importance. A virus titer assay demonstrated that dog strains produced higher titers in cells expressing dog SLAM than cells expressing SLAM of non-dog hosts, which suggested possible fitness benefits of specialization post-cell entry. We provide in vitro evidence for the expression of specialist and generalist traits by CDV strains, and fitness trade-offs across carnivore host environments caused by

  5. Antagonistic Pleiotropy and Fitness Trade-Offs Reveal Specialist and Generalist Traits in Strains of Canine Distemper Virus

    Science.gov (United States)

    Nikolin, Veljko M.; Osterrieder, Klaus; von Messling, Veronika; Hofer, Heribert; Anderson, Danielle; Dubovi, Edward; Brunner, Edgar; East, Marion L.

    2012-01-01

    Theoretically, homogeneous environments favor the evolution of specialists whereas heterogeneous environments favor generalists. Canine distemper is a multi-host carnivore disease caused by canine distemper virus (CDV). The described cell receptor of CDV is SLAM (CD150). Attachment of CDV hemagglutinin protein (CDV-H) to this receptor facilitates fusion and virus entry in cooperation with the fusion protein (CDV-F). We investigated whether CDV strains co-evolved in the large, homogeneous domestic dog population exhibited specialist traits, and strains adapted to the heterogeneous environment of smaller populations of different carnivores exhibited generalist traits. Comparison of amino acid sequences of the SLAM binding region revealed higher similarity between sequences from Canidae species than to sequences from other carnivore families. Using an in vitro assay, we quantified syncytia formation mediated by CDV-H proteins from dog and non-dog CDV strains in cells expressing dog, lion or cat SLAM. CDV-H proteins from dog strains produced significantly higher values with cells expressing dog SLAM than with cells expressing lion or cat SLAM. CDV-H proteins from strains of non-dog species produced similar values in all three cell types, but lower values in cells expressing dog SLAM than the values obtained for CDV-H proteins from dog strains. By experimentally changing one amino acid (Y549H) in the CDV-H protein of one dog strain we decreased expression of specialist traits and increased expression of generalist traits, thereby confirming its functional importance. A virus titer assay demonstrated that dog strains produced higher titers in cells expressing dog SLAM than cells expressing SLAM of non-dog hosts, which suggested possible fitness benefits of specialization post-cell entry. We provide in vitro evidence for the expression of specialist and generalist traits by CDV strains, and fitness trade-offs across carnivore host environments caused by antagonistic

  6. Establishment of reverse transcription loop-mediated isothermal amplification for rapid detection and differentiation of canine distemper virus infected and vaccinated animals.

    Science.gov (United States)

    Liu, Da-Fei; Liu, Chun-Guo; Tian, Jin; Jiang, Yi-Tong; Zhang, Xiao-Zhan; Chai, Hong-Liang; Yang, Tian-Kuo; Yin, Xiu-Chen; Zhang, Hong-Ying; Liu, Ming; Hua, Yu-Ping; Qu, Lian-Dong

    2015-06-01

    Although widespread vaccination against canine distemper virus (CDV) has been conducted for many decades, several canine distemper outbreaks in vaccinated animals have been reported frequently. In order to detect and differentiate the wild-type and vaccine strains of the CDV from the vaccinated animals, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) method was developed. A set of four primers-two internal and two external-were designed to target the H gene for the specific detection of wild-type CDV variants. The CDV-H RT-LAMP assay rapidly amplified the target gene, within 60 min, using a water bath held at a constant temperature of 65°C. The assay was 100-fold more sensitive than conventional RT-PCR, with a detection limit of 10(-1)TCID50ml(-1). The system showed a preference for wild-type CDV, and exhibited less sensitivity to canine parvovirus, canine adenovirus type 1 and type 2, canine coronavirus, and canine parainfluenza virus. The assay was validated using 102 clinical samples obtained from vaccinated dog farms, and the results were comparable to a multiplex nested RT-PCR assay. The specific CDV-H RT-LAMP assay provides a simple, rapid, and sensitive tool for the detection of canines infected with wild-type CDV from canines vaccinated with attenuated vaccine. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Molecular typing of canine distemper virus strains reveals the presence of a new genetic variant in South America.

    Science.gov (United States)

    Sarute, Nicolás; Pérez, Ruben; Aldaz, Jaime; Alfieri, Amauri A; Alfieri, Alice F; Name, Daniela; Llanes, Jessika; Hernández, Martín; Francia, Lourdes; Panzera, Yanina

    2014-06-01

    Canine distemper virus (CDV, Paramyxoviridae, Morbillivirus) is the causative agent of a severe infectious disease affecting terrestrial and marine carnivores worldwide. Phylogenetic relationships and the genetic variability of the hemagglutinin (H) protein and the fusion protein signal-peptide (Fsp) allow for the classification of field strains into genetic lineages. Currently, there are nine CDV lineages worldwide, two of them co-circulating in South America. Using the Fsp-coding region, we analyzed the genetic variability of strains from Uruguay, Brazil, and Ecuador, and compared them with those described previously in South America and other geographical areas. The results revealed that the Brazilian and Uruguayan strains belong to the already described South America lineage (EU1/SA1), whereas the Ecuadorian strains cluster in a new clade, here named South America 3, which may represent the third CDV lineage described in South America.

  8. Protective levels of canine distemper virus antibody in an urban dog population using plaque reduction neutralization test

    Directory of Open Access Journals (Sweden)

    O.I. Oyedele

    2004-11-01

    Full Text Available Blood samples from 50 dogs were collected at three veterinary clinics in Ibadan and Abuja, Nigeria and the serum from each sample was evaluated serologically for neutralizing antibodies against canine distemper virus (CDV by the highly sensitive plaque reduction (PRN neutralization assay. Thirteen dogs had plaque reduction neutralization titres of 0-100, seven had titres of 100-1 000 while 30 had titres ranging from 1 000-6 000. The PRN titres of vaccinated dogs were found to be significantly higher than unvaccinated dogs. The widespread use of the highly reproducible PRN test for the evaluation of antibody response to CDV may be very important in the generation of international CDV positive serum standards that should help to improve pre-and post-vaccination testing of dogs worldwide.

  9. Severe canine distemper outbreak in unvaccinated dogs in Mozambique

    Directory of Open Access Journals (Sweden)

    Julieta Zacarias

    2016-07-01

    Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

  10. Canine distemper spillover in domestic dogs from urban wildlife.

    Science.gov (United States)

    Kapil, Sanjay; Yeary, Teresa J

    2011-11-01

    Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.

  11. Canine distemper virus matrix protein influences particle infectivity, particle composition, and envelope distribution in polarized epithelial cells and modulates virulence.

    Science.gov (United States)

    Dietzel, Erik; Anderson, Danielle E; Castan, Alexandre; von Messling, Veronika; Maisner, Andrea

    2011-07-01

    In paramyxoviruses, the matrix (M) protein mediates the interaction between the envelope and internal proteins during particle assembly and egress. In measles virus (MeV), M mutations, such as those found in subacute sclerosing panencephalitis (SSPE) strains, and differences in vaccine and wild-type M proteins can affect the strength of interaction with the envelope glycoproteins, assembly efficiency, and spread. However, the contribution of the M protein to the replication and pathogenesis of the closely related canine distemper virus (CDV) has not been characterized. To this end this, we generated a recombinant wild-type CDV carrying a vaccine strain M protein. The recombinant virus retained the parental growth phenotype in VerodogSLAMtag cells, but displayed an increased particle-to-infectivity ratio very similar to that of the vaccine strain, likely due to inefficient H protein incorporation. Even though infectious virus was released only from the apical surface, consistent with the release polarity of the wild-type CDV strain, envelope protein distribution in polarized epithelial cells reproduced the bipolar pattern seen in vaccine strain-infected cells. Most notably, the chimeric virus was completely attenuated in ferrets and caused only a mild and transient leukopenia, indicating that the differences in particle infectivity and envelope protein sorting mediated by the vaccine M protein contribute importantly to vaccine strain attenuation.

  12. The fusion protein of wild-type canine distemper virus is a major determinant of persistent infection

    International Nuclear Information System (INIS)

    Plattet, Philippe; Rivals, Jean-Paul; Zuber, BenoIt; Brunner, Jean-Marc; Zurbriggen, Andreas; Wittek, Riccardo

    2005-01-01

    The wild-type A75/17 canine distemper virus (CDV) strain induces a persistent infection in the central nervous system but infects cell lines very inefficiently. In contrast, the genetically more distant Onderstepoort CDV vaccine strain (OP-CDV) induces extensive syncytia formation. Here, we investigated the roles of wild-type fusion (F WT ) and attachment (H WT ) proteins in Vero cells expressing, or not, the canine SLAM receptor by transfection experiments and by studying recombinants viruses expressing different combinations of wild-type and OP-CDV glycoproteins. We show that low fusogenicity is not due to a defect of the envelope proteins to reach the cell surface and that H WT determines persistent infection in a receptor-dependent manner, emphasizing the role of SLAM as a potent enhancer of fusogenicity. However, importantly, F WT reduced cell-to-cell fusion independently of the cell surface receptor, thus demonstrating that the fusion protein of the neurovirulent A75/17-CDV strain plays a key role in determining persistent infection

  13. In vitro inhibition of canine distemper virus by flavonoids and phenolic acids: implications of structural differences for antiviral design.

    Science.gov (United States)

    Carvalho, O V; Botelho, C V; Ferreira, C G T; Ferreira, H C C; Santos, M R; Diaz, M A N; Oliveira, T T; Soares-Martins, J A P; Almeida, M R; Silva, A

    2013-10-01

    Infection caused by canine distemper virus (CDV) is a highly contagious disease with high incidence and lethality in the canine population. Antiviral activity of flavonoids quercetin, morin, rutin and hesperidin, and phenolic cinnamic, trans-cinnamic and ferulic acids were evaluated in vitro against the CDV using the time of addition assay to determine which step of the viral replicative cycle was affected. All flavonoids displayed great viral inhibition when they were added at the times 0 (adsorption) and 1h (penetration) of the viral replicative cycle. Both quercetin and hesperidin presented antiviral activity at the time 2h (intracellular). In the other hand, cinnamic acid showed antiviral activity at the times 0 and 2h while trans-cinnamic acid showed antiviral effect at the times -1h (pre-treatment) and 0 h. Ferulic acid inhibited CDV replicative cycle at the times 0 and 1h. Our study revealed promising candidates to be considered in the treatment of CDV. Structural differences among compounds and correlation to their antiviral activity were also explored. Our analysis suggest that these compounds could be useful in order to design new antiviral drugs against CDV as well as other viruses of great meaning in veterinary medicine. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

    Science.gov (United States)

    Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

  15. Canine distemper virus (CDV) infection of ferrets as a model for testing Morbillivirus vaccine strategies: NYVAC- and ALVAC-based CDV recombinants protect against symptomatic infection.

    Science.gov (United States)

    Stephensen, C B; Welter, J; Thaker, S R; Taylor, J; Tartaglia, J; Paoletti, E

    1997-02-01

    Canine distemper virus (CDV) infection of ferrets causes an acute systemic disease involving multiple organ systems, including the respiratory tract, lymphoid system, and central nervous system (CNS). We have tested candidate CDV vaccines incorporating the fusion (F) and hemagglutinin (HA) proteins in the highly attenuated NYVAC strain of vaccinia virus and in the ALVAC strain of canarypox virus, which does not productively replicate in mammalian hosts. Juvenile ferrets were vaccinated twice with these constructs, or with an attenuated live-virus vaccine, while controls received saline or the NYVAC and ALVAC vectors expressing rabies virus glycoprotein. Control animals did not develop neutralizing antibody and succumbed to distemper after developing fever, weight loss, leukocytopenia, decreased activity, conjunctivitis, an erythematous rash typical of distemper, CNS signs, and viremia in peripheral blood mononuclear cells (as measured by reverse transcription-PCR). All three CDV vaccines elicited neutralizing titers of at least 1:96. All vaccinated ferrets survived, and none developed viremia. Both recombinant vaccines also protected against the development of symptomatic distemper. However, ferrets receiving the live-virus vaccine lost weight, became lymphocytopenic, and developed the erythematous rash typical of CDV. These data show that ferrets are an excellent model for evaluating the ability of CDV vaccines to protect against symptomatic infection. Because the pathogenesis and clinical course of CDV infection of ferrets is quite similar to that of other Morbillivirus infections, including measles, this model will be useful in testing new candidate Morbillivirus vaccines.

  16. Phylogenetic analysis of canine distemper virus in South America clade 1 reveals unique molecular signatures of the local epidemic.

    Science.gov (United States)

    Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R

    2016-07-01

    Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Serologic responses after vaccination of fennec foxes (Vulpes zerda) and meerkats (Suricata suricatta) with a live, canarypox-vectored canine distemper virus vaccine.

    Science.gov (United States)

    Coke, Rob L; Backues, Kay A; Hoover, John P; Saliki, Jeremiah T; Ritchey, Jerry W; West, Gary D

    2005-06-01

    Fennec foxes (Vulpes zerda) and meerkats (Suricata suricatta) are considered to be susceptible to canine distemper virus (CDV) infection. Although no definitive clinical cases of natural CDV infections have been reported, mortalities due to CDV have been suspected and are reported in other closely related species. A commercially available monovalent, live, canarypox-vectored CDV vaccine induced neutralizing antibody titers that were maintained for at least a year in both fennec foxes and meerkats.

  18. Fatal combined infection with canine distemper virus and orthopoxvirus in a group of Asian marmots (Marmota caudata).

    Science.gov (United States)

    Origgi, F C; Sattler, U; Pilo, P; Waldvogel, A S

    2013-09-01

    A fatal combined infection with canine distemper virus (CDV) and orthopoxvirus (OPXV) in Asian marmots (Marmota caudata) is reported in this article. A total of 7 Asian marmots from a small zoological garden in Switzerland were found dead in hibernation during a routine check in the winter of 2011. The marmots died in February 2011. No clinical signs of disease were observed at any time. The viruses were detected in all individuals for which the tissues were available (n = 3). Detection of the viruses was performed by reverse transcription polymerase chain reaction. The most consistent gross lesion was a neck and thorax edema. A necrotizing pharyngitis and a multifocal necrotizing pneumonia were observed histologically. Numerous large intracytoplasmic eosinophilic inclusions were seen in the epithelial cells of the pharynx, of the airways, and in the skin keratinocytes. Brain lesions were limited to mild multifocal gliosis. Phylogenetic analysis revealed that the marmot CDV strain was closely related to the clusters of CDVs detected in Switzerland in wild carnivores during a local outbreak in 2002 and the 2009-2010 nationwide epidemic, suggesting a spillover of this virus from wildlife. The OPXV was most closely related to a strain of cowpoxvirus, a poxvirus species considered endemic in Europe. This is the first reported instance of CDV infection in a rodent species and of a combined CDV and OPXV infection.

  19. Delineating morbillivirus entry, dissemination and airborne transmission by studying in vivo competition of multicolor canine distemper viruses in ferrets.

    Directory of Open Access Journals (Sweden)

    Rory D de Vries

    2017-05-01

    Full Text Available Identification of cellular receptors and characterization of viral tropism in animal models have vastly improved our understanding of morbillivirus pathogenesis. However, specific aspects of viral entry, dissemination and transmission remain difficult to recapitulate in animal models. Here, we used three virologically identical but phenotypically distinct recombinant (r canine distemper viruses (CDV expressing different fluorescent reporter proteins for in vivo competition and airborne transmission studies in ferrets (Mustela putorius furo. Six donor ferrets simultaneously received three rCDVs expressing green, red or blue fluorescent proteins via conjunctival (ocular, Oc, intra-nasal (IN or intra-tracheal (IT inoculation. Two days post-inoculation sentinel ferrets were placed in physically separated adjacent cages to assess airborne transmission. All donor ferrets developed lymphopenia, fever and lethargy, showed progressively increasing systemic viral loads and were euthanized 14 to 16 days post-inoculation. Systemic replication of virus inoculated via the Oc, IN and IT routes was detected in 2/6, 5/6 and 6/6 ferrets, respectively. In five donor ferrets the IT delivered virus dominated, although replication of two or three different viruses was detected in 5/6 animals. Single lymphocytes expressing multiple fluorescent proteins were abundant in peripheral blood and lymphoid tissues, demonstrating the occurrence of double and triple virus infections. Transmission occurred efficiently and all recipient ferrets showed evidence of infection between 18 and 22 days post-inoculation of the donor ferrets. In all cases, airborne transmission resulted in replication of a single-colored virus, which was the dominant virus in the donor ferret. This study demonstrates that morbilliviruses can use multiple entry routes in parallel, and co-infection of cells during viral dissemination in the host is common. Airborne transmission was efficient, although

  20. Delineating morbillivirus entry, dissemination and airborne transmission by studying in vivo competition of multicolor canine distemper viruses in ferrets.

    Science.gov (United States)

    de Vries, Rory D; Ludlow, Martin; de Jong, Alwin; Rennick, Linda J; Verburgh, R Joyce; van Amerongen, Geert; van Riel, Debby; van Run, Peter R W A; Herfst, Sander; Kuiken, Thijs; Fouchier, Ron A M; Osterhaus, Albert D M E; de Swart, Rik L; Duprex, W Paul

    2017-05-01

    Identification of cellular receptors and characterization of viral tropism in animal models have vastly improved our understanding of morbillivirus pathogenesis. However, specific aspects of viral entry, dissemination and transmission remain difficult to recapitulate in animal models. Here, we used three virologically identical but phenotypically distinct recombinant (r) canine distemper viruses (CDV) expressing different fluorescent reporter proteins for in vivo competition and airborne transmission studies in ferrets (Mustela putorius furo). Six donor ferrets simultaneously received three rCDVs expressing green, red or blue fluorescent proteins via conjunctival (ocular, Oc), intra-nasal (IN) or intra-tracheal (IT) inoculation. Two days post-inoculation sentinel ferrets were placed in physically separated adjacent cages to assess airborne transmission. All donor ferrets developed lymphopenia, fever and lethargy, showed progressively increasing systemic viral loads and were euthanized 14 to 16 days post-inoculation. Systemic replication of virus inoculated via the Oc, IN and IT routes was detected in 2/6, 5/6 and 6/6 ferrets, respectively. In five donor ferrets the IT delivered virus dominated, although replication of two or three different viruses was detected in 5/6 animals. Single lymphocytes expressing multiple fluorescent proteins were abundant in peripheral blood and lymphoid tissues, demonstrating the occurrence of double and triple virus infections. Transmission occurred efficiently and all recipient ferrets showed evidence of infection between 18 and 22 days post-inoculation of the donor ferrets. In all cases, airborne transmission resulted in replication of a single-colored virus, which was the dominant virus in the donor ferret. This study demonstrates that morbilliviruses can use multiple entry routes in parallel, and co-infection of cells during viral dissemination in the host is common. Airborne transmission was efficient, although transmission of

  1. [Establishment and application of a Vero cell line stably expressing raccoon dog SLAM, the cellular receptor of canine distemper virus].

    Science.gov (United States)

    Zhao, Jianjun; Yan, Ruxun; Zhang, Hailing; Zhang, Lei; Hu, Bo; Bai, Xue; Shao, Xiqun; Chai, Xiuli; Yan, Xijun; Wu, Wei

    2012-12-04

    The signaling lymphocyte activation molecule (SLAM, also known as CD150), is used as a cellular receptor by canine distemper virus (CDV). Wild-type strains of CDVs can be isolated and propagated efficiently in non-lymphoid cells expressing this protein. Our aim is to establish a Vero cells expressing raccoon dog SLAM (rSLAM) to efficiently isolate CDV from pathological samples. A eukaryotic expression plasmid, pIRES2-EGFP-rSLAMhis, containing rSLAM gene fused with six histidine-coding sequence, EGFP gene, and neomycin resistance gene was constructed. After transfection with the plasmid, a stable cell line, Vero-rSLAM, was screened from Vero cells with the identification of EGFP reporter and G418 resistance. Three CD positive specimens from infected foxes and raccoon dogs were inoculated to Vero-rSLAM cells for CDV isolation. Foxes and raccoon dogs were inoculated subcutaneously LN (10)fl strain with 4 x 10(2.39)TCID50 dose to evaluate pathogenicity of CDV isolations. The rSLAMh fused gene was shown to transcript and express stably in Vero-rSLAM cells by RT-PCR and Immunohistochemistry assay. Three CDV strains were isolated successfully in Vero-rSLAM cells 36 -48 hours after inoculation with spleen or lung specimens from foxes and raccoon dogs with distemper. By contrast, no CDV was recovered from those CD positive specimens when Vero cells were used for virus isolation. Infected foxes and raccoon dogs with LN(10)f1 strain all showed typical CD symptoms and high mortality (2/3 for foxes and 3/3 for raccoon dogs) in 22 days post challenge. Our results indicate that Vero-rSLAM cells stably expressing raccoon dog SLAM are highly sensitive to CDV in clinical specimens and the CDV isolation can maintain high virulence to its host animals.

  2. Experimental adaptation of wild-type canine distemper virus (CDV to the human entry receptor CD150.

    Directory of Open Access Journals (Sweden)

    Maria Bieringer

    Full Text Available Canine distemper virus (CDV, a close relative of measles virus (MV, is widespread and well known for its broad host range. When the goal of measles eradication may be achieved, and when measles vaccination will be stopped, CDV might eventually cross the species barrier to humans and emerge as a new human pathogen. In order to get an impression how fast such alterations may occur, we characterized required adaptive mutations to the human entry receptors CD150 (SLAM and nectin-4 as first step to infect human target cells. Recombinant wild-type CDV-A75/17(red adapted quickly to growth in human H358 epithelial cells expressing human nectin-4. Sequencing of the viral attachment proteins (hemagglutinin, H, and fusion protein, F genes revealed that no adaptive alteration was required to utilize human nectin-4. In contrast, the virus replicated only to low titres (10(2 pfu/ml in Vero cells expressing human CD150 (Vero-hSLAM. After three passages using these cells virus was adapted to human CD150 and replicated to high titres (10(5 pfu/ml. Sequence analyses revealed that only one amino acid exchange in the H-protein at position 540 Asp→Gly (D540G was required for functional adaptation to human CD150. Structural modelling suggests that the adaptive mutation D540G in H reflects the sequence alteration from canine to human CD150 at position 70 and 71 from Pro to Leu (P70L and Gly to Glu (G71E, and compensates for the gain of a negative charge in the human CD150 molecule. Using this model system our data indicate that only a minimal alteration, in this case one adaptive mutation, is required for adaptation of CDV to the human entry receptors, and help to understand the molecular basis why this adaptive mutation occurs.

  3. Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

    Science.gov (United States)

    Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

    2009-12-10

    Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

  4. Comparison of two assays for detection of antibodies against canine parvovirus and canine distemper virus in dogs admitted to a Florida animal shelter.

    Science.gov (United States)

    Gray, Lauren K; Crawford, P Cynda; Levy, Julie K; Dubovi, Edward J

    2012-05-01

    To compare 2 assays for use in the identification of dogs with a protective antibody titer (PAT) against canine parvovirus (CPV) and canine distemper virus (CDV). Prospective cross-sectional study. 431 dogs admitted to a municipal animal shelter in north central Florida. Blood samples were collected from dogs on the day of admission to the shelter. Serum was obtained, criterion-referenced assays were used to identify dogs that had PATs against CPV (titers ≥ 80; hemagglutination inhibition assay) and CDV (titers ≥ 32; virus neutralization assay), and results were compared with results of a semiquantitative ELISA and an immunofluorescence assay (IFA). For correct identification of dogs that had PATs against viruses, the ELISA had significantly higher specificity for CPV (98%) and CDV (95%) than did the IFA (82% and 70%, respectively) and had significantly lower sensitivity for CDV (88%) than did the IFA (97%); the sensitivity for CPV was similar (ELISA, 98%; IFA, 97%). Overall diagnostic accuracy was significantly greater with the ELISA than with the IFA. Predictive value of a positive result for PATs was significantly higher with the ELISA for CPV (99%) and CDV (93%) than with the IFA (92% and 71%, respectively). The ELISA had fewer false-positive results than did the IFA and could be performed on-site in shelters in < 1 hour. Accuracy and practicality of the ELISA may be useful for identifying the infection risk of dogs exposed during outbreaks attributable to CPV and CDV infections in shelters.

  5. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China

    Directory of Open Access Journals (Sweden)

    Tan Bin

    2011-11-01

    Full Text Available Abstract A new isolate of canine distemper virus (CDV, named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N, phosphoprotein (P and receptor binding haemagglutinin (H gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

  6. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China.

    Science.gov (United States)

    Tan, Bin; Wen, Yong-Jun; Wang, Feng-Xue; Zhang, Shu-Qin; Wang, Xiu-Dong; Hu, Jia-Xin; Shi, Xin-Chuan; Yang, Bo-Chao; Chen, Li-Zhi; Cheng, Shi-Peng; Wu, Hua

    2011-11-16

    A new isolate of canine distemper virus (CDV), named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N), phosphoprotein (P) and receptor binding haemagglutinin (H) gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

  7. Molecular surveillance of canine distemper virus in diarrhoetic puppies in northeast China from May 2014 to April 2015.

    Science.gov (United States)

    Li, Chunqiu; Guo, Donghua; Wu, Rui; Kong, Fanzhi; Zhai, Junjun; Yuan, Dongwei; Sun, Dongbo

    2018-04-24

    To trace the prevalence of canine distemper virus (CDV) in diarrhoetic dogs, a total of 201 stool samples were collected in the Heilongjiang province of northeastern China from May 2014 to April 2015. The 201 fecal samples were subjected to the detection of CDV by using RT-PCR targeting the partial N gene, phylogenetic analysis based on the complete H gene, and co-infection analysis. Results indicated that 24.88% (50/201) of the samples were positive for CDV. The fifty CDV samples exhibited an overall co-infection rate of 94% (47/50) with four enteric viruses (82%, 41/50) and five bacteria (72%, 36/50). The positivity rate of CDV exhibited differences among regions, seasons, ages, and immunization status. Phylogenetic analysis of the complete H genes (n=6) revealed that the CDV strains identified in our study belonged to the Asia-1 group, and showed genetic diversities. These data provide evidence that there are a number of genetically diverse CDV Asia-1 strains circulating in diarrhoetic dogs in northeastern China; the CDV-affected animals exhibit the high co-infection with other enteric viruses and bacteria.

  8. Clinical manifestations of canine distemper in Nigerian dogs ...

    African Journals Online (AJOL)

    Twenty dogs of local breeds found in Nigeria, experimentally infected with local isolate of canine distemper virus, manifested fever, conjunctivitis, photophobia salivation, anorexia, dermatitis, and diarrhoea. Apart from these clinical signs already described for the disease in other breeds of dogs,45% of the dogs showed ...

  9. Canine distemper associated with generalized oedema in Nigerian ...

    African Journals Online (AJOL)

    Twenty puppies of Nigeria local breed of dogs which were experimentally infected with a local isolate of canine distemper virus manifested clinical signs known for the disease including anorexia, ocular discharges, postular dermatitis on the lower abdomen and diarrhoea. In addition, they also manifested generalized ...

  10. Three-year rabies duration of immunity in dogs following vaccination with a core combination vaccine against canine distemper virus, canine adenovirus type-1, canine parvovirus, and rabies virus.

    Science.gov (United States)

    Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

    2006-01-01

    Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.

  11. Emergence of canine distemper virus strains with modified molecular signature and enhanced neuronal tropism leading to high mortality in wild carnivores.

    Science.gov (United States)

    Origgi, F C; Plattet, P; Sattler, U; Robert, N; Casaubon, J; Mavrot, F; Pewsner, M; Wu, N; Giovannini, S; Oevermann, A; Stoffel, M H; Gaschen, V; Segner, H; Ryser-Degiorgis, M-P

    2012-11-01

    An ongoing canine distemper epidemic was first detected in Switzerland in the spring of 2009. Compared to previous local canine distemper outbreaks, it was characterized by unusually high morbidity and mortality, rapid spread over the country, and susceptibility of several wild carnivore species. Here, the authors describe the associated pathologic changes and phylogenetic and biological features of a multiple highly virulent canine distemper virus (CDV) strain detected in and/or isolated from red foxes (Vulpes vulpes), Eurasian badgers (Meles meles), stone (Martes foina) and pine (Martes martes) martens, from a Eurasian lynx (Lynx lynx), and a domestic dog. The main lesions included interstitial to bronchointerstitial pneumonia and meningopolioencephalitis, whereas demyelination--the classic presentation of CDV infection--was observed in few cases only. In the brain lesions, viral inclusions were mainly in the nuclei of the neurons. Some significant differences in brain and lung lesions were observed between foxes and mustelids. Swiss CDV isolates shared together with a Hungarian CDV strain detected in 2004. In vitro analysis of the hemagglutinin protein from one of the Swiss CDV strains revealed functional and structural differences from that of the reference strain A75/17, with the Swiss strain showing increased surface expression and binding efficiency to the signaling lymphocyte activation molecule (SLAM). These features might be part of a novel molecular signature, which might have contributed to an increase in virus pathogenicity, partially explaining the high morbidity and mortality, the rapid spread, and the large host spectrum observed in this outbreak.

  12. Use of serologic tests to predict resistance to Canine distemper virus-induced disease in vaccinated dogs.

    Science.gov (United States)

    Jensen, Wayne A; Totten, Janet S; Lappin, Michael R; Schultz, Ronald D

    2015-09-01

    The objective of the current study was to determine whether detection of Canine distemper virus (CDV)-specific serum antibodies correlates with resistance to challenge with virulent virus. Virus neutralization (VN) assay results were compared with resistance to viral challenge in 2 unvaccinated Beagle puppies, 9 unvaccinated Beagle dogs (4.4-7.2 years of age), and 9 vaccinated Beagle dogs (3.7-4.7 years of age). Eight of 9 (89%) unvaccinated adult dogs exhibited clinical signs after virus challenge, and 1 (13%) dog died. As compared to adult dogs, the 2 unvaccinated puppies developed more severe clinical signs and either died or were euthanized after challenge. In contrast, no clinical signs were detected after challenge of the 9 adult vaccinated dogs with post-vaccination intervals of up to 4.4 years. In vaccinated dogs, the positive and negative predictive values of VN assay results for resistance to challenge were 100% and 0%, respectively. Results indicate that dogs vaccinated with modified live CDV can be protected from challenge for ≤4.4 years postvaccination and that detection of virus-specific antibodies is predictive of whether dogs are resistant to challenge with virulent virus. Results also indicate that CDV infection in unvaccinated dogs results in age-dependent morbidity and mortality. Knowledge of age-dependent morbidity and mortality, duration of vaccine-induced immunity, and the positive and negative predictive values of detection of virus-specific serum antibodies are useful in development of rational booster vaccination intervals for the prevention of CDV-mediated disease in adult dogs. © 2015 The Author(s).

  13. Canine distemper in endangered Ethiopian wolves.

    Science.gov (United States)

    Gordon, Christopher H; Banyard, Ashley C; Hussein, Alo; Laurenson, M Karen; Malcolm, James R; Marino, Jorgelina; Regassa, Fekede; Stewart, Anne-Marie E; Fooks, Anthony R; Sillero-Zubiri, Claudio

    2015-05-01

    The Ethiopian wolf (Canis simensis) is the world's rarest canid; ≈500 wolves remain. The largest population is found within the Bale Mountains National Park (BMNP) in southeastern Ethiopia, where conservation efforts have demonstrated the negative effect of rabies virus on wolf populations. We describe previously unreported infections with canine distemper virus (CDV) among these wolves during 2005-2006 and 2010. Death rates ranged from 43% to 68% in affected subpopulations and were higher for subadult than adult wolves (83%-87% vs. 34%-39%). The 2010 CDV outbreak started 20 months after a rabies outbreak, before the population had fully recovered, and led to the eradication of several focal packs in BMNP's Web Valley. The combined effect of rabies and CDV increases the chance of pack extinction, exacerbating the typically slow recovery of wolf populations, and represents a key extinction threat to populations of this highly endangered carnivore.

  14. Dog overpopulation and burden of exposure to canine distemper virus and other pathogens on Santa Cruz Island, Galapagos.

    Science.gov (United States)

    Diaz, Nicole M; Mendez, Gabriella S; Grijalva, C Jaime; Walden, Heather S; Cruz, Marilyn; Aragon, Eduardo; Hernandez, Jorge A

    2016-01-01

    Dog overpopulation and diseases are hazards to native island species and humans on the Galapagos. Vaccination and importation of dogs are prohibited on the Galapagos. Risk management of these hazards requires the use of science-based risk assessment and risk communication. The objectives of the study reported here were (i) to estimate the human:dog ratio and (ii) the prevalence of and identify exposure factors associated with positive antibody titers to canine distemper virus (CDV) and other pathogens, as well as infection with intestinal parasites in owned dogs on Santa Cruz Island, Galapagos in September 2014. The observed human:dog ratio was 6.148:1 which extrapolates to 2503 dogs (two times more than a recent dog count conducted by Galapagos Biosecurity Agency in March 2014). The proportion of spayed female dogs (50%) was higher, compared to neutered male dogs (30%) (p=0.04). Prevalence of dogs with positive antibody titers to CDV was 36% (95% CI=26, 46%), to canine parvovirus was 89% (95% CI=82, 95%), and to canine adenovirus was 40% (95% CI=30, 51%). The frequency of seropositive dogs to CDV was lower in urban dogs (26%), compared to rural dogs (53%) (pdog population on Santa Cruz is susceptible to an outbreak of CDV (particularly among urban dogs) with potential spill over to marine mammals. Dog's age (1-2 or 3-14 years old, compared to younger dogs), and residence (rural, urban) were associated with positive antibody titers to parvovirus, adenovirus, Ehrlichia spp., or Anaplasma spp., as well as infection with Ancylostoma spp., an intestinal parasite in dogs that can be transmitted to humans, particularly children. These results provide the most comprehensive assessment of dog overpopulation and exposure to CDV and other pathogens on the Galapagos to date. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Arctic lineage-canine distemper virus as a cause of death in Apennine wolves (Canis lupus in Italy.

    Directory of Open Access Journals (Sweden)

    Daria Di Sabatino

    Full Text Available Canine distemper virus (CDV infection is a primary threat affecting a wide number of carnivore species, including wild animals. In January 2013, two carcasses of Apennine wolves (Canis lupus were collected in Ortona dei Marsi (L'Aquila province, Italy by the local Veterinary Services. CDV was immediately identified either by RT-PCR or immunohistochemistry in lung and central nervous tissue samples. At the same time, severe clinical signs consistent with CDV infection were identified and taped (Videos S1-S3 from three wolves rescued in the areas surrounding the National Parks of the Abruzzi region by the Veterinary Services. The samples collected from these symptomatic animals also turned out CDV positive by RT-PCR. So far, 30 carcasses of wolves were screened and CDV was detected in 20 of them. The sequencing of the haemagglutinin gene and subsequent phylogenetic analysis demonstrated that the identified virus belonged to the CDV Arctic lineage. Strains belonging to this lineage are known to circulate in Italy and in Eastern Europe amongst domestic dogs. To the best of our knowledge this is the first report of CDV Arctic lineage epidemics in the wild population in Europe.

  16. Variable transcription of pro- and anti-inflammatory cytokines in phocine lymphocytes following canine distemper virus infection.

    Science.gov (United States)

    Seibel, H; Siebert, U; Rosenberger, T; Baumgärtner, W

    2014-10-15

    Canine distemper virus (CDV) is a highly contagious viral pathogen. Domesticated dogs are the main reservoir of CDV. Although phocine distemper virus was responsible for the recent epidemics in seals in the North and Baltic Seas, most devastating epidemics in seals were also caused by CDV. To further study the pathogenesis of CDV infection in seals, it was the aim of the present study to investigate the mechanisms of CDV induced immunosuppression in seals by analyzing the gene transcription of different pro- and anti-inflammatory cytokines in Concanavalin A (Con A) stimulated and non-stimulated phocine lymphocytes in vitro following infection with the CDV Onderstepoort (CDV-OND) strain. Phocine lymphocytes were isolated via density gradient centrifugation. The addition of 1 μg/ml Con A and virus was either performed simultaneously or lymphocytes were stimulated for 48 h with Con A prior to virus infection. Gene transcription of interleukin (IL)-6, IL-12 and tumor necrosis factor alpha (TNFα) as pro-inflammatory cytokines and IL-4, IL-10 and transforming growth factor beta (TGFβ) as anti-inflammatory cytokines were determined by using RT-qPCR. CDV-OND infection caused an initial increase of pro-inflammatory phocine cytokines mRNA 24h after infection, followed by a decrease in gene transcription after 48 h. A strong increase in the transcription of IL-4 and TGFβ was detected after 48 h when virus and mitogen were added simultaneously. An increased IL-10 production occurred only when stimulation and infection were performed simultaneously. Furthermore, an inhibition of IL-12 on IL-4 was noticed in phocine lymphocytes which were stimulated for 48 h prior to infection. In summary, the duration of the stimulation or the lymphocytes seem to have an important influence on the cytokine transcription and indicates that the outcome of CDV infection is dependent on various factors that might sensitize lymphocytes or make them more susceptible or reactive to CDV infection

  17. Canine distemper antibodies in lions of the Masai Mara.

    Science.gov (United States)

    Kock, R; Chalmers, W S; Mwanzia, J; Chillingworth, C; Wambua, J; Coleman, P G; Baxendale, W

    1998-06-13

    Canine distemper virus (CDV) has been implicated in some recent deaths of lions, which showed clinical signs of distemper, in the the Serengeti plain. Similar clinical findings have since been reported in lions of the Masai Mara. Fifty-five per cent of serum samples obtained from wild lions of the Masai Mara have been found to contain neutralising antibody to CDV, indicating that they had been exposed to the virus. Adult orphan lions kept in captivity, were vaccinated with the live attenuated Onderstepoort strain of CDV. The results indicated that the vaccine is both safe and immunogenic, and may be potentially useful for the prophylactic vaccination of lions at high risk.

  18. Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA

    Science.gov (United States)

    Lednicky, John A; Dubach, Jean; Kinsel, Michael J; Meehan, Thomas P; Bocchetta, Maurizio; Hungerford, Laura L; Sarich, Nicolene A; Witecki, Kelley E; Braid, Michael D; Pedrak, Casandra; Houde, Christiane M

    2004-01-01

    Background Mortality rates have differed during distemper outbreaks among free-ranging raccoons (Procyon lotor) living around a large Chicago-area zoo, and appeared higher in year 2001 than in 1998 and 2000. We hypothesized that a more lethal variant of the local Canine distemper virus (CDV) lineage had emerged in 2001, and sought the genetic basis that led to increased virulence. However, a more complex model surfaced during preliminary analyses of CDV genomic sequences in infected tissues and of virus isolated in vitro from the raccoons. Results Phylogenetic analyses of subgenomic CDV fusion (F) -, phosphoprotein (P) -, and complete hemagglutinin (H) – gene sequences indicated that distinct American CDV lineages caused the distemper epizootics. The 1998 outbreak was caused by viruses that are likely from an old CDV lineage that includes CDV Snyder Hill and Lederle, which are CDV strains from the early 1950's. The 2000 and 2001 viruses appear to stem from the lineage of CDV A75/17, which was isolated in the mid 1970's. Only the 2001 viruses formed large syncytia in brain and/or lung tissue, and during primary isolation in-vitro in Vero cells, demonstrating at least one phenotypic property by which they differed from the other viruses. Conclusions Two different American CDV lineages caused the raccoon distemper outbreaks. The 1998 viruses are genetically distant to the 2000/2001 viruses. Since CDV does not cause persistent infections, the cycling of different CDV lineages within the same locale suggests multiple reintroductions of the virus to area raccoons. Our findings establish a precedent for determining whether the perceived differences in mortality rates are actual and attributable in part to inherent differences between CDV strains arising from different CDV lineages. PMID:15507154

  19. Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA

    Directory of Open Access Journals (Sweden)

    Lednicky John A

    2004-09-01

    Full Text Available Abstract Background Mortality rates have differed during distemper outbreaks among free-ranging raccoons (Procyon lotor living around a large Chicago-area zoo, and appeared higher in year 2001 than in 1998 and 2000. We hypothesized that a more lethal variant of the local Canine distemper virus (CDV lineage had emerged in 2001, and sought the genetic basis that led to increased virulence. However, a more complex model surfaced during preliminary analyses of CDV genomic sequences in infected tissues and of virus isolated in vitro from the raccoons. Results Phylogenetic analyses of subgenomic CDV fusion (F -, phosphoprotein (P -, and complete hemagglutinin (H – gene sequences indicated that distinct American CDV lineages caused the distemper epizootics. The 1998 outbreak was caused by viruses that are likely from an old CDV lineage that includes CDV Snyder Hill and Lederle, which are CDV strains from the early 1950's. The 2000 and 2001 viruses appear to stem from the lineage of CDV A75/17, which was isolated in the mid 1970's. Only the 2001 viruses formed large syncytia in brain and/or lung tissue, and during primary isolation in-vitro in Vero cells, demonstrating at least one phenotypic property by which they differed from the other viruses. Conclusions Two different American CDV lineages caused the raccoon distemper outbreaks. The 1998 viruses are genetically distant to the 2000/2001 viruses. Since CDV does not cause persistent infections, the cycling of different CDV lineages within the same locale suggests multiple reintroductions of the virus to area raccoons. Our findings establish a precedent for determining whether the perceived differences in mortality rates are actual and attributable in part to inherent differences between CDV strains arising from different CDV lineages.

  20. A comparison of the immune responses of dogs exposed to canine distemper virus (CDV) — Differences between vaccinated and wild-type virus exposed dogs

    Science.gov (United States)

    Perrone, Danielle; Bender, Scott; Niewiesk, Stefan

    2010-01-01

    Canine distemper virus (CDV)-specific immune response was measured in different dog populations. Three groups of vaccinated or wild-type virus exposed dogs were tested: dogs with a known vaccination history, dogs without a known vaccination history (shelter dogs), and dogs with potential exposure to wild-type CDV. The use of a T-cell proliferation assay demonstrated a detectable CDV-specific T-cell response from both spleen and blood lymphocytes of dogs. Qualitatively, antibody assays [enzyme-linked immunosorbent assay (ELISA) and neutralization assay] predicted the presence of a T-cell response well, although quantitatively neither antibody assays nor the T-cell assay correlated well with each other. An interesting finding from our study was that half of the dogs in shelters were not vaccinated (potentially posing a public veterinary health problem) and that antibody levels in dogs living in an environment with endemic CDV were lower than in vaccinated animals. PMID:20885846

  1. A comparison of the immune responses of dogs exposed to canine distemper virus (CDV) - Differences between vaccinated and wild-type virus exposed dogs.

    Science.gov (United States)

    Perrone, Danielle; Bender, Scott; Niewiesk, Stefan

    2010-07-01

    Canine distemper virus (CDV)-specific immune response was measured in different dog populations. Three groups of vaccinated or wild-type virus exposed dogs were tested: dogs with a known vaccination history, dogs without a known vaccination history (shelter dogs), and dogs with potential exposure to wild-type CDV. The use of a T-cell proliferation assay demonstrated a detectable CDV-specific T-cell response from both spleen and blood lymphocytes of dogs. Qualitatively, antibody assays [enzyme-linked immunosorbent assay (ELISA) and neutralization assay] predicted the presence of a T-cell response well, although quantitatively neither antibody assays nor the T-cell assay correlated well with each other. An interesting finding from our study was that half of the dogs in shelters were not vaccinated (potentially posing a public veterinary health problem) and that antibody levels in dogs living in an environment with endemic CDV were lower than in vaccinated animals.

  2. Accuracy of a point-of-care ELISA test kit for predicting the presence of protective canine parvovirus and canine distemper virus antibody concentrations in dogs.

    Science.gov (United States)

    Litster, A L; Pressler, B; Volpe, A; Dubovi, E

    2012-08-01

    Canine parvovirus (CPV) and canine distemper virus (CDV) are highly infectious and often fatal diseases with worldwide distributions, and are important population management considerations in animal shelters. A point-of-care ELISA test kit is available to detect serum antibodies to CPV and CDV, and presumptively to predict protective status. The aim of this study was to determine the diagnostic accuracy of the test compared to CPV hemagglutination inhibition titers and CDV serum neutralization titers determined by a reference laboratory, using sera collected from dogs housed at animal shelters. The ELISA test was used under both field and laboratory conditions and duplicate specimens were processed using an extra wash step. The test kit yielded accurate results (CPV: sensitivity 92.3%, specificity 93.5%; CDV: sensitivity 75.7%, specificity 91.8%) under field conditions. CDV sensitivity was improved by performing the test under laboratory conditions and using an optical density (OD) meter (laboratory performed 94.0%; OD 88.1%). Point-of-care ELISA testing for serum CPV and CDV antibody titers was demonstrated to be a useful tool for determining antibody status when making decisions regarding the need for CPV and/or CDV vaccination and also in animal shelters for population management. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Use of hydrophilic extra-viral domain of canine distemper virus H protein for enzyme-linked immunosorbent assay development.

    Science.gov (United States)

    Cho, Ki-hyun; Kim, Jeongmi; Yoo, Hyun-ah; Kim, Dae-hee; Park, Seung-yong; Song, Chang-seon; Choi, In-soo; Lee, Joong-bok

    2014-12-01

    Simple methods for measuring the levels of serum antibody against canine distemper virus (CDV) would assist in the effective vaccination of dogs. To develop an enzyme-linked immunosorbent assay (ELISA) specific for CDV, we expressed hydrophilic extra-viral domain (HEVD) protein of the A75/17-CDV H gene in a pET 28a plasmid-based Escherichia (E.) coli vector system. Expression was confirmed by dot and Western blotting. We proposed that detection of E. coli-expressed H protein might be conformation- dependent because intensities of the reactions observed with these two methods varied. The H gene HEVD protein was further purified and used as an antigen for an ELISA. Samples from dogs with undetectable to high anti-CDV antibody titers were analyzed using this HEVD-specific ELISA and a commercial CDV antibody detection kit (ImmunoComb). Levels of HEVD antigenicity measured with the assays and immunochromatography correlated. These data indicated that the HEDV protein may be used as antigen to develop techniques for detecting antibodies against CDV.

  4. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

    Science.gov (United States)

    Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

    2016-02-01

    During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Pneumonia due to Talaromyces marneffei in a Dog from Southern Brazil with Concomitant Canine Distemper Virus Infection.

    Science.gov (United States)

    Headley, S A; Pretto-Giordano, L G; Lima, S C; Suhett, W G; Pereira, A H T; Freitas, L A; Suphoronski, S A; Oliveira, T E S; Alfieri, A F; Pereira, E C; Vilas-Boas, L A; Alfieri, A A

    2017-07-01

    The pathological and molecular findings associated with Talaromyces marneffei-induced pneumonia with concomitant infection by canine distemper virus (CDV) are described in a dog. The principal pathological alteration occurred in the lungs. Histopathology confirmed multifocal granulomatous pneumonia associated with numerous intralesional and intracellular septate fission cells consistent with T. marneffei. A molecular assay designed to amplify a partial fragment of the 18S rRNA gene of T. marneffei provided positive results from two fungal cultures derived from the lung. Sequencing and phylogenetic analyses confirmed the results of polymerase chain reaction (PCR). Furthermore, antigens of the CDV N protein were identified within the bronchial epithelium by immunohistochemistry and a PCR assay amplified the CDV N gene from hepatic and pulmonary fragments. Collectively, the pathological and molecular techniques confirmed a diagnosis of T. marneffei-induced pneumonia with concomitant infection by CDV. These findings represent the first description of pulmonary penicilliosis in the dog and extend the geographical niche of this emerging infectious pathogen. In this case, infection by CDV may have induced immunosuppression, which facilitated the development of pulmonary penicilliosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Identification of a novel canine distemper virus B-cell epitope using a monoclonal antibody against nucleocapsid protein.

    Science.gov (United States)

    Yi, Li; Cheng, Yuening; Zhang, Miao; Cao, Zhigang; Tong, Mingwei; Wang, Jianke; Zhao, Hang; Lin, Peng; Cheng, Shipeng

    2016-02-02

    Canine distemper virus (CDV) is a member of the genus Morbillivirus within the family Paramyxoviridae and has caused severe economic losses in China. Nucleocapsid protein (N) is the major structural viral protein and can be used to diagnose CDV and other morbilliviruses. In this study, a specific monoclonal antibody, 1N8, was produced against the CDV N protein (amino acids 277-471). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis. The results indicated that (350)LNFGRSYFDPA(360) was the minimal linear epitope that could be recognized by mAb 1N8. ELISA assays revealed that mouse anti-CDV sera could also recognize the minimal linear epitope. Alignment analysis of the amino acid sequences indicated that the epitope was highly conserved among CDV strains. Furthermore, the epitope was conserved among other morbilliviruses, which was confirmed with PRRV using western blotting. Taken together, the results of this study may have potential applications in the development of suitable diagnostic techniques for CDV or other morbilliviruses. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Impacts of canine distemper virus infection on the giant panda population from the perspective of gut microbiota.

    Science.gov (United States)

    Zhao, Na; Li, Meng; Luo, Jing; Wang, Supen; Liu, Shelan; Wang, Shan; Lyu, Wenting; Chen, Lin; Su, Wen; Ding, Hua; He, Hongxuan

    2017-01-04

    The recent increase in infectious disease outbreaks has been directly linked to the global loss of biodiversity and the decline of some endangered species populations. Between December 2014 and March 2015, five captive giant pandas died due to canine distemper virus (CDV) infection in China. CDV has taken a heavy toll on tigers and lions in recent years. Here, we describe the first gut microbiome diversity study of CDV-infected pandas. By investigating the influence of CDV infection on gut bacterial communities in infected and uninfected individuals and throughout the course of infection, we found that CDV infection distorted the gut microbiota composition by reducing the prevalence of the dominant genera, Escherichia and Clostridium, and increasing microbial diversity. Our results highlight that increases in intestinal inflammation and changes in the relative abundances of pathogen-containing gut communities occur when individuals become infected with CDV. These results may provide new insights into therapeutics that target the microbiota to attenuate the progression of CDV disease and to reduce the risk of gut-linked disease in individuals with CDV. In addition, our findings underscore the need for better information concerning the dynamics of infection and the damage caused by pathogens in panda populations.

  8. An outbreak of canine distemper virus in tigers (Panthera tigris): possible transmission from wild animals to zoo animals.

    Science.gov (United States)

    Nagao, Yumiko; Nishio, Yohei; Shiomoda, Hiroshi; Tamaru, Seiji; Shimojima, Masayuki; Goto, Megumi; Une, Yumi; Sato, Azusa; Ikebe, Yusuke; Maeda, Ken

    2012-06-01

    Canine distemper virus (CDV), a morbillivirus that causes one of the most contagious and lethal viral diseases known in canids, has an expanding host range, including wild animals. Since December 2009, several dead or dying wild raccoon dogs (Nyctereutes procyonoides) were found in and around one safari-style zoo in Japan, and CDV was isolated from four of these animals. In the subsequent months (January to February 2010), 12 tigers (Panthera tigris) in the zoo developed respiratory and gastrointestinal diseases, and CDV RNA was detected in fecal samples of the examined tigers. In March 2010, one of the tigers developed a neurological disorder and died; CDV was isolated from the lung of this animal. Sequence analysis of the complete hemagglutinin (H) gene and the signal peptide region of the fusion (F) gene showed high homology among these isolates (99.8-100%), indicating that CDV might have been transmitted from raccoon dog to tiger. In addition, these isolates belonged to genotype Asia-1 and had lower homology (<90%) to the vaccine strain (Onderstepoort). Seropositivity of lions (Panthera leo) in the zoo and wild bears (Ursus thibetanus) captured around this area supported the theory that a CDV epidemic had occurred in many mammal species in and around the zoo. These results indicate a risk of CDV transmission among many animal species, including large felids and endangered species.

  9. Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein

    International Nuclear Information System (INIS)

    Zhang, Xinsheng; Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J.; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A.; Parks, Christopher L.

    2015-01-01

    Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance

  10. Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xinsheng, E-mail: xzhang@iavi.org [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States); Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Anzala, Omu [Kenya AIDS Vaccine Initiative (KAVI)-Institute of Clinical Research, Nairobi (Kenya); Sanders, Eduard J. [Centre for Geographic Medicine Research, Kenya Medical Research Institute (KEMRI), Kilifi, Kenya & Centre for Clinical Vaccinology and Tropical Medicine, University of Oxford, Headington (United Kingdom); Kamali, Anatoli [MRC/UVRI Uganda Virus Research Unit on AIDS, Masaka and Entebbe (Uganda); Karita, Etienne [Projet San Francisco, Kigali (Rwanda); Allen, Susan [Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA (United States); Fast, Pat [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Gilmour, Jill [Human Immunology Laboratory, International AIDS Vaccine Initiative, London (United Kingdom); Price, Matt A. [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Department of Epidemiology and Biostatistics, University of California at San Francisco, San Francisco, CA (United States); Parks, Christopher L. [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States)

    2015-08-15

    Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance.

  11. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013

    DEFF Research Database (Denmark)

    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted

    2015-01-01

    During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit...... distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine...... distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case...

  12. Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

    Science.gov (United States)

    Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

    2012-01-01

    A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

  13. Estimating the potential impact of canine distemper virus on the Amur tiger population (Panthera tigris altaica) in Russia.

    Science.gov (United States)

    Gilbert, Martin; Miquelle, Dale G; Goodrich, John M; Reeve, Richard; Cleaveland, Sarah; Matthews, Louise; Joly, Damien O

    2014-01-01

    Lethal infections with canine distemper virus (CDV) have recently been diagnosed in Amur tigers (Panthera tigris altaica), but long-term implications for the population are unknown. This study evaluates the potential impact of CDV on a key tiger population in Sikhote-Alin Biosphere Zapovednik (SABZ), and assesses how CDV might influence the extinction potential of other tiger populations of varying sizes. An individual-based stochastic, SIRD (susceptible-infected-recovered/dead) model was used to simulate infection through predation of infected domestic dogs, and/or wild carnivores, and direct tiger-to-tiger transmission. CDV prevalence and effective contact based on published and observed data was used to define plausible low- and high-risk infection scenarios. CDV infection increased the 50-year extinction probability of tigers in SABZ by 6.3% to 55.8% compared to a control population, depending on risk scenario. The most significant factors influencing model outcome were virus prevalence in the reservoir population(s) and its effective contact rate with tigers. Adjustment of the mortality rate had a proportional impact, while inclusion of epizootic infection waves had negligible additional impact. Small populations were found to be disproportionately vulnerable to extinction through CDV infection. The 50-year extinction risk in populations consisting of 25 individuals was 1.65 times greater when CDV was present than that of control populations. The effects of density dependence do not protect an endangered population from the impacts of a multi-host pathogen, such as CDV, where they coexist with an abundant reservoir presenting a persistent threat. Awareness of CDV is a critical component of a successful tiger conservation management policy.

  14. Estimating the potential impact of canine distemper virus on the Amur tiger population (Panthera tigris altaica in Russia.

    Directory of Open Access Journals (Sweden)

    Martin Gilbert

    Full Text Available Lethal infections with canine distemper virus (CDV have recently been diagnosed in Amur tigers (Panthera tigris altaica, but long-term implications for the population are unknown. This study evaluates the potential impact of CDV on a key tiger population in Sikhote-Alin Biosphere Zapovednik (SABZ, and assesses how CDV might influence the extinction potential of other tiger populations of varying sizes. An individual-based stochastic, SIRD (susceptible-infected-recovered/dead model was used to simulate infection through predation of infected domestic dogs, and/or wild carnivores, and direct tiger-to-tiger transmission. CDV prevalence and effective contact based on published and observed data was used to define plausible low- and high-risk infection scenarios. CDV infection increased the 50-year extinction probability of tigers in SABZ by 6.3% to 55.8% compared to a control population, depending on risk scenario. The most significant factors influencing model outcome were virus prevalence in the reservoir population(s and its effective contact rate with tigers. Adjustment of the mortality rate had a proportional impact, while inclusion of epizootic infection waves had negligible additional impact. Small populations were found to be disproportionately vulnerable to extinction through CDV infection. The 50-year extinction risk in populations consisting of 25 individuals was 1.65 times greater when CDV was present than that of control populations. The effects of density dependence do not protect an endangered population from the impacts of a multi-host pathogen, such as CDV, where they coexist with an abundant reservoir presenting a persistent threat. Awareness of CDV is a critical component of a successful tiger conservation management policy.

  15. Estimating the Potential Impact of Canine Distemper Virus on the Amur Tiger Population (Panthera tigris altaica) in Russia

    Science.gov (United States)

    Gilbert, Martin; Miquelle, Dale G.; Goodrich, John M.; Reeve, Richard; Cleaveland, Sarah; Matthews, Louise; Joly, Damien O.

    2014-01-01

    Lethal infections with canine distemper virus (CDV) have recently been diagnosed in Amur tigers (Panthera tigris altaica), but long-term implications for the population are unknown. This study evaluates the potential impact of CDV on a key tiger population in Sikhote-Alin Biosphere Zapovednik (SABZ), and assesses how CDV might influence the extinction potential of other tiger populations of varying sizes. An individual-based stochastic, SIRD (susceptible-infected-recovered/dead) model was used to simulate infection through predation of infected domestic dogs, and/or wild carnivores, and direct tiger-to-tiger transmission. CDV prevalence and effective contact based on published and observed data was used to define plausible low- and high-risk infection scenarios. CDV infection increased the 50-year extinction probability of tigers in SABZ by 6.3% to 55.8% compared to a control population, depending on risk scenario. The most significant factors influencing model outcome were virus prevalence in the reservoir population(s) and its effective contact rate with tigers. Adjustment of the mortality rate had a proportional impact, while inclusion of epizootic infection waves had negligible additional impact. Small populations were found to be disproportionately vulnerable to extinction through CDV infection. The 50-year extinction risk in populations consisting of 25 individuals was 1.65 times greater when CDV was present than that of control populations. The effects of density dependence do not protect an endangered population from the impacts of a multi-host pathogen, such as CDV, where they coexist with an abundant reservoir presenting a persistent threat. Awareness of CDV is a critical component of a successful tiger conservation management policy. PMID:25354196

  16. Recent host range expansion of canine distemper virus and variation in its receptor, the signaling lymphocyte activation molecule, in carnivores.

    Science.gov (United States)

    Ohishi, Kazue; Suzuki, Rintaro; Maeda, Taro; Tsuda, Miwako; Abe, Erika; Yoshida, Takao; Endo, Yasuyuki; Okamura, Maki; Nagamine, Takashi; Yamamoto, Hanae; Ueda, Miya; Maruyama, Tadashi

    2014-07-01

    The signaling lymphocyte activation molecule (SLAM) is a receptor for morbilliviruses. To understand the recent host range expansion of canine distemper virus (CDV) in carnivores, we determined the nucleotide sequences of SLAMs of various carnivores and generated three-dimensional homology SLAM models. Thirty-four amino acid residues were found for the candidates binding to CDV on the interface of the carnivore SLAMs. SLAM of the domestic dog (Canis lupus familiaris) were similar to those of other members of the suborder Caniformia, indicating that the animals in this group have similar sensitivity to dog CDV. However, they were different at nine positions from those of felids. Among the nine residues, four of domestic cat (Felis catus) SLAM (72, 76, 82, and 129) and three of lion (Panthera leo persica) SLAM (72, 82, and 129) were associated with charge alterations, suggesting that the felid interfaces have lower affinities to dog CDV. Only the residue at 76 was different between domestic cat and lion SLAM interfaces. The domestic cat SLAM had threonine at 76, whereas the lion SLAM had arginine, a positively charged residue like that of the dog SLAM. The cat SLAM with threonine is likely to have lower affinity to CDV-H and to confer higher resistance against dog CDV. Thus, the four residues (72, 76, 82, and 129) on carnivore SLAMs are important for the determination of affinity and sensitivity with CDV. Additionally, the CDV-H protein of felid strains had a substitution of histidine for tyrosine at 549 of dog CDV-H and may have higher affinity to lion SLAM. Three-dimensional model construction is a new risk assessment method of morbillivirus infectivity. Because the method is applicable to animals that have no information about virus infection, it is especially useful for morbillivirus risk assessment and wildlife conservation.

  17. Vaccine-induced canine distemper in a lesser panda.

    Science.gov (United States)

    Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J

    1976-11-01

    A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.

  18. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Directory of Open Access Journals (Sweden)

    Cui Shang-jin

    2010-05-01

    Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  19. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Science.gov (United States)

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  20. Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

    Science.gov (United States)

    Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

    2016-07-15

    Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

  1. Canine Distemper Virus Infects Canine Keratinocytes and Immune Cells by Using Overlapping and Distinct Regions Located on One Side of the Attachment Protein▿

    Science.gov (United States)

    Langedijk, Johannes P. M.; Janda, Jozef; Origgi, Francesco C.; Örvell, Claes; Vandevelde, Marc; Zurbriggen, Andreas; Plattet, Philippe

    2011-01-01

    The morbilliviruses measles virus (MeV) and canine distemper virus (CDV) both rely on two surface glycoproteins, the attachment (H) and fusion proteins, to promote fusion activity for viral cell entry. Growing evidence suggests that morbilliviruses infect multiple cell types by binding to distinct host cell surface receptors. Currently, the only known in vivo receptor used by morbilliviruses is CD150/SLAM, a molecule expressed in certain immune cells. Here we investigated the usage of multiple receptors by the highly virulent and demyelinating CDV strain A75/17. We based our study on the assumption that CDV-H may interact with receptors similar to those for MeV, and we conducted systematic alanine-scanning mutagenesis on CDV-H throughout one side of the β-propeller documented in MeV-H to contain multiple receptor-binding sites. Functional and biochemical assays performed with SLAM-expressing cells and primary canine epithelial keratinocytes identified 11 residues mutation of which selectively abrogated fusion in keratinocytes. Among these, four were identical to amino acids identified in MeV-H as residues contacting a putative receptor expressed in polarized epithelial cells. Strikingly, when mapped on a CDV-H structural model, all residues clustered in or around a recessed groove located on one side of CDV-H. In contrast, reported CDV-H mutants with SLAM-dependent fusion deficiencies were characterized by additional impairments to the promotion of fusion in keratinocytes. Furthermore, upon transfer of residues that selectively impaired fusion induction in keratinocytes into the CDV-H of the vaccine strain, fusion remained largely unaltered. Taken together, our results suggest that a restricted region on one side of CDV-H contains distinct and overlapping sites that control functional interaction with multiple receptors. PMID:21849439

  2. The humoral immune response to recombinant nucleocapsid antigen of canine distemper virus in dogs vaccinated with attenuated distemper virus or DNA encoding the nucleocapsid of wild-type virus.

    Science.gov (United States)

    Griot-Wenk, M E; Cherpillod, P; Koch, A; Zurbriggen, R; Bruckner, L; Wittek, R; Zurbriggen, A

    2001-06-01

    This study compared the humoral immune response against the nucleocapsid-(N) protein of canine distemper virus (CDV) of dogs vaccinated with a multivalent vaccine against parvo-, adeno-, and parainfluenza virus and leptospira combined with either the attenuated CDV Onderstepoort strain (n = 15) or an expression plasmid containing the N-gene of CDV (n = 30). The vaccinations were applied intramuscularly three times at 2-week intervals beginning at the age of 6 weeks. None of the pre-immune sera recognized the recombinant N-protein, confirming the lack of maternal antibodies at this age. Immunization with DNA vaccine for CDV resulted in positive serum N-specific IgG response. However, their IgG (and IgA) titres were lower than those of CDV-vaccinated dogs. Likewise, DNA-vaccinated dogs did not show an IgM peak. There was no increase in N-specific serum IgE titres in either group. Serum titres to the other multivalent vaccine components were similar in both groups.

  3. Rabies and canine distemper virus epidemics in the red fox population of northern Italy (2006-2010.

    Directory of Open Access Journals (Sweden)

    Pierre Nouvellet

    Full Text Available Since 2006 the red fox (Vulpes vulpes population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV. Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006-2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures.

  4. The role of canine distemper virus and persistent organic pollutants in mortality patterns of Caspian seals (Pusa caspica).

    Science.gov (United States)

    Wilson, Susan C; Eybatov, Tariel M; Amano, Masao; Jepson, Paul D; Goodman, Simon J

    2014-01-01

    Persistent organic pollutants are a concern for species occupying high trophic levels since they can cause immunosuppression and impair reproduction. Mass mortalities due to canine distemper virus (CDV) occurred in Caspian seals (Pusa caspica), in spring of 1997, 2000 and 2001, but the potential role of organochlorine exposure in these epizootics remains undetermined. Here we integrate Caspian seal mortality data spanning 1971-2008, with data on age, body condition, pathology and blubber organochlorine concentration for carcases stranded between 1997 and 2002. We test the hypothesis that summed PCB and DDT concentrations contributed to CDV associated mortality during epizootics. We show that age is the primary factor explaining variation in blubber organochlorine concentrations, and that organochlorine burden, age, sex, and body condition do not account for CDV infection status (positive/negative) of animals dying in epizootics. Most animals (57%, n = 67) had PCB concentrations below proposed thresholds for toxic effects in marine mammals (17 µg/g lipid weight), and only 3 of 67 animals had predicted TEQ values exceeding levels seen to be associated with immune suppression in harbour seals (200 pg/g lipid weight). Mean organonchlorine levels were higher in CDV-negative animals indicating that organochlorines did not contribute significantly to CDV mortality in epizootics. Mortality monitoring in Azerbaijan 1971-2008 revealed bi-annual stranding peaks in late spring, following the annual moult and during autumn migrations northwards. Mortality peaks comparable to epizootic years were also recorded in the 1970s-1980s, consistent with previous undocumented CDV outbreaks. Gompertz growth curves show that Caspian seals achieve an asymptotic standard body length of 126-129 cm (n = 111). Males may continue to grow slowly throughout life. Mortality during epizootics may exceed the potential biological removal level (PBR) for the population, but the low frequency of

  5. Dynamics of a morbillivirus at the domestic–wildlife interface: Canine distemper virus in domestic dogs and lions

    Science.gov (United States)

    Viana, Mafalda; Matthiopoulos, Jason; Halliday, Jo; Packer, Craig; Craft, Meggan E.; Hampson, Katie; Czupryna, Anna; Dobson, Andrew P.; Dubovi, Edward J.; Ernest, Eblate; Fyumagwa, Robert; Hoare, Richard; Hopcraft, J. Grant C.; Horton, Daniel L.; Kaare, Magai T.; Kanellos, Theo; Lankester, Felix; Mentzel, Christine; Mlengeya, Titus; Mzimbiri, Imam; Takahashi, Emi; Willett, Brian; Haydon, Daniel T.; Lembo, Tiziana

    2015-01-01

    Morbilliviruses cause many diseases of medical and veterinary importance, and although some (e.g., measles and rinderpest) have been controlled successfully, others, such as canine distemper virus (CDV), are a growing concern. A propensity for host-switching has resulted in CDV emergence in new species, including endangered wildlife, posing challenges for controlling disease in multispecies communities. CDV is typically associated with domestic dogs, but little is known about its maintenance and transmission in species-rich areas or about the potential role of domestic dog vaccination as a means of reducing disease threats to wildlife. We address these questions by analyzing a long-term serological dataset of CDV in lions and domestic dogs from Tanzania’s Serengeti ecosystem. Using a Bayesian state–space model, we show that dynamics of CDV have changed considerably over the past three decades. Initially, peaks of CDV infection in dogs preceded those in lions, suggesting that spill-over from dogs was the main driver of infection in wildlife. However, despite dog-to-lion transmission dominating cross-species transmission models, infection peaks in lions became more frequent and asynchronous from those in dogs, suggesting that other wildlife species may play a role in a potentially complex maintenance community. Widespread mass vaccination of domestic dogs reduced the probability of infection in dogs and the size of outbreaks but did not prevent transmission to or peaks of infection in lions. This study demonstrates the complexity of CDV dynamics in natural ecosystems and the value of long-term, large-scale datasets for investigating transmission patterns and evaluating disease control strategies. PMID:25605919

  6. The role of canine distemper virus and persistent organic pollutants in mortality patterns of Caspian seals (Pusa caspica.

    Directory of Open Access Journals (Sweden)

    Susan C Wilson

    Full Text Available Persistent organic pollutants are a concern for species occupying high trophic levels since they can cause immunosuppression and impair reproduction. Mass mortalities due to canine distemper virus (CDV occurred in Caspian seals (Pusa caspica, in spring of 1997, 2000 and 2001, but the potential role of organochlorine exposure in these epizootics remains undetermined. Here we integrate Caspian seal mortality data spanning 1971-2008, with data on age, body condition, pathology and blubber organochlorine concentration for carcases stranded between 1997 and 2002. We test the hypothesis that summed PCB and DDT concentrations contributed to CDV associated mortality during epizootics. We show that age is the primary factor explaining variation in blubber organochlorine concentrations, and that organochlorine burden, age, sex, and body condition do not account for CDV infection status (positive/negative of animals dying in epizootics. Most animals (57%, n = 67 had PCB concentrations below proposed thresholds for toxic effects in marine mammals (17 µg/g lipid weight, and only 3 of 67 animals had predicted TEQ values exceeding levels seen to be associated with immune suppression in harbour seals (200 pg/g lipid weight. Mean organonchlorine levels were higher in CDV-negative animals indicating that organochlorines did not contribute significantly to CDV mortality in epizootics. Mortality monitoring in Azerbaijan 1971-2008 revealed bi-annual stranding peaks in late spring, following the annual moult and during autumn migrations northwards. Mortality peaks comparable to epizootic years were also recorded in the 1970s-1980s, consistent with previous undocumented CDV outbreaks. Gompertz growth curves show that Caspian seals achieve an asymptotic standard body length of 126-129 cm (n = 111. Males may continue to grow slowly throughout life. Mortality during epizootics may exceed the potential biological removal level (PBR for the population, but the low

  7. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR for diagnosis of natural infection with canine distemper virus

    Directory of Open Access Journals (Sweden)

    Wong Min-Liang

    2010-06-01

    Full Text Available Abstract Background Canine distemper virus (CDV is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR of the matrix (M gene to the fusion (F gene (designated M-F UTR in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

  8. Dynamics of a morbillivirus at the domestic-wildlife interface: Canine distemper virus in domestic dogs and lions.

    Science.gov (United States)

    Viana, Mafalda; Cleaveland, Sarah; Matthiopoulos, Jason; Halliday, Jo; Packer, Craig; Craft, Meggan E; Hampson, Katie; Czupryna, Anna; Dobson, Andrew P; Dubovi, Edward J; Ernest, Eblate; Fyumagwa, Robert; Hoare, Richard; Hopcraft, J Grant C; Horton, Daniel L; Kaare, Magai T; Kanellos, Theo; Lankester, Felix; Mentzel, Christine; Mlengeya, Titus; Mzimbiri, Imam; Takahashi, Emi; Willett, Brian; Haydon, Daniel T; Lembo, Tiziana

    2015-02-03

    Morbilliviruses cause many diseases of medical and veterinary importance, and although some (e.g., measles and rinderpest) have been controlled successfully, others, such as canine distemper virus (CDV), are a growing concern. A propensity for host-switching has resulted in CDV emergence in new species, including endangered wildlife, posing challenges for controlling disease in multispecies communities. CDV is typically associated with domestic dogs, but little is known about its maintenance and transmission in species-rich areas or about the potential role of domestic dog vaccination as a means of reducing disease threats to wildlife. We address these questions by analyzing a long-term serological dataset of CDV in lions and domestic dogs from Tanzania's Serengeti ecosystem. Using a Bayesian state-space model, we show that dynamics of CDV have changed considerably over the past three decades. Initially, peaks of CDV infection in dogs preceded those in lions, suggesting that spill-over from dogs was the main driver of infection in wildlife. However, despite dog-to-lion transmission dominating cross-species transmission models, infection peaks in lions became more frequent and asynchronous from those in dogs, suggesting that other wildlife species may play a role in a potentially complex maintenance community. Widespread mass vaccination of domestic dogs reduced the probability of infection in dogs and the size of outbreaks but did not prevent transmission to or peaks of infection in lions. This study demonstrates the complexity of CDV dynamics in natural ecosystems and the value of long-term, large-scale datasets for investigating transmission patterns and evaluating disease control strategies.

  9. Rabies and canine distemper virus epidemics in the red fox population of northern Italy (2006-2010).

    Science.gov (United States)

    Nouvellet, Pierre; Donnelly, Christl A; De Nardi, Marco; Rhodes, Chris J; De Benedictis, Paola; Citterio, Carlo; Obber, Federica; Lorenzetto, Monica; Pozza, Manuela Dalla; Cauchemez, Simon; Cattoli, Giovanni

    2013-01-01

    Since 2006 the red fox (Vulpes vulpes) population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV). Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006-2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures.

  10. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus.

    Science.gov (United States)

    Chulakasian, Songkhla; Lee, Min-Shiuh; Wang, Chi-Young; Chiou, Shyan-Song; Lin, Kuan-Hsun; Lin, Fong-Yuan; Hsu, Tien-Huan; Wong, Min-Liang; Chang, Tien-Jye; Hsu, Wei-Li

    2010-06-10

    Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR) of the matrix (M) gene to the fusion (F) gene (designated M-F UTR) in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

  11. Urban domestic dog populations as a source of canine distemper virus for wild carnivores in the Coquimbo region of Chile.

    Science.gov (United States)

    Acosta-Jamett, G; Chalmers, W S K; Cunningham, A A; Cleaveland, S; Handel, I G; Bronsvoort, B M deC

    2011-09-28

    Urban areas can support dog populations dense enough to maintain canine distemper virus (CDV) and can be a source of infection for rural dogs and free-ranging carnivores. The aim of this study was to investigate the relationships between urban and rural domestic dog and wild carnivore populations and their effects on the epidemiology of CDV to explain retrospectively a CD outbreak in wild foxes in 2003. From 2005 to 2007 a cross-sectional household questionnaire survey was conducted in Coquimbo and Ovalle cities, in three towns and in rural sites along two transects from these cities to the Fray Jorge National Park (FJNP) in the Coquimbo region, Chile. Blood samples were collected from unvaccinated dogs at surveyed households and from free-ranging foxes in rural areas along the transects. The seroprevalence of CDV in domestic dogs was higher in urban than in rural areas and in the later was highest in dogs born before 2001-2002. The seroprevalence of CDV in foxes was higher in areas closer to human settlements. A high seroprevalence in dogs born before 2001-2002 further supports a link between CDV patterns in rural dog and fox populations. In our study area, urban dogs are proposed to be the source of CDV infection to wild carnivores. The large dog population size and density detected in Coquimbo and Ovalle provides optimal conditions for maintaining a large and dense susceptible population of dogs, which can act as a reservoir for highly infectious diseases and could have been the source of infection in the CD outbreak in wild foxes. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Rabies and Canine Distemper Virus Epidemics in the Red Fox Population of Northern Italy (2006–2010)

    Science.gov (United States)

    De Benedictis, Paola; Citterio, Carlo; Obber, Federica; Lorenzetto, Monica; Pozza, Manuela Dalla; Cauchemez, Simon; Cattoli, Giovanni

    2013-01-01

    Since 2006 the red fox (Vulpes vulpes) population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV). Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006–2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures. PMID:23630599

  13. Serological and demographic evidence for domestic dogs as a source of canine distemper virus infection for Serengeti wildlife.

    Science.gov (United States)

    Cleaveland, S; Appel, M G; Chalmers, W S; Chillingworth, C; Kaare, M; Dye, C

    2000-03-15

    Following an epidemic of canine distemper virus (CDV) in Serengeti lions in 1994, the role of domestic dogs in the epidemiology of the disease was investigated by serological and demographic analyses. From 1992 to 1994, data were collected from two domestic dog populations bordering the Serengeti National Park. Several lines of evidence indicated that patterns of CDV infection differed significantly between higher-density dog populations of Serengeti District to the west of the park and lower-density populations of Ngorongoro District to the south-east: (a) CDV age-seroprevalence patterns differed significantly between years in Ngorongoro District populations but not in Serengeti District populations; (b) CDV seropositive pups (Ngorongoro District only in 1994, whereas a proportion of pups in Serengeti District were seropositive in each year of the study; (c) in Ngorongoro District, the proportion of deaths attributed to disease was significantly higher in 1994 than in 1993, whereas in Serengeti District, there was no significant difference in disease-related mortality between years; (d) in Ngorongoro District, significantly more CDV seronegative dogs than seropositive dogs died in 1994, whereas there was no difference in survival of CDV seropositives and seronegatives between years in Serengeti District. We concluded that, between 1992 and 1994, CDV persisted in higher-density dog populations of Serengeti District, but occurred only sporadically in lower-density Ngorongoro District populations. Data from Ngorongoro District are consistent with exposure of dogs to CDV in 1991 and 1994, but not in 1992 and 1993. These findings suggest that higher-density domestic dog populations to the west of the Serengeti National Park were a more likely source of CDV infection for wildlife during 1994 than lower-density pastoralist dogs to the south and east of the park.

  14. Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs

    OpenAIRE

    McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel

    1985-01-01

    Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...

  15. Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

    Science.gov (United States)

    Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2013-12-01

    Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations.

    Science.gov (United States)

    Riley, Matthew C; Wilkes, Rebecca P

    2015-12-18

    Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine

  17. DNA vaccines encoding proteins from wild-type and attenuated canine distemper virus protect equally well against wild-type virus challenge.

    Science.gov (United States)

    Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete

    2012-10-01

    Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.

  18. Tumour necrosis factor-alpha-induced protein 8 (TNFAIP8) expression associated with cell survival and death in cancer cell lines infected with canine distemper virus.

    Science.gov (United States)

    Garcia, J A; Ferreira, H L; Vieira, F V; Gameiro, R; Andrade, A L; Eugênio, F R; Flores, E F; Cardoso, T C

    2017-06-01

    Oncolytic virotherapy is a novel strategy for treatment of cancer in humans and companion animals as well. Canine distemper virus (CDV), a paramyxovirus, has proven to be oncolytic through induction of apoptosis in canine-derived tumour cells, yet the mechanism behind this inhibitory action is poorly understood. In this study, three human mammary tumour cell lines and one canine-derived adenofibrosarcoma cell line were tested regarding to their susceptibility to CDV infection, cell proliferation, apoptosis, mitochondrial membrane potential and expression of tumour necrosis factor-alpha-induced protein 8 (TNFAIP8). CDV replication-induced cytopathic effect, decrease of cell proliferation rates, and >45% of infected cells were considered death and/or under late apoptosis/necrosis. TNFAIP8 and CDVM gene expression were positively correlated in all cell lines. In addition, mitochondrial membrane depolarization was associated with increase in virus titres (p < 0.005). Thus, these results strongly suggest that both human and canine mammary tumour cells are potential candidates for studies concerning CDV-induced cancer therapy. © 2015 John Wiley & Sons Ltd.

  19. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  20. Emergence of canine distemper virus strains with two amino acid substitutions in the haemagglutinin protein, detected from vaccinated carnivores in North-Eastern China in 2012-2013.

    Science.gov (United States)

    Zhao, Jianjun; Zhang, Hailing; Bai, Xue; Martella, Vito; Hu, Bo; Sun, Yangang; Zhu, Chunsheng; Zhang, Lei; Liu, Hao; Xu, Shujuan; Shao, Xiqun; Wu, Wei; Yan, Xijun

    2014-04-01

    A total of 16 strains of canine distemper virus (CDV) were detected from vaccinated minks, foxes, and raccoon dogs in four provinces in North-Eastern China between the end of 2011 and 2013. Upon sequence analysis of the haemagglutinin gene and comparison with wild-type CDV from different species in the same geographical areas, two non-synonymous single nucleotide polymorphisms were identified in 10 CDV strains, which led to amino acid changes at positions 542 (isoleucine to asparagine) and 549 (tyrosine to histidine) of the haemagglutinin protein coding sequence. The change at residue 542 generated a potentially novel N-glycosylation site. Masking of antigenic epitopes by sugar moieties might represent a mechanism for evasion of virus neutralising antibodies and reduced protection by vaccination. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Jaundice and bilirubinemia as manifestations of canine distemper in raccoons and ferrets

    Science.gov (United States)

    Kilham, L.; Habermann, R.T.; Herman, C.M.

    1956-01-01

    1) Two strains of distemper virus have been isolated from wild raccoons and one strain from ferrets. 2) All strains isolated have induced bilirubinemia in raccoons and ferrets. Many raccoons with bilirubinemia also had jaundice. 3) Identification of these strains as members of the canine distemper virus complex has been by clinical and pathological findings consistent with this diagnosis as well as by cross-immunity tests.

  2. Evaluation of post-vaccination immunity to canine distemper and ...

    African Journals Online (AJOL)

    SERVER

    2007-08-20

    Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...

  3. Vaccination against Canine Distemper Virus Infection in Infant Ferrets with and without Maternal Antibody Protection, Using Recombinant Attenuated Poxvirus Vaccines

    Science.gov (United States)

    Welter, Janet; Taylor, Jill; Tartaglia, James; Paoletti, Enzo; Stephensen, Charles B.

    2000-01-01

    Canine distemper virus (CDV) infection of ferrets is clinically and immunologically similar to measles, making this a useful model for the human disease. The model was used to determine if parenteral or mucosal immunization of infant ferrets at 3 and 6 weeks of age with attenuated vaccinia virus (NYVAC) or canarypox virus (ALVAC) vaccine strains expressing the CDV hemagglutinin (H) and fusion (F) protein genes (NYVAC-HF and ALVAC-HF) would induce serum neutralizing antibody and protect against challenge infection at 12 weeks of age. Ferrets without maternal antibody that were vaccinated parenterally with NYVAC-HF (n = 5) or ALVAC-HF (n = 4) developed significant neutralizing titers (log10 inverse mean titer ± standard deviation of 2.30 ± 0.12 and 2.20 ± 0.34, respectively) by the day of challenge, and all survived with no clinical or virologic evidence of infection. Ferrets without maternal antibody that were vaccinated intranasally (i.n.) developed lower neutralizing titers, with NYVAC-HF producing higher titers at challenge (1.11 ± 0.57 versus 0.40 ± 0.37, P = 0.02) and a better survival rate (6/7 versus 0/5, P = 0.008) than ALVAC-HF. Ferrets with maternal antibody that were vaccinated parenterally with NYVAC-HF (n = 7) and ALVAC-HF (n = 7) developed significantly higher antibody titers (1.64 ± 0.54 and 1.28 ± 0.40, respectively) than did ferrets immunized with an attenuated CDV vaccine (0.46 ± 0.59; n = 7) or the recombinant vectors expressing rabies glycoprotein (RG) (0.19 ± 0.32; n = 8, P = 7 × 10−6). The NYVAC vaccine also protected against weight loss, and both the NYVAC and attenuated CDV vaccines protected against the development of some clinical signs of infection, although survival in each of the three vaccine groups was low (one of seven) and not significantly different from the RG controls (none of eight). Combined i.n.-parenteral immunization of ferrets with maternal antibody using NYVAC-HF (n = 9) produced higher titers (1.63 ± 0

  4. Vaccination against canine distemper virus infection in infant ferrets with and without maternal antibody protection, using recombinant attenuated poxvirus vaccines.

    Science.gov (United States)

    Welter, J; Taylor, J; Tartaglia, J; Paoletti, E; Stephensen, C B

    2000-07-01

    Canine distemper virus (CDV) infection of ferrets is clinically and immunologically similar to measles, making this a useful model for the human disease. The model was used to determine if parenteral or mucosal immunization of infant ferrets at 3 and 6 weeks of age with attenuated vaccinia virus (NYVAC) or canarypox virus (ALVAC) vaccine strains expressing the CDV hemagglutinin (H) and fusion (F) protein genes (NYVAC-HF and ALVAC-HF) would induce serum neutralizing antibody and protect against challenge infection at 12 weeks of age. Ferrets without maternal antibody that were vaccinated parenterally with NYVAC-HF (n = 5) or ALVAC-HF (n = 4) developed significant neutralizing titers (log(10) inverse mean titer +/- standard deviation of 2.30 +/- 0.12 and 2.20 +/- 0.34, respectively) by the day of challenge, and all survived with no clinical or virologic evidence of infection. Ferrets without maternal antibody that were vaccinated intranasally (i.n.) developed lower neutralizing titers, with NYVAC-HF producing higher titers at challenge (1.11 +/- 0.57 versus 0.40 +/- 0.37, P = 0.02) and a better survival rate (6/7 versus 0/5, P = 0.008) than ALVAC-HF. Ferrets with maternal antibody that were vaccinated parenterally with NYVAC-HF (n = 7) and ALVAC-HF (n = 7) developed significantly higher antibody titers (1.64 +/- 0. 54 and 1.28 +/- 0.40, respectively) than did ferrets immunized with an attenuated CDV vaccine (0.46 +/- 0.59; n = 7) or the recombinant vectors expressing rabies glycoprotein (RG) (0.19 +/- 0.32; n = 8, P = 7 x 10(-6)). The NYVAC vaccine also protected against weight loss, and both the NYVAC and attenuated CDV vaccines protected against the development of some clinical signs of infection, although survival in each of the three vaccine groups was low (one of seven) and not significantly different from the RG controls (none of eight). Combined i.n.-parenteral immunization of ferrets with maternal antibody using NYVAC-HF (n = 9) produced higher titers (1

  5. Morbillivirus control of the interferon response: relevance of STAT2 and mda5 but not STAT1 for canine distemper virus virulence in ferrets.

    Science.gov (United States)

    Svitek, Nicholas; Gerhauser, Ingo; Goncalves, Christophe; Grabski, Elena; Döring, Marius; Kalinke, Ulrich; Anderson, Danielle E; Cattaneo, Roberto; von Messling, Veronika

    2014-03-01

    The V proteins of paramyxoviruses control the innate immune response. In particular, the V protein of the genus Morbillivirus interferes with the signal transducer and activator of transcription 1 (STAT1), STAT2, and melanoma differentiation-associated protein 5 (mda5) signaling pathways. To characterize the contributions of these pathways to canine distemper virus (CDV) pathogenesis, we took advantage of the knowledge about the mechanisms of interaction between the measles virus V protein with these key regulators of innate immunity. We generated recombinant CDVs with V proteins unable to properly interact with STAT1, STAT2, or mda5. A virus with combined STAT2 and mda5 deficiencies was also generated, and available wild-type and V-protein-knockout viruses were used as controls. Ferrets infected with wild-type and STAT1-blind viruses developed severe leukopenia and loss of lymphocyte proliferation activity and succumbed to the disease within 14 days. In contrast, animals infected with viruses with STAT2 or mda5 defect or both STAT2 and mda5 defects developed a mild self-limiting disease similar to that associated with the V-knockout virus. This study demonstrates the importance of interference with STAT2 and mda5 signaling for CDV immune evasion and provides a starting point for the development of morbillivirus vectors with reduced immunosuppressive properties. The V proteins of paramyxoviruses interfere with the recognition of the virus by the immune system of the host. For morbilliviruses, the V protein is known to interact with the signal transducer and activator of transcription 1 (STAT1) and STAT2 and the melanoma differentiation-associated protein 5 (mda5), which are involved in interferon signaling. Here, we examined the contribution of each of these signaling pathways to the pathogenesis of the carnivore morbillivirus canine distemper virus. Using viruses selectively unable to interfere with the respective signaling pathway to infect ferrets, we found that

  6. Comparison of reverse-transcription real-time PCR and immunohistochemistry for the detection of canine distemper virus infection in raccoons in Ontario, Canada.

    Science.gov (United States)

    Nemeth, Nicole M; Oesterle, Paul T; Campbell, G Douglas; Ojkic, Davor; Jardine, Claire M

    2018-03-01

    Canine distemper virus (CDV) is a widespread morbillivirus that causes subclinical to fatal infections in domestic and wild carnivores. Raccoons ( Procyon lotor) are CDV reservoirs and suffer from associated disease. Aspects of pathogenesis may lead to difficulty in the interpretation of commonly used testing modalities, such as reverse-transcription real-time (RT-rt)PCR and immunohistochemistry (IHC). The reliance upon such tests is greater for wildlife, which are often submitted as carcasses with no clinical history. We compared CDV RT-rtPCR results to immunohistochemistry (the gold standard) in tissues from 74 raccoons. These tests had high kappa agreement (lymph node: 0.9335; lung: 0.8671) and a negative correlation between IHC score and threshold cycle (Ct) value for lymph node and lung (Spearman rank correlation coefficient [ r s ] = -0.8555 and -0.8179, respectively; p < 0.00001). An RT-rtPCR Ct value of 30 in lung and lymph node with sensitivity and specificity of 92.3 and 92.6% and 86.8 and 96.4%, respectively, was suitable for determining CDV involvement. Conjunctival swabs provide an alternative for distemper diagnosis, as there was a strong correlation between Ct values of conjunctival swabs and tissues ( r s = -0.8498, p < 0.00001, n = 46). This information will aid in more efficient and accurate diagnoses in individuals, small-scale outbreaks, and epidemiologic investigations in wildlife.

  7. Caspase-3/-8/-9, Bax and Bcl-2 expression in the cerebellum, lymph nodes and leukocytes of dogs naturally infected with canine distemper virus.

    Science.gov (United States)

    Del Puerto, H L; Martins, A S; Moro, L; Milsted, A; Alves, F; Braz, G F; Vasconcelos, A C

    2010-01-26

    Canine distemper is an immunosuppressive disease caused by the canine distemper virus (CDV). Pathogenesis mainly involves the central nervous system and immunosuppression. Dogs naturally infected with CDV develop apoptotic cells in lymphoid tissues and the cerebellum, but this apoptotic mechanism is not well characterized. To better understand this process, we evaluated the expression of Bax, Bcl-2, and caspase-3, -8 and -9, by evaluating mRNA levels in the peripheral blood, lymph nodes and cerebellum of CDV-infected (CDV+) and uninfected (CDV-) dogs by real-time polymerase chain reaction (PCR). Blood samples from 12 CDV+ and 8 CDV- dogs, diagnosed by reverse transcription-PCR, were subjected to hematological analysis and apoptotic gene expression was evaluated using real-time-PCR. Tissues from the cerebellum and lymph nodes of four CDV+ and three CDV-dogs were also subjected to real time-PCR. No significant differences were found between CDV+ and CDV- dogs in the hemotological results or in the expression of caspase-3, -8, -9, Bax, and Bcl-2 in the peripheral blood. However, expression of Bax, caspase-3, -8 and -9 was significantly higher in the cerebellum of CDV+ compared to CDV- dogs. Expression of caspase-3 and -8 was significantly higher in the lymph nodes of CDV+ compared to CDV- dogs. We concluded that infection with CDV induces apoptosis in the cerebellum and lymph nodes in different ways. Lymph node apoptosis apparently occurs via caspase-3 activation, through the caspase-8 pathway, and cerebellum apoptosis apparently occurs via caspase-3 activation, through the caspase-8 and mitochondrial pathways.

  8. Development of a challenge-protective vaccine concept by modification of the viral RNA-dependent RNA polymerase of canine distemper virus.

    Science.gov (United States)

    Silin, D; Lyubomska, O; Ludlow, M; Duprex, W P; Rima, B K

    2007-12-01

    We demonstrate that insertion of the open reading frame of enhanced green fluorescent protein (EGFP) into the coding sequence for the second hinge region of the viral L (large) protein (RNA-dependent RNA polymerase) attenuates a wild-type canine distemper virus. Moreover, we show that single intranasal immunization with this recombinant virus provides significant protection against challenge with the virulent parental virus. Protection against wild-type challenge was gained either after recovery of cellular immunity postimmunization or after development of neutralizing antibodies. Insertion of EGFP seems to result in overattenuation of the virus, while our previous experiments demonstrated that the insertion of an epitope tag into a similar position did not affect L protein function. Thus, a desirable level of attenuation could be reached by manipulating the length of the insert (in the second hinge region of the L protein), providing additional tools for optimization of controlled attenuation. This strategy for controlled attenuation may be useful for a "quick response" in vaccine development against well-known and "new" viral infections and could be combined efficiently with other strategies of vaccine development and delivery systems.

  9. Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein.

    Science.gov (United States)

    Zhang, Xinsheng; Wallace, Olivia L; Domi, Arban; Wright, Kevin J; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A; Parks, Christopher L

    2015-08-01

    Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Clinical and serological response of wild dogs (Lycaon pictus to vaccination against canine distemper, canine parvovirus infection and rabies

    Directory of Open Access Journals (Sweden)

    J. Van Heerden

    2002-07-01

    Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  11. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies.

    Science.gov (United States)

    van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E

    2002-03-01

    Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.

  12. Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

    Science.gov (United States)

    Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

    2014-01-01

    Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

  13. Evaluation of synthetic infection-enhancing lipopeptides as adjuvants for a live-attenuated canine distemper virus vaccine administered intra-nasally to ferrets.

    Science.gov (United States)

    Nguyen, D Tien; Ludlow, Martin; van Amerongen, Geert; de Vries, Rory D; Yüksel, Selma; Verburgh, R Joyce; Osterhaus, Albert D M E; Duprex, W Paul; de Swart, Rik L

    2012-07-20

    Inactivated paramyxovirus vaccines have been associated with hypersensitivity responses upon challenge infection. For measles and canine distemper virus (CDV) safe and effective live-attenuated virus vaccines are available, but for human respiratory syncytial virus and human metapneumovirus development of such vaccines has proven difficult. We recently identified three synthetic bacterial lipopeptides that enhance paramyxovirus infections in vitro, and hypothesized these could be used as adjuvants to promote immune responses induced by live-attenuated paramyxovirus vaccines. Here, we tested this hypothesis using a CDV vaccination and challenge model in ferrets. Three groups of six animals were intra-nasally vaccinated with recombinant (r) CDV(5804P)L(CCEGFPC) in the presence or absence of the infection-enhancing lipopeptides Pam3CSK4 or PHCSK4. The recombinant CDV vaccine virus had previously been described to be over-attenuated in ferrets. A group of six animals was mock-vaccinated as control. Six weeks after vaccination all animals were challenged with a lethal dose of rCDV strain Snyder-Hill expressing the red fluorescent protein dTomato. Unexpectedly, intra-nasal vaccination of ferrets with rCDV(5804P)L(CCEGFPC) in the absence of lipopeptides resulted in good immune responses and protection against lethal challenge infection. However, in animals vaccinated with lipopeptide-adjuvanted virus significantly higher vaccine virus loads were detected in nasopharyngeal lavages and peripheral blood mononuclear cells. In addition, these animals developed significantly higher CDV neutralizing antibody titers compared to animals vaccinated with non-adjuvanted vaccine. This study demonstrates that the synthetic cationic lipopeptides Pam3CSK4 and PHCSK4 not only enhance paramyxovirus infection in vitro, but also in vivo. Given the observed enhancement of immunogenicity their potential as adjuvants for other live-attenuated paramyxovirus vaccines should be considered

  14. The administration of a single dose of a multivalent (DHPPiL4R) vaccine prevents clinical signs and mortality following virulent challenge with canine distemper virus, canine adenovirus or canine parvovirus

    OpenAIRE

    Stephen Wilson; Joanna Illambas; Elisabeth Siedek; Anne Thomas; Vickie King; Catrina Stirling; Edita Plevová; Jeremy Salt; Gordon Sture

    2014-01-01

    Four challenge studies following vaccination of dogs with a multivalent vaccine containing canine parvovirus (CPV-2b), adenovirus (CAV-1/-2) and distemper (CDV) are described. Six week old puppies received a single vaccination while non-vaccinated control dogs received water. In each respective trial, groups of dogs were challenged 21 days after vaccination with heterologous viral isolates. Clinical observations, rectal temperature measurements, and blood and swab samples for analysis were co...

  15. Characterization of two recent Japanese field isolates of canine distemper virus and examination of the avirulent strain utility as an attenuated vaccine.

    Science.gov (United States)

    Takenaka, Akiko; Yoneda, Misako; Seki, Takahiro; Uema, Masashi; Kooriyama, Takanori; Nishi, Toshiya; Fujita, Kentaro; Miura, Ryuichi; Tsukiyama-Kohara, Kyoko; Sato, Hiroki; Kai, Chieko

    2014-12-05

    Recently, several new strains of canine distemper virus (CDV) have been isolated in Japan. To investigate their pathogenesis in dogs, the Yanaka and Bunkyo-K strains were investigated by infecting dogs and determining clinical signs, amount of virus, and antibody responses. The Yanaka strain is avirulent and induced an antibody response. The Bunkyo-K strain induced typical CDV clinical signs in infected dogs and virulence was enhanced by brain passage. Molecular and phylogenetic analyses of H genes demonstrated the Bunkyo-K strains were of a different lineage from Asia-1 group including the Yanaka strain and Asia-2 group that contain recent Japanese isolates, which were recently identified as major prevalent strains worldwide but distinct from old vaccine strains. Based on these data, we tested the ability of the Yanaka strain for vaccination. Inoculation with the Yanaka strain efficiently induced CDV neutralizing antibodies with no clinical signs, and the protection effects against challenge with either old virulent strain or Bunkyo-K strain were equal or greater when compared with vaccination by an original vaccine strain. Thus, the Yanaka strain is a potential vaccine candidate against recent prevalent CDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Immunohistochemical detection of autophagy-related microtubule-associated protein 1 light chain 3 (LC3) in the cerebellums of dogs naturally infected with canine distemper virus.

    Science.gov (United States)

    Kabak, Y B; Sozmen, M; Yarim, M; Guvenc, T; Karayigit, M O; Gulbahar, M Y

    2015-01-01

    We investigated the expression of microtubule-associated protein 1 light chain 3 (LC3) protein in the cerebellums of dogs infected with canine distemper virus (CDV) using immunohistochemistry to detect autophagy. The cerebellums of 20 dogs infected with CDV were used. Specimens showing demyelination of white matter were considered to have an acute infection, whereas specimens showing signs of severe perivascular cuffing and demyelination of white matter were classified as having chronic CDV. Cerebellar sections were immunostained with CDV and LC3 antibodies. The cytoplasm of Purkinje cells, granular layer cells, motor neurons in large cerebellar ganglia and some neurons in white matter were positive for the LC3 antibody in both the control and CDV-infected dogs. In the infected cerebellums, however, white matter was immunostained more intensely, particularly the neurons and gemistocytic astrocytes in the demyelinated areas, compared to controls. Autophagy also was demonstrated in CDV-positive cells using double immunofluorescence staining. Our findings indicate that increased autophagy in the cerebellum of dogs naturally infected with CDV may play a role in transferring the virus from cell to cell.

  17. Exposure of Free-Ranging Wild Carnivores and Domestic Dogs to Canine Distemper Virus and Parvovirus in the Cerrado of Central Brazil.

    Science.gov (United States)

    Furtado, Mariana Malzoni; Hayashi, Erika Midori Kida; Allendorf, Susan Dora; Coelho, Claudio José; de Almeida Jácomo, Anah Tereza; Megid, Jane; Ramos Filho, José Domingues; Silveira, Leandro; Tôrres, Natália Mundim; Ferreira Neto, José Soares

    2016-09-01

    Human population growth around protected areas increases the contact between wild and domestic animals, promoting disease transmission between them. This study investigates the exposure of free-ranging wild carnivores and domestic dogs to canine distemper virus (CDV) and parvovirus in Emas National Park (ENP) in the Cerrado savanna of central Brazil. Serum samples were collected from 169 wild carnivores, including the maned wolf (Chrysocyon brachyurus), crab-eating fox (Cerdocyon thous), hoary fox (Pseudalopex vetulus), puma (Puma concolor), ocelot (Leopardus pardalis), pampas cat (Leopardus colocolo), jaguarundi (Herpailurus yagouaroundi), striped hog-nosed skunk (Conepatus semistriatus) and coati (Nasua nasua), and from 35 domestic dogs living on rural properties bordering ENP. Serological tests showed that 10.6% of wild carnivores (maned wolves, crab-eating foxes and ocelots) and 71.4% of domestic dogs were exposed to CDV, and 56.8% of wild carnivores, including all species sampled except coatis, and 57.1% of domestic dogs were exposed to parvovirus. This report is the first to indicate that the free-ranging pampas cat, jaguarundi and striped hog-nosed skunk are exposed to parvovirus. CDV and parvovirus deserve attention in ENP, and it is extremely important to monitor the health of carnivore populations and perform molecular diagnosis of the viruses to determine the possible involvement of the domestic dog in their transmission.

  18. Membrane-bound SIV envelope trimers are immunogenic in ferrets after intranasal vaccination with a replication-competent canine distemper virus vector.

    Science.gov (United States)

    Zhang, Xinsheng; Wallace, Olivia; Wright, Kevin J; Backer, Martin; Coleman, John W; Koehnke, Rebecca; Frenk, Esther; Domi, Arban; Chiuchiolo, Maria J; DeStefano, Joanne; Narpala, Sandeep; Powell, Rebecca; Morrow, Gavin; Boggiano, Cesar; Zamb, Timothy J; Richter King, C; Parks, Christopher L

    2013-11-01

    We are investigating canine distemper virus (CDV) as a vaccine vector for the delivery of HIV envelope (Env) that closely resembles the native trimeric spike. We selected CDV because it will promote vaccine delivery to lymphoid tissues, and because human exposure is infrequent, reducing potential effects of pre-existing immunity. Using SIV Env as a model, we tested a number of vector and gene insert designs. Vectors containing a gene inserted between the CDV H and L genes, which encoded Env lacking most of its cytoplasmic tail, propagated efficiently in Vero cells, expressed the immunogen on the cell surface, and incorporated the SIV glycoprotein into progeny virus particles. When ferrets were vaccinated intranasally, there were no signs of distress, vector replication was observed in the gut-associated lymphoid tissues, and the animals produced anti-SIV Env antibodies. These data show that live CDV-SIV Env vectors can safely induce anti-Env immune responses following intranasal vaccination. © 2013 Elsevier Inc. All rights reserved.

  19. Canine Distemper Virus Infection Leads to an Inhibitory Phenotype of Monocyte-Derived Dendritic Cells In Vitro with Reduced Expression of Co-Stimulatory Molecules and Increased Interleukin-10 Transcription

    Science.gov (United States)

    Herder, Vanessa; Stein, Veronika M.; Tipold, Andrea; Urhausen, Carola; Günzel-Apel, Anne-Rose; Rohn, Karl; Baumgärtner, Wolfgang; Beineke, Andreas

    2014-01-01

    Canine distemper virus (CDV) exhibits a profound lymphotropism that causes immunosuppression and increased susceptibility of affected dogs to opportunistic infections. Similar to human measles virus, CDV is supposed to inhibit terminal differentiation of dendritic cells (DCs), responsible for disturbed repopulation of lymphoid tissues and diminished antigen presenting function in dogs. In order to testify the hypothesis that CDV-infection leads to an impairment of professional antigen presenting cells, canine DCs have been generated from peripheral blood monocytes in vitro and infected with CDV. Virus infection was confirmed and quantified by transmission electron microscopy, CDV-specific immunofluorescence, and virus titration. Flow cytometric analyses revealed a significant down-regulation of the major histocompatibility complex class II and co-stimulatory molecules CD80 and CD86 in CDV-infected DCs, indicative of disturbed antigen presenting capacity. Molecular analyses revealed an increased expression of the immune inhibitory cytokine interleukin-10 in DCs following infection. Results of the present study demonstrate that CDV causes phenotypical changes and altered cytokine expression of DCs, which represent potential mechanisms to evade host immune responses and might contribute to immune dysfunction and virus persistence in canine distemper. PMID:24769532

  20. Canine distemper virus infection leads to an inhibitory phenotype of monocyte-derived dendritic cells in vitro with reduced expression of co-stimulatory molecules and increased interleukin-10 transcription.

    Directory of Open Access Journals (Sweden)

    Visar Qeska

    Full Text Available Canine distemper virus (CDV exhibits a profound lymphotropism that causes immunosuppression and increased susceptibility of affected dogs to opportunistic infections. Similar to human measles virus, CDV is supposed to inhibit terminal differentiation of dendritic cells (DCs, responsible for disturbed repopulation of lymphoid tissues and diminished antigen presenting function in dogs. In order to testify the hypothesis that CDV-infection leads to an impairment of professional antigen presenting cells, canine DCs have been generated from peripheral blood monocytes in vitro and infected with CDV. Virus infection was confirmed and quantified by transmission electron microscopy, CDV-specific immunofluorescence, and virus titration. Flow cytometric analyses revealed a significant down-regulation of the major histocompatibility complex class II and co-stimulatory molecules CD80 and CD86 in CDV-infected DCs, indicative of disturbed antigen presenting capacity. Molecular analyses revealed an increased expression of the immune inhibitory cytokine interleukin-10 in DCs following infection. Results of the present study demonstrate that CDV causes phenotypical changes and altered cytokine expression of DCs, which represent potential mechanisms to evade host immune responses and might contribute to immune dysfunction and virus persistence in canine distemper.

  1. Canine distemper virus infection leads to an inhibitory phenotype of monocyte-derived dendritic cells in vitro with reduced expression of co-stimulatory molecules and increased interleukin-10 transcription.

    Science.gov (United States)

    Qeska, Visar; Barthel, Yvonne; Herder, Vanessa; Stein, Veronika M; Tipold, Andrea; Urhausen, Carola; Günzel-Apel, Anne-Rose; Rohn, Karl; Baumgärtner, Wolfgang; Beineke, Andreas

    2014-01-01

    Canine distemper virus (CDV) exhibits a profound lymphotropism that causes immunosuppression and increased susceptibility of affected dogs to opportunistic infections. Similar to human measles virus, CDV is supposed to inhibit terminal differentiation of dendritic cells (DCs), responsible for disturbed repopulation of lymphoid tissues and diminished antigen presenting function in dogs. In order to testify the hypothesis that CDV-infection leads to an impairment of professional antigen presenting cells, canine DCs have been generated from peripheral blood monocytes in vitro and infected with CDV. Virus infection was confirmed and quantified by transmission electron microscopy, CDV-specific immunofluorescence, and virus titration. Flow cytometric analyses revealed a significant down-regulation of the major histocompatibility complex class II and co-stimulatory molecules CD80 and CD86 in CDV-infected DCs, indicative of disturbed antigen presenting capacity. Molecular analyses revealed an increased expression of the immune inhibitory cytokine interleukin-10 in DCs following infection. Results of the present study demonstrate that CDV causes phenotypical changes and altered cytokine expression of DCs, which represent potential mechanisms to evade host immune responses and might contribute to immune dysfunction and virus persistence in canine distemper.

  2. Canine Distemper in an isolated population of fishers (Martes pennanti) from California

    Science.gov (United States)

    Stefan m. Keller; Mourad Gabriel; Karen A. Terio; Edward J. Dubovi; Elizabeth Van Wormer; Rick Sweitzer; Reginald Barret; Craig Thompson; Kathryn Purcell; Linda Munson

    2012-01-01

    Four fishers (Martes pennanti) from an insular population in the southern Sierra Nevada Mountains, California, USA died as a consequence of an infection with canine distemper virus (CDV) in 2009. Three fishers were found in close temporal and spatial relationship; the fourth fisher died 4 mo later at a 70 km distance from the initial group. Gross...

  3. Uncommon acute neurologic presentation of canine distemper in 4 adult dogs.

    Science.gov (United States)

    Galán, Alba; Gamito, Araceli; Carletti, Beatrice E; Guisado, Alicia; de las Mulas, Juana Martín; Pérez, José; Martín, Eva M

    2014-04-01

    Four uncommon cases of canine distemper (CD) were diagnosed in vaccinated adult dogs. All dogs had acute onset of neurologic signs, including seizures, abnormal mentation, ataxia, and proprioceptive deficits. Polymerase chain reaction for CD virus was positive on cerebrospinal fluid in 2 cases. Due to rapid deterioration the dogs were euthanized and CD was confirmed by postmortem examination.

  4. 9 CFR 113.302 - Distemper Vaccine-Mink.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Distemper Vaccine-Mink. 113.302... Virus Vaccines § 113.302 Distemper Vaccine—Mink. Distemper Vaccine—Mink shall be prepared from virus... follows: (1) To detect virulent canine distemper virus, each of two distemper susceptible mink or ferrets...

  5. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013.

    Science.gov (United States)

    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina

    2015-09-30

    During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be

  6. Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup Infecção simultânea por vírus da cinomose e da parvovirose associada à necrose cardíaca em um canino

    OpenAIRE

    Selwyn Arlington Headley; Taís Berelli Saito

    2003-01-01

    Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...

  7. Exposure of pampas fox (Pseudalopex gymnocercus and crab-eating fox (Cerdocyon thous from the Southern region of Brazil to Canine distemper virus (CDV, Canine parvovirus (CPV and Canine coronavirus (CCoV

    Directory of Open Access Journals (Sweden)

    Silvia de Oliveira Hübner

    2010-06-01

    Full Text Available The exposure of 13 Brazilian free-ranging nondomestic canids (five pampas fox - Pseudalopex gymnocercus and eight crab-eating fox -Cerdocyon thous from Southern region of Brazil, to Canine distemper virus (CDV, canine parvovirus (CPV and Canine coronavirus (CCoV was investigated. Antibodies against CDV were detected in 38.5% (5/13 of the samples. There were anti-CDV antibodies in 60% (3/5 of P. gymnocercus and in 25% (2/8 of C. thous. The frequency was higher among the adults and males. Eleven canids (84.6% presented antibodies against CPV, 80% (4/5 were from P. gymnocercus and 87.5% (7/8 were from C. thous. There was no difference in positivity rate against CPV between gender and age. Antibodies against CCoV were detected in 38.5% (5/13 of the samples, with 60% (3/5 of positivity in P. gymnocercus and 25% (2/8 in C. thous. The frequency of antibodies against CCoV was higher among the adults and males. The study showed that these canids were exposed to CDV, CPV and CCoV.Foi investigada a ocorrência de exposição em 13 canídeos não domésticos de vida livre (cinco graxains-do-campo - Pseudalopex gymnocercus e oito graxains-do-mato - Cerdocyon thous da região sul do Brasil ao vírus da cinomose canina (CDV, parvovírus canino (CPV e coronavírus canino (CCoV. Anticorpos contra o CDV foram detectados em 38,5% (5/13 das amostras. Haviam anticorpos anti-CDV em 60% (3/5 dos P. gymnocercus e em 25% (2/8 dos C. thous. A freqüência foi maior entre machos e adultos. Para CPV, 11 canídeos (84,6% apresentaram anticorpos, 80% (4/5 eram da espécie P. gymnocercus e 87,5% (7/8 eram C. thous. Não houve diferença de positividade para o CPV entre sexos e idades. Anticorpos contra o CCoV foram detectados em 38,5% (5/13 das amostras, sendo 60% (3/5 de positividade entre os P. gymnocercus e 25% (2/8 entre os C. thous. A freqüência de anticorpos para CCoV foi maior entre os machos e adultos. O estudo revelou que estes canídeos foram expostos ao CDV, CPV

  8. Canine Distemper Virus Antigen Detection in External Epithelia of Recently Vaccinated, Sick Dogs by Fluorescence Microscopy Is a Valuable Prognostic Indicator

    Science.gov (United States)

    Neel, Tina

    2014-01-01

    Currently, there are no reliable predictors of the clinical outcomes of domesticated dogs that have been recently vaccinated against canine distemper virus (CDV) and develop respiratory disease. In this study, vaccinated dogs from Oklahoma City that were showing clinical signs of respiratory disease were evaluated for CDV antigen using a direct fluorescent antibody test (FAT). Clinical outcomes after standard symptomatic therapy for respiratory disease were recorded, and a statistical analysis of the results was performed. We present our study showing that CDV FAT results were predictive of clinical recovery (prognostic indicator, prospects of clinical recovery) among vaccinated dogs showing clinical signs of respiratory disease. Negative CDV FAT results equated to 80% chances of recovery after symptomatic therapy, compared to 55% chances of recovery when the CDV FAT results were positive. Based on the results of this study, we show that veterinarians can make better informed decisions about the clinical outcomes of suspected CDV cases, with 2-h turnaround times, by using the CDV FAT. Thus, antemortem examination with the CDV FAT on external epithelia of recently vaccinated, sick dogs is a clinically useful diagnostic test and valuable prognostic indicator for veterinarians. Application of the CDV FAT to these samples avoids unnecessary euthanasia of dogs with suspected CDV. PMID:25428156

  9. Deduced sequences of the membrane fusion and attachment proteins of canine distemper viruses isolated from dogs and wild animals in Korea.

    Science.gov (United States)

    Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo

    2013-08-01

    Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.

  10. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Directory of Open Access Journals (Sweden)

    Nicolás Sarute

    Full Text Available Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  11. Possible lin between elevated accumulation of trace elements and canine distemper virus infection in the Caspian seals (Phoca caspica) stranded in 2000 and 2001

    Science.gov (United States)

    Shinsuke, T.; Takashi, K.; Yasumi, A.; Tokutaka, I.; Reiji, K.

    2003-05-01

    In the Caspian Sea, a die-off of thousands of Caspian seals (Phoca caspica) occurred in 1997 and 2000. While a direct cause for these deaths seems to be canine distemper virus (CDV) infection, immunosuppression due to environmental pollutants is considered as one of the possible explanations for the development of the disease. The purpose of this work is to examine whether exposure to trace metals could be one of the factors involved in the mass mortality of Caspian seals. Concentrations of 13 trace elements weredetermined in liver, kidney and muscle of Caspian seals found stranded along the coasts of the Caspian Sea in 2000 and 2001. Concentrations of toxic elemen ts (Ag, Cd, Hg, Tl and Pb) in the Caspian seals collected in 2000 and 2001 were comparable to or lower than those in healthy Caspian seals collected in 1993 and 1998 and in seals from other regions, suggesting that these elements would not be the causative agent for the death of Caspian seals. In contrast, Zn and Fe concentrations in the stranded Caspian seals were apparently higher than those in seals from other locations. These results suggest the disturbance in homeostatic control and nutritional statu s of essential elements in the stranded Caspian seals.

  12. Canine distemper virus antigen detection in external epithelia of recently vaccinated, sick dogs by fluorescence microscopy is a valuable prognostic indicator.

    Science.gov (United States)

    Kapil, Sanjay; Neel, Tina

    2015-02-01

    Currently, there are no reliable predictors of the clinical outcomes of domesticated dogs that have been recently vaccinated against canine distemper virus (CDV) and develop respiratory disease. In this study, vaccinated dogs from Oklahoma City that were showing clinical signs of respiratory disease were evaluated for CDV antigen using a direct fluorescent antibody test (FAT). Clinical outcomes after standard symptomatic therapy for respiratory disease were recorded, and a statistical analysis of the results was performed. We present our study showing that CDV FAT results were predictive of clinical recovery (prognostic indicator, prospects of clinical recovery) among vaccinated dogs showing clinical signs of respiratory disease. Negative CDV FAT results equated to 80% chances of recovery after symptomatic therapy, compared to 55% chances of recovery when the CDV FAT results were positive. Based on the results of this study, we show that veterinarians can make better informed decisions about the clinical outcomes of suspected CDV cases, with 2-h turnaround times, by using the CDV FAT. Thus, antemortem examination with the CDV FAT on external epithelia of recently vaccinated, sick dogs is a clinically useful diagnostic test and valuable prognostic indicator for veterinarians. Application of the CDV FAT to these samples avoids unnecessary euthanasia of dogs with suspected CDV. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Infection with a Hepatozoon sp. closely related to Hepatozoon felis in a wild Pampas gray fox (Lycalopex -Pseudalopex -gymnocercus) co-infected with canine distemper virus.

    Science.gov (United States)

    Giannitti, Federico; Diab, Santiago S; Uzal, Francisco A; Fresneda, Karina; Rossi, Daniel; Talmi-Frank, Dalit; Baneth, Gad

    2012-05-25

    A species of Hepatozoon closely related to Hepatozoon felis found in the skeletal and cardiac muscle of a wild Pampas gray fox (Lycalopex gymnocercus) is described. The fox was euthanized after showing severe incoordination. On necropsy and histopathology there was bilateral, diffuse, severe, sub-acute, necrotizing bronchointerstitial pneumonia, with intracytoplasmic and intranuclear eosinophilic inclusion bodies. Canine distemper virus was detected by immunohistochemistry in the bronchiolar epithelium, syncytial cells, alveolar macrophages and pneumocytes. The skeletal muscle and myocardium contained multiple round to oval protozoan cysts ranging from 64 μm × 75 μm to 98 μm × 122 μm, with a central eosinophilic meront-like core surrounded by concentric rings of mucinous material resembling Hepatozoon americanum cysts but smaller in size. Macrophages within rare pyogranulomas and monocytes/macrophages in adjacent sinusoidal blood vessels in the skeletal muscle contained intracytoplasmic round protozoa consistent with merozoites or developing gamonts of Hepatozoon. Hepatozoon sp. infection was confirmed by PCR of skeletal muscle and the sequenced 18S rRNA PCR product was found to be 99% identical to H. felis by BLAST analysis and deposited in GenBank as accession number HQ020489. It clustered together in the phylogenetic analysis with published H. felis sequences and separately from H. canis, H. americanum and other Hepatozoon species. However, the close relatedness of the fox Hepatozoon to H. felis does not rule out infection with a different and possibly unknown Hepatozoon species. Published by Elsevier B.V.

  14. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Science.gov (United States)

    Sarute, Nicolás; Calderón, Marina Gallo; Pérez, Ruben; La Torre, José; Hernández, Martín; Francia, Lourdes; Panzera, Yanina

    2013-01-01

    Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus) is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H) gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp) coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  15. Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from breeding foxes, raccoon dogs and minks in China.

    Science.gov (United States)

    Zhao, Jian-Jun; Yan, Xi-Jun; Chai, Xiu-Li; Martella, Vito; Luo, Guo-Liang; Zhang, Hai-Ling; Gao, Han; Liu, Ying-Xue; Bai, Xue; Zhang, Lei; Chen, Tao; Xu, Lei; Zhao, Chun-Fei; Wang, Feng-Xue; Shao, Xi-Qun; Wu, Wei; Cheng, Shi-Peng

    2010-01-06

    Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. Genetic/antigenic heterogeneity has been observed among the various CDV strains, notably in the haemagglutinin (H) gene, that appears as a good target to gather epidemiological information. Based on sequence analysis of the H gene, wild-type CDV strains cluster into distinct geographic lineages (genotypes), irrespective of the species of isolation. The sequence of the H gene of 28 CDV strains detected from both vaccinated and non-vaccinated breeding foxes, raccoon dogs and minks from different geographical areas of China during the years 2004-2008 was determined. All the CDV strains but two (strains HL and HLJ2) were characterized as Asia-1 genotype and were highly similar to each other (96.2-99.7% at the amino acid [aa] level) and to other Asia-1 strains (96.1-99.5% aa) previously detected in China. The CDV strains HL and HLJ2 were both collected from foxes in Heilongjiang province in 2005. Strain HL resembled CDVs of the Arctic genotype (GR88-like) and displayed high aa identity (98.0%) to the Chinese canine strain Liu. By converse, strain HLJ2 was barely related to CDVs of the Asia-2 genotype (88.7-90.3% aa identity), and could represent a novel CDV genotype, tentatively proposed as Asia-3. These results suggest that at least three different CDV genotypes, distantly related (81.8-91.6% aa identity) to the vaccine strains, Onderstepoort-like (America-1 genotype), are currently circulating in breeding foxes, raccoon dogs and minks in China, and that the genotype Asia-1 is predominant. Whether the diversity between wild-type CDVs and the vaccine strains may affect, to some extent, the efficacy of the vaccines deserves further investigations.

  16. Clinical and serological response of wild dogs (Lycaon pictus) to vaccination against canine distemper, canine parvovirus infection and rabies

    OpenAIRE

    J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides

    2002-01-01

    Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...

  17. CANINE DISTEMPER IN A VACCINATED SNOW LEOPARD ( PANTHERA UNCIA).

    Science.gov (United States)

    Chinnadurai, Sathya K; Kinsel, Michael J; Adkesson, Michael J; Terio, Karen

    2017-12-01

    A 6-yr-old male snow leopard ( Panthera uncia) presented with acute seizures, hyperthermia, and tachypnea. Because of a diagnosis of anuric renal failure, the animal was euthanized. On histopathologic examination, numerous intralesional intracytoplasmic and intranuclear inclusions were found in the lungs, lymph nodes, and stomach. Positive immunohistochemical staining for canine distemper virus (CDV) was found in the lungs and, to a lesser extent, in the lymph nodes and brain. Molecular testing yielded a CDV H gene sequence that was closely related to CDV isolates concurrently found in wild raccoons from adjacent forested areas. The leopard had been vaccinated once against CDV with the use of a recombinant canarypox-vectored live vaccine during a routine wellness examination 12 wk prior to death. Serial serum neutralization titers performed on banked serum collected between vaccination and death showed poor serologic response to the vaccine. This case demonstrates a probable failure of protection against naturally occurring CDV.

  18. The recombinant EHV-1 vector producing CDV hemagglutinin as potential vaccine against canine distemper.

    Science.gov (United States)

    Pan, Zihao; Liu, Jin; Ma, Jiale; Jin, Qiuli; Yao, Huochun; Osterrieder, Nikolaus

    2017-10-01

    Canine distemper virus (CDV), is a pantropic agent of morbillivirus that causes fetal disease in dogs. Base on a broad host rang of CDV, the continued vaccines inoculation is unavoidable to pose gene recombination risk in vaccine virus and wild virus. The current study presents the construction of novel vectors, using equine herpesvirus type 1 (EHV-1) expressing the canine distemper virus (CDV). The recent field strain hemagglutinin protein and nucleoprotein were used for the construction of the viral vector vaccines. Based on the Bacterial artificial chromosome (BAC) genomes of EHV-1 RacH strain, the recombinant EHV-1 vaccine virus encoding CDV hemagglutinin protein (EHV-H) or CDV nucleoprotein (EHV-N) was constructed separately. The constructed BACs were rescued after 72 h post infection, and the expression of H or N in the recombinant viruses was confirmed by western-blotting. Furthermore, high levels of neutralizing antibodies were induced persistently following vaccination in the groups EHV-H&EHV-N and EHV-H, but the EHV-N group. The groups of vaccinated EHV-H and EHV-H&EHV-N pups were monitored for clinical signs, whereas the vaccinated EHV-N group developed moderate symptoms. The present study demonstrated that EHV-1 based recombinant virus carrying CDV H could be a promising vaccine candidate against canine distemper. Copyright © 2017. Published by Elsevier Ltd.

  19. Canine distemper virus isolated from a monkey efficiently replicates on Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor.

    Science.gov (United States)

    Feng, Na; Liu, Yuxiu; Wang, Jianzhong; Xu, Weiwei; Li, Tiansong; Wang, Tiecheng; Wang, Lei; Yu, Yicong; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Gao, Yuwei; Hu, Guixue; Xia, Xianzhu

    2016-08-02

    In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains. The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (10(5.2±0.2) TCID50/ml) and monkey-origin SLAM (10(5.4±0.1) TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (10(3.3±0.3) TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period. Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.

  20. Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs.

    Science.gov (United States)

    Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki

    2012-08-01

    Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  1. The Asia 2 specific signal peptide region and other domains in fusion protein genes characterized Asia 1 and Asia 2 canine distemper viruses

    Science.gov (United States)

    Sultan, Serageldeen; Charoenvisal, Nataya; Lan, Nguyen Thi; Yamaguchi, Ryoji; Maeda, Ken; Kai, Kazushige

    2009-01-01

    Background Although the presence of Asia 2 group of canine distemper virus (CDV) was known by the sequencing and phylogenetic analysis of hemagglutinin (H) gene, the fusion (F) protein gene sequence of Asia 2 group had not been identified. So, the sequence analysis of F gene was carried out to elucidate the genotypic varaitons among Asian isolates. Results The phylogenetic analysis of F and H gene sequences from fourteen CDV isolates obtained from diseased dogs in Japan and Thailand indicated that the F genes had a new initiation codon and extra 27 nucleotides upstream of the usual open reading frame (ORF) and the F proteins had extra 9 amino acids at the N-terminal position only in Asia 2 isolates. On the contrary, the Asia 1 isolates had three extra putative N-glycosylation sites (two sites in the signal peptide region and one site in the F1 region) except for two strains of Th12 and Ac96I (two sites in signal peptide region) adding to four putative N-glycosylation sites that were conserved among all Asian isolates and Onderstepoort strain. In addition to this difference in N-glycosylation sites, the signal peptide region had a great diversity between Asia 1 and Asia 2 isolates. Also, characteristic amino acids were detected for some strains. Conclusion Asia 2 isolates were distinguished from other CDV lineages by the extra 27 nucleotide sequence. The signal peptide region of F gene gives a remarkable differentiation between Asia 1 and Asia 2 isolates. Strains Th12 and Ac96I were differentiated from other Asia 1 strains by the F protein glycosylation sites. PMID:19807927

  2. The canine MHC class Ia allele DLA-88*508:01 presents diverse self- and canine distemper virus-origin peptides of varying length that have a conserved binding motif.

    Science.gov (United States)

    Ross, Peter; Nemec, Paige S; Kapatos, Alexander; Miller, Keith R; Holmes, Jennifer C; Suter, Steven E; Buntzman, Adam S; Soderblom, Erik J; Collins, Edward J; Hess, Paul R

    2018-03-01

    Ideally, CD8+ T-cell responses against virally infected or malignant cells are defined at the level of the specific peptide and restricting MHC class I element, a determination not yet made in the dog. To advance the discovery of canine CTL epitopes, we sought to determine whether a putative classical MHC class Ia gene, Dog Leukocyte Antigen (DLA)-88, presents peptides from a viral pathogen, canine distemper virus (CDV). To investigate this possibility, DLA-88*508:01, an allele prevalent in Golden Retrievers, was expressed as a FLAG-tagged construct in canine histiocytic cells to allow affinity purification of peptide-DLA-88 complexes and subsequent elution of bound peptides. Pattern analysis of self peptide sequences, which were determined by liquid chromatography-tandem mass spectrometry (LC-MS/MS), permitted binding preferences to be inferred. DLA-88*508:01 binds peptides that are 9-to-12 amino acids in length, with a modest preference for 9- and 11-mers. Hydrophobic residues are favored at positions 2 and 3, as are K, R or F residues at the C-terminus. Testing motif-matched and -unmatched synthetic peptides via peptide-MHC surface stabilization assay using a DLA-88*508:01-transfected, TAP-deficient RMA-S line supported these conclusions. With CDV infection, 22 viral peptides ranging from 9-to-12 residues in length were identified in DLA-88*508:01 eluates by LC-MS/MS. Combined motif analysis and surface stabilization assay data suggested that 11 of these 22 peptides, derived from CDV hemagglutinin, large polymerase, matrix, nucleocapsid, and V proteins, were processed and presented, and thus, potential targets of anti-viral CTL in DLA-88*508:01-bearing dogs. The presentation of diverse self and viral peptides indicates that DLA-88 is a classical MHC class Ia gene. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

    Science.gov (United States)

    Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

    2016-01-01

    Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

  4. Distemper virus encephalitis exerts detrimental effects on hippocampal neurogenesis.

    Science.gov (United States)

    von Rüden, E-L; Avemary, J; Zellinger, C; Algermissen, D; Bock, P; Beineke, A; Baumgärtner, W; Stein, V M; Tipold, A; Potschka, H

    2012-08-01

    Despite knowledge about the impact of brain inflammation on hippocampal neurogenesis, data on the influence of virus encephalitis on dentate granule cell neurogenesis are so far limited. Canine distemper is considered an interesting model of virus encephalitis, which can be associated with a chronic progressing disease course and can cause symptomatic seizures. To determine the impact of canine distemper virus (CDV) infection on hippocampal neurogenesis, we compared post-mortem tissue from dogs with infection with and without seizures, from epileptic dogs with non-viral aetiology and from dogs without central nervous system diseases. The majority of animals with infection and with epilepsy of non-viral aetiology exhibited neuronal progenitor numbers below the age average in controls. Virus infection with and without seizures significantly decreased the mean number of neuronal progenitor cells by 43% and 76% as compared to age-matched controls. Ki-67 labelling demonstrated that hippocampal cell proliferation was neither affected by infection nor by epilepsy of non-viral aetiology. Analysis of CDV infection in cells expressing caspase-3, doublecortin or Ki-67 indicated that infection of neuronal progenitor cells is extremely rare and suggests that infection might damage non-differentiated progenitor cells, hamper neuronal differentiation and promote glial differentiation. A high inter-individual variance in the number of lectin-reactive microglial cells was evident in dogs with distemper infection. Statistical analyses did not reveal a correlation between the number of lectin-reactive microglia cells and neuronal progenitor cells. Our data demonstrate that virus encephalitis with and without seizures can exert detrimental effects on hippocampal neurogenesis, which might contribute to long-term consequences of the disease. The lack of a significant impact of distemper virus on Ki-67-labelled cells indicates that the infection affected neuronal differentiation and

  5. Distemper virus as a cause of central nervous disease and death in badgers (Meles meles) in Denmark

    DEFF Research Database (Denmark)

    Hammer, Anne Sofie; Dietz, H. H.; Andersen, T. H.

    2004-01-01

    During the summer of 2002 a distemper-like disease was observed in the free-ranging badger population in Denmark. It was characterised by grand seizures, abnormal behaviour and death; the badgers all had severe chronic pneumonia and some had non-suppurative encephalomyelitis. in this study, eight...... of the affected badgers were examined by gross pathological, histological, immunohistological, bacteriological, parasitological and virological methods, and were diagnosed with distemper; canine distemper virus was identified....

  6. Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

    Science.gov (United States)

    Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

    2015-07-01

    We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.

  7. Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper

    Czech Academy of Sciences Publication Activity Database

    Albrechtová, K.; Sedlák, K.; Petrželková, Klára Judita; Hlaváč, J.; Mihalca, A. D.; Lesingirian, A.; Kanyari, P. W. N.; Modrý, David

    2011-01-01

    Roč. 182, 2-4 (2011), s. 230-238 ISSN 0304-4017 Institutional research plan: CEZ:AV0Z60930519; CEZ:AV0Z60220518 Keywords : Canine distemper virus * Acanthocheilonema dracunculoides * Samburu dogs * Immunosupression Subject RIV: EG - Zoology Impact factor: 2.579, year: 2011

  8. New aspects of the pathogenesis of canine distemper leukoencephalitis.

    Science.gov (United States)

    Lempp, Charlotte; Spitzbarth, Ingo; Puff, Christina; Cana, Armend; Kegler, Kristel; Techangamsuwan, Somporn; Baumgärtner, Wolfgang; Seehusen, Frauke

    2014-07-02

    Canine distemper virus (CDV) is a member of the genus morbillivirus, which is known to cause a variety of disorders in dogs including demyelinating leukoencephalitis (CDV-DL). In recent years, substantial progress in understanding the pathogenetic mechanisms of CDV-DL has been made. In vivo and in vitro investigations provided new insights into its pathogenesis with special emphasis on axon-myelin-glia interaction, potential endogenous mechanisms of regeneration, and astroglial plasticity. CDV-DL is characterized by lesions with a variable degree of demyelination and mononuclear inflammation accompanied by a dysregulated orchestration of cytokines as well as matrix metalloproteinases and their inhibitors. Despite decades of research, several new aspects of the neuropathogenesis of CDV-DL have been described only recently. Early axonal damage seems to represent an initial and progressive lesion in CDV-DL, which interestingly precedes demyelination. Axonopathy may, thus, function as a potential trigger for subsequent disturbed axon-myelin-glia interactions. In particular, the detection of early axonal damage suggests that demyelination is at least in part a secondary event in CDV-DL, thus challenging the dogma of CDV as a purely primary demyelinating disease. Another unexpected finding refers to the appearance of p75 neurotrophin (NTR)-positive bipolar cells during CDV-DL. As p75NTR is a prototype marker for immature Schwann cells, this finding suggests that Schwann cell remyelination might represent a so far underestimated endogenous mechanism of regeneration, though this hypothesis still remains to be proven. Although it is well known that astrocytes represent the major target of CDV infection in CDV-DL, the detection of infected vimentin-positive astrocytes in chronic lesions indicates a crucial role of this cell population in nervous distemper. While glial fibrillary acidic protein represents the characteristic intermediate filament of mature astrocytes

  9. New Aspects of the Pathogenesis of Canine Distemper Leukoencephalitis

    Science.gov (United States)

    Lempp, Charlotte; Spitzbarth, Ingo; Puff, Christina; Cana, Armend; Kegler, Kristel; Techangamsuwan, Somporn; Baumgärtner, Wolfgang; Seehusen, Frauke

    2014-01-01

    Canine distemper virus (CDV) is a member of the genus morbillivirus, which is known to cause a variety of disorders in dogs including demyelinating leukoencephalitis (CDV-DL). In recent years, substantial progress in understanding the pathogenetic mechanisms of CDV-DL has been made. In vivo and in vitro investigations provided new insights into its pathogenesis with special emphasis on axon-myelin-glia interaction, potential endogenous mechanisms of regeneration, and astroglial plasticity. CDV-DL is characterized by lesions with a variable degree of demyelination and mononuclear inflammation accompanied by a dysregulated orchestration of cytokines as well as matrix metalloproteinases and their inhibitors. Despite decades of research, several new aspects of the neuropathogenesis of CDV-DL have been described only recently. Early axonal damage seems to represent an initial and progressive lesion in CDV-DL, which interestingly precedes demyelination. Axonopathy may, thus, function as a potential trigger for subsequent disturbed axon-myelin-glia interactions. In particular, the detection of early axonal damage suggests that demyelination is at least in part a secondary event in CDV-DL, thus challenging the dogma of CDV as a purely primary demyelinating disease. Another unexpected finding refers to the appearance of p75 neurotrophin (NTR)-positive bipolar cells during CDV-DL. As p75NTR is a prototype marker for immature Schwann cells, this finding suggests that Schwann cell remyelination might represent a so far underestimated endogenous mechanism of regeneration, though this hypothesis still remains to be proven. Although it is well known that astrocytes represent the major target of CDV infection in CDV-DL, the detection of infected vimentin-positive astrocytes in chronic lesions indicates a crucial role of this cell population in nervous distemper. While glial fibrillary acidic protein represents the characteristic intermediate filament of mature astrocytes

  10. Development of a combined canine distemper virus specific RT-PCR protocol for the differentiation of infected and vaccinated animals (DIVA) and genetic characterization of the hemagglutinin gene of seven Chinese strains demonstrated in dogs.

    Science.gov (United States)

    Yi, Li; Cheng, Shipeng; Xu, Hongli; Wang, Jianke; Cheng, Yuening; Yang, Shen; Luo, Bin

    2012-01-01

    A combined reverse-transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of the canine distemper virus (CDV). A pair of primers (P1/P2) was used to detect both CDV wild-type strains and vaccines. Another pair (P3/P4) was used to detect only CDV wild-type strains. A 335bp fragment was amplified from the genomic RNA of the vaccine and wild-type strains. A 555bp fragment was amplified specifically from the genomic RNA of the wild-type strains. No amplification was achieved for the uninfected cells, cells infected with canine parvovirus, canine coronavirus, or canine adenovirus. The combined RT-PCR method detected effectively and differentiated the CDV wild-type and vaccine strains by two separate RT-PCRs. The method can be used for clinical detection and epidemiological surveillance. The phylogenetic analysis of the hemagglutinin gene of the local wild-type CDV strains revealed that the seven local isolates all belonged to the Asia-1 lineage, and were clustered closely with one another at the same location. These results suggested that the CDV genotype Asia-1 is circulating currently in domestic dogs in China. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Canine distemper in Siberian tiger cubs from Zagreb ZOO: case report

    Directory of Open Access Journals (Sweden)

    Dean Konjević

    2011-01-01

    Full Text Available Canine distemper is a contagious, potentially lethal disease of mainly domestic and wild canids, but also of many other mammalian species including large felids. In February 2004, two Siberian tiger (Panthera tigris altaica cubs at the age of six months died at the Zagreb ZOO. The animals were presented for necropsy with two days history of severe digestive disorders, characterized mainly by haemathemesis. Dissections revealed catarrhal to pseudomembranous gastroenteritis (depending on the animal accompanied with haemorrhagic oedema of the lungs. Necrotic tonsillitis and disseminated depletion of the lymphocytes were the most prominent histological findings in both examined animals, while intranuclear and intracytoplasmatic inclusion bodies were found in the samples of the tongues and intestines. Representative portions of the livers, intestines, tonsils and lymph nodes were submitted for bacteriological and mycological analysis. The presence of Clostridium spp., Campylobacter coli and Escherichia coli was detected in gut samples, coli-like bacteria were found in samples of liver, tonsils and lymph nodes, while Candida sp. was found in the gut and pharynx samples. Toxicological analysis excluded anticoagulant and organophosphorous intoxication as the cause of death. Immunohistochemical analysis was positive for canine distemper virus. Based on all this, epizootiological, clinical and additional findings, canine distemper was recognized as the cause of the observed condition in these animals.

  12. Controversial results of therapy with mesenchymal stem cells in the acute phase of canine distemper disease.

    Science.gov (United States)

    Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E

    2016-05-23

    Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms.

  13. Canine distemper outbreak in pet store puppies linked to a high-volume dog breeder.

    Science.gov (United States)

    Schumaker, Brant A; Miller, Myrna M; Grosdidier, Paul; Cavender, Jacqueline L; Montgomery, Donald L; Cornish, Todd E; Farr, Robert M; Driscoll, Michael; Maness, Lori J; Gray, Tangney; Petersen, Dana; Brown, William L; Logan, Jim; O'Toole, Donal

    2012-11-01

    Canine distemper is uncommon in the pet trade in the United States, in large part due to effective vaccines against Canine distemper virus (CDV). This is a report of CDV affecting 24 young dogs of multiple breeds shortly after sale by 2 pet stores in Wyoming during August-October 2010. Cases were diagnosed over 37 days. Diagnosis was established by a combination of fluorescent antibody staining, reverse transcription polymerase chain reaction, negative stain electron microscopy, and necropsy with histopathology. Viral hemagglutinin gene sequences were analyzed from 2 affected dogs and were identical (GenBank accession no. JF283477). Sequences were distinct from those in a contemporaneous unrelated case of CDV in a Wyoming dog (JF283476) that had no contact with the pet store dogs. The breeding property from which the puppies originated was quarantined by the Kansas Animal Health Department. Puppies intended for sale were tested for CDV. Canine distemper was diagnosed on site in November 2010. At that point 1,466 dogs were euthanized to eliminate dispersal of the disease through commercial channels. The investigation underscores the risks inherent in large-scale dog breeding when vaccination and biosecurity practices are suboptimal.

  14. Concomitant canine distemper, infectious canine hepatitis, canine parvoviral enteritis, canine infectious tracheobronchitis, and toxoplasmosis in a puppy.

    Science.gov (United States)

    Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes

    2013-01-01

    The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.

  15. Prevalence of positive antibody test results for canine parvovirus (CPV) and canine distemper virus (CDV) and response to modified live vaccination against CPV and CDV in dogs entering animal shelters.

    Science.gov (United States)

    Litster, Annette; Nichols, Jamieson; Volpe, Allison

    2012-05-25

    Canine parvovirus (CPV) and canine distemper virus (CDV) infections are relatively common in animal shelters and are important population management issues since the immune status of incoming dogs is usually unknown. This study aimed to determine the prevalence of positive antibody test results for CPV and CDV in incoming dogs aged ≥ 4 months and to measure antibody response over 2 weeks following vaccination with a modified live vaccine (MLV). Dogs aged 4-24 months entering an adoption-guarantee shelter (Shelter 1, n=51) and aged ≥ 4 months entering a limited admission shelter (Shelter 2; n=51) were enrolled. Dogs from Shelter 1 had been vaccinated with MLV at a municipal shelter 5 days before enrollment, whereas dogs from Shelter 2 had no known history of vaccination at enrollment. Sera were obtained on day 1, immediately prior to CPV/CDV MLV, and tested using an in-clinic ELISA kit to detect CPV/CDV antibodies. Dogs negative for CPV and/or CDV were retested at day 6-8 and those dogs still negative at day 6-8 were retested at day 13-15. Prior to CPV/CDV MLV on day 1, more dogs tested positive for CPV (Shelter 1 - 68.6%; Shelter 2 - 84.3%) than for CDV (Shelter 1 - 37.3%; Shelter 2 - 41.2%). On day 1, prior to MLV, all spayed/neutered animals tested CPV antibody-positive (n=17/102) and CPV antibody-positive dogs were older than serologically negative dogs (Shelter 1, P=0.0029; Shelter 2, P=0.0042). By day 13-15, almost all dogs were CPV antibody-positive (Shelter 1 - 97.9%; Shelter 2 - 100.0%) and CDV antibody-positive (Shelter 1 - 93.8%; Shelter 2 - 97.8%). MLV induces protective antibody titers against CPV/CDV in almost all dogs after 13-15 days. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Rabies, canine distemper, and canine parvovirus exposure in large carnivore communities from two Zambian ecosystems.

    Science.gov (United States)

    Berentsen, Are R; Dunbar, Mike R; Becker, Matthew S; M'soka, Jassiel; Droge, Egil; Sakuya, Nicholas M; Matandiko, Wigganson; McRobb, Rachel; Hanlon, Cathleen A

    2013-09-01

    Disease transmission within and among wild and domestic carnivores can have significant impacts on populations, particularly for threatened and endangered species. We used serology to evaluate potential exposure to rabies virus, canine distemper virus (CDV), and canine parvovirus (CPV) for populations of African lions (Panthera leo), African wild dogs (Lycaon pictus), and spotted hyenas (Crocuta crocuta) in Zambia's South Luangwa National Park (SLNP) and Liuwa Plain National Park (LPNP) as well as community lands bordering these areas. In addition, domestic dogs in the study region were evaluated for exposure to CDV and rabies. We provide the first comprehensive disease exposure data for these species in these ecosystems. Twenty-one lions, 20 hyenas, 13 wild dogs, and 38 domestic dogs were sampled across both regions from 2009 to 2011. Laboratory results show 10.5% of domestic dogs, 5.0% of hyenas, and 7.7% of wild dogs sampled were positive for CDV exposure. All lions were negative. Exposure to CPV was 10.0% and 4.8% for hyenas and lions, respectively. All wild dogs were negative, and domestic dogs were not tested due to insufficient serum samples. All species sampled were negative for rabies virus neutralizing antibodies except lions. Forty percent of lions tested positive for rabies virus neutralizing antibodies. Because these lions appeared clinically healthy, this finding is consistent with seroconversion following exposure to rabies antigen. To our knowledge, this finding represents the first ever documentation of rabies virus neutralizing antibodies consistent with rabies exposure that did not lead to clinical disease in free-ranging African lions from this region. With ever-increasing human pressure on these ecosystems, understanding disease transmission dynamics is essential for proper management and conservation of these carnivore species.

  17. Virus isolation and molecular characterization of canine distemper virus by RT-PCR from a mature dog with multifocal encephalomyelit Isolamento e caracterização molecular do vírus da cinomose canina por RT-PCR a partir de um cão adulto com encefalomielite multifocal

    Directory of Open Access Journals (Sweden)

    Alexandre Mendes Amude

    2007-06-01

    Full Text Available A case of multifocal distemper encephalomyelitis in a mature dog is described. In the presented case the ante mortem clinical diagnosis of canine distemper virus (CDV infection could not be ideally performed due to the absence of typical signs of distemper, such as myoclonus and systemic signs accompanying the nervous signs. The definitive diagnosis of distemper encephalomyelitis was only carried out at post mortem through virus isolation in cell culture from fresh central nervous system (CNS fragments and CDV nucleoprotein gene detection in the CNS by RT-PCR.Descreve-se um caso de encefalomielite multifocal pela cinomose em um cão adulto. No caso apresentado o diagnóstico clínico da infecção pelo vírus da cinomose canina (CDV não pode ser adequadamente realizado devido à ausência de sinais típicos da enfermidade, tais como mioclonia e sinais sistêmicos. O diagnóstico definitivo somente foi possível post mortem pelo isolamento do CDV em cultivo celular a partir dos fragmentos frescos do sistema nervoso central (SNC e pela detecção do gene da nucleoproteína do CDV em fragmentos do SNC por meio da RT-PCR.

  18. Cross-species transmission of canine distemper virus—an update

    Directory of Open Access Journals (Sweden)

    Andreas Beineke

    2015-12-01

    Full Text Available Canine distemper virus (CDV is a pantropic morbillivirus with a worldwide distribution, which causes fatal disease in dogs. Affected animals develop dyspnea, diarrhea, neurological signs and profound immunosuppression. Systemic CDV infection, resembling distemper in domestic dogs, can be found also in wild canids (e.g. wolves, foxes, procyonids (e.g. raccoons, kinkajous, ailurids (e.g. red pandas, ursids (e.g. black bears, giant pandas, mustelids (e.g. ferrets, minks, viverrids (e.g. civets, genets, hyaenids (e.g. spotted hyenas, and large felids (e.g. lions, tigers. Furthermore, besides infection with the closely related phocine distemper virus, seals can become infected by CDV. In some CDV outbreaks including the mass mortalities among Baikal and Caspian seals and large felids in the Serengeti Park, terrestrial carnivores including dogs and wolves have been suspected as vectors for the infectious agent. In addition, lethal infections have been described in non-carnivore species such as peccaries and non-human primates demonstrating the remarkable ability of the pathogen to cross species barriers. Mutations affecting the CDV H protein required for virus attachment to host-cell receptors are associated with virulence and disease emergence in novel host species. The broad and expanding host range of CDV and its maintenance within wildlife reservoir hosts considerably hampers disease eradication.

  19. Níveis de anticorpos contra o vírus da cinomose canina e o parvovírus canino em cães não vacinados e vacinados Antibodies levels against canine distemper virus and canine parvovirus in vaccinated and unvaccinated dogs

    Directory of Open Access Journals (Sweden)

    R. Hass

    2008-02-01

    Full Text Available Antibody titres to canine distemper virus (CDV and canine parvovirus (CPV were measured in 132 dogs: 80 had been vaccinated at least once, 22 had not been vaccinated, and 30 had unknown vaccination history. Serum antibody titers were measured by means of serum neutralization (CDV or hemagglutination inhibition (CPV. Serum CDV titers >20 and serum CPV titers >80 were considered protective. Protective antibodies to CDV were present in 40.1% of the population: 39.8% of the vaccinated dogs, 31.8% unvaccinated, and in 46.6% of the dogs with unknown vaccination history. Protective antibodies to CPV were present in 90.9% of the dogs: 93.7% of the vaccinated dogs, 90.9% of the unvaccinated, and 83.3% of the dogs with unknown vaccination history.

  20. Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper.

    Science.gov (United States)

    Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David

    2011-12-15

    Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Adjuvant effects of recombinant giant panda (Ailuropoda melanoleuca) IL-18 on the canine distemper disease vaccine in mice

    OpenAIRE

    YAN, Yue; NIU, Lili; DENG, Jiabo; WANG, Qiang; YU, Jianqiu; ZHANG, Yizheng; WANG, Jianxi; CHEN, Jiao; WEI, Changhe; TAN, Xuemei

    2014-01-01

    Canine distemper virus (CDV) is a morbillivirus known to cause morbidity and mortality in a broad range of animals. Giant pandas (Ailuropoda melanoleuca), especially captive ones, are susceptible to natural infection with CDV. Interleukin-18 (IL-18) is a powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. In this study, a giant panda IL-18 gene eukaryotic expression plasmid (pcAmIL-18) was constructed. Female BALB/c mice were muscular...

  2. Identification of a novel linear B-cell epitope using a monoclonal antibody against the carboxy terminus of the canine distemper virus nucleoprotein and sequence analysis of the identified epitope in different CDV isolates.

    Science.gov (United States)

    Yi, Li; Cao, Zhigang; Tong, Mingwei; Cheng, Yuening; Yang, Yong; Li, Shuang; Wang, Jianke; Lin, Peng; Sun, Yaru; Zhang, Miao; Cheng, Shipeng

    2017-09-29

    The Nucleoprotein (NP) is the most abundant and highly immunogenic protein in canine distemper virus (CDV), playing an important role in CDV viral replication and assembly. In this study, a specific monoclonal antibody, named C8, was produced against the NP protein C terminal (amino acids 401-523). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis.The results indicated that 444 GDKYPIHFNDER 455 was the minimal linear epitope that could be recognized by mAb C8. Sequence alignments demonstrated that this linear epitope is less conserved among three CDV genotypes. We next analyzed the level of conservation of the defined epitope in19 Chinese CDV clinical isolates, and it has one site variation in amino acid among these CDV isolations. 2 isolates have the amino acid mutations F451L, while one has P448Ssubstitution.Phylogenetic analysis showed the two isolates with F451Lsubstitution had a closer relationship in a virulent strain ZJ-7, so the epitope may be a significant tag associated with virus virulence. This collection of mAb along with defined linear epitope may provide useful reagents for investigations of NP protein function and the development of CDV specific diagnostics.

  3. Genetic diversity and phylogenetic analysis of the attachment glycoprotein of phocine distemper viruses of the 2002 and 1988 epizootics

    DEFF Research Database (Denmark)

    Nielsen, L; Arctander, P; Jensen, T H

    2009-01-01

    To investigate the possible origin and spread of the dramatic re-emergent 2002 distemper epizootic observed among seals in Danish Waters, we have sequenced wild-type genes of the attachment (H) glycoproteins of viruses from both the 2002 and 1988 epizootics. Phylogenetic analysis of the H genes...... of phocine distemper virus (PDV) together with other morbilliviruses, suggests that the re-emergent 2002 PDV is more closely related to a putative recent ancestral PDV than the 1988 PDV isolates. Moreover, upsurges of distemper disease in land-living carnivores linked in time and locality to the 2002 seal...... epizootic in Danish Waters was investigated and determined to be caused by canine distemper virus, the closest relative of PDV, revealing no direct epidemiological link to the seal epizootics. (C) 2009 Elsevier B.V. All rights reserved....

  4. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  5. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    Science.gov (United States)

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Pathologic and Molecular Virologic Characterization of a Canine Distemper Outbreak in Farmed Civets.

    Science.gov (United States)

    Techangamsuwan, S; Banlunara, W; Radtanakatikanon, A; Sommanustweechai, A; Siriaroonrat, B; Lombardini, E D; Rungsipipat, A

    2015-07-01

    In October 2011, a fatal disease outbreak occurred in 3 civet species farmed for their use in the coffee industry in Thailand. The disease quickly killed 20 animals in a mixed population of Asian palm civets (Paradoxurus hermaphroditus; n = 18), a masked palm civet (Paguma larvata; n = 1), and small Indian civet (Viverricula indica; n = 1). Clinical signs consisted of severe lethargy, weakness, vomiting, and diarrhea with associated dehydration, dyspnea, nasal and footpad hyperkeratosis, and seizures. All civets were positive for canine morbillivirus using the commercial canine distemper virus (CDV) antigen test kit. Consistently observed necropsy findings consisted of severe pneumonia and hemorrhagic enteritis. Microscopic examination revealed severe gastroenteritis, bronchointerstitial pneumonia, lymphadenitis, necrotizing dermatitis, nonsuppurative polioencephalitis, and characteristic intranuclear/intracytoplasmic eosinophilic viral inclusions in multiple tissues. Immunohistochemical analysis revealed immunoreactivity of varying intensity, while virus isolation demonstrated typical cytopathic effects. To confirm CDV infection, reverse transcription-polymerase chain reaction against fusion (F), phosphoprotein (P), and hemagglutinin (H) genes showed bands of expected size using conjunctival swabs (9 civets, 1 dog [Canis lupus familiaris] living on the farm). Phylogenetic analyses and restriction fragment length polymorphism results indicated that the civets were infected by the Asia-1 strain of CDV commonly found in dogs in Thailand. The deduced amino acid sequences of the signaling lymphocyte activation molecule binding region of the CDV-H proteins revealed a Y549H mutation in both CDV-infected Asian palm civets (n = 4) and a co-located dog. We report a canine distemper outbreak in a civet colony with lineage classification and a Y549H mutation in noncanid species in Thailand. © The Author(s) 2014.

  7. Canine distemper of vaccine origin in European mink, Mustela lutreola--a case report.

    Science.gov (United States)

    Ek-Kommonen, C; Rudbäck, E; Anttila, M; Aho, M; Huovilainen, A

    2003-04-02

    Cases of canine distemper (CD) related to vaccination of exotic carnivores extend over three decades and have been described in at least nine different species. Our report describes a case of acute CD in a European mink, Mustela lutreola, vaccinated with live attenuated CD vaccine licensed for use in fur-farmed mink. The male mink died of an acute grey matter disease with an unusually long incubation period. A female vaccinated at the same time showed no obvious signs of illness. The diagnosis was confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and by subsequent sequencing of the PCR products. The sequenced products of the virus isolated from the mink and of the vaccine batch showed 100% identity. This is the first report in which molecular methods were used to confirm that the disease was caused by the vaccine strain. Based on our findings, it is clearly evident that current CD vaccines cannot be safely used in exotic species.

  8. Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny Infecção pelo vírus da cinomose canina em um furão (Galictis cuja: primeiro relato e filogenia viral

    Directory of Open Access Journals (Sweden)

    Jane Megid

    2013-02-01

    Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.Doenças infecciosas em animais selvagens têm aumentado devido às alterações em seu habitat e ao maior contato com animais domésticos. A cinomose já foi descrita em diversas espécies de carnívoros selvagens, representando uma ameaça à conservação da vida selvagem. Nesse estudo é descrito o primeiro caso de infecção pelo vírus da cinomose em um furão (Galictis cuja. Um indivíduo de vida livre, sem sinais clínicos aparentes, apresentou morte súbita após um dia em cativeiro. Foi realizado o diagnóstico molecular para detecção do vírus da cinomose canina, sendo o resultado positivo. A filogenia do vírus indicou que cães domésticos foram a provável fonte de infecção.

  9. Analisis Faktor Risiko Penyakit Distemper pada Anjing di Denpasar

    Directory of Open Access Journals (Sweden)

    I Gusti Made Krisna Erawan

    2009-09-01

    Full Text Available A study was conducted to identify the risk factors of canine distemper in Denpasar, Bali. Risk factorsfor canine distemper were characterized using hospital records of private veterinary practitioners. Thisstudy showed that there was no difference in the susceptibility to canine distemper virus infection betweenmales and females. The occurrence of canine distemper disease is not significantly affected by the season.The risk of canine distemper disease for young dogs, between 0 and 1 year was 4.95-fold increase ascompared the risk of disease for dogs that were older than 1 year (Oods-Ratio: 4.95. Incomplete vaccinationwas associated with a 3.77-fold increase in the risk of canine distemper (Oods-Ratio: 3.77.

  10. Detecção do gene da nucleoproteína do vírus da cinomose canina por RT-PCR em urina de cães com sinais clínicos de cinomose Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    Directory of Open Access Journals (Sweden)

    C.M.S. Gebara

    2004-08-01

    Full Text Available A presença do vírus da cinomose canina (CDV foi avaliada pela reação em cadeia da polimerase, precedida de transcrição reversa (RT-PCR, em 87 amostras de urina de cães que apresentavam sinais clínicos sugestivos de cinomose. Os animais foram distribuídos em três grupos. No grupo A foram incluídos 41 cães com alterações sistêmicas; no grupo B, 37 cães com alterações neurológicas; e no grupo C, nove cães com alterações sistêmicas e neurológicas simultâneas. O grupo D (controle foi composto por 20 cães assintomáticos. Os resultados da RT-PCR foram correlacionados com a forma clínica da infecção e com as alterações hematológicas encontradas. Foi possível a amplificação parcial do gene da nucleoproteína do CDV em 41 (47,1% das 87 amostras de urina provenientes de cães com sinais clínicos sugestivos de cinomose. Todas as amostras obtidas de animais assintomáticos foram negativas na RT-PCR. Amostras positivas foram encontradas nos três grupos de animais com sinais clínicos na proporção de 51,2% (24/41, 29% (11/37 e 100% (9/9 para os grupos A, B e C, respectivamente. A leucocitose foi a alteração hematológica mais freqüente nos três grupos de cães com sinais clínicos porém, não foi possível estabelecer correlação entre o resultado da RT-PCR e as alterações hematológicas. Os resultados demonstraram que, independente da forma de apresentação clínica, a técnica da RT-PCR realizada em urina pode ser utilizada no diagnóstico ante mortem da infecção pelo CDV.The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control included 20 assymptomatic dogs. A chi2

  11. Duration of immunity in red wolves (Canis rufus) following vaccination with a modified live parvovirus and canine distemper vaccine.

    Science.gov (United States)

    Anderson, Kadie; Case, Allison; Woodie, Kathleen; Waddell, William; Reed, Holly H

    2014-09-01

    There is growing information available regarding duration of immunity for core vaccines in both domestic and nondomestic species. Vaccination protocols in nondomestic canids have frequently followed guidelines developed for the domestic dog; however, these protocols can be inappropriate for nondomestic canids such as the African wild dog (Lycaon pictus), leaving some animals susceptible to infectious disease and others at risk for contracting vaccine-induced disease. In this study, red wolves (Canis rufus) were vaccinated against canine distemper virus (CDV) and canine parvovirus (CPV) and vaccination titers were followed annually for 3 yr. One hundred percent of wolves developed and maintained a positive titer to CDV for 3 yr and 96.9% of wolves developed and maintained a positive titer to CPV for 3 yr. Seroconversion for canine adenovirus was sporadic. The results of this study support decreasing the frequency of vaccine administration in the red wolf population to a triennial basis.

  12. 9 CFR 113.47 - Detection of extraneous viruses by the fluorescent antibody technique.

    Science.gov (United States)

    2010-01-01

    ... respiratory syncytial virus. (3) Canine cells shall, in addition, be tested for: (i) Canine coronavirus; (ii) Canine distemper virus; and (iii) Canine parvovirus. (4) Equine cells shall, in addition, be tested for...

  13. SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

    Science.gov (United States)

    Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

    2017-10-01

    Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

  14. Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs

    Directory of Open Access Journals (Sweden)

    Touihri Leila

    2012-12-01

    Full Text Available Abstract Background During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV or distemper virus (CDV after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. Methods We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an “Internal Ribosome Entry Site” (IRES domain. Results The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The

  15. Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs.

    Science.gov (United States)

    Touihri, Leila; Ahmed, Sami Belhaj; Chtourou, Yacine; Daoud, Rahma; Bahloul, Chokri

    2012-12-27

    During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV) or distemper virus (CDV) after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV) 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an "Internal Ribosome Entry Site" (IRES) domain. The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The FMDV 2A was also efficient in the design of multivalent

  16. The administration of a single dose of a multivalent (DHPPiL4R vaccine prevents clinical signs and mortality following virulent challenge with canine distemper virus, canine adenovirus or canine parvovirus

    Directory of Open Access Journals (Sweden)

    Stephen Wilson

    2014-01-01

    In conclusion, we demonstrated that a single administration of a minimum titre, multivalent vaccine to dogs of six weeks of age is efficacious and prevents clinical signs and mortality caused by CAV-1 and CDV; prevents clinical signs and significantly reduces virus shedding caused by CAV-2; and prevents clinical signs, leucopoenia and viral excretion caused by CPV.

  17. Analysis of infection epidemiological distemper virus, dogs in the municipality of Garanhuns, Pernambuco, Brazil

    Directory of Open Access Journals (Sweden)

    Érica Chaves Lúcio

    2014-06-01

    Full Text Available Distemper is caused by a Morbillivirus and has worldwide distribution, the dog being the major reservoir for this virus. Transmission occurs by aerosols and the virus can be excreted at the end of the acute phase. It is a disease with no predilection for race, age or sex; however the literature suggests that puppies are most affected. In this study were analyzed serum samples from pet dogs in the city districts and neighborhoods of Garanhuns Boa Vista, Cohab 1, Cohab 2, Magano and center during the period from August to December 2012. Samples were collected from dogs older than three months, not vaccinated against distemper. To produce the maps of geographical distribution of animals were collected coordinates for each home visit. Of the samples analyzed, 90.38% were positive, and 28.72% had high antibody concentration, 47.88% and 23.40% average concentration or low. By analyzing the distribution by districts observed a higher prevalence of infection in neighborhoods with Cohab 2 100.00% and Cohab 1 with 96.00%; Boa Vista with 93.10%; Magano with 78.26%; center with 50.00%. This study did not identify any variable associated with infection related to sex and 100.0% of the animals, including positive and negative, were not castrated. It was shown that 75.0% of the animals had never been taken to the veterinarian, and of these, 94.8% were positive, a fact that may be related to higher seropositivity in these animals. The results of this study show that the canine distemper virus is widespread in the canine population of Garanhuns, Pernambuco, highlights the importance of epidemiological studies to characterize the real situation of infection by this virus in canine populations, in order to reduce damage to animal health caused by this agent.

  18. Morphometric analysis of the thymus of puppies infected with the Snyder Hill Strain of canine distemper virus Análise morfométrica do timo de cães filhotes infectados com a amostra Snyder Hill do vírus de cinomose canina

    Directory of Open Access Journals (Sweden)

    C.M. Alves

    2006-08-01

    Full Text Available The thymic morphometry analysis was used for determining apoptosis and atrophy of the thymus of eight puppies inoculated with canine distemper virus (CDV. Three healthy dogs were used as negative controls. Sections, 5µm thick, were stained by HE and Shorr, and the latter were evaluated by morphometry. CDV nucleoprotein was detected by immunohistochemistry. Morphometric results confirmed lymphoid hypotrophy in CDV inoculated dog thymuses, more stroma, less parenchyma and higher apoptotic index/field than negative control (not inoculated puppies. Apoptosis plays a role in the mechanism of thymus atrophy that develops in canine distemper.Determinaram-se a apoptose e a atrofia no timo de oito cães novos, inoculados experimentalmente com o vírus de cinomose. Três cães saudáveis foram usados como controle negativo. Secções coradas pelo Shorr foram avaliadas por morfometria. A nucleoproteína viral foi detectada por imunoistoquímica. Os resultados morfométricos confirmaram a hipotrofia e mostraram que o timo dos cães inoculados tinha mais estroma, menos parênquima e maior índice apoptótico/campo que o dos animais-controle. Pode-se concluir que a apoptose desempenha importante papel no mecanismo de hipotrofia tímica que se desenvolve na cinomose.

  19. Immunohistochemical and transcriptome analyses indicate complex breakdown of axonal transport mechanisms in canine distemper leukoencephalitis.

    Science.gov (United States)

    Spitzbarth, Ingo; Lempp, Charlotte; Kegler, Kristel; Ulrich, Reiner; Kalkuhl, Arno; Deschl, Ulrich; Baumgärtner, Wolfgang; Seehusen, Frauke

    2016-07-01

    CDV-DL (Canine distemper virus-induced demyelinating leukoencephalitis) represents a spontaneously occurring animal model for demyelinating disorders. Axonopathy represents a key pathomechanism in this disease; however, its underlying pathogenesis has not been addressed in detail so far. This study aimed at the characterization of axonal cytoskeletal, transport, and potential regenerative changes with a parallel focus upon Schwann cell remyelination. Immunohistochemistry of canine cerebellar tissue as well as a comparative analysis of genes from an independent microarray study were performed. Increased axonal immunoreactivity for nonphosphorylated neurofilament was followed by loss of cytoskeletal and motor proteins. Interestingly, a subset of genes encoding for neurofilament subunits and motor proteins was up-regulated in the chronic stage compared to dogs with subacute CDV-DL. However, immunohistochemically, hints for axonal regeneration were restricted to up-regulated axonal positivity of hypoxia-inducible factor 1 alpha, while growth-associated protein 43, erythropoietin and its receptor were not or even down-regulated. Periaxin-positive structures, indicative of Schwann cell remyelination, were only detected within few advanced lesions. The present findings demonstrate a complex sequence of axonal cytoskeletal breakdown mechanisms. Moreover, though sparse, this is the first report of Schwann cell remyelination in CDV-DL. Facilitation of these very limited endogenous regenerative responses represents an important topic for future research.

  20. Canine distemper viral infection threatens the giant panda population in China

    Science.gov (United States)

    Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan

    2017-01-01

    We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas (Ailuropoda melanoleuca) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin (H) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population. PMID:29371956

  1. Canine distemper viral infection threatens the giant panda population in China.

    Science.gov (United States)

    Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan

    2017-12-26

    We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas ( Ailuropoda melanoleuca ) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin ( H ) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population.

  2. Increased reproductive output of Danish red fox females following an outbreak of canine distemper

    DEFF Research Database (Denmark)

    Pagh, Sussie; Chriél, Mariann; Madsen, Aksel Bo

    2018-01-01

    A decline in the Danish population of red foxes Vulpes vulpes due to an outbreak of canine distemper (CDV) in 2012 gave us the opportunity to test the hypothesis that the reproductive performance of foxes increases when the population density declines. The reproductive performance of 280 female...

  3. Achados patológicos e imuno-histoquímicos em cães infectados naturalmente pelo vírus da cinomose canina Pathologic and immunohistochemistry findings in dogs naturally infected by canine distemper virus

    Directory of Open Access Journals (Sweden)

    Luciana Sonne

    2009-02-01

    Full Text Available A cinomose canina é uma doença viral e afeta principalmente os sistemas respiratório, gastrintestinal e nervoso. Neste trabalho foram analisados os achados patológicos e imuno-histoquímicos de 54 cães com cinomose de um total de 760 cães necropsiados no período de julho de 2006 a outubro de 2007. As lesões macroscópicas observadas foram caracterizadas por corrimento ocular e nasal mucopurulentas, hiperqueratose dos coxins digitais, pulmões avermelhados e não colapsados, atrofia do timo, conteúdo intestinal diarréico e placas de Peyer proeminentes. Os achados histológicos caracterizavam-se principalmente por pneumonia intersticial, rarefação linfóide, desmielinização da substância branca, manguitos perivasculares e corpúsculos de inclusão intranucleares e intracitoplasmáticos, que se localizam principalmente na mucosa do estômago, epitélios da bexiga, brônquios e bronquíolos, pelve renal, coxins digitais, pálpebra, orelha e tonsila no sistema nervoso central e em células mononucleares dos linfonodos, baço e tonsilas. Os tecidos foram marcados pela técnica imuno-histoquímica utilizando anticorpo monoclonal anti-cinomose canina. O coxim digital foi o tecido com maior número de casos marcados positivamente (67,4% dos casos, seguido pelo estômago com 62,7%. A imuno-histoquímica mostrou ser uma ferramenta importante para o estudo da distribuição do antígeno em cães infectados pela cinomose bem como indicou o melhor tecido para a confirmação do diagnóstico de casos suspeitos.Canine distemper is a viral disease that affects mainly respiratory, gastrointestinal and nervous system. The present study analyzes pathologic and immunohistochemical findings in 54 dogs with canine distemper of a total of 760 canine necropsies performed from July 2006 to October 2007. The gross lesions were characterized by mucopurulent oculonasal discharge, hyperkeratosis of footpads, red and not collapsed lungs, thymic atrophy, watery

  4. Risk Assessment of Canine Distemper in the Distribution Area of Giant Panda in Sichuan, Shaanxi and Gansu Provinces, China

    Directory of Open Access Journals (Sweden)

    Weigeng Shao

    2017-11-01

    Full Text Available Giant panda is the world-class precious endangered species, facing the canine distemper and other important infectious diseases on its wild and captive population of a serious threat. In this study, we used MaxEnt model and combined with ArcGIS analysis to predict the potential risk of canine distemper to giant panda habitat in Sichuan, Gansu and Shaanxi Provinces, China. The results showed that 35.05% and 19.47% of the distribution areas of the giant pandas were in the high risk and medium risk of canine distemper, respectively. The canine distemper pose a great risk to the healthy survival of giant pandas in China. In future, epidemic prevention, vaccine development and application of wild animals should be enhanced so as to effectively protect the giant panda.

  5. Epidemiology and clinical presentation of canine distemper disease in dogs and ferrets in Australia, 2006-2014.

    Science.gov (United States)

    Wyllie, S E; Kelman, M; Ward, M P

    2016-07-01

    To determine the status and distribution of distemper in Australian dogs and ferrets. Retrospective case series. Cases were identified via a national voluntary disease reporting system, veterinarian groups and a national laboratory database. The geographic distribution, seasonal distribution, signalment and clinical presentation of cases were described using maps and frequency distributions. A total of 48 individually affected dogs and ferrets in 27 case groups were identified, including eight confirmed case groups (> one individual). Confirmed cases were more common in summer and on the central coast of New South Wales and southern Victoria, and occurred exclusively in young, unvaccinated dogs. For dogs there was no obvious sex predilection. A mortality rate of 100% in ferrets and up to 77% in dogs was estimated. Neurological, gastrointestinal and respiratory were the most commonly reported systems affected in dogs and ferrets. There was no evidence that any large, unreported outbreaks occurred during the study period. Continuation of vaccination against canine distemper virus is justified within Australia, particularly for younger dogs. Veterinarians should continue to consider distemper in their differential diagnosis of cases with neurological, gastrointestinal and respiratory presentation. © 2016 Australian Veterinary Association.

  6. Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde.

    Science.gov (United States)

    Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis

    2014-04-23

    Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from

  7. Epidemiological features and the neuropathological manifestations of canine distemper virus-induced infections in Brazil: a reviewAspectos epidemiológicos e as manifestações neuropatológicas associadas à infecção pelo vírus da cinomose canina no Brasil: uma revisão

    Directory of Open Access Journals (Sweden)

    Selwyn Arligton Headley

    2012-10-01

    Full Text Available This article provides a critical review of current epidemiological trends of canine distemper virus (CDV and syndromes related to canine distemper encephalitis (CDE with specific reference to the situation in Brazil. Epidemiological data relative to susceptible animal populations, prevalence, seasonal occurrence, and age-related patterns associated with CDV are discussed. The participation of mongrel dogs in maintaining CDV within rural and semi-urban canine populations and their importance in the epidemiology of canine distemper is highlighted. The economic impact of treating the clinical manifestations associated with CDV-induced infections in Brazil is estimated. Additionally, neurological and neuropathological manifestations of CDV in Brazil are discussed, and a novel manifestation of CDE is proposed. Esse manuscrito fornece uma revisão crítica das tendências epidemiológicas associadas ao vírus da cinomose canina (CDV e às síndromes relacionadas à encefalite por cinomose com referência específica à situação no Brasil. Os dados epidemiológicos relativos às populações de animais suscetíveis, prevalência, sazonalidade e os padrões relacionados à idade foram discutidos. Também é enfocada nessa revisão a participação de cães de rua na manutenção do CDV nas populações caninas nas áreas rurais e nas regiões semiurbanas e a sua importância na epidemiologia da cinomose. Foi ainda estimado o impacto econômico relacionado ao tratamento das manifestações clínicas associadas à cinomose no Brasil. Adicionalmente, as manifestações neurológicas e neuropatológicas da cinomose no Brasil são discutidas e uma manifestação neuropatológica inédita da infecção é sugerida.

  8. Fatal canine distemper infection in a pack of African wild dogs in the Serengeti ecosystem, Tanzania.

    Science.gov (United States)

    Goller, Katja V; Fyumagwa, Robert D; Nikolin, Veljko; East, Marion L; Kilewo, Morris; Speck, Stephanie; Müller, Thomas; Matzke, Martina; Wibbelt, Gudrun

    2010-12-15

    In 2007, disease related mortality occurred in one African wild dog (Lycaon pictus) pack close to the north-eastern boundary of the Serengeti National Park, Tanzania. Histopathological examination of tissues from six animals revealed that the main pathologic changes comprised interstitial pneumonia and suppurative to necrotizing bronchopneumonia. Respiratory epithelial cells contained numerous eosinophilic intracytoplasmic inclusion bodies and multiple syncytial cells were found throughout the parenchymal tissue, both reacting clearly positive with antibodies against canine distemper virus (CDV) antigen. Phylogenetic analysis based on a 388 nucleotide (nt) fragment of the CDV phosphoprotein (P) gene revealed that the pack was infected with a CDV variant most closely related to Tanzanian variants, including those obtained in 1994 during a CDV epidemic in the Serengeti National Park and from captive African wild dogs in the Mkomazi Game Reserve in 2000. Phylogenetic analysis of a 335-nt fragment of the fusion (F) gene confirmed that the pack in 2007 was infected with a variant most closely related to one variant from 1994 during the epidemic in the Serengeti National Park from which a comparable fragment is available. Screening of tissue samples for concurrent infections revealed evidence of canine parvovirus, Streptococcus equi subsp. ruminatorum and Hepatozoon sp. No evidence of infection with Babesia sp. or rabies virus was found. Possible implications of concurrent infections are discussed. This is the first molecular characterisation of CDV in free-ranging African wild dogs and only the third confirmed case of fatal CDV infection in a free-ranging pack. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Phocine distemper Virus: Current knowledge and future directions

    NARCIS (Netherlands)

    P. Duignan; M.-F. Van Bressem (Marie-Françoise); J.D. Baker (Jason); M. Barbieri (Michelle); K.M. Colegrove (Kathleen M); S. De Guise (Sylvain); R.L. de Swart (Rik); G. di Guardo (Giovanni); A.P. Dobson (Andrew); W.P. Duprex (Paul); G. Early (Greg); D. Fauquier (Deborah); T. Goldstein (Tracey); S.J. Goodman (Simon J.); B.T. Grenfell (Bryan); K.R. Groch (Kátia R.); F. Gulland (Frances); A. Hall (Ailsa); B.A. Jensen (Brenda A.); K. Lamy (Karina); K. Matassa (Keith); S. Mazzariol (Sandro); S.E. Morris (Sinead E.); O. Nielsen (Ole); D. Rotstein (David); T.K. Rowles (Teresa K); J. Saliki (Jeremy); U. Siebert (Ursula); T. Waltzek (Thomas); J.F.X. Wellehan (James F. X.)

    2014-01-01

    textabstractPhocine distemper virus (PDV) was first recognized in 1988 following a massive epidemic in harbor and grey seals in north-western Europe. Since then, the epidemiology of infection in North Atlantic and Arctic pinnipeds has been investigated. In the western North Atlantic endemic

  10. Canine Distemper Virus Matrix Protein Influences Particle Infectivity, Particle Composition, and Envelope Distribution in Polarized Epithelial Cells and Modulates Virulence ▿

    OpenAIRE

    Dietzel, Erik; Anderson, Danielle E.; Castan, Alexandre; von Messling, Veronika; Maisner, Andrea

    2011-01-01

    In paramyxoviruses, the matrix (M) protein mediates the interaction between the envelope and internal proteins during particle assembly and egress. In measles virus (MeV), M mutations, such as those found in subacute sclerosing panencephalitis (SSPE) strains, and differences in vaccine and wild-type M proteins can affect the strength of interaction with the envelope glycoproteins, assembly efficiency, and spread. However, the contribution of the M protein to the replication and pathogenesis o...

  11. Avaliação da urina e de leucócitos como amostras biológicas para a detecção ante mortem do vírus da cinomose canina por RT-PCR em cães naturalmente infectados Evaluation of the urine and leucocytes as biological samples for ante mortem detection of canine distemper virus by RT-PCR assay in naturally infected dogs

    Directory of Open Access Journals (Sweden)

    F.J. Negrão

    2007-02-01

    Full Text Available Urine and leucocytes were comparatively evaluated as clinical samples for ante mortem detection of the canine distemper virus (CDV by a reverse transcription-polymerase chain reaction (RT-PCR assay. One hundred and eighty eight dogs with clinical symptoms of distemper, were distributed in three groups. The group A was constituted of 93 dogs with systemic signs of distemper; the group B by 11 dogs with neurological signs, and the group C by 84 dogs that presented simultaneously systemic and neurological signs. In 66.5% (125/188 of the dogs was amplified an amplicon with 287 base pair of the CDV nucleoprotein gene. In 60.8% (76/125 of the animals the CDV was detected simultaneously in the urine and leucocytes, and in 39.2% (49/125 of the dogs just a type of clinical sample (urine: n=37; leucocytes: n=12 was positive. These results demonstrate that the different forms of clinical distemper disease can hinder the choice of only one type of clinical sample to carry out the ante mortem etiological diagnosis of CDV infection, and false-negative results can be generated.

  12. Simultaneous canine distemper encephalitis and canine parvovirus infection with distemper-associated cardiac necrosis in a pup Infecção simultânea por vírus da cinomose e da parvovirose associada à necrose cardíaca em um canino

    Directory of Open Access Journals (Sweden)

    Selwyn Arlington Headley

    2003-12-01

    Full Text Available Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a dual infection of canine distemper virus and canine parvovirus.Descreve-se a infecção simultânea de cinomose e parvovirose associada à degeneração e necrose do miocárdio em um cão. Clinicamente, o cão apresentou mioclonias, nistagmo, hipoplasia do esmalte dentário, pústulas abdominais e ulceração bilateral da córnea. Foram observadas encefalite desmielinzante, degeneração e necrose do miocárdio com mineralização, e necrose, hemorragia e fusão das vilosidades intestinais. As lesões observadas neste cão são características com uma infecção pelos vírus da cinomose e da parvovirose.

  13. Early DNA vaccination of puppies against canine distemper in the presence of maternally derived immunity.

    Science.gov (United States)

    Griot, Christian; Moser, Christian; Cherpillod, Pascal; Bruckner, Lukas; Wittek, Riccardo; Zurbriggen, Andreas; Zurbriggen, Rinaldo

    2004-01-26

    Canine distemper (CD) is a disease in carnivores caused by CD virus (CDV), a member of the morbillivirus genus. It still is a threat to the carnivore and ferret population. The currently used modified attenuated live vaccines have several drawbacks of which lack of appropriate protection from severe infection is the most outstanding one. In addition, puppies up to the age of 6-8 weeks cannot be immunized efficiently due to the presence of maternal antibodies. In this study, a DNA prime modified live vaccine boost strategy was investigated in puppies in order to determine if vaccinated neonatal dogs induce a neutralizing immune response which is supposed to protect animals from a CDV challenge. Furthermore, a single DNA vaccination of puppies, 14 days after birth and in the presence of high titers of CDV neutralizing maternal antibodies, induced a clear and significant priming effect observed as early as 3 days after the subsequent booster with a conventional CDV vaccine. It was shown that the priming effect develops faster and to higher titers in puppies preimmunized with DNA 14 days after birth than in those vaccinated 28 days after birth. Our results demonstrate that despite the presence of maternal antibodies puppies can be vaccinated using the CDV DNA vaccine, and that this vaccination has a clear priming effect leading to a solid immune response after a booster with a conventional CDV vaccine.

  14. Evaluation of a Community's Risk for Canine Parvovirus and Distemper Using Antibody Testing and GIS Mapping of Animal Shelter Intakes.

    Science.gov (United States)

    Spindel, Miranda E; Krecic, Matthew R; Slater, Margaret R; Vigil, Nicole

    2018-03-20

    This cross-sectional study aimed to identify where dogs with negative antibody tests to canine parvovirus (CPV) and canine distemper virus (CDV) originated when entering a community shelter, using a commercially available ELISA antibody test and Geographic Information Systems mapping. Of 2745 canines entering during a three-month period, 1056 test results were obtained. Dogs or puppies weighing over 2 lb were eligible if they could be humanely, nonchemically restrained for phlebotomy. Age and minor health issues weren't exclusions. Dogs were excluded if trained personnel were concerned health would be compromised by phlebotomy. Blood samples were collected within 24 hours of entry. Four hundred and twenty-seven (40%) dogs had positive antibody test results for both viruses, 422 (40%) were positive for CPV, 37 (4%) were positive for CDV, and 170 (16%) were negative for both. Mapping revealed geographic patterns for dogs with negative antibody tests. This shelter admitted dogs with negative CPV and/or CDV antibody tests from defined community areas. Targeting vaccination efforts in communities to areas where dogs with negative antibody tests originate could be an effective wellness strategy.

  15. Canine distemper outbreak in raccoons suggests pathogen interspecies transmission amongst alien and native carnivores in urban areas from Germany.

    Science.gov (United States)

    Rentería-Solís, Zaida; Förster, Christine; Aue, Angelika; Wittstatt, Ulrich; Wibbelt, Gudrun; König, Matthias

    2014-11-07

    From December 2012 to May 2013, an outbreak occurred among urban wild carnivores from Berlin. We collected 97 free-ranging raccoons from the city area. PCR assays, histopathology and immunohistochemistry confirmed canine distemper virus (CDV) infection in 74 raccoons. Phylogenetic analysis of haemagglutinin gene fragments (1767 nucleotides) of CDV isolated from four raccoons showed close relation to CDV isolates from foxes from Germany and a domestic dog from Hungary; all belonging to the "Europe" lineage of CDV. These study results suggest an inter-species transmission of CDV as the origin for the outbreak among the raccoon population. Implications for domestic pets and suggested interspecies transmission between urban wildlife and raccoons are discussed. This is the first major outbreak of CDV amongst free-ranging raccoons in Europe. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Associations between biosecurity and outbreaks of canine distemper on Danish mink farms in 2012-2013

    DEFF Research Database (Denmark)

    Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted

    2015-01-01

    distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case...

  17. Detecção do vírus da cinomose canina por RT-PCR utilizando-se oligonucleotídeos para os genes da fosfoproteína, hemaglutinina e neuraminidase Detection of canine distemper virus by RT-PCR using oligonucleotides targeted to the phosphoprotein, hemagglutinin and neuraminidase genes

    Directory of Open Access Journals (Sweden)

    M. Pozza

    2007-10-01

    Full Text Available Empregou-se a técnica de reação em cadeia pela polimerase precedida de transcrição reversa para detecção do vírus da cinomose canina (CC. Para a padronização da técnica foram selecionados quatro pares de oligonucleotídeos (P1, P2, N1, H1, baseados em seqüências dos genes da fosfoproteína, neuraminidase e hemaglutinina, sendo utilizadas três cepas vacinais de vírus da CC como controles positivos. Foram analisadas três amostras isoladas de cães com cinomose e quatro amostras provenientes de cães com suspeita clínica de cinomose. Não houve amplificação nas amostras com suspeita clínica da doença. Os resultados obtidos com os oligonucleotídeos P1 e N1 foram superiores aos de H1. Os oligonucleotídeos P2 foram considerados inapropriados para a detecção do vírus da CC. Os amplicons obtidos com os oligonucleotídeos P1, N1 e H1 foram clivados com endonucleases de restrição, sendo os perfis das amostras virais comparados aos da amostra vacinal Lederle, utilizada como referência. Um padrão similar de restrição foi observado em todas as amostras analisadas.The reverse transcription-polymerase chain reaction was used to detect canine distemper virus (CDV. Four oligonucleotide pairs were selected (P1, P2, N1, H1, based on the sequences of the phosphoprotein, hemagglutinin and nuraminidase genes for assay standardization, and three CDV vaccine strains were used as positive controls. Three viral isolates from dogs with canine distemper and four samples from animals clinically suspected of distemper were analysed. No amplification was detected in suspected samples. Results obtained by using P1 and N1 oligonucleotides were superior to those with H1 ones. P2 oligonucleotides were considered inadequate for CDV detection. Amplicons resulting from amplification of P1, N1 and H1 oligonucleotides were submitted to cleavage by restriction endonucleases and restriction patterns of viral samples were compared to that of Lederle strain

  18. Canine distemper infections, with special reference to South Africa, with a review of the literature : review article

    Directory of Open Access Journals (Sweden)

    A.L. Leisewitz

    2001-07-01

    Full Text Available Canine distemper virus is a member of the genus Morbillivirus of the family Paramyxoviridaethat causes severe disease in dogs and a range of wild mammals. The clinical signs relate essentially to the respiratory, gastrointestinal and central nervous systems. In South Africa, infection with Ehrlichia canis and canine parvovirus may present similarly. Many dogs will initially present with a wide range of central nervous system signs without any history of systemic disease. A recent South African study evaluating ante mortem diagnosis highlighted the importance of recognising clinical signs, cerebrospinal fluid IgG titres, serum IgM titres and immunocytochemistry of epithelial tissue. A 2-year retrospective evaluation of cerebrospinal fluid samples collected from dogs presented to the Onderstepoort Veterinary Academic Hospital indicates that distemper infection is common, and this disease should routinely be suspected in cases of diverse neurological disease in dogs. The South African dog population is specifically at high risk for the disease because of the large pool of unvaccinated, reproductively-active dogs that expose the wildlife resources of the country to risk of fatal disease. Outbreaks of disease in dogs continue to occur in developed and developing communities in both vaccinated and unvaccinated dogs worldwide, and have also been described in a wide range of free-ranging wildlife, including seals, dolphins and lions, and in endangered zoo animals. Modified live virus vaccines have contributed markedly to disease control in the dog population but have caused mortality in some wild carnivores. New recombinant vaccines are being developed that will be safe in wild animals. The pathogenesis of CNS demyelination has been compared to various important demyelinating diseases in humans and, amongst other things, relates to down-regulation of the oligodendrocyte gene coding for myelin synthesis and non-immunocyte CNS cell expression of type II

  19. Lesões histológicas no sistema nervoso central de cães com encefalite e diagnóstico molecular da infecção pelo vírus da cinomose canina Histopathological lesions in the central nervous system of dogs with encephalitis and molecular diagnosis of canine distemper virus infection

    Directory of Open Access Journals (Sweden)

    C.M.S. Gebara

    2004-04-01

    Full Text Available Dez amostras de urina de cães que apresentavam sinais clínicos sistêmicos e neurológicos indicativos da infecção pelo vírus da cinomose canina (CDV foram analisadas pela técnica da reação em cadeia pela polimerase precedida de transcrição reversa (RT-PCR para a detecção do RNA do CDV. O exame histopatológico foi realizado em fragmentos de cérebro, cerebelo e bexiga. Como controle negativo foram colhidos fragmentos de órgãos e urina de quatro cães sem sinais clínicos de doença infecciosa e que morreram por outras causas. Todos os cães (9/10 positivos em RT-PCR apresentaram alterações histológicas no cérebro e cerebelo, características de encefalite aguda (5/9 ou crônica (4/9 compatíveis com as causadas pelo CDV. Um dos cães com alterações clínicas neurológicas semelhantes às observadas em cinomose foi negativo na RT-PCR e apresentou alterações histopatológicas inespecíficas. Nas amostras de bexiga não foram observadas lesões histológicas. Todas as amostras biológicas provenientes dos cães-controle foram negativas na RT-PCR (urina e não apresentaram alterações histológicas (fragmentos de órgãos. O trabalho evidenciou a especificidade da RT-PCR no diagnóstico precoce e ante mortem na infecção pelo CDV.The reverse transcription-polymerase chain reaction (RT-PCR was used to detect canine distemper virus (CDV RNA in 10 urine samples from dogs that had died with clinical systemic and neurological signs indicative of CDV infection. Brain, cerebellum and urinary bladder fragments were collected for histopathological examination. For the negative control, urine and organ fragments were collected at necropsy from four dogs without clinical symptoms of infectious diseases that had died from other causes. The dogs positives in RT-PCR (9/10 presented histological lesions in the brain and cerebellum characteristic of acute (5/9 or chronic (4/9 encephalitis compatible with those caused by CDV. One of the dogs

  20. Phocine Distemper Virus in Seals, East Coast, United States, 2006

    Science.gov (United States)

    Earle, J.A. Philip; Melia, Mary M.; Doherty, Nadine V.; Nielsen, Ole

    2011-01-01

    In 2006 and 2007, elevated numbers of deaths among seals, constituting an unusual mortality event, occurred off the coasts of Maine and Massachusetts, United States. We isolated a virus from seal tissue and confirmed it as phocine distemper virus (PDV). We compared the viral hemagglutinin, phosphoprotein, and fusion (F) and matrix (M) protein gene sequences with those of viruses from the 1988 and 2002 PDV epizootics. The virus showed highest similarity with a PDV 1988 Netherlands virus, which raises the possibility that the 2006 isolate from the United States might have emerged independently from 2002 PDVs and that multiple lineages of PDV might be circulating among enzootically infected North American seals. Evidence from comparison of sequences derived from different tissues suggested that mutations in the F and M genes occur in brain tissue that are not present in lung, liver, or blood, which suggests virus persistence in the central nervous system. PMID:21291591

  1. Climate extremes promote fatal co-infections during canine distemper epidemics in African lions.

    Directory of Open Access Journals (Sweden)

    Linda Munson

    Full Text Available Extreme climatic conditions may alter historic host-pathogen relationships and synchronize the temporal and spatial convergence of multiple infectious agents, triggering epidemics with far greater mortality than those due to single pathogens. Here we present the first data to clearly illustrate how climate extremes can promote a complex interplay between epidemic and endemic pathogens that are normally tolerated in isolation, but with co-infection, result in catastrophic mortality. A 1994 canine distemper virus (CDV epidemic in Serengeti lions (Panthera leo coincided with the death of a third of the population, and a second high-mortality CDV epidemic struck the nearby Ngorongoro Crater lion population in 2001. The extent of adult mortalities was unusual for CDV and prompted an investigation into contributing factors. Serological analyses indicated that at least five "silent" CDV epidemics swept through the same two lion populations between 1976 and 2006 without clinical signs or measurable mortality, indicating that CDV was not necessarily fatal. Clinical and pathology findings suggested that hemoparsitism was a major contributing factor during fatal epidemics. Using quantitative real-time PCR, we measured the magnitude of hemoparasite infections in these populations over 22 years and demonstrated significantly higher levels of Babesia during the 1994 and 2001 epidemics. Babesia levels correlated with mortalities and extent of CDV exposure within prides. The common event preceding the two high mortality CDV outbreaks was extreme drought conditions with wide-spread herbivore die-offs, most notably of Cape buffalo (Syncerus caffer. As a consequence of high tick numbers after the resumption of rains and heavy tick infestations of starving buffalo, the lions were infected by unusually high numbers of Babesia, infections that were magnified by the immunosuppressive effects of coincident CDV, leading to unprecedented mortality. Such mass mortality

  2. Climate extremes promote fatal co-infections during canine distemper epidemics in African lions.

    Science.gov (United States)

    Munson, Linda; Terio, Karen A; Kock, Richard; Mlengeya, Titus; Roelke, Melody E; Dubovi, Edward; Summers, Brian; Sinclair, Anthony R E; Packer, Craig

    2008-06-25

    Extreme climatic conditions may alter historic host-pathogen relationships and synchronize the temporal and spatial convergence of multiple infectious agents, triggering epidemics with far greater mortality than those due to single pathogens. Here we present the first data to clearly illustrate how climate extremes can promote a complex interplay between epidemic and endemic pathogens that are normally tolerated in isolation, but with co-infection, result in catastrophic mortality. A 1994 canine distemper virus (CDV) epidemic in Serengeti lions (Panthera leo) coincided with the death of a third of the population, and a second high-mortality CDV epidemic struck the nearby Ngorongoro Crater lion population in 2001. The extent of adult mortalities was unusual for CDV and prompted an investigation into contributing factors. Serological analyses indicated that at least five "silent" CDV epidemics swept through the same two lion populations between 1976 and 2006 without clinical signs or measurable mortality, indicating that CDV was not necessarily fatal. Clinical and pathology findings suggested that hemoparsitism was a major contributing factor during fatal epidemics. Using quantitative real-time PCR, we measured the magnitude of hemoparasite infections in these populations over 22 years and demonstrated significantly higher levels of Babesia during the 1994 and 2001 epidemics. Babesia levels correlated with mortalities and extent of CDV exposure within prides. The common event preceding the two high mortality CDV outbreaks was extreme drought conditions with wide-spread herbivore die-offs, most notably of Cape buffalo (Syncerus caffer). As a consequence of high tick numbers after the resumption of rains and heavy tick infestations of starving buffalo, the lions were infected by unusually high numbers of Babesia, infections that were magnified by the immunosuppressive effects of coincident CDV, leading to unprecedented mortality. Such mass mortality events may become

  3. Climate Extremes Promote Fatal Co-Infections during Canine Distemper Epidemics in African Lions

    Science.gov (United States)

    Munson, Linda; Terio, Karen A.; Kock, Richard; Mlengeya, Titus; Roelke, Melody E.; Dubovi, Edward; Summers, Brian; Sinclair, Anthony R. E.; Packer, Craig

    2008-01-01

    Extreme climatic conditions may alter historic host-pathogen relationships and synchronize the temporal and spatial convergence of multiple infectious agents, triggering epidemics with far greater mortality than those due to single pathogens. Here we present the first data to clearly illustrate how climate extremes can promote a complex interplay between epidemic and endemic pathogens that are normally tolerated in isolation, but with co-infection, result in catastrophic mortality. A 1994 canine distemper virus (CDV) epidemic in Serengeti lions (Panthera leo) coincided with the death of a third of the population, and a second high-mortality CDV epidemic struck the nearby Ngorongoro Crater lion population in 2001. The extent of adult mortalities was unusual for CDV and prompted an investigation into contributing factors. Serological analyses indicated that at least five “silent” CDV epidemics swept through the same two lion populations between 1976 and 2006 without clinical signs or measurable mortality, indicating that CDV was not necessarily fatal. Clinical and pathology findings suggested that hemoparsitism was a major contributing factor during fatal epidemics. Using quantitative real-time PCR, we measured the magnitude of hemoparasite infections in these populations over 22 years and demonstrated significantly higher levels of Babesia during the 1994 and 2001 epidemics. Babesia levels correlated with mortalities and extent of CDV exposure within prides. The common event preceding the two high mortality CDV outbreaks was extreme drought conditions with wide-spread herbivore die-offs, most notably of Cape buffalo (Syncerus caffer). As a consequence of high tick numbers after the resumption of rains and heavy tick infestations of starving buffalo, the lions were infected by unusually high numbers of Babesia, infections that were magnified by the immunosuppressive effects of coincident CDV, leading to unprecedented mortality. Such mass mortality events may

  4. Combined distemper-adenoviral pneumonia in a dog

    Science.gov (United States)

    Rodriguez-Tovar, Luis E.; Ramírez-Romero, Rafael; Valdez-Nava, Yazel; Nevárez-Garza, Alicia M.; Zárate-Ramos, Juan J.; López, Alfonso

    2007-01-01

    A 3 1/2-month-old pug with oculonasal discharge and seizures was submitted for postmortem examination. Grossly, the lungs had cranioventral consolidation, and microscopically, 2 distinct types of inclusion bodies compatible with Canine distemper virus and Canine adenovirus type 2. Presence of both viruses was confirmed via immunohistochemical staining. PMID:17616064

  5. Evaluation of oral and subcutaneous delivery of an experimental canarypox recombinant canine distemper vaccine in the Siberian polecate (Mustela eversmanni)

    Science.gov (United States)

    Wimsatt, Jeffrey; Biggins, Dean E.; Innes, Kim; Taylor, Bobbi; Garell, Della

    2003-01-01

    We assessed the safety and efficacy of an experimental canarypox-vectored recombinant canine distemper virus (CDV) subunit vaccine in the Siberian polecat (Mustela eversmanni), a close relative of the black-footed ferret, (M. nigripes), an endangered species that is highly susceptible to the virus. Siberian polecats were randomized into six treatment groups. Recombinant canine distemper vaccine was administered s.c. at three dose levels (104.5, 105.0, and 105.5 plaque-forming units [PFU] per dose) and was administered orally by spraying the vaccine into the oropharnyx at two dose levels (105.5, 108.0 PFU per dose). The sixth group of control animals was not vaccinated. For both routes of administration, two 1-ml doses of reconstituted vaccine were delivered 4 wk apart, followed by live virus challenge 3 wk after the second vaccination. During the challenge, Synder Hill test strain CDV obtained from the National Veterinary Services Laboratory in Ames, Iowa, was administered i.p. Serial blood samples for CDV serology were collected immediately before vaccination and challenge, and 10, 15, and 20 days after challenge. Clinical signs and body weights were recorded up to 32 days after challenge. The survival rate in animals receiving vaccine at the highest oral dose (108.0 PFU per dose) was 83.3%. Survival rate was 50.0% in the high s.c. and 60.0% in the medium s.c. groups. All animals in the low–s.c. dose, low–oral dose, and control groups died after exposure. Vaccine dose overall (oral and s.c.) and dose in response to s.c. administration when considered alone were significant predictors of survival (P = 0.006 and P = 0.04, respectively). Among the polecats challenged with virulent virus, those that died became sick sooner than those that survived. Animals that died lost significantly more weight during the 10 days after challenge than did animals that survived (P = 0.02). Survival rates did not differ by sex, founder female status, or breeding pedigree in any of

  6. Epidemiology of canine distemper and canine parvovirus in domestic dogs in urban and rural areas of the Araucanía region in Chile.

    Science.gov (United States)

    Acosta-Jamett, G; Surot, D; Cortés, M; Marambio, V; Valenzuela, C; Vallverdu, A; Ward, M P

    2015-08-05

    To assess whether the seroprevalence of canine distemper virus (CDV) and canine parvovirus (CPV) in domestic dogs is higher in urban versus rural areas of the Araucanía region in Chile and risk factors for exposure, a serosurvey and questionnaire survey at three, urban-rural paired sites was conducted from 2009 to 2012. Overall, 1161 households were interviewed of which 71% were located in urban areas. A total of 501 blood samples were analysed. The overall CDV and CPV seroprevalences were 61% (CI 90%: 58-70%) and 47% (CI 90%: 40-49%), and 89% (CI 90%: 85-92%) and 72% (CI 90%: 68-76%) in urban and rural areas, respectively. The higher seroprevalence in domestic dogs in urban areas suggests that urban domestic dogs might be a maintenance host for both CDV and CPV in this region. Due to the presence of endangered wild canids populations in areas close to these domestic populations, surveillance and control of these pathogens in urban dog populations is needed a priority. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Accumulation of Extracellular Matrix in Advanced Lesions of Canine Distemper Demyelinating Encephalitis.

    Science.gov (United States)

    Seehusen, Frauke; Al-Azreg, Seham A; Raddatz, Barbara B; Haist, Verena; Puff, Christina; Spitzbarth, Ingo; Ulrich, Reiner; Baumgärtner, Wolfgang

    2016-01-01

    In demyelinating diseases, changes in the quality and quantity of the extracellular matrix (ECM) may contribute to demyelination and failure of myelin repair and axonal sprouting, especially in chronic lesions. To characterize changes in the ECM in canine distemper demyelinating leukoencephalitis (DL), histochemical and immunohistochemical investigations of formalin-fixed paraffin-embedded cerebella using azan, picrosirius red and Gomori`s silver stain as well as antibodies directed against aggrecan, type I and IV collagen, fibronectin, laminin and phosphacan showed alterations of the ECM in CDV-infected dogs. A significantly increased amount of aggrecan was detected in early and late white matter lesions. In addition, the positive signal for collagens I and IV as well as fibronectin was significantly increased in late lesions. Conversely, the expression of phosphacan was significantly decreased in early and more pronounced in late lesions compared to controls. Furthermore, a set of genes involved in ECM was extracted from a publically available microarray data set and was analyzed for differential gene expression. Gene expression of ECM molecules, their biosynthesis pathways, and pro-fibrotic factors was mildly up-regulated whereas expression of matrix remodeling enzymes was up-regulated to a relatively higher extent. Summarized, the observed findings indicate that changes in the quality and content of ECM molecules represent important, mainly post-transcriptional features in advanced canine distemper lesions. Considering the insufficiency of morphological regeneration in chronic distemper lesions, the accumulated ECM seems to play a crucial role upon regenerative processes and may explain the relatively small regenerative potential in late stages of this disease.

  8. Phocine distemper virus (PDV) seroprevalence as predictor for future outbreaks in harbour seals.

    Science.gov (United States)

    Ludes-Wehrmeister, Eva; Dupke, Claudia; Harder, Timm C; Baumgärtner, Wolfgang; Haas, Ludwig; Teilmann, Jonas; Dietz, Rune; Jensen, Lasse F; Siebert, Ursula

    2016-02-01

    Phocine distemper virus (PDV) infections caused the two most pronounced mass mortalities in marine mammals documented in the past century. During the two outbreaks, 23,000 and 30,000 harbour seals (Phoca vitulina), died in 1988/1989 and 2002 across populations in the Wadden Sea and adjacent waters, respectively. To follow the mechanism and development of disease spreading, the dynamics of Morbillivirus-specific antibodies in harbour seal populations in German and Danish waters were examined. 522 serum samples of free-ranging harbour seals of different ages were sampled between 1990 and 2014. By standard neutralisation assays, Morbillivirus-specific antibodies were detected, using either the PDV isolate 2558/Han 88 or the related canine distemper virus (CDV) strain Onderstepoort. A total of 159 (30.5%) of the harbour seals were seropositive. Annual seroprevalence rates showed an undulating course: Peaks were seen in the post-epidemic years 1990/1991 and 2002/2003. Following each PDV outbreak, seroprevalence decreased and six to eight years after the epidemics samples were tested seronegative, indicating that the populations are now again susceptible to new PDV outbreak. After the last outbreak in 2002, the populations grew steadily to an estimated maximum (since 1975) of about 39,100 individuals in the Wadden Sea in 2014 and about 23,540 harbour seals in the Kattegat area in 2013. A re-appearence of PDV would presumably result in another epizootic with high mortality rates as encountered in the previous outbreaks. The current high population density renders harbour seals vulnerable to rapid spread of infectious agents including PDV and the recently detected influenza A virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Experimental canine distemper infection as a means of demonstrating latent effects of subacute lead intoxication

    Energy Technology Data Exchange (ETDEWEB)

    White, D.J.; McLeod, S.

    1976-01-01

    Observations on the response of the body to experimental infection with distemper virus in dogs previously dosed subacutely with lead have demonstrated a latent effect of lead on several body systems. Effects which indicated a relationship to earlier treatment with lead included evidence for stimulation of haemoglobin synthesis, changes to red blood cells resulting in increased destruction, increased vulnerability of the parenchymatous cells of the liver to damage, reduction in the weight of the skeleton and thyroid, an increase in weight of the thymus and brain and histopathological changes in the thymus. 21 references, 2 figures, 1 table.

  10. [The growth of attenuated strains of canine parvovirus, mink enteritis virus, feline panleukopenia virus, and rabies virus on various types of cell cultures].

    Science.gov (United States)

    Zuffa, T

    1987-10-01

    The growth characteristics were studied in the attenuated strains of canine parvovirus CPVA-BN 80/82, mink enteritis virus MEVA-BN 63/82 and feline panleucopenia virus FPVA-BN 110/83 on the stable feline kidney cell line FE, and in the attenuated canine distemper virus CDV-F-BN 10/83 on chicken embryo cell cultures (KEB) and cultures of the stable cell line VERO. When the FE cultures were infected with different parvoviruses in cell suspension at MOI 2-4 TKID50 per cell, the first multiplication of the intracellular virus was recorded 20 hours p. i. In the canine parvovirus, the content of intracellular and extracellular virus continued increasing parallelly until the fourth day; then, from the fourth to the sixth day, the content of extracellular virus still increased whereas that of intracellular virus fell rapidly. In the case of the mink enteritis virus the release of the virus into the culture medium continued parallelly with the production of the cellular virus until the sixth day. In the case of the feline panleucopenia virus the values concerning free virus and virus bound to cells were lower, starting from the second day p. i. When KEB or VERO cultures were infected in cell suspension with the canine distemper virus at MOI about 0.004 per 1 cell, the replicated intracellular virus was first recorded in the KEB cultures five hours after infection but in the VERO cultures only 20 hours after infection, with a timely release of the virus into the culture medium in both kinds of tissue. In the KEB and VERO cultures the highest values of infection titres were recorded on the fourth day p. i., the course of virus multiplication on the cells being parallel with its release into the culture medium.

  11. Adjuvant effects of recombinant giant panda (Ailuropoda melanoleuca) IL-18 on the canine distemper disease vaccine in mice.

    Science.gov (United States)

    Yan, Yue; Niu, Lili; Deng, Jiabo; Wang, Qiang; Yu, Jianqiu; Zhang, Yizheng; Wang, Jianxi; Chen, Jiao; Wei, Changhe; Tan, Xuemei

    2015-02-01

    Canine distemper virus (CDV) is a morbillivirus known to cause morbidity and mortality in a broad range of animals. Giant pandas (Ailuropoda melanoleuca), especially captive ones, are susceptible to natural infection with CDV. Interleukin-18 (IL-18) is a powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. In this study, a giant panda IL-18 gene eukaryotic expression plasmid (pcAmIL-18) was constructed. Female BALB/c mice were muscularly inoculated with the plasmids pcAmIL-18, pcDNA3.1 and PBS, respectively. They were subsequently injected with an attenuated CDV vaccine for dogs, and the induced humoral and cellular responses were evaluated. The results showed that pcAmIL-18 remarkably improved the level of specific antibody, IFN-γ and IL-2 in mice sera, the T lymphocyte proliferation index and the percentage of CD4(+) and CD8(+) cells. These data indicated that pcAmIL-18 is a potential adjuvant that promotes specific immunity.

  12. Serologic evaluation, efficacy, and safety of a commerical modified-live canine distemper vaccine in domestic ferrets.

    Science.gov (United States)

    Wimsatt, J; Jay, M T; Innes, K E; Jessen, M; Collins, J K

    2001-05-01

    To determine efficacy and safety of a commercial modified-live canine distemper virus (CDV) vaccine used for prophylaxis in domestic ferrets. Sixteen 16-week-old neutered male ferrets. Equal groups of ferrets were inoculated subcutaneously at 16 and 20 weeks of age with saline (0.9% NaCl) solution or a vaccine derived from the Onderstepoort CDV strain and attenuated in a primate cell line. Live virulent CDV was administered to all ferrets intranasally and orally 3 weeks after the second inoculation. Clinical signs and body weights were monitored regularly during the study. Blood samples for serologic examination were drawn prior to each inoculation, before challenge exposure, and 10, 15, and 21 days after exposure. Blood samples for reverse transcriptase polymerase chain reaction (RT-PCR) were obtained 5 days after the first vaccination, and 5, 10, 15, and 21 days after challenge exposure. After challenge exposure, control ferrets had significantly more clinical signs and weight loss, compared with vaccinates. All vaccinated ferrets survived, whereas all control ferrets died. The RT-PCR assay was successful in detecting CDV in blood and fresh or formalin-fixed tissues from infected ferrets. Findings suggest that the vaccine when given SC to domestic ferrets as directed is safe and protective against challenge exposure with virulent CDV. The RT-PCR assay may simplify detection of CDV in fresh and fixed tissues.

  13. Systemic acanthamoebiasis associated with canine distemper in dogs in the semiarid region of Paraíba, Brazil

    Directory of Open Access Journals (Sweden)

    Maria T.S. Frade

    2015-02-01

    Full Text Available Infections by free-living amoebae can cause systemic disease in animals and humans. We describe the epidemiological, clinical and pathological aspects of disseminated acanthamoebiasis associated with canine distemper in three dogs of the semiarid region of Paraíba, Northeastern Brazil. Affected dogs developed progressive neurological and respiratory signs that progressed to death within in two to 20 days. Gross lesions were irregular and with yellow-reddish nodules randomly distributed in the lungs, heart, kidneys, spleen, lymph nodes, adrenals, and intestine. One dog had foci of malacia in the parietal cortex and another one in nucleus of brain basis. Histologically, pyogranulomas with areas of necrosis and hemorrhage in all organs affected were observed, associated with myriads of intralesional amoebic trophozoites. All three cases were concomitant canine distemper, that possibly triggered immunosuppression in the dogs. The diagnosis was performed through microscopic findings of infection by free-living amoebae and confirmed Acanthamoeba sp. by immunohistochemistry

  14. Distemper-like disease and encephalitozoonosis in wild dogs (Lycaon pictus).

    Science.gov (United States)

    Van Heerden, J; Bainbridge, N; Burroughs, R E; Kriek, N P

    1989-01-01

    Clinical signs of a fatal disease resembling those of canine distemper were observed in two groups of captive wild dog (Lycaon pictus) pups 13 days after vaccination with a commercially available combination vaccine for dogs which contained a live attenuated strain of canine distemper virus. Histopathological examination of tissues revealed the presence of intranuclear inclusion bodies in neurons and lesions resembling canine distemper as well as colonies of an Encephalitozoon sp. in the central nervous system and kidneys. Lesions were observed in both organs which resembled those described in other species infected with Encephalitozoon cuniculi.

  15. Phocine distemper virus: current knowledge and future directions.

    Science.gov (United States)

    Duignan, Pádraig J; Van Bressem, Marie-Françoise; Baker, Jason D; Barbieri, Michelle; Colegrove, Kathleen M; De Guise, Sylvain; de Swart, Rik L; Di Guardo, Giovanni; Dobson, Andrew; Duprex, W Paul; Early, Greg; Fauquier, Deborah; Goldstein, Tracey; Goodman, Simon J; Grenfell, Bryan; Groch, Kátia R; Gulland, Frances; Hall, Ailsa; Jensen, Brenda A; Lamy, Karina; Matassa, Keith; Mazzariol, Sandro; Morris, Sinead E; Nielsen, Ole; Rotstein, David; Rowles, Teresa K; Saliki, Jeremy T; Siebert, Ursula; Waltzek, Thomas; Wellehan, James F X

    2014-12-22

    Phocine distemper virus (PDV) was first recognized in 1988 following a massive epidemic in harbor and grey seals in north-western Europe. Since then, the epidemiology of infection in North Atlantic and Arctic pinnipeds has been investigated. In the western North Atlantic endemic infection in harp and grey seals predates the European epidemic, with relatively small, localized mortality events occurring primarily in harbor seals. By contrast, PDV seems not to have become established in European harbor seals following the 1988 epidemic and a second event of similar magnitude and extent occurred in 2002. PDV is a distinct species within the Morbillivirus genus with minor sequence variation between outbreaks over time. There is now mounting evidence of PDV-like viruses in the North Pacific/Western Arctic with serological and molecular evidence of infection in pinnipeds and sea otters. However, despite the absence of associated mortality in the region, there is concern that the virus may infect the large Pacific harbor seal and northern elephant seal populations or the endangered Hawaiian monk seals. Here, we review the current state of knowledge on PDV with particular focus on developments in diagnostics, pathogenesis, immune response, vaccine development, phylogenetics and modeling over the past 20 years.

  16. Phocine Distemper Virus: Current Knowledge and Future Directions

    Directory of Open Access Journals (Sweden)

    Pádraig J. Duignan

    2014-12-01

    Full Text Available Phocine distemper virus (PDV was first recognized in 1988 following a massive epidemic in harbor and grey seals in north-western Europe. Since then, the epidemiology of infection in North Atlantic and Arctic pinnipeds has been investigated. In the western North Atlantic endemic infection in harp and grey seals predates the European epidemic, with relatively small, localized mortality events occurring primarily in harbor seals. By contrast, PDV seems not to have become established in European harbor seals following the 1988 epidemic and a second event of similar magnitude and extent occurred in 2002. PDV is a distinct species within the Morbillivirus genus with minor sequence variation between outbreaks over time. There is now mounting evidence of PDV-like viruses in the North Pacific/Western Arctic with serological and molecular evidence of infection in pinnipeds and sea otters. However, despite the absence of associated mortality in the region, there is concern that the virus may infect the large Pacific harbor seal and northern elephant seal populations or the endangered Hawaiian monk seals. Here, we review the current state of knowledge on PDV with particular focus on developments in diagnostics, pathogenesis, immune response, vaccine development, phylogenetics and modeling over the past 20 years.

  17. 'Saving the lives of our dogs': the development of canine distemper vaccine in interwar Britain.

    Science.gov (United States)

    Bresalier, Michael; Worboys, Michael

    2014-06-01

    This paper examines the successful campaign in Britain to develop canine distemper vaccine between 1922 and 1933. The campaign mobilized disparate groups around the common cause of using modern science to save the nation's dogs from a deadly disease. Spearheaded by landed patricians associated with the country journal The Field, and funded by dog owners and associations, it relied on collaborations with veterinary professionals, government scientists, the Medical Research Council (MRC) and the commercial pharmaceutical house the Burroughs Wellcome Company (BWC). The social organization of the campaign reveals a number of important, yet previously unexplored, features of interwar science and medicine in Britain. It depended on a patronage system that drew upon a large base of influential benefactors and public subscriptions. Coordinated by the Field Distemper Fund, this system was characterized by close relationships between landed elites and their social networks with senior science administrators and researchers. Relations between experts and non-experts were crucial, with high levels of public engagement in all aspects of research and vaccine development. At the same time, experimental and commercial research supported under the campaign saw dynamic interactions between animal and human medicine, which shaped the organization of the MRC's research programme and demonstrated the value of close collaboration between veterinary and medical science, with the dog as a shared object and resource. Finally, the campaign made possible the translation of 'laboratory' findings into field conditions and commercial products. Rather than a unidirectional process, translation involved negotiations over the very boundaries of the 'laboratory' and the 'field', and what constituted a viable vaccine. This paper suggests that historians reconsider standard historical accounts of the nature of patronage, the role of animals, and the interests of landed elites in interwar British

  18. Distemper outbreak and its effect on African wild dog conservation.

    NARCIS (Netherlands)

    M.W.G. van de Bildt (Marco); T. Kuiken (Thijs); A.M. Visee; S. Lema; A.R. Fitzjohn; A.D.M.E. Osterhaus (Albert)

    2002-01-01

    textabstractIn December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus

  19. Antibodies to parvovirus, distemper virus and adenovirus conferred to household dogs using commercial combination vaccines containing Leptospira bacterin.

    Science.gov (United States)

    Taguchi, M; Namikawa, K; Maruo, T; Lynch, J; Sahara, H

    2010-12-11

    To examine how the inclusion (+) or exclusion (-) of inactivated Leptospira antigens in a vaccine for canine parvovirus type 2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type 2 (CAdV-2) affects antibody titres to CPV-2, CDV and CAdV-1 antigens, household dogs were vaccinated with commercially available vaccines from one of three manufacturers. CPV-2, CDV and CAdV-1 antibody titres were measured 11 to 13 months later and compared within three different age groups and three different bodyweight groups. There were significant differences between CPV-2 antibody titres in dogs vaccinated with (+) vaccine and those vaccinated with (-) vaccine for two products in the two-year-old group and for one product in the greater than seven-year-old group; no significant differences were seen that could be attributed to bodyweight. No differences in CDV antibody titres were observed within age groups, but a significant difference was seen in the 11 to 20 kg weight group for one product. Significant differences in CAdV-1 antibody titres were seen for one product in both the two-year-old group and the ≤10 kg weight group.

  20. Canine adenovirus type 1 in a fennec fox (Vulpes zerda).

    Science.gov (United States)

    Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku

    2014-12-01

    A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.

  1. Soroprevalência das infecções por parvovírus, adenovírus, coronavírus canino e pelo vírus da cinomose em cães de Santa Maria, Rio Grande do Sul, Brasil Seroprevalence of parvovirus, adenovirus, coronavirus and canine distemper virus infections in dogs of Santa Maria, Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Renata Dezengrini

    2007-02-01

    Full Text Available As infecções pelo vírus da cinomose (CDV, por parvovírus (CPV, adenovírus (CAV e coronavírus (CCoV são importantes causas de morbidade e de mortalidade em cães de todo o mundo, porém pouco se sabe sobre a sua incidência e prevalência no Brasil. Para determinar-se a prevalência dessas infecções na população canina de Santa Maria, RS, Brasil, amostras de sangue foram coletadas de 817 cães não-vacinados de 14 bairros do município e testadas para a presença de anticorpos específicos. Anticorpos contra o CDV foram detectados em 27,3% (223/817 das amostras, contra o CPV em 68,7% (561/817, contra o CAV em 43% (353/817 e contra o CCoV em 50,4% (412/817 dos cães. Observou-se um aumento gradativo da prevalência de anticorpos de acordo com a idade para o CDV, o CAV e o CCoV. Os índices de positividade para o CPV, o CAV e o CCoV foram um pouco superiores entre machos, e semelhantes entre os sexos para o CDV. Os animais que convivem com outros cães em casa ou na rua apresentaram prevalência maior de anticorpos para o CDV e o CCoV do que cães sem contato ou convívio, enquanto que, para o CPV e o CAV, não houve diferença. Esses resultados demonstram que esses vírus estão difundidos na população canina dos bairros da cidade. Por outro lado, demonstram também que uma parte considerável da população é soronegativa e, portanto, está desprotegida frente a esses agentes, indicando a necessidade de se ampliar a cobertura vacinal.Canine distemper virus (CDV, parvovirus (CPV, adenovirus (CAV and coronavirus (CCoV infections have been associated with significant morbidity and mortality among dogs worldwide yet very little is known about these infections in Brazil. As to determine the prevalence of these infections in the canine population of Santa Maria, RS, Brazil, 817 blood samples were collected from non-vaccinated dogs of 14 neighborhoods and tested for specific antibodies. Antibodies to CDV were detected in 27.3% (223/817 of

  2. Influence of maternally-derived antibodies in 6-week old dogs for the efficacy of a new vaccine to protect dogs against virulent challenge with canine distemper virus, adenovirus or parvovirus

    OpenAIRE

    Wilson, Stephen; Siedek, Elisabeth; Thomas, Anne; King, Vickie; Stirling, Catrina; Plevová, Edita; Salt, Jeremy; Sture, Gordon

    2014-01-01

    The results from three studies determining the efficacy of a canine multivalent vaccine in the presence of maternal antibodies are reported. Each study used 15 six week old dogs; five dogs were sero-negative; the remaining 10 had maternally derived antibodies to CDV, CAV and CPV. The five MDA-negative dogs and five of the MDA-positive dogs were vaccinated twice with the vaccine while the remaining 5 MDA-positive dogs were administered sterile water. According to EU guidelines for MDA studies ...

  3. Clinical and molecular investigation of a canine distemper outbreak and vector-borne infections in a group of rescue dogs imported from Hungary to Switzerland.

    Science.gov (United States)

    Willi, Barbara; Spiri, Andrea M; Meli, Marina L; Grimm, Felix; Beatrice, Laura; Riond, Barbara; Bley, Tim; Jordi, Rolf; Dennler, Matthias; Hofmann-Lehmann, Regina

    2015-07-16

    Canine distemper virus (CDV) is a major pathogen of dogs and wild carnivores worldwide. In Switzerland, distemper in domestic dogs is rarely reported. In recent years, the import of dogs from Eastern Europe to Switzerland has steadily increased. In the present study, we describe a distemper outbreak in 15 rescue dogs that were imported from Hungary to Switzerland by an animal welfare organisation. The data on vaccination and medical history were recorded (14 dogs), and the samples were collected to investigate CDV and vector-borne infections (13 dogs) and canine parvovirus infection (12 dogs). The dogs were monitored for six months. One dog was euthanised directly after import. Thirteen dogs showed clinical signs after arrival, i.e., diarrhoea (57 %), coughing (43 %) and nasal and/or ocular discharge (21 %); radiographic findings that were compatible with bronchopneumonia were present in four dogs. CDV infection was diagnosed in 11 dogs (85 %); 10 dogs (91 %) tested PCR-positive in conjunctival swabs. Vector-borne infections (Babesia spp., Leishmania infantum, Dirofilaria immitis) were found in 4 dogs (31 %). Three dogs were hospitalized, and six dogs received ambulatory therapy for up to two months until recovery. None of the dogs developed neurological disease. CDV shedding was detected for a period of up to four months. Because dogs were put under strict quarantine until CDV shedding ceased, CDV did not spread to any other dogs. The CDV isolates showed 99 % sequence identity in the HA gene among each other and belonged to the Arctic-like lineage of CDV. The present study highlights the imminent risks of spreading contagious viral and vector-borne infections through the non-selective import of sick dogs and dogs with incomplete vaccination from Eastern Europe. CDV shedding was detected for several months after the cessation of clinical signs, which emphasised the roles of asymptomatic carriers in CDV epidemiology. A long-term follow-up using sensitive PCR and

  4. Phocine Distemper Virus in Northern Sea Otters in the Pacific Ocean, Alaska, USA

    Science.gov (United States)

    Mazet, Jonna A.K.; Gill, Verena A.; Doroff, Angela M.; Burek, Kathy A.; Hammond, John A.

    2009-01-01

    Phocine distemper virus (PDV) has caused 2 epidemics in harbor seals in the Atlantic Ocean but had never been identified in any Pacific Ocean species. We found that northern sea otters in Alaska are infected with PDV, which has created a disease threat to several sympatric and decreasing Pacific marine mammals. PMID:19523293

  5. 9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).

    Science.gov (United States)

    2010-01-01

    ... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...

  6. In search of virus carriers of the 1988 and 2002 phocine distemper virus outbreaks in European harbour seals

    NARCIS (Netherlands)

    Kreutzer, M.; Kreutzer, R.; Siebert, U.; Muller, G.; Reijnders, P.J.H.; Brasseur, S.M.J.M.; Harkonen, T.; Dietz, R.; Sonne, C.; Born, E.W.; Baumgartner, W.

    2008-01-01

    European harbour seal (Phoca vitulina) populations decreased substantially during the phocine distemper virus (PDV) outbreaks of 1988 and 2002. Different hypotheses have stated that various seals and terrestrial carnivore species might be the source of infection. To further analyse these hypotheses,

  7. Canine parvovirus infection, canine distemper and infectious canine hepatitis: inclination to vaccinate and antibody response in the Swedish dog population.

    Science.gov (United States)

    Olson, P; Hedhammar, A; Klingeborn, B

    1996-01-01

    The inclination of dog owners to vaccinate was investigated by sending a questionnaire to randomly selected Swedish dog-owning households. According to the owners (n = 538), 86.7% of the dogs had been vaccinated against CPV and 95.8% had been vaccinated against CD/ICH. The inclination to vaccinate mixed breeds was significantly lower than the inclination to vaccinate pure-bred dogs. In a second study titres of CPV, CD and CAV-1 virus antibodies were measured in 176 randomly selected dogs with known vaccination histories. CPV antibody titres > or = 1:80 were detected in 70.9% of the CPV vaccinated dogs. There was a significant difference in the fraction of dogs with CPV titre > or = 1:80 between the group last vaccinated with live attenuated vaccine and the group last vaccinated with inactivated vaccine. Titres of CD and CAV-1 virus antibodies > or = 1:16 were found in 86.1% and 91.6% of the vaccinated dogs respectively. The fraction of dogs with CAV-1 antibody titres > or = 1:16 was significantly greater in the group that received inactivated CAV-1 vaccine than in the group vaccinated with attenuated live CAV-2 vaccine. Approximately 50% of the dogs were booster vaccinated against all 3 diseases at one year of age.

  8. Post-vaccinal distemper encephalitis in two Border Collie cross littermates.

    Science.gov (United States)

    Fairley, R A; Knesl, O; Pesavento, P A; Elias, B C

    2015-03-01

    One 4.5-month-old male Border Collie cross presented with aggression and seizures in October 2006. A 16-month-old, female, spayed Border Collie cross presented with hypersalivation and a dropped jaw and rapidly became stuporous in September 2007. The dogs were littermates and developed acute neurological signs 5 and 27 days, respectively, after vaccination with different modified live vaccines containing canine distemper virus. Sections of brain in both dogs showed evidence of encephalitis mainly centred on the grey matter of brainstem nuclei, where there was extensive and intense parenchymal and perivascular infiltration of histiocytes and lymphocytes. Intra-nuclear and intra-cytoplasmic inclusions typical of distemper were plentiful and there was abundant labelling for canine distemper virus using immunohistochemistry. Post-vaccinal canine distemper. Post-vaccinal canine distemper has mainly been attributed to virulent vaccine virus, but it may also occur in dogs whose immunologic nature makes them susceptible to disease induced by a modified-live vaccine virus that is safe and protective for most dogs.

  9. Phylogenetic evidence of canine distemper virus in Serengeti's lions.

    NARCIS (Netherlands)

    T.C. Harder (Timm); M.J.H. Kenter (Marcel); M.J.G. Appel (Max); M.E. Roelke-Parker (Melody); T. Barrett (Thomas); A.D.M.E. Osterhaus (Albert)

    1995-01-01

    textabstractRecently an epizootic, reported to be due to a morbillivirus infection, affected the lion population of the Tanzanian Serengeti National Park. A morbillivirus phosphoprotein (P) gene fragment was amplified by PCR from tissue samples of several affected lions. Sequencing of the

  10. GAMBARAN PATOLOGI PARU-PARU PADA ANJING LOKAL BALI YANG TERINFEKSI PENYAKIT DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Made Kardena

    2012-11-01

    Full Text Available Canine distemper is a contagious disease, which can infect any dog species includingdomestic dog in Bali. This research used ten domestic dogs in Bali, which were naturallyinfected with canine distemper virus and have been positively confirmed by laboratory testusing RT-PCR method. Lung tissue changes have been identified on gross pathologicalobservation, i.e.: on average the lungs were changed in color and size. The lungs mainlychanged into pale or darker; in addition, the lungs tended to become bigger. Mean while,the septa alveoli of the lungs observed thicker and were infiltrated by inflammatory cells.This tissue changes indicated that canine distemper virus which infected domestic dog inBali caused inflammatory reaction in lung, which is known as interstitial pneumoniainterstitial. These changes implied to be related to the disturbance of the respiration tract,which was accompanied by mucus-purulent exudates

  11. 9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...

  12. Distemper Outbreak and Its Effect on African Wild Dog Conservation

    Science.gov (United States)

    van de Bildt, Marco W.G.; Kuiken, Thijs; Visee, Aart M.; Lema, Sangito; Fitzjohn, Tony R.

    2002-01-01

    In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species. PMID:11897078

  13. The Role of the Hendra Virus and Nipah Virus Attachment Glycoproteins in Receptor Binding and Antibody Neutralization

    Science.gov (United States)

    2014-01-31

    of important human (measles (MeV), mumps, human parainfluenza and respiratory syncytial virus (RSV)) and animal ( canine distemper virus (CDV...occurrence of a natural canine infection (6; 7). Since the emergence of HeV there have been a total of 86 horse fatalities, 2 canine infections and 7...Infectious Diseases 6. Anonymous. 2011. HENDRA VIRUS, EQUINE - AUSTRALIA (21): (QUEENSLAND) CANINE . Pro-Med-mail, Archive No. 20110802.2324

  14. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    Science.gov (United States)

    2003-01-01

    including measles virus (MeV), mumps virus, Sendai virus (SeV), Newcastle disease virus (NDV), rinderpest virus, canine distemper virus (CDV), human...Institute of Health, Bethesda, MD. Hut 102, MT2, MT4, and CEM human T cell lines were provided by Chou-Zen Giam, USUHS, Bethesda, MD. The human osteosarcoma

  15. Use of modified live feline panleukopenia virus vaccine to immunize dogs against canine parvovirus.

    Science.gov (United States)

    Pollock, R V; Carmichael, L E

    1983-02-01

    Modified live feline panleukopenia virus (FPLV) vaccine protected dogs against canine parvovirus (CPV) infection. However, unlike the long-lived (greater than or equal to 20-month) immunity engendered by CPV infection, the response of dogs to living FPLV was variable. Doses of FPLV (snow leopard strain) in excess of 10(5.7) TCID50 were necessary for uniform immunization; smaller inocula resulted in decreased success rates. The duration of immunity, as measured by the persistence of hemagglutination-inhibiting antibody, was related to the magnitude of the initial response to vaccination; dogs with vigorous initial responses resisted oronasal CPV challenge exposure 6 months after vaccination, and hemagglutination-inhibiting antibodies persisted in such dogs for greater than 1 year. Limited replication of FPLV in dogs was demonstrated, but unlike CPV, the feline virus did not spread to contact dogs or cats. Adverse reactions were not associated with living FPLV vaccination, and FPLV did not interfere with simultaneous response to attenuated canine distemper virus.

  16. Ocelots on Barro Colorado Island are infected with feline immunodeficiency virus but not other common feline and canine viruses.

    Science.gov (United States)

    Franklin, Samuel P; Kays, Roland W; Moreno, Ricardo; TerWee, Julie A; Troyer, Jennifer L; VandeWoude, Sue

    2008-07-01

    Transmission of pathogens from domestic animals to wildlife populations (spill-over) has precipitated local wildlife extinctions in multiple geographic locations. Identifying such events before they cause population declines requires differentiating spillover from endemic disease, a challenge complicated by a lack of baseline data from wildlife populations that are isolated from domestic animals. We tested sera collected from 12 ocelots (Leopardus pardalis) native to Barro Colorado Island, Panama, which is free of domestic animals, for antibodies to feline herpes virus, feline calicivirus, feline corona virus, feline panleukopenia virus, canine distemper virus, and feline immunodeficiency virus (FIV), typically a species-specific infection. Samples also were tested for feline leukemia virus antigens. Positive tests results were only observed for FIV; 50% of the ocelots were positive. We hypothesize that isolation of this population has prevented introduction of pathogens typically attributed to contact with domestic animals. The high density of ocelots on Barro Colorado Island may contribute to a high prevalence of FIV infection, as would be expected with increased contact rates among conspecifics in a geographically restricted population.

  17. Vaccination of Ferrets for Rabies and Distemper.

    Science.gov (United States)

    Wade, Laura L

    2018-01-01

    Companion ferrets need to be vaccinated against 2 viral diseases that cause neurologic illness: canine distemper and rabies. Although not common in ferrets, both viruses are fatal in ferrets and rabies virus is also fatal in humans. In this article, we provide a basic review of the 2 diseases, highlighting key neurologic concerns. We also review and update current vaccine concerns from a practitioner's perspective, including available vaccines, vaccine schedule recommendations, vaccine reactions, and risk assessment. Last, we mention the ferret and its use in cutting-edge vaccine development. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Effects of subclinical inflammation on C-reactive protein and haptoglobin levels as well as specific humoral immunity in dogs vaccinated against canine distemper and parvovirus.

    Science.gov (United States)

    Romiszewski, Przemysław; Kostro, Krzysztof; Lisiecka, Urszula

    2018-03-05

    The aim of the present study was to assess the effects of subclinical inflammation on specific humoral immunity in dogs vaccinated with Nobivac® DHP based on serum levels of CRP and Hp. Dogs from the group I were administered Nobivac® DHP, the vaccine against distemper, infectious hepatitis and parvovirus whereas group II animals received subcutaneous turpentine oil to induce subclinical inflammation, followed by Nobivac® DHP after 24 h. Animals in group III received only turpentine oil in the way and amount identical to that as in group II. Nobivac DHP relatively poorly induced the immune inflammatory response showing good immunogenic properties, which was evidenced by only a double increase in mean CRP and Hp levels associated with antigenic stimulation in group I. In group II, serum neutralization (SN) and haemagglutination inhibition (HI) results were quite closely correlated with serum levels of CPR and Hp. Our findings suggest that the efficacy of vaccinations in dogs can be significantly affected by subclinical inflammations, which is indicated by a correlation between serum CRP and Hp levels versus antibody titres for canine distemper and parvovirus in both experimental groups of dogs (group I and II). The correlation of mean CRP and Hp values in dogs with subclinical inflammation and after vaccination with the kinetics of increasing antibody titres against distemper and parvovirus in group II dogs reflects the severity of inflammatory response and the extent of specific humoral immunity. Routine determinations of serum CRP and Hp levels as the indices of inflammation severity can be the essential biochemical markers for assessment of dogs' health in the period preceding specific immunoprophylaxis and efficacy of the vaccine.

  19. Use of SLAM and PVRL4 and identification of pro-HB-EGF as cell entry receptors for wild type phocine distemper virus.

    Directory of Open Access Journals (Sweden)

    Mary M Melia

    Full Text Available Signalling lymphocyte activation molecule (SLAM has been identified as an immune cell receptor for the morbilliviruses, measles (MV, canine distemper (CDV, rinderpest and peste des petits ruminants (PPRV viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4, also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG and the tetraspan proteins, integrin β and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF,for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin β antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation.

  20. Immunohistochemical detection of metalloproteinase-9 (MMP-9, anti-oxidant like 1 protein (AOP-1 and synaptosomal-associated protein (SNAP-25 in the cerebella of dogs naturally infected with spontaneous canine distemper

    Directory of Open Access Journals (Sweden)

    Tereza C. Cardoso

    2011-04-01

    Full Text Available In most viral infections of the central nervous system (CNS, the integrity of brain extracelluar matrix (ECM, oxidative stress and dysfunction in neuronal transmission may contribute to the observed pathology. The purpose of this study was to investigate the role of these factors in demyelinating canine distemper virus (CDV infections. Regardless of ECM integrity, the expression of metalloproteinase-9 (MMP-9 was visualized in microglial-like cells, whereas the expression of anti-oxidant like-1 (AOP-1 and synaptosomal associated protein (SNAP-25 was frequently detected in Purkinje cells (r2 = 0.989; p < 0.05, regardless of whether the lesions were classified as acute or chronic. Increased numbers of immunolabeled microglia-like cells and reactive gliosis were observed in advanced cases of demyelinating CDV, suggesting that the expression of AOP-1 and SNAP-25 is correlated with the ultimate death of affected cells. Our findings bring a new perspective to understanding the role of the AOP-1, MMP-9 and SNAP-25 proteins in mediating chronic leukoencephalitis caused by CDV. (Folia Histochemica et Cytobiologica 2011; Vol. 49, No. 1, pp. 41–48

  1. Stage-structured transmission of phocine distemper virus in the Dutch 2002 outbreak

    Science.gov (United States)

    Klepac, Petra; Pomeroy, Laura W.; Bjørnstad, Ottar N.; Kuiken, Thijs; Osterhaus, Albert D.M.E.; Rijks, Jolianne M.

    2009-01-01

    Heterogeneities in transmission among hosts can be very important in shaping infectious disease dynamics. In mammals with strong social organization, such heterogeneities are often structured by functional stage: juveniles, subadults and adults. We investigate the importance of such stage-related heterogeneities in shaping the 2002 phocine distemper virus (PDV) outbreak in the Dutch Wadden Sea, when more than 40 per cent of the harbour seals were killed. We do this by comparing the statistical fit of a hierarchy of models with varying transmission complexity: homogeneous versus heterogeneous mixing and density- versus frequency-dependent transmission. We use the stranding data as a proxy for incidence and use Poisson likelihoods to estimate the ‘who acquires infection from whom’ (WAIFW) matrix. Statistically, the model with strong heterogeneous mixing and density-dependent transmission was found to best describe the transmission dynamics. However, patterns of incidence support a model of frequency-dependent transmission among adults and juveniles. Based on the maximum-likelihood WAIFW matrix estimates, we use the next-generation formalism to calculate an R0 between 2 and 2.5 for the Dutch 2002 PDV epidemic. PMID:19364743

  2. Oncolytic virotherapy in veterinary medicine: current status and future prospects for canine patients

    Directory of Open Access Journals (Sweden)

    Patil Sandeep S

    2012-01-01

    Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.

  3. [Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].

    Science.gov (United States)

    Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng

    2009-09-01

    To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.

  4. Genetic characterization of canine influenza A virus (H3N2) in Thailand.

    Science.gov (United States)

    Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn

    2014-02-01

    In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.

  5. Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.

    OpenAIRE

    McMaster, G K; Tratschin, J D; Siegl, G

    1981-01-01

    The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.

  6. Movements and site fidelity of harbour seals (Phoca vitulina) in Kattegat, Denmark, with implications for the epidemiology of the phocine distemper virus

    DEFF Research Database (Denmark)

    Dietz, R.; Teilmann, J.; Andersen, S.M.

    2013-01-01

    Twenty-seven harbour seals were caught and tagged at the island of Anholt in central Kattegat, Denmark, the epicentre of the phocine distemper virus (PDV) outbreaks in 1988 and 2002 that killed 50–60% of the populations. The satellite tagging shows that harbour seals from Anholt moved widely across...

  7. Perfil hematológico e avaliação eletroforética das proteínas séricas de cães com cinomose Hematological profile and electrophoretic evaluation of serum proteins of dogs with canine distemper

    Directory of Open Access Journals (Sweden)

    I.N.G. Silva

    2005-02-01

    Full Text Available The hematological and serum proteins electrophoretic profiles of 13 dogs with distemper (Lentz inclusion body in leukocytes were studied. The most frequent hematological findings were: normocitic normocromic anemia (61%, leukopenia (46%, left shount (54%, trombocytopenia (69% and lymphopenia (85%. Electrophoretic analysis of serum proteins showed hypoproteinemia (54%, with reduced albumin and increased alfa-2 globulin. These findings can be used to support the clinical diagnosis of canine distemper.

  8. Virological and serological findings in dogs with naturally occurring distemper.

    Science.gov (United States)

    Elia, Gabriella; Camero, Michele; Losurdo, Michele; Lucente, Maria Stella; Larocca, Vittorio; Martella, Vito; Decaro, Nicola; Buonavoglia, Canio

    2015-03-01

    Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. The unpredictable and variable course of CDV-related disease may hamper correct diagnosis of infection and makes it crucial the collection of samples suitable for laboratory confirmation. In the present study we were able to follow the disease in two dogs infected naturally, collecting different biological matrices during the entire period of infection. By real time RT-PCR, viral RNA was detected and quantified, suggesting that urine and rectal swabs would be useful for ante-mortem diagnosis of distemper in dogs, regardless of the clinical stage and form of the illness. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. [The prevention of distemper in zoo animals].

    Science.gov (United States)

    Franke, V; Matern, B; Ackermann, O; Danner, K

    1989-02-01

    The distemper virus infection of different non-domestic carnivorous zoo animals is known since long. All species involved belonged to the suborder Fissipedia. In 1988 a distemper or morbillivirus-like infection occurred in harbour seals, a member of the suborder pinnipedia. For the prophylaxis of distemper in dogs attenuated live vaccines are commonly used. In zoo animals, however, these vaccines caused distemper several times. In contrast, an inactivated virus vaccine proved both its safety and efficacy in more than hundred zoo animals of various species.

  10. Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers

    NARCIS (Netherlands)

    van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.

    2012-01-01

    In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic

  11. Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

    OpenAIRE

    Povey, C.

    1982-01-01

    A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...

  12. Long-lived immunity to canine core vaccine antigens in UK dogs as assessed by an in-practice test kit.

    Science.gov (United States)

    Killey, R; Mynors, C; Pearce, R; Nell, A; Prentis, A; Day, M J

    2018-01-01

    To determine the utility of an in-practice test kit to detect protective serum antibody against canine distemper virus, canine adenovirus and canine parvovirus type 2 in a sample of the UK dog population. Serum samples from 486 dogs, last vaccinated between less than 1 month and 124 months previously, were tested with the VacciCheck™ test kit for protective antibodies against distemper, adenovirus and parvovirus type 2. A high proportion of the dogs tested (93·6%) had protective antibody against all three of the core vaccine antigens: 95·7% of the dogs were seropositive against canine distemper virus, 97·3% against canine adenovirus and 98·5% against canine parvovirus type 2. The small number of dogs that were seronegative for one or more of the antigens (n = 31) may have had waning of previous serum antibody or may have been rare genetic non-responders to that specific antigen. UK veterinarians can be reassured that triennial revaccination of adult dogs with core vaccines provides long-lived protective immunity. In-practice serological test kits are a valuable tool for informing decision-making about canine core revaccination. © 2017 British Small Animal Veterinary Association.

  13. Prevalence of canine distemper virus in wild mustelids in the Czech Republic and a case of canine distemper in young stone martens

    Czech Academy of Sciences Publication Activity Database

    Pavlačík, L.; Celer, V.; Koubek, Petr; Literák, I.

    2007-01-01

    Roč. 52, č. 2 (2007), s. 69-73 ISSN 0375-8427 R&D Projects: GA AV ČR IBS6093003 Institutional research plan: CEZ:AV0Z60930519 Keywords : genus Morbillivirus * direct immunofluorescence test * serology * Eurasian badger * stone marten Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.645, year: 2007 http://www.vri.cz/docs/vetmed/52-2-69.pdf

  14. Canine distemper virus and Toxoplasma gondii co-infection in dogs with neurological signs

    Directory of Open Access Journals (Sweden)

    D.M. Aguiar

    2012-02-01

    Full Text Available O presente estudo relata a ocorrência de co-infecção entre o vírus da cinomose canina (CDV e Toxoplama gondii em cães com sinais neurológicos. Amostras de soro e tecido nervoso (pos-mortem de 21 cães, suspeitos de cinomose canina foram analisadas pela Reação de Imunofluorecência indireta (RIFI para pesquisa de anticorpos contra T. gondii e N. caninum e por RT-PCR para CDV. Dezessete (80,9% cães foram positivos para o CDV pela RT-PCR e 8 (38,1% foram positivos para anticorpos contra T. gondii. Sete cães (41,1% apresentaram-se positivos para ambos agentes, caracterizando processo de co-infecção. Somente 1 (4,7% cão foi soropositivo para N. caninum (RIFI=100, entretanto este mesmo animal foi positivo para T. gondii (RIFI=4096 e para CDV (RT-PCR.

  15. Host response during acute canine distemper virus infections in naive and DNA immunized mink

    DEFF Research Database (Denmark)

    Nielsen, Line

    SAMMENDRAG (DANISH SUMMARY) Mink blev inokuleret med to forskellige vildtype hundesygevirus (CDV) stammer fra forskellige genotyper. DK91 stammen repræsenter de europæiske genotyper isoleret efter 1990, mens Snyder Hill stammen repræsenter de gamle amerikanske genotyper isoleret før 1960. De to C...

  16. Parasites in harbour seals ( Phoca vitulina) from the German Wadden Sea between two Phocine Distemper Virus epidemics

    Science.gov (United States)

    Lehnert, K.; Raga, J. A.; Siebert, U.

    2007-12-01

    Parasites were collected from 107 harbour seals ( Phoca vitulina) found on the coasts of Schleswig-Holstein, Germany, between 1997 and 2000. The prevalence of the parasites and their associated pathology were investigated. Eight species of parasites, primarily nematodes, were identified from the examined organs: two anisakid nematodes ( Pseudoterranova decipiens (sensu lato) , Contracaecum osculatum (sensu lato)) from the stomach, Otostrongylus circumlitus (Crenosomatidae) and Parafilaroides gymnurus (Filaroididae) from the respiratory tract, one filarioid nematode ( Acanthocheilonema spirocauda) from the heart, two acanthocephalans, Corynosoma strumosum and C. semerme (Polymorphidae), from the intestine and an ectoparasite, Echinophthirius horridus (Anoplura, Insecta). Lungworm infection was the most prominent parasitological finding and secondary bacterial bronchopneumonia the most pathogenic lesion correlated with the parasites. Heavy nematode burdens in the respiratory tract were highly age-related and more frequent in young seals. A positive correlation was observed between high levels of pulmonary infection and severity of bronchopneumonia. The prevalence of lungworms in this study was higher than in seals that died during the 1988/1989 Phocine Distemper Virus epidemic, and the prevalence of acanthocephalans and heartworms had decreased compared to findings from the first die-off.

  17. Aspectos clinicopatológicos de 620 casos neurológicos de cinomose em cães: Clinicopathological features in 620 neurological cases of canine distemper

    Directory of Open Access Journals (Sweden)

    Marcia C. Silva

    2007-05-01

    ,7% dos cães idosos. Somente encefalite não-supurativa foi descrita em 11,6% dos filhotes, 7,5% dos adultos e 7,1% dos cães idosos.The files of 5,361 necropsies performed in dogs in the Veterinary Pathology Laboratory of the Federal University of Santa Maria during 1965-2006 were reviewed in search of cases of canine distemper. Six hundred and eighty three cases (12.7% of the disease were found, 620 of which had neurological signs. From those 620, the following data on each case were retrieved: age, clinical signs, histopathology and concomitance or not of another disease. Age groups were classified as puppies (up to 1 year of age, adults (from 1 to 9 years and aged (from 10 years on. In 565 out of the 620 (91.1% neurological cases of canine distemper, histopathological brain changes were observed and in 554 of those 565 the age was registered in the files with following age group distribution: 45.9% of puppies, 51.4% of adults, and 2.7% of aged dogs. Neurological clinical signs encompassed a large spectrum of motor, postural and behavioral disturbances which could occur together or individually. Most frequent clinical signs were myoclonus (38.4%, motor incoordination (25.0%, seizures (18.5%, and paraplegia (13.4%. In 98.4% of the 565 dogs with histopathological changes in the brain demyelination, non-suppurative encephalitis or a combination of these two were found. Intranuclear eosinophilic inclusion bodies were observed in different brain cells of 343 of the 565 dogs with histopathological changes. In 170 (49.6% the cellular type bearing the inclusions was not mentioned in the file and in the remaining cases the inclusions were seen in astrocytes (94.8% of the cases, neurons (3.5%, oligodendrocytes (1.1%, and ependyma cells (0.6%. Taking in consideration the type of lesions and the age groups, cases with combined demyelination and non-suppurative encephalitis occurred in 40.0% of the puppies, 51.2% of the adult dogs and 72.7% of the aged dogs. Demyelination alone

  18. Development of a one-step duplex RT-qPCR for the quantification of phocine distemper virus.

    Science.gov (United States)

    Bogomolni, Andrea L; Frasca, Salvatore; Matassa, Keith A; Nielsen, Ole; Rogers, Kara; De Guise, Sylvain

    2015-04-01

    Worldwide, stranded marine mammals and the network personnel who respond to marine mammal mortality have provided much of the information regarding marine morbillivirus infections. An assay to determine the amount of virus present in tissue samples would be useful to assist in routine surveying of animal health and for monitoring large-scale die-off events. False negatives from poor-quality samples prevent determination of the true extent of infection, while only small amounts of tissue samples or archived RNA may be available at the time of collection for future retrospective analysis. We developed a one-step duplex real-time reverse transcriptase-quantitative-PCR assay (RT-qPCR) based on Taqman probe technology to quantify phocine distemper virus (PDV) isolated from an outbreak in harbor (Phoca vitulina concolor) and gray seals (Halichoerus grypus) along the northeast US coast in 2006. The glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) gene was selected to assess RNA quality. This duplex assay is specific for PDV and sensitive through a range of 10(0) to 10(9) copies ds-plasmid DNA. For the GAPDH target, the reaction in duplex amplified 10(0) to 10(9) copies of ds-plasmid DNA and was detectable in multiple seal species. This assay reduced the likelihood of false negative results due to degradation of tissues and well-to-well variability while providing sensitive and specific detection of PDV, which would be applicable in molecular epidemiologic studies and pathogen detection in field and laboratory investigations involving a variety of seal species.

  19. Development of a Vaccine Incorporating Killed Virus of Canine Origin for the Prevention of Canine Parvovirus Infection

    Science.gov (United States)

    Povey, C.

    1982-01-01

    A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811

  20. Presence of infectious RD-114 virus in a proportion of canine parvovirus isolates.

    Science.gov (United States)

    Yoshikawa, Rokusuke; Sato, Eiji; Miyazawa, Takayuki

    2012-03-01

    We recently found that certain canine live attenuated vaccines produced using `non-feline' cell lines were contaminated with an infectious feline endogenous retrovirus, termed RD-114 virus. We suspected that RD-114 virus may have contaminated the seed stock of canine parvovirus (CPV) during the production of the contaminated vaccines. In this study, we collected stock viruses of CPVs propagated in a feline cell line, and checked the presence of infectious RD-114 virus. Consequently, we found that RD-114 viral RNA was present in all stock viruses, and 7 out of 18 stock viruses were contaminated with infectious RD-114 virus. We also found that RD-114 virus was stable physically and is capable of retaining its infectivity for a long period at -80°C.

  1. Marcação imunoistoquímica da expressão astrocitária de proteína glial fibrilar ácida e de vimentina no sistema nervoso central de cães com cinomose Immunohistochemical staining of the astrocytic expression of glial fibrillary acidic protein and vimentin in the central nervous system of dogs with canine distemper

    Directory of Open Access Journals (Sweden)

    Heloísa Orsini

    2007-12-01

    immunohistochemical staining of two astrocytic proteins - glial fibrillary acidic protein (GFAP and vimentin (VIM -, comparing samples of cerebellum and brainstem from eight dogs with canine distemper and from two healthy dogs, from different breeds and ages varying from 1 to 4 years old. Histological sections were submitted to the avidin-biotin-peroxidase indirect method of immmunohistochemical staining (ABC and the astrocytic reactivity, observed in light microscopy, was quantified in a computer system for image analysis. It was possible to notice, on most of the sections from sick animals, degenerative lesions that indicate demyelination. The immunostaining for GFAP and VIM was more intense on animals with canine distemper, specially around the ventricules and near degenerated sites. There was no significant difference between the immunostaining (GFAP and VIM of animals with canine distemper with and without inflammatory infiltrate of the cerebellar white matter. The increased immunoreactivity of astrocytes for GFAP and the VIM reexpression in injured areas indicate the astrocytic involvement on nervous tissue response to the demyelinating lesions induced by the canine distemper virus (CDV in the CNS.

  2. Molecular surveillance of traditional and emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio

    2016-08-30

    A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Canine parvovirus type 2 vaccine protects against virulent challenge with type 2c virus.

    Science.gov (United States)

    Spibey, N; Greenwood, N M; Sutton, D; Chalmers, W S K; Tarpey, I

    2008-04-01

    The ability of dogs vaccinated with a live attenuated CPV type 2 (Nobivac Intervet) vaccine to resist challenge with a current CPV2c isolate was investigated. Six SPF beagle dogs were given the minimum recommended course of vaccination, comprising a single inoculation of vaccine (Nobivac Lepto+Nobivac Pi) at 8-10 weeks of age followed 3 weeks later with a parvovirus vaccine in combination with distemper, adenovirus and parainfluenza virus (Nobivac DHPPi) and a repeat leptospirosis vaccine. Six control dogs were kept unvaccinated. All animals were challenged orally with a type 2c isolate of CPV and monitored for clinical signs, virus shedding, white blood cell fluctuations and serological responses. All vaccinated dogs were fully protected; showing no clinical signs nor shedding challenge virus in the faeces, in contrast to control animals, which displayed all the typical signs of infection with pathogenic CPV and shed challenge virus in the faeces.

  4. Zymographic patterns of MMP-2 and MMP-9 in the CSF and cerebellum of dogs with subacute distemper leukoencephalitis.

    Science.gov (United States)

    Machado, Gisele F; Melo, Guilherme D; Souza, Milena S; Machado, Andressa A; Migliolo, Daniela S; Moraes, Olívia C; Nunes, Cáris M; Ribeiro, Erica S

    2013-07-15

    Distemper leukoencephalitis is a disease caused by the canine distemper virus (CDV) infection. It is a demyelinating disease affecting mainly the white matter of the cerebellum and areas adjacent to the fourth ventricle; the enzymes of the matrix metalloproteinases (MMPs) group, especially MMP-2 and MMP-9 have a key role in the myelin basic protein fragmentation and in demyelination, as well as in leukocyte traffic into the nervous milieu. To evaluate the involvement of MMPs during subacute distemper leukoencephalitis, we measured the levels of MMP-2 and MMP-9 by zymography in the cerebrospinal fluid (CSF) and in the cerebellum of 14 dogs naturally infected with CDV and 10 uninfected dogs. The infected dogs presented high levels of pro-MMP-2 in the CSF and elevated levels of pro-MMP-2 and pro-MMP-9 in the cerebellar tissue. Active MMP-2 was detected in the CSF of some infected dogs. As active MMP-2 and MMP-9 are required for cellular migration across the blood-brain barrier and any interference between MMPs and their inhibitors may result in an amplification of demyelination, this study gives additional support to the involvement of MMPs during subacute distemper leukoencephalitis and suggests that MMP-2 and MMP-9 may take part in the brain inflammatory changes of this disease. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Phocine Distemper in German Seals, 2002

    Science.gov (United States)

    Wohlsein, Peter; Beineke, Andreas; Haas, Ludwig; Greiser-Wilke, Irene; Siebert, Ursula; Fonfara, Sonja; Harder, Timm; Stede, Michael; Gruber, Achim.D.; Baumgärtner, Wolfgang

    2004-01-01

    Approximately 21,700 seals died during a morbillivirus epidemic in northwestern Europe in 2002. Phocine distemper virus 1 was isolated from seals in German waters. The sequence of the P gene showed 97% identity with the Dutch virus isolated in 1988. There was 100% identity with the Dutch isolate from 2002 and a single nucleotide mismatch with the Danish isolate. PMID:15200869

  6. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  7. Immunoglobulin E antibodies to pollens augmented in dogs by virus vaccines.

    Science.gov (United States)

    Frick, O L; Brooks, D L

    1983-03-01

    An inbred "atopic dog colony" was established to study the effect of viruses on immunoregulation of immunoglobulin (Ig) E antibodies. Dogs were selected for high skin reactivity to grass and weed pollens. Their offspring were inoculated with pollen extracts in alum immediately after routine vaccinations (attenuated live-virus vaccines for canine distemper and infectious canine hepatitis, and a killed bacterin for Leptospira). Heat labile antipollen IgE antibodies were measured by passive cutaneous anaphylaxis. Pups vaccinated for canine distemper before being given pollen extracts had many more IgE antibodies than did their control littermates who were not vaccinated until after the last pollen extract injection. This may be a natural example of the "allergic break-through phenomenon."

  8. Inactivated recombinant plant virus protects dogs from a lethal challenge with canine parvovirus

    DEFF Research Database (Denmark)

    Langeveld, J.P.M.; Brennan, F.R.; Martinez-Torrecuadrada, J.L.

    2001-01-01

    A vaccine based upon a recombinant plant virus (CPMV-PARVO1), displaying a peptide derived from the VP2 capsid protein of canine parvovirus (CPV), has previously been described. To date, studies with the vaccine have utilized viable plant chimaeric particles (CVPs). In this study, CPMV-PARVO1...

  9. Three-year serologic immunity against canine parvovirus type 2 and canine adenovirus type 2 in dogs vaccinated with a canine combination vaccine.

    Science.gov (United States)

    Larson, L J; Schultz, R D

    2007-01-01

    A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.

  10. Alterações citológicas do sangue periférico e da medula óssea de cães com cinomose Cytological alterations of the bone marrow and peripheral blood of dogs with canine distemper

    Directory of Open Access Journals (Sweden)

    R.K. Almeida

    2009-12-01

    Full Text Available Avaliaram-se o mielograma, o hemograma e a ocorrência de apoptose no sangue periférico e na medula óssea de cães com cinomose de ocorrência natural. Foram utilizados 15 cães distribuídos em dois grupos: (a controle - seis animais clinicamente saudáveis com RT-PCR negativa para o vírus da cinomose canina (CC; (b infectado - nove animais com manifestações clínicas de CC e RT-PCR positiva. Dos cães com CC, oito (88,9% apresentaram anemia discreta a moderada (hematócrito: 30,6%, normocítica (VCM: 67,9fL e normocrômica (CHCM: 34,1g/dL. Todos os animais apresentaram contagens médias normais de leucócitos totais (11600 células/µL e neutrófilos segmentados (8802 células/µL. Linfopenia foi observada em cinco animais (55,6% e desvio nuclear dos neutrófilos para a esquerda em oito (88,9%. As contagens médias de linfócitos e neutrófilos bastonetes foram, respectivamente, 1054 e 1508células/µL. No mielograma, todos os animais apresentaram celularidade e relação M:E dentro dos limites de referência. O hemograma e a medula óssea dos cães-controle não apresentaram alteração e não havia células em apoptose no esfregaço sanguíneo desses animais. Nos cães com CC, a média do índice apoptótico foi 0,73% no esfregaço sanguíneo e 1,87% na medula óssea. A apoptose, portanto, pode estar envolvida na patogênese das alterações hematológicas observadas na CC.The myelogram, the hemogram, and the occurrence of apoptosis in peripheral blood and bone marrow in dogs with canine distemper (CD of natural occurrence were studied. Fifteen dogs were distributed into two groups: (a control - six clinically healthy animals with RT-PCR negative for canine distemper virus (CDV; and (b infected - nine animals showing clinical CD manifestations and RT-PCR positive. The majority of dogs with CD (88.9% presented discrete to moderate (hematocrit: 30.6%, normocytic (MCH: 67.9fL and normochromic (MCHC: 34.1g/dL anemia. All animals showed

  11. Development of new therapy for canine mammary cancer with recombinant measles virus

    Directory of Open Access Journals (Sweden)

    Koichiro Shoji

    2016-01-01

    Full Text Available Oncolytic virotherapy is a promising treatment strategy for cancer. We previously generated a recombinant measles virus (rMV-SLAMblind that selectively uses a poliovirus receptor-related 4 (PVRL4/Nectin4 receptor, but not signaling lymphocyte activation molecule (SLAM. We demonstrated that the virus exerts therapeutic effects against human breast cancer cells. Here, we examined the applicability of rMV-SLAMblind to treating canine mammary cancers (CMCs. We found that the susceptibilities of host cells to rMV-SLAMblind were dependent on canine Nectin-4 expression. Nectin-4 was detected in four of nine CMC cell lines. The rMV-SLAMblind efficiently infected those four Nectin-4-positive cell lines and was cytotoxic for three of them (CF33, CHMm, and CTBm. In vivo experiment showed that the administration of rMV-SLAMblind greatly suppressed the progression of tumors in mice xenografted with a CMC cell line (CF33. Immunohistochemistry revealed that canine Nectin-4 was expressed in 45% of canine mammary tumors, and the tumor cells derived from one clinical specimen were efficiently infected with rMV-SLAMblind. These results suggest that rMV-SLAMblind infects CMC cells and displays antitumor activity in vitro, in xenografts, and ex vivo. Therefore, oncolytic virotherapy with rMV-SLAMblind can be a novel method for treating CMCs.

  12. Two potential recombinant rabies vaccines expressing canine parvovirus virion protein 2 induce immunogenicity to canine parvovirus and rabies virus.

    Science.gov (United States)

    Luo, Jun; Shi, Hehe; Tan, Yeping; Niu, Xuefeng; Long, Teng; Zhao, Jing; Tian, Qin; Wang, Yifei; Chen, Hao; Guo, Xiaofeng

    2016-08-17

    Both rabies virus (RABV) and canine parvovirus (CPV) cause lethal diseases in dogs. In this study, both high egg passage Flury (HEP-Flury) strains of RABV and recombinant RABV carrying double RABV glycoprotein (G) gene were used to express the CPV virion protein 2 (VP2) gene, and were designated rHEP-VP2 and, rHEP-dG-VP2 respectively. The two recombinant RABVs maintained optimal virus titration according to their viral growth kinetics assay compared with the parental strain HEP-Flury. Western blotting indicated that G protein and VP2 were expressed in vitro. The expression of VP2 in Crandell feline kidney cells post-infection by rHEP-VP2 and rHEP-dG-VP2 was confirmed by indirect immunofluorescence assay with antibody against VP2. Immunogenicity of recombinant rabies viruses was tested in Kunming mice. Both rHEP-VP2 and rHEP-dG-VP2 induced high levels of rabies antibody compared with HEP-Flury. Mice immunized with rHEP-VP2 and rHEP-dG-VP2 both had a high level of antibodies against VP2, which can protect against CPV infection. A challenge experiment indicated that more than 80% mice immunized with recombinant RABVs survived after infection of challenge virus standard 24 (CVS-24). Together, this study showed that recombinant RABVs expressing VP2 induced protective immune responses to RABV and CPV. Therefore, rHEP-VP2 and rHEP-dG-VP2 might be potential combined vaccines for RABV and CPV. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Studi Histopatologi Limpa Anjing Penderita Distemper Dikaitkan Dengan Sebaran Sel-Sel Radang Pada Otak Dan Paru (HISTOPHATOLOGICAL STUDY OF SPLEEN ON DOGS INFECTED WITH DISTEMPER ASSOCIATED TO INFLAMATION IN THE BRAIN AND LUNGS

    Directory of Open Access Journals (Sweden)

    Muhamad Furkam Fadilah

    2015-08-01

    Full Text Available This study aim was to determine the distribution of inflammatory cells in canine distemper in terms of the level of inflammation in the spleen, brain and lungs. The sample used 20 infected dogs wihich from the spleens, brains, and lungs of the dogs were collected. These organs were processed for histophatological observation using harris hematoxilyn-eosyn stain. The inflammation of the organs examined by using binocular microscope with 200X magnification. the results showed that inflammation was observed in the spleens: 9 samples (45% showed the presence of lymphoidcells that experienced a mild inflammation 7 (35% moderate inflammation, and 4 (20% severe inflammation in brain, 3 samples (15% did not show observe inflammation, 12 (60% mild, 5(25% moderate inflammation, and not observed any severe inflammation in brain, pulmonary: 6(30% mild inflammation, 11 (55% moderate inflammation, and 3 (15% severe inflammation. It can be concluded that the inflammation was observed microscopically in the spleen, brain and lungin the dog that infected with canine distemper virus

  14. Biological and immunogenic properties of rabies virus glycoprotein expressed by canine herpesvirus vector.

    Science.gov (United States)

    Xuan, X; Tuchiya, K; Sato, I; Nishikawa, Y; Onoderaz, Y; Takashima, Y; Yamamoto, A; Katsumata, A; Iwata, A; Ueda, S; Mikami, T; Otsuka, H

    1998-01-01

    In order to evaluate whether canine herpesvirus (CHV) could be used as a live vector for the expression of heterologous immunogenes, we constructed a recombinant canine herpesvirus (CHV) expressing glycoprotein (G protein) of rabies virus (RV). The gene of G protein was inserted within the thymidine kinase gene of CHV YP11mu strain under the control of the human cytomegalovirus immediate early promoter. The G protein expressed by the recombinant CHV was processed and transported to the cell surface as in RV infected cells, and showed the same biological activities such as low pH dependent cell fusion and hemadsorption. The antigenic authenticity of the recombinant G protein was confirmed by a panel of monoclonal antibodies specific for G protein. Dogs inoculated intransally with the recombinant CHV produced higher titres of virus neutralizing antibodies against RV than those inoculated with a commercial, inactivated rabies vaccine. These results suggest that the CHV recombinant expressing G protein can be used as a vaccine to control canine rabies and that CHV may be useful as a vector to develop live recombinant against other infectious diseases in dogs.

  15. Origins and Evolutionary Dynamics of H3N2 Canine Influenza Virus.

    Science.gov (United States)

    Zhu, Henan; Hughes, Joseph; Murcia, Pablo R

    2015-05-01

    Influenza A viruses (IAVs) are maintained mainly in wild birds, and despite frequent spillover infections of avian IAVs into mammals, only a small number of viruses have become established in mammalian hosts. A new H3N2 canine influenza virus (CIV) of avian origin emerged in Asia in the mid-2000s and is now circulating in dog populations of China and South Korea, and possibly in Thailand. The emergence of CIV provides new opportunities for zoonotic infections and interspecies transmission. We examined 14,764 complete IAV genomes together with all CIV genomes publicly available since its first isolation until 2013. We show that CIV may have originated as early as 1999 as a result of segment reassortment among Eurasian and North American avian IAV lineages. We also identified amino acid changes that might have played a role in CIV emergence, some of which have not been previously identified in other cross-species jumps. CIV evolves at a lower rate than H3N2 human influenza viruses do, and viral phylogenies exhibit geographical structure compatible with high levels of local transmission. We detected multiple intrasubtypic and heterosubtypic reassortment events, including the acquisition of the NS segment of an H5N1 avian influenza virus that had previously been overlooked. In sum, our results provide insight into the adaptive changes required by avian viruses to establish themselves in mammals and also highlight the potential role of dogs to act as intermediate hosts in which viruses with zoonotic and/or pandemic potential could originate, particularly with an estimated dog population of ∼ 700 million. Influenza A viruses circulate in humans and animals. This multihost ecology has important implications, as past pandemics were caused by IAVs carrying gene segments of both human and animal origin. Adaptive evolution is central to cross-species jumps, and this is why understanding the evolutionary processes that shape influenza A virus genomes is key to elucidating

  16. Short communication. Old diseases for new nightmares: distemper strikes back in Italy

    Directory of Open Access Journals (Sweden)

    Alessio Lorusso

    2014-06-01

    Full Text Available This article analyses the distemper outbreak that affected the population of Apennine wolves (Canis lupus in Italy during 2013. Distemper, as rabies, is a well-known viral infectious disease that concerns the canine population worldwide and represents a threat for wild species too. Implementation of vaccination and legislation for compulsory vaccination strategies should be achieved in areas with endangered wild species.

  17. Evidence for natural recombination between mink enteritis virus and canine parvovirus

    Directory of Open Access Journals (Sweden)

    Wang Jianke

    2012-10-01

    Full Text Available Abstract A virus was isolated from mink showing clinical and pathological signs of enteritis in China. This virus, designated MEV/LN-10, was identified as mink enteritis virus (MEV based on its cytopathic effect in the feline F81 cell line, the hemagglutination (HA and hemagglutination inhibition (HI assay, electron microscopy (EM and animal infection experiments. The complete viral genome was cloned and sequenced. Phylogenetic and recombination analyses on the complete MEV/LN-10 genome showed evidence of recombination between MEV and canine parvovirus (CPV. The genome was composed of the NS1 gene originating from CPV while the VP1 gene was of MEV origin. This is the first demonstration of recombination between a CPV and MEV in nature. Our findings not only provide valuable evidence indicating that recombination is an important genetic mechanism contributing to the variation and evolution of MEV, but also that heterogeneous recombination can occur in the feline parvovirus subspecies.

  18. Lethal distemper in badgers (Meles meles) following epidemic in dogs and wolves.

    Science.gov (United States)

    Di Sabatino, Daria; Di Francesco, Gabriella; Zaccaria, Guendalina; Malatesta, Daniela; Brugnola, Luca; Marcacci, Maurilia; Portanti, Ottavio; De Massis, Fabrizio; Savini, Giovanni; Teodori, Liana; Ruggieri, Enzo; Mangone, Iolanda; Badagliacca, Pietro; Lorusso, Alessio

    2016-12-01

    Canine distemper virus (CDV) represents an important conservation threat to many wild carnivores. A large distemper epidemic sustained by an Arctic-lineage strain occurred in Italy in 2013, mainly in the Abruzzi region, causing overt disease in domestic and shepherd dogs, Apennine wolves (Canis lupus) and other wild carnivores. Two badgers were collected by the end of September 2015 in a rural area of the Abruzzi region and were demonstrated to be CDV-positive by real time RT-PCR and IHC in several tissues. The genome of CDV isolates from badgers showed Y549H substitution in the mature H protein. By employing all publicly available Arctic-lineage H protein encoding gene sequences, six amino acid changes in recent Italian strains with respect to Italian strains of dogs from 2000 to 2008, were observed. A CDV strain belonging to the European-wildlife lineage was also identified in a fox found dead in the same region in 2016, proving co-circulation of an additional CDV lineage. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Evaluating the influence of epidemiological parameters and host ecology on the spread of phocine distemper virus through populations of harbour seals.

    Directory of Open Access Journals (Sweden)

    Catriona M Harris

    Full Text Available BACKGROUND: Outbreaks of phocine distemper virus (PDV in Europe during 1988 and 2002 were responsible for the death of around 23,000 and 30,000 harbour seals, respectively. These epidemics, particularly the one in 2002, provided an unusual opportunity to estimate epidemic parameters for a wildlife disease. There were marked regional differences in the values of some parameters both within and between epidemics. METHODOLOGY AND PRINCIPAL FINDINGS: We used an individual-based model of seal movement that allowed us to incorporate realistic representations of space, time and animal behaviour into a traditional epidemiological modelling framework. We explored the potential influence of a range of ecological (foraging trip duration, time of epidemic onset, population size and epidemiological (length of infectious period, contact rate between infectious and susceptible individuals, case mortality parameters on four readily-measurable epidemic characteristics (number of dead individuals, duration of epidemic, peak mortality date and prevalence and on the probability that an epidemic would occur in a particular region. We analysed the outputs as if they were the results of a series of virtual experiments, using Generalised Linear Modelling. All six variables had a significant effect on the probability that an epidemic would be recognised as an unusual mortality event by human observers. CONCLUSIONS: Regional and temporal variation in contact rate was the most likely cause of the observed differences between the two epidemics. This variation could be a consequence of differences in the way individuals divide their time between land and sea at different times of the year.

  20. Anticorpos neutralizantes contra os vírus da cinomose e da parainfluenza em cães de canis dos municípios de Novo Hamburgo e Porto Alegre, RS, Brasil Neutralizing antibodies to distemper and parainfluenza viruses in dogs in shelter kennels in the municipalities of Novo Hamburgo and Porto Alegre, RS, Brazil

    Directory of Open Access Journals (Sweden)

    Tamahine Larronda Schmidt Hartmann

    2007-08-01

    Full Text Available No presente estudo, foi realizada uma pesquisa em busca de anticorpos neutralizantes contra os vírus da cinomose (CDV e da parainfluenza (CPIV caninos em amostras de soro de 173 cães recolhidos a canis municipais em Novo Hamburgo (n=82 e Porto Alegre (n=91, RS. A pesquisa de anticorpos neutralizantes foi realizada pela técnica de soroneutralização frente a duas amostras vacinais de CDV (Rockborn e Snyder Hill e frente a uma amostra de CPIV (V660. Em relação ao CDV, 95,9% das amostras de soros foram negativas para anticorpos neutralizantes contra a amostra Snyder Hill e 90,7% soronegativas para a amostra Rockborn. Entre os soropositivos (n=20; 11,6%, somente três deles apresentaram anticorpos neutralizantes frente às duas amostras de CDV testadas, indicando pouca reatividade cruzada entre as mesmas. Quanto ao CPIV, a prevalência de anticorpos neutralizantes encontrada frente à amostra V660 foi de 51,4%. Esses achados indicam que a maioria dos cães examinados não teve contato prévio com o CDV, seja por infecção natural ou por imunização prévia. O CPIV, porém, parece estar amplamente difundido na população canina examinada, provavelmente por exposição natural ao vírus.In this report a serological survey was carried out in search for antibodies to canine distemper virus (CDV and canine parainfluenza virus (CPIV in 173 sera from dogs withdraw in kennels of the municipalities of Novo Hamburgo (n=82 and Porto Alegre (n=91, RS, Brazil. Neutralizing antibodies were evaluated against two CDV strains used for vaccine production (Rockborn and Snyder Hill as well as one strain of CPIV (V660. Search for anti-CDV neutralizing antibodies revealed that 95.9% of sera were negative for antibodies to CDV Snyder Hill and 90.7% were negative for antibodies to CDV Rockborn. Among the positive sera (n=20; 11.6 % only three of those had neutralizing antibodies to both CDV strains, indicating a low degree of cross reactivity between those. As

  1. Evaluation of a commercial kit of chromatographic immunoassay for detection of canine distemper antigen in dogs with systemic or neurologic signs of the diseaseAvaliação de um kit de imunoensaio cromatográfico para detecção do antígeno do vírus da cinomose em cães com sinais sistêmicos ou neurológicos da doença

    Directory of Open Access Journals (Sweden)

    Murilo Cézar Curti

    2012-12-01

    Full Text Available The canine distemper is a multisystemic disease highly contagious which can lead to serious consequences and even to death. Different types of tests can be used for the ante mortem diagnosis of canine distemper, however, due to unpredictable course of the disease, the final diagnosis remains uncertain in some cases. We evaluated in 33 dogs with suspected canine distemper, the effectiveness of a commercial test for detection of antigen (Ag of canine distemper, still comparing the frequency of clinical and neurological signs among positive and negative dogs. In 27/33 dogs the material was collected from the ocular mucosa, in 5/33 dogs the test was performed with CSF and in one animal material was collected from the ocular mucosa and CSF. In 14 dogs was performed also the RT-PCR technique. The Ag test was positive in 7/13 confirmed cases of canine distemper, all of them with systemic signs, but in dogs that had only neurologic signs, the antigen test was negative. In six dogs the antigen test was negative, however the RT-PCR was positive. The results of this study showed that the antigen test did not help for the canine distemper diagnosis in many cases with systemic and neurologic signs, still allowing that several cases had false-negative results. A cinomose é uma doença multisistêmica altamente contagiosa, que pode levar a graves sequelas e até ao óbito. Diferentes tipos de exames podem ser usados para o diagnóstico ante mortem da cinomose, entretanto, devido ao curso imprevisível da doença, o diagnóstico final permanece incerto em alguns casos. O objetivo deste trabalho foi avaliar a eficácia do teste comercial de imunoensaio cromatográfico para detecção de antígeno (Ag da cinomose em 33 cães com suspeita de cinomose canina, comparandose ainda a frequência dos sinais clínicos e neurológicos entre cães positivos e negativos. Em 27/33 o material foi coletado da mucosa ocular, em 5/33 foi coletado do LCR e em um animal o

  2. Zoonotic Risk, Pathogenesis, and Transmission of Avian-Origin H3N2 Canine Influenza Virus.

    Science.gov (United States)

    Sun, Hailiang; Blackmon, Sherry; Yang, Guohua; Waters, Kaitlyn; Li, Tao; Tangwangvivat, Ratanaporn; Xu, Yifei; Shyu, Daniel; Wen, Feng; Cooley, Jim; Senter, Lucy; Lin, Xiaoxu; Jarman, Richard; Hanson, Larry; Webby, Richard; Wan, Xiu-Feng

    2017-11-01

    Two subtypes of influenza A virus (IAV), avian-origin canine influenza virus (CIV) H3N2 (CIV-H3N2) and equine-origin CIV H3N8 (CIV-H3N8), are enzootic in the canine population. Dogs have been demonstrated to seroconvert in response to diverse IAVs, and naturally occurring reassortants of CIV-H3N2 and the 2009 H1N1 pandemic virus (pdmH1N1) have been isolated. We conducted a thorough phenotypic evaluation of CIV-H3N2 in order to assess its threat to human health. Using ferret-generated antiserum, we determined that CIV-H3N2 is antigenically distinct from contemporary human H3N2 IAVs, suggesting that there may be minimal herd immunity in humans. We assessed the public health risk of CIV-H3N2 × pandemic H1N1 (pdmH1N1) reassortants by characterizing their in vitro genetic compatibility and in vivo pathogenicity and transmissibility. Using a luciferase minigenome assay, we quantified the polymerase activity of all possible 16 ribonucleoprotein (RNP) complexes (PB2, PB1, PA, NP) between CIV-H3N2 and pdmH1N1, identifying some combinations that were more active than either parental virus complex. Using reverse genetics and fixing the CIV-H3N2 hemagglutinin (HA), we found that 51 of the 127 possible reassortant viruses were viable and able to be rescued. Nineteen of these reassortant viruses had high-growth phenotypes in vitro , and 13 of these replicated in mouse lungs. A single reassortant with the NP and HA gene segments from CIV-H3N2 was selected for characterization in ferrets. The reassortant was efficiently transmitted by contact but not by the airborne route and was pathogenic in ferrets. Our results suggest that CIV-H3N2 reassortants may pose a moderate risk to public health and that the canine host should be monitored for emerging IAVs. IMPORTANCE IAV pandemics are caused by the introduction of novel viruses that are capable of efficient and sustained transmission into a human population with limited herd immunity. Dogs are a a potential mixing vessel for avian

  3. Inactivated recombinant plant virus protects dogs from a lethal challenge with canine parvovirus.

    Science.gov (United States)

    Langeveld, J P; Brennan, F R; Martínez-Torrecuadrada, J L; Jones, T D; Boshuizen, R S; Vela, C; Casal, J I; Kamstrup, S; Dalsgaard, K; Meloen, R H; Bendig, M M; Hamilton, W D

    2001-06-14

    A vaccine based upon a recombinant plant virus (CPMV-PARVO1), displaying a peptide derived from the VP2 capsid protein of canine parvovirus (CPV), has previously been described. To date, studies with the vaccine have utilized viable plant chimaeric particles (CVPs). In this study, CPMV-PARVO1 was inactivated by UV treatment to remove the possibility of replication of the recombinant plant virus in a plant host after manufacture of the vaccine. We show that the inactivated CVP is able to protect dogs from a lethal challenge with CPV following parenteral immunization with the vaccine. Dogs immunized with the inactivated CPMV-PARVO1 in adjuvant displayed no clinical signs of disease and shedding of CPV in faeces was limited following CPV challenge. All immunized dogs elicited high titres of peptide-specific antibody, which neutralized CPV in vitro. Levels of protection, virus shedding and VP2-specific antibody were comparable to those seen in dogs immunized with the same VP2- peptide coupled to keyhole limpet hemocyanin (KLH). Since plant virus-derived vaccines have the potential for cost-effective manufacture and are not known to replicate in mammalian cells, they represent a viable alternative to current replicating vaccine vectors for development of both human and veterinary vaccines.

  4. Toxoplasma gondii genotyping in a dog co-infected with distemper virus and ehrlichiosis rickettsia Genotipagem de Toxoplasma gondii em cão co-infectado com o vírus da cinomose e a rickettsia da erliquiose

    Directory of Open Access Journals (Sweden)

    Leandro d'Arc Moretti

    2006-12-01

    Full Text Available This paper reports a toxoplasmosis, erhlichiosis and distemper co-infection in a dog with an exuberant neuropathological clinical picture. Primary involvement was discussed based on information collected in the analysis of the clinical case, such as neurological impairment, epidemiological data, poor immunoprophylactic scheme of the dog affected and the role of these diseases on immunosuppression. Canine distemper and ehrlichiosis were diagnosed based on epidemiologic data, clinical signs, hematological and cytological evaluation. Toxoplasma gondii was isolated and genetically characterized as Type I using restriction analysis (RFLP with SAG-2 genes. Immunosuppression features of both dogs and human beings are discussed, as well as implications on animal and public health. This is the first report on toxoplasmosis, ehrlichiosis and distemper co-infection in a dog in Brazil, associated with genotyping determination of the T. gondii strain involved.Este artigo relata a co-infecção tripla pelos agentes da cinomose, erliquiose e toxoplasmose em um cão com acentuado quadro clínico neuropático. Discute-se a doença primária baseando-se em dados clínicos, epidemiológicos, no protocolo imunoprofilático inadequado e no papel daquelas doenças na imunossupressão. A cinomose e a erliquiose foram diagnosticadas mediante a situação epidemiológica da região e sinais clínicos compatíveis, aliados aos achados de hemograma e citologia. Utilizando-se a análise de restrição (RFLP com os genes SAG-2, caracterizou-se geneticamente a linhagem de Toxoplasma gondii isolada, como pertencente ao Tipo I. Discutem-se aspectos de imunossupressão, tanto em cães quanto em seres humanos, bem como suas implicações em saúde pública e animal. Este é o primeiro relato de infecção tripla pelos agentes da toxoplasmose, erliquiose e cinomose no Brasil, associado com a genotipificação da estirpe de T. gondii envolvida.

  5. Evaluation of Trapper-Collected Nobuto Filter-Paper Blood Samples for Distemper and Parvovirus Antibody Detection in Coyotes (Canis latrans) and Raccoons (Procyon lotor).

    Science.gov (United States)

    Kamps, Amanda J; Dubay, Shelli A; Langenberg, Julie; Maes, Roger K

    2015-07-01

    Blood samples are often collected from free-ranging wildlife for antibody detection. However, filter-paper (FP) strips are more cost efficient and easy to collect and store. We evaluated trapper-collected FP strips and body-cavity blood for canine distemper (CDV) and parvovirus (CPV-2) antibody detection in raccoons (Procyon lotor) and coyotes (Canis latrans). From 2008 to 2010, licensed trappers near Madison and Milwaukee, Wisconsin, US collected paired samples from harvested animals. Canine distemper antibodies were detected using virus neutralization and parvovirus antibodies were detected using hemagglutination inhibition. Titers ≥ 1:32 for CDV and ≥ 1:25 for CPV-2 were considered evidence of exposure. Using Cohen's kappa test of agreement, FP strip titers agreed with sera for CDV in coyotes (n = 28, K = 0.772) and raccoons (n = 29, K = 0.858) and for CPV-2 in coyotes (n = 40, K = 0.775) and raccoons (n = 70, K = 0.646). However, raccoons determined to be exposed to CPV-2 from sera were unexposed by FP strips in 35% of the samples. Titer results may be affected by quality and volume of blood samples, interval between collection and processing, small sample sizes, and diagnostic testing procedures. Filter-paper strips can be useful for detecting CDV and CPV-2 exposure in coyotes and raccoons with correct field sample collection and appropriate diagnostic testing procedures.

  6. A virus vector based on Canine Herpesvirus for vaccine applications in canids.

    Science.gov (United States)

    Strive, T; Hardy, C M; Wright, J; Reubel, G H

    2007-01-31

    Canine Herpesvirus (CHV) is being developed as a virus vector for the vaccination of European red foxes. However, initial studies using recombinant CHV vaccines in foxes revealed viral attenuation and lack of antibody response to inserted foreign antigens. These findings were attributed both to inactivation of the thymidine kinase (TK) gene and excess foreign genetic material in the recombinant viral genome. In this study, we report an improved CHV-bacterial artificial chromosome (BAC) vector system designed to overcome attenuation in foxes. A non-essential region was identified in the CHV genome as an alternative insertion site for foreign genes. Replacement of a guanine/cytosine (GC)-rich intergenic region between UL21 and UL22 of CHV with a marker gene did not change growth behaviour in vitro, showing that this region is not essential for virus growth in cell culture. We subsequently produced a CHV-BAC vector with an intact TK gene in which the bacterial genes and the antigen expression cassette were inserted into this GC-rich locus. Unlike earlier constructs, the new CHV-BAC allowed self-excision of the bacterial genes via homologous recombination after transfection of BACs into cell culture. The BAC-CHV system was used to produce a recombinant virus that constitutively expressed porcine zona pellucida subunit C protein between the UL21 and UL22 genes of CHV. Complete self-excision of the bacterial genes from CHV was achieved within one round of replication whilst retaining antigen gene expression.

  7. The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

    Science.gov (United States)

    Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

    2017-05-01

    Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A modified live canine parvovirus vaccine. II. Immune response.

    Science.gov (United States)

    Carmichael, L E; Joubert, J C; Pollock, R V

    1983-01-01

    The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

  9. Contact heterogeneity, rather than transmission efficiency, limits the emergence and spread of canine influenza virus.

    Directory of Open Access Journals (Sweden)

    Benjamin D Dalziel

    2014-10-01

    Full Text Available Host-range shifts in influenza virus are a major risk factor for pandemics. A key question in the study of emerging zoonoses is how the evolution of transmission efficiency interacts with heterogeneity in contact patterns in the new host species, as this interplay influences disease dynamics and prospects for control. Here we use a synergistic mixture of models and data to tease apart the evolutionary and demographic processes controlling a host-range shift in equine H3N8-derived canine influenza virus (CIV. CIV has experienced 15 years of continuous transfer among dogs in the United States, but maintains a patchy distribution, characterized by sporadic short-lived outbreaks coupled with endemic hotspots in large animal shelters. We show that CIV has a high reproductive potential in these facilities (mean R(0 = 3.9 and that these hotspots act as refugia from the sparsely connected majority of the dog population. Intriguingly, CIV has evolved a transmission efficiency that closely matches the minimum required to persist in these refugia, leaving it poised on the extinction/invasion threshold of the host contact network. Corresponding phylogenetic analyses show strong geographic clustering in three US regions, and that the effective reproductive number of the virus (R(e in the general dog population is close to 1.0. Our results highlight the critical role of host contact structure in CIV dynamics, and show how host contact networks could shape the evolution of pathogen transmission efficiency. Importantly, efficient control measures could eradicate the virus, in turn minimizing the risk of future sustained transmission among companion dogs that could represent a potential new axis to the human-animal interface for influenza.

  10. Short communication: isolation and phylogenetic analysis of an avian-origin H3N2 canine influenza virus in dog shelter, China.

    Science.gov (United States)

    Su, Shuo; Yuan, Ziguo; Chen, Jidang; Xie, Jiexiong; Li, Huatao; Huang, Zhen; Zhang, Minze; Du, Guohao; Chen, Zhongming; Tu, Liqing; Zou, Yufei; Miao, Junhao; Wang, Hui; Jia, Kun; Li, Shoujun

    2013-06-01

    A H3N2 canine influenza virus, A/canine/Guangdong/3/2011 (H3N2), was isolated from roaming dogs in rural China. Sequence and phylogenetic analysis of eight gene segments revealed that the A/canine/Guangdong/3/2011 (H3N2) was most similar to a recent H3N2 canine influenza virus isolated in cats from South Korea, which originated from an avian strain. To our knowledge, this is the first report of an avian-origin H3N2 CIV which was isolated from roaming dogs in China. The epidemiologic information provided herein suggests that continued study is required to determine if this virus could be established in the roaming dog population in rural China and pose potential threats to public health.

  11. Whole genome sequence analysis of the arctic-lineage strain responsible for distemper in Italian wolves and dogs through a fast and robust next generation sequencing protocol.

    Science.gov (United States)

    Marcacci, Maurilia; Ancora, Massimo; Mangone, Iolanda; Teodori, Liana; Di Sabatino, Daria; De Massis, Fabrizio; Camma', Cesare; Savini, Giovanni; Lorusso, Alessio

    2014-06-01

    Dynamic surveillance and characterization of canine distemper virus (CDV) circulating strains are essential against possible vaccine breakthroughs events. This study describes the setup of a fast and robust next-generation sequencing (NGS) Ion PGM™ protocol that was used to obtain the complete genome sequence of a CDV isolate (CDV2784/2013). CDV2784/2013 is the prototype of CDV strains responsible for severe clinical distemper in dogs and wolves in Italy during 2013. CDV2784/2013 was isolated on cell culture and total RNA was used for NGS sample preparation. A total of 112.3 Mb of reads were assembled de novo using MIRA version 4.0rc4, which yielded a total number of 403 contigs with 12.1% coverage. The whole genome (15,690 bp) was recovered successfully and compared to those of existing CDV whole genomes. CDV2784/2013 was shown to have 92% nt identity with the Onderstepoort vaccine strain. This study describes for the first time a fast and robust Ion PGM™ platform-based whole genome amplification protocol for non-segmented negative stranded RNA viruses starting from total cell-purified RNA. Additionally, this is the first study reporting the whole genome analysis of an Arctic lineage strain that is known to circulate widely in Europe, Asia and USA. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Evolution of canine and equine influenza (H3N8) viruses co-circulating between 2005 and 2008

    International Nuclear Information System (INIS)

    Rivailler, Pierre; Perry, Ijeoma A.; Jang Yunho; Davis, C. Todd; Chen Limei; Dubovi, Edward J.; Donis, Ruben O.

    2010-01-01

    Influenza virus, subtype H3N8, was transmitted from horses to greyhound dogs in 2004 and subsequently spread to pet dog populations. The co-circulation of H3N8 viruses in dogs and horses makes bi-directional virus transmission between these animal species possible. To understand the dynamics of viral transmission, we performed virologic surveillance in dogs and horses between 2005 and 2008 in the United States. The genomes of influenza A H3N8 viruses isolated from 36 dogs and horses were sequenced to determine their origin and evolution. Phylogenetic analyses revealed that H3N8 influenza viruses from horses and dogs were monophyletic and distinct. There was no evidence of canine influenza virus infection in horses with respiratory disease or new introductions of equine influenza viruses into dogs in the United States. Analysis of a limited number of equine influenza viruses suggested substantial separation in the transmission of viruses causing clinically apparent influenza in dogs and horses.

  13. Recombination between vaccine and field strains of canine parvovirus is revealed by isolation of virus in canine and feline cell cultures.

    Science.gov (United States)

    Mochizuki, Masami; Ohshima, Takahisa; Une, Yumi; Yachi, Akiko

    2008-12-01

    Canine parvovirus type 2 (CPV) is a pathogen that causes severe hemorrhagic gastroenteritis with a high fatality rate in pups worldwide. Since CPV emerged in the late 1970s, its origin has been explored with the conclusion that CPV originated from feline panleukopenia virus or a closely related virus. Both high mutation rate and recombination are assumed to be key factors in the evolution of parvoviruses. Here we provide evidence for natural recombination in CPV isolated from dogs in cell culture. Antigenic and genetic properties of isolates from 10 diseased pups were elucidated. Six pups had been vaccinated beforehand with live combined vaccine containing original antigenic type CPV (CPV-2). Six isolates recovered from 4 vaccinated pups in cell cultures were found to contain either CPV-2 or CPV-2-like viruses. The other isolates, including all those from non-vaccinated pups, were CPV-2b viruses. Antigenic typing of two CPV-2-like isolates, 03-029/M and 1887/f, with a monoclonal antibody panel suggested they were a mixture of CPV-2 and CPV-2a (03-029/M) and a recombinant of CPV-2 and CPV-2b (1887/f). Genetic analysis of the VP1 gene indicated that isolate 03-029/M was a mixture of CPV-2, CPV-2a and a recombinant of CPV-2 and CPV-2a viruses, while isolate 1887/f was composed of a recombinant of CPV-2 and CPV-2b viruses. This is the first demonstration of natural CPV recombination in the field and suggests that recombination in the evolution of CPV is a more frequent and important process than previously believed.

  14. Immunological reactive rate to Zika virus in canine sera: A report from a tropical area and concern on pet, zoonosis and reservoir host

    Institute of Scientific and Technical Information of China (English)

    Beuy Joob; Viroj Wiwanitkit

    2017-01-01

    This letter to editor discusses and describes Zika virus IgG seropositivity rate in canine sera from endemic area. This is the first world report and it raises an urgent concern on pet, zoonosis and reservoir host regarding Zika virus.

  15. Toxoplasmosis in distemper virus infected dogs/ Toxoplasmose em cães co-infectados com o vírus da cinomose

    Directory of Open Access Journals (Sweden)

    Aristeu Vieira da Silva

    2002-05-01

    Full Text Available This report shows four cases of dog´s toxoplasmosis, pointing that the neurologic signalment of toxoplasmosis and distemper is quite indistinguishable. The anmnestic data of flesh-eating and cat contact is linked with easier suspect of toxoplasmosis, reinforced by the presence of linfadenopathy, pneumonia and neurologic signs. A treatment proposal is offered, being a preventive measure to toxoplasmosis in distemper dogs, according to the clinician diagnostic conditions.Relatam-se quatro casos de toxoplasmose em cães, evidenciando-se a sintomatologia nervosa indistinguível daquela causada pela cinomose de forma isolada e mostrando a ocorrência concomitante das duas enfermidades. Sugere-se que os dados de anamnese, como hábitos de carnivorismo e contato com gatos, aliados a sinais clínicos como linfadenopatia, pneumonia, secreção ocular purulenta e distúrbios neurológicos, favoreçam a suspeita clínica de toxoplasmose. Propõe-se um tratamento, preventivo para a toxoplasmose, nos cães com cinomose, baseado nas condições de diagnóstico disponíveis pelo clínico.

  16. Self-assembly of virus-like particles of canine parvovirus capsid protein expressed from Escherichia coli and application as virus-like particle vaccine.

    Science.gov (United States)

    Xu, Jin; Guo, Hui-Chen; Wei, Yan-Quan; Dong, Hu; Han, Shi-Chong; Ao, Da; Sun, De-Hui; Wang, Hai-Ming; Cao, Sui-Zhong; Sun, Shi-Qi

    2014-04-01

    Canine parvovirus disease is an acute infectious disease caused by canine parvovirus (CPV). Current commercial vaccines are mainly attenuated and inactivated; as such, problems concerning safety may occur. To resolve this problem, researchers developed virus-like particles (VLPs) as biological nanoparticles resembling natural virions and showing high bio-safety. This property allows the use of VLPs for vaccine development and mechanism studies of viral infections. Tissue-specific drug delivery also employs VLPs as biological nanomaterials. Therefore, VLPs derived from CPV have a great potential in medicine and diagnostics. In this study, small ubiquitin-like modifier (SUMO) fusion motif was utilized to express a whole, naturalVP2 protein of CPV in Escherichia coli. After the cleavage of the fusion motif, the CPV VP2 protein has self-assembled into VLPs. The VLPs had a size and shape that resembled the authentic virus capsid. However, the self-assembly efficiency of VLPs can be affected by different pH levels and ionic strengths. The mice vaccinated subcutaneously with CPV VLPs and CPV-specific immune responses were compared with those immunized with the natural virus. This result showed that VLPs can effectively induce anti-CPV specific antibody and lymphocyte proliferation as a whole virus. This result further suggested that the antigen epitope of CPV was correctly present on VLPs, thereby showing the potential application of a VLP-based CPV vaccine.

  17. The avian-origin H3N2 canine influenza virus has limited replication in swine

    Science.gov (United States)

    A genetically and antigenically distinct H3N2 canine influenza of avian-origin was detected in March of 2015 in Chicago, Illinois. A subsequent outbreak was reported with over 1,000 dogs in the Midwest affected. The potential for canine-to-swine transmission was unknown. Experimental infection in pi...

  18. European surveillance of emerging pathogens associated with canine infectious respiratory disease.

    Science.gov (United States)

    Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe

    2017-12-01

    Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Virus neutralizing antibody response in mice and dogs with a bicistronic DNA vaccine encoding rabies virus glycoprotein and canine parvovirus VP2.

    Science.gov (United States)

    Patial, Sonika; Chaturvedi, V K; Rai, A; Saini, M; Chandra, Rajesh; Saini, Y; Gupta, Praveen K

    2007-05-16

    A bicistronic DNA vaccine against rabies and parvovirus infection of dogs was developed by subcloning rabies glycoprotein and canine parvovirus (CPV) VP2 genes into a bicistronic vector. After characterizing the expression of both the proteins in vitro, the bicistronic DNA vaccine was injected in mice and induced immune response was compared with monocistronic DNA vaccines. There was no significant difference in ELISA and virus neutralizing (VN) antibody responses against rabies and CPV in mice immunized with either bicistronic or monocistronic DNA vaccine. Further, there was significantly similar protection in mice immunized with either bicistronic or monocistronic rabies DNA vaccine on rabies virus challenge. Similarly, dogs immunized with monocistronic and bicistronic DNA vaccines developed comparable VN antibodies against rabies and CPV. This study indicated that bicistronic DNA vaccine can be used in dogs to induce virus neutralizing immune responses against both rabies and CPV.

  20. Molecular detection of canine distemper virus (CDV, canine adenovirus A type 1 and 2 (CAdV-1 and CAdV-2, and canine parvovirus type 2 (CPV-2 in the urine of naturally infected dogs

    Directory of Open Access Journals (Sweden)

    Ana Paula Silva

    2014-12-01

    Full Text Available Bovine babesiosis is an important disease of cattle where Rhipicephalus microplus acts as a vector for the two causal organisms Babesia bovis and Babesia bigemina. A total of 22 calves were randomly monitored during three years by semi-nested PCR assay and ELISA test to determine prevalence of B. bovis and B. bigemina. The overall prevalence of B. bovis and B. bigemina was 30% and 35% by nested PCR (nPCR, and 70% and 75% by ELISA, respectively. Statistical analysis of the characteristics of animals showed that age and tick infestations (p<0.05 might play an important role in the spread of babesiosis as animal less than 6 months old. A high correlation (Kappa index of 0.70 for B. bovis and 0.65 for B. bigemina, respectively between serological and molecular tests suggests that the combination of the utilized techniques in the present study is suitable for babesiosis diagnosis in an endemic unstable area.

  1. Molecular characterization of atypical antigenic variants of canine rabies virus reveals its reintroduction by wildlife vectors in southeastern Mexico.

    Science.gov (United States)

    Garcés-Ayala, Fabiola; Aréchiga-Ceballos, Nidia; Ortiz-Alcántara, Joanna M; González-Durán, Elizabeth; Pérez-Agüeros, Sandra I; Méndez-Tenorio, Alfonso; Torres-Longoria, Belem; López-Martínez, Irma; Hernández-Rivas, Lucía; Díaz-Quiñonez, José Alberto; Ramírez-González, José Ernesto

    2017-12-01

    Rabies is an infectious viral disease that is practically always fatal following the onset of clinical signs. In Mexico, the last case of human rabies transmitted by dogs was reported in 2006 and canine rabies has declined significantly due to vaccination campaigns implemented in the country. Here we report on the molecular characterization of six rabies virus strains found in Yucatan and Chiapas, remarkably, four of them showed an atypical reaction pattern when antigenic characterization with a reduced panel of eight monoclonal antibodies was performed. Phylogenetic analyses on the RNA sequences unveiled that the three atypical strains from Yucatan are associated with skunks. Analysis using the virus entire genome showed that they belong to a different lineage distinct from the variants described for this animal species in Mexico. The Chiapas atypical strain was grouped in a lineage that was considered extinct, while the others are clustered within classic dog variants.

  2. The failure of an inactivated mink enteritis virus vaccine in four preparations to provide protection to dogs against challenge with canine parvovirus-2.

    OpenAIRE

    Carman, S; Povey, C

    1982-01-01

    Four experimental vaccine preparations comprising a strain of mink enteritis virus inactivated by either formalin or beta-propiolactone, and either adjuvanted or nonadjuvanted, failed to stimulate a consistent serum antibody response in 20 vaccinated dogs and failed to protect all but one of these dogs against oral challenge with canine parvovirus-2.

  3. Pesti Des Petits ruminants virus infection in animals

    Directory of Open Access Journals (Sweden)

    Chauhan H.C.

    2009-08-01

    Full Text Available For centuries morbillivirus infections have had a huge impact on both human beings and animals. Morbilliviruses are highly contagious pathogens that cause some of the most devastating viral diseases of humans and animals world wide. They include measles virus (MV, canine distemper virus (CDV, rinderpest virus (RPV and peste des petits ruminants (PPRV virus. Furthermore, new emerging infectious diseases of morbilliviruses with significant ecological consequences of marine mammals have been discovered in the past decades. Phocid distemper virus (PDV in seals and the cetacean morbillivirus (CMV have been found in dolphins, whales and porpoises. Peste des petits ruminants (PPR is a highly contagious ,infectious , an acute or sub acute viral disease of domestic and wild small ruminants characterized by fever, oculonasal discharges, stomatitis, conjunctivitis, gastroenteritis and pneumonia. Goats are more severely affected than sheep. It is also known as pseudorinderpest of small ruminants, pest of small ruminants, pest of sheep and goats, kata, stomatitis- pneumoentritis syndrome, contagious pustular stomatitis and pneumoentritis complex. It is one of the major notifiable diseases of the World Organization for Animal Health (OIE. [Vet. World 2009; 2(4.000: 150-155

  4. Evolutionary characteristics of morbilliviruses during serial passages in vitro: Gradual attenuation of virus virulence.

    Science.gov (United States)

    Liu, Fuxiao; Wu, Xiaodong; Li, Lin; Zou, Yanli; Liu, Shan; Wang, Zhiliang

    2016-08-01

    The genus Morbillivirus is classified into the family Paramyxoviridae, and is composed of 6 members, namely measles virus (MV), rinderpest virus (RPV), peste-des-petits-ruminants virus (PPRV), canine distemper virus (CDV), phocine distemper virus (PDV) and cetacean morbillivirus (CeMV). The MV, RPV, PPRV and CDV have been successfully attenuated through their serial passages in vitro for the production of live vaccines. It has been demonstrated that the morbilliviral virulence in animals was progressively attenuated with their consecutive passages in vitro. However, only a few reports were involved in explanation of an attenuation-related mechanism on them until many years after the establishment of a quasispecies theory. RNA virus quasispecies arise from rapid evolution of viruses with high mutation rate during genomic replication, and play an important role in gradual loss of viral virulence by serial passages. Here, we overviewed the development of live-attenuated vaccine strains against morbilliviruses by consecutive passages in vitro, and further discussed a related mechanism concerning the relationship between virulence attenuation and viral evolution. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Gas-permeable ethylene bags for the small scale cultivation of highly pathogenic avian influenza H5N1 and other viruses in embryonated chicken eggs

    Directory of Open Access Journals (Sweden)

    McCurdy Kimberly S

    2010-01-01

    Full Text Available Abstract Background Embryonated chicken eggs (ECE are sometimes used for the primary isolation or passage of influenza viruses, other viruses, and certain bacteria. For small-scale experiments with pathogens that must be studied in biosafety level three (BSL3 facilities, inoculated ECE are sometimes manipulated and maintained in small egg incubators within a biosafety cabinet (BSC. To simplify the clean up and decontamination of an egg incubator in case of egg breakage, we explored whether ethylene breather bags could be used to encase ECE inoculated with pathogens. This concept was tested by determining embryo survival and examining virus yields in bagged ECE. Results Virus yields acceptable for many applications were attained when influenza-, alpha-, flavi-, canine distemper-, and mousepox viruses were propagated in ECE sealed within ethylene breather bags. Conclusions For many small-scale applications, ethylene breather bags can be used to encase ECE inoculated with various viruses.

  6. Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA.

    Science.gov (United States)

    Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb

    2017-07-01

    Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.

  7. Defining the Antigenic Structure of the Henipavirus Attachment (G) Glycoprotein: Implications for the Fusion Mechanism

    Science.gov (United States)

    2009-01-01

    Morbillivirus Measles Virus Canine Distemper virus Rinderpest virus Respirovirus Bovine Parainfluenzavirus 3 Human Parainfluenzavirus 1,3...M. D. Curran, and B. K. Rima. 1997. Nucleotide sequence analysis of the large (L) genes of Phocine Distemper virus and Canine Distemper virus...components of Canine Distemper virus. J Gen Virol 66 ( Pt 3):443-56. 115. Parashar, U. D., L. M. Sunn, F. Ong, A. W. Mounts, M. T. Arif, T. G. Ksiazek

  8. Genotyping canine distemper virus (CDV) by a hemi-nested multiplex PCR provides a rapid approach for investigation of CDV outbreaks

    DEFF Research Database (Denmark)

    Blixenkrone-Møller, Merete; Martella, Vito

    2007-01-01

    CDV is a highly contagious viral pathogen causing a lethal systemic disease in dogs and other carnivores. Several lineages or genotypes of CDV exist that are variously distributed throughout several continents. Legal or uncontrolled trading of animals may modify the epidemiology of CDV, introduci...

  9. Radioimmunoassay of measles virus hemagglutinin protein G

    International Nuclear Information System (INIS)

    Lund, G.A.; Salmi, A.A.

    1982-01-01

    Guinea pig and rabbit antisera from animals immunized with purified measles virus hemagglutinin (G) protein were used to establish a solid-phase four-layer radioimmunoassay for quantitative measurement of the G protein. The sensitivity of the assay was 2 ng of purified G protein, and 200 μg of protein from uninfected Vero cells neither decreased the sensitivity nor reacted non-specifically in the assay. Radioimmunoassay standard dose-response curves were established and unknown values interpolated from these using the logit program of a desktop computer. Using this procedure, a measles virus growth curve in infected Vero cells was determined by measurement of G protein production. Under these same conditions, hemagglutination was not sensitive enough to detect early hemagglutinin production. Viral antigens in canine distemper virus, Newcastle disease virus, parainfluenza viruses 1-4, simian virus 5, and respiratory syncytial virus-infected cell lysates did not cross-react in the radioimmunoassay. A small degree of cross-reactivity was detected with mumps viral antigens, both with Vero cell-derived (wild-type strain) and egg-derived (Enders strain) purified virus preparations and with a cell lysate antigen prepared from wild-type mumps virus-infected Vero cells. (Auth.)

  10. Radioimmunoassay of measles virus hemagglutinin protein G

    Energy Technology Data Exchange (ETDEWEB)

    Lund, G A; Salmi, A A [Turku Univ. (Finland)

    1982-08-01

    Guinea pig and rabbit antisera from animals immunized with purified measles virus hemagglutinin (G) protein were used to establish a solid-phase four-layer radioimmunoassay for quantitative measurement of the G protein. The sensitivity of the assay was 2 ng of purified G protein, and 200 ..mu..g of protein from uninfected Vero cells neither decreased the sensitivity nor reacted non-specifically in the assay. Radioimmunoassay standard dose-response curves were established and unknown values interpolated from these using the logit program of a desktop computer. Using this procedure, a measles virus growth curve in infected Vero cells was determined by measurement of G protein production. Under these same conditions, hemagglutination was not sensitive enough to detect early hemagglutinin production. Viral antigens in canine distemper virus, Newcastle disease virus, parainfluenza viruses 1-4, simian virus 5, and respiratory syncytial virus-infected cell lysates did not cross-react in the radioimmunoassay. A small degree of cross-reactivity was detected with mumps viral antigens, both with Vero cell-derived (wild-type strain) and egg-derived (Enders strain) purified virus preparations and with a cell lysate antigen prepared from wild-type mumps virus-infected Vero cells.

  11. Experiments with a homologous, inactivated canine parvovirus vaccine in vaccination programmers for dogs.

    Science.gov (United States)

    Wilson, J H; Hermann-Dekkers, W M

    1982-01-01

    The significance of canine parvovirus (CPV) infections as a permanent threat susceptible dogs, in particular pups, made the authors develop three liquid homologous inactivated adjuvant CPV vaccines that were compatible with existing canine vaccines and could be incorporated in current vaccination programmes. On vaccine (Kavak Parvo) contained only the CPV component, the second product (Kavak i-LP) also contained two inactivated leptospiral antigens, and the third vaccine (Kavak i-HLP) contained in addition an inactivated canine hepatitis virus. This paper reports on the studies conducted to test the safety and efficacy of the three products. They were used as such and