International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Yu, Chi-Ho; Yhee, Ji-Young; Im, Keum-Soon; Kim, Na-Hyun; Sur, Jung-Hyang
2010-01-01
Human seminoma is classified as classical seminoma (SE) and spermatocytic seminoma (SS). Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD) being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns) were classified as SE or SS by immunohistochemistry (IHC) using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF) and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS) program was used for various statistical analyses. The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8%) and PLAP-/PAS- SSs were 15/23 (61.2%). All SE cases (8/8, 100%) were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%), 9 diffuse (9/15, 60%), and 4 intratubular/diffuse (4/15, 26.7%) types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels were a correlated vascular parameter. Although
Directory of Open Access Journals (Sweden)
Kim Jong-Hyuk
2010-05-01
Full Text Available Abstract Background Human seminoma is classified as classical seminoma (SE and spermatocytic seminoma (SS. Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Methods Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns were classified as SE or SS by immunohistochemistry (IHC using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS program was used for various statistical analyses. Results The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8% and PLAP-/PAS- SSs were 15/23 (61.2%. All SE cases (8/8, 100% were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%, 9 diffuse (9/15, 60%, and 4 intratubular/diffuse (4/15, 26.7% types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. Conclusion In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels
Morphological and immunohistochemical characterisation of seminomas in Norwegian dogs
Directory of Open Access Journals (Sweden)
Thorvaldsen Tor
2012-09-01
Full Text Available Abstract Background Seminomas in the dog have traditionally been assumed to resemble human spermatocytic seminomas, based on their low malignancy and high occurrence in old individuals. However, recently published studies indicate that canine seminomas can be classified as classical and spermatocytic seminomas in a similar way as in man, and that classical seminomas comprise a substantial proportion of seminomas in the dog. These two factors both contribute to increasing the potential of canine seminoma as a relevant model for human testicular cancer. The aim of the present study was to characterise seminoma in Norwegian dogs using morphology and immunohistochemistry, and determine whether these tumours are comparable with human classical seminoma. Methods By applying diagnostic criteria from human pathology, 45 seminomas from the Norwegian Canine Cancer Register were examined histologically with hematoxylin and eosin (HE and periodic acid-Schiff (PAS stains. All sections were stained immunohistochemically with antibodies against human placental alkaline phosphatase (PLAP and the transmembrane receptor c-KIT. Results Although two of the seminomas showed immunohistochemical staining characteristics indicative of classical seminoma (PLAP+/c-KIT+, all 45 examined seminomas were morphologically consistent with spermatocytic seminoma. Conclusions The value of canine seminoma as a model for SE in man remains unclear. Among the 45 investigated tumours from Norwegian dogs, none were classified as classical seminoma based on morphological criteria consistent with human seminomas. Regional or breed differences in the occurrence of classical seminoma in the dog, as well as the lack of uniform diagnostic criteria, might explain the discrepancy between the findings in the current study and the results presented by other authors.
DEFF Research Database (Denmark)
Bush, J M; Gardiner, D W; Palmer, J S
2011-01-01
Unlike seminomas in humans, seminomas in animals are not typically sub-classified as classical or spermatocytic types. To compare testicular germ cell tumours (TGCT) in dogs with those of men, archived tissues from 347 cases of canine testicular tumours were morphologically evaluated...... in canine TGCT. None of the canine TGCT evaluated demonstrated the presence of carcinoma in situ cells, a standard feature of human classical seminomas, suggesting that classical seminomas either do not occur in dogs or are rare in occurrence. Canine spermatocytic seminomas may provide a useful model...... and characterized using human classification criteria. Histopathological and immunohistological analysis of PLAP, KIT, DAZ and DMRT1 expression revealed that canine seminomas closely resemble human spermatocytic seminomas. In addition, a relatively frequent concomitant presence of somatic cell tumours was noted...
Classical and anaplastic seminoma: Difference in survival
International Nuclear Information System (INIS)
Bobba, V.S.; Mittal, B.B.; Hoover, S.V.; Kepka, A.
1987-01-01
The authors undertook a retrospective study of seminoma patients treated with radiation therapy between 1961 and 1985. The classical group consisted of 66 patients, of whom 47 were stage I and 19 were stage II. The anaplastic group consisted of 21 patients, of whom 11 were stage I, nine were stage II, and one was stage III. The median follow-up was 66 months. The five-year crude survival rate for the entire group was 92%, for classical 96%, and for anaplastic 78% (P<.005). Similarly, there was a significant difference (P<.005) in actuarial relapse-free survival at 5 years between classical and anaplastic seminoma. For classical stage I, the relapse-free actuarial 5-year survival rate was 96; for classical stage II, 84%. For anaplastic stage I the relapse-free actuarial 5-year survival rate was 82%, and for stage II 75%. Six patients in the classical group (9%) failed treatment. In the anaplastic group, five patients or 24 failed treatment. Therefore, the authors' data suggest a difference in survival and failure rate between classical and anaplastic seminoma. Extratesticular seminoma with anaplastic histology has an even worse prognosis
An 81-year-old patient with recent diagnosis of classic testicular seminoma
Directory of Open Access Journals (Sweden)
Sandro José Martins
2016-06-01
Full Text Available An old patient with recent diagnosis of classic seminoma is reported. The tumor of left testicle was heralded by tenderness about 30 days before medical attention and enlarged testis confirmation. There was antecedent of left testis hypotrophy treated with testosterone and a surgery for varicocele at 15 years of age. Clinical hypothesis of testicular tumor was strengthened by ultrasonography images and elevated tumor markers (lactate dehydrogenase, α-fetoprotein, and β-hCG. Radical orchiectomy was performed and a classic seminoma (pT1pNx was diagnosed. Active waiting was the first choice for management, but six months later a retroperitoneal mass with lymph node enlargement were found, and he underwent four sessions of carboplatin (AUC 5, bleomycin and etoposide (BEP regimen. Asymptomatic, he was referred to outpatient surveillance on Oncology. Population-based studies about frequency and outcome of early-stage testis seminoma in elderly are scarce. Case studies might contribute to the knowledge about this condition.
Testis. Strategy for the management of seminoma testis
International Nuclear Information System (INIS)
Fetterly, J.C.M.
1984-01-01
Many years of experience demonstrate the marked radiocurability of seminoma testis with modest radiation dosage, and accordingly large volumes may be radiated without damage to surrounding normal structures. While several histological types of seminoma are described (classical, anaplastic, or spermatocytic) our treatment strategy is identical
Directory of Open Access Journals (Sweden)
Nicolas Chevalier
2014-01-01
Full Text Available Testicular germ cell tumors (TGCTs are the most common solid cancers in young men, with an increasing incidence over several years. However, their pathogenesis remains a matter of debate. Some epidemiological data suggest the involvement of both environmental and genetic factors. We reported two distinct effects of estrogens and/or xeno-estrogens on in vitro human seminoma-derived cells proliferation: (1 an antiproliferative effect via a classical estrogen receptor beta-dependent pathway, and (2 a promotive effect via a non-classical membrane G-protein-coupled receptor, GPR30/GPER, which is only overexpressed in seminomas, the most common TGCT. In order to explain this overexpression, we investigated the possible association of polymorphisms in the GPER gene by using allele-specific tetra-primer polymerase chain reaction performed on tissue samples from 150 paraffin-embedded TGCT specimens (131 seminomas, 19 non seminomas. Compared to control population, loss of homozygous ancestral genotype GG in two polymorphisms located in the promoter region of GPER (rs3808350 and rs3808351 was more frequent in seminomas but not in non-seminomas (respectively, OR = 1.960 (1.172–3.277 and 7.000 (2.747–17.840; p < 0.01. These polymorphisms may explain GPER overexpression and represent a genetic factor of susceptibility supporting the contribution of environmental GPER ligands in testicular carcinogenesis.
Aschim, E L; Haugen, T B; Tretli, S; Daltveit, A K; Grotmol, T
2006-08-01
The origin of testicular germ cell cancer (TGCC) is believed to be carcinoma in situ cells developed in utero. Clinically, TGCCs are divided into two major histological groups, seminomas and non-seminomas, where the latter group includes non-seminomatous TGCCs with seminomatous components (mixed S/NS TGCC). Recent studies, however, have suggested that non-seminomas and mixed S/NS TGCCs could have certain differences in aetiology, and in this study the TGCCs were divided into three, rather than the conventional two histological groups. A large case-control study was undertaken on data on all live-born boys registered in the Medical Birth Registry of Norway during the period 1967-1998 (n=961 396). Among these were 1087 TGCC cases registered in the Cancer Registry of Norway until February 2004. We found several risk factors for TGCC, including low parity, low gestational age, epilepsy and retained placenta. Several of the variables studied seemed to be risk factors for specific histological groups, e.g. parity 0 vs. 2 and low gestational age being associated with increased risk of non-seminomas, but not of mixed S/NS TGCC, and low maternal age being associated with increased risk of mixed S/NS TGCC, but not of non-seminomatous TGCC. Therefore, our results might suggest that non-seminomas and mixed S/NS TGCCs have partially different risk factors, whose associations may be obscured by combining these two histological groups. The histological groups were not significantly different, however. Most of our findings on risk factors for TGCC are in agreement with at least some previous studies. An unexplainable exception is low birth weight being associated with reduced risk of TGCC in our study.
Javanbakht, J; Pedram, B; Taheriyan, M R; Khadivar, F; Hosseini, S H; Abdi, F S; Hosseini, E; Moloudizargari, M; Aghajanshakeri, S H; Javaherypour, S; Shafiee, R; Emrani Bidi, R
2014-06-01
In this study, 12 dogs affected by canine transmissible venereal tumor (CTVT) and testicular seminoma tumor were studied retrospectively. The cytological sample was smeared onto a glass slide and either air-dried for May-Grünwald-stain, and masses were surgically removed. The tumors were grossly examined, and sections of 4-μm thick were obtained from each sample and stained with H&E. For chemotherapy, vincristine sulfate was administered weekly as an infusion over 3 min via the cephalic vein at a dose of 0.025 mg/kg after diluting with physiological saline to a total amount of 10 ml. If no remission was observed after 8 weeks, chemotherapy was continued with weekly doxorubicin infusion at a dose of 1 mg/kg. All the tumor samples were divided into four cytohistopathologic groups, namely: multilobular (six cases), papillary (two cases), pedunculated (two cases), and tubular (two cases of seminoma). The most frequently represented tumor type was multilobular (6/10, 60 %) followed by pedunculated (2/10, 20 %), papillary (2/10, 20 %), and tubular (two cases of seminoma, 100 %). Cytological smears from eight tumors in regression after chemotherapy were poorly cellular, and many cells were fragmented. In two progressive tumors, there was an average of 1,406 ± 972 CTVT 200 cells/μl or 96.71 % of total cells counted. Thus, tumor cells represented 96.71 % of total cells within the biopsy specimens and the leukocytes 4.29 % (leukocyte, tumor cell ratio=0.062 ± 0.031). In eight regressive tumors, there was an average of 1,245 ± 1,032 CTVT 200 cells/μl or 97.31 % of total cells counted. Thus, tumor cells represented 97.31 % of total cells and leukocytes 2.69 % (leukocyte, tumor cell ratio=0.071 ± 0.174). Our data suggested that combination treatment with vincristine and doxorubicin in the future could be an excellent therapeutic alternative for the treatment of TVT for probably reducing the resistance to vincristine, and also, treatment success could easily be followed
Impalpable Testicular Seminoma Identified on Sonoelastography
Directory of Open Access Journals (Sweden)
Eric M. Ghiraldi
2015-09-01
Full Text Available The role of sonoelastography in diagnosing cancerous masses has increased since the advent of elastography as an ultrasound modality. Its ability to display differences in the mechanical properties of cancerous masses compared to normal surrounding tissue has shown benefit in increasing the accuracy of diagnosing malignant breast and thyroid masses and has shown early potential in accomplishing better targeted prostate biopsies. To date, the literature is limited in the number of studies describing the use of sonoelastography for testicular masses. We describe a 34-year-old man who presented with an incidental finding of an impalpable hypoechoic testicular mass on grayscale ultrasound during an infertility work-up. Sonoelastography was performed displaying intermediate testicular elastic properties. Upon frozen section of the mass during surgical exploration, classic testicular seminoma was diagnosed and subsequent radical orchiectomy was performed. We would like to use this atypical presentation of testicular seminoma to review the potential role of elastography for diagnosing testicular cancer.
Directory of Open Access Journals (Sweden)
Ciaputa Rafał
2015-04-01
Full Text Available Immunohistochemical profiles of the most common canine testicular tumours, including the Leydig cell tumours, seminomas, and Sertoli cell tumours were analysed, and the results were compared with those obtained in the corresponding types of human testicular neoplasms. The expressions of vimentin, von Willebrand factor (FVIII, chromogranin A, synaptophysin, and MCM3 were quantified. In the case of Sertoli cell tumours, only canine ones were analysed, since this type of tumour is very rarely diagnosed in men. The expression of the analysed proteins in the testicular tumours was similar. The von Willebrand factor exhibited the strongest expression in Leydig cell tumours in dogs and men, while vimentin was expressed more strongly in dogs (96.7% had an intensity at +++ than in men (62.5% had +++ in the Leydigioma. The immunoexpression of MCM3 in seminomas was high in both men and dogs – 90% +++ and 100% +++ respectively. The lack of chromogranin A and synaptophysin was observed in almost 100% of seminomas in men and dogs. This differed from the results obtained for Leydigioma, where chromogranin A was expressed in 70% of dogs at +++ and in 100% of men at ++++. The results may indicate that the antibodies were selected correctly. Their analysis and interpretation provides valuable information concerning the nature of the studied tumours.
Downregulation of Clusterin Expression in Human Testicular Seminoma
Directory of Open Access Journals (Sweden)
Bianjiang Liu
2013-11-01
Full Text Available Background: Clusterin, a heterodimeric glycoprotein of approximately 80 kDa, exists extensively in human body fluids. The abnormal expression of clusterin is closely related to the occurrence, progression, and prognosis of tumors. Up to now, few studies have focused on clusterin in human testicular cancer. This study describes an extensive exploration of the presence and expression of clusterin in testicular seminoma. Methods: Tumor tissues and normal testis tissues were collected from 13 patients with testicular seminoma and 16 patients undergoing surgical castration for prostate cancer. Real-time polymerase chain reaction (PCR was performed to detect the expression difference of clusterin mRNA between testicular seminoma and normal testis. Western blot and immunohistochemical analysis were performed to detect the presence and expression difference of clusterin protein between two groups. Results: Real-time PCR showed the expression of clusterin mRNA in testicular seminoma to be significantly lower than in normal testis (only 13% relative quantification. Western blot analysis indicated marked reductions in the expression of clusterin protein in testicular seminoma. Similar results were observed upon immunohistochemical analysis. Conclusion: In testicular seminoma and normal testis, clusterin exists in its heterodimeric secretory isoform. Clusterin expression is significantly lower in testicular seminoma than in normal testis. This is the first comprehensive study of the presence and expression of clusterin in human testicular cancer.
International Nuclear Information System (INIS)
Sagerman, R.H.; Kotlove, D.J.; Regine, W.; Chung, C.T.; King, G.A.; Dalai, P.S.
1988-01-01
Between 1966 and 1985, 32 patients with stage II (21 A,11 B) testicular seminoma were treated with postorchiectomy irradiation to the retroperitoneal and ipsilateral iliac nodes; 28 received elective mediastinal-supraclavicular irradiation. The median follow-up was 8 1/2 years; 29 patients were followed up for over 3 years and 24 for over 5 years. Twenty-eight patients remain alive and well and four have die, two of a second primary cancer. Two patients developed recurrent seminoma in the mediastinum; these patients showed a variant lymphangiographic pattern. Both remain well after further irradiation or irradiation plus chemotherapy. A third patient developed nonseminomatous ''recurrence'' in the radiation field and is well after chemotherapy
Management of testicular seminoma. Our experience.
Sperlongano, P; Pisaniello, D; Di Mauro, U; Pone, D; Casoli, E
2000-01-01
The authors report their experience in the management of seminomas. They examine 12 cases of seminoma among a series of 19 patients with testicular germ cell tumours observed at the Second Surgical Department of the Second University of Naples. Their results showed a better prognosis for patients in early stage of the disease who underwent surgery and adjuvant prophylactic radiotherapy; good survival rates for patients in advanced stages of the disease were achieved by the combined use of surgery, adjuvant radiotherapy and chemotherapy. The authors discuss risk factors, clinical and diagnostic features of seminomas, relating their prognosis with the combined use of both surgery and adjuvant therapies. They consider total orchiectomy, followed by prophylactic radiotherapy, the treatment of choice, especially in stages IA and IIA. They don't perform the routine retroperitoneal lymphadenectomy, differently from American authors, who always achieve it to stage the disease. The authors stress the improvement in the prognosis of seminoma, which has actually reached the 98% of five-year survival rate, for stages I and II.
Mutations in LRRC50 predispose zebrafish and humans to seminomas.
Directory of Open Access Journals (Sweden)
Sander G Basten
2013-04-01
Full Text Available Seminoma is a subclass of human testicular germ cell tumors (TGCT, the most frequently observed cancer in young men with a rising incidence. Here we describe the identification of a novel gene predisposing specifically to seminoma formation in a vertebrate model organism. Zebrafish carrying a heterozygous nonsense mutation in Leucine-Rich Repeat Containing protein 50 (lrrc50 also called dnaaf1, associated previously with ciliary function, are found to be highly susceptible to the formation of seminomas. Genotyping of these zebrafish tumors shows loss of heterozygosity (LOH of the wild-type lrrc50 allele in 44.4% of tumor samples, correlating with tumor progression. In humans we identified heterozygous germline LRRC50 mutations in two different pedigrees with a family history of seminomas, resulting in a nonsense Arg488* change and a missense Thr590Met change, which show reduced expression of the wild-type allele in seminomas. Zebrafish in vivo complementation studies indicate the Thr590Met to be a loss-of-function mutation. Moreover, we show that a pathogenic Gln307Glu change is significantly enriched in individuals with seminoma tumors (13% of our cohort. Together, our study introduces an animal model for seminoma and suggests LRRC50 to be a novel tumor suppressor implicated in human seminoma pathogenesis.
Seminoma testicular form unusual presentation and clinical course
International Nuclear Information System (INIS)
Roldán G, Arén O.; Varangot, M.; Levin, R.; Delgado, L.; Viola, A.; Vázquez, A.; Musé, I.
2004-01-01
Introduction: The recognized sensitivity to treatment (tto) onco specific tumors testicular germ, and in particular the range seminoma, makes the finding of patients (ptes) having a poor outcome and lack of response to it, represents a striking fact. The high rate of redemption described in ptes relapsing after response to first line tto, confronted with identifying ptes that require the design of therapeutic strategies multidisciplinary individualized resistant to the presence of residual masses. Patients and methods: From the presentation of 6 clinical cases of carriers ptes seminoma (TS) with unusual clinical presentation and evolution, is performed literature review including: 1 Relapse of stage I ptes with TS after adjuvant radiotherapy - Cases No. 1 and 2 2 primary retroperitoneal seminoma - Clinical Case 3 3 oncospecific treatment refractory seminoma - Clinical cases 4, 5 and 6 discussion:1. TS stage I ptes with complementary receiving interval reaches radiant tto Progression-free 98% at 5 years and an overall survival of 94% at 10 years. In cases we report only the lung relapse (case 1) and bone (case 2) are evident to 17 and 12 months after diagnosis. The role of surgery and salvage chemotherapy is emphasized, and the poor prognosis of the unusual second relapse. 2 TS retroperitoneal extragonadal start is, according to the literature, less frequent than primarily mediastinal. Moreover, within this group 83% corresponds to non-seminoma. Chemotherapy is the tto of choice with 88% of without overall differences from the beginning of mediastinal survival. 3 Carriers ptes advanced seminoma treated with cisplatin-based chemotherapy (cisplatin with or without bleomycin -etopósido) achieve 70-90% complete responses. approximately 50% of carriers, a second relapse achieved complete response with vinblastine - ifosfamide and cisplatin (VIP). Given the low frequency of this situation, the role of High-dose chemotherapy with stem cell transplantation in patients
Seminoma in a Man with Russell-Silver Syndrome Presenting with Testicular Torsion
Directory of Open Access Journals (Sweden)
Satoshi Funada
2016-01-01
Full Text Available Russell-Silver syndrome (RSS is a type of primordial dwarfism. Only one case of testicular cancer in RSS has been reported, the pathology of which was nonseminoma. Here, we report a case of seminoma in a 36-year-old man who was diagnosed with RSS at birth. The seminoma was diagnosed when the patient presented with testicular torsion. This is the first report of testicular seminoma in an RSS patient in the literature. We also discussed the correlation between seminoma and RSS.
International Nuclear Information System (INIS)
Roldán, G.; Musé, I.
2004-01-01
Introduction: The patients with testicular germ cell tumors (TGT) present in the contralateral tumor development in approximately 3% of the cases. A small subset presenting with synchronous bilateral tumors (TBS). Case report: Patient is a 41-year study of infertility in who have performed bilateral testicular biopsies. Using ultrasound bilateral testicular nodules were diagnosed predominantly right. It performs a bilateral orchiectomy evidencing bilateral pure classic seminoma (T1 and T4). Staging the regional nodal involvement and distance rule and visceral with normal tumor markers. Receive adjuvant radiotherapy (3060 cGy) including inguinal lymph node chains, and pelvic and lumbo-aortic remaining free of disease at 33 months after surgery. Discussion: 85% of all bilateral TGT metachronous are presented as 15% synchronously. TBS represent less than 1% of the most representative series. In most cases they are seminomas and have been associated with infertility and history Family suggestive of genetic predisposition. Bilateral orchiectomy is local treatment of choice and subsequent planned strategy is according the loco-regional extension stressing the importance of hormone replacement and psychological support. Conclusions: In patients with a family history suggestive or infertile should be evaluated for TBS, especially if it carries a seminoma. the bilateral orchiectomy is local treatment of choice. We found no evidence seminomatous TBS have a worse prognosis compared with patients with unilateral or bilateral metachronous tumors of similar size lesional
Isolated Femoral Muscle and Bone Metastases Rarely Encountered in Testicular Seminoma
Directory of Open Access Journals (Sweden)
Serkan Degirmencioglu
2013-01-01
Full Text Available Isolated muscle and bone metastases are rarely encountered in patients with testicular seminomas. In the present study, a patient who was admitted with pain, loss of motion, and swelling in the right leg 20 months following surgery for stage I seminoma was presented. Hypermetabolic lesion was detected in the right femoral muscle and bone via positron emission tomography. After the presence of metastasis from seminoma was confirmed by biopsy, bleomycin, cisplatin, and etoposide, combination chemotherapy was administered to the patient.
Bilateral Malignant Seminomas in Two Unrelated, Aged Trumpeter Hornbills (Bycanistes buccinator).
Wernick, Morena B; Tobias, Jeremy R; Moeller, Robert B; Barnes, John; Palmieri, Chiara; Shivaprasad, H L
2015-06-01
Seminomas occur infrequently in birds. Two cases of bilateral malignant seminomas in unrelated trumpeter hornbills (Bycanistes buccinator) are described. Case 1 was a 22-year-old trumpeter hornbill submitted for necropsy because of sudden death at a zoo in California. Postmortem examination revealed multiple masses within the body cavity, 2 of which replaced both testes. Case 2 was a 19-year-old trumpeter hornbill at a zoo in North Carolina that underwent exploratory surgery for a suspected gastrointestinal obstruction. Both testes were diffusely enlarged, compressing and replacing the adjacent kidneys. In both birds, the masses were composed of discrete, round to polyhedral cells, typical of seminomas. Examination of the ancestry of the hornbills showed they were unrelated to each other, suggesting a potential predisposition for these birds to develop seminomas.
Carboplatin AUC 10 for IGCCCG good prognosis metastatic seminoma.
Tookman, Laura; Rashid, Sukaina; Matakidou, Athena; Phillips, Melissa; Wilson, Peter; Ansell, Wendy; Jamal-Hanjani, Mariam; Chowdhury, Simon; Harland, Stephen; Sarwar, Naveed; Oliver, Timothy; Powles, Thomas; Shamash, Jonathan
2013-06-01
Metastatic seminoma is a highly curable disease. Standard treatment comprises of combination chemotherapy. The short- and long-term toxicities of this treatment are increasingly recognised and the possibility of over treatment in such a curable disease should be considered. We have therefore assessed the use of single agent carboplatin at a dose of AUC 10 in patients with good prognosis metastatic seminoma. Patients with good prognosis metastatic seminoma treated with carboplatin (AUC 10) were identified at our institution and affiliated institutions. Treatment was three weekly for a total of three or four cycles. Outcome and toxicities were analysed. With a median follow-up of 36 months, 61 patients in total were treated with carboplatin AUC 10, all good prognosis by the IGCCCG criteria. Forty-eight percent had stage IIA/IIB disease and 52% had greater than stage IIB disease. Thirty-one patients (51%) had a complete response following treatment. Three-year survival was 96.3% with a three-year progression free survival of 93.2%. The main treatment toxicity was haematological with 46% having grade 3, 24% having grade 4 neutropenia and 54% experiencing grade 3/4 thrombocytopenia. There were no treatment related deaths. Single agent carboplatin at a dose of AUC 10 is an effective treatment for good prognosis metastatic seminoma. The outcome compares favourably to previously published outcomes of combination chemotherapy. Although haematological toxicity is a concern, single agent carboplatin treatment for good prognosis metastatic seminoma could be considered a treatment option and is associated with less toxicity than combination regimens currently used.
Radiation therapy for stage I and II testicular seminoma
International Nuclear Information System (INIS)
Latini, P.; Aristei, C.; Maranzano, E.; Checcaglini, F.; Panizza, M.B.; Perrucci, E.; Bellucci, M.C.
1988-01-01
From june 1977 through june 1987, 46 patients (36 evaluable) affected by stage I and II non-bulky testicular seminoma were treated with postoperative telecobaltotherapy (TCT). In stage I seminomas, radiotherapy was extended to the omolateral iliac and the para-aortic areas (total dose: 30 Gy over 4 weeks). In stage II seminomas, the subdiaphragmatic lymph nodes were irradiated with 40-45 Gy over 5-6 weeks; after an interval of one month the subdiaphragmatic lymph nodes were irradiated again with a total dose of 25 Gy over 3.5 weeks. Minimal follow-up lasted two years and maximum ten years (average:5.5%) recurrences occurred, but salvage radiotherapy and salvage chemotherapy respectively allowed a complete permanent remission. One patient died from a different neoplasia with no evidence of testicular involvement. The 5-year actuarial survival is 96.6±3.4. In 20% of the patients the side effects were nausea and/or vomiting, easily controlled. No late complications were observed
Directory of Open Access Journals (Sweden)
Takeo Nakaya, MD
2016-09-01
Full Text Available We experienced the giant seminoma with 18 × 10 × 10 cm sized and about 2.6 kg weight of 25 year old patient. We intensively examined the histological tissue type distributions in this giant seminoma. Most of the tumor consisted of seminoma components. In addition, the tumor included the very small fragments of yolk sac tumor and embryonal carcinoma component at the root part of the seminoma mass. This shows that intensive histological examination may contribute to the finding of other embryonic component of the large seminoma. This may show that leaving the seminoma growing may generate the other embryonic tumor component, not always big enough to find out in a routine procedure, during the growth, in the different way from the original mixed cell germ tumor.
[Granulomatous slack skin associated with metastatic testicular seminoma].
Carton de Tournai, D; Deschamps, L; Laly, P; Zeboulon, C; Bouaziz, J-D; Ram-Wolff, C; Doumecq-Lacoste, J-M; Ortonne, N; Rivet, J; Battistella, M; Bagot, M
Granulomatous slack skin (GSS) is an extremely rare subtype of T-cell lymphoma, a variant of mycosis fungoides (MF). Herein, we describe the first reported case of GSS associated with metastatic testicular seminoma. A 28-year-old male patient presented with circumscribed erythematous loose skin masses, especially in the body folds and which had been relapsing for 4years. Skin biopsy showed a loss of elastic fibers and an atypical granulomatous T-cell infiltrate with epidermotropism, enabling a diagnosis of GSS to be made. A biopsy of a retroperitoneal lymphadenopathy showed testicular seminoma metastasis. Patients suffering from GSS have a statistically higher risk of developing a second primary cancer, especially Hodgkin's lymphoma. The association found between GSS and a lymphoproliferative malignancy requires long-term follow-up and determines the patient's prognosis. It is not possible to prove a formal link between GSS and testicular seminoma. However, this case illustrates the value of screening for a second cancer, particularly where extra-cutaneous lesions appear during GSS treatment. Lymph node biopsy should be performed routinely in the event of GSS with possible lymph node involvement. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Seminoma Presenting as Renal Mass, Inferior Vena Caval Thrombus, and Regressed Testicular Mass
Directory of Open Access Journals (Sweden)
Valary T. Raup
2015-01-01
Full Text Available Testicular cancer is the most common malignancy of men aged 15–40. Metastatic spread classically begins with involvement of the retroperitoneal lymph nodes, with metastases to the liver, lung, bone, and brain representing advancing disease. Treatment is based on pathologic analysis of the excised testicle and presence of elevated tumor markers. We report a case of a 34-year-old male presenting with back pain who was found to have a right renal mass with tumor extension into the inferior vena cava. Subsequent biopsy was consistent with seminoma. We review this rare case and discuss the literature regarding its diagnosis and management.
Radiotherapy in stage 1 testicular seminoma: retrospective study and review of literature
International Nuclear Information System (INIS)
Bauduceau, O.; Le-Moulec, S.; Bernard, O.; Souleau, B.; Houlgatte, A.
2003-01-01
Introduction. - Seminoma accounts for about 40% of germ cell tumours of the testicle. In this retrospective analysis, we review literature concerning management of stage I seminoma. Materials and methods. - Between March 1987 and April 2001, 65 patients with stage I pure testicular seminoma received adjuvant radiotherapy with a 25 MV linear accelerator. Results. - Median age was 33 years. Testicular tumour has been found on the right testis in 39 patients and on the left one in 24 patients. Patients have been treated using an anterior-posterior parallel pair and have received 20-25 Gy in 10-14 fractions. The target volume consisted of paraaortic, and paraaortic + homolateral iliac lymph nodes in 17 and 46 patients, respectively. Acute toxicity was mainly digestive, 38% of patients presenting nausea and vomiting. Median follow-up time was 37 months. All patients are alive in complete remission. Discussion. - Because of good radio-sensitivity of seminoma, radiotherapy is regarded as standard adjuvant treatment (5 years relapse rate: 3-5%). Acute toxicity is dominated by moderate gastro-intestinal side effects. Secondary neoplasia represents one of the worst possible long-term complications of therapy. Waiting for ongoing randomized trials, the modern literature for seminoma reflects a trend toward lower radiation doses (20-25 Gy) and smaller treatment volumes (paraaortic field). Adjuvant chemotherapy with two courses of carbo-platin, might be equivalent to radiotherapy but must be investigated in randomized trials. A surveillance policy is one of the other management options less recommended. (author)
Is mediastinal irradiation necessary for stage I testicular seminoma
International Nuclear Information System (INIS)
Jose, B.; Perkins, L.P.; Kays, H.; Chu, A.M.; Sharma, S.C.
1984-01-01
This study is a review of 39 patients with testicular seminoma, Stage I, treated at the Department of Radiation Oncology, James Graham Brown Cancer Center from 1959 to 1978. The age of the patients ranged from 16 to 70 years with a median of 37. Thirty-two (82%) patients presented with swelling or mass in the testis, four patients with pain, and three patients had seminoma diagnosed incidentally. Twenty (51%) patients had the tumor on the right side and 19 (49%) patients had the tumor on the left side. All patients received irradiation to the ipsilateral inguinal, iliac, and bilateral para-aortic nodes with ''hockey stick'' type fields. The majority of the patients received a midplane dose of 3,200 to 3,600 rad in 3-4 weeks time. None of the patients received prophylactic irradiation to the mediastinum and supraclavicular region. The 5-year actuarial survival rate is 96%. There is no additional benefit in giving prophylactic irradiation to the mediastinum and supraclavicular regions in Stage I testicular seminoma. A brief review of the literature regarding the role of prophylactic irradiation in this group of patients is done
Burned-out seminoma revealed by solitary rib bone metastasis
Energy Technology Data Exchange (ETDEWEB)
Nishisho, Toshihiko; Miyagi, Ryo; Sairyo, Koichi [Tokushima University Graduate School, Department of Orthopedics, Institute of Biomedical Sciences, Tokushima-city, Tokushima (Japan); Sakaki, Mika [Saitama Medical University International Medical Center, Department of Pathology, Hidaka-city, Saitama (Japan); Takao, Shoichiro [Tokushima University Graduate School, Department of Radiology, Institute of Biomedical Sciences, Tokushima-city, Tokushima (Japan)
2017-10-15
Burned-out tumor is a rare phenomenon in which a testicular tumor regresses in the primary lesion and progresses in a metastatic lesion. We report the case of a 30-year-old male with burned-out seminoma revealed by open biopsy of solitary 10th rib bone metastasis. He underwent inguinal orchiectomy, which revealed hyalinization, indicating a spontaneously regressed testicular tumor. Chemotherapy for seminoma was administered in three cycles of bleomycin + etoposide + cisplatin therapy. The chemotherapy was effective, and wide resection of the rib was subsequently performed. No postoperative chemotherapy was performed, and there has been no evidence of recurrence for 3 years postoperatively. (orig.)
TREATMENT FOR STAGE I TESTICULAR SEMINOMA
Directory of Open Access Journals (Sweden)
E. A. Burova
2014-07-01
Full Text Available Overall survival is about 100% in patients with stage I germinogenic testicular tumors after orchifuniculectomy, which is achieved, by applying alternative adjuvant approaches. The use of approaches, such as a follow-up, chemo- and radiotherapy, may be recommended in seminoma. The paper shows the advantages and disadvantages of these methods.
TREATMENT FOR STAGE I TESTICULAR SEMINOMA
Directory of Open Access Journals (Sweden)
E. A. Burova
2010-01-01
Full Text Available Overall survival is about 100% in patients with stage I germinogenic testicular tumors after orchifuniculectomy, which is achieved, by applying alternative adjuvant approaches. The use of approaches, such as a follow-up, chemo- and radiotherapy, may be recommended in seminoma. The paper shows the advantages and disadvantages of these methods.
Radiotherapy Treatment Planning for Testicular Seminoma
International Nuclear Information System (INIS)
Wilder, Richard B.; Buyyounouski, Mark K.; Efstathiou, Jason A.; Beard, Clair J.
2012-01-01
Virtually all patients with Stage I testicular seminoma are cured regardless of postorchiectomy management. For patients treated with adjuvant radiotherapy, late toxicity is a major concern. However, toxicity may be limited by radiotherapy techniques that minimize radiation exposure of healthy normal tissues. This article is an evidence-based review that provides radiotherapy treatment planning recommendations for testicular seminoma. The minority of Stage I patients who choose adjuvant treatment over surveillance may be considered for (1) para-aortic irradiation to 20 Gy in 10 fractions, or (2) carboplatin chemotherapy consisting of area under the curve, AUC = 7 × 1−2 cycles. Two-dimensional radiotherapy based on bony anatomy is a simple and effective treatment for Stage IIA or IIB testicular seminoma. Centers with expertise in vascular and nodal anatomy may consider use of anteroposterior–posteroanterior fields based on three-dimensional conformal radiotherapy instead. For modified dog-leg fields delivering 20 Gy in 10 fractions, clinical studies support placement of the inferior border at the top of the acetabulum. Clinical and nodal mapping studies support placement of the superior border of all radiotherapy fields at the top of the T12 vertebral body. For Stage IIA and IIB patients, an anteroposterior–posteroanterior boost is then delivered to the adenopathy with a 2-cm margin to the block edge. The boost dose consists of 10 Gy in 5 fractions for Stage IIA and 16 Gy in 8 fractions for Stage IIB. Alternatively, bleomycin, etoposide, and cisplatin chemotherapy for 3 cycles or etoposide and cisplatin chemotherapy for 4 cycles may be delivered to Stage IIA or IIB patients (e.g., if they have a horseshoe kidney, inflammatory bowel disease, or a history of radiotherapy).
Radiotherapy Treatment Planning for Testicular Seminoma
Energy Technology Data Exchange (ETDEWEB)
Wilder, Richard B., E-mail: richardbwilder@yahoo.com [Department of Radiation Oncology, Moffitt Cancer Center, Tampa, FL (United States); Buyyounouski, Mark K. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Efstathiou, Jason A. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA (United States); Beard, Clair J. [Department of Radiation Oncology, Dana-Farber/Brigham and Women' s Cancer Center, Boston, MA (United States)
2012-07-15
Virtually all patients with Stage I testicular seminoma are cured regardless of postorchiectomy management. For patients treated with adjuvant radiotherapy, late toxicity is a major concern. However, toxicity may be limited by radiotherapy techniques that minimize radiation exposure of healthy normal tissues. This article is an evidence-based review that provides radiotherapy treatment planning recommendations for testicular seminoma. The minority of Stage I patients who choose adjuvant treatment over surveillance may be considered for (1) para-aortic irradiation to 20 Gy in 10 fractions, or (2) carboplatin chemotherapy consisting of area under the curve, AUC = 7 Multiplication-Sign 1-2 cycles. Two-dimensional radiotherapy based on bony anatomy is a simple and effective treatment for Stage IIA or IIB testicular seminoma. Centers with expertise in vascular and nodal anatomy may consider use of anteroposterior-posteroanterior fields based on three-dimensional conformal radiotherapy instead. For modified dog-leg fields delivering 20 Gy in 10 fractions, clinical studies support placement of the inferior border at the top of the acetabulum. Clinical and nodal mapping studies support placement of the superior border of all radiotherapy fields at the top of the T12 vertebral body. For Stage IIA and IIB patients, an anteroposterior-posteroanterior boost is then delivered to the adenopathy with a 2-cm margin to the block edge. The boost dose consists of 10 Gy in 5 fractions for Stage IIA and 16 Gy in 8 fractions for Stage IIB. Alternatively, bleomycin, etoposide, and cisplatin chemotherapy for 3 cycles or etoposide and cisplatin chemotherapy for 4 cycles may be delivered to Stage IIA or IIB patients (e.g., if they have a horseshoe kidney, inflammatory bowel disease, or a history of radiotherapy).
Seminoma mediastÃnico: A propósito de um caso clÃnico
Directory of Open Access Journals (Sweden)
José Roberto Silva
2008-09-01
Full Text Available Resumo: A propósito de um caso clÃnico, os autores fazem uma breve revisão da clÃnica, diagnóstico e tratamento do seminoma com localização mediastÃnica.Rev Port Pneumol 2008; XIV (5: 705-708 Abstact: In reference to a clinical report, the authors of this article make a review about semiology, diagnosis and treatment of mediastinal seminoma.Rev Port Pneumol 2008; XIV (5: 705-708 Palavras-chave: Seminoma mediastÃnico, caso clÃnico, Key-words: Mediastinal seminoma, case report
Sexual and marital relationships after radiotherapy for seminoma
International Nuclear Information System (INIS)
Schover, L.R.; Gonzales, M.; von Eschenbach, A.C.
1986-01-01
Questionnaires on sexual function, marital status, and fertility were returned by 84 men who received radiotherapy for seminoma (Stage I, II, or III). The mean length of follow-up was ten years. Although 93 per cent were married, 19 per cent had low rates of sexual activity, 12 per cent reported low sexual desire, 15 per cent had erectile dysfunction, 10 per cent had difficulty reaching orgasm, and 14 per cent had premature ejaculation. The most common problems were reduced intensity of orgasm (33%) and reduced semen volume (49%). Twenty-one men remained childless, and 30 per cent of men worried at least occasionally about infertility. Thirteen children were conceived after cancer therapy. The data suggest that sexual dysfunction and infertility are important concerns for a subgroup of men treated for seminoma
Sexual and marital relationships after radiotherapy for seminoma
Energy Technology Data Exchange (ETDEWEB)
Schover, L.R.; Gonzales, M.; von Eschenbach, A.C.
1986-02-01
Questionnaires on sexual function, marital status, and fertility were returned by 84 men who received radiotherapy for seminoma (Stage I, II, or III). The mean length of follow-up was ten years. Although 93 per cent were married, 19 per cent had low rates of sexual activity, 12 per cent reported low sexual desire, 15 per cent had erectile dysfunction, 10 per cent had difficulty reaching orgasm, and 14 per cent had premature ejaculation. The most common problems were reduced intensity of orgasm (33%) and reduced semen volume (49%). Twenty-one men remained childless, and 30 per cent of men worried at least occasionally about infertility. Thirteen children were conceived after cancer therapy. The data suggest that sexual dysfunction and infertility are important concerns for a subgroup of men treated for seminoma.
An Unusual Case of Metastatic Seminoma in a Dog.
Dugat, Danielle R; Medici, Emily L; Rochat, Mark C; Arble, Jason A; Snider, Timothy A
2015-01-01
An 8 yr old, reportedly castrated male Boston terrier presented with a history of generalized hyperesthesia and intermittent shifting leg lameness. Physical examination revealed a caudal abdominal mass and bilateral shoulder pain. A complete blood count, serum biochemistry panel, and urinalysis were unremarkable. Thoracic radiographs demonstrated bony proliferation and lysis of the third sternebra, an expansile lesion of the left tenth rib, and lucency in both proximal humeral metaphyses. Abdominal radiographs and ultrasound revealed a soft tissue mass within the caudoventral right abdomen. Ultrasonography also revealed an enlarged lymph node within the right retroperitoneal space. Exploratory laparotomy identified the mass as a retained testicle. A cryptorchidectomy, lymph node biopsy, and bilateral percutaneous core biopsies of the proximal humeri were performed. Histopathologic examination revealed malignant seminoma of the testicle with metastasis to lymph node and bone. Adjuvant chemotherapy was recommended, but it was declined by the owner. All follow-up was lost. This case highlights a unique case for causative hyperesthesia secondary to a novel site of metastasis from malignant seminoma. Metastasis to bone has not been reported in humans or dogs and represents a very unusual and aberrant variant of the normally relatively benign biological behavior of seminoma in the dog.
Is Radiotherapy Necessary for Stage 1 Testicular Seminoma?
International Nuclear Information System (INIS)
Lee, Jung Ae; Park, Won; Lim, Do Hoon; Ahn, Yong Chan; Huh, Seung Jae; Yu, Jeong Il; Choi, Han Yong; Lee, Hyun Moo; Cho, Eun Yoon
2009-01-01
To report on the clinical outcome of patients with stage I testicular seminoma by postoperative radiotherapy (PORT) or surveillance after radical inguinal orchiectomy. This study is a retrospective review of 32 stage I pure seminoma patients treated between 1996 and 2005 at the Samsung Medical Center. Twenty two of the patients were treated by PORT, which was directed at the paraaortic lymphatics with a median dose of 25.2 Gy in 14 fractions for 3 weeks. The 10 remaining patients were managed by surveillance. The median follow-up period was 96 months with a range of 24 to 155 months. Clinically, most patients presented with a testicular mass or discomfort. Two of the patients had a history of undescended testes. Pathologically, 23 of the patients had intratubular germ cell neoplasia with seminoma. Both recurrence-free survival (RFS) and overall survival (OS) rates of patients treated by PORT were 100%. In the control group, 1 of the 10 patients suffered a para-aortic lymph node relapse. The RFS and OS rates of the surveillance group were 88.9% and 100%, respectively. No difference in survival was observed between the two groups. Moreover, symptom recurrence was only observed in 1 patient in the control group. The use of PORT may reduce the risk of relapse. With the availability of effective diagnostic and salvage modalities, surveillance monitoring may be considered for patients in good compliance
Radiotherapy for Stage I seminoma testis: results of treatment and complications
International Nuclear Information System (INIS)
Hamilton, C.; Horwich, A.; Easton, D.; Peckham, M.J.
1986-01-01
The results of treatment by infradiaphragmatic lymph node irradiation and orchiectomy in 232 patients with Stage I testicular seminoma are reported. Of this group, only five (2%) patients relapsed and none died from seminoma. Contralateral testicular tumours occurred in 12 patients and five developed second non-testicular malignancies. The acute and late morbidity of radiotherapy was low although 15 patients developed peptic ulceration. There was a significant association between prior abdominal surgery and a history of dyspepsia with ensuing peptic ulceration. Future management policy is discussed on the basis of these observations. (Auth.)
Intra-Abdominal Testicular Seminoma in a Woman with Testicular Feminization Syndrome
Directory of Open Access Journals (Sweden)
Darshana D. Rasalkar
2011-01-01
Full Text Available We report a case of intra-abdominal testicular tumor in a 36-year-old married lady presenting with chief complaints of primary amenorrhea. The patient was later diagnosed with testicular feminization syndrome, a form of male pseudohermaphroditism. This testicular tumor was histologically proven as seminoma. Due to rarity, imaging findings in patients with testicular feminization syndrome and intraabdominal testicular tumor have been poorly documented. So far, only one case report had described the combined role of CT and MR imaging in intraabdominal testicular sex-cord stromal tumor. To our knowledge, this case is first to document USG and MR imaging in addition to MR spectroscopy features in intraabdominal testicular seminoma.
A novel role of KIF3b in the seminoma cell cycle
Energy Technology Data Exchange (ETDEWEB)
Shen, Hao-Qing; Xiao, Yu-Xi; She, Zhen-Yu [The Sperm Laboratory, College of Life Sciences, Zhejiang University, 866 Yu Hang Tang Road, Hangzhou 310058 (China); Tan, Fu-Qing [The First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou 310003 (China); Yang, Wan-Xi, E-mail: wxyang@spermlab.org [The Sperm Laboratory, College of Life Sciences, Zhejiang University, 866 Yu Hang Tang Road, Hangzhou 310058 (China)
2017-03-01
KIF3b is a protein of the kinesin-2 family which plays an important role in intraflagellar transport. Testis cancer is a common cancer among young men. Its diagnostic rate is increasing and over half of the cases are seminomas. Many aspects of the mechanism and gene expression background of this cancer remain unclear. Using western-blotting and semi-quantitative PCR we found high protein levels of KIF3b enrichment in seminoma tissue despite the mRNA levels remaining equivalent to that of normal testicular tissues. The distribution of KIF3b was mainly in cells with division potential. Wound-healing assays and cell counting kit assays showed that the knockdown of KIF3b significantly suppressed cell migration ability, viability and number in HeLa cells. Immunofluorescence images during the cell cycle revealed that KIF3b tended to gather at the spindles and was enriched at the central spindle. This indicated that KIF3b may also have direct impacts upon spindle formation and cytokinesis. By counting the numbers of nuclei, spindles and cells, we found that the rates of multipolar division and multi-nucleation were raised in KIF3b-knockdown cells. In this way we demonstrate that KIF3b functions importantly in mitosis and may be essential to seminoma cell division and proliferation as well as being necessary for normal cell division. - Highlights: • A significant upregulation of KIF3b is detected in seminoma. • Knockdown of KIF3b impacts on cell proliferation and migration. • KIF3b may have direct impacts upon spindle formation and cytokinesis.
Patterns of care in the management of seminoma stage I
DEFF Research Database (Denmark)
Vossen, Carla Y; Horwich, Alan; Daugaard, Gedske
2012-01-01
Study Type - Therapy (practise pattern survey). Level of Evidence 3b. What's known on the subject? and What does the study add? The uncertainties about differences in relapse and rates of other late events such as second malignancy and cardiovascular events for the three post-orchidectomy strateg......Study Type - Therapy (practise pattern survey). Level of Evidence 3b. What's known on the subject? and What does the study add? The uncertainties about differences in relapse and rates of other late events such as second malignancy and cardiovascular events for the three post......-orchidectomy strategies in seminoma stage I patients has led to debates about whether the three strategies are equally effective and safe. The differences in interpretation of the data as well as the debates are likely to result in differences in treatment after orchidectomy in seminoma stage I patient management...
Postoperative radiotherapy for stage I/II seminoma: results for 212 patients
International Nuclear Information System (INIS)
Bauman, Glenn S.; Venkatesan, Varagur M.; Ago, C. Tetteh; Radwan, John S.; Dar, A. Rashid; Winquist, Eric W.
1998-01-01
Purpose: A retrospective review of patients with Stage I and II seminoma treated at a regional cancer center was performed to assess the long term efficacy and toxicity associated with post operative radiotherapy. Methods and Materials: Between 1950 and 1995, 212 patients seen at the London Regional Cancer Centre received adjuvant radiotherapy following orchiectomy for Stage I (169) and II (43) seminoma. Median follow-up for the group was 7.5 years. Results: Progression free, cause specific, and overall survival were 95%, 98%, and 95% at 5 years, and 94%, 98%, and 94% at 10 years respectively. An increased risk of failure was noted among patients with bulky Stage II disease. No other prognostic factors for relapse were identified. Late toxicity was uncommon with only 12/212 (6%) developing any late GI toxicity potentially attributable to radiotherapy. The incidence of second malignancies (excluding second testicular tumors) was 6/212 (actuarial:1%, 1%, 6% at 5,10,15 years respectively). There was a trend toward increased acute complications for patients treated with larger volumes of radiation. No prognostic factors associated with increased risk of late toxicity or second malignancy were identified, likely a consequence of the small number of these events. Conclusion: Survival and toxicity were comparable to that reported in the literature. Post-operative radiotherapy remains a safe and efficacious adjuvant treatment for Stage I and early Stage II seminoma
Surveillance following orchidectomy for stage I seminoma of the testis
DEFF Research Database (Denmark)
von der Maase, H; Specht, L; Jacobsen, G K
1993-01-01
, pelvic lymph nodes in 5, inguinal lymph nodes in 2 and lung metastases in 1 patient. The median time to relapse was 14 months, range 2-37 months. The 4-year relapse-free survival was 80%. 37 of the relapsing patients (76%) had radiotherapy as relapse treatment. Of these patients, 4 (11%) had a second......From 1985 to 1988, 261 unselected patients entered a nationwide Danish study of surveillance only for testicular seminoma stage I. The median follow-up time after orchidectomy was 48 months, range 6-67 months. 49 patients relapsed (19%). Sites of relapse were paraaortic lymph nodes in 41 patients...... to chemotherapy-induced neutropenia. Thus, there have been three seminoma-related deaths (1.1%). The testicular tumour size had an independent prognostic significance. The 4-year relapse-free survivals were 94, 82 and 64% for tumours or = 6 cm, respectively. Patients with tumours > or = 6 cm...
Heterozygote FANCD2 mutations associated with childhood T Cell ALL and testicular seminoma.
Smetsers, Stephanie; Muter, Joanne; Bristow, Claire; Patel, Leena; Chandler, Kate; Bonney, Denise; Wynn, Robert F; Whetton, Anthony D; Will, Andrew M; Rockx, Davy; Joenje, Hans; Strathdee, Gordon; Shanks, Jonathan; Klopocki, Eva; Gille, Johan J P; Dorsman, Josephine; Meyer, Stefan
2012-12-01
Fanconi anaemia (FA) is an inherited disease with congenital and developmental abnormalities characterised by cellular cross linker hypersensitivity. FA is caused by mutations in any of so far 15 identified FANC genes, which encode proteins that interact in a common DNA damage response (DDR) pathway. Individuals with FA have a high risk of developing acute myeloid leukaemia (AML) and squamous cell carcinoma. An increased cancer risk has been firmly established for carriers of mutations in FANCD1/BRCA2, FANCJ/BRIP1, FANCN/PALB2, RAD51C/FANCO and link the FA pathway to inherited breast and ovarian cancer. We describe a pedigree with FANCD2 mutations c.458T > C (p.Leu153Ser) and c.2715 + 1G > A (p.Glu906LeufsX4) with mild phenotype FA in the index case, T cell ALL in the Leu153Ser heterozygous brother and testicular seminoma in the p.Glu906LeufsX4 heterozygous father. Both FANCD2 alleles were present in the T Cell ALL and the seminoma. This links specific FANCD2 mutations to T cell ALL and seminoma without evidence of allelic loss in the tumour tissue.
Persistent Mullerian Duct Syndrome (PMDS With Large Intraabdominal Seminoma
Directory of Open Access Journals (Sweden)
Della Harigovind
2017-07-01
Full Text Available Persistent Mullerian Duct Syndrome, a form of male pseudohermaphroditism is characterized by the presence of the Mullerian duct derivatives in an otherwise phenotypically as well as genotypically normal male. We report a case of large intra abdominal seminoma in a male patient with cryptorchidism, along with persistence of Mullerian duct derivatives (uterus.
Energy Technology Data Exchange (ETDEWEB)
Tsili, Athina C., E-mail: a_tsili@yahoo.gr [Department of Radiology, Medical School, University of Ioannina, 45110 Ioannina (Greece); Sylakos, Anastasios, E-mail: anasylakos@yahoo.gr [Department of Urology, Medical School, University of Ioannina, 45110 Ioannina (Greece); Ntorkou, Alexandra, E-mail: alexdorkou@yahoo.com [Department of Radiology, Medical School, University of Ioannina, 45110 Ioannina (Greece); Stavrou, Sotirios, E-mail: s.sotiris@yahoo.gr [Department of Urology, Medical School, University of Ioannina, 45110 Ioannina (Greece); Astrakas, Loukas G., E-mail: astrakas@uoi.gr [Department of Medical Physics, Medical School, University of Ioannina, 45110 Ioannina (Greece); Sofikitis, Nikolaos, E-mail: akrosnin@hotmail.com [Department of Urology, Medical School, University of Ioannina, 45110 Ioannina (Greece); Argyropoulou, Maria I., E-mail: margyrop@cc.uoi.gr [Department of Radiology, Medical School, University of Ioannina, 45110 Ioannina (Greece)
2015-07-15
Highlights: • Functional MRI in the characterization of testicular germ cell tumors was assessed. • ADC values proved useful in the characterization of testicular germ cell tumors. • Testicular germ cell tumors had similar enhancement patterns of dynamic MRI. - Abstract: Introduction: The aim of this study is to investigate the role of apparent diffusion coefficient (ADC) values and dynamic contrast enhancement (DCE) patterns in differentiating seminomas from nonseminomatous germ cell tumors (NSGCTs). Materials and methods: The MRI examinations of the scrotum of 26 men with histologically proven testicular GCTs were reviewed. DWI was performed in all patients, using a single shot, multi-slice spin-echo planar diffusion pulse sequence and b-values of 0 and 900 s/mm{sup 2}. Subtraction DCE-MRI was performed in 20 cases using a 3D fast-field echo sequence after gadolinium administration. Time-signal intensity curves were created and semi-quantitative parameters (peak enhancement, time to peak, wash-in and wash-out rate) were calculated. The Student's t-test was used to compare the mean values of ADC, peak enhancement, time to peak, wash-in and wash-out rate between seminomas and NSGCTs. ROC analysis was also performed. Results: Histopathology disclosed the presence of 15 seminomas and 11 NSGCTs. The mean ± s.d. of ADC values (× 10{sup −3} mm{sup 2}/s) of seminomas (0.59 ± 0.009) were significantly lower than those of NSGCTs (0.90 ± 0.33) (P = 0.01). The optimal ADC cut-off value was 0.68 × 10{sup −3} mm{sup 2}/s. No differences between the two groups were observed for peak enhancement (P = 0.18), time to peak (P = 0.63) wash-in rate (P = 0.32) and wash-out rate (P = 0.18). Conclusions: ADC values may be used to preoperatively differentiate seminomas from NSGCTs.
International Nuclear Information System (INIS)
Tsili, Athina C.; Sylakos, Anastasios; Ntorkou, Alexandra; Stavrou, Sotirios; Astrakas, Loukas G.; Sofikitis, Nikolaos; Argyropoulou, Maria I.
2015-01-01
Highlights: • Functional MRI in the characterization of testicular germ cell tumors was assessed. • ADC values proved useful in the characterization of testicular germ cell tumors. • Testicular germ cell tumors had similar enhancement patterns of dynamic MRI. - Abstract: Introduction: The aim of this study is to investigate the role of apparent diffusion coefficient (ADC) values and dynamic contrast enhancement (DCE) patterns in differentiating seminomas from nonseminomatous germ cell tumors (NSGCTs). Materials and methods: The MRI examinations of the scrotum of 26 men with histologically proven testicular GCTs were reviewed. DWI was performed in all patients, using a single shot, multi-slice spin-echo planar diffusion pulse sequence and b-values of 0 and 900 s/mm 2 . Subtraction DCE-MRI was performed in 20 cases using a 3D fast-field echo sequence after gadolinium administration. Time-signal intensity curves were created and semi-quantitative parameters (peak enhancement, time to peak, wash-in and wash-out rate) were calculated. The Student's t-test was used to compare the mean values of ADC, peak enhancement, time to peak, wash-in and wash-out rate between seminomas and NSGCTs. ROC analysis was also performed. Results: Histopathology disclosed the presence of 15 seminomas and 11 NSGCTs. The mean ± s.d. of ADC values (× 10 −3 mm 2 /s) of seminomas (0.59 ± 0.009) were significantly lower than those of NSGCTs (0.90 ± 0.33) (P = 0.01). The optimal ADC cut-off value was 0.68 × 10 −3 mm 2 /s. No differences between the two groups were observed for peak enhancement (P = 0.18), time to peak (P = 0.63) wash-in rate (P = 0.32) and wash-out rate (P = 0.18). Conclusions: ADC values may be used to preoperatively differentiate seminomas from NSGCTs
Starita-Geribaldi, Mireille; Samson, Michel; Guigonis, Jean-Marie; Pointis, Georges; Fenichel, Patrick
2008-06-01
Two isoforms of human cytoplasmic isocitrate dehydrogenase (IDPc) of close molecular weights and different isoelectric points were identified in human seminal plasma (SP) by two-dimensional gel electrophoresis (2-DE) followed by mass spectrometry (MS). These two isoforms were detected in the normospermic men SP and their expressions were markedly altered in patients with testicular seminoma, the most frequent testicular germ cell cancer (TGCC): increase of the more acidic spot and decrease of the more basic one. Since oligospermia has been considered as a high risk pathological condition for developing a testicular cancer, the two IDPc isoforms were analyzed in SP of a group of secretory azoospermic patients. In this group the two spots displayed similar variations of expression to those observed in testicular seminoma. These results propose IDPc as a promising SP biomarker of testicular seminoma. Whether IDPc alteration in secretory azoospermia is predictive of testicular seminoma remains to be elucidated. (c) 2007 Wiley-Liss, Inc.
Post orchiectomy management in stage II testicular seminoma
International Nuclear Information System (INIS)
Singhal, S.; Dixit, S.; Ramana Murthy, R.; Neema, J.P.; Vyas, R.K.; Baboo, H.A.
1994-01-01
Twenty eight patients with stage II A and twenty patients with stage II B testicular seminoma were treated at this institute between January 1982 and December 1988. The three year crude survival observed in this retrospective analysis was 82% and 75% respectively. Post orchiectomy infradiaphragmatic radiotherapy was the mainstay of the treatment. In stage II A, 4 patients were administered adjuvant chemotherapy as well. Prophylactic mediastinal irradiation (PMI) was not employed as a routine in this subgroup. Eight patients (28%) relapsed (mediastinal nodes - 4, pulmonary - 3, scrotal - 1). In stage II B, twelve patients were treated with primary abdominal radiotherapy and of them 4 were delivered PMI as well. Induction chemotherapy was administered in remaining 8 patients. Seven patients (35%) relapsed (pulmonary-4, mediastinal nodes-3). Mediastinal recurrence was noted only in those who were treated with abdominal radiotherapy alone. Though salvage chemotherapy proved successful in 5 of the seven patients (70%) with nodal relapse, none of the patients with extranodal relapse responded to subsequent chemotherapy. For stage II A abdominal radiotherapy alone is recommended and for stage II B induction chemotherapy is advised keeping radiotherapy reserved for residual mass. PMI as a routine in stage II testicular seminoma is not advocated as no survival benefit is observed. (author) 15 refs., 6 tabs
DEFF Research Database (Denmark)
Bachner, M; Loriot, Y; Gross-Goupil, M
2012-01-01
2-¹⁸fluoro-deoxy-D-glucose positron emission tomography (FDG-PET) has been recommended in international guidelines in the evaluation of postchemotherapy seminoma residuals. Our trial was designed to validate these recommendations in a larger group of patients.......2-¹⁸fluoro-deoxy-D-glucose positron emission tomography (FDG-PET) has been recommended in international guidelines in the evaluation of postchemotherapy seminoma residuals. Our trial was designed to validate these recommendations in a larger group of patients....
Primary retroperitoneal seminoma - embryology, histopathology and treatment particularities.
Gîngu, Constantin Virgil; Mihai, Mihaela; Baston, Cătălin; Crăsneanu, Mugurel Alexandru; Dick, Alexandru Vladimir; Olaru, Vlad; Sinescu, Ioanel
2016-01-01
Retroperitoneal seminoma is a very rare form of cancer, with embryological origin represented by primordial germ cells from the urogenital ridges left behind during the fetal development. Extragenital germ cell tumors can also occur in the mediastinum or the pineal gland. The aim of this paper is to outline the particularities and draw embryological, histopatological and treatment conclusions regarding extragonadal germ cell tumors. A 43-year-old patient without any additional pathology was admitted for anemia of unknown etiology. The clinical examination revealed through deep abdominal palpation a mass in the left flank, and normal testes. Thoraco-abdomino-pelvic computed tomography (CT) scan showed a large retroperitoneal tumor adjacent to the great vessels in the left lumbo-iliac region. The blood work revealed just a low hemoglobin and hematocrit. With the established diagnosis of retroperitoneal tumor, radical surgical removal was decided. During the surgery, we were required to dissect a large solid encapsulated tumor mass from the aorta and the common iliac artery, starting at the renal pedicle all the way to the left iliac bifurcation. The surgical access was obtained through a transperitoneal left subcostal incision prolonged pararectally. Histopathological and immunohistochemical studies revealed a seminoma of the usual type. After the histological findings, the patient's tumor markers were investigated (LDH - lactate dehydrogenase, βHCG - beta-human chorionic gonadotropin, αFP - alpha-fetoprotein), all values being within normal ranges. In addition, the left testicle was thoroughly reexamined, clinically, through ultrasound and magnetic resonance imaging (MRI) scans, and no abnormalities were observed. After the surgery, the patient followed three courses of chemotherapy (BEP - Bleomycin, Etoposide and Cisplatin). The CT scan done 24 months after surgery found no signs of local or distant tumor recurrence. The patient entered a follow-up schedule
Energy Technology Data Exchange (ETDEWEB)
Simone, Charles B., E-mail: csimone@alumni.upenn.edu [Department of Radiation Oncology, Hospital of University of Pennsylvania, Philadelphia, Pennsylvania (United States); Radiation Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland (United States); Kramer, Kevin [Henry M. Jackson Foundation for the Advancement of Military Medicine, Rockville, Maryland (United States); O' Meara, William P. [Division of Radiation Oncology, National Naval Medical Center, Bethesda, Maryland (United States); Bekelman, Justin E. [Department of Radiation Oncology, Hospital of University of Pennsylvania, Philadelphia, Pennsylvania (United States); Belard, Arnaud [Henry M. Jackson Foundation for the Advancement of Military Medicine, Rockville, Maryland (United States); McDonough, James [Department of Radiation Oncology, Hospital of University of Pennsylvania, Philadelphia, Pennsylvania (United States); O' Connell, John [Radiation Oncology Service, Walter Reed Army Medical Center, Washington, DC (United States)
2012-01-01
Purpose: Photon radiotherapy has been the standard adjuvant treatment for stage I seminoma. Single-dose carboplatin therapy and observation have emerged as alternative options due to concerns for acute toxicities and secondary malignancies from radiation. In this institutional review board-approved study, we compared photon and proton radiotherapy for stage I seminoma and the predicted rates of excess secondary malignancies for both treatment modalities. Methods and Material: Computed tomography images from 10 consecutive patients with stage I seminoma were used to quantify dosimetric differences between photon and proton therapies. Structures reported to be at increased risk for secondary malignancies and in-field critical structures were contoured. Reported models of organ-specific radiation-induced cancer incidence rates based on organ equivalent dose were used to determine the excess absolute risk of secondary malignancies. Calculated values were compared with tumor registry reports of excess secondary malignancies among testicular cancer survivors. Results: Photon and proton plans provided comparable target volume coverage. Proton plans delivered significantly lower mean doses to all examined normal tissues, except for the kidneys. The greatest absolute reduction in mean dose was observed for the stomach (119 cGy for proton plans vs. 768 cGy for photon plans; p < 0.0001). Significantly more excess secondary cancers per 10,000 patients/year were predicted for photon radiation than for proton radiation to the stomach (4.11; 95% confidence interval [CI], 3.22-5.01), large bowel (0.81; 95% CI, 0.39-1.01), and bladder (0.03; 95% CI, 0.01-0.58), while no difference was demonstrated for radiation to the pancreas (0.02; 95% CI, -0.01-0.06). Conclusions: For patients with stage I seminoma, proton radiation therapy reduced the predicted secondary cancer risk compared with photon therapy. We predict a reduction of one additional secondary cancer for every 50 patients
Barriers to the Implementation of Surveillance for Stage I Testicular Seminoma
International Nuclear Information System (INIS)
Arvold, Nils D.; Catalano, Paul J.; Sweeney, Christopher J.; Hoffman, Karen E.; Nguyen, Paul L.; Balboni, Tracy A.; Fosså, Sophie D.; Travis, Lois B.; Beard, Clair J.
2012-01-01
Purpose: Postorchiectomy adjuvant radiotherapy (RT) for Stage I seminoma can be associated with long-term toxicity, and management strategies with a lower treatment burden achieve the same excellent cure rate. Because studies suggest that radiation oncologists in the United States continue to recommend RT for these patients, we sought to identify factors associated with management recommendations. Methods and Materials: We conducted a one-time internet-based survey among 491 randomly selected American radiation oncologists self-described as specializing in genitourinary oncology. Results: Response rate was 53% (n = 261). Forty-nine percent of respondents worked in university-affiliated practices. Sixty-two percent of respondents always/usually recommended adjuvant RT for patients with Stage I seminoma, whereas 21% always/usually recommended surveillance and 3% always/usually recommended chemotherapy. One third (33%) expressed concerns that patients who experienced relapse during surveillance could not be salvaged. Although 88% of physicians were aware of an increased risk of second malignant neoplasms (SMN) after adjuvant RT, 85% underestimated its magnitude. Compared with physicians not typically recommending RT, physicians who always/usually recommended RT were more likely to believe that patients might not be salvaged at relapse during surveillance (p = 0.008) and were less aware of the association between RT and SMN (p = 0.04). Conclusions: Respondents who always/usually recommend postorchiectomy RT for patients with Stage I seminoma are more likely to underestimate late RT morbidity and to believe that surveillance is associated with increased mortality. Given the equivalent efficacy and reduced morbidity of surveillance compared with RT, our findings underscore the need for ongoing physician education to increase appropriate clinical implementation of surveillance strategies.
Barriers to the Implementation of Surveillance for Stage I Testicular Seminoma
Energy Technology Data Exchange (ETDEWEB)
Arvold, Nils D. [Harvard Radiation Oncology Program, Harvard Medical School, Boston, Massachusetts (United States); Catalano, Paul J. [Department of Biostatistics, Harvard School of Public Health, and Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Sweeney, Christopher J. [Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Hoffman, Karen E. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Nguyen, Paul L.; Balboni, Tracy A. [Department of Radiation Oncology, Brigham and Women' s Hospital and Dana-Farber Cancer Institute, Boston, Massachusetts (United States); Fossa, Sophie D. [Department of Clinical Research, Norwegian Radium Hospital, Oslo University, Oslo (Norway); Travis, Lois B. [Department of Radiation Oncology, University of Rochester Medical Center, Rochester, New York (United States); Beard, Clair J., E-mail: cbeard@lroc.harvard.edu [Department of Radiation Oncology, Brigham and Women' s Hospital and Dana-Farber Cancer Institute, Boston, Massachusetts (United States)
2012-10-01
Purpose: Postorchiectomy adjuvant radiotherapy (RT) for Stage I seminoma can be associated with long-term toxicity, and management strategies with a lower treatment burden achieve the same excellent cure rate. Because studies suggest that radiation oncologists in the United States continue to recommend RT for these patients, we sought to identify factors associated with management recommendations. Methods and Materials: We conducted a one-time internet-based survey among 491 randomly selected American radiation oncologists self-described as specializing in genitourinary oncology. Results: Response rate was 53% (n = 261). Forty-nine percent of respondents worked in university-affiliated practices. Sixty-two percent of respondents always/usually recommended adjuvant RT for patients with Stage I seminoma, whereas 21% always/usually recommended surveillance and 3% always/usually recommended chemotherapy. One third (33%) expressed concerns that patients who experienced relapse during surveillance could not be salvaged. Although 88% of physicians were aware of an increased risk of second malignant neoplasms (SMN) after adjuvant RT, 85% underestimated its magnitude. Compared with physicians not typically recommending RT, physicians who always/usually recommended RT were more likely to believe that patients might not be salvaged at relapse during surveillance (p = 0.008) and were less aware of the association between RT and SMN (p = 0.04). Conclusions: Respondents who always/usually recommend postorchiectomy RT for patients with Stage I seminoma are more likely to underestimate late RT morbidity and to believe that surveillance is associated with increased mortality. Given the equivalent efficacy and reduced morbidity of surveillance compared with RT, our findings underscore the need for ongoing physician education to increase appropriate clinical implementation of surveillance strategies.
International Nuclear Information System (INIS)
Vázquez, A.; Cuello, M.; Terzieff, V.; Viola, A.
2004-01-01
The only bone metastases in pure seminoma is a biological entity extremely rare. We report a case studied since 2000, treatment and outcome. Case report: 35. Orquiectomizado in September 2000 AP: pure seminoma in the presence of a neoplastic nodule in the spermatic cord.Adjuvant lumboaorticas, left iliac and inguinal chains Rt., 3060 cGy in 3.2 sem. until December 2000 Normal tumor markers throughout the period. In Oct. 2001 TAC control morfoestructural altered posterior the sixth left costal arch. AP: puncture under TAC. Malignant germ cell tumor compatible with pure seminoma. C.O. single lesion. MDT is performed based on PEB for 4 cycles and additional RT obtaining a complete response with reduction bone lesion, asymptomatic until November 2002, again at the level falls costal, VIP x 3 New relapse dorsal paravertebral June 2003, Gemcitabine and Rt paclitaxel, dose intensification transplant. Keeps score high. Poor prognosis. Discussion: In the literature we found no reports of bone lesions only secondary to a pure seminoma. They are described in the context of a frame overall spread in advanced patients and in more than three or four including accompanying synchronous nodal, liver and lung damage. Subsequent developments mark the disease resistance to treatments performed. The three lines are Qt prior to transplantation have shown that best results for the treatment of disease. We discuss the time introduction thereof to obtain a durable complete response. If the marker not normalized but not displayed clinical or paraclinical disease prognosis is bad in the short term
Side Effects of Adjuvant Radiotherapy in Patients With Testicular Seminoma Stage I
International Nuclear Information System (INIS)
Gamulin, M.; Grgic, M.
2011-01-01
In the present study the side effects of adjuvant radiotherapy of testicular seminoma stage I patients were followed up in the period between 13 to 84 months (median 28 months). The most frequent side effects in these patients during radiotherapy were gastrointestinal problems (nausea/vomiting), psychologic and cognitive problems and minor sexual problems. The reported side effects were treated by antimmimetics and anxiolytics. After radiotherapy, the side effects persisted in 6 % of patients but therapy was needed only in few. Healthy children were born to 76 % of patients in the age group 18 - 39 years after radiotherapy. The present study shows that adjuvant irradiation of paraaortal lymph nodes with total a dose of 24 Gy in 16 daily fractions in testicular seminoma patients causes acceptable side effects with acceptable quality of life and fertility, however in conditions of individual approach and family consulting. (author)
Energy Technology Data Exchange (ETDEWEB)
Servagi-Vernat, S.; Crehange, G.; Lorchel, F.; Bontemps, P.; Bosset, J.F. [Centre Hospitalier Universitaire Jean Minjoz, Service de Radiotherapie, 25 - Besancon (France)
2006-05-15
Orchidectomy with adjuvant radiotherapy of retroperitoneal paraaortic and ipsilateral iliac nodes is the standard treatment for localized testicular seminoma (I, IIA, IIB). Post therapeutic follow-up allows to detect local relapse and radio-induced second cancer. Nevertheless, evaluation of risk of second malignancy still remains difficult. We report 2 cases of rectal cancer after radiotherapy for testicular seminoma. (authors)
Results of treatment in irradiated testicular seminoma patients
International Nuclear Information System (INIS)
Kellokump-Lehtinen, P.
1990-01-01
Excellent treatment results have been acieved historically with postoperative radiotherapy in testicular seminoma. In this retrospective study the treatment results of 211 patients with Stage I/II testicular seminoma treated in Finland during the years 1970-1983 were evaluated. 176 (84%) patients received postoperative radiotherapy alone. In addition to radiotherapy, 26 (12%) patients received chemotherapy during the primary treatment. There were 129 Stage I (61%), 66 Stage IIA-B (31%) and 16 Stage IIC (8%) tumors. The 5-year survival rate was 95% in Stage I, 87% in Stage IIA-B and 73% in Stage IIC. In Stage I, seven relapses (relapse rate 6%) occured after irradiation; three of them were cured with second-line therapies. None of the relapses occurred within the radiotherapy field. In Stage IIA-B, 31 patients had only parailiacic + aortic irradiation, 25 patients received both parailiacic + aortic and mediastinal irradiation. With both radiotherapy techniques there was no significant difference in the number of relapses (seven and three) and in the remission rate (94% and 96%). Radiotherapy alone was used on four Stage IIC patients and one of them died during the primary treatment. Two of them relapsed, but could be cured with chemotherapy. These results correspond to those reported in the literature and tye suggest that prophylactic mediastinal irradiation is unneccessary in Stage IIA-B patients. Stage IIC patients should receive chemotherapy initially. (author). 19 refs.; 2 figs.; 2 tabs
Iwatsuki, Shoichiro; Naiki, Taku; Kawai, Noriyasu; Etani, Toshiki; Iida, Keitaro; Ando, Ryosuke; Nagai, Takashi; Okada, Atsushi; Tozawa, Keiichi; Sugiyama, Yosuke; Yasui, Takahiro
2016-05-05
Patients with a primary pure seminoma in the testis who have elevated serum alpha-fetoprotein are rare and should be treated as patients with nonseminomatous germ cell tumors. However, nonpalpable testicular tumors in this condition have never been reported. We describe a case of nonpalpable pure testicular seminoma with elevated serum alpha-fetoprotein presenting retroperitoneal metastasis. A 29-year-old Asian man was referred to our hospital with right flank pain. Computed tomography showed a mass located between his aorta and inferior vena cava, but a testicular tumor was not detected. His serum levels of lactate dehydrogenase, alpha-fetoprotein, and DUPAN-2 were high. Although no tumor or nodule was palpable in his testis, ultrasonography revealed multiple low echoic lesions in his right testicular parenchyma. He was diagnosed with right testicular cancer with retroperitoneal lymph node metastasis and underwent right high orchiectomy. A pathological examination revealed pure seminoma and no nonseminomatous components were found in the specimen. Three courses of induction systemic chemotherapy (cisplatin, etoposide, and bleomycin) normalized his serum alpha-fetoprotein and DUPAN-2 levels. Three additional courses of chemotherapy (etoposide and bleomycin) were performed, and treatment was completed with laparoscopic retroperitoneal lymph node dissection. Pathology of the dissected specimen showed fibrous and necrotic tissue with no viable cells. He is alive without recurrence 54 months after orchiectomy. We report a case of pure testicular seminoma with elevated serum alpha-fetoprotein and DUPAN-2 presenting retroperitoneal metastasis. We recommend an ultrasound examination of bilateral testes when large retroperitoneal tumors are detected in young men, even if a mass is not palpable in the scrotum.
DEFF Research Database (Denmark)
Pedersen, Louise Holm; Nielsen, John E; Daugaard, Gedske
2016-01-01
-seminomas. It is well established from e.g. melanoma, colorectal and thyroid cancer that a methylated phenotype can be correlated to prognosis and can be related to BRAF mutations. In the present study we investigated the global methylation level in 67 seminomas and classified them as hypo-methylated, intermediate...
Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.
Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J
2016-01-01
Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.
Directory of Open Access Journals (Sweden)
Francesca Ferranti
Full Text Available Seminoma is one of the most common Testicular Germ Cell Tumours that originates during embryonic development due to an alteration of the local niche that in turn results in a delayed or blocked differentiation of Primordial Germ Cells. The block of differentiation is actually a common way to develop cancer disease as postulated by the "embryonic rest theory of cancer". In agreement with this theory different studies have demonstrated that embryonic cues display the capacity of reprogramming aggressive cancer cells towards a less aggressive phenotype. Herein we investigate the ability of a culture medium added with 10% egg albumen (EW, Egg White to modulate seminoma cell phenotype and behaviour, by ensuring a proper set of morphogenetic signals. We chose to use the TCam-2 seminoma cell line that has been established as the only available cell line, obtained from a primary testicular seminoma. EW is able to: 1 modify TCam-2 cell spreading rate and cell-substrate adhesion without affecting proliferation and survival indexes; 2 modulate TCam-2 actin distribution pattern increasing cortical localization of actin filaments; 3 increase TCam-2 cell-cell junction capability; 4 decrease both chemo-sensitive and collective TCam-2 migratory behaviour. According to these observations morphometric fractal analysis revealed the ability of EW to increase Circularity and Solidity parameters and, consequently, to decrease Fractal dimension. Prompted by these observations we hypothesize that EW treatment could rescue, at least in part, the neoplastic-metastatic behaviour of seminoma cells.
Treatment Trends for Stage I Testicular Seminoma in an Equal-Access Medical System.
Wingate, Jonathan T; Etzioni, Ruth; Macdonald, Dusten M; Brand, Timothy C
2016-10-01
The practice patterns for adjuvant therapies for stage I seminoma are rapidly evolving, and surveillance is currently preferred. How these recommendations have affected contemporary practice in an equal-access US population is unknown. A total of 436 men diagnosed with clinical stage IA-IB seminoma from 2001 to 2011 were identified in the Automated Central Tumor Registry (ACTUR). The ACTUR is the cancer registry system for the Department of Defense. Logistic regression models analyzed the association between patient characteristics and adjuvant therapy. Overall and recurrence-free survival were determined from Kaplan-Meier analysis. The use of adjuvant radiotherapy in this population decreased significantly from 2001 to 2011. In 2001, 83.9% of patients received radiotherapy compared with only 24.0% in 2011. During that period, a concomitant increase occurred in the use of chemotherapy from 0% to 38.0%. A later year of diagnosis was significantly associated with a greater rate of receiving chemotherapy relative to radiotherapy (P associated with the receipt of surveillance (P = .412 for 2006-2011 vs. 2001-2005; odds ratio, 0.83; 95% CI, 0.54-1.29). Black race or age was not significantly associated with adjuvant therapy. With a median follow-up period of 4.7 years, the 5-year overall and recurrence-free survival rates were 98.0% and 77.0%, respectively. The use of adjuvant radiotherapy has been replaced by chemotherapy for clinical stage I testicular seminoma in an equal-access system. The lack of an increase in active surveillance in our cohort might represent overtreatment of the population. Published by Elsevier Inc.
LENUS (Irish Health Repository)
Raheem, Omer A
2011-04-14
Abstract Introduction Postirradiation lumbosacral syndrome is a radiculopathy induced by radiation injury to the spinal cord. Its usual presentation is motor deficit and or sensory loss involving the lower limbs. Visceral involvement has not been reported previously. Case presentation We describe a case of severe hypotonic bladder caused by radiation-induced spinal cord injury following treatment of stage Ι testicular seminoma in a 38-year-old Caucasian man who had undergone radical orchidectomy and prophylactic paraaortic lymph node irradiation for stage Ι seminoma. Three years later he had clinical and urodynamic findings of hypotonic bladder. The magnetic resonance imaging results suggested a radiation-induced injury. Conclusion Such an unusual presentation of the syndrome of postirradiation lumbosacral radiculopathy can impose a clinical challenge to practicing clinicians. Future studies are required to further delineate the mechanism of injury and further management plans.
LENUS (Irish Health Repository)
Raheem, Omer A
2012-02-01
INTRODUCTION: Postirradiation lumbosacral syndrome is a radiculopathy induced by radiation injury to the spinal cord. Its usual presentation is motor deficit and or sensory loss involving the lower limbs. Visceral involvement has not been reported previously. CASE PRESENTATION: We describe a case of severe hypotonic bladder caused by radiation-induced spinal cord injury following treatment of stage Iota testicular seminoma in a 38-year-old Caucasian man who had undergone radical orchidectomy and prophylactic paraaortic lymph node irradiation for stage Iota seminoma. Three years later he had clinical and urodynamic findings of hypotonic bladder. The magnetic resonance imaging results suggested a radiation-induced injury. CONCLUSION: Such an unusual presentation of the syndrome of postirradiation lumbosacral radiculopathy can impose a clinical challenge to practicing clinicians. Future studies are required to further delineate the mechanism of injury and further management plans.
DEFF Research Database (Denmark)
Kristensen, Dina Graae; Mlynarska, Olga; Nielsen, John E
2012-01-01
Testicular spermatocytic seminoma (SS) is a rare tumor type predominantly found in elderly men. It is thought to originate from spermatogonia and shows cytological and genetic heterogeneity. In this study, we performed for the first time a comprehensive analysis of epigenetic modifications in a s...
Adjuvant radiotherapy in stage 1 seminoma: Evaluation of prognostic factors and results of survival
Directory of Open Access Journals (Sweden)
Lasif Serdar
2015-01-01
Conclusion: Adjuvant RT resulted in excellent long-term survival and local control in patients with stage-1 seminoma after orchiectomy. During a short follow-up, secondary malignancy (SM and late cardiovascular morbidity were not observed. Despite those results, concern of SM and late cardiovascular morbidity remains.
T2 relaxation times of irradiated vertebral bone marrow in patients with seminoma.
Argiris, A; Maris, T; Vlahos, L
1997-01-01
Our purpose was to demonstrate the effects of localized radiotherapy on lumbar vertebral bone marrow with the use of quantitative MRI with measurements of T2 relaxation times. Ten patients with early stage testicular seminoma with a history of radiation therapy to a "dog-leg" field including the lumbar vertebrae underwent MR imaging of their lumbar spine using a 0.5 Tesla magnet. Five healthy subjects and two nonirradiated patients were imaged as well. The intervals from the beginning of radiotherapy to MRI examination varied from 1.5 to 52 months, and the radiation dose ranged from 3000-4200 cGy. The T2 relaxation times of the lumbar vertebral bone marrow and subcutaneous fat were calculated for each subject. Postirradiation bone marrow in irradiated seminoma patients exhibited significantly longer T2 relaxation times than nonirradiated bone marrow in controls (71.1 vs. 63.6 ms, p = 0.047, t-test). The differences between the T2 relaxation times of bone marrow and subcutaneous fat for each subject allowed for even better differentiation between irradiated patients and controls (10.4 vs. 0.4 ms, p = 0.0004, t-test). Postirradiation bone marrow had significantly longer T2 relaxation times than subcutaneous fat in irradiated patients (N = 10, 71.1 vs. 60.7 ms, p = 0.00009, t-test), while nonirradiated bone marrow had T2 relaxation times not statistically different from subcutaneous fat in nonirradiated subjects (N = 7, 63.6 vs. 63.2 ms). Measurements of T2 relaxation times of bone marrow enabled us to differentiate between irradiated seminoma patients and controls. Postirradiation bone marrow undergoes late radiation effects resulting in longer T2 relaxation times than nonirradiated bone marrow and subcutaneous fat.
Second cancer risk and mortality in men treated with radiotherapy for stage I seminoma
Horwich, A; Fossa, S D; Huddart, R; Dearnaley, D P; Stenning, S; Aresu, M; Bliss, J M; Hall, E
2014-01-01
Background: Patients with stage I testicular seminoma are typically diagnosed at a young age and treatment is associated with low relapse and mortality rates. The long-term risks of adjuvant radiotherapy in this patient group are therefore particularly relevant. Methods: We identified patients and obtained treatment details from 12 cancer centres (11 United Kingdom, 1 Norway) and ascertained second cancers and mortality through national registries. Data from 2629 seminoma patients treated with radiotherapy between 1960 and 1992 were available, contributing 51 151 person-years of follow-up. Results: Four hundred and sixty-eight second cancers (excluding non-melanoma skin cancers) were identified. The standardised incidence ratio (SIR) was 1.61 (95% confidence interval (CI): 1.47–1.76, P<0.0001). The SIR was 1.53 (95% CI: 1.39–1.68, P<0.0001) when the 32 second testicular cancers were also excluded. This increase was largely due to an excess risk to organs in the radiation field; for pelvic–abdominal sites the SIR was 1.62 (95% CI: 1.43–1.83), with no significant elevated risk of cancers in organs elsewhere. There was no overall increase in mortality with a standardised mortality ratio (SMR) of 1.06 (95% CI: 0.98–1.14), despite an increase in the cancer-specific mortality (excluding testicular cancer deaths) SMR of 1.46 (95% CI: 1.30–1.65, P<0.0001). Conclusion: The prognosis of stage I seminoma is excellent and it is important to avoid conferring long-term increased risk of iatrogenic disease such as radiation-associated second cancers. PMID:24263066
Secondary malignancy among seminoma patients treated with adjuvant radiation therapy
Energy Technology Data Exchange (ETDEWEB)
Chao, Clifford K.S.; Lai, Peter P; Michalski, Jeff M; Perez, Carlos A
1995-11-01
Purpose: Early-stage testicular seminoma is among the most radiosensitive tumors, with an overall cure rate of over 90%. Among those cured of the disease by orchiectomy and postoperative irradiation, there is a risk of having a second malignancy. We conducted a study to determine the relative risk of the occurrence of secondary malignancy. Methods and Materials: From 1964 through 1988, 128 patients with histologically confirmed early-stage seminoma of the testis underwent orchiectomy and postoperative irradiation at the Radiation Oncology Center, Mallinckrodt Institute of Radiology, and affiliate hospitals. The follow-up periods ranged from 5 to 29 years, with a median of 11.7 years. The expected rate of developing a second cancer was computed by the standardized incidence ratio using the Connecticut Tumor Registry Database. The rate is based on the number of person-years at risk, taking into account age, gender, and race. Results: Nine second nontesticular malignancies were found; the time of appearance in years is indicated in brackets: two squamous cell carcinomas of the lung [3, 11], one adenocarcinoma of the rectum [15], one chronic lymphocytic leukemia [2], one adenocarcinoma of the pancreas [14], one diffuse histiocytic lymphoma of the adrenal gland [7], one sarcoma of the pelvis [5], and two transitional cell carcinomas of the renal pelvis and ureter [14, 17]. One patient who developed a contralateral testicular tumor was excluded from risk assessment. The actuarial risk of second nontesticular cancer is 3%, 5%, and 20%, respectively, at 5, 10, and 15 years of follow-up. When compared with the general population, the overall risk of second nontesticular cancer in the study group did not reach the 0.05 significance level, with an observed/expected (O/E) ratio of 2.09 (95% confidence interval, 0.39-3.35). When analyzed by the latency period after radiation treatment, during the period of 11 to 15 years, the risk was higher (O/E ratio of 4.45, 95% confidence
International Nuclear Information System (INIS)
Jacobsen, Kari Dolven; Olsen, Dag Rune; Fossaa, Kristian; Fossaa, Sophie Dorothea
1997-01-01
Purpose: To establish a predictive model for the estimation of the gonadal dose during adjuvant para-aortic (PA) or dog leg (DL: PA plus ipsilateral iliac) field radiotherapy in patients with testicular seminoma. Methods and Materials: The surface gonadal dose was measured in patients with seminoma Stage I receiving PA or DL radiotherapy. Sperm cell analysis was performed before and 1 year after irradiation. PA and DL radiotherapy were simulated in the Alderson phantom while we measured the dose to the surface and middle of an artificial testicle, varying its position within realistic anatomical constraints. The symphysis-to-testicle distance (STD), field length, and thickness of the patient were experimental variables. The developed mathematical model was validated in subsequent patients. Results: The mean gonadal dose in patients was 0.09 and 0.32 Gy after PA and DL irradiation, respectively (p < 0.001). DL radiotherapy, but not PA irradiation led to significant reduction of the sperm count 1 year after irradiation. The gonadal dose-reducing effect of PA irradiation was confirmed in the Alderson phantom. A significant correlation was found between the STD and the gonadal dose during DL irradiation. A mathematical model was established for calculation of the gonadal dose and confirmed by measurements in patients. Conclusions: During radiotherapy of seminoma, the gonadal dose decreases with increasing STD. It is possible to predict the individual gonadal dose based on delivered midplane dose and STD
Directory of Open Access Journals (Sweden)
Cong-Cong Shen
2014-01-01
Full Text Available BACKGROUND: Testis-expressed sequence 101 (TEX101 was found to be highly expressed in testis and involved in acrosome reaction in previous studies. Recently, the metastasis suppressor function of TEX101 in cancer was disclosed, but the comprehensive investigation of its expression has rarely been reported. In this study, the expression features of TEX101 in normal human organs and seminoma were systematically analyzed. RESULTS: Immunohistochemistry demonstrated intense staining of TEX101 in human testis tissues; however, its expression in 27 other types of normal human organs, including the ovary, was negligible. Higher expression of TEX101 was observed in the spermatocytes and spermatids of the testis, but relatively lower staining was detected in spermatogonia. Western blotting showed a single TEX101 band of 38 kDa in human testis, but it did not correspond to the predicted molecular weight of its mature form at 21 KDa. Furthermore, we examined seminoma tissues by immunohistochemistry and found that none of the 36 samples expressed TEX101. CONCLUSIONS: Our data confirmed TEX101 to be a testis protein that could be related to the maturation process of male germ cells. The lack of TEX101 in seminoma indicated its potential role in tumor progression. This characteristic expression of TEX101 could provide a valuable reference for understanding its biological functions.
Energy Technology Data Exchange (ETDEWEB)
Bauduceau, O.; Le-Moulec, S.; Bernard, O. [Hopital des Armees du Val-de-Grace, Service de Radiotherapie et Oncologie, 75 - Paris (France); Souleau, B. [Hopital des Armees Percy, Service d' Hematologie, 92 - Clamart (France); Houlgatte, A. [Hopital des Armees du Val-de-Grace, Service d' Urologie, 75 - Paris (France)
2003-12-01
Introduction. - Seminoma accounts for about 40% of germ cell tumours of the testicle. In this retrospective analysis, we review literature concerning management of stage I seminoma. Materials and methods. - Between March 1987 and April 2001, 65 patients with stage I pure testicular seminoma received adjuvant radiotherapy with a 25 MV linear accelerator. Results. - Median age was 33 years. Testicular tumour has been found on the right testis in 39 patients and on the left one in 24 patients. Patients have been treated using an anterior-posterior parallel pair and have received 20-25 Gy in 10-14 fractions. The target volume consisted of paraaortic, and paraaortic + homolateral iliac lymph nodes in 17 and 46 patients, respectively. Acute toxicity was mainly digestive, 38% of patients presenting nausea and vomiting. Median follow-up time was 37 months. All patients are alive in complete remission. Discussion. - Because of good radio-sensitivity of seminoma, radiotherapy is regarded as standard adjuvant treatment (5 years relapse rate: 3-5%). Acute toxicity is dominated by moderate gastro-intestinal side effects. Secondary neoplasia represents one of the worst possible long-term complications of therapy. Waiting for ongoing randomized trials, the modern literature for seminoma reflects a trend toward lower radiation doses (20-25 Gy) and smaller treatment volumes (paraaortic field). Adjuvant chemotherapy with two courses of carbo-platin, might be equivalent to radiotherapy but must be investigated in randomized trials. A surveillance policy is one of the other management options less recommended. (author)
Prognosis in canine idiopathic immune-mediated haemolytic anaemia
Piek, C.J.
2011-01-01
Canine idiopathic immune-mediated haemolytic anaemia (iIMHA) is one of the most frequently occurring immune-mediated diseases in dogs. A gel-based Coombs' test was shown to perform equally well as a classical Coombs' test. Since the gel-based Coombs' test can be commercially produced and is easy and
Long-term results of para-aortic irradiation for patients with stage I seminoma of the testis
International Nuclear Information System (INIS)
Niazi, Tamim M.; Souhami, Luis; Sultanem, Khalil; Duclos, Marie; Shenouda, George; Freeman, Carolyn
2005-01-01
Purpose: Adjuvant postoperative para-aortic lymph nodal irradiation is an acceptable alternative to para-aortic and ipsilateral pelvic irradiation postorchiectomy for patients with Stage I seminoma of the testis. In this article, we report the long-term results of our prospective evaluation of para-aortic irradiation only for such patients. Methods and materials: Between March 1991 and September 2000, 71 patients with Stage I seminoma were treated with adjuvant irradiation to the para-aortic region only after radical inguinal orchiectomy. Radiotherapy was delivered using parallel-opposed fields extending from T11 to L5. A total dose of 25 Gy in 15 fractions was prescribed to midpoint. Follow-up was performed every 3 months for the first year, every 4 months for the second and third years, every 6 months for the fourth and fifth years, and annually thereafter. Chest X-ray, tumor markers, and computed tomography scan of the pelvis were performed routinely as part of the follow-up investigation. Results: At a median follow-up of 75 months, 68 of 71 patients are alive and free of relapse. Only 1 patient (1.4%) experienced failure in the ipsilateral inguinal nodal region. Two patients (2.8%) died of unrelated causes. The actuarial 10-year relapse free survival is 98.5% and the actuarial 10-year overall survival is 92%. No late toxicity has been encountered. Conclusion: Patients with Stage I seminoma of the testis may be safely treated with para-aortic radiotherapy only. Risk of pelvic failure is very low and treatment toxicity minimal
Bieri, S; Rouzaud, M; Miralbell, R
1999-03-01
To evaluate the influence of different shielding conditions and field geometry on the scatter dose to the remaining testicle during postoperative radiotherapy (RT) in seminoma. Testicular dose measurements were made with LiF thermoluminescent dosimeters (TLD) in 29 patients with stage I and IIA seminoma. The target volume consisted of para-aortic (PA) and para-aortic and homolateral iliac (PAI) lymph nodes in 14 and 15 patients, respectively. All patients had a scrotal shield as well as an additional block extending 7 cm inferiorly from the caudal field edge to shield the testicle from external scatter and collimator leakage. Doses with and without testicular blocks were measured for all patients. In seven patients treated exclusively to the PA region the gonadal dose was assessed according to four different shielding conditions: without any protection, with a gonadal shield alone, with the addition of an inferior field border block to the gonadal shield, and with the field border block alone. For patients treated with PAI fields the mean testicular doses per fraction were 3.89 cGy (S.D. +/- 1.44) and 1.48 cGy (S.D. +/- 0.51) without and with gonadal shielding, respectively (P-value shielding conditions, the additional external block to the testicular shield did not reduce significantly the measured dose on the testis. These results suggest a benefit of gonadal shielding even in seminoma patients undergoing radiotherapy limited to the para-aortic region.
Post, Carl M; Jain, Aditya; Degnin, Catherine; Chen, Yiyi; Craycraft, Mike; Hung, Arthur Y; Jaboin, Jerry J; Thomas, Charles R; Mitin, Timur
2018-01-16
Patients with testicular seminoma may face fertility issues because of their underlying disease as well as treatments they undergo. The current patterns of practice among U.S. radiation oncologists aimed at assessing and preserving fertility in patients with Stage I seminoma are unknown. We surveyed practicing U.S. radiation oncologists via an Institutional Review Board-approved online questionnaire. Respondents' characteristics and perceived patient infertility rates were analyzed for association with treatment recommendations. We received 353 responses, of whom one quarter (23%) consider themselves experts. A vast majority (84%) recommend observation as a default strategy. Fifty-two percent routinely advise fertility assessment for patients before observation or chemotherapy, and 74% routinely do so before adjuvant radiation therapy (RT). Forty-one percent and 43% believe that 10% and 30% of patients are infertile following orchiectomy, respectively. Thirty-seven percent and 22% believe infertility rates following para-aortic RT to be 30% and 50%, respectively. Eighty percent routinely use clamshell scrotal shielding. Responders with higher perceived infertility rates are more likely to recommend fertility assessment/sperm banking (Fisher's exact p < 0.0001). Responders who routinely advised fertility assessment were more likely to use clamshell shielding (Cochran-Armitage trend test p = 0.0007). Clamshell use was positively correlated with higher perceived infertility rates following para-aortic RT (Spearman's correlation coefficient = 0.006). Despite a clear knowledge of fertility issues in men diagnosed with seminoma, there is no universal adoption of fertility assessment among U.S. radiation oncologists.
Pichler, Renate; Leonhartsberger, Nicolai; Stöhr, Brigitte; Horninger, Wolfgang; Steiner, Hannes
2012-01-01
To report on the oncological outcome and toxicity of patients treated with 2 cycles of cisplatin-based chemotherapy for low-volume metastatic stage II seminoma. We retrospectively identified a case series of 15 patients with seminoma stage IIA (26.7%) and IIB (73.3%) who underwent chemotherapy consisting of 2 cycles of cisplatin, etoposide and bleomycin (PEB) (cisplatin 20 mg/m(2) on days 1-5, etoposide 100 mg/m(2) on days 1-5, bleomycin 30 mg on days 1, 8 and 15) according to patient preference (refusing a 3rd cycle of PEB) or institutional practice in the last decades. Complete staging before chemotherapy was available in all patients. Patient age, the side and diameter of the primary tumor, the size of the lymph nodes before and after chemotherapy, acute and late toxicity of chemotherapy, the incidence of second malignancies, the relapse-free rate and cancer-specific mortality were recorded. Chemotherapy was well tolerated and no episode of febrile neutropenia occurred. Thrombocytopenia grade 4 was not seen in any patient, while leukopenia grade 4 was observed in 4 (26.6%) patients. The mean (range) lymph node size decreased significantly from 2.54 cm (1.1-4.0) before chemotherapy to 0.75 cm (0.4-2.2) after chemotherapy (p < 0.001). After a median (range) follow-up of 60 (13-185) months, no patient had relapsed, no patient had died as a result of seminoma and second malignancy was seen in only 1 (6.6%) patient. These excellent long-term results from a retrospective case series of 2 cycles of PEB in stage IIA/IIB seminoma patients represent a hint for further research with a view to reducing treatment burden. However, these incidental findings should be studied in prospective trials prior to drawing any conclusions. Copyright © 2013 S. Karger AG, Basel.
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
Czech Academy of Sciences Publication Activity Database
Benešová, Martina; Trejbalová, Kateřina; Kučerová, Dana; Vernerová, Z.; Hron, Tomáš; Szabo, A.; Amouroux, R.; Klezl, P.; Hajkova, P.; Hejnar, Jiří
2017-01-01
Roč. 56, č. 8 (2017), s. 1837-1850 ISSN 0899-1987 R&D Projects: GA MZd NT14601 Institutional support: RVO:68378050 Keywords : 5-hydroxymethylcytosine * 5-methylcytosine * germ cell tumor * seminoma * TET 1 Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 4.185, year: 2016
American Canine Hepatozoonosis
Ewing, S. A.; Panciera, R. J.
2003-01-01
American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294
International Nuclear Information System (INIS)
Incrocci, Luca; Hop, Wim C.J.; Wijnmaalen, Arendjan; Slob, A. Koos
2002-01-01
Purpose: Orchiectomy followed by infradiaphragmatic irradiation is the standard treatment for Stage I-II testicular seminoma in The Netherlands. Because body image and sexual functioning can be affected by treatment, a retrospective study was carried out to assess treatment outcome, body image, and changes in sexuality after orchiectomy and radiotherapy. Methods and Materials: The medical charts of 166 patients with Stage I-II testicular seminoma were reviewed. A questionnaire on body image and current sexual functioning regarding the frequency and quality of erections, sexual activity, significance of sex, and changes in sexuality was sent to 157 patients (at a mean of 51 months after treatment). Results: Seventy-eight percent (n=123, mean age 42 years) completed the questionnaire. During irradiation, almost half of patients experienced nausea and 19% nausea and vomiting. Only 3 patients had disease relapse. After treatment, about 20% reported less interest and pleasure in sex and less sexual activity. Interest in sex, erectile difficulties, and satisfaction with sexual life did not differ from age-matched healthy controls. At the time of the survey, 17% of patients had erectile difficulties, a figure that was significantly higher than before treatment, but which correlated also with age. Twenty percent expressed concerns about fertility, and 52% found their body had changed after treatment. Cancer treatment had negatively influenced sexual life in 32% of the patients. Conclusions: Orchiectomy with radiotherapy is an effective and well-tolerated treatment for Stage I-II testicular seminoma. Treatment-induced changes in body image and concerns about fertility were detected, but the sexual problems encountered did not seem to differ from those of healthy controls, although baseline data are lacking
Testicular cancer: seminoma. Stage I. Adjuvant radiotherapy. Results at 3 years
International Nuclear Information System (INIS)
Lione, M.; Ticera, N.; Mandachain, M.
2008-01-01
Full text: Purpose: To evaluate the results achieved with adjuvant radiotherapy. Materials and methods: We analyzed 40 medical records of patients diagnosed with stage I of testicular cancer, all of them received adjuvant radiotherapy between April 1992 and May 2004. The histological type was classical seminoma (95%) and spermatocytes (5%). Diagnosis and staging were performed with testicular ultrasound, determination of tumor markers, computed tomography of abdomen - pelvis and chest radiographs. Radiotherapy: Patients were treated with 60 Co unit and a linear accelerator of 6 MV photons. Volumes: Group I: lumboaortic lymph node region and ipsilateral pelvis. Group II: lumboaortic only. Daily dose: 1.8 Gy, total dose: 30.6 Gy. Patient in supine position, 2 parallel fields and opposed, DFP: 80 cm, calculated from midplane. They were followed for 3 years with chest X-ray, CAT scan of abdomen and pelvis at 12 months and then a full clinical control 1 time per year. Results: We defined the rate of ipsilateral pelvic node recurrence (group I: 0% vs. Group II: 6.25%), progression at distance (group I: 8.3% vs. Group II: 0%) and global survival (GS) (group I: 100% vs. group II: 100%) at 3 years of follow up. Conclusions: Our result is similar to that published in the international literature. Given the small number of patients, no evidence of changes in GS with the addition of radiotherapy to ipsilateral pelvic node. Radiation therapy to lumboaortic lymph nodes is the usual treatment, being necessary to optimize the modality of radiotherapy (RC3D - IRMT) to reduce toxicity in a long term. (authors) [es
Mazonakis, Michalis; Berris, Theocharris; Lyraraki, Efrossyni; Damilakis, John
2015-03-01
This study was conducted to calculate the peripheral dose to critical structures and assess the radiation risks from modern radiotherapy for stage IIA/IIB testicular seminoma. A Monte Carlo code was used for treatment simulation on a computational phantom representing an average adult. The initial treatment phase involved anteroposterior and posteroanaterior modified dog-leg fields exposing para-aortic and ipsilateral iliac lymph nodes followed by a cone-down phase for nodal mass irradiation. Peripheral doses were calculated using different modified dog-leg field dimensions and an extended conventional dog-leg portal. The risk models of the BEIR-VII report and ICRP-103 were combined with dosimetric calculations to estimate the probability of developing stochastic effects. Radiotherapy for stage IIA seminoma with a target dose of 30 Gy resulted in a range of 23.0-603.7 mGy to non-targeted peripheral tissues and organs. The corresponding range for treatment of stage IIB disease to a cumulative dose of 36 Gy was 24.2-633.9 mGy. A dose variation of less than 13% was found by altering the field dimensions. Radiotherapy with the conventional instead of the modern modified dog-leg field increased the peripheral dose up to 8.2 times. The calculated heart doses of 589.0-632.9 mGy may increase the risk for developing cardiovascular diseases whereas the testicular dose of more than 231.9 mGy may lead to a temporary infertility. The probability of birth abnormalities in the offspring of cancer survivors was below 0.13% which is much lower than the spontaneous mutation rate. Abdominoplevic irradiation may increase the lifetime intrinsic risk for the induction of secondary malignancies by 0.6-3.9% depending upon the site of interest, patient’s age and tumor dose. Radiotherapy for stage IIA/IIB seminoma with restricted fields and low doses is associated with an increased morbidity. These data may allow the definition of a risk-adapted follow-up scheme for long
International Nuclear Information System (INIS)
Bieri, S.; Rouzaud, M.; Miralbell, R.
1999-01-01
Purpose: To evaluate the influence of different shielding conditions and field geometry on the scatter dose to the remaining testicle during postoperative radiotherapy (RT) in seminoma.Materials and methods: Testicular dose measurements were made with LiF thermoluminescent dosimeters (TLD) in 29 patients with stage I and IIA seminoma. The target volume consisted of para-aortic (PA) and para-aortic and homolateral iliac (PAI) lymph nodes in 14 and 15 patients, respectively. All patients had a scrotal shield as well as an additional block extending 7 cm inferiorly from the caudal field edge to shield the testicle from external scatter and collimator leakage. Doses with and without testicular blocks were measured for all patients. In seven patients treated exclusively to the PA region the gonadal dose was assessed according to four different shielding conditions: without any protection, with a gonadal shield alone, with the addition of an inferior field border block to the gonadal shield, and with the field border block alone.Results: For patients treated with PAI fields the mean testicular doses per fraction were 3.89 cGy (S.D.±1.44) and 1.48 cGy (S.D.±0.51) without and with gonadal shielding, respectively (P-value <0.001); the corresponding values for PA fields were 1.86 cGy (S.D.±0.86) and 0.65 cGy (S.D.±0.35). For the patients treated to the PA region and assessed according to the four different shielding conditions, the additional external block to the testicular shield did not reduce significantly the measured dose on the testis.Conclusions: These results suggest a benefit of gonadal shielding even in seminoma patients undergoing radiotherapy limited to the para-aortic region. (Copyright (c) Elsevier Science B.V., Amsterdam. All rights reserved.)
Fine needle aspiration cytology and cell block in the diagnosis of seminoma testis
Directory of Open Access Journals (Sweden)
Abhishant Pandey
2011-01-01
Full Text Available Testicular neoplasms which show a wide variety of morphologic types, comprise a small proportion of malignancies. Early identification and treatment is essential for achieving long term survival. The cytologic findings in fine needle aspiration smears from left testicular swelling of a 49 year old male suggestive of a germ cell tumor was complimented by cell block preparation as seminoma. This was confirmed by histopathologic studies. We are presenting this case to emphasize that cell block can be used for diagnosis of testicular tumors.
Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio
2016-08-30
A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Fossa, S.D.A.; Aass, N.; Kaalhus, O.
1989-01-01
After infradiaphragmatic radiotherapy the cancer-related 10 year survival was 99% in 365 patients with seminoma Stage I referred to the Norwegian Radium Hospital between 1970 and 1982. Thirteen patients relapsed, 11 of them within the first 3 years after treatment. Nine of the recurrent patients were cured by radiotherapy alone (4) or in combination with chemotherapy (5). There is no need to include the inguinal lymph nodes into the irradiation field or to give scrotal irradiation, not even to patients with tumor infiltration beyond the testicular tissue, or to those with prior scrotal or inguinal surgery. At least 1 year after radiotherapy moderate or more severe dyspepsia was observed in 16 patients. Nine patients developed a peptic ulcer. In general, there was no increased risk for development of a second non-germ cell cancer after radiotherapy. However, 4 patients developed a pulmonary cancer indicating a border-line significance of increased risk for this type of malignancy. (p:0.05). In conclusion, infradiaphragmatic radiotherapy remains the optimal routine treatment in seminoma patients with Stage I
Cost analysis of alternate management schemes in early stage testicular seminoma
International Nuclear Information System (INIS)
Sharda, Navneet N.; Kinsella, Timothy J.; Ritter, Mark A.
1995-01-01
Purpose: Optimal management of early stage testicular seminoma remains uncertain. Standard therapy includes inguinal orchidectomy followed by irradiation of the pelvic and para-aortic nodes. Due to the excellent survival rates (<4% seminoma specific mortality as per the Princess Margaret, Institute Goustave-Roussy experience), the option of observation following orchidectomy has been proposed, with no diminution in absolute survival noted since salvage chemotherapy is effective in the treatment of early systemic relapse. However, the intensity of follow-up required if observation is chosen will likely add an increased medical cost burden which needs to be balanced against the cost of standard treatment using radiation therapy. We have therefore performed a cost comparison between these two management strategies in order to define any differences. Methods and Materials: All costs reported are adjusted to 1994 dollars and analysis is begun immediately post-orchidectomy. The cost of observation was calculated assuming a 15% relapse rate (10%-20%) over seven years of follow-up. The follow-up schedule was assumed identical to that commonly reported in the literature (Princess Margaret, Institute Gustave-Roussy, Royal Marsden), consisting of periodic CXR, CT abd/pelvis, tumor markers and examinations. Chemotherapy costs associated with treatment of recurrences were generated from the inpatient hospital charges and physician billing of five patients who received three cycles of a standard United States regimen consisting of bleomycin, etoposide and cis-platinum in 1994. On average, four days of hospitalization were required. Radiological costs were also calculated from the actual patient billing records in 1994 and incremented at a rate of 3%/year over the length of proposed follow-up. Costs of irradiation and subsequent standard follow-up were similarly generated from the hospital charges and physician billing of five patients treated postoperatively. A 4% recurrence
Contemporary management of stage I and II seminoma.
Chung, Peter; Warde, Padraig
2013-10-01
Seminoma represents about 60 % of all testicular germ cell tumors. At presentation about 80 % of patients have stage I and about 15 % have stage II disease. The last three decades have seen a substantial change in the philosophy of management with the success of surveillance as a strategy to minimize unnecessary treatment, recognition of the late effects of radiation therapy, and the success of cisplatin-based chemotherapy as curative treatment either in the first-line or salvage setting. Overall, in stage I disease where 80-85 % are cured with orchiectomy alone, efforts now are directed at reducing the burden of the disease and its diagnosis on patients with increasing utilization of surveillance and decreased employment of adjuvant therapy. For stage II disease, balancing the relative toxicities of radiation and chemotherapy while avoiding the use of multimodality therapy due to the additive long-term toxicity has become the priority.
Contemporary management of stage i testicular seminoma: a survey of Canadian radiation oncologists
Samant, R.; Alomary, I.; Genest, P.; Eapen, L.
2008-01-01
Recently published studies clearly indicate that there are now several acceptable options for managing stage i testicular seminoma patients after orchiectomy. We therefore decided to survey Canadian radiation oncologists to determine how they currently manage such patients and to compare the results with previous surveys. Our results demonstrate that adjuvant single-agent chemotherapy is being considered as an option by an increasing proportion of radiation oncologists (although it is not considered the preferred option), the routine use of radiotherapy is declining, and surveillance is becoming increasingly popular and is recommended most often. PMID:18769613
Czech Academy of Sciences Publication Activity Database
Benešová, Martina; Trejbalová, Kateřina; Kovářová, Denisa; Vernerová, Z.; Hron, Tomáš; Kučerová, Dana; Hejnar, Jiří
2017-01-01
Roč. 14, č. 1 (2017), č. článku 20. ISSN 1742-4690 R&D Projects: GA ČR GA13-37600S; GA MZd NT14601 Institutional support: RVO:68378050 Keywords : Human endogenous retrovirus * ERVWE1 * Germ cell tumor * Seminoma * Promoter DNA methylation * 5-Hydroxymethylcytosine * Transcription * RNA splicing Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Virology Impact factor: 3.867, year: 2016
International Nuclear Information System (INIS)
Kamezaki, Kenjirou; Fukuda, Takahiro; Makino, Shigeyoshi; Harada, Mine
2005-01-01
A 17-year-old man with mediastinal seminoma was treated with chemotherapy and mediastinal irradiation therapy. Then he received high-dose chemotherapy containing cyclophosphamide (CY) followed by autologous peripheral blood stem cell transplantation. He suffered from CY-induced cardiomyopathy beginning six days after the administration of high-dose CY. The predictable factors associated with the onset of CY-induced cardiomyopathy are not precisely known. It is suggested that the history of mediastinal irradiation was responsible for the onset of cardiomyopathy. (author)
Bone marrow-sparing intensity-modulated radiation therapy for Stage I seminoma
International Nuclear Information System (INIS)
Zilli, Thomas; Boudreau, Chantal; Doucet, Robert; Alizadeh, Moein; Lambert, Carole; Van Nguyen, Thu; Taussky, Daniel
2011-01-01
Background. A direct association between radiotherapy dose, side-effects and secondary cancers has been described in patients with seminoma. A treatment planning study was performed in order to compare computed tomography-based traditional radiotherapy (CT-tRT) versus bone marrow-sparing intensity-modulated radiation therapy (BMS-IMRT) in patients with Stage I seminoma. Material and methods. We optimized in 10 patients a CT-tRT and a BMS-IMRT treatment plan to deliver 20 Gy to the para-aortic nodes. CT-tRT and IMRT consisted of anteroposterior-posterioranterior parallel-opposed and seven non-opposed coplanar fields using 16 and 6-MV photon energies, respectively. Dose-Volume Histograms for clinical target volume (CTV), planning target volume (PTV) and organs at risk (OARs) were compared for both techniques using Wilcoxon matched-pair signed rank-test. Results. Dmean to CTV and PTV were similar for both techniques, even if CT-tRT showed a slightly improved target coverage in terms of PTV-D95% (19.7 vs. 19.5 Gy, p 0.005) and PTV-V95% (100 vs. 99.7%, p = 0.011) compared to BMS-IMRT. BMS-IMRT resulted in a significant reduction (5.2 Gy, p = 0.005) in the Dmean to the active bone marrow (ABM). The V100% and V75% of the OARs were reduced with BMS-IMRT by: ABM-V100% = 51.7% and ABM-V75% = 42.3%; bowel-V100% = 15.7% and bowel-V75% = 16.8%; stomach-V100% = 22% and stomach-V75% = 27.7%; pancreas-V100% = 37.1% and pancreas-V75% = 35.9% (p = 0.005 for all variables). Conclusions. BMS-IMRT reduces markedly the dose to the OARs compared to CT-tRT. This should translate into a reduction in acute and long-term toxicity, as well as into the risk of secondary solid and hematological cancers
Looijenga, L.H.J.; Hersmus, R.; Gillis, A.J.M.; Pfundt, R.; Stoop, H.J.; Gurp, R.J.H.L.M. van; Veltman, J.; Beverloo, H.B.; Drunen, E. van; Geurts van Kessel, A.H.M.; Pera, R.R.; Schneider, D.T.; Summersgill, B.; Shipley, J.; McIntyre, A.; Spek, P. van der; Schoenmakers, E.F.P.M.; Oosterhuis, J.W.
2006-01-01
Spermatocytic seminomas are solid tumors found solely in the testis of predominantly elderly individuals. We investigated these tumors using a genome-wide analysis for structural and numerical chromosomal changes through conventional karyotyping, spectral karyotyping, and array comparative genomic
European surveillance of emerging pathogens associated with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe
2017-12-01
Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
Low-dose testicular irradiation in seminoma patients. In-vivo dosimetry
International Nuclear Information System (INIS)
Gruber, G.; Schwegler, N.
1999-01-01
Background: This article should demonstrate the problems concerning gonadal dose in seminoma patients, the impact of shielding and possible consequences for therapy and advising of patients with desire to have children. Patients and Method: Since November 1993 gonadal doses of 43 patients (Stage I/II, Royal Marsden) have been determined in 80 measurements with 2 ionization chambers on the ipsi- and contralateral side of the remaining testicle. The patients were all treated with ap/pa 'hockey-stick'-shaped fields on a 6 MV linear accelerator. With single doses of 1.8 Gy in midplane, total doses of 34.2 Gy were applied in 13, and 30.6 Gy in 30 men. Protection was used in 33 patients, 6 times with conventional shielding, later plus an additional clam-shell from ap. The results of 22 measurements on 6 men with and without protection are of special interest. In 25 patients a sperm analysis before radiotherapy was conducted. Results: Before the beginning of radiotherapy (RT) 56% of available patients have shown an impaired spermatogenesis. The mean gonadal doses were 2.4% of midplane dose-MD (4.8 cGy), 1.8% MD (3.2 cGy) and 1% MD (1.8 cGy) per fraction for patients without (n-patients=10, m-measurements=15), with conventional (n=6, m=7), and additional clam-shell shielding (n=33, m=58). The corresponding median values were 2.1% (SD 1.07), 1,7% (SD 0.28) and 1% (SD 0.41) of midplane dose. According to direct comparisons, a dose reduction of about half can be expected in most cases. Mean dose fluctuations of 11.6% (median 10%) have to be taken into account. Conclusion: Effective shielding can diminish gonadal dose in seminoma patients to about 1% of midplane and gives a good possibility of taking the maintenance of fertility and the desire to have children into account. The application should be considered especially for patients with impaired spermatogenesis before RT. Eventual fluctuations induced us to determine the gonadal dose 3 times per patient in direct
Kubota, Akihiro; Tajima, Takashi; Narukawa, Shinya; Yamazato, Masamizu; Fukaura, Hikoaki; Takahashi, Yukitoshi; Tanaka, Keiko; Shimizu, Jun; Nomura, Kyoichi
2012-01-01
A 36-year-old man presented with cognitive impairment and disturbance of short-term memory functions with character change. Cerebrospinal fluid analysis revealed no abnormalities; however, brain MRI revealed high-signal intensity from bilateral hippocampus lesions on fluid attenuated inversion recovery (FLAIR) images and T(2) weighted images. The 18F-fluorodeoxyglucose PET demonstrated high glucose uptake in the bilateral hippocampus lesions. He was diagnosed as limbic encephalitis, and was administered high-dose intravenous methylprednisolone and immune adsorption plasma therapy followed by intravenous immunoglobulin therapy. MRI abnormalities improved after treatment but recent memory disturbance remained. Ma2 antibody, NMDA-receptor antibody, and GluRε2 antibody were positive. Eleven months atter the onset of disease, the tumor was identified in left testicle by ultrasound and removed the tumor. The pathological findings were seminoma. We experienced a case of paraneoplastic limbic encephalitis associated with seminoma with short-term memory disturbance. The occurrence of paraneoplastic limbic encephalitis with antibodies against cell membrane (NMDA-receptor antibody and GluRε2 antibody) and intracellular (Ma2 antibody) is rare even in the literature.
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Nodular Hepatic Tuberculosis Masquerading as a Seminoma Liver Metastasis.
Harbi, Houssem; Chaabouni, Amine; Kallel, Rim; Toumi, Nozha; Fendri, Sami; Krichene, Jihene; Boujelbene, Salah; Mzali, Rafik
2018-04-01
Isolated macro-nodular liver tuberculosis is a very rare condition. It may mimic primitive or secondary tumors of the liver. This could delay or mislead the therapeutic management. An immunocompetent 48-year-old man with a history of non-metastatic seminoma was treated with right orchidectomy followed by 20 Gy radiotherapy. The discovery, 8 months later, of a 2 cm nodule of the hepatic dome evoked a liver metastasis. Percutaneous biopsy was not feasible. Wedge resection was performed whereas medical treatment would have sufficed, as pathologic examination of the resected specimen showed a macro-nodular hepatic tuberculosis. The patient received anti-tuberculosis drugs for 9 months. The diagnosis of isolated macro-nodular liver tuberculosis is frequently misleading, particularly in immunocompetent and paucisymptomatic patients. Thus percutaneous biopsy is mandatory for diagnosis and also prior to any major surgeries. © 2018 The Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Effect of Radiotherapy Volume and Dose on Secondary Cancer Risk in Stage I Testicular Seminoma
International Nuclear Information System (INIS)
Zwahlen, Daniel R.; Martin, Jarad M.; Millar, Jeremy L.; Schneider, Uwe
2008-01-01
Purpose: To estimate and compare the secondary cancer risk (SCR) due to para-aortic (PA), dogleg field (DLF), or extensive field (EF) radiotherapy (RT) at different dose levels for Stage I testicular seminoma. Methods and Materials: The organ equivalent dose concept with a linear, plateau, and linear-exponential dose-response model was applied to the dose distributions to estimate the SCR. The dose distributions were calculated in a voxel-based anthropomorphic phantom. Three different three-dimensional plans were computed: PA, DLF, and EF. The plans were calculated with 6-MV photons and two opposed fields, using 20 Gy in 10 fractions. Results: The estimated cumulative SCR for a 75-year-old patient treated with PA-RT at age 35 was 23.3% (linear model), 20.9% (plateau model), and 20.8% (linear-exponential model) compared with 19.8% for the general population. Dependent on the model, PA-RT compared with DLF-RT reduced the SCR by 48-63% or 64-69% when normalized to EF-RT. For PA-RT, the linear dose-response model predicted a decrease of 45% in the SCR, using 20 Gy instead of 30 Gy; the linear-exponential dose-response model predicted no change in SCR. Conclusion: Our model suggested that the SCR after PA-RT for Stage I testicular seminoma is reduced by approximately one-half to two-thirds compared with DLF-RT, independent of the dose-response model. The SCR is expected to be equal or lower with 20 Gy than with 30 Gy. In the absence of mature patient data, the organ equivalent dose concept offers the best potential method of estimating the SCR when discussing treatment options with patients
Stage 1 testicular seminoma; Seminomes testiculaire de stade 1
Energy Technology Data Exchange (ETDEWEB)
Gross, E.; Champetier, C.; Zaccariotto, A.; Duberge, T. [Departement de radiotherapie, hopital de la Timone, 13 - Marseille (France); Pointreau, Y. [Service de radiotherapie, centre regional universitaire de cancerologie Henry-S.-Kaplan CHU de Tours, Hpital Bretonneau, 37 - Tours (France); Chauvet, B. [Institut Sainte-Catherine, 84 - Avignon (France)
2010-07-01
Testicular cancer is rare, representing only 1 % of malignant tumors, but the most common cancer in young men, 15 to 35 years. Adjuvant radiotherapy after orchidectomy in testicular seminoma stage I, reduces risk of relapse. It aims to eradicate micro-metastatic disease in lymph drainage territories. In the case of adjuvant radiotherapy, the relapse-free survival of 96 % with an overall survival of 98 % at 5 years. The irradiation volume is made up of lymph nodes paraaortic which it is possible to add the ipsilateral renal hilum to the testicular lesion. The current recommended dose is 20 Gy in 10 fractions and 2 weeks, usually delivered by two antero-posterior beams. The acute toxicities, mainly represented by nausea and diarrhea are usually quickly resolved to the end of irradiation. Regarding toxicities long-term, preservation of semen should be considered after surgery because of fear of infertility post-treatment. The risk of second cancer associated with exposure to ionizing radiation, albeit small, is especially important to consider these patients to significant life expectancy. Nevertheless, developments in radiotherapy techniques and lower doses and irradiated volumes can probably reduce this risk further. (authors)
Energy Technology Data Exchange (ETDEWEB)
Glanzmann, C.; Schultz, G.; Luetoff, U.M. (Zurich University Hospital (Switzerland). Department of Radiation Oncology)
1991-09-01
Long-term abdominal or urological morbidity and second malignancies in 289 surviving patients with infradiaphragmatic adjuvant radiotherapy (RT) for testicular cancer between 1950 and 1988 are analyzed by retrospective chart review. After RT with single doses between 1.5 and 2.0 Gy and a total dose between 30 and 35 Gy, no peptic ulcer or other abdominal or urological long-term morbidity was observed, except second tumours. The cumulative incidence of 16 second extratesticular malignancy was (in years after RT): 0.4% (4 years), 1.3% (9 years), 4.5% (14 years), 6.3% (19 years), 7.5% (24 years), 15.6% (29 years), 23.6% (35 years). The ratio of observed to expect incidence of extratesticular malignancies did not differ significantly from unity; only the frequency of penile cancer (n=2) was somewhat higher than expected. The cumulative risk of bilateral testicular cancer was 4.8% with no difference between patients with seminoma or non-seminomatous germ cell tumours. In a recent group of 128 patients with a stage I seminoma staged and treated between 1978-1988 by modern standard, there was no recurrence. (author). 28 refs., 2 tabs.
International Nuclear Information System (INIS)
Sato, Fuminori; Yamazaki, Hajime; Ataka, Ken; Mashima, Ichiro; Suzuki, Kenta; Takahashi, Toru; Umezu, Hajime; Gejyo, Fumitake
2000-01-01
A 52-year-old man developed malignant peritoneal mesothelioma 17 years after radiotherapy for seminoma of the testis. Although asbestos exposure is considered to be the major risk factor for the development of malignant mesothelioma, prior therapeutic radiation has also been postulated as a causative factor. The unexplained appearance of ascites or pleural effusion within a previously irradiated area should be considered suggestive of malignant mesothelioma in any long-term survivor of cancer. In addition, the patient suffered a deep vein thrombosis four years before the diagnosis of mesothelioma. Deep vein thrombosis is a common complication of malignant disease, and is often the first clue to occult malignancy. (author)
Energy Technology Data Exchange (ETDEWEB)
Sato, Fuminori; Yamazaki, Hajime; Ataka, Ken; Mashima, Ichiro; Suzuki, Kenta; Takahashi, Toru; Umezu, Hajime; Gejyo, Fumitake [Niigata Univ. (Japan). School of Medicine
2000-11-01
A 52-year-old man developed malignant peritoneal mesothelioma 17 years after radiotherapy for seminoma of the testis. Although asbestos exposure is considered to be the major risk factor for the development of malignant mesothelioma, prior therapeutic radiation has also been postulated as a causative factor. The unexplained appearance of ascites or pleural effusion within a previously irradiated area should be considered suggestive of malignant mesothelioma in any long-term survivor of cancer. In addition, the patient suffered a deep vein thrombosis four years before the diagnosis of mesothelioma. Deep vein thrombosis is a common complication of malignant disease, and is often the first clue to occult malignancy. (author)
Ross, Peter; Nemec, Paige S; Kapatos, Alexander; Miller, Keith R; Holmes, Jennifer C; Suter, Steven E; Buntzman, Adam S; Soderblom, Erik J; Collins, Edward J; Hess, Paul R
2018-03-01
Ideally, CD8+ T-cell responses against virally infected or malignant cells are defined at the level of the specific peptide and restricting MHC class I element, a determination not yet made in the dog. To advance the discovery of canine CTL epitopes, we sought to determine whether a putative classical MHC class Ia gene, Dog Leukocyte Antigen (DLA)-88, presents peptides from a viral pathogen, canine distemper virus (CDV). To investigate this possibility, DLA-88*508:01, an allele prevalent in Golden Retrievers, was expressed as a FLAG-tagged construct in canine histiocytic cells to allow affinity purification of peptide-DLA-88 complexes and subsequent elution of bound peptides. Pattern analysis of self peptide sequences, which were determined by liquid chromatography-tandem mass spectrometry (LC-MS/MS), permitted binding preferences to be inferred. DLA-88*508:01 binds peptides that are 9-to-12 amino acids in length, with a modest preference for 9- and 11-mers. Hydrophobic residues are favored at positions 2 and 3, as are K, R or F residues at the C-terminus. Testing motif-matched and -unmatched synthetic peptides via peptide-MHC surface stabilization assay using a DLA-88*508:01-transfected, TAP-deficient RMA-S line supported these conclusions. With CDV infection, 22 viral peptides ranging from 9-to-12 residues in length were identified in DLA-88*508:01 eluates by LC-MS/MS. Combined motif analysis and surface stabilization assay data suggested that 11 of these 22 peptides, derived from CDV hemagglutinin, large polymerase, matrix, nucleocapsid, and V proteins, were processed and presented, and thus, potential targets of anti-viral CTL in DLA-88*508:01-bearing dogs. The presentation of diverse self and viral peptides indicates that DLA-88 is a classical MHC class Ia gene. Copyright © 2018 Elsevier B.V. All rights reserved.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
Abnormal hCG levels in a patient with treated stage I seminoma: a diagnostic dilemma.
LENUS (Irish Health Repository)
Aherne, Noel J
2008-01-01
BACKGROUND: We report the case of a patient with treated Stage Ia seminoma who was found to have an elevated beta human chorionic gonadotrophin (hCG) on routine follow - up. This instigated restaging and could have lead to commencement of chemotherapy. CASE PRESENTATION: The patient was a bodybuilder, and following a negative metastatic work - up, admitted to injecting exogenous beta hCG. This was done to reduce withdrawal symptoms from androgen abuse. The patient remains well eight years post diagnosis. CONCLUSION: This case highlights the need for surgical oncologists to conduct vigilant screening of young male patients with a history of testicular germ cell tumours and who may indulge in steroid abuse.
Abnormal hCG levels in a patient with treated stage I seminoma: a diagnostic dilemma
Directory of Open Access Journals (Sweden)
Fitzpatrick David G
2008-06-01
Full Text Available Abstract Background We report the case of a patient with treated Stage Ia seminoma who was found to have an elevated beta human chorionic gonadotrophin (hCG on routine follow – up. This instigated restaging and could have lead to commencement of chemotherapy. Case presentation The patient was a bodybuilder, and following a negative metastatic work – up, admitted to injecting exogenous beta hCG. This was done to reduce withdrawal symptoms from androgen abuse. The patient remains well eight years post diagnosis. Conclusion This case highlights the need for surgical oncologists to conduct vigilant screening of young male patients with a history of testicular germ cell tumours and who may indulge in steroid abuse.
Giorgio Treglia; Ramin Sadeghi; Salvatore Annunziata; Carmelo Caldarella; Francesco Bertagna; Luca Giovanella
2014-01-01
Objective. To meta-analyze published data about the diagnostic performance of fluorine-18-Fluorodeoxyglucose (18F-FDG) positron emission tomography (PET) and PET/computed tomography (PET/CT) in the postchemotherapy management of patients with seminoma. Methods. A comprehensive literature search of studies published through January 2014 on this topic was performed. All retrieved studies were reviewed and qualitatively analyzed. Pooled sensitivity and specificity, positive and negative predicti...
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Towards individualised radiotherapy for Stage I seminoma
International Nuclear Information System (INIS)
Martin, Jarad M.; Joon, Daryl Lim; Ng, Nicole; Grace, Michael; Gelderen, David van; Lawlor, Marita; Wada, Morikatsu; Joon, Michael Lim; Quong, George; Khoo, Vincent
2005-01-01
Background and purpose: Adjuvant radiotherapy is currently standard treatment of Stage I seminoma (SOS). The use of computerised tomogram (CT) planning is compared with traditional planning for greater treatment individualisation. Material and methods: Two plans were generated for each of 10 patients: one using traditional rectangular para-aortic fields, and one using conformal fields. The primary target volume compared was the dosimetric coverage of the inferior vena cava and aorta. Results: The dosimetric analysis of traditional plans showed that they provided reasonable dosimetric coverage of the CTV. However, if 1 cm is used for uncertainty based on nodal coverage then the periphery of the PTV could be significantly under-dosed. The CT based plan delivered improved dosimetry to the vessel PTV compared with the traditional field (CT D95=24.7 Gy, traditional D95=23.6 Gy, P=0.002). CT-based plans were significantly wider than traditional plans (CT=11.8 cm, traditional=9 cm, P=0.002). The CT plan tended to irradiate relatively small volumes of the kidneys to higher doses. Conclusions: Traditional para-aortic fields may deliver suboptimal dosimetry to an anatomically defined PTV. Our CT-based fields tend to be wider than traditional fields, and provide improved dosimetry to vessels based target volumes. Given that traditional fields are often delivering significantly less than the prescribed dose to the target volume, and that marginal relapses cause a high proportion of treatment failure, there is a suggestion that CT-based plans may avoid underdosage and geographical miss sometimes seen with traditional plans
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
Somatic isoform of angiotensin I-converting enzyme in the pathology of testicular germ cell tumors.
Franke, F E; Pauls, K; Kerkman, L; Steger, K; Klonisch, T; Metzger, R; Alhenc-Gelas, F; Burkhardt, E; Bergmann, M; Danilov, S M
2000-12-01
Retained fetal expression of angiotensin I-converting enzyme (ACE, CD143) has recently been shown in intratubular germ cell neoplasms (IGCN) and invasive germ cell tumors (GCT), suggesting the somatic isoform (sACE) as a characteristic component of neoplastic germ cells. We analyzed the distribution of sACE in 159 testicular GCT, including 87 IGCN. sACE protein was determined by immunohistochemistry (MAb CG2) on routinely formalin-fixed and paraffin-embedded tissue sections, supplemented by mRNA expression analysis using in situ hybridization. These data were compared with those obtained by germ cell/placental alkaline phosphatases (PIAP; MAbs PL8-F6 and 8A9) employing an uniform score system for the evaluation of immunoreactivity (IRS; possible values from 0 to 12). Expression of sACE and PIAP was found in all 87 analyzed IGCN (IRS > 4, median IRS of 12). Heterogeneous staining patterns were not related to the type of adjacent GCT but correlated with low expression in adjacent seminomas (P =.032 for sACE; P =.005 for PIAP). Both sACE and PIAP often showed a decreased and more heterogeneous but still moderate expression in 91 classic seminomas (median IRS of 8) and were completely absent in tumor cells of spermatocytic seminomas. Despite all similarities, we found sACE and PIAP differently regulated during GCT progression. This was documented by a well-preserved expression of either sACE or PIAP or both in all classic seminomas, low PIAP immunoreactivity in metastasis of seminomas, and completely diverging expression patterns in nonseminomatous GCT. Our findings underline the close molecular relationship between IGCN and seminoma, and suggest sACE as an appropriate marker for seminomatous differentiated tumors. HUM PATHOL 31:1466-1476. Copyright 2000 by W.B. Saunders Company
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
Directory of Open Access Journals (Sweden)
Senthilnathan Palanisamy
2015-01-01
Full Text Available Persistent Mullerian duct syndrome (PMDS is one of the three rare intersex disorders caused by defective anti-mullerian hormone or its receptor, characterized by undescended testes with presence of underdeveloped derivatives of mullerian duct in genetically male infant or adult with normal external genitals and virilization. This population will essentially have normal, 46(XY, phenotype. We hereby present a case of PMDS, presented with incarcerated left inguinal hernia associated with cryptorchidism and seminoma of right testes. Patient underwent laparoscopic hernia repair with bilateral orchidectomy and hysterectomy with uneventful postoperative recovery. Here we highlight the importance of minimal access approach for this scenario in terms of better visualization, less blood loss, combining multiple procedures along with early return to work and excellent cosmetic outcome.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Directory of Open Access Journals (Sweden)
V. B. Matveev
2014-07-01
Full Text Available Objective: to evaluate the outcome of retroperitoneal lymph node dissection (RLND in disseminated testicular non-seminoma patients with residual metastases after induction chemotherapy. Material and methods. The RLND performed in 1983 to 2007 were analyzed in 367 testicular non-seminoma patients with residual retroperitoneal masses after ineffective induction chemotherapy. The median age was 26.06.9 years. Orchidectomy was performed in all patients. Category N1 was regarded in 12 (3.3% patients, N2 in 79 (21.5%, N3 in 238 (64.9%, Nx in 38 (10.4%. Distant metastases were present in 133 (36.2% cases. The baseline tumor marker level was elevated in 328 (89.4% patients (S1 in 169 (46.0%, S2 in 108 (29.4%, S3 in 51 (13.9%, Sx in 39 (10.6%. According to the IGCCCG prognostic model, 149 (40.6% patients were classified as good prognostic group, 100 (27.2% as moderate, 77 (21.0% as poor ones; the prognostic group was not defined in 41 (11.2% cases who had started treatment at another facility due to data unavailability. After orchifuniculectomy, all patients received induction cisplatin-based chemotherapy which resulted in tumor shrinkage <50% in 70 (19.1%, 51-90% in 166 (45.2%, and >90% - in 29 (7.9% cases. The response was not properly assessed in 102 (27.8% cases. CT scan revealed residual retroperitoneal masses after chemotherapy in all patients (<2 cm - 52 (14.2%, 2-5 cm - 166 (45.2%, >5 cm - 149 (40.6%. The tumor markers level remained elevated following chemotherapy in 70 (19.1% cases. All patients underwent RLND (complete in 295 (80.4% cases. Radical RLND demanded resection of adjacent organs in 22 (5.9% cases. Extraretroperitoneal metastases were removed simultaneously with retroperitoneal tumor in 22 (5.9% patients. Postoperative chemotherapy was administered in 100 (27.2% cases. The median followup was 82.1 (3-188 months. Results. Complications developed in 31 (8.5% of the 367 of patients. Mortality rate was 0.6% (2/367 cases. Resection of
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Seelig, Davis M; Ito, Daisuke; Forster, Colleen L; Yoon, Una A; Breen, Matthew; Burns, Linda J; Bachanova, Veronika; Lindblad-Toh, Kerstin; O'Brien, Timothy D; Schmechel, Stephen C; Rizzardi, Anthony E; Modiano, Jaime F; Linden, Michael A
2017-07-01
Activation of the classical nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) pathway is a common molecular event observed in both human and canine diffuse large B-cell lymphoma (DLBCL). Although the oncogenic potential of the alternative NFκB pathway (ANFκBP) has also been recently identified in DLBCL, its precise role in tumor pathogenesis and potential as a treatment target is understudied. We hypothesized that up-regulation of the ANFκBP plays an important role in the proliferation and survival of canine DLBCL cells, and we demonstrate that the ANFκBP is constitutively active in primary canine DLBCL samples and a cell line (CLBL1). We further demonstrate that a small interfering RNA inhibits the activation of the NFκB pathway and induces apoptosis in canine DLBCL cells. In conclusion, the ANFκBP facilitates survival of canine DLBCL cells, and thus, dogs with spontaneous DLBCL can provide a useful large animal model to study therapies targeting the ANFκBP.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Directory of Open Access Journals (Sweden)
Radović Katarina
2010-01-01
Full Text Available Introduction. Various mobile devices are used in the therapy of unilateral free-end saddle. Unilateral dentures with precise connectivity elements are not used frequently. In this paper the problem of applying and functionality of unilateral freeend saddle denture without major connector was taken into consideration. Objective. The aim was to analyze and compare a unilateral RPD (removable partial denture and a classical RPD by calculating and analyzing stresses under different loads. Methods. 3D models of unilateral removable partial denture and classical removable partial denture with casted clasps were made by using computer program CATIA V5 (abutment teeth, canine and first premolar, with crowns and abutment tissues were also made. The models were built in full-scale. Stress analyses for both models were performed by applying a force of 300 N on the second premolar, a force of 500 N on the first molar and a force of 700 N on the second molar. Results. The Fault Model Extractor (FME analysis and calculation showed the complete behavior of unilateral removable partial denture and abutments (canine and first premolar, as well as the behavior of RPD under identical loading conditions. Applied forces with extreme values caused high stress levels on both models and their abutments within physiological limits. Conclusion. Having analyzed stresses under same conditions, we concluded that the unilateral RPD and classical RPD have similar physiological values.
Surgical uterine drainage and lavage as treatment for canine pyometra : clinical communication
Directory of Open Access Journals (Sweden)
K.G.M. De Cramer
2010-05-01
Full Text Available Pyometra is a common post-oestral syndrome in bitches. Classical treatment consists of either ovariohystorectomy or medical intervention. Surgical uterine drainage and lavage via direct trans-cervical catheterisation using a 5% povidone-iodine in saline solution was performed successfully in 8 bitches with pyometra. All bitches conceived and whelped without complications subsequent to this treatment. It is concluded that this method offers an effective alternative treatment for canine pyometra with shorter recovery times as well as good clinical recovery and pregnancy rates in bitches destined for further breeding.
Directory of Open Access Journals (Sweden)
René Hidalgo Pérez
2012-06-01
Full Text Available El cáncer testicular constituye el 1% de las neoplasias del varón, es el tumor más común en hombres entre 15 y los 35 años, la gran mayoría son malignos. El objetivo del trabajo es presentar el caso de un tumor testicular germinal unilateral de presentación clínica infrecuente diagnosticado por ecografía en un paciente de 37 años, sin antecedentes patológicos personales ni urológicos de interés, que llegó a nuestra consulta remitido por el urólogo por estudio de infertilidad. No refería fiebre, dolor, síntomas urológicos acompañantes ni afectación del estado general, se detectaba al examen físico una tumefacción palpable renitente a nivel del testículo derecho. El testículo izquierdo tenía un tamaño normal y consistencia algo aumentada, muy discretamente doloroso, con un epidídimo de características normales. Durante un estudio ecográfico, por sospecha de varicocele derecho; se visualizó una tumoración testicular contralateral sincrónica (izquierda, de gran tamaño en el testículo de éste lado con un patrón hipoecogénico heterogéneo. Se practicó orquiectomía inguinal izquierda y en el posterior estudio anatomopatológico se confirmó la presencia de la tumoración testicular unilateral componente histológico tipo seminoma.Testicle cancer constitutes 1% of the neoplasms in males; it is the most common tumor in men between 15 and 35 years old, most of them malignant. This paper was aimed at presenting a case of unilateral germinal testicular tumor of an uncommon clinical presentation that was diagnosed by ultrasound in a 37 years old patient, without personal neither pathological nor urologic history of interest, who was referred by the urologist to study his infertility. The patient presented no fever, pain, associated urological symptoms, and his general health status was not either affected. At physical examination a renitent palpable tumor in the right testicle was found. Left testicle showed a normal
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
McNally, Richard J Q; Basta, Nermine O; Errington, Steven; James, Peter W; Norman, Paul D; Hale, Juliet P; Pearce, Mark S
2015-12-01
Previous research from developed countries has shown a marked increase in the incidence of testicular cancer in the past 50 years. This has also been demonstrated in northern England, along with improving 5-year survival. The present study aims to determine if socioeconomic factors may play a role in both etiology and survival from non-seminoma testicular cancer. We extracted all 214 cases of non-seminoma testicular cancer diagnosed in teenage and young adult men aged between 15 and 24 years during 1968 to 2006 from the Northern Region Young Persons' Malignant Disease Registry, which is a population-based specialist regional registry. Negative binomial regression was used to examine the relationship between incidence and both the Townsend deprivation score (and component variables) and small-area population density. Cox regression was used to analyze the relationship between survival and both deprivation and population density. Decreased incidence was associated with living in areas of higher household overcrowding for young adults aged between 20 and 24 years (relative risk per 1% increase in household overcrowding = 0.79; 95% CI: 0.66-0.94) but no association was detected for young people aged between 15 and 19 years. Community-level household unemployment was associated with worse survival (hazard ratio per 1% increase in household unemployment = 1.04; 95% CI: 1.00-1.08). This study has shown that increased risk of non-seminoma testicular cancer in teenage and young adult men may be associated with some aspect of more advantaged living. In contrast, greater deprivation is linked with worse survival prospects. The study was ecological by design and so these area-based results may not necessarily apply to individuals. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Radiation/hyperthermia in canine hemangiopericytomas: A large animal model for therapeutic response
International Nuclear Information System (INIS)
Richardson, R.C.; Anderson, V.L.; Voorhees, W.D. III; Blevins, W.E.; Inskeep, T.K.; Janas, W.; Shupe, R.E.; Babbs, C.F.
1984-01-01
X-irradiation followed by microwave induced hyperthermia resulted in a 91% objective response rate in 11 dogs with naturally occurring hemangiopericytomas. The authors used a novel statistical procedure to quantitatively evaluate the clinical behavior of locally invasive, non-metastatic tumors undergoing therapy for control of local disease. Utilizing a small sample size, the procedure demonstrated distribution of the data and classical parametric and non-parametric statistical methods, including setting confidence limits on the population mean and placing tolerance limits on a population percentage. Similarities of canine and human hemangiopericytomas were observed. Application of the statistical methods to human and animal trials were apparent
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
Directory of Open Access Journals (Sweden)
Gehrckens Ralf
2009-12-01
Full Text Available Abstract Background Vascular complications occurring during cisplatin-based chemotherapy of germ cell tumours are inadequately recognized to date. Case Presentation A 49 year old man with advanced seminoma underwent two courses of chemotherapy according to the PEB regimen. Upon restaging, two thrombotic deposits were noted in the descending part of the thoracic aorta and in the infrarenal abdominal aorta, respectively. Although thrombotic plaques caused aortic occlusion of about 30%, no clinical signs of malperfusion of limbs were registered. The patient was placed on anticoagulant therapy. Six months after completion of chemotherapy, thrombotic deposits had completely resolved. In the absence of other predisposing factors, it must be assumed that cisplatin-based chemotherapy represented a strong stimulus for arterial thrombosis in the aorta. Conclusions This is the first case of endo-aortic thrombosis during chemotherapy for testicular germ cell cancer. Providers of chemotherapy must be aware of arterial thrombosis even in young patients with testicular cancer.
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
Peters, M.A.J.; Mol, J.A.; Wolferen, van M.E.; Oosterlaken-Dijksterhuis, M.A.; Teerds, K.J.; Sluijs, van F.J.
2003-01-01
Testis tumors occur frequently in dogs. The main types of tumors are Sertoli cell tumors, seminomas, and Leydig cell tumors. Mixed tumors and bilateral occurrence of tumors may be encountered frequently. To elucidate the possible relationship between the insulin-like growth factor (IGF) system and
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Giorgio Treglia
2014-01-01
Full Text Available Objective. To meta-analyze published data about the diagnostic performance of fluorine-18-Fluorodeoxyglucose (18F-FDG positron emission tomography (PET and PET/computed tomography (PET/CT in the postchemotherapy management of patients with seminoma. Methods. A comprehensive literature search of studies published through January 2014 on this topic was performed. All retrieved studies were reviewed and qualitatively analyzed. Pooled sensitivity and specificity, positive and negative predictive values (PPV and NPV, accuracy, and area under the summary ROC curve (AUC of 18F-FDG-PET or PET/CT on a per examination-based analysis were calculated. Subgroup analyses considering the size of residual/recurrent lesions were carried out. Results. Nine studies including 375 scans were selected. The pooled analysis provided the following results: sensitivity 78% (95% confidence interval (95% CI: 67–87%, specificity 86% (95% CI: 81–89%, PPV 58% (95% CI: 48–68%, NPV 94% (95% CI: 90–96%, and accuracy 84% (95% CI: 80–88%. The AUC was 0.90. A better diagnostic accuracy of 18F-FDG-PET or PET/CT in evaluating residual/recurrent lesions >3 cm compared to those <3 cm was found. Conclusions. 18F-FDG-PET and PET/CT were demonstrated to be accurate imaging methods in the postchemotherapy management of patients with seminoma; nevertheless possible sources of false-negative and false-positive results should be considered. The literature focusing on this setting still remains limited and cost-effectiveness analyses are warranted.
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
DEFF Research Database (Denmark)
Gueler, B; Sonne, S B; Zimmer, J
2012-01-01
are believed to originate from fetal gonocytes.METHODSDDX3Y protein expression was analysed during development in different tissues by western blotting. The localization of DDX3Y in normal fetal and prepubertal testis tissue of different ages as well as in a series of distinct TGCT tissue samples (CIS......, classical seminoma, spermatocytic seminoma, teratoma and embryonal carcinoma) was performed by immunohistochemistry.RESULTSGerm cell-specific expression of DDX3Y protein was revealed in fetal prospermatogonia but not in gonocytes and not before the 17th gestational week. After birth, DDX3Y was expressed......, but not in somatically differentiated non-seminomas, consistent with its germ-cell specific function.CONCLUSIONSThe fetal germ cell DDX3Y expression suggests a role in early spermatogonial proliferation and implies that, in men with AZFa deletion, germ cell depletion may begin prenatally. The strong expression of DDX3Y...
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Cost-effectiveness of clust X-ray follow-up of patients treated for seminoma of the testis
Energy Technology Data Exchange (ETDEWEB)
Ciatto, S; Cionini, L; Pacini, P
1986-01-01
The authors report on a consecutive series of 253 cases of seminoma of the testis followed with periodic chest X-ray examinations from a minimum of three to a maximum of 27 years. The detection rate of asymptomatic intrathoracic metastases (ITM) was considered together with the costs of the follow-up procedure. Chest X-ray follow-up is not advisable beyound one year from primary treatment, since most (14 of 18) ITM occur in the first year, the detection rate of ITM beyond this date is too low (0.11% patients/year), and the related costs are too high (over $ 130,000 per ITM detected). Chest X-ray follow-up is questionable even in the first year primary treatment for Stage I cases bacause of the low detection rate (1.38 % patients/year) and the high costs (over $ 14,000 per ITM detected), whwreas it appears to be opportune in Stage IIA and IIB.
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Radiotherapy for early stages testicular seminoma: patterns of care study in Germany
International Nuclear Information System (INIS)
Classen, Johannes; Souchon, Rainer; Hehr, Thomas; Bamberg, Michael
2002-01-01
Background and purpose: To evaluate compliance of radiotherapeutic departments with 1997 German consensus guidelines for staging and treatment of testicular cancer patients. Material and methods: A questionnaire was mailed to all departments of radiotherapy in Germany as identified by the data-base of the German Society for Radiation Oncology (DEGRO). The questionnaire was analysed with particular respect to institutional characteristics, frequency of seminoma patients treated per year, treatment techniques, and institutional compliance with consensus guidelines. Results: Fifty-six institutions (39%) returned the questionnaire, 46% of which fully complied with consensus guidelines concerning staging requirements. A minimum workup with computed tomography (CT) of abdomen and pelvis, X-ray or CT of the chest and tumour markers was mandatory in 87.5% of the departments. Compliance with the recommended treatment schedule was high in stage I with less than 5% major violations of recommended dose prescription or target volume definition. In stage IIA/B, however, 22.6 and 10.2% of the departments showed major deviations from either standardised treatment target volumes or total doses of irradiation, respectively. Conclusions: Compliance with consensus recommendations in German departments for radiotherapy is satisfactory in many institutions. However, major deviations from treatment guidelines were observed in stage II disease indicating the need for continuous improvement in the quality of testicular cancer patient management
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old
Production and purification of non replicative canine adenovirus type 2 derived vectors.
Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard
2013-12-03
Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Consequences of crown shortening canine teeth in Greenland sled dogs
DEFF Research Database (Denmark)
Kortegaard, H E; Anthony Knudsen, T; Dahl, S
2015-01-01
OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...
Dental anomalies associated with buccally- and palatally-impacted maxillary canines.
Sajnani, Anand K; King, Nigel M
2014-08-01
The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.
SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.
Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi
2017-10-01
Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.
Overexpression of vimentin in canine prostatic carcinoma
DEFF Research Database (Denmark)
Rodrigues, M M P; Rema, A; Gärtner, F
2011-01-01
Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....
Vaccines for Canine Leishmaniasis
Directory of Open Access Journals (Sweden)
Faeze Foroughi-Parvar
2014-01-01
Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.
Upper canine inclination influences the aesthetics of a smile.
Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S
2015-02-01
This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.
Treatment modalities of palatal impacted canines
Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona
2012-01-01
Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...
Oz, A Z; Ciger, S
2018-03-01
The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.
Comprehensive characterization of commercially available canine training aids.
Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A
2014-09-01
Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...
Evaluation of post-vaccination immunity to canine distemper and ...
African Journals Online (AJOL)
SERVER
2007-08-20
Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...
Canine as a biomedical research model: immunological, hematological, and oncological aspects
International Nuclear Information System (INIS)
Shifrine, M.; Wilson, F.D.
1980-01-01
The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies
Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan
2014-06-01
More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year
Directory of Open Access Journals (Sweden)
Sophia Pfahler
Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.
Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).
Christiansen, Per
2008-07-01
The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.
Canine length in wild male baboons: maturation, aging and social dominance rank.
Directory of Open Access Journals (Sweden)
Jordi Galbany
Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki
2012-10-01
The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.
Comparative expression pathway analysis of human and canine mammary tumors
Directory of Open Access Journals (Sweden)
Marconato Laura
2009-03-01
Full Text Available Abstract Background Spontaneous tumors in dog have been demonstrated to share many features with their human counterparts, including relevant molecular targets, histological appearance, genetics, biological behavior and response to conventional treatments. Mammary tumors in dog therefore provide an attractive alternative to more classical mouse models, such as transgenics or xenografts, where the tumour is artificially induced. To assess the extent to which dog tumors represent clinically significant human phenotypes, we performed the first genome-wide comparative analysis of transcriptional changes occurring in mammary tumors of the two species, with particular focus on the molecular pathways involved. Results We analyzed human and dog gene expression data derived from both tumor and normal mammary samples. By analyzing the expression levels of about ten thousand dog/human orthologous genes we observed a significant overlap of genes deregulated in the mammary tumor samples, as compared to their normal counterparts. Pathway analysis of gene expression data revealed a great degree of similarity in the perturbation of many cancer-related pathways, including the 'PI3K/AKT', 'KRAS', 'PTEN', 'WNT-beta catenin' and 'MAPK cascade'. Moreover, we show that the transcriptional relationships between different gene signatures observed in human breast cancer are largely maintained in the canine model, suggesting a close interspecies similarity in the network of cancer signalling circuitries. Conclusion Our data confirm and further strengthen the value of the canine mammary cancer model and open up new perspectives for the evaluation of novel cancer therapeutics and the development of prognostic and diagnostic biomarkers to be used in clinical studies.
IQGAP1 is an oncogenic target in canine melanoma.
Directory of Open Access Journals (Sweden)
Becky H Lee
Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.
Expression and function of survivin in canine osteosarcoma.
Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H
2012-01-01
Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.
National clinical guidelines for management of the palatally ectopic maxillary canine.
Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M
2012-08-01
This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.
Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.
Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka
2016-07-01
Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.
Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.
Directory of Open Access Journals (Sweden)
Emily J Shields
Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique
Directory of Open Access Journals (Sweden)
Julieta Zacarias
2016-07-01
Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique
Management of an Unusual Ectopic Eruption of Maxillary Canine.
Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula
2017-05-01
Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.
Cardiac involvement in canine babesiosis : review article
Directory of Open Access Journals (Sweden)
R.G. Lobetti
2005-06-01
Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.
The Ondersteport Canine distemper virus strain and measles ...
African Journals Online (AJOL)
Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...
Management of an impacted and transposed maxillary canine
Directory of Open Access Journals (Sweden)
Deepti A
2010-03-01
Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.
Aspects and clinical procedures of eruptive changes of permanent upper canines
Directory of Open Access Journals (Sweden)
Sheila Marcia Francisco
2012-04-01
Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.
A randomized clinical study of two interceptive approaches to palatally displaced canines.
Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela
2008-08-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.
International Nuclear Information System (INIS)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-01-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed
Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.
Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul
2017-02-01
The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Canine detection of free-ranging brown treesnakes on Guam
Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.
2011-01-01
We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.
Cryopreservation of microencapsulated canine sperm.
Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu
2011-03-01
The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Renata Madureira
2017-08-01
Full Text Available Foi atendido na rotina clínica de um hospital veterinário, um cão, macho, da raça Schnauzer, criptorquida com massa em canal inguinal direito. Durante o procedimento cirúrgico para a retirada da massa, foi encontrada uma formação tubular a qual fazia a ligação entre essa massa e o testículo esquerdo. A análise histopatológica concluiu que a formação tubular tratava-se de tubas uterinas, a massa era o testículo direito com seminoma e sertolioma e o testículo esquerdo apresentava atrofia. A avaliação citogenética revelou cromossomos normais, do sexo masculino, 78, XY concluindo que se tratava de um pseudo-hermafrodita masculino.
Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2006-01-01
Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.
Management of impacted all canines with surgical exposure and alignment by orthodontic treatment
Directory of Open Access Journals (Sweden)
Radha Katiyar
2013-01-01
Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.
FLT3 mutations in canine acute lymphocytic leukemia
International Nuclear Information System (INIS)
Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L
2011-01-01
FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias
Vaccine-induced canine distemper in a lesser panda.
Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J
1976-11-01
A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.
Alpha-1-antitrypsin studies: canine serum and canine surfactant protein
International Nuclear Information System (INIS)
Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.
1974-01-01
Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)
Canine hip dysplasia: significance of early bony spurring
International Nuclear Information System (INIS)
Morgan, J.P.
1987-01-01
It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head
Radiographic assessment of dental anomalies in patients with ectopic maxillary canines
DEFF Research Database (Denmark)
Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul
2008-01-01
dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...
Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.
Directory of Open Access Journals (Sweden)
Da-Wei Yao
2014-06-01
Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.
The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D
Directory of Open Access Journals (Sweden)
Markéta Vaňková
2016-01-01
Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Directory of Open Access Journals (Sweden)
Sumitra
2012-01-01
Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.
Prostate histotripsy for BPH: initial canine results
Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.
2009-02-01
Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.
Difficulties in estimating the human burden of canine rabies.
Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H
2017-01-01
Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
CANINE BUTTERFLY GLIOBLASTOMAS: A NEURORADIOLOGICAL REVIEW
Directory of Open Access Journals (Sweden)
John Henry Rossmeisl
2016-05-01
Full Text Available In humans, high-grade gliomas may infiltrate across the corpus callosum resulting in bihemispheric lesions that may have symmetrical, winged-like appearances. This particular tumor manifestation has been coined a ‘butterfly’ glioma (BG. While canine and human gliomas share many neuroradiological and pathological features, the BG morphology has not been previously reported in dogs. Here we describe the magnetic resonance imaging (MRI characteristics of BG in three dogs, and review the potential differential diagnoses based on neuroimaging findings. All dogs presented with generalized seizures and interictal neurological deficits referable to multifocal or diffuse forebrain disease. MRI examinations revealed asymmetrical (2/3 or symmetrical (1/3, bihemispheric intra-axial mass lesions that predominantly affected the frontoparietal lobes and associated with extensive perilesional edema, and involvement of the corpus callosum. The masses displayed heterogeneous T1, T2, and FLAIR signal intensities, variable contrast enhancement (2/3, and mass effect. All tumors demonstrated classical histopathological features of glioblastoma (GBM including glial cell pseudopalisading, serpentine necrosis, microvascular proliferation, as well as invasion of the corpus callosum by neoplastic astrocytes. Although rare, GBM should be considered a differential diagnosis in dogs with MRI evidence of asymmetric or symmetric bilateral, intra-axial cerebral mass lesions with signal characteristics compatible with glioma.
Energy Technology Data Exchange (ETDEWEB)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-10-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.
Lotspeich, Erica; Kitts, Kelley; Goodpaster, John
2012-07-10
It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).
Glickman, L T; Appel, M J
1981-08-01
Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.
Current practices and research updates on diabetes mellitus in canine
Directory of Open Access Journals (Sweden)
Pankaj Kumar
2014-11-01
Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.
Eruption of the maxillary canines in relation to skeletal maturity.
Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica
2008-05-01
Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.
Citizen science: a new direction in canine behavior research.
Hecht, Julie; Spicer Rice, Eleanor
2015-01-01
Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.
Antiviral effect of lithium chloride on infection of cells by canine parvovirus.
Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun
2015-11-01
Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.
Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe
2018-04-01
Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.
Ultrasonographic evaluation of the canine shoulder.
Long, C D; Nyland, T G
1999-01-01
The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.
The Comparative Diagnostic Features of Canine and Human Lymphoma
Directory of Open Access Journals (Sweden)
Davis M. Seelig
2016-06-01
Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
The Comparative Diagnostic Features of Canine and Human Lymphoma.
Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A
2016-06-01
The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
Directory of Open Access Journals (Sweden)
Shalini Gupta
2014-01-01
Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.
[Nonsurgical endodontic treatment of an invaginated canine].
Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P
1989-01-01
We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.
Canine babesiosis: from molecular taxonomy to control
Directory of Open Access Journals (Sweden)
Irwin Peter J
2009-03-01
Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.
Genetic characterization of canine influenza A virus (H3N2) in Thailand.
Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn
2014-02-01
In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.
Glucosamine and chondroitin use in canines for osteoarthritis: A ...
African Journals Online (AJOL)
Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...
A case of unusual root morphology: Maxillary canine with two roots
Directory of Open Access Journals (Sweden)
Nagesh Bolla
2009-01-01
Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E
2016-11-01
The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of
Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.
von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H
2008-05-01
Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.
Orthodontic Traction of Impacted Canine Using Cantilever
Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé
2016-01-01
The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...
Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon
2016-02-01
To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Detection of canine pneumovirus in dogs with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe
2013-12-01
Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.
Directory of Open Access Journals (Sweden)
Patil Sandeep S
2012-01-01
Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.
Wilmes, Benedict; Drescher, Dieter
2009-05-01
In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.
Genetics of Human and Canine Dilated Cardiomyopathy
Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...
Orthodontic treatment of a complete transposed impacted maxillary canine
Directory of Open Access Journals (Sweden)
Pi-Huei Liu
2015-03-01
Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.
Directory of Open Access Journals (Sweden)
Herman Michael
2010-01-01
Full Text Available Complete androgen insensitivity is a rare X-linked disorder characterized by a female phenotype in a chromosomally male individual. Malignant transformation of the un-descended testis is a rare phenomena compared to other inter-sex syndromes. This is a case of a 32-year-old female who was diagnosed with androgen insensitivity and presented to the emergency room with pelvic pain. Later the pelvic pain was found to be due to testicular masses, one of which was pure seminoma. We reviewed the literature emphasizing the biochemical and endocrinologic abnormalities leading to the syndrome, as well as the potential for malignant changes of the un-descended testes, diagnosis, and therapeutic management. We discuss the importance of early diagnosis and the consequence associated with misdiagnosis.
International Nuclear Information System (INIS)
Yeoh, E.; O'Brein, P.C.; Razali, M.
1993-01-01
Seventy-seven patients treated with megavoltage irradiation to the paraaortic and/or pelvic nodal areas, for stage I and non-bulky ( 34 years), stage (I vs II) and dose of radiation (≤ 30 Gy vs > 30 Gy), showed none of these variables to have a significant influence on overall survival or on the incidence of late complications. The results of these findings are discussed in the light of recent studies of a surveillance policy following orchidectomy for stage I seminoma of the testis. Given that gastrointestinal toxicity is the major toxicity associated with the treatment of stage I patients, the data from this study should assist clinicians and their patients to arrive at an informed decision regarding adjuvant radiotherapy. 15 refs., 1 tab., 2 figs
Tooth fractures in canine clinical practice
International Nuclear Information System (INIS)
Capik, I.; Ledecky, V.; Sevcik, A.
2001-01-01
Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients
Canine faecal contamination and parasitic risk in the city of Naples (southern Italy
Directory of Open Access Journals (Sweden)
Veneziano Vincenzo
2006-09-01
Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between
Current state of knowledge: the canine gastrointestinal microbiome.
Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S
2012-06-01
Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.
Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis
2014-04-23
Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from
Directory of Open Access Journals (Sweden)
Dennis Andrew Buck
2017-09-01
Full Text Available Introduction: Testicular cancer is the most common malignancy in men aged 15–40 years [Bols et al.: Philadelphia, Wolters Kluwer, Lippincott Williams & Wilkins, 2011]. Its incidence comprises 0.8% of all male cancers worldwide, with a mortality rate of 0.1%. The incidence has nearly doubled from 1975 to 2007 leading to the concern of environmental causes [Thomas: Am J Epidemiol 2013; 178: 1240–1245]. Testicular cancer presents as a painless testicular mass without transillumination. Testicular cancer is subcategorized under germ cell testicular cancer or sex cord-stromal tumors. Of the germ cell tumors, approximately 90% originate in the testis, with the other 10% being extragonadal [Bols et al.: Philadelphia, Wolters Kluwer, Lippincott Williams & Wilkins, 2011]. Typically, if a patient presents with a testicular mass and is 50 years old or older, the diagnosis of a primary lymphoma is considered until proven otherwise [Bols et al.: Philadelphia, Wolters Kluwer, Lippincott Williams & Wilkins, 2011]. Germ cell testicular cancer is further divided into the subtypes of seminomatous and nonseminomatous; each presents with a unique histology and differing treatment implications. Discussion: Given the uniqueness of our patient’s metachronous second testicular primary, we sought to compare our case findings to available historic publications. We sought to address the issues of the incidence of a second primary testicular malignancy with regard to varying histology, age of incidence, and timing of a second primary testicular cancer, the presence of bowel involvement, and finally a brief discussion of testosterone replacement therapy. Conclusion: A review of our case presents several unique factors. The above varying literature has shown our patient to have met the odds of a contralateral testicular primary development in that he had a nonseminomatous primary, followed by a second testicular primary seminoma. Our patient exceeded the 15-year
Buck, Dennis Andrew; Smith, Tristan Dean; Montana, Wilbur Nelson
2017-01-01
Testicular cancer is the most common malignancy in men aged 15-40 years [Bols et al.: Philadelphia, Wolters Kluwer, Lippincott Williams & Wilkins, 2011]. Its incidence comprises 0.8% of all male cancers worldwide, with a mortality rate of 0.1%. The incidence has nearly doubled from 1975 to 2007 leading to the concern of environmental causes [Thomas: Am J Epidemiol 2013; 178: 1240-1245]. Testicular cancer presents as a painless testicular mass without transillumination. Testicular cancer is subcategorized under germ cell testicular cancer or sex cord-stromal tumors. Of the germ cell tumors, approximately 90% originate in the testis, with the other 10% being extragonadal [Bols et al.: Philadelphia, Wolters Kluwer, Lippincott Williams & Wilkins, 2011]. Typically, if a patient presents with a testicular mass and is 50 years old or older, the diagnosis of a primary lymphoma is considered until proven otherwise [Bols et al.: Philadelphia, Wolters Kluwer, Lippincott Williams & Wilkins, 2011]. Germ cell testicular cancer is further divided into the subtypes of seminomatous and nonseminomatous; each presents with a unique histology and differing treatment implications. Given the uniqueness of our patient's metachronous second testicular primary, we sought to compare our case findings to available historic publications. We sought to address the issues of the incidence of a second primary testicular malignancy with regard to varying histology, age of incidence, and timing of a second primary testicular cancer, the presence of bowel involvement, and finally a brief discussion of testosterone replacement therapy. A review of our case presents several unique factors. The above varying literature has shown our patient to have met the odds of a contralateral testicular primary development in that he had a nonseminomatous primary, followed by a second testicular primary seminoma. Our patient exceeded the 15-year cumulative risk of contralateral metachronous testicular cancer of 1
Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study
Directory of Open Access Journals (Sweden)
Zeeshan Iqbal Bhat
2013-01-01
Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.
Directory of Open Access Journals (Sweden)
Laura Nordio
2017-05-01
Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.
Models of experimental saccular aneurysms of carotid arteries in canine
International Nuclear Information System (INIS)
Zhang Haixia; Cheng Yingsheng; Li Minghua
2006-01-01
Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)
Testosterone biotransformation by the isolated perfused canine pancreas
International Nuclear Information System (INIS)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis
Testosterone biotransformation by the isolated perfused canine pancreas
Energy Technology Data Exchange (ETDEWEB)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.
Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations
Directory of Open Access Journals (Sweden)
Steiner JM
2014-10-01
Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test
Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.
Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H
2006-02-01
The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Sumitra
2012-01-01
A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M
2018-01-01
Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Directory of Open Access Journals (Sweden)
Cecilia M Lopez
Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
Homologous radioimmunoassay for canine prolactin and its application in various physiological states
International Nuclear Information System (INIS)
Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.
1977-01-01
The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)
Prevalence and epidemiology of canine and feline heartworm infection in Taiwan.
Lu, Ta-Li; Wong, Jun-Yue; Tan, Ta-Lun; Hung, Yong-Wei
2017-11-09
-positive cats, 6 of them were also antigen-positive. In 19 antigen-positive cats, 13 of them were antibody negative. In antibody-positive and antigen-negative cats, half had no clinical signs. In antigen-positive cats, 21% had no clinical signs and only 38% had classic heartworm clinical signs (dyspnea, cough, or gastrointestinal signs). Our canine study showed that southern and eastern Taiwan have the highest heartworm prevalence. Dogs not receiving preventive and living outdoors or those that have either cough or dyspnea have a high incidence of heartworm infection. We also confirmed that feline heartworm exposure exists in most cities in Taiwan. The diagnosis of feline heartworm infection will remain challenging for clinicians, however, without a consistent relationship between the presence of heartworm infection and clinical signs and the vagaries of microfilaria and antigen/antibody testing.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus
Directory of Open Access Journals (Sweden)
Lourdes M. B. Pessoa
2016-01-01
Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)
Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de
2016-01-01
The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.
Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-10-01
Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique.
Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G
2016-07-15
Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.
International Nuclear Information System (INIS)
Bauchinger, M.; Schmid, E.; Braselmann, H.; Willich, N.; Clemm, C.
1989-01-01
The time-effect relationship of dicentrics and cells containing unstable chromosome abnormalities C u cells) was studied in peripheral lymphocytes of 40 blood samples from 23 suffering from seminoma during a time period of 0-1720 days after radiation therapy. Nine patients were studied before treatment. Since the half-time for the disappearance of damaged cells from circulating blood is an increasing function of post-exposure time it can only be expressed as a differential value. The present model discriminates between the mean lifetime m for lymphocytes and a parameter q which is the differential half-time for the decline of damaged cells immediately after exposure (t=0). If the time t is hort compared with m the decline is asymptotically time-hyperbolic rather than exponential and can be described by q only. According to recalculations of previous data, comprising 30 years post exposure, m approximates 10 years. Differential half-times can be derived for any time post treatment within the analysed time period for the decline of the incidence of dicentrics. For example at the end of therapy (t=0) the differential half-time was calculated to be 0.4 years and at 1720 days post exposure 3.6 years resulted. The corresponding values for the percentage of C u cells cannot be derived for t=0; at 1720 days 3.9 years resulted. (author). 13 refs.; 3 figs.; 3 tabs
[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].
Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng
2009-09-01
To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.
Cellular endocytic compartment localization of expressed canine CD1 molecules
DEFF Research Database (Denmark)
Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.
2016-01-01
CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....
Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.
Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna
2015-01-01
Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.
Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines
Directory of Open Access Journals (Sweden)
Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman
2011-01-01
Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.
Orthodontic management of bilaterally impacted mandibular canines in a growing patient
Directory of Open Access Journals (Sweden)
Rajaganesh J Gautam
2016-01-01
Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
Energy Technology Data Exchange (ETDEWEB)
Mazonakis, Michalis, E-mail: mazonak@med.uoc.gr; Damilakis, John [Department of Medical Physics, Faculty of Medicine, University of Crete, P.O. Box 2208, Iraklion, Crete 71003 (Greece); Varveris, Charalambos; Lyraraki, Efrossyni [Department of Radiotherapy and Oncology, University Hospital of Iraklion, Iraklion, Crete 71110 (Greece)
2015-11-15
Purpose: The aim of the current study was to (a) calculate the organ equivalent dose (OED) and (b) estimate the associated second cancer risk to partially in-field critical structures from adjuvant radiotherapy for stage I seminoma of the testis on the basis of three different nonlinear risk models. Methods: Three-dimensional plans were created for twelve patients who underwent a treatment planning computed tomography of the abdomen. The plans for irradiation of seminoma consisted of para-aortic anteroposterior and posteroanterior fields giving 20 Gy to the target site with 6 MV photons. The OED of stomach, colon, liver, pancreas, and kidneys, that were partially included in the treatment volume, was calculated using differential dose–volume histograms. The mechanistic, bell-shaped, and plateau models were employed for these calculations provided that organ-specific parameters were available for the subsequent assessment of the excess absolute risk (EAR) for second cancer development. The estimated organ-specific lifetime risks were compared with the respective nominal intrinsic probabilities for cancer induction. Results: The mean OED, which was calculated from the patients’ treatment plans, varied from 0.54 to 6.61 Gy by the partially in-field organ of interest and the model used for dosimetric calculations. The difference between the OED of liver derived from the mechanistic model with those from the bell-shaped and plateau models was less than 1.8%. An even smaller deviation of 1.0% was observed for colon. For the rest organs of interest, the differences between the OED values obtained by the examined models varied from 8.6% to 50.0%. The EAR for stomach, colon, liver, pancreas, and kidney cancer induction at an age of 70 yr because of treatment of a typical 39-yr-old individual was up to 4.24, 11.39, 0.91, 3.04, and 0.14 per 10 000 persons-yr, respectively. Patient’s irradiation was found to elevate the lifetime intrinsic risks by 8.3%–63.0% depending
Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.
McMaster, G K; Tratschin, J D; Siegl, G
1981-01-01
The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.
Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus
Directory of Open Access Journals (Sweden)
Sudarisman
2006-03-01
Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.
Comparative photoelastic study of dental and skeletal anchorages in the canine retraction
Directory of Open Access Journals (Sweden)
Cristiane Aparecida de Assis Claro
2014-01-01
Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.
Sajnani, Anand K
2015-02-01
The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Mann, Elizabeth; Whittington, Lisa
2014-01-01
Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Directory of Open Access Journals (Sweden)
Moges Woldemeskel
2014-11-01
Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.
How far is the root apex of a unilateral impacted canine from the root apices' arch form?
Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il
2017-02-01
The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Automated tru-cut imaging-guided core needle biopsy of canine ...
African Journals Online (AJOL)
The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...
Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E
2014-05-01
Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1) mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Feline and canine coronaviruses: common genetic and pathobiological features.
Le Poder, Sophie
2011-01-01
A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Directory of Open Access Journals (Sweden)
Otávio Valério Carvalho
2012-01-01
Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo
2012-01-01
Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403
Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia
Directory of Open Access Journals (Sweden)
Víctor Acero P
2015-09-01
Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.
Compensatory canine angulation in angle Class II and III patients
Directory of Open Access Journals (Sweden)
Mauro Carlos Agner Busato
2009-09-01
Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.
Gossellin, J; Wren, J A; Sunderland, S J
2007-08-01
Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.
Peracute Infectious Canine Hepatitis
Directory of Open Access Journals (Sweden)
A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam
2012-05-01
Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.
Radioresistant canine hematopoietic cells
International Nuclear Information System (INIS)
Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.
1987-01-01
Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells
Origgi, F C; Plattet, P; Sattler, U; Robert, N; Casaubon, J; Mavrot, F; Pewsner, M; Wu, N; Giovannini, S; Oevermann, A; Stoffel, M H; Gaschen, V; Segner, H; Ryser-Degiorgis, M-P
2012-11-01
An ongoing canine distemper epidemic was first detected in Switzerland in the spring of 2009. Compared to previous local canine distemper outbreaks, it was characterized by unusually high morbidity and mortality, rapid spread over the country, and susceptibility of several wild carnivore species. Here, the authors describe the associated pathologic changes and phylogenetic and biological features of a multiple highly virulent canine distemper virus (CDV) strain detected in and/or isolated from red foxes (Vulpes vulpes), Eurasian badgers (Meles meles), stone (Martes foina) and pine (Martes martes) martens, from a Eurasian lynx (Lynx lynx), and a domestic dog. The main lesions included interstitial to bronchointerstitial pneumonia and meningopolioencephalitis, whereas demyelination--the classic presentation of CDV infection--was observed in few cases only. In the brain lesions, viral inclusions were mainly in the nuclei of the neurons. Some significant differences in brain and lung lesions were observed between foxes and mustelids. Swiss CDV isolates shared together with a Hungarian CDV strain detected in 2004. In vitro analysis of the hemagglutinin protein from one of the Swiss CDV strains revealed functional and structural differences from that of the reference strain A75/17, with the Swiss strain showing increased surface expression and binding efficiency to the signaling lymphocyte activation molecule (SLAM). These features might be part of a novel molecular signature, which might have contributed to an increase in virus pathogenicity, partially explaining the high morbidity and mortality, the rapid spread, and the large host spectrum observed in this outbreak.
Surgical innovations in canine gonadectomy
Van Goethem, Bart
2016-01-01
In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated
Response of the seminiferous epithelium to scattered radiation in seminoma patients
International Nuclear Information System (INIS)
Schlappack, O.K.; Kratzik, C.; Schmidt, W.; Spona, J.; Schuster, E.
1988-01-01
Semen and blood samples were obtained, at 3-month intervals over 12 to 28 months, from patients who underwent subdiaphragmal radiation after orchidectomy for seminoma testis. Before radiotherapy a mean (+/- SE) semen volume of 4.7 +/- 0.5 ml, a mean sperm count of 44.4 +/- 13.5 x 10(6)/ml, a mean percentage of motile cells of 20.3 +/- 5.2, a mean percentage of morphologically normal spermatozoa of 13.4 +/- 5.4, a mean percentage of swollen sperm of 39.6 +/- 7.4, and a mean serum follicle-stimulating hormone (FSH) value of 8.3 +/- 1.2 mIU/ml was found. The mean testicular dose from scatter was 62 +/- 5 cGy (range, 34 to 95 cGy). Sperm counts between 0 and 2.75 x 10(6)/ml were seen at 6.8 +/- 0.6 months and recovery to values greater than 2.25 x 10(6)/ml at 11.8 +/- 0.8 months after the start of radiation. Peak FSH values of 19.2 +/- 1.6 mIU/ml were obtained at 6.7 +/- 0.9 months after the start of irradiation. After recovery mean semen volume was 3.9 +/- 0.4 ml, mean sperm count 34.6 +/- 5.6 x 10(6)/ml, the mean percentage of motile cells 42.5 +/- 6.0, the mean percentage of swollen sperm 58.7 +/- 6.8, and the mean percentage of spermatozoa with normal morphology 23.4 +/- 5.1. Only motility was significantly different (P less than 0.01) from pretreatment values. The elevation of FSH values with time after start of radiotherapy reflected the toxicity to spermatogenesis but no correlation was found between peak FSH levels and scattered radiation dose. Also, neither the time from start of radiotherapy to sperm count nadir or recovery nor the time to peak FSH levels was significantly correlated with radiation dose
Stahl, Franka; Grabowski, Rosemarie
2003-05-01
The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features
Directory of Open Access Journals (Sweden)
Sophie Le Poder
2011-01-01
Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY
HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ
1993-01-01
A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of
Laparoscopic radical prostatectomy in the canine model.
Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M
1996-12-01
The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.
Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew
2011-11-01
Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.
Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola
2014-07-01
An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Functional Characterization of Canine Interferon-Lambda
Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun
2014-01-01
In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142
Maxillary canine impactions related to impacted central incisors: two case reports.
Bayram, Mehmet; Ozer, Mete; Sener, Ismail
2007-09-01
The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by
Orthodontic treatment of a stubborn palatally ectopic canine: a case report.
Al-Musfir, Tumadher M; Morris, David O
2014-03-01
This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.
Successful experimental challenge of dogs with canine parvovirus-2.
Carman, S; Povey, C
1982-01-01
Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...
Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan
2014-01-01
Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...
Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.
Kemoli, Arthur Musakulu; Junior, Thomas Munyao
2017-01-01
Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
Recent advances in canine leptospirosis: focus on vaccine development
Directory of Open Access Journals (Sweden)
Klaasen HLBM
2015-06-01
Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis
Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.
Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K
2017-07-01
This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.
Impacted canines: Etiology, diagnosis, and orthodontic management
Directory of Open Access Journals (Sweden)
Ranjit Manne
2012-01-01
Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.
Leigh, S R; Jungers, W L
1994-12-01
A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.
Construction of classical and non-classical coherent photon states
International Nuclear Information System (INIS)
Honegger, Reinhard; Rieckers, Alfred
2001-01-01
It is well known that the diagonal matrix elements of all-order coherent states for the quantized electromagnetic field have to constitute a Poisson distribution with respect to the photon number. The present work gives first the summary of a constructive scheme, developed previously, which determines in terms of an auxiliary Hilbert space all possible off-diagonal elements for the all-order coherent density operators in Fock space and which identifies all extremal coherent states. In terms of this formalism it is then demonstrated that each pure classical coherent state is a uniformly phase locked (quantum) coherent superposition of number states. In a mixed classical coherent state the exponential of the locked phase is shown to be replaced by a rather arbitrary unitary operator in the auxiliary Hilbert space. On the other hand classes for density operators--and for their normally ordered characteristic functions--of non-classical coherent states are obtained, especially by rather weak perturbations of classical coherent states. These illustrate various forms of breaking the classical uniform phase locking and exhibit rather peculiar properties, such as asymmetric fluctuations for the quadrature phase operators. Several criteria for non-classicality are put forward and applied to the elaborated non-classical coherent states, providing counterexamples against too simple arguments for classicality. It is concluded that classicality is only a stable concept for coherent states with macroscopic intensity
Classical, Semi-classical and Quantum Noise
Poor, H; Scully, Marlan
2012-01-01
David Middleton was a towering figure of 20th Century engineering and science and one of the founders of statistical communication theory. During the second World War, the young David Middleton, working with Van Fleck, devised the notion of the matched filter, which is the most basic method used for detecting signals in noise. Over the intervening six decades, the contributions of Middleton have become classics. This collection of essays by leading scientists, engineers and colleagues of David are in his honor and reflect the wide influence that he has had on many fields. Also included is the introduction by Middleton to his forthcoming book, which gives a wonderful view of the field of communication, its history and his own views on the field that he developed over the past 60 years. Focusing on classical noise modeling and applications, Classical, Semi-Classical and Quantum Noise includes coverage of statistical communication theory, non-stationary noise, molecular footprints, noise suppression, Quantum e...
Dereure, Jacques; Vanwambeke, Sophie O; Malé, Pierre; Martinez, Susana; Pratlong, Francine; Balard, Yves; Dedet, Jean-Pierre
2009-12-01
In 1994, an ecoepidemiologic study was carried out in the mid-Ariège valley (French Pyrenees) where autochthonous cases of canine leishmaniasis had been previously reported. Serologic samples were collected from 336 dogs in two groups of villages. The seroprevalences were 11.67% in the valley villages and only 1.43% in the foothill villages. Five lymph node biopsies were taken from serologically positive dogs, and resultant isolates were identified as Leishmania infantum zymodeme MON-1. Phlebotomine sandflies were collected in five locations by CDC light traps. Both of the known French vectors, Phlebotomus ariasi and P. perniciosus, were identified. Bioclimatic and floristic studies showed that this area is an enclave of the supra-Mediterranean climatic zone, containing a typically xerothermophilic Mediterranean flora. The Pyrenees Mountains are usually considered to be outside of the endemic range of leishmaniasis in southern France, and so our demonstration of a microfocus of canine leishmaniasis in the northern foothills is noteworthy. A second serologic survey carried out in 2007 (216 dogs) showed an inversion of the seropositive rates between the two groups of villages compared with those of 1994: only 2.72% in the valley villages and 11.32% in the foothills villages. The decrease of seroprevalence in the first area (valley villages) can be related to a considerable use of deltamethrin collars during the transmission season. The increase of seroprevalence of the foothill villages could be related to climatic conditions, since there was an increase of about 1 degrees C in the mean annual temperature.
Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.
Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P
2014-01-21
The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Identification and function analysis of canine stimulator of interferon gene (STING).
Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong
2017-12-01
Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population
Directory of Open Access Journals (Sweden)
Fouad Ayoub
2014-01-01
Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.
Increasing Incidence of Canine Leptospirosis in Switzerland
Directory of Open Access Journals (Sweden)
Andrea Major
2014-07-01
Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.
Directory of Open Access Journals (Sweden)
Jennifer Ann Foltz
2016-11-01
Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.
Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers
van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.
2012-01-01
In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic
2013-05-21
...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...
Directory of Open Access Journals (Sweden)
Kimon C. Kanelakis
2009-01-01
Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.
Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S
2016-06-01
The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.
Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.
Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F
2015-03-01
We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.
An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.
Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A
2011-12-01
To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.
Bilateral second premolars agenesia together with a unilateral canine radiculomegaly
Directory of Open Access Journals (Sweden)
Arthur Musakulu Kemoli
2017-01-01
Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
In vitro development of canine somatic cell nuclear transfer embryos in different culture media.
Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea
2015-01-01
The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.
K-RAS and N-RAS mutations in testicular germ cell tumors
Directory of Open Access Journals (Sweden)
Bekir Muhammet Hacioglu
2017-05-01
Full Text Available Testicular cancer is a relatively rare tumor type, accounting for approximately 1% of all cancers in men. However, among men aged between 15 and 40 years, testicular cancer is the most commonly diagnosed malignancy. Testicular germ cell tumors (TGCTs are classified as seminoma and non-seminoma. The RAS oncogene controls several cellular functions, including cell proliferation, apoptosis, migration, and differentiation. Thus, RAS signaling is important for normal germ cell development. Mutations of the Kirsten RAS (K-RAS gene are present in over 20% of all cancers. RAS gene mutations have also been reported in TGCTs. We investigated K-RAS and N-RAS mutations in seminoma and non-seminoma TGCT patients. A total of 24 (55% pure seminoma cases and 19 (45% non-seminoma cases were included in the study. K-RAS and N-RAS analyses were performed in our molecular pathology laboratory, using K-RAS and N-RAS Pyro Kit 24 V1 (Qiagen. In total, a RAS mutation was present in 12 patients (27%: 7 seminoma (29% and 5 non-seminoma cases (26% [p = 0.55]. A K-RAS mutation was present in 4 pure seminoma tumors (16% and 3 non-seminoma tumors (15% [p = 0.63], and an N-RAS mutation was observed in 4 seminoma tumors (16% and 3 non-seminoma tumors (15% [p = 0.63]. Both, K-RAS and N-RAS mutations were present in two patients: one with seminoma tumor and the other with non-seminoma tumor. To date, no approved targeted therapy is available for the treatment of TGCTs. The analysis of K-RAS and N-RAS mutations in these tumors may provide more treatment options, especially in platinum-resistant tumors.
Directory of Open Access Journals (Sweden)
Deli Liu
2015-06-01
Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.
Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis
Directory of Open Access Journals (Sweden)
Jill Narak
2015-01-01
Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.
Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu
2011-10-01
The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.
Collett, A R; Fletcher, B
2000-12-01
A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.
"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.
Kranz, William D; Strange, Nicholas A; Goodpaster, John V
2014-12-01
Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.
Morphological study of maxillary canine region based on CT
International Nuclear Information System (INIS)
Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi
2010-01-01
The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)
Bertram, Christof A; Gurtner, Corinne; Dettwiler, Martina; Kershaw, Olivia; Dietert, Kristina; Pieper, Laura; Pischon, Hannah; Gruber, Achim D; Klopfleisch, Robert
2018-07-01
Integration of new technologies, such as digital microscopy, into a highly standardized laboratory routine requires the validation of its performance in terms of reliability, specificity, and sensitivity. However, a validation study of digital microscopy is currently lacking in veterinary pathology. The aim of the current study was to validate the usability of digital microscopy in terms of diagnostic accuracy, speed, and confidence for diagnosing and differentiating common canine cutaneous tumor types and to compare it to classical light microscopy. Therefore, 80 histologic sections including 17 different skin tumor types were examined twice as glass slides and twice as digital whole-slide images by 6 pathologists with different levels of experience at 4 time points. Comparison of both methods found digital microscopy to be noninferior for differentiating individual tumor types within the category epithelial and mesenchymal tumors, but diagnostic concordance was slightly lower for differentiating individual round cell tumor types by digital microscopy. In addition, digital microscopy was associated with significantly shorter diagnostic time, but diagnostic confidence was lower and technical quality was considered inferior for whole-slide images compared with glass slides. Of note, diagnostic performance for whole-slide images scanned at 200× magnification was noninferior in diagnostic performance for slides scanned at 400×. In conclusion, digital microscopy differs only minimally from light microscopy in few aspects of diagnostic performance and overall appears adequate for the diagnosis of individual canine cutaneous tumors with minor limitations for differentiating individual round cell tumor types and grading of mast cell tumors.
Pathophysiology, diagnosis, and treatment of canine hip dysplasia
International Nuclear Information System (INIS)
Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.
1996-01-01
Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education
Does contemporary canine diet cause cancer? ; A review
Directory of Open Access Journals (Sweden)
Joseph B Gentzel
2013-07-01
Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer
Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing
2014-06-01
The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.
Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.
Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D
2014-12-01
Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
Electroencephalography as a diagnostic technique for canine neurological diseases
Directory of Open Access Journals (Sweden)
Wrzosek Marcin
2016-06-01
Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.
Ascorbic acid: Nonradioactive extracellular space marker in canine heart
International Nuclear Information System (INIS)
Reil, G.H.; Frombach, R.; Kownatzki, R.; Quante, W.; Lichtlen, P.R.
1987-01-01
The distribution pattern of ascorbic acid and L-[ 14 C]ascorbic acid in myocardial tissue was compared with those of the classical radioactive extracellular space markers [ 3 H]-inulin, [ 3 H]sucrose, and Na 82 Br. A new polarographic techniques was developed for analogue registration of ascorbic acid concentration in coronary venous blood. The kinetic data of the markers were studied in an open-chest canine heart preparation during a constant tracer infusion of up to 9 min. Distribution volumes were calculated based on the mean transit time method of Zierler. The distribution volume of ascorbic acid as well as of L-[ 14 C]ascorbic acid in myocardial tissue agreed closely with those of [ 3 H]inulin and [ 3 H]sucrose as well as 82 Br. The obtained kinetic data confirmed that ascorbic acid exhibits the physicochemical properties of an extracellular space marker, though this compound was shown to leak slowly into myocardial cells. Favorable attributes of this indicator are its low molecular weight, high diffusibility in interstitial fluid, low binding affinity to macromolecules, and high transcapillary as well as low transplasmalemmal penetration rate. Therefore, this nonradioactive marker can be applied in a safe and simple fashion, and without untoward side effects in experimental animals as well as in patients
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model
International Nuclear Information System (INIS)
Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na
2009-01-01
Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)
A survey of canine tick-borne diseases in India
Directory of Open Access Journals (Sweden)
Coleman Glen T
2011-07-01
Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.
New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins
Directory of Open Access Journals (Sweden)
J. Michael Plavcan
2012-03-01
Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I
2013-06-13
Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data
Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei
2013-01-01
Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666
Directory of Open Access Journals (Sweden)
Jiexia Wen
2013-01-01
Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.
3D enamel thickness in Neandertal and modern human permanent canines.
Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano
2017-12-01
Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K
2011-04-09
Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.
Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O
2018-01-01
Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA
Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O
2018-01-01
Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647
Canine Detection of Illict Drugs: Sensory Apparatus Technology
National Research Council Canada - National Science Library
Morrison, Edward
2000-01-01
This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...
Coryneform bacteria associated with canine otitis externa
DEFF Research Database (Denmark)
Aalbæk, Bent; Bemis, David A.; Schjærff, Mette
2010-01-01
This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...
Antigenic typing Polish isolates of canine parvovirus
Energy Technology Data Exchange (ETDEWEB)
Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)
1995-12-31
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.
Antigenic typing Polish isolates of canine parvovirus
International Nuclear Information System (INIS)
Mizak, B.; Plucienniczak, A.
1995-01-01
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs
Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A
2006-01-01
The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.
Soriano Sarrió, Pilar; Chirivella, Isabel; Navarro Fos, Samuel
2008-06-01
The existence of non seminomatous mixed germ cell tumors of the testis is a frequent event in urologic oncology. Nevertheless, the presence of both components, seminomatous and non seminomatous, in a germ cell tumor is unusual. We present a case of pure classic seminoma of the testis with a lymph node metastasis of pure embryonal carcinoma, with confirmatory immuohistochemical study and clinical outcome of the patient. A 34-year-old man presented with 3 cm supraclavicular tumor. CT scan also revealed multiple metastases in lymph nodes, liver, kidney and left adrenal gland. Tumor markers were negative and the biopsy performed discovered a lymph node metastasis of embryonal carcinoma of probable testicular origin. Ultrasound revealed a 6 mm hypoechoic nodule in the right testis. Orchyectomy was performed and pathologic analysis demonstrated a tumor, 1 cm of diameter, histopathologically compatible with classical seminoma with pagetoid extension to rete testis. Albuginea and spermatic cord did not present neoplastic involvement. Currently the patient is being treated with chemotherapy. The interest of the case is to remark an unusual aggressive clinical presentation as well as to perform a bibliographic review with emphasis in the theories regarding heterogeneous differentiation and spontaneous regression of germ cell tumors of the testis.
Directory of Open Access Journals (Sweden)
D S Kothavade
2012-01-01
Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.
Cathepsin K expression and activity in canine osteosarcoma.
Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M
2012-01-01
Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa
Directory of Open Access Journals (Sweden)
Nozyechi Ngulube Chidumayo
2018-02-01
Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.
Canine trypanosomosis: Clinical observations and morphological ...
African Journals Online (AJOL)
Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...
The unerupted maxillary canine - a post-surgical review.
LENUS (Irish Health Repository)
O'Dowling, Ian
2009-10-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
The unerupted maxillary canine--a post-surgical review.
O'Dowling, Ian
2009-01-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
Canine distemper spillover in domestic dogs from urban wildlife.
Kapil, Sanjay; Yeary, Teresa J
2011-11-01
Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.
Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction
Directory of Open Access Journals (Sweden)
Anísio Bueno de Carvalho
2012-12-01
Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS
Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis
International Nuclear Information System (INIS)
Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.
1988-01-01
Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)
International Nuclear Information System (INIS)
Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq
2011-01-01
This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.
A comparative study between mixed-type tumours from human salivary and canine mammary glands
International Nuclear Information System (INIS)
Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D
2007-01-01
In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations
Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F
2013-09-01
The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.
Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T
1995-06-01
For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.
Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.
Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M
2013-09-01
Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.
Mechanical properties of canine osteosarcoma-affected antebrachia.
Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M
2017-05-01
To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.
Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro
Directory of Open Access Journals (Sweden)
Cintia Xavier de Mello
2014-12-01
Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.
Directory of Open Access Journals (Sweden)
Adina Coșarcă
2014-02-01
Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated
Valley, Lois
1989-01-01
The SPS product, Classic-Ada, is a software tool that supports object-oriented Ada programming with powerful inheritance and dynamic binding. Object Oriented Design (OOD) is an easy, natural development paradigm, but it is not supported by Ada. Following the DOD Ada mandate, SPS developed Classic-Ada to provide a tool which supports OOD and implements code in Ada. It consists of a design language, a code generator and a toolset. As a design language, Classic-Ada supports the object-oriented principles of information hiding, data abstraction, dynamic binding, and inheritance. It also supports natural reuse and incremental development through inheritance, code factoring, and Ada, Classic-Ada, dynamic binding and static binding in the same program. Only nine new constructs were added to Ada to provide object-oriented design capabilities. The Classic-Ada code generator translates user application code into fully compliant, ready-to-run, standard Ada. The Classic-Ada toolset is fully supported by SPS and consists of an object generator, a builder, a dictionary manager, and a reporter. Demonstrations of Classic-Ada and the Classic-Ada Browser were given at the workshop.
Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs
McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel
1985-01-01
Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution
van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.
2009-01-01
An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact
Nayak, Reshma; Nayak, Us Krishna; Hegde, Gautam
2010-01-01
Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs (80 males and 80 females), of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation between the developmental stages of MP3 and the mandibular right canine in male and female groups, is of high statistical significance (p = 0.001). The correlation coefficient between MP3 stages and developmental stages of mandibular canine and chronological age in male and females was found to be not significant. The correlation between the mandibular canine calcification stages and MP3 stages was found to be significant. The developmental stages of the mandibular canine could be used very reliably as a sole indicator for assessment of skeletal maturity.
Directory of Open Access Journals (Sweden)
Pamela M. Ortiz
2018-01-01
Full Text Available Objectives. To investigate the association between unilateral/bilateral maxillary canine impaction and sella-turcica bridging using CBCT imaging. Methods. This retrospective comparative study analyzed 76 CBCT images of the craniofacial complex including sella-turcica. The impacted cuspid group consisted of thirty-eight subjects (7 males, 31 females; mean age, 14.6 ± 3.2 years diagnosed with unilateral (left n=14, right n=11 or bilateral (n=13 palatal canine impaction. The control group included thirty-eight subjects matched by sex (7 males, 31 females; mean age, 19.5 ± 3.6 years with no impaction. Multinomial logistic regression analysis was used to determine the association between unilateral/bilateral canine impaction and right and left sella-turcica bridging. Results. The prevalence of sella-turcica bridging was 59.3% and 50% in the impacted canine and control groups, respectively. Although the odds for unilateral canine impaction were increased in the right and left sella-turcica bridging groups compared to the controls, the difference was not statistically significant. The risk of bilateral impaction was different between the two sides of sella-turcica bridging, but, again, the findings were not statistically significant. Conclusion. Contrary to previous 2D studies, there is no statistically significant association between unilateral/bilateral palatal canine impaction and sella-turcica bridging when using 3D CBCT.
Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells
Directory of Open Access Journals (Sweden)
Michelle G. Ritt
2015-04-01
Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.
Automation of gender determination in human canines using artificial intelligence
Directory of Open Access Journals (Sweden)
F. Fidya
2017-09-01
Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.
Experimental research of covered stent implanted in canine hepatic artery
International Nuclear Information System (INIS)
Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde
2007-01-01
Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)
Extrusion processing : effects on dry canine diets
Tran, Q.D.
2008-01-01
Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.
Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the
International Nuclear Information System (INIS)
Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.
2011-01-01
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology
Energy Technology Data Exchange (ETDEWEB)
Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)
2011-03-30
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.
Sigler, Lauren M; Baccetti, Tiziano; McNamara, James A
2011-03-01
Our aim was to investigate the effect of rapid maxillary expansion and transpalatal arch therapy combined with deciduous canine extraction on the eruption rate of palatally displaced canines (PDCs) in patients in the late mixed dentition in a 2-center prospective study. Seventy subjects were enrolled based on PDCs diagnosed on panoramic radiographs. The treatment group (TG, 40 subjects) underwent RME followed by TPA therapy and extraction of the deciduous canines. The control group (CG, 30 subjects) received no orthodontic treatment. At the start of the trial, panoramic radiographs and dental casts were compared between the TG and the CG with the Mann-Whitney U test (P anomalies was reported. No statistically significant difference was found for any measurement at the start of the trial between the 2 groups. The prevalence rates of eruption of the maxillary canines were 80% for the TG and 28% in the CG, a statistically significant difference (chi-square =16.26, P mixed dentition with PDCs. Pretreatment variables indicating success of treatment on the eruption of PDCs were less severe sectors of displacement, prepubertal stages of skeletal maturity, and open root apices of PDCs. Several dental anomalies were associated significantly with PDCs, thus confirming the genetic etiology of this eruption disturbance. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
DEFF Research Database (Denmark)
Damborg, Peter; Guardabassi, Luca; Pedersen, Karl
2008-01-01
Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...
To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age.
Malik, Pooja; Rana, Vivek; Rehani, Usha
2012-01-01
The purpose of this study was to assess skeletal age and establish relationship between mandibular canine calcification and skeletal age. The study included 147 females aged 10 to 13 years. The subjects were divided into three groups: Group I-comprising of 10 to 11 years old female; Group II-comprising of 11 to 12 years old female; Group III-12 to 13 years female. OPG and hand and wrist radiographs of left side for each subject were taken with prior consent of their parents. The calcification status of canine was evaluated from orthopantomograms according to scores given in Demirjian's method. The stages of ossification of various carpal bones were evaluated using radiographic atlas of Greulich-Pyle and skeletal age was calculated. Data collected was statistically analyzed. The results drawn from this study showed that a strong correlation was observed for canine calcification stage F for 10 to 11 years and for stage G in 11 to 12 years and 12 to 13 years respectively. How to cite this article: Malik P, Rana V, Rehani U. To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age. Int J Clin Pediatr Dent 2012;5(1): 14-19.
Identification of a new genotype of canine distemper virus circulating in America.
Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón
2011-08-01
Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.
Dimopoulou, Maria; Kirpensteijn, Jolle; Moens, Hester; Kik, Marja
2008-07-01
To investigate the histologic characteristics of feline osteosarcoma (OS) and compare the histologic data with phenotypically comparable canine OS. The effects of histologic and clinical variables on survival statistics were evaluated. Retrospective study. Cats (n=62) and dogs (22). Medical records of 62 cats with OS were reviewed for clinically relevant data. Clinical outcome was obtained by telephone interview. Histologic characteristics of OS were classified using a standardized grading system. Histologic characteristics in 22 feline skeletal OS were compared with 22 canine skeletal OS of identical location and subtype. Prognostic variables for clinical outcome were determined using multivariate analysis. Feline OS was characterized by moderate to abundant cellular pleomorphism, low mitotic index, small to moderate amounts of matrix, high cellularity, and a moderate amount of necrosis. There was no significant difference between histologic variables in feline and canine OS. Histologic grade, surgery, and mitotic index significantly influenced clinical outcome as determined by multivariate analysis. Tumor invasion into vessels was not identified as a significant prognosticator. Feline and canine skeletal OS have similar histologic but different prognostic characteristics. Prognosis for cats with OS is related to histologic grade and mitotic index of the tumor.
Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina
2015-09-30
During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be
A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article
Directory of Open Access Journals (Sweden)
S. Gur
2009-05-01
Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.
Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China.
Li, Weike; Li, Tiansong; Liu, Yuxiu; Gao, Yuwei; Yang, Songtao; Feng, Na; Sun, Heting; Wang, Shengle; Wang, Lei; Bu, Zhigao; Xia, Xianzhu
2014-08-01
Canine distemper (CD) is a highly contagious, often fatal, multisystemic, and incurable disease in dogs and other carnivores, which is caused by canine distemper virus (CDV). Although vaccines have been used as the principal means of controlling the disease, CD has been reported in vaccinated animals. The hemoagglutinin (H) protein is one of the most important antigens for inducing protective immunity against CD, and antigenic variation of recent CDV strains may explain vaccination failure. In this study, a new CDV isolate (TM-CC) was obtained from a Tibetan Mastiff that died of distemper, and its genome was characterized. Phylogenetic analysis of the H gene revealed that the CDV-TM-CC strain is unique among 20 other CDV strains and can be classified into the Asia-1 group with the Chinese strains, Hebei and HLJ1-06, and the Japanese strain, CYN07-hV. The H gene of CDV-TM-CC shows low identity (90.4 % nt and 88.9 % aa) with the H gene of the classical Onderstepoort vaccine strain, which may explain the inability of the Tibetan Mastiff to mount a protective immune response. We also performed a comprehensive phylogenetic analysis of the N, P, and F protein sequences, as well as potential N-glycosylation sites and cysteine residues. This analysis shows that an N-glycosylation site at aa 108-110 within the F protein of CDV-TM-CC is specific for the wild-type strains (5804P, A75/17, and 164071) and the Asia-1 group strains, and may be another important factor for the poor immune response. These results provide important information for the design of CD vaccines in the China region and elsewhere.
The effects of sulforaphane on canine osteosarcoma proliferation and invasion.
Rizzo, V L; Levine, C B; Wakshlag, J J
2017-09-01
Recent evidence in in vitro and in vivo models suggests that sulforaphane (SFN), found in raw cruciferous vegetables, may have utility in chemoprevention, as an antineoplastic agent and as a free radical scavenger. The effects of SFN alone or with doxorubicin on cell viability were examined, as well as cell cycle kinetics, invasion capabilities and apoptosis in three canine osteosarcoma cell line (D17, OS 2.4 and HMPOS). Results showed that SFN could not induce cell death at potentially physiological concentrations (canine osteosarcoma. © 2016 John Wiley & Sons Ltd.
Rabies in Asia: the classical zoonosis.
Wilde, Henry; Hemachudha, Thiravat; Wacharapluesadee, Supaporn; Lumlertdacha, Boonlert; Tepsumethanon, Veera
2013-01-01
Rabies remains a constant threat to humans throughout much of Asia. The dog is the main reservoir and vector with wildlife playing a very minor role. No Asian country or region has been declared rabies free by WHO in over two decades and there is evidence of canine rabies spread to new regions during the past 10 years. We now have the knowledge and technology to control canine rabies. The main barrier in managing this costly endemic is lack of motivation by authorities to address this issue along with regional inability of public health and livestock (agriculture) officials to tackle this issue in cooperation and coordination. Rabies is one of the first recognized zoonoses and a model for a true "One Health" management goal where human; veterinary, and government officials must work together in harmony to defeat this disease.
Construct canine intracranial aneurysm model by endovascular technique
International Nuclear Information System (INIS)
Liang Xiaodong; Liu Yizhi; Ni Caifang; Ding Yi
2004-01-01
Objective: To construct canine bifurcation aneurysms suitable for evaluating the exploration of endovascular devices for interventional therapy by endovascular technique. Methods: The right common carotid artery of six dogs was expanded with a pliable balloon by means of endovascular technique, then embolization with detached balloon was taken at their originations DAS examination were performed on 1, 2, 3 d after the procedurse. Results: 6 aneurysm models were created in six dogs successfully with the mean width and height of the aneurysms decreasing in 3 days. Conclusions: This canine aneurysm model presents the virtue in the size and shape of human cerebral bifurcation saccular aneurysms on DSA image, suitable for developing the exploration of endovascular devices for aneurismal therapy. The procedure is quick, reliable and reproducible. (authors)
Loire Classics: Reviving Classicism in some Loire Poets
Directory of Open Access Journals (Sweden)
Wim Verbaal
2017-06-01
Full Text Available The term 'Loire poets' has come to refer to a rather undefinable group of poets that in the second half of the eleventh century distinguishes itself through its refined poetics. They are often characterized as medieval humanists thanks to their renewed interest in the classics. Sometimes their movement is labelled a 'classicist' one. But what does this 'classicism' mean? Is it even permitted to speak of medieval 'classicisms'? This contribution approaches the question of whether we can apply this modern label to pre-modern phenomena. Moreover, it explores the changes in attitude towards the classics that sets the Loire poets off from their predecessors and contemporaries. The article focuses on poems by Hildebert of Lavardin, Baudri of Bourgueil, Marbod of Rennes, and Geoffrey of Reims. They are compared with some contemporary poets, such as Reginald of Canterbury and Sigebert of Gembloux.
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
Energy Technology Data Exchange (ETDEWEB)
Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)
2014-04-15
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.
2014-01-01
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C
2018-02-26
Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.
Canine and incisor microwear in pitheciids and Ateles reflects documented patterns of tooth use.
Delezene, Lucas K; Teaford, Mark F; Ungar, Peter S
2016-09-01
Platyrrhine species differ in the extent to and the manner in which they use their incisors and canines during food ingestion. For example, Ateles uses its anterior teeth to process mechanically nondemanding soft fruits, while the sclerocarp-harvesting pitheciids rely extensively on these teeth to acquire and process more demanding foods. Pitheciids themselves vary in anterior tooth use, with the pitheciines (Cacajao, Chiropotes, and Pithecia) noted to use their robust canines in a variety of ways to predate seeds, while Callicebus, which rarely predates seeds, uses its incisors and exceptionally short canines to scrape tough mesocarp from fruits. To investigate the relationship between tooth use and dental wear, microwear textures were investigated for the anterior teeth of these five genera of platyrrhine primates. Using a white light confocal microscope, 12 microwear texture attributes that reflect feature size, anisotropy, density, and complexity were recorded from high-resolution epoxy casts of the incisors and canines of adult wild-collected Brazilian specimens of Ateles, Callicebus, Cacajao, Chiropotes, and Pithecia. Pitheciine canines tend to have deep microwear features and complex, anisotropic microwear textures, while Ateles anterior teeth tend to have very small features, low feature density, and less complex and anisotropic surfaces. Callicebus incisor and canine microwear is generally intermediate in size and complexity between those extremes. These findings align with expectations from reported field observations of tooth use and illustrate the potential for using microwear texture analysis to infer patterns of anterior tooth use in extinct primates. Am J Phys Anthropol 161:6-25, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.
Directory of Open Access Journals (Sweden)
David Kovacevic
Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.
Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.
Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H
2007-07-01
Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.
Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.
Directory of Open Access Journals (Sweden)
Kinga Majchrzak
Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs
Detection of Ammonium Nitrate Variants by Canine: A Study of Generalization between Like Substances
2018-04-30
Memorandum Report Homemade explosive Detector dog Canine behavior/ learning Ammonium nitrate Canine training 61-4687-08 Office...varying temperatures and humidities...presence of contaminants, the form in which the AN is found (i.e. prill, ground, or crystalline), and environmental conditions (i.e. temperature and
International Nuclear Information System (INIS)
Costella, J.P.; McKellar, B.H.J.; Rawlinson, A.A.
1997-03-01
We review how antiparticles may be introduced in classical relativistic mechanics, and emphasize that many of their paradoxical properties can be more transparently understood in the classical than in the quantum domain. (authors)
Nasolacrimal obstruction caused by root abscess of the upper canine in a cat.
Anthony, James M G; Sandmeyer, Lynne S; Laycock, Amanda R
2010-03-01
A 10-year-old, castrated male domestic short hair cat was presented to the Small Animal Clinic at the Western College of Veterinary Medicine with a presenting complaint of chronic, ocular discharge from the left eye. Ocular examination confirmed epiphora and mucopurulent discharge but there were no apparent reasons for the ocular discharge, and nasolacrimal obstruction was suspected. The cat had swelling of the left side of the face, severe periodontal disease and a fractured upper left canine tooth with pulpal exposure. Dacryocystorhinography revealed narrowing of the nasolacrimal duct above the root of the fractured upper left canine and dental radiographs showed a severe periapical lucency at the apex of the upper left canine tooth. The fractured canine tooth was removed. Subsequently, the ocular discharge and facial swelling resolved. After 2 years, the epiphora has never reoccurred. This is a noteworthy case because a suspected root abscess resulted in extralumenal compression of the nasolacrimal duct, which shows the importance of a thorough oral examination when nasolacrimal obstruction is evident.
Characterization of STAT3 activation and expression in canine and human osteosarcoma
Directory of Open Access Journals (Sweden)
Li Pui-Kai
2009-03-01
Full Text Available Abstract Background Dysregulation of signal transducer and activator of transcription 3 (STAT3 has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. Methods To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656 or STAT3 (LLL3 inhibitors and cell proliferation (CyQUANT, caspase 3/7 activity (ELISA, apoptosis (Western blotting for PARP cleavage and/or viability (Wst-1 were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Results Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known
Characterization of STAT3 activation and expression in canine and human osteosarcoma
International Nuclear Information System (INIS)
Fossey, Stacey L; Liao, Albert T; McCleese, Jennifer K; Bear, Misty D; Lin, Jiayuh; Li, Pui-Kai; Kisseberth, William C; London, Cheryl A
2009-01-01
Dysregulation of signal transducer and activator of transcription 3 (STAT3) has been implicated as a key participant in tumor cell survival, proliferation, and metastasis and is often correlated with a more malignant tumor phenotype. STAT3 phosphorylation has been demonstrated in a subset of human osteosarcoma (OSA) tissues and cell lines. OSA in the canine population is known to exhibit a similar clinical behavior and molecular biology when compared to its human counterpart, and is often used as a model for preclinical testing of novel therapeutics. The purpose of this study was to investigate the potential role of STAT3 in canine and human OSA, and to evaluate the biologic activity of a novel small molecule STAT3 inhibitor. To examine STAT3 and Src expression in OSA, we performed Western blotting and RT-PCR. OSA cells were treated with either STAT3 siRNA or small molecule Src (SU6656) or STAT3 (LLL3) inhibitors and cell proliferation (CyQUANT), caspase 3/7 activity (ELISA), apoptosis (Western blotting for PARP cleavage) and/or viability (Wst-1) were determined. Additionally, STAT3 DNA binding after treatment was determined using EMSA. Expression of STAT3 targets after treatment was demonstrated with Western blotting, RT-PCR, or gel zymography. Our data demonstrate that constitutive activation of STAT3 is present in a subset of canine OSA tumors and human and canine cell lines, but not normal canine osteoblasts. In both canine and human OSA cell lines, downregulation of STAT3 activity through inhibition of upstream Src family kinases using SU6656, inhibition of STAT3 DNA binding and transcriptional activities using LLL3, or modulation of STAT3 expression using siRNA, all resulted in decreased cell proliferation and viability, ultimately inducing caspase-3/7 mediated apoptosis in treated cells. Furthermore, inhibition of either Src or STAT3 activity downregulated the expression of survivin, VEGF, and MMP2, all known transcriptional targets of STAT3. These data
Ertan Erdinc, Aslihan M
2008-01-01
Impaction of maxillary canines is a common orthodontic anomaly that causes facial and dentoalveolar system problems, both functional and esthetic. A combination of surgery and orthodontics is important in bringing impacted canines to their ideal position in the dental arch. In this case report of a 14-year-old patient with impacted right and left maxillary canines, the crowns of these teeth were surgically exposed, brackets were bonded, and light orthodontic forces were delivered for 2 years to align the teeth in the dental arch.
Kim, S-J; Kwon, Y-H; Hwang, C-J
2016-05-01
The objective of this study was to compare the biomechanical characteristics between two types of self-ligating brackets and conventional metal brackets using finite element analysis of a vertically displaced canine model focusing on the desired force on the canine and undesirable forces on adjacent teeth. Three-dimensional finite element models of the maxillary dentition with 1-mm, 2-mm, and 3-mm vertically displaced canines were constructed. Two different self-ligating brackets (In-Ovation C and Smart clip) and a conventional metal bracket (Micro-arch) were modeled. After a 0.016-inch NiTi (0.40 mm, round) wire was engaged, the displacement of each tooth was calculated using x-, y-, and z-coordinates, and the tensile and compressive stresses were calculated. The extrusion and maximal tensile stress of the canine differed little between the three brackets, but the intrusion and minimal compressive stress values of the adjacent teeth differed considerably and were highest in the Smart clip and least in the In-Ovation C. The extrusion and maximal tensile stress of the canine in the 3-mm displacement model was less than that in the 2-mm displacement model, and the intrusion and minimal compressive stress of the adjacent teeth increased with the degree of displacement. Self-ligating brackets were not superior to conventional brackets in leveling a vertically displaced canine. A continuous arch wire may not be recommended for leveling of severely displaced canines whether using self-ligating or conventional brackets. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Behling-Kelly, Erica
2016-03-01
The evaluation of lipoprotein metabolism in small animal medicine is hindered by the lack of a gold standard method and paucity of validation data to support the use of automated chemistry methods available in the typical veterinary clinical pathology laboratory. The physical and chemical differences between canine and human lipoproteins draw into question whether the transference of some of these human methodologies for the study of canine lipoproteins is valid. Validation of methodology must go hand in hand with exploratory studies into the diagnostic or prognostic utility of measuring specific lipoproteins in veterinary medicine. The goal of this study was to compare one commercially available wet-chemistry method to manual and automated lipoprotein electrophoresis in the analysis of canine lipoproteins. Canine lipoproteins from 50 dogs were prospectively analyzed by 2 electrophoretic methods, one automated and one manual method, and one wet-chemistry method. Electrophoretic methods identified a higher proportion of low-density lipoproteins than the wet-chemistry method. Automated electrophoresis occasionally failed to identify very low-density lipoproteins. Wet-chemistry methods designed for evaluation of human lipoproteins are insensitive to canine low-density lipoproteins and may not be applicable to the study of canine lipoproteins. Automated electrophoretic methods will likely require significant modifications if they are to be used in the analysis of canine lipoproteins. Studies aimed at determining the impact of a disease state on lipoproteins should thoroughly investigate the selected methodology prior to the onset of the study. © 2016 American Society for Veterinary Clinical Pathology.
Amorim, Irina; Freitas, Daniela P; Magalhães, Ana; Faria, Fátima; Lopes, Célia; Faustino, Augusto M; Smet, Annemieke; Haesebrouck, Freddy; Reis, Celso A; Gärtner, Fátima
2014-08-01
The gastric mucosa of dogs is often colonized by non-Helicobacter pylori helicobacters (NHPH), while H. pylori is the predominant gastric Helicobacter species in humans. The colonization of the human gastric mucosa by H. pylori is highly dependent on the recognition of host glycan receptors. Our goal was to define the canine gastric mucosa glycophenotype and to evaluate the capacity of different gastric Helicobacter species to adhere to the canine gastric mucosa. The glycosylation profile in body and antral compartments of the canine gastric mucosa, with focus on the expression of histo-blood group antigens was evaluated. The in vitro binding capacity of FITC-labeled H. pylori and NHPH to the canine gastric mucosa was assessed in cases representative of the canine glycosylation pattern. The canine gastric mucosa lacks expression of type 1 Lewis antigens and presents a broad expression of type 2 structures and A antigen, both in the surface and glandular epithelium. Regarding the canine antral mucosa, H. heilmannii s.s. presented the highest adhesion score whereas in the body region the SabA-positive H. pylori strain was the strain that adhered more. The canine gastric mucosa showed a glycosylation profile different from the human gastric mucosa suggesting that alternative glycan receptors may be involved in Helicobacter spp. binding. Helicobacter pylori and NHPH strains differ in their ability to adhere to canine gastric mucosa. Among the NHPH, H. heilmannii s.s. presented the highest adhesion capacity in agreement with its reported colonization of the canine stomach. © 2014 John Wiley & Sons Ltd.
uPAR EXPRESSION IN CANINE NORMAL PROSTATE AND WITH PROLIFERATIVE DISORDERS
Directory of Open Access Journals (Sweden)
Mariana Rodrigues Faleiro
2013-06-01
Full Text Available Prostatic lesions such as prostatic intraepithelial neoplasia (PIN and proliferative inflammatory atrophy (PIA are studied in human and canine species due to their malignance potential. The plasminogen activator (PA system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC was evaluated by immunohistochemistry in a tissue microarray (TMA slide to establish the role of this enzyme in extracellular matrix (ECM remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1% normal prostates, 46 (13.0% with BPH, 128 (36.1% with PIA, 74 (20.8% with PIN and 71 (20.0% with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.
Penetration of ASM 981 in canine skin: a comparative study.
Gutzwiller, Meret E Ricklin; Reist, Martin; Persohn, Elke; Peel, John E; Roosje, Petra J
2006-01-01
ASM 981 has been developed for topical treatment of inflammatory skin diseases. It specifically inhibits the production and release of pro-inflammatory cytokines. We measured the skin penetration of ASM 981 in canine skin and compared penetration in living and frozen skin. To make penetration of ASM 981 visible in dog skin, tritium labelled ASM 981 was applied to a living dog and to defrosted skin of the same dog. Using qualitative autoradiography the radioactive molecules were detected in the lumen of the hair follicles until the infundibulum, around the superficial parts of the hair follicles and into a depth of the dermis of 200 to 500 microm. Activity could not be found in deeper parts of the hair follicles, the dermis or in the sebaceous glands. Penetration of ASM 981 is low in canine skin and is only equally spread in the upper third of the dermis 24 hours after application. Penetration in frozen skin takes even longer than in living canine skin but shows the same distribution.
Adjuvant therapy with carboplatin and pamidronate for canine appendicular osteosarcoma.
Kozicki, A R; Robat, C; Chun, R; Kurzman, I D
2015-09-01
Amputation and chemotherapy are the mainstay of treatment for canine appendicular osteosarcoma (OSA). In vitro studies have demonstrated anti-tumour activity of pamidronate against canine OSA. The purpose of this study was to assess the safety of adding pamidronate to standard post-operative carboplatin chemotherapy in 17 dogs with appendicular OSA treated with limb amputation. Median disease-free interval (DFI) and median survival time (MST) were evaluated as secondary endpoints. Incidence of side effects and treatment outcomes were compared to 14 contemporary control patients treated with carboplatin alone. There were no identified side effects to the pamidronate treatment. The median DFI for the study group was 185 days compared to 172 days for the control group (P = 0.90). The MST of the study group was 311 days compared to 294 days for the control group (P = 0.89). Addition of pamidronate to carboplatin chemotherapy for the treatment of canine appendicular OSA is safe and does not impair efficacy of standard carboplatin treatment. © 2013 Blackwell Publishing Ltd.
Surgical treatments of the impacted canine tooth in young dogs
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Sasaki, K.; Taura, Y.; Nakama, S.; Yamanouchi, T.
1993-01-01
Surgical treatments of the impacted canine tooth were carried out in 8 young dogs, and the results were successful in 12 out of 14 cases (85.7%). The treatments consisting of surgical correction by immediate tipping movement, fenestration of the gingiva, and removal of the impacted tooth, were applied to 14 cases radiographically showing the immature tooth root and no abnormalities in the tooth root or alveolar bone. Impacted teeth were seen in 8 regions of the maxilla and 6 regions of the mandible. Mesioversion was seen in almost all maxillary impacted teeth, while linguoversion or lingual mesioversion in all mandibular cases. Surgical correction was carried out by immediate tipping movement after removal of the retained deciduous canine with or without resection of the alveolar bone. Fixation of the moved teeth was done using a wedge made from the deciduous canine root, which was driven into the vacant alveolar cavity after moving. An additional fixation using a steel wire and/or self-curing resin was done, if necessary
Nonsurgical, nonextraction management of impacted maxillary canine
Directory of Open Access Journals (Sweden)
Jasneet Singh
2018-01-01
Full Text Available NS, a 12 year 2 months old female patient, presented with the chief complaint of irregular teeth. Diagnosis revealed skeletal Class II jaw base relation, with average (toward vertical growth pattern, dentoalveolar angles Class I molar relationship with severe crowding in upper and moderate crowding in the lower arch, normally positioned maxillary incisors but proclined lower incisors, “V” shape constricted maxillary arch with first premolar in crossbite, overretained deciduous molar and a high placed buccoversion canine in the first quadrant and an impacted canine in the second quadrant, constricted mandibular arch with first premolar blocked out in the third quadrant. Treatment with a nonsurgical, nonextraction treatment plan by expansion of the upper arch and taking advantage of natural eruptive forces of the tooth was planned. The final outcome solved the patient's complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
Measurement of lower canine clinical crown index in male and female for gender identification
Directory of Open Access Journals (Sweden)
Rita Dewi Handayani
2007-11-01
Full Text Available The purpose of this research was to acquire the value index of clinical crown lower jaw canine male and female, and to prove whether the index of male's canine is bigger than female's. The samples of the research was the students of Faculty of Dentistry Universitas Padjadjaran class of 1998 until 2001 by using proportional random sampling method according to the criteria and also adjust with the numbers of male and female composition in per class. The characteristic of the research was analytical descriptive with survey technique. The result of t test statistic measurement was that index of clinical crown tower jaw canine of mate was 1.50 and female was 1.21, by using reliance 95%. The inference of the research showed that the index of clinical crown lower jaw canine of male was significantly bigger than female's. The result of the research can be used as auxiliary data from the techniques to process gender identification in odontology forensic.
Brusveen, Elin Marie Gravdal; Brudvik, Pongsri; Bøe, Olav Egil; Mavragani, Maria
2012-04-01
The purpose of the study was to evaluate impacted maxillary canines as risk factor for orthodontic apical root resorption. The sample comprised 66 patients treated with fixed appliances. Thirty-two patients with a unilateral impacted maxillary canine, which was distanced from the roots of the incisors at a preliminary phase of treatment before bonding, formed the impaction group, and 34 patients without impactions served as the controls. Root shortening was calculated by using pretreatment and posttreatment intraoral radiographs. Inclination of the eruption path of the impacted canine relative to the midline, axis of the lateral incisor, and nasal line, root development, and the medial and vertical positions of the impacted tooth were recorded on orthopantomograms and lateral cephalometric films. The follicle/tooth ratio was evaluated by using periapical radiographs. No significant difference in apical resorption of the maxillary incisors was detected between the impaction and control groups, or between the incisors of the impacted and contralateral sides in the same subject. Likewise, no difference in the severity of root resorption was found between the incisors of impacted side alone and the incisors of the control group. Mesial and vertical inclinations of the impacted canines were negatively related to a lateral incisor's root resorption. No correlations were found between resorption and medial or vertical position of the crown of the canine. The follicle/tooth ratio was significantly related to the mesial inclination of the impacted canine, but not to root resorption. An impacted maxillary canine, after being distanced from the incisor roots, does not seem to be a risk factor for apical root resorption during orthodontic treatment. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Directory of Open Access Journals (Sweden)
Mehdi Hayat Shahi
Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Intracellular Route of Canine Parvovirus Entry
Vihinen-Ranta, Maija; Kalela, Anne; Mäkinen, Päivi; Kakkola, Laura; Marjomäki, Varpu; Vuento, Matti
1998-01-01
The present study was designed to investigate the endocytic pathway involved in canine parvovirus (CPV) infection. Reduced temperature (18°C) or the microtubule-depolymerizing drug nocodazole was found to inhibit productive infection of canine A72 cells by CPV and caused CPV to be retained in cytoplasmic vesicles as indicated by immunofluorescence microscopy. Consistent with previously published results, these data indicate that CPV enters a host cell via an endocytic route and further suggest that microtubule-dependent delivery of CPV to late endosomes is required for productive infection. Cytoplasmic microinjection of CPV particles was used to circumvent the endocytosis and membrane fusion steps in the entry process. Microinjection experiments showed that CPV particles which were injected directly into the cytoplasm, thus avoiding the endocytic pathway, were unable to initiate progeny virus production. CPV treated at pH 5.0 prior to microinjection was unable to initiate virus production, showing that factors of the endocytic route other than low pH are necessary for the initiation of infection by CPV. PMID:9420290
Canine urothelial carcinoma: genomically aberrant and comparatively relevant.
Shapiro, S G; Raghunath, S; Williams, C; Motsinger-Reif, A A; Cullen, J M; Liu, T; Albertson, D; Ruvolo, M; Bergstrom Lucas, A; Jin, J; Knapp, D W; Schiffman, J D; Breen, M
2015-06-01
Urothelial carcinoma (UC), also referred to as transitional cell carcinoma (TCC), is the most common bladder malignancy in both human and canine populations. In human UC, numerous studies have demonstrated the prevalence of chromosomal imbalances. Although the histopathology of the disease is similar in both species, studies evaluating the genomic profile of canine UC are lacking, limiting the discovery of key comparative molecular markers associated with driving UC pathogenesis. In the present study, we evaluated 31 primary canine UC biopsies by oligonucleotide array comparative genomic hybridization (oaCGH). Results highlighted the presence of three highly recurrent numerical aberrations: gain of dog chromosome (CFA) 13 and 36 and loss of CFA 19. Regional gains of CFA 13 and 36 were present in 97 % and 84 % of cases, respectively, and losses on CFA 19 were present in 77 % of cases. Fluorescence in situ hybridization (FISH), using targeted bacterial artificial chromosome (BAC) clones and custom Agilent SureFISH probes, was performed to detect and quantify these regions in paraffin-embedded biopsy sections and urine-derived urothelial cells. The data indicate that these three aberrations are potentially diagnostic of UC. Comparison of our canine oaCGH data with that of 285 human cases identified a series of shared copy number aberrations. Using an informatics approach to interrogate the frequency of copy number aberrations across both species, we identified those that had the highest joint probability of association with UC. The most significant joint region contained the gene PABPC1, which should be considered further for its role in UC progression. In addition, cross-species filtering of genome-wide copy number data highlighted several genes as high-profile candidates for further analysis, including CDKN2A, S100A8/9, and LRP1B. We propose that these common aberrations are indicative of an evolutionarily conserved mechanism of pathogenesis and harbor genes
Canine osteosarcoma: a naturally occurring disease to inform pediatric oncology.
Fenger, Joelle M; London, Cheryl A; Kisseberth, William C
2014-01-01
Osteosarcoma (OSA) is the most common form of malignant bone cancer in children and dogs, although the disease occurs in dogs approximately 10 times more frequently than in people. Multidrug chemotherapy and aggressive surgical techniques have improved survival; however, new therapies for OSA are critical, as little improvement in survival times has been achieved in either dogs or people over the past 15 years, even with significant efforts directed at the incorporation of novel therapeutic approaches. Both clinical and molecular evidence suggests that human and canine OSA share many key features, including tumor location, presence of microscopic metastatic disease at diagnosis, development of chemotherapy-resistant metastases, and altered expression/activation of several proteins (e.g. Met, ezrin, phosphatase and tensin homolog, signal transducer and activator of transcription 3), and p53 mutations, among others. Additionally, canine and pediatric OSA exhibit overlapping transcriptional profiles and shared DNA copy number aberrations, supporting the notion that these diseases are similar at the molecular level. This review will discuss the similarities between pediatric and canine OSA with regard to histology, biologic behavior, and molecular genetic alterations that indicate canine OSA is a relevant, spontaneous, large animal model of the pediatric disease and outline how the study of naturally occurring OSA in dogs will offer additional insights into the biology and future treatment of this disease in both children and dogs. © The Author 2014. Published by Oxford University Press on behalf of the Institute for Laboratory Animal Research. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Killey, R; Mynors, C; Pearce, R; Nell, A; Prentis, A; Day, M J
2018-01-01
To determine the utility of an in-practice test kit to detect protective serum antibody against canine distemper virus, canine adenovirus and canine parvovirus type 2 in a sample of the UK dog population. Serum samples from 486 dogs, last vaccinated between less than 1 month and 124 months previously, were tested with the VacciCheck™ test kit for protective antibodies against distemper, adenovirus and parvovirus type 2. A high proportion of the dogs tested (93·6%) had protective antibody against all three of the core vaccine antigens: 95·7% of the dogs were seropositive against canine distemper virus, 97·3% against canine adenovirus and 98·5% against canine parvovirus type 2. The small number of dogs that were seronegative for one or more of the antigens (n = 31) may have had waning of previous serum antibody or may have been rare genetic non-responders to that specific antigen. UK veterinarians can be reassured that triennial revaccination of adult dogs with core vaccines provides long-lived protective immunity. In-practice serological test kits are a valuable tool for informing decision-making about canine core revaccination. © 2017 British Small Animal Veterinary Association.
International Nuclear Information System (INIS)
Kumar, K.S.; Srinivasan, V.; Toles, R.E.; Miner, V.L.; Jackson, W.E.; Seed, T.M.
2002-01-01
There is an urgent need to develop non-toxic radioprotectors. We tested the efficacy of a 3-drug combination (3-DC) of iloprost, misoprostol, and 3D-MPL (3-deacylated monophosphoryl lipid A) and the effects of postirradiation clinical support with high doses of antibiotics and blood transfusion. Canines were given 3-DC or the vehicle and exposed to 3.4 Gy or 4.1 Gy of 60 Co radiation. Canines irradiated at 4.1 Gy were also given clinical support, which consisted of blood transfusion and antibiotics (gentamicin, and cefoxitin or cephalexin). Peripheral blood cell profile and 60-day survival were used as indices of protection. At 3.4 Gy, 3-DC- or vehicle-treated canines without postirradiation clinical support survived only for 10 to 12 days. Fifty percent of the canines treated with 3-DC or vehicle and provided postirradiation clinical support survived 4.1-Gy irradiation. Survival of canines treated with vehicle before irradiation significantly correlated with postirradiation antibiotic treatments, but not with blood transfusion. The recovery profile of peripheral blood cells in 4.1 Gy-irradiated canines treated with vehicle and antibiotics was better than drug-treated canines. These results indicate that therapy with high doses of intramuscular aminoglycoside antibiotic (gentamicin) and an oral cephalosporin (cephalexin) enhanced survival of irradiated canines. Although blood transfusion correlated with survival of 3-DC treated canines, there were no additional survivors with 3-DC treated canines than the controls. (author)
Pharmacological characterization of canine melancortin-4 receptor and its natural variant V213F.
Yan, J; Tao, Y-X
2011-08-01
Dogs have become one of the most important companion animals in modern society. However, it is estimated that 20% to 40% of owned dogs are obese, suggesting that obesity has become one of the most important canine health problem. In addition, obesity in dogs also leads to type II diabetes. Because the melanocortin-4 receptor (MC4R) has been shown to be essential in maintaining energy homeostasis in several different species, including rodents and humans, we initiated studies toward elucidating the roles of MC4R in obesity pathogenesis in dogs. Canine MC4R has been cloned, and a missense variant V213F was identified. We designed primers and successfully cloned canine MC4R and generated the variant V213F by site-directed mutagenesis. The objective of this study was to investigate the pharmacological properties of canine MC4R and its natural variant V213F. We measured ligand binding and signaling properties with the use of both natural and synthetic ligands. Human MC4R was also included in the experiments for comparison. Both wild-type canine MC4R and its natural variant V213F functioned normally in terms of binding and signaling. Of the ligands we used, [Nle(4), D-Phe(7)]-α-melanocyte-stimulating hormone is the most potent ligand. We conclude that the cloned canine MC4R is a functional receptor, and the natural variant V213F does not have any functional defect and therefore is not likely to cause obesity in dogs. Copyright © 2011 Elsevier Inc. All rights reserved.
Influence of Radiographic Positioning on Canine Sacroiliac and Lumbosacral Angle Measurements.
Jones, Susan; Savage, Mason; Naughton, Brian; Singh, Susheela; Robertson, Ian; Roe, Simon C; Marcellin-Little, Denis J; Mathews, Kyle G
2018-01-01
To evaluate the influence of radiographic malpositioning on canine sacroiliac and lumbosacral inclination angles. Using canine cadavers, lateral pelvic radiographs were acquired with the radiographic beam in a neutral position and then rotated 5, 10 and 15° to mimic rotational malpositioning. The focal point of the beam was then focused over the abdomen and again over mid-diaphysis of the femur to mimic an abdominal or femoral radiographic study. Five degrees of rotational malpositioning did not influence measurements of sacroiliac or lumbosacral inclination, but malpositioning by more than 5° led to a significant decrease in both sacroiliac and lumbosacral angles. Moving the focal point to the femur significantly decreased the measured lumbosacral angle. Abdominally centred radiographs had no effect on lumbosacral and sacroiliac angle measurements. When evaluating canine lumbosacral and sacroiliac angles radiographically, pelvic rotation of more than 5° should be avoided as should the use of lateral radiographs centred over the femur. Schattauer GmbH Stuttgart.
Characterization and modulation of canine mast cell derived eicosanoids
Lin, Tzu-Yin; London, Cheryl A.
2013-01-01
Mast cells play an important role in both innate and acquired immunity as well as several pathological conditions including allergy, arthritis and neoplasia. They influence these processes by producing a variety of mediators including cytokines, chemokines and eicosanoids. Very little is currently known about the spectrum of inflammatory mediators, particularly eicosanoids (prostaglandins and leukotrienes), produced by canine mast cells. This is important since modulating mast cell derived eicosanoids may help in the treatment of autoimmune and inflammatory disorders. The purpose of this study was to investigate the spectrum of eicosanoids produced by normal canine mast cells and to evaluate the effects of cytokines and non-steroidal anti-inflammatory mediators (NSAIDS) on eicosanoid production and release. Canine bone marrow derived cultured mast cells (cBMCMCs) expressed COX-1, COX-2, and 5-LOX and synthesized and released PGD2, PGE2, LTB4, and LTC4 following activation by a variety of stimuli. The selective COX-2 NSAIDs carprofen (Rimadyl®) and deracoxib (Deramaxx®) inhibited PGD2 and PGE2 production but only slightly inhibited LTB4 and LTC4. The mixed COX-1/COX-2 inhibitor piroxicam blocked PGD2 and PGE2 production, but upregulated LTC4 following treatment while tepoxilan (Zubrin®), a pan COX/LOX inhibitor, markedly reduced the production of all eicosanoids. The LOX inhibitor nordihydroguaiaretic acid (NDGA) prevented LTB4/LTC4 release and BMBMC degranulation. Pre-incubation of cBMCMCs with IL-4 and SCF sensitized these cells to degranulation in response to substance P. In conclusion, canine BMCMCs produce an array of eicosanoids similar to those produced by mast cells from other species. Tepoxilan appeared to be the most effective NSAID for blocking eicosanoid production and thus may be useful for modulating mast cell mediated responses in dogs. PMID:20036014
Molecular Epidemiology of Canine Parvovirus, Europe
Desario, Costantina; Addie, Diane D.; Martella, Vito; Vieira, Maria João; Elia, Gabriella; Zicola, Angelique; Davis, Christopher; Thompson, Gertrude; Thiry, Ethienne; Truyen, Uwe; Buonavoglia, Canio
2007-01-01
Canine parvovirus (CPV), which causes hemorrhagic enteritis in dogs, has 3 antigenic variants: types 2a, 2b, and 2c. Molecular method assessment of the distribution of the CPV variants in Europe showed that the new variant CPV-2c is widespread in Europe and that the viruses are distributed in different countries. PMID:17953097
Thiruvenkatachari, Badri; Javidi, Hanieh; Griffiths, Sarah Elizabeth; Shah, Anwar A; Sandler, Jonathan
2017-10-01
Maxillary canines are generally considered important both cosmetically and functionally. Most claims on the importance of maxillary canines, however, have been based on expert opinions and clinician-based studies. There are no scientific studies in the literature reporting on their cosmetic importance or how laypeople perceive a smile treated by maxillary canine extractions. Our objective was to investigate whether there is any difference in the perceptions of patients' smiles treated by extracting either maxillary canines or first premolars, as judged by orthodontists, dentists, and laypeople. This retrospective study included 24 participants who had unilateral or bilateral extraction of maxillary permanent canines and fixed appliances in the maxillary and mandibular arches to comprehensively correct the malocclusion, selected from orthodontic patients treated at Chesterfield Royal Hospital NHS trust in the United Kingdom over the last 20 years. The control group of patients had extraction of maxillary first premolars followed by fixed appliances and finished to an extremely high standard judged by the requirement that they had been submitted for the Membership in Orthodontics examination. The finished Peer Assessment Rating scores for this group were less than 5. The end-of-treatment frontal extraoral smiling and frontal intraoral views were presented for both groups. The photographs were blinded for extraction choice and standardized for size and brightness using computer software (Adobe Photoshop CC version 14.0; Adobe Systems, San Jose, Calif). The work file was converted to an editable pdf file and e-mailed to the assessors. The assessor panel consisted of 30 members (10 orthodontists, 10 dentists, and 10 laypeople), who were purposely selected. The measures were rated on a 10-point Likert scale. The attractiveness ratings were not statistically significantly different between the canine extraction and premolar extraction groups, with a mean difference of 0
Dentigerous Cyst Associated with Ectopic Canine and a ...
African Journals Online (AJOL)
ankylosis, cystic or neoplastic lesion or trauma may be the local factors ... After clinical and radiographic examination, a provisional diagnosis of ... bone along with the impacted teeth (permanent ectopic canine ... [7] Panoramic radiograph and ...
Expression, Purification and Characterization of Recombinant Canine FGF21 in Escherichia coli.
Zheng, Zhong; Yang, Chengjun; Yin, Ruofeng; Jiang, Jinxi; He, Haiting; Wang, Xinxin; Kan, Mujie; Xiao, Yechen
2016-01-01
The canine metabolic diseases, such as obesity and diabetes, have become a worldwide problem. Fibroblast growth factor 21 (FGF21) is a potent regulator which has many biological functions relative to metabolism regulation. It suggests that FGF21 plays important roles in regulating canine metabolic diseases. To acquire the recombinant canine FGF21 (rcFGF21) in Escherichia coli, the recombinant bacteria were induced by 0.5 mM IPTG for 16 hours at 16 °C, and the rcFGF21 protein was purified by Ni-NTA. 8 mg rcFGF21 was acquired from one liter bacteria. The rcFGF21 protein has specific immunoblot reactivity against anti-FGF21 and anti-His antibody. The in vivo experimental result showed that rcFGF21 can significantly reduce plasma glucose of STZ-induced diabetic mice.
Establishment of Demodex canis on canine skin engrafted onto scid-beige mice.
Caswell, J L; Yager, J A; Barta, J R; Parker, W
1996-12-01
A small animal model of canine demodicosis is described. Normal canine skin was engrafted onto scid (severe combined immunodeficient)-beige mice, which lack functional B and T lymphocytes and have reduced natural killer cell activity. The xenografts were later infected with Demodex canis collected from a dog with demodicosis. At 30-112 days following infection, mites were seen histologically in the canine hair follicles of the engrafted skin. Demodex canis adults, nymphs, larvae, and eggs were present in samples macerated in sodium hydroxide. Mite infestations could not be demonstrated in the mouse skin, nor were mites passed from the infected graft to uninfected skin grafts on in-contact mice. This model may be utilized to assess the efficacy of miticidal treatments, to evaluate the importance of specific components of the immune response, and to study the biology of D. canis.
Potential hazard of zoonotic parasites present in canine feces in Puerto Escondido, Oaxaca
Directory of Open Access Journals (Sweden)
León Vélez-Hernández
2014-11-01
Full Text Available Objective. To estimate the zoonotic parasites prevalence in feral dog feces in Puerto Escondido. Material and methods. The fecalism frecuency was estimated in ten zones. To identify the parasites parasitological flotation and direct smear methods were used. The parasitic prevalence was estimated in the canine feces. Results. All the zones presented canine fecalism. The parasitic prevalence in the feces was 73.33%. The parasites with the highest prevalence were Toxocara canis (47.78%, Ancylostoma caninum (17.88%, and Dipylidium caninum (13.89%. Conclusion. Canine fecalism comes from strayed and owned dogs. 66.66% of the parasites found in the dog feces are zoonotics. The factors associated to this problem are the suburban habitat, waste mishandling and nil tenure of stray dogs.
Radioimmunoassay of canine growth hormone
International Nuclear Information System (INIS)
Eigenmann, J.E.; Eigenmann, R.Y.
1981-01-01
A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)
An evaluation of the histological effects of intra-articular methadone in the canine model.
Jones, Timothy A; Hand, Walter R; Ports, Michael D; Unger, Daniel V; Herbert, Daniel; Pellegrini, Joseph E
2003-02-01
Methadone hydrochloride is an opiate that has pharmacodynamic and pharmacokinetic properties that suggest it may provide longer analgesia than morphine when administered via the intra-articular route. However, no studies to date have been conducted examining the effects of intra-articular methadone hydrochloride on local tissues. Therefore, the purpose of this study was to determine the histopathologic effects of intra-articular methadone hydrochloride on local tissues in the canine knee. Nine canines, 1 to 4 years old, weighing between 20 kg and 23 kg were used. All canines had their knees randomized to receive either bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 5 mg methadone hydrochloride (0.5 mL) for the study knee, or bupivacaine, 0.5% with epinephrine 1:200,000 (4.5 mL), and 0.5 mL normal saline for the control knee. Serum methadone hydrochloride levels were obtained on all canines at 6 and 24 hours. Canines were randomly assigned to 1 of 3 groups to be euthanized at either 24 hours, 14 days, or 28 days. Following euthanization and necropsy, synovial fluid levels and tissue samples were obtained and examined for histopathologic changes. Synovial fluid samples noted a few white blood cells at 24 hours and none at 14 and 28 days. Tissue samples showed no histopathologic changes, and serum concentration levels of methadone hydrochloride were negligible.
Krause-Parello, Cheryl A; Sarni, Sarah; Padden, Eleni
2016-12-01
Veterans with post-traumatic stress disorder (PTSD) are a vulnerable population at high risk for depression, isolation, and suicide. A substantial body of anecdotal evidence exists supporting the use of canines as an effective adjunct treatment for this population. However, a comprehensive review of its use based on scientific literature has thus far not been conducted. A narrative literature review was conducted to examine the current state of the science on canine assistance for veterans diagnosed with PTSD in order to synthesize current empirical knowledge on the subject. Articles were retrieved among the small body of recent literature using computerized database searches. Inclusion criteria included peer-reviewed journal publications published through October 1st, 2015. Only originally published articles that examined the outcomes of canine assistance on veterans with PTSD were examined. Additionally, each included article was specific to veterans, dogs, and, PTSD in combination rather than article that discuss the concepts separately. Exclusion criteria included symposia and conference material, dissertations, media articles, and no mention of canines as a treatment modality. 563 articles were retrieved; 6 met the criteria. When evaluating data, information and themes were extracted into an Excel table; this table was employed in the synthesis of information into manuscript form. The following themes were explored within the selected publications: What is Canine Assistance; Why Use Canine Assistance for PTSD in Veterans; Concerns; and Future Directions. The literature endorsed canine assistance for PTSD in veterans as a promising modality. Authors also raised concerns about lack of protocols, cost and availability barriers, and animal welfare calling for additional, rigorous research to advance its use as a treatment for veterans with PTSD. PTSD continues to pose significant psychological, health, and welfare challenges to veterans and the multi
Orthodontic tooth movement of total buccally blocked-out canine: a case report
Alkhal, Hessa M; Rabie, Bakr; Wong, Ricky W K
2009-01-01
Orthodontic tooth movement of total buccally blocked-out canine is usually difficult as it is related with the problems of severe crowding, midline deviation, involvement of long root movement and risk of gingival recession. A case report was presented to illustrate the treatment principles. It demonstrated with careful planning in extraction sequence and orthodontic mechanics to deliver light, controlled force, condition of totally blocked out canine could be corrected with good results.
T cell cytokine gene polymorphisms in canine diabetes mellitus.
Short, Andrea D; Catchpole, Brian; Kennedy, Lorna J; Barnes, Annette; Lee, Andy C; Jones, Chris A; Fretwell, Neale; Ollier, William E R
2009-03-15
Insulin-deficiency diabetes in dogs shares some similarities with human latent autoimmune diabetes of adults (LADA). Canine diabetes is likely to have a complex pathogenesis with multiple genes contributing to overall susceptibility and/or disease progression. An association has previously been shown between canine diabetes and MHC class II genes, although other genes are also likely to contribute to the genetic risk. Potential diabetes susceptibility genes include immuno-regulatory TH1/TH2 cytokines such as IFNgamma, IL-12, IL-4 and IL-10. We screened these candidate genes for single nucleotide polymorphisms (SNPs) in a range of different dog breeds using dHPLC analysis and DNA sequencing. Thirty-eight of the SNPs were genotyped in crossbreed dogs and seven other breed groups (Labrador Retriever, West Highland White Terrier, Collie, Schnauzer, Cairn Terrier, Samoyed and Cavalier King Charles Spaniel), which demonstrated substantial intra-breed differences in allele frequencies. When SNPs were examined for an association with diabetes by case:control analysis significant associations were observed for IL-4 in three breeds, the Collie, Cairn Terrier and Schnauzer and for IL-10 in the Cavalier King Charles Spaniel. These results suggest that canine cytokine genes regulating the TH1/TH2 immune balance might play a contributory role in determining susceptibility to diabetes in some breeds.