WorldWideScience

Sample records for cancer biomarker proteins

  1. Exosomal Proteins as a Diagnostic Biomarkers in Lung Cancer

    DEFF Research Database (Denmark)

    Sandfeld-Paulsen, B; Jakobsen, K R; Bæk, R;

    2016-01-01

    BACKGROUND: Exosomes have been suggested as promising biomarkers in non-small cell lung cancer (NSCLC), since they contain proteins from their originating cells and are readily available in plasma. In this study, we explore the potential of exosome protein profiling in diagnosing lung cancer...... patients of all stages and various histological subtypes. METHODS: Plasma was isolated from 581 patients (431 with lung cancer, 150 controls). The Extracellular Vesicle (EV) Array was used to phenotype exosomes. The EV Array contained 49 antibodies for capturing exosomes. Subsequently, a cocktail of biotin......-conjugated CD9, CD81 and CD63 antibodies was used to detect and visualize captured exosomes. Multi-marker models were made combining two or more markers. The optimal multi-marker model was evaluated by Area under the curve (AUC) and Random Forests analysis. RESULTS: The markers CD151, CD171 and Tspan8 were...

  2. Identification of cancer protein biomarkers using proteomic techniques

    Energy Technology Data Exchange (ETDEWEB)

    Mor, Gil G; Ward, David C; Bray-Ward, Patricia

    2015-03-10

    The claimed invention describes methods to diagnose or aid in the diagnosis of cancer. The claimed methods are based on the identification of biomarkers which are particularly well suited to discriminate between cancer subjects and healthy subjects. These biomarkers were identified using a unique and novel screening method described herein. The biomarkers identified herein can also be used in the prognosis and monitoring of cancer. The invention comprises the use of leptin, prolactin, OPN and IGF-II for diagnosing, prognosis and monitoring of ovarian cancer.

  3. Identification of cancer protein biomarkers using proteomic techniques

    Energy Technology Data Exchange (ETDEWEB)

    Mor, Gil G. (Cheshire, CT); Ward, David C. (Las Vegas, NV); Bray-Ward, Patricia (Las Vegas, NV)

    2010-02-23

    The claimed invention describes methods to diagnose or aid in the diagnosis of cancer. The claimed methods are based on the identification of biomarkers which are particularly well suited to discriminate between cancer subjects and healthy subjects. These biomarkers were identified using a unique and novel screening method described herein. The biomarkers identified herein can also be used in the prognosis and monitoring of cancer. The invention comprises the use of leptin, prolactin, OPN and IGF-II for diagnosing, prognosis and monitoring of ovarian cancer.

  4. Resolving breast cancer heterogeneity by searching reliable protein cancer biomarkers in the breast fluid secretome

    International Nuclear Information System (INIS)

    One of the major goals in cancer research is to find and evaluate the early presence of biomarkers in human fluids and tissues. To resolve the complex cell heterogeneity of a tumor mass, it will be useful to characterize the intricate biomolecular composition of tumor microenvironment (the so called cancer secretome), validating secreted proteins as early biomarkers of cancer initiation and progression. This approach is not broadly applicable because of the paucity of well validated and FDA-approved biomarkers and because most of the candidate biomarkers are mainly organ-specific rather than tumor-specific. For these reasons, there is an urgent need to identify and validate a panel of biomarker combinations for early detection of human tumors. This is especially important for breast cancer, the cancer spread most worldwide among women. It is well known that patients with early diagnosed breast cancer live longer, require less extensive treatment and fare better than patients with more aggressive and/or advanced disease. In the frame of searching breast cancer biomarkers (especially using nipple aspirate fluid mirroring breast microenvironment), studies have highlighted an optimal combination of well-known biomarkers: uPA + PAI-1 + TF. When individually investigated they did not show perfect accuracy in predicting the presence of breast cancer, whereas the triple combination has been demonstrated to be highly predictive of pre-cancer and/or cancerous conditions, approaching 97-100% accuracy. Despite the heterogeneous composition of breast cancer and the difficulties to find specific breast cancer biomolecules, the noninvasive analysis of the nipple aspirate fluid secretome may significantly improve the discovery of promising biomarkers, helping also the differentiation among benign and invasive breast diseases, opening new frontiers in early oncoproteomics

  5. Argonaute proteins: potential biomarkers for human colon cancer

    International Nuclear Information System (INIS)

    Although Argonaute proteins are considered to play important roles in stem cell self-renewal, RNA interference (RNAi) and translational regulation, relatively little is known about their functions in human disease. In this study, we investigated the expression of eight members of human Argonaute family in colon cancer and identified their potential roles in tumor development and progression. Antibodies against human Argonaute proteins were prepared by immunizing rabbits with synthetic peptides derived from the sequences of Argonaute members. Then we constructed a tissue microarray containing 75 specimens from colon cancer and 75 specimens from adjacent non-cancer tissue, and assayed eight different proteins (EIF2C1, EIF2C2, EIF2C3, EIF2C4, PIWIL1, PIWIL2, PIWIL3 and PIWIL4) by immunohistochemistry on consecutive formalin-fixed tissue microarray sections. The expression of EIF2C1-4 and PIWIL1-4 was significantly higher in tumorous tissue than in adjacent tissue. Notably, a significant correlation was observed between the positive expression of EIF2C2, EIF2C3, EIF2C4, PIWIL4 and the presence of distant metastasis. Logistic regression analysis revealed that an increased expression of EIF2C1 and PIWIL2 was significantly associated with occurrence of colon cancer tissue compared with non-cancer tissue. Argonaute proteins are overexpressed in colon cancer relative to adjacent non-cancer tissue. The expression of EIF2C2-4 and PIWIL4 appears increased in advanced tumors with distant metastasis, suggesting it may promote tumor invasion. Furthermore, EIF2C1 and PIWIL2 might represent novel colon cancer markers with early diagnostic significance

  6. Novel serum protein biomarker panel revealed by mass spectrometry and its prognostic value in breast cancer

    OpenAIRE

    Chung, Liping; Moore, Katrina; Phillips, Leo; Boyle, Frances M.; Marsh, Deborah J.; Baxter, Robert C.

    2014-01-01

    Introduction Serum profiling using proteomic techniques has great potential to detect biomarkers that might improve diagnosis and predict outcome for breast cancer patients (BC). This study used surface-enhanced laser desorption/ionization time-of-flight (SELDI-TOF) mass spectrometry (MS) to identify differentially expressed proteins in sera from BC and healthy volunteers (HV), with the goal of developing a new prognostic biomarker panel. Methods Training set serum samples from 99 BC and 51 H...

  7. Prostate cancer serum biomarker discovery through proteomic analysis of alpha-2 macroglobulin protein complexes

    OpenAIRE

    Burgess, Earle F.; Ham, Amy-Joan L.; Tabb, David L.; Billheimer, Dean; Roth, Bruce J.; Chang, Sam S.; Cookson, Michael S.; Hinton, Timothy J.; Cheek, Kristin L.; Hill, Salisha; Jennifer A Pietenpol

    2008-01-01

    Alpha-2 macroglobulin (A2M) functions as a universal protease inhibitor in serum and is capable of binding various cytokines and growth factors. In this study, we investigated if immunoaffinity enrichment and proteomic analysis of A2M protein complexes from human serum could improve detection of biologically relevant and novel candidate protein biomarkers in prostate cancer. Serum samples from six patients with androgen-independent, metastatic prostate cancer and six control patients without ...

  8. Prostate cancer serum biomarker discovery through proteomic analysis of alpha-2 macroglobulin protein complexes

    Science.gov (United States)

    Burgess, Earle F.; Ham, Amy-Joan L.; Tabb, David L.; Billheimer, Dean; Roth, Bruce J.; Chang, Sam S.; Cookson, Michael S.; Hinton, Timothy J.; Cheek, Kristin L.; Hill, Salisha; Pietenpol, Jennifer A.

    2010-01-01

    Alpha-2 macroglobulin (A2M) functions as a universal protease inhibitor in serum and is capable of binding various cytokines and growth factors. In this study, we investigated if immunoaffinity enrichment and proteomic analysis of A2M protein complexes from human serum could improve detection of biologically relevant and novel candidate protein biomarkers in prostate cancer. Serum samples from six patients with androgen-independent, metastatic prostate cancer and six control patients without malignancy were analyzed by immunoaffinity enrichment of A2M protein complexes and MS identification of associated proteins. Known A2M substrates were reproducibly identified from patient serum in both cohorts, as well as proteins previously undetected in human serum. One example is heat shock protein 90 alpha (HSP90α), which was identified only in the serum of cancer patients in this study. Using an ELISA, the presence of HSP90α in human serum was validated on expanded test cohorts and found to exist in higher median serum concentrations in prostate cancer (n = 18) relative to control (n = 13) patients (median concentrations 50.7 versus 27.6 ng/mL, respectively, p = 0.001). Our results demonstrate the technical feasibility of this approach and support the analysis of A2M protein complexes for proteomic-based serum biomarker discovery. PMID:20107526

  9. Nano and Microparticle-Enhanced Immunosensor Approaches for the Detection of Cancer Biomarker Proteins

    Science.gov (United States)

    Mani, Vigneshwaran

    Accurate, sensitive, point-of-care multiplexed protein measurements are critical for early disease detection and monitoring, impacting biomarker and drug discovery, and personalized medicine. Significant application involves monitoring panels of proteins in the blood that are biomarkers for diagnosing cancer. However, measurements of biomarker panels in blood or other bodily fluids have been slow to integrate into current practice of cancer diagnostics partly due to the lack of technically simple, low-cost, sensitive, point-of-care multiplexed measurement devices, as well as the lack of rigorously validated protein panels. The present thesis in part addresses these limitations by the development of electrochemical and surface plasmon resonance (SPR) immunosensors utilizing 1mum superparamagnetic labels for accurate detection of prostate cancer biomarker proteins in patient serum samples. Electrochemical discrete immunosensors featuring nanostructured surface with densely packed 5 nm glutathione-coated gold nanoparticles coupled with multi-enzyme magnetic particle (MP) labels enabled measurement of prostate specific antigen (PSA) with a detection limit (DL) of 0.5 pg mL-1 in undiluted serum. Such low DLs are attributed to high surface area, conductivity of nanostructured surface, and multi-enzyme signal amplification. DLs are further improved by utilizing MP bioconjugated with more than 100,000 antibody labels to offline capture proteins from the serum sample matrix, minimizing nonspecific binding of interfering proteins on sensor surface before detection. This approach provided an unprecedented 10 fg DL mL-1 for PSA in undiluted serum using a flow SPR biosensor. Finally electrochemical microfluidic immunoarrays featuring nanostructured surface and offline protein capture by multi-label MPs enabled multiplexed detection of prostate cancer biomarkers PSA and interleukin-6 (IL-6). These approaches provided up to 1000-fold lower DLs compared to commercial bead based

  10. Protein Z: A putative novel biomarker for early detection of ovarian cancer.

    Science.gov (United States)

    Russell, Matthew R; Walker, Michael J; Williamson, Andrew J K; Gentry-Maharaj, Aleksandra; Ryan, Andy; Kalsi, Jatinderpal; Skates, Steven; D'Amato, Alfonsina; Dive, Caroline; Pernemalm, Maria; Humphryes, Phillip C; Fourkala, Evangelia-Ourania; Whetton, Anthony D; Menon, Usha; Jacobs, Ian; Graham, Robert L J

    2016-06-15

    Ovarian cancer (OC) has the highest mortality of all gynaecological cancers. Early diagnosis offers an approach to achieving better outcomes. We conducted a blinded-evaluation of prospectively collected preclinical serum from participants in the multimodal group of the United Kingdom Collaborative Trial of Ovarian Cancer Screening. Using isobaric tags (iTRAQ) we identified 90 proteins differentially expressed between OC cases and controls. A second targeted mass spectrometry analysis of twenty of these candidates identified Protein Z as a potential early detection biomarker for OC. This was further validated by ELISA analysis in 482 serial serum samples, from 80 individuals, 49 OC cases and 31 controls, spanning up to 7 years prior to diagnosis. Protein Z was significantly down-regulated up to 2 years pre-diagnosis (p = 0.000000411) in 8 of 19 Type I patients whilst in 5 Type II individuals, it was significantly up-regulated up to 4 years before diagnosis (p = 0.01). ROC curve analysis for CA-125 and CA-125 combined with Protein Z showed a statistically significant (p= 0.00033) increase in the AUC from 77 to 81% for Type I and a statistically significant (p= 0.00003) increase in the AUC from 76 to 82% for Type II. Protein Z is a novel independent early detection biomarker for Type I and Type II ovarian cancer; which can discriminate between both types. Protein Z also adds to CA-125 and potentially the Risk of Ovarian Cancer algorithm in the detection of both subtypes. PMID:26815306

  11. Ultrasensitive, multiplexed detection of cancer biomarkers directly in serum by using a quantum dot-based microfluidic protein chip.

    Science.gov (United States)

    Hu, Mei; Yan, Juan; He, Yao; Lu, Haoting; Weng, Lixing; Song, Shiping; Fan, Chunhai; Wang, Lianhui

    2010-01-26

    Sensitive and selective detection for cancer biomarkers are critical in cancer clinical diagnostics. Here we developed a microfluidic protein chip for an ultrasensitive and multiplexed assay of cancer biomarkers. Aqueous-phase-synthesized CdTe/CdS quantum dots (aqQDs) were employed as fluorescent signal amplifiers to improve the detection sensitivity. Secondary antibodies (goat anti-mouse IgG) were conjugated to luminescent CdTe/CdS QDs to realize a versatile fluorescent probe that could be used for multiplexed detection in both sandwich and reverse phase immunoassays. We found that our microfluidic protein chip not only possessed ultrahigh femtomolar sensitivity for cancer biomarkers, but was selective enough to be directly used in serum. This protein chip thus combines the high-throughput capabilities of a microfluidic network with the high sensitivity and multicolor imaging ability offered by highly fluorescent QDs, which can become a promising diagnostic tool in clinical applications. PMID:20041634

  12. Biomarkers for Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Rikako Ishigamori

    2010-09-01

    Full Text Available Colorectal cancer (CRC is the third most common epithelial malignancy in the world. Since CRC develops slowly from removable precancerous lesions, detection of the lesion at an early stage by regular health examinations can reduce the incidence and mortality of this malignancy. Colonoscopy significantly improves the detection rate of CRC, but the examination is expensive and inconvenient. Therefore, we need novel biomarkers that are non-invasive to enable us to detect CRC quite early. A number of validation studies have been conducted to evaluate genetic, epigenetic or protein markers for identification in the stool and/or serum. Currently, the fecal occult blood test is the most widely used method of screening for CRC. However, advances in genomics and proteomics will lead to the discovery of novel non-invasive biomarkers.

  13. Discovery of dachshund 2 protein as a novel biomarker of poor prognosis in epithelial ovarian cancer

    Directory of Open Access Journals (Sweden)

    Nodin Björn

    2012-01-01

    Full Text Available Abstract Background The Dachshund homolog 2 (DACH2 gene has been implicated in development of the female genital tract in mouse models and premature ovarian failure syndrome, but to date, its expression in human normal and cancerous tissue remains unexplored. Using the Human Protein Atlas as a tool for cancer biomarker discovery, DACH2 protein was found to be differentially expressed in epithelial ovarian cancer (EOC. Here, the expression and prognostic significance of DACH2 was further evaluated in ovarian cancer cell lines and human EOC samples. Methods Immunohistochemical expression of DACH2 was examined in tissue microarrays with 143 incident EOC cases from two prospective, population-based cohorts, including a subset of benign-appearing fallopian tubes (n = 32. A nuclear score (NS, i.e. multiplier of staining fraction and intensity, was calculated. For survival analyses, cases were dichotomized into low (NS 3 using classification and regression tree analysis. Kaplan Meier analysis and Cox proportional hazards modelling were used to assess the impact of DACH2 expression on survival. DACH2 expression was analysed in the cisplatin sensitive ovarian cancer cell line A2780 and its cisplatin resistant derivative A2780-Cp70. The specificity of the DACH2 antibody was tested using siRNA-mediated silencing of DACH2 in A2780-Cp70 cells. Results DACH2 expression was considerably higher in the cisplatin resistant A2780-Cp70 cells compared to the cisplatin-sensitive A2780 cells. While present in all sampled fallopian tubes, DACH2 expression ranged from negative to strong in EOC. In EOC, DACH2 expression correlated with several proteins involved in DNA integrity and repair, and proliferation. DACH2 expression was significantly higher in carcinoma of the serous subtype compared to non-serous carcinoma. In the full cohort, high DACH2 expression was significantly associated with poor prognosis in univariable analysis, and in carcinoma of the serous subtype

  14. Biomarkers of HIV-associated Cancer

    OpenAIRE

    Brian Thabile Flepisi; Patrick Bouic; Gerhard Sissolak; Bernd Rosenkranz

    2014-01-01

    Cancer biomarkers have provided great opportunities for improving the management of cancer patients by enhancing the efficiency of early detection, diagnosis, and efficacy of treatment. Every cell type has a unique molecular signature, referred to as biomarkers, which are identifiable characteristics such as levels or activities of a myriad of genes, proteins, or other molecular features. Biomarkers can facilitate the molecular definition of cancer, provide information about the course of can...

  15. Validation of New Cancer Biomarkers

    DEFF Research Database (Denmark)

    Duffy, Michael J; Sturgeon, Catherine M; Söletormos, Georg; Barak, Vivian; Molina, Rafael; Hayes, Daniel F; Diamandis, Eleftherios P; Bossuyt, Patrick

    2015-01-01

    BACKGROUND: Biomarkers are playing increasingly important roles in the detection and management of patients with cancer. Despite an enormous number of publications on cancer biomarkers, few of these biomarkers are in widespread clinical use. CONTENT: In this review, we discuss the key steps in...... advancing a newly discovered cancer candidate biomarker from pilot studies to clinical application. Four main steps are necessary for a biomarker to reach the clinic: analytical validation of the biomarker assay, clinical validation of the biomarker test, demonstration of clinical value from performance of...... the biomarker test, and regulatory approval. In addition to these 4 steps, all biomarker studies should be reported in a detailed and transparent manner, using previously published checklists and guidelines. Finally, all biomarker studies relating to demonstration of clinical value should be...

  16. Transferrin-bound proteins as potential biomarkers for advanced breast cancer patients

    Directory of Open Access Journals (Sweden)

    Paul Dowling

    2014-12-01

    General significance: Mass spectrometry profiling of Transferrin-bound proteins has revealed serum proteins that can distinguish between serum from advanced breast cancer patients and healthy control subjects with high confidence.

  17. Identification of biomarkers for radiation-induced acute intestinal symptoms (RIAISs) in cervical cancer patients by serum protein profiling

    International Nuclear Information System (INIS)

    Radiation-induced acute intestinal symptoms (RIAISs) are the most frequent complication of radiotherapy that causes great pain and limits the treatment efficacy. The aim of this study was to identify serum biomarkers of RIAISs in cervical cancer patients by surface-enhanced laser desorption/ionization time-of-flight mass spectrometry (SELDI-TOF MS). Serum samples were collected from 66 cervical cancer patients prior to pelvic radiotherapy. In our study, RIAISs occurred in 11 patients. An additional 11 patients without RIAISs were selected as controls, whose age, stage, histological type and treatment methods were matched to RIAISs patients. The 22 sera were subsequently analyzed by SELDI-TOF MS, and the resulting protein profiles were evaluated to identify biomarkers using appropriate bioinformatics tools. Comparing the protein profiles of serum samples from the RIAIS group and the control group, it was found that 22 protein peaks were significantly different (P < 0.05), and six of these peaks with mass-to-charge (m/z) ratios of 7514.9, 4603.94, 6887.41, 2769.21, 3839.72 and 4215.7 were successfully identified. A decision tree model of biomarkers was constructed based on three biomarkers (m/z 1270.88, 1503.23 and 7514.90), which separated RIAIS-affected patients from the control group with an accuracy of 81%. This study suggests that serum proteomic analysis by SELDI-TOF MS can identify cervical cancer patients that are susceptible to RIAISs prior to pelvic radiotherapy. (author)

  18. Novel diagnostic biomarkers for prostate cancer

    Directory of Open Access Journals (Sweden)

    Chikezie O. Madu, Yi Lu

    2010-01-01

    Full Text Available Prostate cancer is the most frequently diagnosed malignancy in American men, and a more aggressive form of the disease is particularly prevalent among African Americans. The therapeutic success rate for prostate cancer can be tremendously improved if the disease is diagnosed early. Thus, a successful therapy for this disease depends heavily on the clinical indicators (biomarkers for early detection of the presence and progression of the disease, as well as the prediction after the clinical intervention. However, the current clinical biomarkers for prostate cancer are not ideal as there remains a lack of reliable biomarkers that can specifically distinguish between those patients who should be treated adequately to stop the aggressive form of the disease and those who should avoid overtreatment of the indolent form.A biomarker is a characteristic that is objectively measured and evaluated as an indicator of normal biologic processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention. A biomarker reveals further information to presently existing clinical and pathological analysis. It facilitates screening and detecting the cancer, monitoring the progression of the disease, and predicting the prognosis and survival after clinical intervention. A biomarker can also be used to evaluate the process of drug development, and, optimally, to improve the efficacy and safety of cancer treatment by enabling physicians to tailor treatment for individual patients. The form of the prostate cancer biomarkers can vary from metabolites and chemical products present in body fluid to genes and proteins in the prostate tissues.Current advances in molecular techniques have provided new tools facilitating the discovery of new biomarkers for prostate cancer. These emerging biomarkers will be beneficial and critical in developing new and clinically reliable indicators that will have a high specificity for the diagnosis and prognosis of

  19. Biomarkers in Prostate Cancer Epidemiology

    Directory of Open Access Journals (Sweden)

    Mudit Verma

    2011-09-01

    Full Text Available Understanding the etiology of a disease such as prostate cancer may help in identifying populations at high risk, timely intervention of the disease, and proper treatment. Biomarkers, along with exposure history and clinical data, are useful tools to achieve these goals. Individual risk and population incidence of prostate cancer result from the intervention of genetic susceptibility and exposure. Biochemical, epigenetic, genetic, and imaging biomarkers are used to identify people at high risk for developing prostate cancer. In cancer epidemiology, epigenetic biomarkers offer advantages over other types of biomarkers because they are expressed against a person’s genetic background and environmental exposure, and because abnormal events occur early in cancer development, which includes several epigenetic alterations in cancer cells. This article describes different biomarkers that have potential use in studying the epidemiology of prostate cancer. We also discuss the characteristics of an ideal biomarker for prostate cancer, and technologies utilized for biomarker assays. Among epigenetic biomarkers, most reports indicate GSTP1 hypermethylation as the diagnostic marker for prostate cancer; however, NKX2-5, CLSTN1, SPOCK2, SLC16A12, DPYS, and NSE1 also have been reported to be regulated by methylation mechanisms in prostate cancer. Current challenges in utilization of biomarkers in prostate cancer diagnosis and epidemiologic studies and potential solutions also are discussed.

  20. Introducing differential expression of human heat shock protein 27 in hepatocellular carcinoma: moving toward identification of cancer biomarker.

    Science.gov (United States)

    Khan, Rizma; Siddiqui, Nadir Naveed; Ul Haq, Ahtesham; Rahman, M Ataur

    2016-01-01

    Previously, it has to be acknowledged that overexpressed heat shock protein B27 (HSPB27) have been implicated in the etiology of wide range of human cancers. However, the molecular mechanism leading to the disease initiation to progression in liver cancer is still unknown. Present work was undertaken to investigate the differentially expressed HSPB27 in association with those damages that lead to liver cancer development. For the identification of liver cancer biomarker, samples were subjected to comparative proteomic analysis using two-dimensional gel electrophoresis (2-DE) and were further validated by Western blot and immunohistochemical analysis. After validation, in silico studies were applied to demonstrate the significantly induced phosphorylated and S-nitrosylated signals. The later included the interacting partner of HSPB27, i.e., mitogen-activated protein kinase-3 and 5 (MAPK3 and 5), ubiquitin C (UBC), v-akt murine thymoma viral oncogene homolog 1 (AKT1), mitogen-activated protein kinase 14 (MAPK14), and tumor protein p53 (TP53), which bestowed with critical capabilities, namely, apoptosis, cell cycling, stress activation, tumor suppression, cell survival, angiogenesis, proliferation, and stress resistance. Taking together, these results shed new light on the potential biomarker HSPB27 that overexpression of HSPB27 did lead to upregulation of their interacting partner that together demonstrate their possible role as a novel tumor progressive agent for the treatment of metastasis in liver cancer. HSPB27 is a promising diagnostic marker for liver cancer although further large-scale studies are required. Also, molecular profiling may help pave the road to the discovery of new therapies. PMID:26242269

  1. Investigation of human cationic antimicrobial protein-18 (hCAP-18), lactoferrin and CD163 as potential biomarkers for ovarian cancer

    DEFF Research Database (Denmark)

    Lim, Ratana; Lappas, Martha; Riley, Clyde;

    2013-01-01

    plasma concentrations of three putative ovarian cancer biomarkers: human cationic antimicrobial protein-18 (hCAP-18); lactoferrin; and CD163 in normal healthy women and women with ovarian cancer. METHODS: In this case-control cohort study, ovarian tissue and blood samples were obtained from 164 women (73...

  2. Nanomaterials based biosensors for cancer biomarker detection

    Science.gov (United States)

    Malhotra, Bansi D.; Kumar, Saurabh; Mouli Pandey, Chandra

    2016-04-01

    Biosensors have enormous potential to contribute to the evolution of new molecular diagnostic techniques for patients suffering with cancerous diseases. A major obstacle preventing faster development of biosensors pertains to the fact that cancer is a highly complex set of diseases. The oncologists currently rely on a few biomarkers and histological characterization of tumors. Some of the signatures include epigenetic and genetic markers, protein profiles, changes in gene expression, and post-translational modifications of proteins. These molecular signatures offer new opportunities for development of biosensors for cancer detection. In this context, conducting paper has recently been found to play an important role towards the fabrication of a biosensor for cancer biomarker detection. In this paper we will focus on results of some of the recent studies obtained in our laboratories relating to fabrication and application of nanomaterial modified paper based biosensors for cancer biomarker detection.

  3. Predictive and Prognostic Protein Biomarkers in Epithelial Ovarian Cancer: Recommendation for Future Studies

    International Nuclear Information System (INIS)

    Epithelial ovarian cancer is the most lethal gynecological malignancy. Due to its lack of symptoms, this disease is diagnosed at an advanced stage when the cancer has already spread to secondary sites. While initial rates of response to first treatment is >80%, the overall survival rate of patients is extremely low, mainly due to development of drug resistance. To date, there are no reliable clinical factors that can properly stratify patients for suitable chemotherapy strategies. Clinical parameters such as disease stage, tumor grade and residual disease, although helpful in the management of patients after their initial surgery to establish the first line of treatment, are not efficient enough. Accordingly, reliable markers that are independent and complementary to clinical parameters are needed for a better management of these patients. For several years, efforts to identify prognostic factors have focused on molecular markers, with a large number having been investigated. This review aims to present a summary of the recent advances in the identification of molecular biomarkers in ovarian cancer patient tissues, as well as an overview of the need and importance of molecular markers for personalized medicine in ovarian cancer

  4. Predictive and Prognostic Protein Biomarkers in Epithelial Ovarian Cancer: Recommendation for Future Studies

    Directory of Open Access Journals (Sweden)

    Cécile Le Page

    2010-05-01

    Full Text Available Epithelial ovarian cancer is the most lethal gynecological malignancy. Due to its lack of symptoms, this disease is diagnosed at an advanced stage when the cancer has already spread to secondary sites. While initial rates of response to first treatment is >80%, the overall survival rate of patients is extremely low, mainly due to development of drug resistance. To date, there are no reliable clinical factors that can properly stratify patients for suitable chemotherapy strategies. Clinical parameters such as disease stage, tumor grade and residual disease, although helpful in the management of patients after their initial surgery to establish the first line of treatment, are not efficient enough. Accordingly, reliable markers that are independent and complementary to clinical parameters are needed for a better management of these patients. For several years, efforts to identify prognostic factors have focused on molecular markers, with a large number having been investigated. This review aims to present a summary of the recent advances in the identification of molecular biomarkers in ovarian cancer patient tissues, as well as an overview of the need and importance of molecular markers for personalized medicine in ovarian cancer.

  5. Identification of Oxidative Stress Related Proteins as Biomarkers for Lung Cancer and Chronic Obstructive Pulmonary Disease in Bronchoalveolar Lavage

    Directory of Open Access Journals (Sweden)

    Amancio Carnero

    2013-02-01

    Full Text Available Lung cancer (LC and chronic obstructive pulmonary disease (COPD commonly coexist in smokers, and the presence of COPD increases the risk of developing LC. Cigarette smoke causes oxidative stress and an inflammatory response in lung cells, which in turn may be involved in COPD and lung cancer development. The aim of this study was to identify differential proteomic profiles related to oxidative stress response that were potentially involved in these two pathological entities. Protein content was assessed in the bronchoalveolar lavage (BAL of 60 patients classified in four groups: COPD, COPD and LC, LC, and control (neither COPD nor LC. Proteins were separated into spots by two dimensional polyacrylamide gel electrophoresis (2D-PAGE and examined by matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF/TOF. A total of 16 oxidative stress regulatory proteins were differentially expressed in BAL samples from LC and/or COPD patients as compared with the control group. A distinct proteomic reactive oxygen species (ROS protein signature emerged that characterized lung cancer and COPD. In conclusion, our findings highlight the role of the oxidative stress response proteins in the pathogenic pathways of both diseases, and provide new candidate biomarkers and predictive tools for LC and COPD diagnosis.

  6. Reverse phase protein array based tumor profiling identifies a biomarker signature for risk classification of hormone receptor-positive breast cancer

    Directory of Open Access Journals (Sweden)

    Johanna Sonntag

    2014-03-01

    Full Text Available A robust subclassification of luminal breast cancer, the most common molecular subtype of human breast cancer, is crucial for therapy decisions. While a part of patients is at higher risk of recurrence and requires chemo-endocrine treatment, the other part is at lower risk and also poorly responds to chemotherapeutic regimens. To approximate the risk of cancer recurrence, clinical guidelines recommend determining histologic grading and abundance of a cell proliferation marker in tumor specimens. However, this approach assigns an intermediate risk to a substantial number of patients and in addition suffers from a high interobserver variability. Therefore, the aim of our study was to identify a quantitative protein biomarker signature to facilitate risk classification. Reverse phase protein arrays (RPPA were used to obtain quantitative expression data for 128 breast cancer relevant proteins in a set of hormone receptor-positive tumors (n = 109. Proteomic data for the subset of histologic G1 (n = 14 and G3 (n = 22 samples were used for biomarker discovery serving as surrogates of low and high recurrence risk, respectively. A novel biomarker selection workflow based on combining three different classification methods identified caveolin-1, NDKA, RPS6, and Ki-67 as top candidates. NDKA, RPS6, and Ki-67 were expressed at elevated levels in high risk tumors whereas caveolin-1 was observed as downregulated. The identified biomarker signature was subsequently analyzed using an independent test set (AUC = 0.78. Further evaluation of the identified biomarker panel by Western blot and mRNA profiling confirmed the proteomic signature obtained by RPPA. In conclusion, the biomarker signature introduced supports RPPA as a tool for cancer biomarker discovery.

  7. A reusable electrochemical immunosensor fabricated using a temperature-responsive polymer for cancer biomarker proteins.

    Science.gov (United States)

    Hong, Wooyoung; Lee, Sooyeon; Jae Kim, Eun; Lee, Maria; Cho, Youngnam

    2016-04-15

    In the present study, we describe a reusable electrochemical immunosensor for the repeated detection of cancer biomarkers using a single platform. The integration of a temperature-responsive polymer on the electrode surface enables easy manipulation of the biological sensing interface (i.e., addition of biotin, streptavidin, and antibody), thus allowing for temperature-induced regeneration and disruption of the interface architecture of the electrode surface. Using our immunosensor, we demonstrate sequential amperometric detection of three tumor markers: CA125, CEA, and PSA. Interestingly, greatly amplified signals are achieved by immersing the immunosensor in a solution of horseradish peroxidase (HRP) and antibody-labeled nanoparticles, resulting in a linear range of 0.0064 to 256 U/mL, 1 pg/mL to 100 ng/mL, and 10 pg/mL to 10 ng/mL with a detection limit of 0.007 U/mL, 0.7 pg/mL, and 0.9 pg/mL for CA125, CEA, and PSA, respectively. By alternating temperature, the immunosensor adsorbs and desorbs the biological elements without damage. Our proposed methodology can be expanded to measure other relevant biological species by repeated detection and thus has enormous potential for industrial and clinical applications. PMID:26606310

  8. Proteomic Approaches for Biomarker Panels in Cancer.

    Science.gov (United States)

    Tanase, Cristiana; Albulescu, Radu; Neagu, Monica

    2016-01-01

    Proteomic technologies remain the main backbone of biomarkers discovery in cancer. The continuous development of proteomic technologies also enlarges the bioinformatics domain, thus founding the main pillars of cancer therapy. The main source for diagnostic/prognostic/therapy monitoring biomarker panels are molecules that have a dual role, being both indicators of disease development and therapy targets. Proteomic technologies, such as mass-spectrometry approaches and protein array technologies, represent the main technologies that can depict these biomarkers. Herein, we will illustrate some of the most recent strategies for biomarker discovery in cancer, including the development of immune-markers and the use of cancer stem cells as target therapy. The challenges of proteomic biomarker discovery need new forms of cross-disciplinary conglomerates that will result in increased and tailored access to treatments for patients; diagnostic companies would benefit from the enhanced co-development of companion diagnostics and pharmaceutical companies. In the technology optimization in biomarkers, immune assays are the leaders of discovery machinery. PMID:26565430

  9. Modulation of circulating protein biomarkers following TRC105 (anti-endoglin antibody) treatment in patients with advanced cancer.

    Science.gov (United States)

    Liu, Yingmiao; Starr, Mark D; Brady, John C; Dellinger, Andrew; Pang, Herbert; Adams, Bonne; Theuer, Charles P; Lee, Nam Y; Hurwitz, Herbert I; Nixon, Andrew B

    2014-06-01

    TRC105 is an endoglin-targeting drug that possesses anti-angiogenic and antitumor potential. Analysis of the initial phase I trial of TRC105 demonstrated good tolerability and efficacy in cancer patients. In this report, we analyzed multiple circulating biomarkers at baseline, cycle 2 day 1 (C2D1), and end of study (EOS) for each patient. The baseline level and the fold change from baseline to both C2D1 and EOS for each marker were statistically analyzed. At C2D1, seven markers were significantly downregulated (angiopoietin-2 [Ang-2], insulin-like growth factor-binding protein-3 [IGFBP-3], plasminogen activator inhibitor-1 [PAI-1] total, platelet-derived growth factor [PDGF]-AA, PDGF-BB, thrombospondin-1 [TSP-1], and vascular endothelial growth factor [VEGF]-D). Meanwhile, seven markers were upregulated by C2D1 (E-Cadherin, soluble Endoglin [sEnd], E-Selectin, interleukin-6 [IL-6], osteopontin [OPN], TSP-2, and von Willebrand factor [vWF]). At EOS, seven markers were upregulated including Ang-2, C-reactive protein (CRP), intercellular adhesion molecule-1 (ICAM-1), IGFBP-1, IL-6, TSP-2, and vascular cell adhesion molecule-1 (VCAM-1). A statistical trend was also seen for increases of VEGF-A and placenta growth factor (PlGF) at EOS. Throughout treatment, sEnd levels significantly increased, an observation that was recapitulated in cultured endothelial cells. This is the first report of plasma-based biomarkers in patients receiving TRC105. TRC105 treatment by C2D1 was associated with decreases in several angiogenic factors, including Ang-2, PDGF isoforms, and VEGF isoforms, offering insight into the mechanisms underlying TRC105's anti-angiogenic, antitumor function. Increases in sEnd were the most significant of all observed biomarker changes and may reflect direct drug effects. Additionally, biomarker changes in response to TRC105 are distinct from those seen in patients treated with VEGF-targeting drugs, suggesting the possible utility of combining these two classes

  10. Modulation of circulating protein biomarkers following TRC105 (anti-endoglin antibody) treatment in patients with advanced cancer

    International Nuclear Information System (INIS)

    TRC105 is an endoglin-targeting drug that possesses anti-angiogenic and antitumor potential. Analysis of the initial phase I trial of TRC105 demonstrated good tolerability and efficacy in cancer patients. In this report, we analyzed multiple circulating biomarkers at baseline, cycle 2 day 1 (C2D1), and end of study (EOS) for each patient. The baseline level and the fold change from baseline to both C2D1 and EOS for each marker were statistically analyzed. At C2D1, seven markers were significantly downregulated (angiopoietin-2 [Ang-2], insulin-like growth factor-binding protein-3 [IGFBP-3], plasminogen activator inhibitor-1 [PAI-1] total, platelet-derived growth factor [PDGF]-AA, PDGF-BB, thrombospondin-1 [TSP-1], and vascular endothelial growth factor [VEGF]-D). Meanwhile, seven markers were upregulated by C2D1 (E-Cadherin, soluble Endoglin [sEnd], E-Selectin, interleukin-6 [IL-6], osteopontin [OPN], TSP-2, and von Willebrand factor [vWF]). At EOS, seven markers were upregulated including Ang-2, C-reactive protein (CRP), intercellular adhesion molecule-1 (ICAM-1), IGFBP-1, IL-6, TSP-2, and vascular cell adhesion molecule-1 (VCAM-1). A statistical trend was also seen for increases of VEGF-A and placenta growth factor (PlGF) at EOS. Throughout treatment, sEnd levels significantly increased, an observation that was recapitulated in cultured endothelial cells. This is the first report of plasma-based biomarkers in patients receiving TRC105. TRC105 treatment by C2D1 was associated with decreases in several angiogenic factors, including Ang-2, PDGF isoforms, and VEGF isoforms, offering insight into the mechanisms underlying TRC105's anti-angiogenic, antitumor function. Increases in sEnd were the most significant of all observed biomarker changes and may reflect direct drug effects. Additionally, biomarker changes in response to TRC105 are distinct from those seen in patients treated with VEGF-targeting drugs, suggesting the possible utility of combining these two

  11. YKL-40—A Protein in the Field of Translational Medicine: A Role as a Biomarker in Cancer Patients?

    International Nuclear Information System (INIS)

    YKL-40 is a 40 kDa glycoprotein produced by cancer cells, inflammatory cells and stem cells. It probably has a role in cell proliferation and differentiation, inflammation, protection against apoptosis, stimulation of angiogenesis, and regulation of extracellular tissue remodelling. Plasma levels of YKL-40 are often elevated in patients with localized or advanced cancer compared to age-matched healthy subjects. Several studies have demonstrated that high plasma YKL-40 is an independent prognostic biomarker of short survival in patients with different types of cancer. However, there is not yet sufficient data to support determination of plasma YKL-40 outside research projects as a biomarker for screening of gastrointestinal cancer and determination of treatment response and poor prognosis before or during treatment and follow-up. Plasma YKL-40 is also elevated in patients with other diseases than cancer, e.g., severe infections, cardiovascular disease, diabetes, chronic obstructive lung disease, asthma, liver fibrosis and rheumatoid arthritis. Co-morbidity should therefore always be considered in patients with cancer, since other sources than cancer cells can increase plasma YKL-40 levels. Future focused translational research projects combining basic and clinical research are needed in a joint effort to answer questions of the complex function and regulation of YKL-40 and the question if plasma YKL-40 is a clinical useful biomarker in patients with cancer

  12. YKL-40—A Protein in the Field of Translational Medicine: A Role as a Biomarker in Cancer Patients?

    Energy Technology Data Exchange (ETDEWEB)

    Schultz, Nicolai A. [Departments of Surgical Gastroenterology, Herlev Hospital, University of Copenhagen, Herlev Ringvej 75, DK-2730 Herlev (Denmark); Johansen, Julia S., E-mail: julia.johansen@post3.tele.dk [Departments of Oncology, Herlev Hospital, University of Copenhagen, Herlev Ringvej 75, DK-2730 Herlev (Denmark); Departments of Medicine, Herlev Hospital, University of Copenhagen, Herlev Ringvej 75, DK-2730 Herlev (Denmark)

    2010-07-12

    YKL-40 is a 40 kDa glycoprotein produced by cancer cells, inflammatory cells and stem cells. It probably has a role in cell proliferation and differentiation, inflammation, protection against apoptosis, stimulation of angiogenesis, and regulation of extracellular tissue remodelling. Plasma levels of YKL-40 are often elevated in patients with localized or advanced cancer compared to age-matched healthy subjects. Several studies have demonstrated that high plasma YKL-40 is an independent prognostic biomarker of short survival in patients with different types of cancer. However, there is not yet sufficient data to support determination of plasma YKL-40 outside research projects as a biomarker for screening of gastrointestinal cancer and determination of treatment response and poor prognosis before or during treatment and follow-up. Plasma YKL-40 is also elevated in patients with other diseases than cancer, e.g., severe infections, cardiovascular disease, diabetes, chronic obstructive lung disease, asthma, liver fibrosis and rheumatoid arthritis. Co-morbidity should therefore always be considered in patients with cancer, since other sources than cancer cells can increase plasma YKL-40 levels. Future focused translational research projects combining basic and clinical research are needed in a joint effort to answer questions of the complex function and regulation of YKL-40 and the question if plasma YKL-40 is a clinical useful biomarker in patients with cancer.

  13. YKL-40—A Protein in the Field of Translational Medicine: A Role as a Biomarker in Cancer Patients?

    Directory of Open Access Journals (Sweden)

    Julia S. Johansen

    2010-07-01

    Full Text Available YKL-40 is a 40 kDa glycoprotein produced by cancer cells, inflammatory cells and stem cells. It probably has a role in cell proliferation and differentiation, inflammation, protection against apoptosis, stimulation of angiogenesis, and regulation of extracellular tissue remodelling. Plasma levels of YKL-40 are often elevated in patients with localized or advanced cancer compared to age-matched healthy subjects. Several studies have demonstrated that high plasma YKL-40 is an independent prognostic biomarker of short survival in patients with different types of cancer. However, there is not yet sufficient data to support determination of plasma YKL-40 outside research projects as a biomarker for screening of gastrointestinal cancer and determination of treatment response and poor prognosis before or during treatment and follow-up. Plasma YKL-40 is also elevated in patients with other diseases than cancer, e.g., severe infections, cardiovascular disease, diabetes, chronic obstructive lung disease, asthma, liver fibrosis and rheumatoid arthritis. Co-morbidity should therefore always be considered in patients with cancer, since other sources than cancer cells can increase plasma YKL-40 levels. Future focused translational research projects combining basic and clinical research are needed in a joint effort to answer questions of the complex function and regulation of YKL-40 and the question if plasma YKL-40 is a clinical useful biomarker in patients with cancer.

  14. Influence of dietary protein sources on putative in vitro and in vivo colon cancer biomarkers

    NARCIS (Netherlands)

    Vis, E.J.

    2002-01-01

    Colon cancer (cancer of the large intestine) is a worldwide problem in especially Western countries. The diet might be responsible for up to 90% of these colon cancer cases. This means that decreasing colon cancer risk should be possible by changing the diet. The research presented in this thesis co

  15. Identification of Biomarkers for Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Anna Meiliana

    2014-12-01

    Full Text Available BACKGROUND: Prostate cancer (PCa was the second most common type of cancer and the fifth leading cause of cancer-related death in men. The great challenge for physicians is being able to accurately predict PCa prognosis and treatment response in order to reduce PCa-speciic mortality while avoiding overtreatment by identifying of when to intervene, and in which patients. CONTENT: Currently, PCa prognosis and treatment decision of PCa involved digital rectal examination, Prostate-Speciic Antigens (PSA, and subsequent biopsies for histopathological staging, known as Gleason score. However, each procedure has its shortcomings. Efforts to find a better clinically meaningful and non-invasive biomarkers still developed involving proteins, circulating tumor cells, nucleic acids, and the ‘omics' approaches. SUMMARY: Biomarkers for PCa will most likely be an assay employing multiple biomarkers in combination using protein and gene microarrays, containing markers that are differentially expressed in PCa. KEYWORDS: prostate cancer, PSA, biomarkers, nomograms, miRNA, proteomic, genomic, metabolomic.

  16. Using Aptamers for Cancer Biomarker Discovery

    Directory of Open Access Journals (Sweden)

    Yun Min Chang

    2013-01-01

    Full Text Available Aptamers are single-stranded synthetic DNA- or RNA-based oligonucleotides that fold into various shapes to bind to a specific target, which includes proteins, metals, and molecules. Aptamers have high affinity and high specificity that are comparable to that of antibodies. They are obtained using iterative method, called (Systematic Evolution of Ligands by Exponential Enrichment SELEX and cell-based SELEX (cell-SELEX. Aptamers can be paired with recent advances in nanotechnology, microarray, microfluidics, and other technologies for applications in clinical medicine. One particular area that aptamers can shed a light on is biomarker discovery. Biomarkers are important in diagnosis and treatment of cancer. In this paper, we will describe ways in which aptamers can be used to discover biomarkers for cancer diagnosis and therapeutics.

  17. Investigation of human cationic antimicrobial protein-18 (hCAP-18, lactoferrin and CD163 as potential biomarkers for ovarian cancer

    Directory of Open Access Journals (Sweden)

    Lim Ratana

    2013-01-01

    Full Text Available Abstract Background Epithelial ovarian cancer is one of the leading causes of gynaecological cancer morbidity and mortality in women. Early stage ovarian cancer is usually asymptomatic, therefore, is often first diagnosed when it is widely disseminated. Currently available diagnostics lack the requisite sensitivity and specificity to be implemented as community-based screening tests. The identification of additional biomarkers may improve the diagnostic efficiency of multivariate index assays. The aims of this study were to characterise and compare the ovarian tissue immunohistochemical localisation and plasma concentrations of three putative ovarian cancer biomarkers: human cationic antimicrobial protein-18 (hCAP-18; lactoferrin; and CD163 in normal healthy women and women with ovarian cancer. Methods In this case–control cohort study, ovarian tissue and blood samples were obtained from 164 women (73 controls, including 28 women with benign pelvic masses; 91 cancer, including 21 women with borderline tumours. Localisation of each antigen within the ovary was assessed by immunohistochemistry and serum concentrations determined by ELISA assays. Results Immunoreactive (ir hCAP-18 and lactoferrin were identified in epithelial cells, while CD163 was predominately localised in stromal cells. Tissue ir CD163 increased significantly (PP Conclusions The data obtained in this study establishes the localisation and concentrations of CD163, hCAP-18, and lactoferrin in ovarian tumours and peripheral blood. Individually, the 3 biomarkers display only modest diagnostic efficiency as assessed by AUC. When combined in a multivariate index assay, however, diagnostic efficiency increases significantly. As such, the utility of the biomarker panel, as an aid in the diagnosis of cancer in symptomatic women, is worthy of further investigation in a larger phase 2 biomarker trial.

  18. YKL-40—A Protein in the Field of Translational Medicine: A Role as a Biomarker in Cancer Patients?

    DEFF Research Database (Denmark)

    Schultz, Nicolai A; Johansen, Julia S

    2010-01-01

    sufficient data to support determination of plasma YKL-40 outside research projects as a biomarker for screening of gastrointestinal cancer and determination of treatment response and poor prognosis before or during treatment and follow-up. Plasma YKL-40 is also elevated in patients with other diseases than...... cancer, e.g., severe infections, cardiovascular disease, diabetes, chronic obstructive lung disease, asthma, liver fibrosis and rheumatoid arthritis. Co-morbidity should therefore always be considered in patients with cancer, since other sources than cancer cells can increase plasma YKL-40 levels. Future...

  19. Searching for early breast cancer biomarkers by serum protein profiling of pre-diagnostic serum; a nested case-control study

    International Nuclear Information System (INIS)

    Serum protein profiles have been investigated frequently to discover early biomarkers for breast cancer. So far, these studies used biological samples collected at or after diagnosis. This may limit these studies' value in the search for cancer biomarkers because of the often advanced tumor stage, and consequently risk of reverse causality. We present for the first time pre-diagnostic serum protein profiles in relation to breast cancer, using the Prospect-EPIC (European Prospective Investigation into Cancer and nutrition) cohort. In a nested case-control design we compared 68 women diagnosed with breast cancer within three years after enrollment, with 68 matched controls for differences in serum protein profiles. All samples were analyzed with SELDI-TOF MS (surface enhanced laser desorption/ionization time-of-flight mass spectrometry). In a subset of 20 case-control pairs, the serum proteome was identified and relatively quantified using isobaric Tags for Relative and Absolute Quantification (iTRAQ) and online two-dimensional nano-liquid chromatography coupled with tandem MS (2D-nanoLC-MS/MS). Two SELDI-TOF MS peaks with m/z 3323 and 8939, which probably represent doubly charged apolipoprotein C-I and C3a des-arginine anaphylatoxin (C3adesArg), were higher in pre-diagnostic breast cancer serum (p = 0.02 and p = 0.06, respectively). With 2D-nanoLC-MS/MS, afamin, apolipoprotein E and isoform 1 of inter-alpha trypsin inhibitor heavy chain H4 (ITIH4) were found to be higher in pre-diagnostic breast cancer (p < 0.05), while alpha-2-macroglobulin and ceruloplasmin were lower (p < 0.05). C3adesArg and ITIH4 have previously been related to the presence of symptomatic and/or mammographically detectable breast cancer. We show that serum protein profiles are already altered up to three years before breast cancer detection

  20. Acoustic wave biosensor for the detection of the breast and prostate cancer metastasis biomarker protein PTHrP.

    Science.gov (United States)

    Crivianu-Gaita, Victor; Aamer, Mohamed; Posaratnanathan, Roy T; Romaschin, Alexander; Thompson, Michael

    2016-04-15

    There are currently no biosensors that are able to reliably detect the process of cancer metastasis. We describe the first label-free real-time ultra-high frequency acoustic wave biosensor prototype capable of detecting the breast and prostate cancer metastasis biomarker, parathyroid hormone-related peptide (PTHrP). Two different linkers - 11-trichlorosilyl-undecanoic acid pentafluorophenyl ester (PFP) and S-(11-trichlorosilyl-undecanyl)-benzothiosulfonate (TUBTS) - were used to immobilize whole anti-PTHrP antibodies and Fab' fragments to surfaces as biorecognition elements. The biosensor surfaces were optimized using X-ray photoelectron spectroscopy (XPS) and the ultra-high frequency electromagnetic piezoelectric acoustic sensor (EMPAS). One optimized whole antibody-based surface (PFP/protein G'/whole antibodies/ethanolamine) and one optimized Fab' fragment-based surface (TUBTS/Fab' fragments) were tested as biosensors. It was determined that an in-line injection of bovine serum albumin prior to analyte injection yielded the most minimally fouling surfaces. Each surface was tested with no mass amplification and with sandwich-type secondary antibody mass amplification. The whole antibody-based mass-amplified biosensor yielded the lowest limit of detection (61 ng/mL), highest sensitivity, and a linear range from 61 ng/mL to 100 μg/mL. However, the Fab' fragment-based biosensor displayed better regenerability as a loss of ~20% of the initial analyte signal intensity was observed with each subsequent injection. The whole antibody-based biosensor was only capable of producing an analyte signal in the first injection. PMID:26594891

  1. Predictive and Prognostic Protein Biomarkers in Epithelial Ovarian Cancer: Recommendation for Future Studies

    OpenAIRE

    Le Page, Cécile; David G Huntsman; Provencher, Diane M; Mes-Masson, Anne-Marie

    2010-01-01

    Epithelial ovarian cancer is the most lethal gynecological malignancy. Due to its lack of symptoms, this disease is diagnosed at an advanced stage when the cancer has already spread to secondary sites. While initial rates of response to first treatment is >80%, the overall survival rate of patients is extremely low, mainly due to development of drug resistance. To date, there are no reliable clinical factors that can properly stratify patients for suitable chemotherapy strategies. Clinical pa...

  2. Predictive and Prognostic Protein Biomarkers in Epithelial Ovarian Cancer: Recommendation for Future Studies

    OpenAIRE

    Cécile Le Page; David G Huntsman; Provencher, Diane M; Anne-Marie Mes-Masson

    2010-01-01

    Epithelial ovarian cancer is the most lethal gynecological malignancy. Due to its lack of symptoms, this disease is diagnosed at an advanced stage when the cancer has already spread to secondary sites. While initial rates of response to first treatment is >80%, the overall survival rate of patients is extremely low, mainly due to development of drug resistance. To date, there are no reliable clinical factors that can properly stratify patients for suitable chemotherapy strategies. Clinical...

  3. Elevated expression of the centromere protein-A(CENP-A)-encoding gene as a prognostic and predictive biomarker in human cancers.

    Science.gov (United States)

    Sun, Xia; Clermont, Pier-Luc; Jiao, Wenlin; Helgason, Cheryl D; Gout, Peter W; Wang, Yuzhuo; Qu, Sifeng

    2016-08-15

    Centromere protein-A (CENP-A), a histone-H3 variant, plays an essential role in cell division by ensuring proper formation and function of centromeres and kinetochores. Elevated CENP-A expression has been associated with cancer development. This study aimed to establish whether elevated CENP-A expression can be used as a prognostic and predictive cancer biomarker. Molecular profiling of CENP-A in human cancers was investigated using genomic, transcriptomic and patient information from databases, including COSMIC, Oncomine, Kaplan-Meier plotter and cBioPortal. A network of CENP-A co-expressed genes was derived from cBioPortal and analyzed using Ingenuity Pathway Analysis (IPA) and Oncomine protocols to explore the function of CENP-A and its predictive potential. Transcriptional and post-transcriptional regulation of CENP-A expression was analyzed in silico. It was found that CENP-A expression was elevated in 20 types of solid cancer compared with normal counterparts. Elevated CENP-A expression highly correlated with cancer progression and poor patient outcome. Genomic analysis indicated that the elevated CENP-A expression was not due to alterations in the sequence or copy number of the CENP-A gene. Furthermore, CENP-A can be regulated by key oncogenic proteins and tumor-suppressive microRNAs. CENP-A co-expression network analysis indicated that CENP-A function is associated with cell cycle progression. Oncomine analysis showed a strong correlation between elevated CENP-A expression and oncolytic response of breast cancer patients to taxane-based chemotherapy. In conclusion, elevated CENP-A expression is coupled to malignant progression of numerous types of cancer. It may be useful as a biomarker of poor patient prognosis and as a predictive biomarker for taxane-based chemotherapy. PMID:27062469

  4. Ovarian cancer biomarkers as diagnostic triage tests

    Directory of Open Access Journals (Sweden)

    Jordan SM

    2013-02-01

    Full Text Available Sara M Jordan, Robert E BristowDivision of Gynecologic Oncology, University of California, Irvine Medical Center, Orange, CA, USAAbstract: Ovarian cancer survival improves with accurate surgical staging, maximal tumor removal, and appropriate adjuvant chemotherapy. Therefore, survival is higher among patients managed by a gynecologic oncologist trained in these surgical techniques. Unfortunately, identifying patients preoperatively for referral to a gynecologic oncologist is often challenging, given that there are no definitive noninvasive diagnostic tests to triage patients with an adnexal mass to a surgical subspecialist. Inaccurate preoperative diagnosis of an adnexal mass frequently results in either unnecessary surgery for a benign mass or inadequate surgical staging for a malignant mass, with a subsequent negative effect on overall survival. Several recent tests have been investigated to improve the preoperative diagnosis of women presenting with adnexal masses. Cancer antigen 125 is the most commonly used serum marker for screening and monitoring of ovarian cancer, but is elevated in many benign conditions and falsely normal in 50% of early-stage epithelial ovarian cancers. The relatively low sensitivity and specificity of CA125 has driven researchers to identify new biomarkers and algorithms to assist with triaging adnexal masses. A promising new biomarker, human epididymis protein 4, has been developed to monitor for recurrence of ovarian cancer. Three algorithms have also been developed, ie, risk of malignancy index, risk of ovarian malignancy algorithm, and OVA-1, which is the first diagnostic algorithm that combines multiple biomarkers for the purpose of triaging adnexal masses to be approved by the US Food and Drug Administration.Keywords: ovarian cancer, biomarkers, CA125, RMI, ROMA, HE4, OVA-1

  5. Biological Networks for Cancer Candidate Biomarkers Discovery

    Science.gov (United States)

    Yan, Wenying; Xue, Wenjin; Chen, Jiajia; Hu, Guang

    2016-01-01

    Due to its extraordinary heterogeneity and complexity, cancer is often proposed as a model case of a systems biology disease or network disease. There is a critical need of effective biomarkers for cancer diagnosis and/or outcome prediction from system level analyses. Methods based on integrating omics data into networks have the potential to revolutionize the identification of cancer biomarkers. Deciphering the biological networks underlying cancer is undoubtedly important for understanding the molecular mechanisms of the disease and identifying effective biomarkers. In this review, the networks constructed for cancer biomarker discovery based on different omics level data are described and illustrated from recent advances in the field.

  6. Biological Networks for Cancer Candidate Biomarkers Discovery.

    Science.gov (United States)

    Yan, Wenying; Xue, Wenjin; Chen, Jiajia; Hu, Guang

    2016-01-01

    Due to its extraordinary heterogeneity and complexity, cancer is often proposed as a model case of a systems biology disease or network disease. There is a critical need of effective biomarkers for cancer diagnosis and/or outcome prediction from system level analyses. Methods based on integrating omics data into networks have the potential to revolutionize the identification of cancer biomarkers. Deciphering the biological networks underlying cancer is undoubtedly important for understanding the molecular mechanisms of the disease and identifying effective biomarkers. In this review, the networks constructed for cancer biomarker discovery based on different omics level data are described and illustrated from recent advances in the field. PMID:27625573

  7. LIBP-Pred: web server for lipid binding proteins using structural network parameters; PDB mining of human cancer biomarkers and drug targets in parasites and bacteria.

    Science.gov (United States)

    González-Díaz, Humberto; Munteanu, Cristian R; Postelnicu, Lucian; Prado-Prado, Francisco; Gestal, Marcos; Pazos, Alejandro

    2012-03-01

    Lipid-Binding Proteins (LIBPs) or Fatty Acid-Binding Proteins (FABPs) play an important role in many diseases such as different types of cancer, kidney injury, atherosclerosis, diabetes, intestinal ischemia and parasitic infections. Thus, the computational methods that can predict LIBPs based on 3D structure parameters became a goal of major importance for drug-target discovery, vaccine design and biomarker selection. In addition, the Protein Data Bank (PDB) contains 3000+ protein 3D structures with unknown function. This list, as well as new experimental outcomes in proteomics research, is a very interesting source to discover relevant proteins, including LIBPs. However, to the best of our knowledge, there are no general models to predict new LIBPs based on 3D structures. We developed new Quantitative Structure-Activity Relationship (QSAR) models based on 3D electrostatic parameters of 1801 different proteins, including 801 LIBPs. We calculated these electrostatic parameters with the MARCH-INSIDE software and they correspond to the entire protein or to specific protein regions named core, inner, middle, and surface. We used these parameters as inputs to develop a simple Linear Discriminant Analysis (LDA) classifier to discriminate 3D structure of LIBPs from other proteins. We implemented this predictor in the web server named LIBP-Pred, freely available at , along with other important web servers of the Bio-AIMS portal. The users can carry out an automatic retrieval of protein structures from PDB or upload their custom protein structural models from their disk created with LOMETS server. We demonstrated the PDB mining option performing a predictive study of 2000+ proteins with unknown function. Interesting results regarding the discovery of new Cancer Biomarkers in humans or drug targets in parasites have been discussed here in this sense. PMID:22234525

  8. A three-protein biomarker panel assessed in diagnostic tissue predicts death from prostate cancer for men with localized disease

    International Nuclear Information System (INIS)

    Only a minority of prostate cancers lead to death. Because no tissue biomarkers of aggressiveness other than Gleason score are available at diagnosis, many nonlethal cancers are treated aggressively. We evaluated whether a panel of biomarkers, associated with a range of disease outcomes in previous studies, could predict death from prostate cancer for men with localized disease. Using a case-only design, subjects were identified from three Australian epidemiological studies. Men who had died of their disease, “cases” (N = 83), were matched to “referents” (N = 232), those who had not died of prostate cancer, using incidence density sampling. Diagnostic tissue was retrieved to assess expression of AZGP1, MUC1, NKX3.1, p53, and PTEN by semiquantitative immunohistochemistry (IHC). Poisson regression was used to estimate mortality rate ratios (MRRs) adjusted for age, Gleason score, and stage and to estimate survival probabilities. Expression of MUC1 and p53 was associated with increased mortality (MRR 2.51, 95% CI 1.14–5.54, P = 0.02 and 3.08, 95% CI 1.41–6.95, P = 0.005, respectively), whereas AZGP1 expression was associated with decreased mortality (MRR 0.44, 95% CI 0.20–0.96, P = 0.04). Analyzing all markers under a combined model indicated that the three markers were independent predictors of prostate cancer death and survival. For men with localized disease at diagnosis, assessment of AZGP1, MUC1, and p53 expression in diagnostic tissue by IHC could potentially improve estimates of risk of dying from prostate cancer based only on Gleason score and clinical stage

  9. Epigenetic biomarkers in esophageal cancer.

    Science.gov (United States)

    Kaz, Andrew M; Grady, William M

    2014-01-28

    The aberrant DNA methylation of tumor suppressor genes is well documented in esophageal cancer, including adenocarcinoma (EAC) and squamous cell carcinoma (ESCC) as well as in Barrett's esophagus (BE), a pre-malignant condition that is associated with chronic acid reflux. BE is a well-recognized risk factor for the development of EAC, and consequently the standard of care is for individuals with BE to be placed in endoscopic surveillance programs aimed at detecting early histologic changes that associate with an increased risk of developing EAC. Yet because the absolute risk of EAC in individuals with BE is minimal, a clinical need in the management of BE is the identification of additional risk markers that will indicate individuals who are at a significant absolute risk of EAC so that they may be subjected to more intensive surveillance. The best currently available risk marker is the degree of dysplasia in endoscopic biopsies from the esophagus; however, this marker is suboptimal for a variety of reasons. To date, there are no molecular biomarkers that have been translated to widespread clinical practice. The search for biomarkers, including hypermethylated genes, for either the diagnosis of BE, EAC, or ESCC or for risk stratification for the development of EAC in those with BE is currently an area of active research. In this review, we summarize the status of identified candidate epigenetic biomarkers for BE, EAC, and ESCC. Most of these aberrantly methylated genes have been described in the context of early detection or diagnostic markers; others might prove useful for estimating prognosis or predicting response to treatment. Finally, special attention will be paid to some of the challenges that must be overcome in order to develop clinically useful esophageal cancer biomarkers. PMID:22406828

  10. Modulation of circulating protein biomarkers following TRC105 (anti-endoglin antibody) treatment in patients with advanced cancer

    OpenAIRE

    Liu, Yingmiao; Starr, Mark D.; Brady, John C; Dellinger, Andrew; Pang, Herbert; Adams, Bonne; Theuer, Charles P.; Lee, Nam Y.; Hurwitz, Herbert I.; Nixon, Andrew B.

    2014-01-01

    TRC105 is an endoglin-targeting drug that possesses anti-angiogenic and antitumor potential. Analysis of the initial phase I trial of TRC105 demonstrated good tolerability and efficacy in cancer patients. In this report, we analyzed multiple circulating biomarkers at baseline, cycle 2 day 1 (C2D1), and end of study (EOS) for each patient. The baseline level and the fold change from baseline to both C2D1 and EOS for each marker were statistically analyzed. At C2D1, seven markers were significa...

  11. Inconvenient truth: cancer biomarker development by using proteomics.

    Science.gov (United States)

    Kondo, Tadashi

    2014-05-01

    A biomarker is a crucial tool for measuring the progress of disease and the effects of treatment for better clinical outcomes in cancer patients. Diagnostic, predictive, and prognostic biomarkers are required in various clinical settings. The proteome, a functional translation of the genome, is considered a rich source of biomarkers; therefore, sizable time and funding have been spent in proteomics to develop biomarkers. Although significant progress has been made in technologies toward comprehensive protein expression profiling, and many biomarker candidates published, none of the reported biomarkers have proven to be beneficial for cancer patients. The present deceleration in biomarker research can be attributed to technical limitations. Additional efforts are required to further technical progress; however, there are many examples demonstrating that problems in biomarker research are not so much with the technology but in the study design. In the study of biomarkers for early diagnosis, candidates are screened and validated by comparing cases and controls of similar sample size, and the low prevalence of disease is often ignored. Although it is reasonable to take advantage of multiple rather than single biomarkers when studying diverse disease mechanisms, the annotation of individual components of reported multiple biomarkers does not often explain the variety of molecular events underlying the clinical observations. In tissue biomarker studies, the heterogeneity of disease tissues and pathological observations are often not considered, and tissues are homogenized as a whole for protein extraction. In addition to the challenge of technical limitations, the fundamental aspects of biomarker development in a disease study need to be addressed. This article is part of a Special Issue entitled: Biomarkers: A Proteomic Challenge. PMID:23896458

  12. A New Serum Biomarker for Lung Cancer - Transthyretin

    Directory of Open Access Journals (Sweden)

    Liyun LIU

    2009-04-01

    Full Text Available Background and objective Lung cancer is the leading cause of cancer death worldwide and very few specific biomarkers could be used in clinical diagnosis at present. The aim of this study is to find novel potential serum biomarkers for lung cancer using Surface Enhanced Laser Desorption/Ionization (SELDI technique. Methods Serumsample of 227 cases including 146 lung cancer, 13 pneumonia, 28 tuberculous pleurisy and 40 normal individuals were analyzed by CM10 chips. The candidate biomarkers were identified by ESI/MS-MS and database searching, and further confirmed by immunoprecipitation. The same sets of serum sample from all groups were re-measured by ELISA assay. Results Three protein peaks with the molecular weight 13.78 kDa, 13.90 kDa and 14.07 kDa were found significantlydecreased in lung cancer serum compared to the other groups and were all automatically selected as specific biomarkers by Biomarker Wizard software. The candidate biomarkers obtained from 1-D SDS gel bands by matching the molecular weight with peaks on CM10 chips were identified by Mass spectrometry as the native transthyretin (nativeTTR, cysTTR and glutTTR, and the identity was further validated by immunoprecipitation using commercial TTR antibodies. Downregulated of TTR was found in both ELISA and SELDI analysis. Conclusion TTRs acted as the potentially useful biomarkers for lung cancer by SELDI technique.

  13. Biomarkers in precision therapy in colorectal cancer

    OpenAIRE

    Reimers, Marlies S.; Zeestraten, Eliane C.M.; Kuppen, Peter J.K.; Liefers, Gerrit Jan; van de Velde, Cornelis J. H.

    2013-01-01

    Colorectal cancer (CRC) is the most commonly diagnosed cancer in Europe. Because CRC is also a major cause of cancer-related deaths worldwide, a lot of research has been focused on the discovery and development of biomarkers to improve the diagnostic process and to predict treatment outcomes. Up till now only a few biomarkers are recommended by expert panels. Current TNM criteria, however, cause substantial under- and overtreatment of CRC patients. Consequently, there is a growing need for ne...

  14. New serum biomarkers for prostate cancer diagnosis

    OpenAIRE

    Chadha, Kailash C.; Austin Miller; Nair, Bindukumar B.; Schwartz, Stanley A.; Trump, Donald L.; Willie Underwood

    2014-01-01

    Background: Prostate-specific antigen (PSA) is currently used as a biomarker for diagnosis and management of prostate cancer (CaP). However, PSA typically lacks the sensitivity and specificity desired of a diagnostic marker. Objective: The goal of this study was to identify an additional biomarker or a panel of biomarkers that is more sensitive and specific than PSA in differentiating benign versus malignant prostate disease and/or localized CaP versus metastatic CaP. Methods: Concurrent meas...

  15. Colorectal Cancer Biomarkers: Where Are We Now?

    Directory of Open Access Journals (Sweden)

    Maria Gonzalez-Pons

    2015-01-01

    Full Text Available Colorectal cancer is one of the major causes of cancer-related death in the Western world. Patient survival is highly dependent on the tumor stage at the time of diagnosis. Reduced sensitivity to chemotherapy is still a major obstacle in effective treatment of advanced disease. Due to the fact that colorectal cancer is mostly asymptomatic until it progresses to advanced stages, the implementation of screening programs aimed at early detection is essential to reduce incidence and mortality rates. Current screening and diagnostic methods range from semi-invasive procedures such as colonoscopy to noninvasive stool-based tests. The combination of the absence of symptoms, the semi-invasive nature of currently used methods, and the suboptimal accuracy of fecal blood tests results in colorectal cancer diagnosis at advanced stages in a significant number of individuals. Alterations in gene expression leading to colorectal carcinogenesis are reflected in dysregulated levels of nucleic acids and proteins, which can be used for the development of novel, minimally invasive molecular biomarkers. The purpose of this review is to discuss the commercially available colorectal cancer molecular diagnostic methods as well as to highlight some of the new candidate predictive and prognostic molecular markers for tumor, stool, and blood samples.

  16. DNA Methylation Biomarkers: Cancer and Beyond

    Directory of Open Access Journals (Sweden)

    Thomas Mikeska

    2014-09-01

    Full Text Available Biomarkers are naturally-occurring characteristics by which a particular pathological process or disease can be identified or monitored. They can reflect past environmental exposures, predict disease onset or course, or determine a patient’s response to therapy. Epigenetic changes are such characteristics, with most epigenetic biomarkers discovered to date based on the epigenetic mark of DNA methylation. Many tissue types are suitable for the discovery of DNA methylation biomarkers including cell-based samples such as blood and tumor material and cell-free DNA samples such as plasma. DNA methylation biomarkers with diagnostic, prognostic and predictive power are already in clinical trials or in a clinical setting for cancer. Outside cancer, strong evidence that complex disease originates in early life is opening up exciting new avenues for the detection of DNA methylation biomarkers for adverse early life environment and for estimation of future disease risk. However, there are a number of limitations to overcome before such biomarkers reach the clinic. Nevertheless, DNA methylation biomarkers have great potential to contribute to personalized medicine throughout life. We review the current state of play for DNA methylation biomarkers, discuss the barriers that must be crossed on the way to implementation in a clinical setting, and predict their future use for human disease.

  17. Genomic Biomarkers for Breast Cancer Risk.

    Science.gov (United States)

    Walsh, Michael F; Nathanson, Katherine L; Couch, Fergus J; Offit, Kenneth

    2016-01-01

    Clinical risk assessment for cancer predisposition includes a three-generation pedigree and physical examination to identify inherited syndromes. Additionally genetic and genomic biomarkers may identify individuals with a constitutional basis for their disease that may not be evident clinically. Genomic biomarker testing may detect molecular variations in single genes, panels of genes, or entire genomes. The strength of evidence for the association of a genomic biomarker with disease risk may be weak or strong. The factors contributing to clinical validity and utility of genomic biomarkers include functional laboratory analyses and genetic epidemiologic evidence. Genomic biomarkers may be further classified as low, moderate or highly penetrant based on the likelihood of disease. Genomic biomarkers for breast cancer are comprised of rare highly penetrant mutations of genes such as BRCA1 or BRCA2, moderately penetrant mutations of genes such as CHEK2, as well as more common genomic variants, including single nucleotide polymorphisms, associated with modest effect sizes. When applied in the context of appropriate counseling and interpretation, identification of genomic biomarkers of inherited risk for breast cancer may decrease morbidity and mortality, allow for definitive prevention through assisted reproduction, and serve as a guide to targeted therapy . PMID:26987529

  18. Electrochemical immunoassay for the protein biomarker mucin 1 and for MCF-7 cancer cells based on signal enhancement by silver nanoclusters

    International Nuclear Information System (INIS)

    An electrochemical immunoassay is described for the detection of the protein biomarker mucin 1 (MUC-1) and of breast cancer cells of type MCF-7 where MUC-1 is over expressed. The method is based on the use of silver nanoclusters (Ag-NCs) acting as a signalling probe. The Ag-NCs were synthesized via chemical reduction in the presence of a DNA strand with the sequence of 5′-GCAGTTGATCCTTTGGATACCCTGG-C12-3′. The strand contains mucin 1 aptamer (GCAGTTGATCCTTTGGATACCCTGG) that can specifically bind to MUC1 and the template (C12) for synthesis of Ag-NCs. The assay involves the following steps: (1) Construction of an immunosensor by immobilizing the antibody against MUC-1 on a glassy carbon electrode; (2) addition of sample containing MUC-1; (3) addition of Ag-NCs; (4) signal amplification via silver enhancement process (deposition of metal silver on Ag-NCs); (5) measurement via square wave voltammetry. The current measured at a potential of 0.11 V (vs. SCE) is logarithmically related to the concentration of MUC-1 in the 1 to 500 nM range, with a detection limit of 0.5 nM. We also demonstrate that MCF-7 cancer cells can be detected by this method with high sensitivity (50 cells per mL) due to the presence of MUC-1 proteins on the cell surface. (author)

  19. DETECTION OF CANCER BIOMARKERS WITH NANOTECHNOLOGY

    Directory of Open Access Journals (Sweden)

    Lei Zhang

    2013-01-01

    Full Text Available Early detection of cancer biomarkers with high precision is critically important for cancer therapy. A variety of sensors based on different nanostructured materials have attracted intensive research interest due to their potential for highly sensitive and selective detection of cancer biomarkers. This review covers the use of a variety of nanostructured materials, including carbon nanotubes, silicon nanowires, gold nanoparticles and quantum dots, in the fabrication of sensors. Emphases are placed on how the detection systems work and what detection limits can be achieved. Some assays described in this review outperform established methods for cancer biomarker detection. It is highly promising that these sensors would soon move into commercial-scale production and find routine use in hospitals.

  20. The proteomics in prostate cancer biomarker discovery

    Directory of Open Access Journals (Sweden)

    V. E. Shevchenko

    2015-06-01

    Full Text Available Prostate cancer (PC represents the second most frequent type of tumor in men worldwide. Proteomics represents a promising approach for the discovery of new biomarkers able to improve the management of PC patients. Markers more specific and sensitive than prostate-specific antigen are needed for PC diagnosis, prognosis and response to treatment. Moreover, proteomics could represent an important tool to identify new molecular targets for PC tailored therapy. Now several possible PC biomarkers sources, each with advantages and limitations, are under investigation, including tissues, urine, serum, plasma and prostatic fluids. Innovative high-throughput proteomic platforms are now identifying and quantifying new specific and sensitive biomarkers for PC detection, stratification and treatment. Nevertheless, many putative biomarkers are still far from being applied in clinical practice.This review aims to discuss the recent advances in PC proteomics, emphasizing biomarker discovery and their application to clinical utility for diagnosis and patient stratification.

  1. Molecular Imaging of Biomarkers in Breast Cancer

    Science.gov (United States)

    Ulaner, Gary A.; Riedl, Chris C.; Dickler, Maura N.; Jhaveri, Komal; Pandit-Taskar, Neeta; Weber, Wolfgang

    2016-01-01

    The success of breast cancer therapy is ultimately defined by clinical endpoints such as survival. It is valuable to have biomarkers that can predict the most efficacious therapies or measure response to therapy early in the course of treatment. Molecular imaging has a promising role in complementing and overcoming some of the limitations of traditional biomarkers by providing the ability to perform noninvasive, repeatable whole-body assessments. The potential advantages of imaging biomarkers are obvious and initial clinical studies have been promising, but proof of clinical utility still requires prospective multicenter clinical trials. PMID:26834103

  2. Proteomics and Mass Spectrometry for Cancer Biomarker Discovery

    Directory of Open Access Journals (Sweden)

    Ming Lu

    2007-01-01

    Full Text Available Proteomics is a rapidly advancing field not only in the field of biology but also in translational cancer research. In recent years, mass spectrometry and associated technologies have been explored to identify proteins or a set of proteins specific to a given disease, for the purpose of disease detection and diagnosis. Such biomarkers are being investigated in samples including cells, tissues, serum/plasma, and other types of body fluids. When sufficiently refined, proteomic technologies may pave the way for early detection of cancer or individualized therapy for cancer. Mass spectrometry approaches coupled with bioinformatic tools are being developed for biomarker discovery and validation. Understanding basic concepts and application of such technology by investigators in the field may accelerate the clinical application of protein biomarkers in disease management.Abbreviations: 2DE: two-dimensional gel electrophoresis; ABPP: activity-based protein profiling; CEA: carcinoembryonic antigen; CI: confidence interval; ESI: electrospray ionization; FP: fluorophosphonate; HPLC: high performance liquid chromatography; ICAT: isotope coded affi nitytags; IEF: isoelectric focusing; iTRAQ: isobaric tags for relative and absolute quantification; LCMS: combined liquid chromatography-mass spectrometry; LCMSMS: liquid chromatography tandem mass spectrometry; LOD: limit of detection; m/z: mass to charge ratio; MALDI: matrix-assisted laser desorption ionization; MS: mass spectrometry; MUDPIT: multidimensional protein identification technology; NAF: nipple aspirate fluid; PMF: peptide mass fingerprinting; PSA: prostate specifi c antigen; PTMs: post-translational modifications; RPMA: reverse phase protein microarray; SELDI: surface enhanced laser desorption ionization; TOF: time-of-flight.

  3. Methylated genes as new cancer biomarkers.

    LENUS (Irish Health Repository)

    Duffy, M J

    2012-02-01

    Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested that measurement of the methylation status of the promoter regions of specific genes can aid early detection of cancer, determine prognosis and predict therapy responses. Promising DNA methylation biomarkers include the use of methylated GSTP1 for aiding the early diagnosis of prostate cancer, methylated PITX2 for predicting outcome in lymph node-negative breast cancer patients and methylated MGMT in predicting benefit from alkylating agents in patients with glioblastomas. However, prior to clinical utilisation, these findings require validation in prospective clinical studies. Furthermore, assays for measuring gene methylation need to be standardised, simplified and evaluated in external quality assurance programmes. It is concluded that methylated genes have the potential to provide a new generation of cancer biomarkers.

  4. Exosomal miRNAs as biomarkers for prostate cancer

    Directory of Open Access Journals (Sweden)

    Nina Pettersen Hessvik

    2013-03-01

    Full Text Available miRNAs are small non-coding RNAs that finely regulate gene expression in cells. Alterations in miRNA expression have been associated with development of cancer, and miRNAs are now being investigated as biomarkers for cancer as well as other diseases. Recently, miRNAs have been found outside cells in body fluids. Extracellular miRNAs exist in different forms - associated with Ago2 proteins, loaded into extracellular vesicles (exosomes, microvesicles or apoptotic bodies or into high density lipoprotein particles. These extracellular miRNAs are probably products of distinct cellular processes, and might therefore play different roles. However, their functions in vivo are currently unknown. In spite of this, they are considered as promising, noninvasive diagnostic and prognostic tools. Prostate cancer is the most common cancer in men in the Western world, but the currently used biomarker (prostate specific antigen has low specificity. Therefore, novel biomarkers are highly needed. In this review we will discuss possible biological functions of extracellular miRNAs, as well as the potential use of miRNAs from extracellular vesicles as biomarkers for prostate cancer.

  5. Cancer biomarker discovery in saliva by mass spectrometry

    Directory of Open Access Journals (Sweden)

    Kiran S. Ambatipudi

    2014-05-01

    Full Text Available The quest for biomarkers has been much pursued to aid in the early diagnosis, monitor post-treatment progress and development of targeted therapies. Nevertheless, the translation of biomarker discovery to clinical use has been limited due to multiple reasons such as the long path from discovery to clinical assays, limitation of samples and incoherent pipeline for biomarker development. To date, diagnosis of cancer has been based on biopsies and histological examinations and often becomes difficult to get repeated sampling from patients for confirmation. Consequently, it is important for clinical researchers to look at multiple body fluids and different molecular techniques to identify biomarkers. One such bodyfluid is saliva, which is easily and non-invasively collected and contains thousands of potential protein biomarkers. Moreover, recent advances in the sensitivity and specificity of mass spectrometry based proteomics hold great promise to identify potential biomarkers. This review presents an overview of the potential use of saliva and mass spectrometry for global discovery and validation of biomarkers.

  6. Hypermethylated DNA, a Biomarker for colorectal cancer

    DEFF Research Database (Denmark)

    Rasmussen, Simon Ladefoged; Krarup, Henrik Bygum; Sunesen, Kåre Gotschalck;

    2016-01-01

    AIM: In colorectal cancer (CRC), improved methods for early detection are essential for increasing survival. Hypermethylated DNA in blood or stool has been proposed as a biomarker for CRC. In recent years, biochemical methods have improved, and several hypermethylated genes that are sensitive and...

  7. A Preliminary Analysis of Non-small Cell Lung Cancer Biomarkers in Serum

    Institute of Scientific and Technical Information of China (English)

    XUE-YUAN XIAO; YING TANG; XIU-PING WEI; DA-CHENG HE

    2003-01-01

    Objective To identify potential serum biomarkers that could be used to discriminate lungcancers from normal. Methods Proteomic spectra of twenty-eight serum samples from patientswith non-small cell lung cancer and twelve from normal individuals were generated by SELDI(Surfaced Enhanced Laser Desorption/Ionization) Mass Spectrometry. Anion-exchange columns wereused to fractionate the sera into 6 designated pH groups. Two different types of protein chip arrays,IMAC-Cu and WCX2, were employed. Samples were examined in PBSII Protein Chip Reader(Ciphergen Biosystem Inc) and the discriminatory profiling between cancer and normal samples wasanalyzed with Biomarker Pattern software. Results Five distinct potential lung cancer biomarkerswith higher sensitivity and specificity were found, with four common biomarkers in both IMAC-Cuand WCX2 chip; the remaining biomarker occurred only in WCX2 chip. Two biomarkers wereup-regulated while three biomarkers were down-regulated in the serum samples from patients withnon-small cell lung cancer. The sensitivities provided by the individual biomarkers were 75%-96.43%and specificities were 75%-100%. Conclusions The preliminary results suggest that serum is acapable resource for detecting specific non-small cell lung cancer biomarkers. SELDI massspectrometry is a useful tool for the detection and identification of new potential biomarker ofnon-small cell lung cancer in serum.

  8. Aberrantly methylated DNA as a biomarker in breast cancer

    DEFF Research Database (Denmark)

    Kristiansen, Søren; Jørgensen, Lars Mønster; Guldberg, Per;

    2013-01-01

    hypermethylation events, their use as tumor biomarkers is usually not hampered by analytical signals from normal cells, which is a general problem for existing protein tumor markers used for clinical assessment of breast cancer. There is accumulating evidence that DNA-methylation changes in breast cancer patients......Aberrant DNA hypermethylation at gene promoters is a frequent event in human breast cancer. Recent genome-wide studies have identified hundreds of genes that exhibit differential methylation between breast cancer cells and normal breast tissue. Due to the tumor-specific nature of DNA...... occur early during tumorigenesis. This may open up for effective screening, and analysis of blood or nipple aspirate may later help in diagnosing breast cancer. As a more detailed molecular characterization of different types of breast cancer becomes available, the ability to divide patients into...

  9. Metabolomics for Biomarker Discovery in Gastroenterological Cancer

    Directory of Open Access Journals (Sweden)

    Shin Nishiumi

    2014-07-01

    Full Text Available The study of the omics cascade, which involves comprehensive investigations based on genomics, transcriptomics, proteomics, metabolomics, etc., has developed rapidly and now plays an important role in life science research. Among such analyses, metabolome analysis, in which the concentrations of low molecular weight metabolites are comprehensively analyzed, has rapidly developed along with improvements in analytical technology, and hence, has been applied to a variety of research fields including the clinical, cell biology, and plant/food science fields. The metabolome represents the endpoint of the omics cascade and is also the closest point in the cascade to the phenotype. Moreover, it is affected by variations in not only the expression but also the enzymatic activity of several proteins. Therefore, metabolome analysis can be a useful approach for finding effective diagnostic markers and examining unknown pathological conditions. The number of studies involving metabolome analysis has recently been increasing year-on-year. Here, we describe the findings of studies that used metabolome analysis to attempt to discover biomarker candidates for gastroenterological cancer and discuss metabolome analysis-based disease diagnosis.

  10. Methylated genes as new cancer biomarkers

    DEFF Research Database (Denmark)

    Brunner, Nils; Duffy, M.J; Napieralski, R.;

    2009-01-01

    measurement of the methylation status of the promoter regions of specific genes can aid early detection of cancer, determine prognosis and predict therapy responses. Promising DNA methylation biomarkers include the use of methylated GSTP1 for aiding the early diagnosis of prostate cancer, methylated PITX2 for...... predicting outcome in lymph node-negative breast cancer patients and methylated MGMT in predicting benefit from alkylating agents in patients with glioblastomas. However, prior to clinical utilisation, these findings require validation in prospective clinical studies. Furthermore, assays for measuring gene...

  11. Biomarkers for predicting complete debulking in ovarian cancer

    DEFF Research Database (Denmark)

    Fagö-Olsen, Carsten Lindberg; Ottesen, Bent; Christensen, Ib Jarle; Høgdall, Estrid; Lundvall, Lene; Nedergaard, Lotte; Engelholm, Svend-Aage; Antonsen, Sofie Leisby; Lydolph, Magnus; Høgdall, Claus

    2014-01-01

    AIM: We aimed to construct and validate a model based on biomarkers to predict complete primary debulking surgery for ovarian cancer patients. PATIENTS AND METHODS: The study consisted of three parts: Part I: Biomarker data obtained from mass spectrometry, baseline data and, surgical outcome were.......64. CONCLUSION: Our validated model based on biomarkers was unable to predict surgical outcome for patients with ovarian cancer....

  12. Cancer Hallmarks, Biomarkers and Breast Cancer Molecular Subtypes.

    Science.gov (United States)

    Dai, Xiaofeng; Xiang, Liangjian; Li, Ting; Bai, Zhonghu

    2016-01-01

    Breast cancer is a complex disease encompassing multiple tumor entities, each characterized by distinct morphology, behavior and clinical implications. Besides estrogen receptor, progesterone receptor and human epidermal growth factor receptor 2, novel biomarkers have shown their prognostic and predictive values, complicating our understanding towards to the heterogeneity of such cancers. Ten cancer hallmarks have been proposed by Weinberg to characterize cancer and its carcinogenesis. By reviewing biomarkers and breast cancer molecular subtypes, we propose that the divergent outcome observed from patients stratified by hormone status are driven by different cancer hallmarks. 'Sustaining proliferative signaling' further differentiates cancers with positive hormone receptors. 'Activating invasion and metastasis' and 'evading immune destruction' drive the differentiation of triple negative breast cancers. 'Resisting cell death', 'genome instability and mutation' and 'deregulating cellular energetics' refine breast cancer classification with their predictive values. 'Evading growth suppressors', 'enabling replicative immortality', 'inducing angiogenesis' and 'tumor-promoting inflammation' have not been involved in breast cancer classification which need more focus in the future biomarker-related research. This review novels in its global view on breast cancer heterogeneity, which clarifies many confusions in this field and contributes to precision medicine. PMID:27390604

  13. Evaluation of reverse phase protein array (RPPA)-based pathway-activation profiling in 84 non-small cell lung cancer (NSCLC) cell lines as platform for cancer proteomics and biomarker discovery.

    Science.gov (United States)

    Ummanni, Ramesh; Mannsperger, Heiko A; Sonntag, Johanna; Oswald, Marcus; Sharma, Ashwini K; König, Rainer; Korf, Ulrike

    2014-05-01

    The reverse phase protein array (RPPA) approach was employed for a quantitative analysis of 71 cancer-relevant proteins and phosphoproteins in 84 non-small cell lung cancer (NSCLC) cell lines and by monitoring the activation state of selected receptor tyrosine kinases, PI3K/AKT and MEK/ERK1/2 signaling, cell cycle control, apoptosis, and DNA damage. Additional information on NSCLC cell lines such as that of transcriptomic data, genomic aberrations, and drug sensitivity was analyzed in the context of proteomic data using supervised and non-supervised approaches for data analysis. First, the unsupervised analysis of proteomic data indicated that proteins clustering closely together reflect well-known signaling modules, e.g. PI3K/AKT- and RAS/RAF/ERK-signaling, cell cycle regulation, and apoptosis. However, mutations of EGFR, ERBB2, RAF, RAS, TP53, and PI3K were found dispersed across different signaling pathway clusters. Merely cell lines with an amplification of EGFR and/or ERBB2 clustered closely together on the proteomic, but not on the transcriptomic level. Secondly, supervised data analysis revealed that sensitivity towards anti-EGFR drugs generally correlated better with high level EGFR phosphorylation than with EGFR abundance itself. High level phosphorylation of RB and high abundance of AURKA were identified as candidates that can potentially predict sensitivity towards the aurora kinase inhibitor VX680. Examples shown demonstrate that the RPPA approach presents a useful platform for targeted proteomics with high potential for biomarker discovery. This article is part of a Special Issue entitled: Biomarkers: A Proteomic Challenge. PMID:24361481

  14. Research status and funding trends of lung cancer biomarkers

    OpenAIRE

    Li, Cui; Hong, Wei

    2013-01-01

    Lung cancer is one of malignant tumors with the highest morbidity and mortality in the world. At present, research of early diagnosis, treatment, prognosis, and metastasis associated biomarkers is most active. This article reviewed the research status of lung cancer biomarkers and analyzed the funding situation in the field of lung cancer markers in recent 10 years in China and abroad, to provide a reference for the future basic and clinical translational research of lung cancer biomarkers.

  15. Risk Factors and Biomarkers of Ischemic Stroke in Cancer Patients

    OpenAIRE

    Kim, Kwangsoo; Lee, Ji-Hun

    2014-01-01

    Background and Purpose Stroke is common among cancer patients. However, risk factors and biomarkers of stroke in cancer patients are not well established. This study aimed to investigate risk factors and biomarkers as well as etiology of ischemic stroke in cancer patients. Methods A retrospective review was conducted in cancer patients with ischemic stroke who were admitted to a general hospital in Busan, Korea, between January 2003 and December 2012. The risk factors and biomarkers for strok...

  16. Mitochondrial DNA as a Cancer Biomarker

    OpenAIRE

    Jakupciak, John P.; Wang, Wendy; Markowitz, Maura E; Ally, Delphine; Coble, Michael; Srivastava, Sudhir; Maitra, Anirban; Barker, Peter E.; Sidransky, David; O’Connell, Catherine D.

    2005-01-01

    As part of a national effort to identify biomarkers for the early detection of cancer, we developed a rapid and high-throughput sequencing protocol for the detection of sequence variants in mitochondrial DNA. Here, we describe the development and implementation of this protocol for clinical samples. Heteroplasmic and homoplasmic sequence variants occur in the mitochondrial genome in patient tumors. We identified these changes by sequencing mitochondrial DNA obtained from tumors and blood from...

  17. Chemoresistive Gas Sensors for the Detection of Colorectal Cancer Biomarkers

    Directory of Open Access Journals (Sweden)

    Cesare Malagù

    2014-10-01

    Full Text Available Numerous medical studies show that tumor growth is accompanied by protein changes that may lead to the peroxidation of the cell membrane with consequent emission of volatile organic compounds (VOCs by breath or intestinal gases that should be seen as biomarkers for colorectal cancer (CRC. The analysis of VOCs represents a non-invasive and potentially inexpensive preliminary screening technique. An array of chemoresistive gas sensors based on screen-printed metal oxide semiconducting films has been selected to discriminate gases of oncological interest, e.g., 1-iodononane and benzene, widely assumed to be biomarkers of colorectal cancer, from those of interference in the gut, such as methane and nitric oxide.

  18. Biomarkers and Pharmacogenetics in Pancreatic Cancer

    Directory of Open Access Journals (Sweden)

    Xunhai Xu

    2011-07-01

    Full Text Available Appropriate identification and validation of biomarkers as well as pharmacogenetics are important in formulating patient-oriented, individualized chemotherapy or biological therapy in cancer patients. These markers can be especially valuable in pancreatic cancer, where high mortality and complex disease biology are frequently encountered. Recently, several advances have been made to further our knowledge in this specific area of pancreatic cancer. In the 2011 American Society of Clinical Oncology (ASCO Annual Meeting, researchers have presented several interesting results in biomarkers development: the identifications of 9 single nucleotide polymorphisms (SNPs that is associated with positive efficacy of gemcitabine (Abstract #4022; the introduction of circulating tumor cells as a prognostic markers in pancreatic adenocarcinoma (Abstract #e14657; the re-affirmation of plasma cytidine deaminase (CDA as a positive predictive markers for gemcitabine efficacy, as well as the postulations that CDA*3 as a potential genotype marker to predict gemcitabine responses (Abstract #e14645; and finally the retrospective tumor tissues analysis in the Arbeitsgemeinschaft Internistische Onkologie (AIO trial in an attempt for epidermal growth factor receptor (EGFR pathway biomarker identifications (Abstract #4047

  19. Integrative analysis to select cancer candidate biomarkers to targeted validation

    Science.gov (United States)

    Heberle, Henry; Domingues, Romênia R.; Granato, Daniela C.; Yokoo, Sami; Canevarolo, Rafael R.; Winck, Flavia V.; Ribeiro, Ana Carolina P.; Brandão, Thaís Bianca; Filgueiras, Paulo R.; Cruz, Karen S. P.; Barbuto, José Alexandre; Poppi, Ronei J.; Minghim, Rosane; Telles, Guilherme P.; Fonseca, Felipe Paiva; Fox, Jay W.; Santos-Silva, Alan R.; Coletta, Ricardo D.; Sherman, Nicholas E.; Paes Leme, Adriana F.

    2015-01-01

    Targeted proteomics has flourished as the method of choice for prospecting for and validating potential candidate biomarkers in many diseases. However, challenges still remain due to the lack of standardized routines that can prioritize a limited number of proteins to be further validated in human samples. To help researchers identify candidate biomarkers that best characterize their samples under study, a well-designed integrative analysis pipeline, comprising MS-based discovery, feature selection methods, clustering techniques, bioinformatic analyses and targeted approaches was performed using discovery-based proteomic data from the secretomes of three classes of human cell lines (carcinoma, melanoma and non-cancerous). Three feature selection algorithms, namely, Beta-binomial, Nearest Shrunken Centroids (NSC), and Support Vector Machine-Recursive Features Elimination (SVM-RFE), indicated a panel of 137 candidate biomarkers for carcinoma and 271 for melanoma, which were differentially abundant between the tumor classes. We further tested the strength of the pipeline in selecting candidate biomarkers by immunoblotting, human tissue microarrays, label-free targeted MS and functional experiments. In conclusion, the proposed integrative analysis was able to pre-qualify and prioritize candidate biomarkers from discovery-based proteomics to targeted MS. PMID:26540631

  20. Targeting cancer testis antigens for biomarkers and immunotherapy in colorectal cancer: Current status and challenges

    Institute of Scientific and Technical Information of China (English)

    Anil; Suri; Nirmala; Jagadish; Shikha; Saini; Namita; Gupta

    2015-01-01

    Colorectal cancer ranks third among the estimatedcancer cases and cancer related mortalities in United States in 2014. Early detection and efficient therapy remains a significant clinical challenge for this disease. Therefore, there is a need to identify novel tumor asso-ciated molecules to target for biomarker development and immunotherapy. In this regard, cancer testis antigens have emerged as a potential targets for developing novel clinical biomarkers and immunotherapy for various malignancies. These germ cell specific proteins exhibit aberrant expression in cancer cells and contribute in tumorigenesis. Owing to their unique expression profile and immunogenicity in cancer patients, cancer testis antigens are clinically referred as the most promising tumor associated antigens. Several cancer testis antigens have been studied in colorectal cancer but none of them could be used in clinical practice. This review is an attempt to address the promising cancer testis antigens in colorectal cancer and their possible clinical implications as biomarkers and immunotherapeutic targets with particular focus on challenges and future interventions.

  1. Network-Based Protein Biomarker Discovery Platforms.

    Science.gov (United States)

    Kim, Minhyung; Hwang, Daehee

    2016-03-01

    The advances in mass spectrometry-based proteomics technologies have enabled the generation of global proteome data from tissue or body fluid samples collected from a broad spectrum of human diseases. Comparative proteomic analysis of global proteome data identifies and prioritizes the proteins showing altered abundances, called differentially expressed proteins (DEPs), in disease samples, compared to control samples. Protein biomarker candidates that can serve as indicators of disease states are then selected as key molecules among these proteins. Recently, it has been addressed that cellular pathways can provide better indications of disease states than individual molecules and also network analysis of the DEPs enables effective identification of cellular pathways altered in disease conditions and key molecules representing the altered cellular pathways. Accordingly, a number of network-based approaches to identify disease-related pathways and representative molecules of such pathways have been developed. In this review, we summarize analytical platforms for network-based protein biomarker discovery and key components in the platforms. PMID:27103885

  2. Putative Biomarkers and Targets of Estrogen Receptor Negative Human Breast Cancer

    Directory of Open Access Journals (Sweden)

    Stephen W. Byers

    2011-07-01

    Full Text Available Breast cancer is a progressive and potentially fatal disease that affects women of all ages. Like all progressive diseases, early and reliable diagnosis is the key for successful treatment and annihilation. Biomarkers serve as indicators of pathological, physiological, or pharmacological processes. Her2/neu, CA15.3, estrogen receptor (ER, progesterone receptor (PR, and cytokeratins are biomarkers that have been approved by the Food and Drug Administration for disease diagnosis, prognosis, and therapy selection. The structural and functional complexity of protein biomarkers and the heterogeneity of the breast cancer pathology present challenges to the scientific community. Here we review estrogen receptor-related putative breast cancer biomarkers, including those of putative breast cancer stem cells, a minor population of estrogen receptor negative tumor cells that retain the stem cell property of self renewal. We also review a few promising cytoskeleton targets for ER alpha negative breast cancer.

  3. Identifying Cancer Biomarkers Via Node Classification within a Mapreduce Framework

    Directory of Open Access Journals (Sweden)

    Taysir Hassan A. Soliman

    2015-12-01

    Full Text Available Big data are giving new research challenges in the life sciences domain because of their variety, volume, veracity, velocity, and value. Predicting gene biomarkers is one of the vital research issues in bioinformatics field, where microarray gene expression and network based methods can be used. These datasets suffer from the huge data voluminous, causing main memory problems. In this paper, a Random Committee Node Classifier algorithm (RCNC is proposed for identifying cancer biomarkers, which is based on microarray gene expression data and Protein-Protein Interaction (PPI data. Data are enriched from other public databases, such as IntACT1 and UniProt2 and Gene Ontology3 (GO. Cancer Biomarkers are identified when applied to different datasets with an accuracy rate an accuracy rate 99.16%, 99.96% precision, 99.24% recall, 99.16% F1-measure and 99.6 ROC. To speed up the performance, it is run within a MapReduce framework, where RCNC MapReduce algorithm is much faster than RCNC sequential algorithm when having large datasets.

  4. New serum biomarkers for prostate cancer diagnosis

    Science.gov (United States)

    Chadha, Kailash C.; Miller, Austin; Nair, Bindukumar B.; Schwartz, Stanley A.; Trump, Donald L.; Underwood, Willie

    2014-01-01

    Background Prostate-specific antigen (PSA) is currently used as a biomarker for diagnosis and management of prostate cancer (CaP). However, PSA typically lacks the sensitivity and specificity desired of a diagnostic marker. Objective The goal of this study was to identify an additional biomarker or a panel of biomarkers that is more sensitive and specific than PSA in differentiating benign versus malignant prostate disease and/or localized CaP versus metastatic CaP. Methods Concurrent measurements of circulating interleukin-8 (IL-8), Tumor necrosis factor-α (TNF-α) and soluble tumor necrosis factor-α receptors 1 (sTNFR1) were obtained from four groups of men: (1) Controls (2) with elevated prostate-specific antigen with a negative prostate biopsy (elPSA_negBx) (3) with clinically localized CaP and (4) with castration resistant prostate cancer. Results TNF-α Area under the receiver operating characteristic curve (AUC = 0.93) and sTNFR1 (AUC = 0.97) were strong predictors of elPSA_negBx (vs. CaP). The best predictor of elPSA_negBx vs CaP was sTNFR1 and IL-8 combined (AUC = 0.997). The strongest single predictors of localized versus metastatic CaP were TNF-α (AUC = 0.992) and PSA (AUC = 0.963) levels. Conclusions The specificity and sensitivity of a PSA-based CaP diagnosis can be significantly enhanced by concurrent serum measurements of IL-8, TNF-α and sTNFR1. In view of the concerns about the ability of PSA to distinguish clinically relevant CaP from indolent disease, assessment of these biomarkers in the larger cohort is warranted. PMID:25593898

  5. New serum biomarkers for prostate cancer diagnosis

    Directory of Open Access Journals (Sweden)

    Kailash C Chadha

    2014-01-01

    Full Text Available Background: Prostate-specific antigen (PSA is currently used as a biomarker for diagnosis and management of prostate cancer (CaP. However, PSA typically lacks the sensitivity and specificity desired of a diagnostic marker. Objective: The goal of this study was to identify an additional biomarker or a panel of biomarkers that is more sensitive and specific than PSA in differentiating benign versus malignant prostate disease and/or localized CaP versus metastatic CaP. Methods: Concurrent measurements of circulating interleukin-8 (IL-8, Tumor necrosis factor-α (TNF-α and soluble tumor necrosis factor-α receptors 1 (sTNFR1 were obtained from four groups of men: (1 Controls (2 with elevated prostate-specific antigen with a negative prostate biopsy (elPSA_negBx (3 with clinically localized CaP and (4 with castration resistant prostate cancer. Results: TNF-α Area under the receiver operating characteristic curve (AUC = 0.93 and sTNFR1 (AUC = 0.97 were strong predictors of elPSA_negBx (vs. CaP. The best predictor of elPSA_negBx vs CaP was sTNFR1 and IL-8 combined (AUC = 0.997. The strongest single predictors of localized versus metastatic CaP were TNF-α (AUC = 0.992 and PSA (AUC = 0.963 levels. Conclusions: The specificity and sensitivity of a PSA-based CaP diagnosis can be significantly enhanced by concurrent serum measurements of IL-8, TNF-α and sTNFR1. In view of the concerns about the ability of PSA to distinguish clinically relevant CaP from indolent disease, assessment of these biomarkers in the larger cohort is warranted.

  6. Testicular cancer: biology and biomarkers.

    Science.gov (United States)

    Looijenga, Leendert H J; Stoop, Hans; Biermann, Katharina

    2014-03-01

    The term "human germ cell tumors" (GCTs) refers to a heterogeneous group of neoplasms, all with a defined histological appearance. They have specific epidemiological characteristics, clinical behavior, and pathogenesis. Histologically, GCTs contain various tissue elements, which are homologs of normal embryogenesis. We have proposed a subclassification of GCTs in five subtypes, three of which preferentially occur in the testis. These include teratomas and yolk sac tumors of neonates and infants (type I), seminomas and nonseminomas of (predominantly) adolescents and adults (type II), and spermatocytic seminomas of the elderly (type III). Both spontaneous and induced animal models have been reported, of which the relevance for human GCTs is still to be clarified. Multidisciplinary studies have recently shed new light on the (earliest steps in the) pathogenesis of GCTs, mainly in regard of malignant type II GCTs (germ cell cancer (GCC)). This review discusses novel understanding of the pathogenesis of (mainly) GCC, focusing on identification of informative diagnostic markers suitable for application in a clinical setting. These include OCT3/4, SOX9/FOXL2, SOX17/SOX2, as well as embryonic microRNAs. These markers have been identified through studies on normal embryogenesis, specifically related to the gonads, including the germ cell lineage. Their strengths and limitations are discussed as well as the expected future approach to identify the group of individuals at highest risk for development of a GCC. The latter would allow screening of defined populations, early diagnosis, optimal follow-up, and potentially early treatment, preventing long-term side effects of systemic treatment. PMID:24487784

  7. Aberrant glycosylation associated with enzymes as cancer biomarkers

    Directory of Open Access Journals (Sweden)

    Meany Danni L

    2011-06-01

    Full Text Available Abstract Background One of the new roles for enzymes in personalized medicine builds on a rational approach to cancer biomarker discovery using enzyme-associated aberrant glycosylation. A hallmark of cancer, aberrant glycosylation is associated with differential expressions of enzymes such as glycosyltransferase and glycosidases. The aberrant expressions of the enzymes in turn cause cancer cells to produce glycoproteins with specific cancer-associated aberrations in glycan structures. Content In this review we provide examples of cancer biomarker discovery using aberrant glycosylation in three areas. First, changes in glycosylation machinery such as glycosyltransferases/glycosidases could be used as cancer biomarkers. Second, most of the clinically useful cancer biomarkers are glycoproteins. Discovery of specific cancer-associated aberrations in glycan structures of these existing biomarkers could improve their cancer specificity, such as the discovery of AFP-L3, fucosylated glycoforms of AFP. Third, cancer-associated aberrations in glycan structures provide a compelling rationale for discovering new biomarkers using glycomic and glycoproteomic technologies. Summary As a hallmark of cancer, aberrant glycosylation allows for the rational design of biomarker discovery efforts. But more important, we need to translate these biomarkers from discovery to clinical diagnostics using good strategies, such as the lessons learned from translating the biomarkers discovered using proteomic technologies to OVA 1, the first FDA-cleared In Vitro Diagnostic Multivariate Index Assay (IVDMIA. These lessons, providing important guidance in current efforts in biomarker discovery and translation, are applicable to the discovery of aberrant glycosylation associated with enzymes as cancer biomarkers as well.

  8. Environmental effects on molecular biomarkers expression in pancreatic and brain cancer

    Science.gov (United States)

    Mensah, Lawrence; Mallidi, Srivalleesha; Massodi, Iqbal; Anbil, Sriram; Mai, Zhiming; Hasan, Tayyaba

    2013-03-01

    A complete understanding of the biological mechanisms regulating devastating disease such as cancer remains elusive. Pancreatic and brain cancers are primary among the cancer types with poor prognosis. Molecular biomarkers have emerged as group of proteins that are preferentially overexpressed in cancers and with a key role in driving disease progression and resistance to chemotherapy. The epidermal growth factor receptor (EGFR), a cell proliferative biomarker is particularly highly expressed in most cancers including brain and pancreatic cancers. The ability of EGFR to sustain prolong cell proliferation is augmented by biomarkers such as Bax, Bcl-XL and Bcl-2, proteins regulating the apoptotic process. To better understand the role and effect of the microenvironment on these biomarkers in pancreatic cancer (PaCa); we analysed two pancreatic tumor lines (AsPc-1 and MiaPaCa-2) in 2D, 3D in-vitro cultures and in orthotopic tumors at different growth stages. We also investigated in patient derived glioblastoma (GBM) tumor cultures, the ability to utilize the EGFR expression to specifically deliver photosensitizer to the cells for photodynamic therapy. Overall, our results suggest that (1) microenvironment changes affect biomarker expression; thereby it is critical to understand these effects prior to designing combination therapies and (2) EGFR expression in tumor cells indeed could serve as a reliable and a robust biomarker that could be used to design targeted and image-guided photodynamic therapy.

  9. Sparse discriminant analysis for breast cancer biomarker identification and classification

    Institute of Scientific and Technical Information of China (English)

    Yu Shi; Daoqing Dai; Chaochun Liu; Hong Yan

    2009-01-01

    Biomarker identification and cancer classification are two important procedures in microarray data analysis. We propose a novel uni-fied method to carry out both tasks. We first preselect biomarker candidates by eliminating unrelated genes through the BSS/WSS ratio filter to reduce computational cost, and then use a sparse discriminant analysis method for simultaneous biomarker identification and cancer classification. Moreover, we give a mathematical justification about automatic biomarker identification. Experimental results show that the proposed method can identify key genes that have been verified in biochemical or biomedical research and classify the breast cancer type correctly.

  10. Stress-induced Phosphoprotein 1 as a Secreted Biomarker for Human Ovarian Cancer Promotes Cancer Cell Proliferation*

    OpenAIRE

    Wang, Tzu-Hao; Chao, Angel; Tsai, Chia-Lung; Chang, Chih-Long; Chen, Shun-Hua; Lee, Yun-Shien; Chen, Jen-Kun; Lin, Yi-Jun; Chang, Pi-Yueh; Wang, Chin-Jung; Chao, An-Shine; Chang, Shuenn-Dyh; Chang, Ting-Chang; Lai, Chyong-Huey; Wang, Hsin-Shih

    2010-01-01

    Ovarian cancers are frequently not diagnosed until advanced stages, resulting in a high case fatality rate. Because of this, more tumor markers, in addition to CA125, for detecting and monitoring ovarian cancer are needed. During a systematic search for potential biomarkers of ovarian cancer, we compared the protein profiles between tumor interstitial fluid and normal interstitial fluid of ovaries, rationalizing that abnormal levels of proteins in tumor interstitial fluid may be detected in p...

  11. Cancer Biomarker Discovery: Lectin-Based Strategies Targeting Glycoproteins

    Directory of Open Access Journals (Sweden)

    David Clark

    2012-01-01

    Full Text Available Biomarker discovery can identify molecular markers in various cancers that can be used for detection, screening, diagnosis, and monitoring of disease progression. Lectin-affinity is a technique that can be used for the enrichment of glycoproteins from a complex sample, facilitating the discovery of novel cancer biomarkers associated with a disease state.

  12. Serum Antibodies to HPV16 Early Proteins Warrant Investigation as Potential Biomarkers for Risk Stratification and Recurrence of HPV-Associated Oropharyngeal Cancer.

    Science.gov (United States)

    Fakhry, Carole; Qualliotine, Jesse R; Zhang, Zhe; Agrawal, Nishant; Gaykalova, Daria A; Bishop, Justin A; Subramaniam, Rathan M; Koch, Wayne M; Chung, Christine H; Eisele, David W; Califano, Joseph; Viscidi, Raphael P

    2016-02-01

    Human papillomavirus (HPV) is responsible for increasing incidence of oropharyngeal cancer. At present, there are no biomarkers in the surveillance algorithm for HPV-positive oropharyngeal cancer (HPV-OPC). HPV16 E6 antibody precedes oropharyngeal cancer diagnosis. If HPV16 E6 indeed precedes primary diagnosis, it is similarly expected to precede disease recurrence and may have a potential role as a biomarker for surveillance of HPV-OPC. To determine whether HPV antibody titers have a potential role as early markers of disease recurrence or prognosis, a retrospective pilot study was designed to determine whether HPV16 early antibody titers E6, E7, E1, and E2 decrease after treatment of HPV16-positive OPC. Trends in pretreatment, early (≤6 months after treatment), and late posttreatment (>6 months after treatment) HPV16 antibody titers were examined. There were 43, 34, and 52 subjects with serum samples available for pretreatment, early, and late posttreatment intervals. Mean pretreatment antibody levels were higher than posttreatment antibody levels. Average antibody levels decreased significantly over time for E6 (Ptrend = 0.001) and E7 (Ptrend < 0.001). Six disease recurrences were observed during the follow-up period (median, 4.4 years). In univariate analysis, a log-unit increase in pretreatment E6 titer was significantly associated with increased risk of disease recurrence (HR, 5.42; 95% CI, 1.1-25.7; P = 0.03). Therefore, levels of antibodies to HPV16 early oncoproteins decline after therapy. Higher E6 titers at diagnosis are associated with significant increases in the risk of recurrence. These data support the prospective evaluation of HPV16 antibodies as markers of surveillance and for risk stratification at diagnosis. PMID:26701665

  13. Phosphoprotein Secretome of Tumor Cells as a Source of Candidates for Breast Cancer Biomarkers in Plasma*

    OpenAIRE

    Zawadzka, Anna M.; Schilling, Birgit; Cusack, Michael P.; Sahu, Alexandria K.; Drake, Penelope; Fisher, Susan J.; Benz, Christopher C.; Gibson, Bradford W.

    2014-01-01

    Breast cancer is a heterogeneous disease whose molecular diversity is not well reflected in clinical and pathological markers used for prognosis and treatment selection. As tumor cells secrete proteins into the extracellular environment, some of these proteins reach circulation and could become suitable biomarkers for improving diagnosis or monitoring response to treatment. As many signaling pathways and interaction networks are altered in cancerous tissues by protein phosphorylation, changes...

  14. Identification and Validation of Src and Phospho-Src Family Proteins in Circulating Mononuclear Cells as Novel Biomarkers for Pancreatic Cancer1

    OpenAIRE

    Yokoi, Kenji; Hawke, David; Oborn, Carol J.; Jang, Jin-Young; Nishioka, Yasuhiko; Fan, Dominic; Kim, Seung Wook; Kim, Sun-Jin; Fidler, Isaiah J.

    2011-01-01

    There is an urgent need to develop novel markers of pancreatic cancer to facilitate early diagnosis. Pancreatic carcinoma is characterized by marked stroma formation with a high number of infiltrating tumor-associated macrophages (TAMs) that originate from circulating mononuclear cells (MNCs). We hypothesized that differential analysis of protein expression and phosphorylation in circulating MNCs from healthy nude mice and nude mice bearing orthotopic human pancreatic cancer would identify a ...

  15. Emerging Therapeutic Biomarkers in Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Peixin Dong

    2013-01-01

    Full Text Available Although clinical trials of molecular therapies targeting critical biomarkers (mTOR, epidermal growth factor receptor/epidermal growth factor receptor 2, and vascular endothelial growth factor in endometrial cancer show modest effects, there are still challenges that might remain regarding primary/acquired drug resistance and unexpected side effects on normal tissues. New studies that aim to target both genetic and epigenetic alterations (noncoding microRNA underlying malignant properties of tumor cells and to specifically attack tumor cells using cell surface markers overexpressed in tumor tissue are emerging. More importantly, strategies that disrupt the cancer stem cell/epithelial-mesenchymal transition-dependent signals and reactivate antitumor immune responses would bring new hope for complete elimination of all cell compartments in endometrial cancer. We briefly review the current status of molecular therapies tested in clinical trials and mainly discuss the potential therapeutic candidates that are possibly used to develop more effective and specific therapies against endometrial cancer progression and metastasis.

  16. Biomarkers for early detection of colorectal cancer and polyps: systematic review.

    Science.gov (United States)

    Shah, Reena; Jones, Emma; Vidart, Victoire; Kuppen, Peter J K; Conti, John A; Francis, Nader K

    2014-09-01

    There is growing interest in early detection of colorectal cancer as current screening modalities lack compliance and specificity. This study systematically reviewed the literature to identify biomarkers for early detection of colorectal cancer and polyps. Literature searches were conducted for relevant papers since 2007. Human studies reporting on early detection of colorectal cancer and polyps using biomarkers were included. Methodologic quality was evaluated, and sensitivity, specificity, and the positive predictive value (PPV) were reported. The search strategy identified 3,348 abstracts. A total of 44 papers, examining 67 different tumor markers, were included. Overall sensitivities for colorectal cancer detection by fecal DNA markers ranged from 53% to 87%. Combining fecal DNA markers increased the sensitivity of colorectal cancer and adenoma detection. Canine scent detection had a sensitivity of detecting colorectal cancer of 99% and specificity of 97%. The PPV of immunochemical fecal occult blood test (iFOBT) is 1.26%, compared with 0.31% for the current screening method of guaiac fecal occult blood test (gFOBT). A panel of serum protein biomarkers provides a sensitivity and specificity above 85% for all stages of colorectal cancer, and a PPV of 0.72%. Combinations of fecal and serum biomarkers produce higher sensitivities, specificities, and PPVs for early detection of colorectal cancer and adenomas. Further research is required to validate these biomarkers in a well-structured population-based study. PMID:25004920

  17. Clinical Use of Cancer Biomarkers in Epithelial Ovarian Cancer

    DEFF Research Database (Denmark)

    Söletormos, Georg; Duffy, Michael J; Othman Abu Hassan, Suher; Verheijen, René H M; Tholander, Bengt; Bast, Robert C; Gaarenstroom, Katja N; Sturgeon, Catharine M; Bonfrer, Johannes M; Petersen, Per Hyltoft; Troonen, Hugo; CarloTorre, Gian; Kanty Kulpa, Jan; Tuxen, Malgorzata K; Molina, Raphael

    2016-01-01

    OBJECTIVE: To present an update of the European Group on Tumor Markers guidelines for serum markers in epithelial ovarian cancer. METHODS: Systematic literature survey from 2008 to 2013. The articles were evaluated by level of evidence and strength of recommendation. RESULTS: Because of its low...... sensitivity (50-62% for early stage epithelial ovarian cancer) and limited specificity (94-98.5%), cancer antigen (CA) 125 (CA125) is not recommended as a screening test in asymptomatic women. The Risk of Malignancy Index, which includes CA125, transvaginal ultrasound, and menopausal status, is recommended...... candidate for secondary cytoreductive surgery. CONCLUSIONS: At present, CA125 remains the most important biomarker for epithelial ovarian cancer, excluding tumors of mucinous origin.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives...

  18. A Serum Biomarker Model to Diagnose Pancreatic Cancer Using Proteomic Fingerprint Technology

    Institute of Scientific and Technical Information of China (English)

    Chunlin Ge; Ning Ma; Dianbo Yao; Fengming Luan; Chaojun Hu; Yongzhe Li; Yongfeng Liu

    2008-01-01

    OBJECTIVE To establish a serum protein pattern model for screening pancreatic cancer.METHODS Twenty-nine serum samples from patients with pancreatic cancer were collected before surgery,and an additional 57 serum samples from age and sex-matched individuals without cancer were used as controls.WCX magnetic beans and a PBS Ⅱ-C protein chip reader(Ciphergen Biosystems Inc)were employed to detect the protein fingerprint expression of all serum samples.The resulting profiles comparing serum from cancer and normal patients were analyzed with the Biomarker Wizard system,to establish a model using the Biomarker Pattern system software.A double-blind test was used to determine the sensitivity and specificity of the model.RESULTS A group of 4 biomarkers (relative molecular weights were 5,705 Da,4,935 Da,5,318 Da,3,243 Da)were selected to set up a decision tree to produce the classification model to effectively screen pancreatic cancer patients.The results yielded a sensitivitv of 100%(20/20),specificity of 97.4%(37/38).The ROC curve was 99.7%.A double-blind test used to challenge the model resulted in a sensitivity of 88.9% and a specifcity of 89.5%.CONCLUSION New serum biomarkers of pancreatic cancer have been identified.The pattern of combined markers provides a powerful and reliable diagnostic method for pancreatic cancer with high sensitivity and specificity.

  19. Circular RNAs as potential biomarkers for cancer diagnosis and therapy.

    Science.gov (United States)

    Wang, Fengling; Nazarali, Adil J; Ji, Shaoping

    2016-01-01

    Circular RNAs (circRNAs) are a naturally occurring type of universal and diverse endogenous noncoding RNAs which unlike linear RNAs, have covalently linked ends. They are usually stable, abundant, conserved RNA molecules and often exhibit tissue/developmental-stage specific expression. Functional circRNAs have been identified to act as microRNA sponges and RNA-binding protein (RBP) sequestering agents as well as transcriptional regulators. These multiple functional roles elicit a great potential for circRNAs in biological applications. Emerging evidence shows that circRNAs play important roles in several diseases, particularly in cancer where they act through regulating protein expression of the pivotal genes that are critical for carcinogenesis. The presence of abundant circRNAs in saliva, exosomes and clinical standard blood samples will make them potential diagnostic or predictive biomarkers for diseases, particularly for cancer development, progression and prognosis. Here, we review the current literature and provide evidence for the impact of circRNAs in cancers and their potential significance in cancer prognosis and clinical treatment. PMID:27429839

  20. Validation of Candidate Serum Ovarian Cancer Biomarkers for Early Detection

    Directory of Open Access Journals (Sweden)

    Feng Su

    2007-01-01

    Full Text Available Objective: We have previously analyzed protein profi les using Surface Enhanced Laser Desorption and Ionization Time-Of-Flight Mass Spectroscopy (SELDI-TOF-MS [Kozak et al. 2003, Proc. Natl. Acad. Sci. U.S.A. 100:12343–8] and identified 3 differentially expressed serum proteins for the diagnosis of ovarian cancer (OC [Kozak et al. 2005, Proteomics, 5:4589–96], namely, apolipoprotein A-I (apoA-I, transthyretin (TTR and transferin (TF. The objective of the present study is to determine the efficacy of the three OC biomarkers for the detection of early stage (ES OC, in direct comparison to CA125.Methods: The levels of CA125, apoA-I, TTR and TF were measured in 392 serum samples [82 women with normal ovaries (N, 24 women with benign ovarian tumors (B, 85 women with ovarian tumors of low malignant potential (LMP, 126 women with early stage ovarian cancer (ESOC, and 75 women with late stage ovarian cancer (LSOC], obtained through the GOG and Cooperative Human Tissue Network. Following statistical analysis, multivariate regression models were built to evaluate the utility of the three OC markers in early detection.Results: Multiple logistic regression models (MLRM utilizing all biomarker values (CA125, TTR, TF and apoA-I from all histological subtypes (serous, mucinous, and endometrioid adenocarcinoma distinguished normal samples from LMP with 91% sensitivity (specifi city 92%, and normal samples from ESOC with a sensitivity of 89% (specifi city 92%. MLRM, utilizing values of all four markers from only the mucinous histological subtype showed that collectively, CA125, TTR, TF and apoA-I, were able to distinguish normal samples from mucinous LMP with 90% sensitivity, and further distinguished normal samples from early stage mucinous ovarian cancer with a sensitivity of 95%. In contrast, in serum samples from patients with mucinous tumors, CA125 alone was able to distinguish normal samples from LMP and early stage ovarian cancer with a sensitivity of

  1. Tumor interstitial fluid - a treasure trove of cancer biomarkers.

    Science.gov (United States)

    Gromov, Pavel; Gromova, Irina; Olsen, Charlotta J; Timmermans-Wielenga, Vera; Talman, Mai-Lis; Serizawa, Reza R; Moreira, José M A

    2013-11-01

    Tumor interstitial fluid (TIF) is a proximal fluid that, in addition to the set of blood soluble phase-borne proteins, holds a subset of aberrantly externalized components, mainly proteins, released by tumor cells and tumor microenvironment through various mechanisms, which include classical secretion, non-classical secretion, secretion via exosomes and membrane protein shedding. Consequently, the interstitial aqueous phase of solid tumors is a highly promising resource for the discovery of molecules associated with pathological changes in tissues. Firstly, it allows one to delve deeper into the regulatory mechanisms and functions of secretion-related processes in tumor development. Secondly, the anomalous secretion of molecules that is innate to tumors and the tumor microenvironment, being associated with cancer progression, offers a valuable source for biomarker discovery and possible targets for therapeutic intervention. Here we provide an overview of the features of tumor-associated interstitial fluids, based on recent and updated information obtained mainly from our studies of breast cancer. Data from the study of interstitial fluids recovered from several other types of cancer are also discussed. This article is a part of a Special Issue entitled: The Updated Secretome. PMID:23416532

  2. PBX3 is a putative biomarker of aggressive prostate cancer.

    Science.gov (United States)

    Ramberg, Håkon; Grytli, Helene Hartvedt; Nygård, Ståle; Wang, Wanzhong; Ögren, Olov; Zhao, Sen; Løvf, Marthe; Katz, Betina; Skotheim, Rolf I; Bjartell, Anders; Eri, Lars Magne; Berge, Viktor; Svindland, Aud; Taskén, Kristin Austlid

    2016-10-15

    There is a great need to identify new and better prognostic and predictive biomarkers to stratify prostate cancer patients for optimal treatment. The aims of this study were to characterize the expression profile of pre-B cell leukemia homeobox (PBX) transcription factors in prostate cancer with an emphasis on investigating whether PBX3 harbours any prognostic value. The expression profile of PBX3 and PBX1 in prostate tissue was determined by immunohistochemical and immunoblot analysis. Furthermore, the expression of PBX3 transcript variants was analyzed by RT-PCR, NanoString Technologies®, and by analyzing RNA sequence data. The potential of PBX3 to predict prognosis, either at mRNA or protein level, was studied in four independent cohorts. PBX3 was mainly expressed in the nucleus of normal prostate basal cells, while it showed cytosolic expression in prostatic intraepithelial neoplasia and cancer cells. We detected four PBX3 transcript variants in prostate tissue. Competing risk regression analysis revealed that high PBX3 expression was associated with slower progression to castration resistant prostate cancer (sub-hazard ratio (SHR) 0.18, 95% CI: 0.081-0.42, p values aggressive prostate cancer. PMID:27273830

  3. Nanomechanical sandwich assay for multiple cancer biomarkers in breast cancer cell-derived exosomes.

    Science.gov (United States)

    Etayash, H; McGee, A R; Kaur, K; Thundat, T

    2016-08-18

    The use of exosomes as cancer diagnostic biomarkers is technically limited by their size, heterogeneity and the need for extensive purification and labelling. We report the use of cantilever arrays for simultaneous detection of multiple exosomal surface-antigens with high sensitivity and selectivity. Exosomes from breast cancer were selectively identified by detecting over-expressed membrane-proteins CD24, CD63, and EGFR. Excellent selectivity however, was achieved when targeting the cell-surface proteoglycan, Glypican-1 at extraordinary limits (∼200 exosomes per mL, ∼0.1 pg mL(-1)). PMID:27492928

  4. A Combined Shotgun and Targeted Mass Spectrometry Strategy for Breast Cancer Biomarker Discovery.

    Science.gov (United States)

    Sjöström, Martin; Ossola, Reto; Breslin, Thomas; Rinner, Oliver; Malmström, Lars; Schmidt, Alexander; Aebersold, Ruedi; Malmström, Johan; Niméus, Emma

    2015-07-01

    It is of highest importance to find proteins responsible for breast cancer dissemination, for use as biomarkers or treatment targets. We established and performed a combined nontargeted LC-MS/MS and a targeted LC-SRM workflow for discovery and validation of protein biomarkers. Eighty breast tumors, stratified for estrogen receptor status and development of distant recurrence (DR ± ), were collected. After enrichment of N-glycosylated peptides, label-free LC-MS/MS was performed on each individual tumor in triplicate. In total, 1515 glycopeptides from 778 proteins were identified and used to create a map of the breast cancer N-glycosylated proteome. Based on this specific proteome map, we constructed a 92-plex targeted label-free LC-SRM panel. These proteins were quantified across samples by LC-SRM, resulting in 10 proteins consistently differentially regulated between DR+/DR- tumors. Five proteins were further validated in a separate cohort as prognostic biomarkers at the gene expression level. We also compared the LC-SRM results to clinically reported HER2 status, demonstrating its clinical accuracy. In conclusion, we demonstrate a combined mass spectrometry strategy, at large scale on clinical samples, leading to the identification and validation of five proteins as potential biomarkers for breast cancer recurrence. All MS data are available via ProteomeXchange and PASSEL with identifiers PXD001685 and PASS00643. PMID:25944384

  5. Inflammatory biomarkers and risk of cancer in 84,000 individuals from the general population.

    Science.gov (United States)

    Allin, Kristine H; Bojesen, Stig E; Nordestgaard, Børge G

    2016-10-01

    Inflammation and cancer are tightly linked. This study tests the hypothesis that an inflammatory score based on plasma levels of C-reactive protein (CRP) and fibrinogen and whole blood leukocyte count is associated with risk of colorectal, lung, breast and prostate cancer. A score ranging from none through three elevated biomarkers was constructed in 84,000 individuals from the Danish general population. During a median follow-up time of 4.8 years, 4,081 incident cancers occurred. Cox proportional hazards regression models were used to estimate hazard ratios (HRs) of incident cancer. Multifactor-adjusted HRs for colorectal cancer were 1.28 (95% CI, 1.01 to 1.62), 1.79 (95% CI, 1.41 to 2.27) and 2.18 (95% CI, 1.67 to 2.86) for individuals with elevated levels of one, two and three inflammatory biomarkers compared to individuals with none elevated biomarkers. A similar stepwise increasing risk was observed for lung and breast cancer with HRs of 3.03 (95% CI, 2.25 to 4.08) and 1.42 (95% CI, 1.11 to 1.80) for three versus none elevated biomarkers. HRs were highest within the first years of follow-up. Absolute 5-year risk of lung cancer was 7.8 (95% CI, 6.1 to 10)% among older smokers with three elevated biomarkers compared to 3.8 (95% CI, 2.6 to 5.6)% among those with none elevated biomarkers. In conclusion, simultaneously elevated CRP, fibrinogen and leukocyte count are associated with an increased risk of colorectal, lung and breast cancer. Cancer as a promoter of inflammation may be more likely to account for our findings than low-grade inflammation promoting cancer development. PMID:27194008

  6. Mass Spectrometry-Based Proteomics in Molecular Diagnostics: Discovery of Cancer Biomarkers Using Tissue Culture

    Directory of Open Access Journals (Sweden)

    Debasish Paul

    2013-01-01

    Full Text Available Accurate diagnosis and proper monitoring of cancer patients remain a key obstacle for successful cancer treatment and prevention. Therein comes the need for biomarker discovery, which is crucial to the current oncological and other clinical practices having the potential to impact the diagnosis and prognosis. In fact, most of the biomarkers have been discovered utilizing the proteomics-based approaches. Although high-throughput mass spectrometry-based proteomic approaches like SILAC, 2D-DIGE, and iTRAQ are filling up the pitfalls of the conventional techniques, still serum proteomics importunately poses hurdle in overcoming a wide range of protein concentrations, and also the availability of patient tissue samples is a limitation for the biomarker discovery. Thus, researchers have looked for alternatives, and profiling of candidate biomarkers through tissue culture of tumor cell lines comes up as a promising option. It is a rich source of tumor cell-derived proteins, thereby, representing a wide array of potential biomarkers. Interestingly, most of the clinical biomarkers in use today (CA 125, CA 15.3, CA 19.9, and PSA were discovered through tissue culture-based system and tissue extracts. This paper tries to emphasize the tissue culture-based discovery of candidate biomarkers through various mass spectrometry-based proteomic approaches.

  7. Towards Personalized Cancer Therapy : New Diagnostic Biomarkers and Radiosensitization Strategies

    OpenAIRE

    Spiegelberg, Diana

    2015-01-01

    This thesis focuses on the evaluation of biomarkers for radio-immunodiagnostics and radio-immunotherapy and on radiosensitization strategies after HSP90 inhibition, as a step towards more personalized cancer medicine. There is a need to develop new tracers that target cancer-specific biomarkers to improve diagnostic imaging, as well as to combine treatment strategies to potentiate synergistic effects. Special focus has been on the cell surface molecule CD44 and its oncogenic variants, which w...

  8. Immune responses to cancer: are they potential biomarkers of prognosis?

    Directory of Open Access Journals (Sweden)

    Theresa L Whiteside

    2013-05-01

    Full Text Available Recent technical improvements in evaluations of immune cells in situ and immune monitoring of patients with cancer have provided a wealth of new data confirming that immune cells play a key role in human cancer progression. This, in turn, has revived the expectation that immune endpoints might serve as reliable biomarkers of outcome or response to therapy in cancer. The recent successes in linking the T-cell signature in human colorectal carcinoma (CRC with prognosis have provided a strong motive for searching for additional immune biomarkers that could serve as intermediate endpoints of response to therapy and outcome in human cancers. A number of potentially promising immune biomarkers have emerged, but most remain to be validated. Among them, the B-cell signature, as exemplified by expression of the immunoglobulin G kappa chain (IGKC in tumor-infiltrating lymphocytes (TIL, has been validated as a biomarker of response to adjuvant therapy and better survival in patients with breast carcinoma and several other types of human solid tumors. Additional immune endpoints are being currently tested as potentially promising biomarkers in cancer. In view of currently growing use of immune cancer therapies, the search for immune biomarkers of prognosis are critically important for identifying patients who would benefit the most from adjuvant immunotherapy.

  9. MicroRNA signatures as clinical biomarkers in lung cancer

    Directory of Open Access Journals (Sweden)

    Markou A

    2015-05-01

    Full Text Available Athina Markou, Martha Zavridou, Evi S Lianidou Analysis of Circulating Tumor Cells, Lab of Analytical Chemistry, Department of Chemistry, University of Athens, Athens, Greece Abstract: Even if early lung cancer detection has been recently significantly improved, the invasive nature of current diagnostic procedures, and a relatively high percentage of false positives, is limiting the application of modern detection tools. The discovery and clinical evaluation of novel specific and robust non-invasive biomarkers for diagnosis of lung cancer at an early stage, as well as for better prognosis and prediction of therapy response, is very challenging. MicroRNAs (miRNAs can play an important role in the diagnosis and management of lung cancer patients, as important and reliable biomarkers for cancer detection and prognostic prediction, and even as promising as novel targets for cancer therapy. miRNAs are important in cancer pathogenesis, and deregulation of their expression levels has been detected not only in lung cancer but in many other human tumor types. Numerous studies strongly support the potential of miRNAs as biomarkers in non-small-cell lung cancer, and there is increasing evidence that altered miRNA expression is associated with tumor progression and survival. It is worth mentioning also that detection of miRNAs circulating in plasma or serum has enormous potential, because miRNAs serve as non-invasive biomarkers not only for the diagnosis and prognosis of the disease, but also as novel response and sensitivity predictors for cancer treatment. In this review, we summarize the current findings on the critical role of miRNAs in lung cancer tumorigenesis and highlight their potential as circulating biomarkers in lung cancer. Our review is based on papers that have been published after 2011, and includes the key words “miRNAs” and “lung cancer”. Keywords: non-small-cell lung carcinoma, miRNAs, tumor biomarkers, circulating miRNAs, liquid

  10. The clinical impact of recent advances in LC-MS for cancer biomarker discovery and verification.

    Science.gov (United States)

    Wang, Hui; Shi, Tujin; Qian, Wei-Jun; Liu, Tao; Kagan, Jacob; Srivastava, Sudhir; Smith, Richard D; Rodland, Karin D; Camp, David G

    2016-01-01

    Mass spectrometry (MS) -based proteomics has become an indispensable tool with broad applications in systems biology and biomedical research. With recent advances in liquid chromatography (LC) and MS instrumentation, LC-MS is making increasingly significant contributions to clinical applications, especially in the area of cancer biomarker discovery and verification. To overcome challenges associated with analyses of clinical samples (for example, a wide dynamic range of protein concentrations in bodily fluids and the need to perform high throughput and accurate quantification of candidate biomarker proteins), significant efforts have been devoted to improve the overall performance of LC-MS-based clinical proteomics platforms. Reviewed here are the recent advances in LC-MS and its applications in cancer biomarker discovery and quantification, along with the potentials, limitations and future perspectives. PMID:26581546

  11. Identification of cystatin SN as a novel biomarker for pancreatic cancer.

    Science.gov (United States)

    Jiang, Jie; Liu, Hui-Ling; Liu, Zhi-Hao; Tan, Si-Wei; Wu, Bin

    2015-05-01

    Cystatin SN (cystatin 1, CST1) is a member of the cystatin superfamily that inhibits the proteolytic activity of cysteine proteases. CST1 is a tumor biomarker that provides useful information for the diagnosis of esophageal, gastric, and colorectal carcinomas. However, the significance of CST1 in pancreatic cancer is unknown. The aim of this study was to assess whether CST1 is a potential biomarker for early diagnosis of malignant pancreatic neoplasms. Microarray analysis of mRNA extracted from pancreatic cancer and pancreatic normal tissues was performed. Bioinformatics revealed that CST1 was one of the highest expressed genes on the array in pancreatic cancer, compared with normal tissue. In addition, the upregulation of CST1 in pancreatic cancer and several pancreatic cancer cell lines was confirmed using real-time PCR (RT-PCR), immunohistochemistry, and Western blotting. Next, CST1 knockdown using siRNA reduced the expression of the proliferation-related proteins p-AKT and PCNA significantly, as well as colony formation and xenograft development in vitro. Consistent with this, CST1 mRNA overexpression was correlated closely with malignancy-associated proteins such as PCNA, cyclin D1, cyclin A2, and cyclin E in pancreatic cancer cell lines. In conclusion, our data suggest that CST1 might contribute to the proliferation of pancreatic cancer cells and could be a potential biomarker for the early detection of pancreatic cancer. PMID:25577248

  12. A review of molecular biomarkers for bladder cancer

    Directory of Open Access Journals (Sweden)

    Miakhil I

    2013-01-01

    Full Text Available Background: Numerous molecular markers for bladder cancer have been identified and investigated with various laboratory techniques. Molecular markers are isolated from tissue, serum and urine. They fall into proteomic, genetic and epigenetic categories. Some of molecular markers show promising results in terms of facilitating early diagnosis and guiding treatment. Molecular markers or the so- called biomarkers can provide additional information alongside staging, grading and lymphovascular invasion, for better prognostication.Aim:This studyprovides an up-to-date review of the frequently studied and most important biomarkers that have shown consistent relevance in relation to bladder cancer. Methods: The key words were searched on the PubMed, Google scholar and NHS library search engines. Results: More than twenty biomarkers as per our methodology were identified but only half of them have shown consistence relevance in bladder cancer. Conclusion: It is envisaged that a combination of a few biomarkers, which are investigated frequently and have shown clinical relevance, could possibly provide useful information in predicting recurrence and provide useful prognostic information. So far none of the biomarkers for bladder cancer are adopted in the UK standard practice. Despite that the Food and Drug Administration (FDA had approved some of these biomarkers, none of the urology associations incorporated them in to their guidelines as yet. However, it won’t be long before a final consensus is reached to integrate molecular staging in to the current TNM staging system.

  13. Proteomic Serum Biomarkers and Their Potential Application in Cancer Screening Programs

    OpenAIRE

    Deelder, André M; Tollenaar, Rob A. E. M.; Mertens, Bart J.; Yuri E. M. van der Burgt; Anouck Huijbers; Tim J. A. Dekker; Wilma E. Mesker; Berit Velstra

    2010-01-01

    Early diagnosis of cancer is of pivotal importance to reduce disease-related mortality. There is great need for non-invasive screening methods, yet current screening protocols have limited sensitivity and specificity. The use of serum biomarkers to discriminate cancer patients from healthy persons might be a tool to improve screening programs. Mass spectrometry based proteomics is widely applied as a technology for mapping and identifying peptides and proteins in body fluids. One commonly use...

  14. Exosomal microRNA Biomarkers: Emerging Frontiers in Colorectal and Other Human Cancers.

    Science.gov (United States)

    Tovar-Camargo, Oscar A; Toden, Shusuke; Goel, Ajay

    2016-05-01

    Diagnostic strategies, particularly non-invasive blood-based screening approaches, are gaining increased attention for the early detection and attenuation of mortality associated with colorectal cancer (CRC). However, the majority of current screening approaches are inadequate at replacing the conventional CRC diagnostic procedures. Yet, due to technological advances and better understanding of molecular events underlying human cancer, a new category of biomarkers are on the horizon. Recent evidence indicates that cells release a distinct class of small vesicles called 'exosomes', which contain nucleic acids and proteins that reflect and typify host-cell molecular architecture. Intriguingly, exosomes released from cancer cells have a distinct genetic and epigenetic makeup, which allows them to undertake their tumorigenic function. From a clinical standpoint, these unique cancer-specific fingerprints present in exosomes appear to be detectable in a small amount of blood, making them very attractive substrates for developing cancer biomarkers, particularly noninvasive diagnostic approaches. PMID:26892862

  15. AGR3 in Breast Cancer: Prognostic Impact and Suitable Serum-Based Biomarker for Early Cancer Detection

    Science.gov (United States)

    Garczyk, Stefan; von Stillfried, Saskia; Antonopoulos, Wiebke; Hartmann, Arndt; Schrauder, Michael G.; Fasching, Peter A.; Anzeneder, Tobias; Tannapfel, Andrea; Ergönenc, Yavuz; Knüchel, Ruth

    2015-01-01

    Blood-based early detection of breast cancer has recently gained novel momentum, as liquid biopsy diagnostics is a fast emerging field. In this study, we aimed to identify secreted proteins which are up-regulated both in tumour tissue and serum samples of breast cancer patients compared to normal tissue and sera. Based on two independent tissue cohorts (n = 75 and n = 229) and one serum cohort (n = 80) of human breast cancer and healthy serum samples, we characterised AGR3 as a novel potential biomarker both for breast cancer prognosis and early breast cancer detection from blood. AGR3 expression in breast tumours is significantly associated with oestrogen receptor α (P<0.001) and lower tumour grade (P<0.01). Interestingly, AGR3 protein expression correlates with unfavourable outcome in low (G1) and intermediate (G2) grade breast tumours (multivariate hazard ratio: 2.186, 95% CI: 1.008-4.740, P<0.05) indicating an independent prognostic impact. In sera analysed by ELISA technique, AGR3 protein concentration was significantly (P<0.001) elevated in samples from breast cancer patients (n = 40, mainly low stage tumours) compared to healthy controls (n = 40). To develop a suitable biomarker panel for early breast cancer detection, we measured AGR2 protein in human serum samples in parallel. The combined AGR3/AGR2 biomarker panel achieved a sensitivity of 64.5% and a specificity of 89.5% as shown by receiver operating characteristic (ROC) curve statistics. Thus our data clearly show the potential usability of AGR3 and AGR2 as biomarkers for blood-based early detection of human breast cancer. PMID:25875093

  16. Cell Line Modeling to Study Biomarker Panel in Prostate Cancer

    Science.gov (United States)

    NickKholgh, Bita; Fang, Xiaolan; Winters, Shira M.; Raina, Anvi; Pandya, Komal S.; Gyabaah, Kenneth; Fino, Nora; Balaji, K.C.

    2016-01-01

    BACKGROUND African–American men with prostate cancer (PCa) present with higher-grade and -stage tumors compared to Caucasians. While the disparity may result from multiple factors, a biological basis is often strongly suspected. Currently, few well-characterized experimental model systems are available to study the biological basis of racial disparity in PCa. We report a validated in vitro cell line model system that could be used for the purpose. METHODS We assembled a PCa cell line model that included currently available African–American PCa cell lines and LNCaP (androgen-dependent) and C4-2 (castration-resistant) Caucasian PCa cells. The utility of the cell lines in studying the biological basis of variance in a malignant phenotype was explored using a multiplex biomarker panel consisting of proteins that have been proven to play a role in the progression of PCa. The panel expression was evaluated by Western blot and RT-PCR in cell lines and validated in human PCa tissues by RT-PCR. As proof-of-principle to demonstrate the utility of our model in functional studies, we performed MTS viability assays and molecular studies. RESULTS The dysregulation of the multiplex biomarker panel in primary African–American cell line (E006AA) was similar to metastatic Caucasian cell lines, which would suggest that the cell line model could be used to study an inherent aggressive phenotype in African–American men with PCa. We had previously demonstrated that Protein kinase D1 (PKD1) is a novel kinase that is down regulated in advanced prostate cancer. We established the functional relevance by over expressing PKD1, which resulted in decreased proliferation and epithelial mesenchymal transition (EMT) in PCa cells. Moreover, we established the feasibility of studying the expression of the multiplex biomarker panel in archived human PCa tissue from African–Americans and Caucasians as a prelude to future translational studies. CONCLUSION We have characterized a novel in

  17. Quantitative proteomic analysis by iTRAQ® for the identification of candidate biomarkers in ovarian cancer serum

    Directory of Open Access Journals (Sweden)

    Higgins LeeAnn

    2010-06-01

    Full Text Available Abstract Background Ovarian cancer is the most lethal gynecologic malignancy, with the majority of cases diagnosed at an advanced stage when treatments are less successful. Novel serum protein markers are needed to detect ovarian cancer in its earliest stage; when detected early, survival rates are over 90%. The identification of new serum biomarkers is hindered by the presence of a small number of highly abundant proteins that comprise approximately 95% of serum total protein. In this study, we used pooled serum depleted of the most highly abundant proteins to reduce the dynamic range of proteins, and thereby enhance the identification of serum biomarkers using the quantitative proteomic method iTRAQ®. Results Medium and low abundance proteins from 6 serum pools of 10 patients each from women with serous ovarian carcinoma, and 6 non-cancer control pools were labeled with isobaric tags using iTRAQ® to determine the relative abundance of serum proteins identified by MS. A total of 220 unique proteins were identified and fourteen proteins were elevated in ovarian cancer compared to control serum pools, including several novel candidate ovarian cancer biomarkers: extracellular matrix protein-1, leucine-rich alpha-2 glycoprotein-1, lipopolysaccharide binding protein-1, and proteoglycan-4. Western immunoblotting validated the relative increases in serum protein levels for several of the proteins identified. Conclusions This study provides the first analysis of immunodepleted serum in combination with iTRAQ® to measure relative protein expression in ovarian cancer patients for the pursuit of serum biomarkers. Several candidate biomarkers were identified which warrant further development.

  18. Serum biomarkers reflecting specific tumor tissue remodeling processes are valuable diagnostic tools for lung cancer

    International Nuclear Information System (INIS)

    Extracellular matrix (ECM) proteins, such as collagen type I and elastin, and intermediate filament (IMF) proteins, such as vimentin are modified and dysregulated as part of the malignant changes leading to disruption of tissue homeostasis. Noninvasive biomarkers that reflect such changes may have a great potential for cancer. Levels of matrix metalloproteinase (MMP) generated fragments of type I collagen (C1M), of elastin (ELM), and of citrullinated vimentin (VICM) were measured in serum from patients with lung cancer (n = 40), gastrointestinal cancer (n = 25), prostate cancer (n = 14), malignant melanoma (n = 7), chronic obstructive pulmonary disease (COPD) (n = 13), and idiopathic pulmonary fibrosis (IPF) (n = 10), as well as in age-matched controls (n = 33). The area under the receiver operating characteristics (AUROC) was calculated and a diagnostic decision tree generated from specific cutoff values. C1M and VICM were significantly elevated in lung cancer patients as compared with healthy controls (AUROC = 0.98, P < 0.0001) and other cancers (AUROC = 0.83 P < 0.0001). A trend was detected when comparing lung cancer with COPD+IPF. No difference could be seen for ELM. Interestingly, C1M and VICM were able to identify patients with lung cancer with a positive predictive value of 0.9 and an odds ratio of 40 (95% CI = 8.7–186, P < 0.0001). Biomarkers specifically reflecting degradation of collagen type I and citrullinated vimentin are applicable for lung cancer patients. Our data indicate that biomarkers reflecting ECM and IMF protein dysregulation are highly applicable in the lung cancer setting. We speculate that these markers may aid in diagnosing and characterizing patients with lung cancer

  19. Urinary PGE-M: a promising cancer biomarker.

    Science.gov (United States)

    Wang, Dingzhi; DuBois, Raymond N

    2013-06-01

    Cancer prevention, early diagnosis, and targeted therapies are the keys to success in better cancer control and treatment. A big challenge remains to identify biomarkers for predicting who may have higher cancer risk and are able to respond to certain chemopreventive agents as well as for assessing a patient's response during treatment. Although a large body of evidence indicates that chronic inflammation is a risk factor for cancer, it is unclear whether inflammatory biomarkers can be used to predict cancer risk, progression, and death. Considering the importance of the proinflammatory COX-2-derived prostaglandin E2 (PGE2) in inflammation and cancer, Morris and colleagues found that urinary PGE-M is positively associated with obesity, smoking, and lung metastases in patients with breast cancer (4). Along the same lines, Kim and colleagues showed a potential association between urinary PGE-M and breast cancer risk in postmenopausal women (beginning on page 511). In agreement with previous reports, their findings indicate that urinary PGE-M may serve as a promising biomarker for prognosticating cancer risk and disease progression. PMID:23636051

  20. Searching for a system: The quest for ovarian cancer biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Rodland, Karin D.; Maihle, Nita J.

    2011-11-01

    The stark difference in clinical outcome for patients with ovarian cancer diagnosed at early stages (95% at 5 years) versus late stages (27.6% at 5 years) has driven a decades-long quest for effective biomarkers that will enable earlier detection of ovarian cancer. Yet despite intense efforts, including the application of modern high throughput technologies such as transcriptomics and proteomics, there has been little improvement in performance compared to the gold standard of quantifying serum CA125 immunoreactivity paired with transvaginal ultrasound. This review describes the strategies that have been used for identification of ovarian cancer biomarkers, including the recent introduction of novel bioinformatic approaches. Results obtained using high throughput-based vs. biologically rational approaches for the discovery of diagnostic early detection biomarkers are compared and analyzed for functional enrichment.

  1. Midkine: A Novel Prognostic Biomarker for Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Jono, Hirofumi, E-mail: hjono@fc.kuh.kumamoto-u.ac.jp; Ando, Yukio [Department of Diagnostic Medicine, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto, 860-8556 (Japan)

    2010-04-20

    Since diagnosis at an early stage still remains a key issue for modern oncology and is crucial for successful cancer therapy, development of sensitive, specific, and non-invasive tumor markers, especially, in serum, is urgently needed. Midkine (MK), a plasma secreted protein, was initially identified in embryonal carcinoma cells at early stages of retinoic acid-induced differentiation. Multiple studies have reported that MK plays important roles in tumor progression, and is highly expressed in various malignant tumors. Because increased serum MK concentrations also have been reported in patients with various tumors, serum MK may have the potential to become a very useful tumor marker. Here, we review and discuss the possibility and usefulness of MK as a novel tumor marker.

  2. Biomarkers, Bundled Payments, and Colorectal Cancer Care

    OpenAIRE

    Ross, William; Lynch, Patrick; Raju, Gottumukkala; Rodriguez, Alma; Burke, Thomas; Hafemeister, Lisa; Hawk, Ernest; Wu, Xifeng; Raymond N. DuBois; MISHRA, LOPA

    2012-01-01

    Changes in the management of cancers such as colorectal cancer (CRC) are urgently needed, as such cancers continue to be one of the most commonly diagnosed cancers; CRC accounts for 21% of all cancers and is responsible for mortalities second only to lung cancer in the United States. A comprehensive science-driven approach towards markedly improved early detection/screening to efficacious targeted therapeutics with clear diagnostic and prognostic markers is essential. In addition, further cha...

  3. The Clinical Impact of Recent Advances in LC-MS for Cancer Biomarker Discovery and Verification

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hui; Shi, Tujin; Qian, Weijun; Liu, Tao; Kagan, Jacob; Srivastava, Sudhir; Smith, Richard D.; Rodland, Karin D.; Camp, David G.

    2016-01-01

    Mass spectrometry-based proteomics has become an indispensable tool in biomedical research with broad applications ranging from fundamental biology, systems biology, and biomarker discovery. Recent advances in LC-MS have made it become a major technology in clinical applications, especially in cancer biomarker discovery and verification. To overcome the challenges associated with the analysis of clinical samples, such as extremely wide dynamic range of protein concentrations in biofluids and the need to perform high throughput and accurate quantification, significant efforts have been devoted to improve the overall performance of LC-MS bases clinical proteomics. In this review, we summarize the recent advances in LC-MS in the aspect of cancer biomarker discovery and quantification, and discuss its potentials, limitations, and future perspectives.

  4. Identification of carboxyl terminal peptide of Fibrinogen as a potential serum biomarker for gastric cancer.

    Science.gov (United States)

    Wu, Cheng; Luo, Zhiwen; Tang, Dan; Liu, Lijie; Yao, Dingkang; Zhu, Liang; Wang, Zhiqiang

    2016-05-01

    Gastric cancer (GC) is a very common disease worldwide where new serum biomarkers are urgently needed to improve their early diagnosis. In this study, we aim to search for the potential serum protein/peptide biomarkers of GC by using surface-enhanced laser desorption/ionization time-of-flight mass spectrometry (SELDI-TOF-MS). We first obtained the serum protein/peptide profiles from a training dataset including 30 patients with GC, 16 cases with chronic benign gastric disease (CGD), and 30 normal controls (CON) where 15 protein peaks were identified to exhibit the obvious deviation (P CGD, and CON analyzed by Biomarker Wizard 3.1 software with three protein peaks with mass-to-charge (m/z) ratio 5910, 5342, and 6439 further confirmed in the validation dataset. Among the three protein peaks, peak 5910 displayed the most significantly different which could distinguish GC patients from CGD and CON with a sensitivity of 86.3 %, a specificity of 91.3 %, and the area under the receiver operating characteristic curve (AUC) of 0.89 by using the optimal cutoff value of 17.3. We further identified peak 5910 as the carboxyl terminal fraction of Fibrinogen α by LC-MS and validated its identity by antiserum-mediated SELDI-based immunodepletion assays. In sum, SELDI-TOF-MS method could effectively generate serum peptidome in cancer patients and provide a new approach to identify potentially diagnostic and prognostic biomarkers for cancer. The carboxyl terminal fraction of Fibrinogen α may be a potential serological biomarker for GC diagnosis. PMID:26662807

  5. Computational and Experimental Approaches to Cancer Biomarker Discovery

    DEFF Research Database (Denmark)

    Krzystanek, Marcin

    Effective cancer treatment requires good biomarkers: measurable indicators of some biological state or condition that constitute the cornerstone of personalized medicine. Prognostic biomarkers provide information about the likely course of the disease, while predictive biomarkers enable prediction...... of a patient’s response to a particular treatment, thus helping to avoid unnecessary treatment and unwanted side effects in non-responding individuals.Currently biomarker discovery is facilitated by recent advances in high-throughput technologies when association between a given biological phenotype...... levels show random distribution in a given cohort. However, gene expression levels may also be affected by technical bias when the actual measurement technology or sample handling may introduce a systematic error. If the distribution of systematic errors correlates with the biological phenotype then the...

  6. TRPM4 protein expression in prostate cancer

    DEFF Research Database (Denmark)

    Berg, Kasper Drimer; Soldini, Davide; Jung, Maria;

    2016-01-01

    BACKGROUND: Transient receptor potential cation channel, subfamily M, member 4 (TRPM4) messenger RNA (mRNA) has been shown to be upregulated in prostate cancer (PCa) and might be a new promising tissue biomarker. We evaluated TRPM4 protein expression and correlated the expression level with.......79-2.62; p = 0.01-0.03 for the two observers) when compared to patients with a lower staining intensity. CONCLUSIONS: TRPM4 protein expression is widely expressed in benign and cancerous prostate tissue, with highest staining intensities found in PCa. Overexpression of TRPM4 in PCa (combination of high...

  7. Development of a label-free LC-MS/MS strategy to approach the identification of candidate protein biomarkers of disease recurrence in prostate cancer patients in a clinical trial of combined hormone and radiation therapy.

    LENUS (Irish Health Repository)

    Morrissey, Brian

    2013-06-01

    Combined hormone and radiation therapy (CHRT) is one of the principle curative regimes for localised prostate cancer (PCa). Following treatment, many patients subsequently experience disease recurrence however; current diagnostics tests fail to predict the onset of disease recurrence. Biomarkers that address this issue would be of significant advantage.

  8. A meta analysis of pancreatic microarray datasets yields new targets as cancer genes and biomarkers.

    Directory of Open Access Journals (Sweden)

    Nalin C W Goonesekere

    Full Text Available The lack of specific symptoms at early tumor stages, together with a high biological aggressiveness of the tumor contribute to the high mortality rate for pancreatic cancer (PC, which has a five year survival rate of less than 5%. Improved screening for earlier diagnosis, through the detection of diagnostic and prognostic biomarkers provides the best hope of increasing the rate of curatively resectable carcinomas. Though many serum markers have been reported to be elevated in patients with PC, so far, most of these markers have not been implemented into clinical routine due to low sensitivity or specificity. In this study, we have identified genes that are significantly upregulated in PC, through a meta-analysis of large number of microarray datasets. We demonstrate that the biological functions ascribed to these genes are clearly associated with PC and metastasis, and that that these genes exhibit a strong link to pathways involved with inflammation and the immune response. This investigation has yielded new targets for cancer genes, and potential biomarkers for pancreatic cancer. The candidate list of cancer genes includes protein kinase genes, new members of gene families currently associated with PC, as well as genes not previously linked to PC. In this study, we are also able to move towards developing a signature for hypomethylated genes, which could be useful for early detection of PC. We also show that the significantly upregulated 800+ genes in our analysis can serve as an enriched pool for tissue and serum protein biomarkers in pancreatic cancer.

  9. Lung cancer screening: from imaging to biomarker

    OpenAIRE

    Xiang, Dong; Zhang, Bicheng; Doll, Donald; Shen, Kui; Kloecker, Goetz; Freter, Carl

    2013-01-01

    Despite several decades of intensive effort to improve the imaging techniques for lung cancer diagnosis and treatment, primary lung cancer is still the number one cause of cancer death in the United States and worldwide. The major causes of this high mortality rate are distant metastasis evident at diagnosis and ineffective treatment for locally advanced disease. Indeed, approximately forty percent of newly diagnosed lung cancer patients have distant metastasis. Currently, the only potential ...

  10. Proteomic Serum Biomarkers and Their Potential Application in Cancer Screening Programs

    Directory of Open Access Journals (Sweden)

    André M. Deelder

    2010-10-01

    Full Text Available Early diagnosis of cancer is of pivotal importance to reduce disease-related mortality. There is great need for non-invasive screening methods, yet current screening protocols have limited sensitivity and specificity. The use of serum biomarkers to discriminate cancer patients from healthy persons might be a tool to improve screening programs. Mass spectrometry based proteomics is widely applied as a technology for mapping and identifying peptides and proteins in body fluids. One commonly used approach in proteomics is peptide and protein profiling. Here, we present an overview of profiling methods that have the potential for implementation in a clinical setting and in national screening programs.

  11. Risk factors and novel biomarkers in breast cancer

    OpenAIRE

    Fourkala, E.-O.

    2011-01-01

    Efforts continue to identify and validate novel risk factors / biomarkers for breast cancer and improve current risk prediction models in the general population due to ongoing issues with sensitivity and specificity. The overall goal of this PhD study is to add to this effort. Specific aims are to (1) examine which is the best source of getting notified for breast cancer diagnosis in the general population since accurate data is crucial for risk assessment studies (2) investigate the assoc...

  12. Prostate cancer biomarker profiles in urinary sediments and exosomes

    NARCIS (Netherlands)

    Dijkstra, S.; Birker, I.L.; Smit, F.P.; Leyten, G.H.J.M.; Reijke, T.M. de; Oort, I.M. van; Mulders, P.F.A.; Jannink, S.A.; Schalken, J.A.

    2014-01-01

    PURPOSE: Urinary biomarker tests for diagnosing prostate cancer have gained considerable interest. Urine is a complex mixture that can be subfractionated. We evaluated 2 urinary fractions that contain nucleic acids, ie cell pellets and exosomes. The influence of digital rectal examination before uri

  13. Identification of candidate epigenetic biomarkers for ovarian cancer detection

    NARCIS (Netherlands)

    Huang, Yi-Wen; Jansen, Rachel A.; Fabbri, Enrica; Potter, Dustin; Liyanarachchi, Sandya; Chan, Michael W. Y.; Liu, Joseph C.; Crijns, Anne P. G.; Brown, Robert; Nephew, Kenneth P.; Van Der Zee, Ate G. J.; Cohn, David E.; Yan, Pearlly S.; Huang, Tim H. -M.; Lin, Huey-Jen L.

    2009-01-01

    Ovarian cancer ranks the most lethal among gynecologic neoplasms in women. To develop potential biomarkers for diagnosis, we have identified five novel genes (CYP39A1, GTF2A1, FOXD4L4, EBP, and HAAO) that are hypermethylated in ovarian tumors, compared with the non-malignant normal ovarian surface e

  14. Soluble endothelial protein C receptor (sEPCR) is likely a biomarker of cancer-associated hypercoagulability in human hematologic malignancies

    International Nuclear Information System (INIS)

    Elevated plasma level of soluble endothelial protein C receptor (sEPCR) may be an indicator of thrombotic risk. The present study aims to correlate leukemia-associated hypercoagulability to high level plasma sEPCR and proposes its measurement in routine clinical practice. EPCR expressions in leukemic cell lines were determined by flow cytometry, immunocytochemistry, and reverse transcription polymerase chain reaction (RT-PCR). EPCR gene sequence of a candidate cell line HL-60 was also determined. Plasma samples (n = 76) and bone marrow aspirates (n = 72) from 148 patients with hematologic malignancies and 101 healthy volunteers were analyzed by enzyme-linked immunosorbent assay (ELISA) via a retrospective study for sEPCR and D-dimer. All leukemic cell lines were found to express EPCR. Also, HL-60 EPCR gene sequence showed extensive similarities with the endothelial reference gene. All single nucleotide polymorphisms (SNPs) originally described and some new SNPs were revealed in the promoter and intronic regions. Among these patients 67% had plasma sEPCR level higher than the controls (100 ± 28 ng/mL), wherein 16.3% patients had experienced a previous thrombotic event. These patients were divided into: group-1 (n = 45) with amount of plasmatic sEPCR below 100 ng/mL, group-2 (n = 45) where the concentration of sEPCR was between 100 and 200, and group-3 (n = 20) higher than 200 ng/mL. The numbers of thrombotic incidence recorded in each group were four, six, and eight, respectively. These results reveal that EPCR is expressed not only by a wide range of human malignant hematological cells but also the detection of plasma sEPCR levels provides a powerful insight into thrombotic risk assessment in cancer patients, especially when it surpasses 200 ng/mL

  15. The Role of Proteomics in Biomarker Development for Improved Patient Diagnosis and Clinical Decision Making in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Claire L. Tonry

    2016-07-01

    Full Text Available Prostate Cancer (PCa is the second most commonly diagnosed cancer in men worldwide. Although increased expression of prostate-specific antigen (PSA is an effective indicator for the recurrence of PCa, its intended use as a screening marker for PCa is of considerable controversy. Recent research efforts in the field of PCa biomarkers have focused on the identification of tissue and fluid-based biomarkers that would be better able to stratify those individuals diagnosed with PCa who (i might best receive no treatment (active surveillance of the disease; (ii would benefit from existing treatments; or (iii those who are likely to succumb to disease recurrence and/or have aggressive disease. The growing demand for better prostate cancer biomarkers has coincided with the development of improved discovery and evaluation technologies for multiplexed measurement of proteins in bio-fluids and tissues. This review aims to (i provide an overview of these technologies as well as describe some of the candidate PCa protein biomarkers that have been discovered using them; (ii address some of the general limitations in the clinical evaluation and validation of protein biomarkers; and (iii make recommendations for strategies that could be adopted to improve the successful development of protein biomarkers to deliver improvements in personalized PCa patient decision making.

  16. Protein biomarkers of periodontitis in saliva.

    Science.gov (United States)

    Taylor, John J

    2014-01-01

    Periodontitis is a chronic inflammatory condition of the tissues that surround and support the teeth and is initiated by inappropriate and excessive immune responses to bacteria in subgingival dental plaque leading to loss of the integrity of the periodontium, compromised tooth function, and eventually tooth loss. Periodontitis is an economically important disease as it is time-consuming and expensive to treat. Periodontitis has a worldwide prevalence of 5-15% and the prevalence of severe disease in western populations has increased in recent decades. Furthermore, periodontitis is more common in smokers, in obesity, in people with diabetes, and in heart disease patients although the pathogenic processes underpinning these links are, as yet, poorly understood. Diagnosis and monitoring of periodontitis rely on traditional clinical examinations which are inadequate to predict patient susceptibility, disease activity, and response to treatment. Studies of the immunopathogenesis of periodontitis and analysis of mediators in saliva have allowed the identification of many potentially useful biomarkers. Convenient measurement of these biomarkers using chairside analytical devices could form the basis for diagnostic tests which will aid the clinician and the patient in periodontitis management; this review will summarise this field and will identify the experimental, technical, and clinical issues that remain to be addressed before such tests can be implemented. PMID:24944840

  17. A Novel Electrochemical Microfluidic Chip Combined with Multiple Biomarkers for Early Diagnosis of Gastric Cancer

    Science.gov (United States)

    Xie, Yao; Zhi, Xiao; Su, Haichuan; Wang, Kan; Yan, Zhen; He, Nongyue; Zhang, Jingpu; Chen, Di; Cui, Daxiang

    2015-12-01

    Early diagnosis is very important to improve the survival rate of patients with gastric cancer and to understand the biology of cancer. In order to meet the clinical demands for early diagnosis of gastric cancer, we developed a disposable easy-to-use electrochemical microfluidic chip combined with multiple antibodies against six kinds of biomarkers (carcinoembryonic antigen (CEA), carbohydrate antigen 19-9 (CA19-9), Helicobacter pylori CagA protein (H.P.), P53oncoprotein (P53), pepsinogen I (PG I), and PG-II). The six kinds of biomarkers related to gastric cancer can be detected sensitively and synchronously in a short time. The specially designed three electrodes system enables cross-contamination to be avoided effectively. The linear ranges of detection of the electrochemical microfluidic chip were as follows: 0.37-90 ng mL-1 for CEA, 10.75-172 U mL-1 for CA19-9, 10-160 U L-1 for H.P., 35-560 ng mL-1 for P53, 37.5-600 ng mL-1 for PG I, and 2.5-80 ng mL-1for PG II. This method owns better sensitivity compared with enzyme-linked immunosorbent assay (ELISA) results of 394 specimens of gastric cancer sera. Furthermore, we established a multi-index prediction model based on the six kinds of biomarkers for predicting risk of gastric cancer. In conclusion, the electrochemical microfluidic chip for detecting multiple biomarkers has great potential in applications such as early screening of gastric cancer patients, and therapeutic evaluation, and real-time dynamic monitoring the progress of gastric cancer in near future.

  18. Effects of synbiotics on cancer risk biomarkers

    OpenAIRE

    Clune, Yvonne E.

    2005-01-01

    Colorectal cancer (CRC) is the fourth most common cause of death from cancer in the world and second most common (behind lung cancer) in developed countries. In recent years there has been much interest in the potential use of prebiotics, probiotics and synbiotics in the prevention and treatment of CRC. We have previously shown that synbiotic consumption in Azoxymethane treated rats modulates the immune system, influences the genotoxic potential of caecal contents and reduces the number of co...

  19. Biomarkers of Angiogenesis in Colorectal Cancer

    OpenAIRE

    Luay Mousa; Salem, Mohamed E.; Sameh Mikhail

    2015-01-01

    Colorectal cancer (CRC) is the third most common cancer worldwide and accounts for 10% of all new cancer diagnoses. Angiogenesis is a tightly regulated process that is mediated by a group of angiogenic factors such as vascular endothelial growth factor and its receptors. Given the widespread use of antiangiogenic agents in CRC, there has been considerable interest in the development of methods to identify novel markers that can predict outcome in the treatment of this disease with angiogenesi...

  20. Evaluating biomarkers to model cancer risk post cosmic ray exposure

    Science.gov (United States)

    Sridharan, Deepa M.; Asaithamby, Aroumougame; Blattnig, Steve R.; Costes, Sylvain V.; Doetsch, Paul W.; Dynan, William S.; Hahnfeldt, Philip; Hlatky, Lynn; Kidane, Yared; Kronenberg, Amy; Naidu, Mamta D.; Peterson, Leif E.; Plante, Ianik; Ponomarev, Artem L.; Saha, Janapriya; Snijders, Antoine M.; Srinivasan, Kalayarasan; Tang, Jonathan; Werner, Erica; Pluth, Janice M.

    2016-06-01

    Robust predictive models are essential to manage the risk of radiation-induced carcinogenesis. Chronic exposure to cosmic rays in the context of the complex deep space environment may place astronauts at high cancer risk. To estimate this risk, it is critical to understand how radiation-induced cellular stress impacts cell fate decisions and how this in turn alters the risk of carcinogenesis. Exposure to the heavy ion component of cosmic rays triggers a multitude of cellular changes, depending on the rate of exposure, the type of damage incurred and individual susceptibility. Heterogeneity in dose, dose rate, radiation quality, energy and particle flux contribute to the complexity of risk assessment. To unravel the impact of each of these factors, it is critical to identify sensitive biomarkers that can serve as inputs for robust modeling of individual risk of cancer or other long-term health consequences of exposure. Limitations in sensitivity of biomarkers to dose and dose rate, and the complexity of longitudinal monitoring, are some of the factors that increase uncertainties in the output from risk prediction models. Here, we critically evaluate candidate early and late biomarkers of radiation exposure and discuss their usefulness in predicting cell fate decisions. Some of the biomarkers we have reviewed include complex clustered DNA damage, persistent DNA repair foci, reactive oxygen species, chromosome aberrations and inflammation. Other biomarkers discussed, often assayed for at longer points post exposure, include mutations, chromosome aberrations, reactive oxygen species and telomere length changes. We discuss the relationship of biomarkers to different potential cell fates, including proliferation, apoptosis, senescence, and loss of stemness, which can propagate genomic instability and alter tissue composition and the underlying mRNA signatures that contribute to cell fate decisions. Our goal is to highlight factors that are important in choosing

  1. Secreted proteins as a fundamental source for biomarker discovery

    Czech Academy of Sciences Publication Activity Database

    Šťastná, Miroslava; Van Eyk, J.E.

    2012-01-01

    Roč. 12, 4-5 (2012), s. 722-735. ISSN 1615-9853 Institutional research plan: CEZ:AV0Z40310501 Keywords : conditioned media * secreted proteins * proteomics * biomarker discovery Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 4.132, year: 2012

  2. Novel Biomarker Proteins in Chronic Lymphocytic Leukemia: Impact on Diagnosis, Prognosis and Treatment

    Science.gov (United States)

    Admoni-Elisha, Lee; Nakdimon, Itay; Shteinfer, Anna; Prezma, Tal; Arif, Tasleem; Arbel, Nir; Melkov, Anna; Zelichov, Ori; Levi, Itai; Shoshan-Barmatz, Varda

    2016-01-01

    In many cancers, cells undergo re-programming of metabolism, cell survival and anti-apoptotic defense strategies, with the proteins mediating this reprogramming representing potential biomarkers. Here, we searched for novel biomarker proteins in chronic lymphocytic leukemia (CLL) that can impact diagnosis, treatment and prognosis by comparing the protein expression profiles of peripheral blood mononuclear cells from CLL patients and healthy donors using specific antibodies, mass spectrometry and binary logistic regression analyses and other bioinformatics tools. Mass spectrometry (LC-HR-MS/MS) analysis identified 1,360 proteins whose expression levels were modified in CLL-derived lymphocytes. Some of these proteins were previously connected to different cancer types, including CLL, while four other highly expressed proteins were not previously reported to be associated with cancer, and here, for the first time, DDX46 and AK3 are linked to CLL. Down-regulation expression of two of these proteins resulted in cell growth inhibition. High DDX46 expression levels were associated with shorter survival of CLL patients and thus can serve as a prognosis marker. The proteins with modified expression include proteins involved in RNA splicing and translation and particularly mitochondrial proteins involved in apoptosis and metabolism. Thus, we focused on several metabolism- and apoptosis-modulating proteins, particularly on the voltage-dependent anion channel 1 (VDAC1), regulating both metabolism and apoptosis. Expression levels of Bcl-2, VDAC1, MAVS, AIF and SMAC/Diablo were markedly increased in CLL-derived lymphocytes. VDAC1 levels were highly correlated with the amount of CLL-cancerous CD19+/CD5+ cells and with the levels of all other apoptosis-modulating proteins tested. Binary logistic regression analysis demonstrated the ability to predict probability of disease with over 90% accuracy. Finally, based on the changes in the levels of several proteins in CLL patients, as

  3. Osteopontin is a prognostic biomarker in non-small cell lung cancer

    OpenAIRE

    Rud, Ane Kristine Kongsgaard; Pedersen, Kjetil Boye; Øijordsbakken, Miriam; Lund-Iversen, Marius; Halvorsen, Ann Rita; Solberg, Steinar; Berge, Gisle; Helland, Åslaug; Brustugun, Odd Terje; Mælandsmo, Gunhild

    2013-01-01

    Background: In a previously published report we characterized the expression of the metastasis-associated proteins S100A4, osteopontin (OPN) and ephrin-A1 in a prospectively collected panel of non-small cell lung cancer (NSCLC) tumors. The aim of the present follow-up study was to investigate the prognostic impact of these potential biomarkers in the same patient cohort. In addition, circulating serum levels of OPN were measured and single nucleotide polymorphisms (SNP) in the −44...

  4. Quantitative proteomics in resected renal cancer tissue for biomarker discovery and profiling

    OpenAIRE

    Atrih, A; Mudaliar, M A V; Zakikhani, P; Lamont, D J; Huang, J T-J; Bray, S.E.; Barton, G.; Fleming, S; Nabi, G.

    2014-01-01

    Background: Proteomics-based approaches for biomarker discovery are promising strategies used in cancer research. We present state-of-art label-free quantitative proteomics method to assess proteome of renal cell carcinoma (RCC) compared with noncancer renal tissues. Methods: Fresh frozen tissue samples from eight primary RCC lesions and autologous adjacent normal renal tissues were obtained from surgically resected tumour-bearing kidneys. Proteins were extracted by complete solubilisation of...

  5. Biomarker-guided repurposing of chemotherapeutic drugs for cancer therapy

    DEFF Research Database (Denmark)

    Stenvang, Jan; Kümler, Iben; Nygård, Sune Boris;

    2013-01-01

    process. This research strategy is commonly known as drug repurposing or drug repositioning and provides a faster path to the clinics. We have developed and implemented a modification of the standard drug repurposing strategy that we review here; rather than investigating target-promiscuous non...... any non-standard chemotherapeutic drug will be relatively low in such a patient cohort it is a pre-requisite that such testing is based on predictive biomarkers. This review describes our strategy of biomarker-guided repurposing of chemotherapeutic drugs for cancer therapy, taking the repurposing of......Cancer is a leading cause of mortality worldwide and matters are only set to worsen as its incidence continues to rise. Traditional approaches to combat cancer include improved prevention, early diagnosis, optimized surgery, development of novel drugs, and honing regimens of existing anti...

  6. Biomarkers of the Metabolic Syndrome and Breast Cancer Prognosis

    Directory of Open Access Journals (Sweden)

    Meng-Hua Tao

    2010-04-01

    Full Text Available In spite of its public health importance, our understanding of the mechanisms of breast carcinogenesis and progress is still evolving. The metabolic syndrome (MS is a constellation of biochemical abnormalities including visceral adiposity, hyperglycemia, hyperinsulinemia, dyslipidemia and high blood pressure. The components of the MS have all been related to late-stage disease and even to a poor prognosis of breast cancer through multiple interacting mechanisms. In this review, we aim to present a summary of recent advances in the understanding of the contribution of the MS to breast cancer with the emphasis on the role of biomarkers of the MS in the prognosis of breast cancer.

  7. Biomarkers of the Metabolic Syndrome and Breast Cancer Prognosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Qiu-Li; Xu, Wang-Hong, E-mail: mtao@buffalo.edu [Department of Epidemiology, School of Public Health, Fudan University, Shanghai 200032 (China); Tao, Meng-Hua, E-mail: mtao@buffalo.edu [Department of Social and Preventive Medicine, School of Public Health and Health Professions, University at Buffalo, Buffalo, NY 14214 (United States)

    2010-04-28

    In spite of its public health importance, our understanding of the mechanisms of breast carcinogenesis and progress is still evolving. The metabolic syndrome (MS) is a constellation of biochemical abnormalities including visceral adiposity, hyperglycemia, hyperinsulinemia, dyslipidemia and high blood pressure. The components of the MS have all been related to late-stage disease and even to a poor prognosis of breast cancer through multiple interacting mechanisms. In this review, we aim to present a summary of recent advances in the understanding of the contribution of the MS to breast cancer with the emphasis on the role of biomarkers of the MS in the prognosis of breast cancer.

  8. Biomarkers of the Metabolic Syndrome and Breast Cancer Prognosis

    International Nuclear Information System (INIS)

    In spite of its public health importance, our understanding of the mechanisms of breast carcinogenesis and progress is still evolving. The metabolic syndrome (MS) is a constellation of biochemical abnormalities including visceral adiposity, hyperglycemia, hyperinsulinemia, dyslipidemia and high blood pressure. The components of the MS have all been related to late-stage disease and even to a poor prognosis of breast cancer through multiple interacting mechanisms. In this review, we aim to present a summary of recent advances in the understanding of the contribution of the MS to breast cancer with the emphasis on the role of biomarkers of the MS in the prognosis of breast cancer

  9. Epigenetic biomarkers in prostate cancer: Current and future uses.

    Science.gov (United States)

    Chiam, Karen; Ricciardelli, Carmela; Bianco-Miotto, Tina

    2014-01-28

    Epigenome alterations are characteristic of nearly all human malignancies and include changes in DNA methylation, histone modifications and microRNAs (miRNAs). However, what induces these epigenetic alterations in cancer is largely unknown and their mechanistic role in prostate tumorigenesis is just beginning to be evaluated. Identification of the epigenetic modifications involved in the development and progression of prostate cancer will not only identify novel therapeutic targets but also prognostic and diagnostic markers. This review will focus on the use of epigenetic modifications as biomarkers for prostate cancer. PMID:22391123

  10. Exosomal miRNAs as cancer biomarkers and therapeutic targets

    OpenAIRE

    Arron Thind; Clive Wilson

    2016-01-01

    Intercommunication between cancer cells and with their surrounding and distant environments is key to the survival, progression and metastasis of the tumour. Exosomes play a role in this communication process. MicroRNA (miRNA) expression is frequently dysregulated in tumour cells and can be reflected by distinct exosomal miRNA (ex-miRNA) profiles isolated from the bodily fluids of cancer patients. Here, the potential of ex-miRNA as a cancer biomarker and therapeutic target is critically analy...

  11. Chromosomal aberrations and SCEs as biomarkers of cancer risk

    DEFF Research Database (Denmark)

    Norppa, H; Bonassi, S; Hansteen, I-L; Hagmar, L; Strömberg, U; Rössner, P; Boffetta, P; Lindholm, C; Gundy, S; Lazutka, J; Cebulska-Wasilewska, A; Fabiánová, E; Srám, R J; Knudsen, Lisbeth E.; Barale, R; Fucic, A

    Previous studies have suggested that the frequency of chromosomal aberrations (CAs), but not of sister chromatid exchanges (SCEs), predicts cancer risk. We have further examined this relationship in European cohorts comprising altogether almost 22,000 subjects, in the framework of a European...... collaborative project (CancerRiskBiomarkers). The present paper gives an overview of some of the results of the project, especially as regards CAs and SCEs. The results confirm that a high level of CAs is associated with an increased risk of cancer and indicate that this association does not depend on the time...... between CA analysis and cancer detection, i.e., is obviously not explained by undetected cancer. The present evidence indicates that both chromatid-type and chromosome-type CAs predict cancer, even though some data suggest that chromosome-type CAs may have a more pronounced predictive value than chromatid...

  12. Candidate serum biomarkers for early intestinal cancer using 15N metabolic labeling and quantitative proteomics in the Apcmin/+ mouse

    OpenAIRE

    Ivancic, Melanie M.; Huttlin, Edward L.; Chen, Xiaodi; Pleiman, Jennifer K; Irving, Amy A; Hegeman, Adrian D.; Dove, William F.; Sussman, Michael R.

    2013-01-01

    Current screening procedures for colorectal cancer are imperfect, highly invasive and result in increased mortality rates due to low compliance. The goal of the experiments reported herein is to identify potential blood-based biomarkers indicative of early-stage intestinal cancers using the ApcMin/+ mouse model of intestinal cancer as an experimental system. Serum proteins from tumor-bearing ApcMin/+ mice were quantitatively compared to tumor-free Apc+/+ wild-type mice via in anima metabolic ...

  13. Single Step Nanoplasmonic Immunoassay for the Measurement of Protein Biomarkers

    OpenAIRE

    Shradha Prabhulkar; Adam de la Zerda; Amit Paranjape; Awdeh, Richard M.

    2013-01-01

    A nanoplasmonic biosensor for highly-sensitive, single-step detection of protein biomarkers is presented. The principle is based on the utilization of the optical scattering properties of gold nanorods (GNRs) conjugated to bio-recognition molecules. The nanoplasmonic properties of the GNRs were utilized to detect proteins using near-infrared light interferometry. We show that the antibody-conjugated GNRs can specifically bind to our model analyte, Glucose Transporter-1 (Glut-1). The signal in...

  14. Urine protein concentration estimation for biomarker discovery.

    Science.gov (United States)

    Mistry, Hiten D; Bramham, Kate; Weston, Andrew J; Ward, Malcolm A; Thompson, Andrew J; Chappell, Lucy C

    2013-10-01

    Recent advances have been made in the study of urinary proteomics as a diagnostic tool for renal disease and pre-eclampsia which requires accurate measurement of urinary protein. We compared different protein assays (Bicinchoninic acid (BCA), Lowry and Bradford) against the 'gold standard' amino-acid assay in urine from 43 women (8 non-pregnant, 34 pregnant, including 8 with pre-eclampsia). BCA assay was superior to both Lowry and Bradford assays (Bland Altman bias: 0.08) compared to amino-acid assay, which performed particularly poorly at higher protein concentrations. These data highlight the need to use amino-acid or BCA assays for unprocessed urine protein estimation. PMID:26103798

  15. Oncoprotein DEK as a tissue and urinary biomarker for bladder cancer

    International Nuclear Information System (INIS)

    Bladder cancer is a significant healthcare problem in the United States of America with a high recurrence rate. Early detection of bladder cancer is essential for removing the tumor with preservation of the bladder, avoiding metastasis and hence improving prognosis and long-term survival. The objective of this study was to analyze the presence of DEK protein in voided urine of bladder cancer patients as a urine-based bladder cancer diagnostic test. We examined the expression of DEK protein by western blot in 38 paired transitional cell carcinoma (TCC) bladder tumor tissues and adjacent normal tissue. The presence of DEK protein in voided urine was analyzed by western blot in 42 urine samples collected from patients with active TCC, other malignant urogenital disease and healthy individuals. The DEK protein is expressed in 33 of 38 bladder tumor tissues with no expression in adjacent normal tissue. Based on our sample size, DEK protein is expressed in 100% of tumors of low malignant potential, 92% of tumors of low grade and in 71% of tumors of high grade. Next, we analyzed 42 urine samples from patients with active TCC, other malignant urogenital disease, non-malignant urogenital disease and healthy individuals for DEK protein expression by western blot analysis. We are the first to show that the DEK protein is present in the urine of bladder cancer patients. Approximately 84% of TCC patient urine specimens were positive for urine DEK. Based on our pilot study of 38 bladder tumor tissue and 42 urine samples from patients with active TCC, other malignant urogenital disease, non-malignant urogenital disease and healthy individuals; DEK protein is expressed in bladder tumor tissue and voided urine of bladder cancer patients. The presence of DEK protein in voided urine is potentially a suitable biomarker for bladder cancer and that the screening for the presence of DEK protein in urine can be explored as a noninvasive diagnostic test for bladder cancer

  16. Cantilever with immobilized antibody for liver cancer biomarker detection

    International Nuclear Information System (INIS)

    A novel cantilever array-based bio-sensor was batch-fabricated with IC compatible MEMS technology for precise liver cancer bio-marker detection. A micro-cavity was designed in the free end of the cantilever for local antibody-immobilization, thus the adsorption of the cancer biomarker takes place only in the local region of the cantilever instead of the whole lever, and the effect of adsorption-induced k variation can be dramatically reduced. These structural features offer several advantages: high sensitivity, high throughput, high mass detection accuracy, and a portable system. In addition, an analytical model has been established to eliminate the effect of the adsorption-induced lever stiffness change and has been applied to the precise mass detection of the cancer biomarker AFP; the experimentally detected AFP antigen mass by the sensor (7.6 pg/mL) is quite close to the calculated one (5.5 pg/mL), two orders of magnitude better than those of the fully antibody-immobilized cantilever sensor. These approaches can promote real applications of the cantilever sensors in cancer diagnosis. (semiconductor devices)

  17. Cantilever with immobilized antibody for liver cancer biomarker detection

    Science.gov (United States)

    Shuaipeng, Wang; Jingjing, Wang; Yinfang, Zhu; Jinling, Yang; Fuhua, Yang

    2014-10-01

    A novel cantilever array-based bio-sensor was batch-fabricated with IC compatible MEMS technology for precise liver cancer bio-marker detection. A micro-cavity was designed in the free end of the cantilever for local antibody-immobilization, thus the adsorption of the cancer biomarker takes place only in the local region of the cantilever instead of the whole lever, and the effect of adsorption-induced k variation can be dramatically reduced. These structural features offer several advantages: high sensitivity, high throughput, high mass detection accuracy, and a portable system. In addition, an analytical model has been established to eliminate the effect of the adsorption-induced lever stiffness change and has been applied to the precise mass detection of the cancer biomarker AFP; the experimentally detected AFP antigen mass by the sensor (7.6 pg/mL) is quite close to the calculated one (5.5 pg/mL), two orders of magnitude better than those of the fully antibody-immobilized cantilever sensor. These approaches can promote real applications of the cantilever sensors in cancer diagnosis.

  18. Mass spectrometry based translational proteomics for biomarker discovery and application in colorectal cancer.

    Science.gov (United States)

    Ma, Hong; Chen, Guilin; Guo, Mingquan

    2016-04-01

    Colorectal cancer (CRC) is a leading cause of cancer-related death in the world. Clinically, early detection of the disease is the most effective approach to tackle this tough challenge. Discovery and development of reliable and effective diagnostic tools for the assessment of prognosis and prediction of response to drug therapy are urgently needed for personalized therapies and better treatment outcomes. Among many ongoing efforts in search for potential CRC biomarkers, MS-based translational proteomics provides a unique opportunity for the discovery and application of protein biomarkers toward better CRC early detection and treatment. This review updates most recent studies that use preclinical models and clinical materials for the identification of CRC-related protein markers. Some new advances in the development of CRC protein markers such as CRC stem cell related protein markers, SRM/MRM-MS and MS cytometry approaches are also discussed in order to address future directions and challenges from bench translational research to bedside clinical application of CRC biomarkers. PMID:26616366

  19. Identification of Tetranectin as a Potential Biomarker for Metastatic Oral Cancer

    Directory of Open Access Journals (Sweden)

    Shen Hu

    2010-09-01

    Full Text Available Lymph node involvement is the most important predictor of survival rates in patients with oral squamous cell carcinoma (OSCC. A biomarker that can indicate lymph node metastasis would be valuable to classify patients with OSCC for optimal treatment. In this study, we have performed a serum proteomic analysis of OSCC using 2-D gel electrophoresis and liquid chromatography/tandem mass spectrometry. One of the down-regulated proteins in OSCC was identified as tetranectin, which is a protein encoded by the CLEC3B gene (C-type lectin domain family 3, member B. We further tested the protein level in serum and saliva from patients with lymph-node metastatic and primary OSCC. Tetranectin was found significantly under-expressed in both serum and saliva of metastatic OSCC compared to primary OSCC. Our results suggest that serum or saliva tetranectin may serve as a potential biomarker for metastatic OSCC. Other candidate serum biomarkers for OSCC included superoxide dismutase, ficolin 2, CD-5 antigen-like protein, RalA binding protein 1, plasma retinol-binding protein and transthyretin. Their clinical utility for OSCC detection remains to be further tested in cancer patients.

  20. Proteomic profiling of mammary carcinomas identifies C7orf24, a gamma-glutamyl cyclotransferase, as a potential cancer biomarker

    DEFF Research Database (Denmark)

    Gromov, Pavel; Gromova, Irina; Friis, Esbern;

    2010-01-01

    Breast cancer is the leading cause of cancer deaths in women today and is the most common cancer (excluding skin cancers) among women in the Western world. Although cancers detected by screening mammography are significantly smaller than nonscreening ones, noninvasive biomarkers for detection...... found in other cancer types. Four of these were investigated in greater detail, and we found that a proportion of tumors (58% in cervical, 38% in lung, 72% in colon, and 46% in breast cancer) expressed C7orf24 at levels exceeding those seen in normal samples. The observed overexpression of this protein...... in different types of cancer suggests deregulation of C7orf24 to be a general event in epithelial carcinogenesis, indicating that this protein may play an important role in cancer cell biology and thus constitute a novel therapeutic target. Furthermore, as C7orf24 is externalized to the tissue extracellular...

  1. Protein Kinase A in Cancer

    Directory of Open Access Journals (Sweden)

    Antonio Caretta

    2011-02-01

    Full Text Available In the past, many chromosomal and genetic alterations have been examined as possible causes of cancer. However, some tumors do not display a clear molecular and/or genetic signature. Therefore, other cellular processes may be involved in carcinogenesis. Genetic alterations of proteins involved in signal transduction have been extensively studied, for example oncogenes, while modifications in intracellular compartmentalization of these molecules, or changes in the expression of unmodified genes have received less attention. Yet, epigenetic modulation of second messenger systems can deeply modify cellular functioning and in the end may cause instability of many processes, including cell mitosis. It is important to understand the functional meaning of modifications in second messenger intracellular pathways and unravel the role of downstream proteins in the initiation and growth of tumors. Within this framework, the cAMP system has been examined. cAMP is a second messenger involved in regulation of a variety of cellular functions. It acts mainly through its binding to cAMP-activated protein kinases (PKA, that were suggested to participate in the onset and progression of various tumors. PKA may represent a biomarker for tumor detection, identification and staging, and may be a potential target for pharmacological treatment of tumors.

  2. Protein Kinase A in Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Caretta, Antonio; Mucignat-Caretta, Carla, E-mail: carla.mucignat@unipd.it [Department of Human Anatomy and Physiology, University of Padova, Via Marzolo 3, 35131 Padova (Italy)

    2011-02-28

    In the past, many chromosomal and genetic alterations have been examined as possible causes of cancer. However, some tumors do not display a clear molecular and/or genetic signature. Therefore, other cellular processes may be involved in carcinogenesis. Genetic alterations of proteins involved in signal transduction have been extensively studied, for example oncogenes, while modifications in intracellular compartmentalization of these molecules, or changes in the expression of unmodified genes have received less attention. Yet, epigenetic modulation of second messenger systems can deeply modify cellular functioning and in the end may cause instability of many processes, including cell mitosis. It is important to understand the functional meaning of modifications in second messenger intracellular pathways and unravel the role of downstream proteins in the initiation and growth of tumors. Within this framework, the cAMP system has been examined. cAMP is a second messenger involved in regulation of a variety of cellular functions. It acts mainly through its binding to cAMP-activated protein kinases (PKA), that were suggested to participate in the onset and progression of various tumors. PKA may represent a biomarker for tumor detection, identification and staging, and may be a potential target for pharmacological treatment of tumors.

  3. Clinical Utility of Biomarkers in Localized Prostate Cancer.

    OpenAIRE

    Leapman, MS; Nguyen, HG; Cooperberg, MR

    2016-01-01

    A new generation of prostate cancer (PCa) biomarkers has emerged, including diagnostic serum and urine markers aimed at refining the identification high-grade tumors and tissue-based gene expression assays offering prognostic and predictive clinical information. Such tests seek to improve treatment-related decisions at multiple decision points, including initial diagnosis and following initial primary therapy. In this review, we aim to contextualize the body of evidence surrounding these emer...

  4. Characterisation of novel biomarkers for cancer therapy monitoring

    Czech Academy of Sciences Publication Activity Database

    Hrabáková, Rita; Kollareddy, M.; Tylečková, Jiřina; Halada, Petr; Hajdúch, M.; Kovářová, Hana

    Brixen: Max-Planck-Institute for Biophysical Chemistry, 2011. s. 1-1. [5th European Summer School „Proteomic basics“. 31.07.2011-06.08.2011, Brixen] R&D Projects: GA MŠk LC07017; GA MŠk MSM6198959216 Institutional research plan: CEZ:AV0Z50450515; CEZ:AV0Z50200510 Keywords : drug resistance * anti-cancer therapy * proteomics * biomarker Subject RIV: CE - Biochemistry

  5. Plasma alkylresorcinols, biomarkers of whole-grain wheat and rye intake, and incidence of colorectal cancer

    DEFF Research Database (Denmark)

    Kyrø, Cecilie; Olsen, Anja; Landberg, Rikard;

    2014-01-01

    between alkylresorcinols, biomarkers of whole-grain rye and wheat intake, and colorectal cancer incidence were investigated using prediagnostic plasma samples from colorectal cancer case patients and matched control subjects nested within the European Prospective Investigation into Cancer and Nutrition...

  6. Protein fingerprints of anti-cancer effects of cyclin-dependent kinase inhibition: identification of candidate biomarkers using 2-D liquid phase separation coupled to mass spectrometry

    Czech Academy of Sciences Publication Activity Database

    Skalníková, Helena; Halada, Petr; Dzubak, P.; Hajdúch, M.; Kovářová, Hana

    2005-01-01

    Roč. 4, č. 4 (2005), s. 447-454. ISSN 1533-0346 R&D Projects: GA ČR GA301/05/0418 Institutional research plan: CEZ:AV0Z50450515; CEZ:AV0Z50200510 Keywords : protein fingerprints Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.677, year: 2005

  7. Candidate List of yoUr Biomarker (CLUB: A Web-based Platform to Aid Cancer Biomarker Research

    Directory of Open Access Journals (Sweden)

    N. Leigh Anderson

    2008-01-01

    Full Text Available CLUB (“Candidate List of yoUr Biomarkers” is a freely available, web-based resource designed to support Cancer biomarker research. It is targeted to provide a comprehensive list of candidate biomarkers for various cancers that have been reported by the research community. CLUB provides tools for comparison of marker candidates from different experimental platforms, with the ability to filter, search, query and explore, molecular interaction networks associated with cancer biomarkers from the published literature and from data uploaded by the community. This complex and ambitious project is implemented in phases. As a first step, we have compiled from the literature an initial set of differentially expressed human candidate cancer biomarkers. Each candidate is annotated with information from publicly available databases such as Gene Ontology, Swiss-Prot database, National Center for Biotechnology Information’s reference sequences, Biomolecular Interaction Network Database and IntAct interaction. The user has the option to maintain private lists of biomarker candidates or share and export these for use by the community. Furthermore, users may customize and combine commonly used sets of selection procedures and apply them as a stored workflow using selected candidate lists. To enable an assessment by the user before taking a candidate biomarker to the experimental validation stage, the platform contains the functionality to identify pathways associated with cancer risk, staging, prognosis, outcome in cancer and other clinically associated phenotypes. The system is available at http://club.bii.a-star.edu.sg.

  8. Fucose: A biomarker in grading of oral cancer

    OpenAIRE

    Kumar, Satish; Saxena, Mona; Srinivas, Kandakurtis; Singh, Vinod Kumar

    2015-01-01

    Introduction: Early diagnosis of cancer helps a great deal in the management of oral cancer patients. Number of proteinous markers have been employed for this purpose. Majority of them are not specific. Recently conjugated oligosaccharide with proteins and lipids have gained considerable importance in the present postgenomics and postproteomic period in the diagnostic and prognostics of cancer cases. Materials and Methods: In this study, serum fucose levels were estimated in 50 control cases ...

  9. Altered Endosome Biogenesis in Prostate Cancer has Biomarker Potential

    OpenAIRE

    Johnson, Ian R D; Parkinson-Lawrence, Emma J.; Shandala, Tetyana; Weigert, Roberto; Lisa M Butler; Brooks, Doug A.

    2014-01-01

    Prostate cancer is the second most common form of cancer in males, affecting one in eight men by the time they reach the age of 70. Current diagnostic tests for prostate cancer have significant problems with both false negatives and false positives, necessitating the search for new molecular markers. A recent investigation of endosomal and lysosomal proteins revealed that the critical process of endosomal biogenesis might be altered in prostate cancer. Here, a panel of endosomal markers was e...

  10. Molecular biomarker set for early detection of ovarian cancer

    KAUST Repository

    Bajic, Vladimir B.

    2015-06-16

    Embodiments of the present invention concern methods and compositions related to detection of ovarian cancer, including detection of the stage of ovarian cancer, in some cases. In particular, the invention encompasses use of expression of TFAP2A and in some embodiments CA125 and/or E2F5 to identify ovarian cancer, including detecting mRNA and/or protein levels of the respective gene products. Kits for detection of ovarian cancer are also described.

  11. Biomarkers for Response to Neoadjuvant Chemoradiation for Rectal Cancer

    International Nuclear Information System (INIS)

    Locally advanced rectal cancer (LARC) is currently treated with neoadjuvant chemoradiation. Although approximately 45% of patients respond to neoadjuvant therapy with T-level downstaging, there is no effective method of predicting which patients will respond. Molecular biomarkers have been investigated for their ability to predict outcome in LARC treated with neoadjuvant chemotherapy and radiation. A literature search using PubMed resulted in the initial assessment of 1,204 articles. Articles addressing the ability of a biomarker to predict outcome for LARC treated with neoadjuvant chemotherapy and radiation were included. Six biomarkers met the criteria for review: p53, epidermal growth factor receptor (EGFR), thymidylate synthase, Ki-67, p21, and bcl-2/bax. On the basis of composite data, p53 is unlikely to have utility as a predictor of response. Epidermal growth factor receptor has shown promise as a predictor when quantitatively evaluated in pretreatment biopsies or when EGFR polymorphisms are evaluated in germline DNA. Thymidylate synthase, when evaluated for polymorphisms in germline DNA, is promising as a predictive biomarker. Ki-67 and bcl-2 are not useful in predicting outcome. p21 needs to be further evaluated to determine its usefulness in predicting outcome. Bax requires more investigation to determine its usefulness. Epidermal growth factor receptor, thymidylate synthase, and p21 should be evaluated in larger prospective clinical trials for their ability to guide preoperative therapy choices in LARC.

  12. Probing the O-glycoproteome of Gastric Cancer Cell Lines for Biomarker Discovery

    DEFF Research Database (Denmark)

    Vieira Campos, Diana Alexandra; Freitas, Daniela; Gomes, Joana; Magalhães, Ana; Steentoft, Catharina; Gomes, Catarina; Vester-Christensen, Malene B; Ferreira, José Alexandre; Afonso, Luis P; Santos, Lúcio L; de Sousa, João Pinto; Mandel, Ulla; Clausen, Henrik; Vakhrushev, Sergey Y; Reis, Celso A

    2015-01-01

    Circulating O-glycoproteins shed from cancer cells represent important serum biomarkers for diagnostic and prognostic purposes. We have recently shown that selective detection of cancer-associated aberrant glycoforms of circulating O-glycoprotein biomarkers can increase specificity of cancer biom...

  13. Using Aptamers for Cancer Biomarker Discovery

    OpenAIRE

    Yun Min Chang; Donovan, Michael J; Weihong Tan

    2013-01-01

    Aptamers are single-stranded synthetic DNA- or RNA-based oligonucleotides that fold into various shapes to bind to a specific target, which includes proteins, metals, and molecules. Aptamers have high affinity and high specificity that are comparable to that of antibodies. They are obtained using iterative method, called (Systematic Evolution of Ligands by Exponential Enrichment) SELEX and cell-based SELEX (cell-SELEX). Aptamers can be paired with recent advances in nanotechnology, microarray...

  14. Biomarkers for diet and cancer prevention research: potentials and challenges

    Institute of Scientific and Technical Information of China (English)

    Cindy D DAVIS; John A MILNER

    2007-01-01

    As cancer incidence is projected to increase for decades there is a need for effec-tive preventive strategies. Fortunately, evidence continues to mount that altering dietary habits is an effective and cost-efficient approach for reducing cancer risk and for modifying the biological behavior of tumors. Predictive, validated and sensitive biomarkers, including those that reliably evaluate "intake" or exposure to a specific food or bioactive component, that assess one or more specific bio-logical "effects" that are linked to cancer, and that effectively predict individual "susceptibility" as a function of nutrient-nutrient interactions and genetics, are fundamental to evaluating who will benefit most from dietary interventions. These biomarkers must be readily accessible, easily and reliably assayed, and predictive of a key process(es) involved in cancer. The response to a food is determined not only by the effective concentration of the bioactive food component(s) reaching the target tissue, but also by the amount of the target requiring modification.Thus, this threshold response to foods and their components will vary from indi-vidual to individual. The key to understanding a personalized response is a greater knowledge of nutrigenomics, proteomics and metabolomics.

  15. Protein folding, protein homeostasis, and cancer

    Institute of Scientific and Technical Information of China (English)

    John H. Van Drie

    2011-01-01

    Proteins fold into their functional 3-dimensional structures from a linear amino acid sequence. In vitro this process is spontaneous; while in vivo it is orchestrated by a specialized set of proteins, called chaperones. Protein folding is an ongoing cellular process, as cellular proteins constantly undergo synthesis and degradation. Here emerging links between this process and cancer are reviewed. This perspective both yields insights into the current struggle to develop novel cancer chemotherapeutics and has implications for future chemotherapy discovery.

  16. E-Cadherin as a diagnostic biomarker in breast cancer

    Directory of Open Access Journals (Sweden)

    Rajeev Singhai

    2011-01-01

    Full Text Available Background: E-cadherin is expressed in most normal epithelial tissues. Selective loss of E-cadherin can cause dedifferentiation and invasiveness in human carcinomas, leading E-cadherin to be classified as a tumor suppressor. Loss of E-cadherin has been demonstrated in invasive lobular carcinoma of the breast, but the relationship between E-cadherin expression and breast cancer histopathology and prognosis is less clear. Aim: Our objective was to assess loss of E-cadherin as a diagnostic breast cancer biomarker and as an aid to the sub-classification of invasive breast cancer. We also correlated the loss of expression of E-cadherin with various clinical and pathologic prognostic factors. Material and Methods: Breast cancer specimens after modified radical mastectomy were obtained from women who underwent surgery at Grant Medical College and Sir J.J Group of Hospitals, Mumbai, India between May 2007 and October 2010. We stained 276 breast cancers specimens with monoclonal antibodies to E-cadherin. The breast cancers were classified by histopathological type. Results: A statistical correlation of E-cadherin loss with a positive diagnosis of invasive lobular carcinoma was found, but there was no correlation with any prognostic tumor variables. A negative E-cadherin stain was a sensitive and specific biomarker to confirm the diagnosis of invasive lobular carcinoma (specificity 97.7%; negative predictive value 96.8%; sensitivity 88.1%; and positive predictive value 91.2%. Positive E-cadherin expression was also associated with tubulolobular carcinomas. Conclusions: E-cadherin immunohistochemistry is helpful in classifying breast cancer cases with indeterminate histopathologic features. E-cadherin loss is uncommon in non-lobular carcinomas but shows no correlation to currently established prognostic variables.

  17. Use of Aleuria alantia Lectin Affinity Chromatography to Enrich Candidate Biomarkers from the Urine of Patients with Bladder Cancer

    Directory of Open Access Journals (Sweden)

    Sarah R. Ambrose

    2015-09-01

    Full Text Available Developing a urine test to detect bladder tumours with high sensitivity and specificity is a key goal in bladder cancer research. We hypothesised that bladder cancer-specific glycoproteins might fulfill this role. Lectin-ELISAs were used to study the binding of 25 lectins to 10 bladder cell lines and serum and urine from bladder cancer patients and non-cancer controls. Selected lectins were then used to enrich glycoproteins from the urine of bladder cancer patients and control subjects for analysis by shotgun proteomics. None of the lectins showed a strong preference for bladder cancer cell lines over normal urothlelial cell lines or for urinary glycans from bladder cancer patients over those from non-cancer controls. However, several lectins showed a strong preference for bladder cell line glycans over serum glycans and are potentially useful for enriching glycoproteins originating from the urothelium in urine. Aleuria alantia lectin affinity chromatography and shotgun proteomics identified mucin-1 and golgi apparatus protein 1 as proteins warranting further investigation as urinary biomarkers for low-grade bladder cancer. Glycosylation changes in bladder cancer are not reliably detected by measuring lectin binding to unfractionated proteomes, but it is possible that more specific reagents and/or a focus on individual proteins may produce clinically useful biomarkers.

  18. The ADAMs family of proteases: new biomarkers and therapeutic targets for cancer?

    LENUS (Irish Health Repository)

    Duffy, Michael J

    2011-06-09

    Abstract The ADAMs are transmembrane proteins implicated in proteolysis and cell adhesion. Forty gene members of the family have been identified, of which 21 are believed to be functional in humans. As proteases, their main substrates are the ectodomains of other transmembrane proteins. These substrates include precursor forms of growth factors, cytokines, growth factor receptors, cytokine receptors and several different types of adhesion molecules. Although altered expression of specific ADAMs has been implicated in different diseases, their best-documented role is in cancer formation and progression. ADAMs shown to play a role in cancer include ADAM9, ADAM10, ADAM12, ADAM15 and ADAM17. Two of the ADAMs, i.e., ADAM10 and 17 appear to promote cancer progression by releasing HER\\/EGFR ligands. The released ligands activate HER\\/EGFR signalling that culminates in increased cell proliferation, migration and survival. Consistent with a causative role in cancer, several ADAMs are emerging as potential cancer biomarkers for aiding cancer diagnosis and predicting patient outcome. Furthermore, a number of selective ADAM inhibitors, especially against ADAM10 and ADAM17, have been shown to have anti-cancer effects. At least one of these inhibitors is now undergoing clinical trials in patients with breast cancer.

  19. Differential profiling of breast cancer plasma proteome by isotope-coded affinity tagging method reveals biotinidase as a breast cancer biomarker

    International Nuclear Information System (INIS)

    Breast cancer is one of the leading causes of women's death worldwide. It is important to discover a reliable biomarker for the detection of breast cancer. Plasma is the most ideal source for cancer biomarker discovery since many cells cross-communicate through the secretion of soluble proteins into blood. Plasma proteomes obtained from 6 breast cancer patients and 6 normal healthy women were analyzed by using the isotope-coded affinity tag (ICAT) labeling approach and tandem mass spectrometry. All the plasma samples used were depleted of highly abundant 6 plasma proteins by immune-affinity column chromatography before ICAT labeling. Several proteins showing differential abundance level were selected based on literature searches and their specificity to the commercially available antibodies, and then verified by immunoblot assays. A total of 155 proteins were identified and quantified by ICAT method. Among them, 33 proteins showed abundance changes by more than 1.5-fold between the plasmas of breast cancer patients and healthy women. We chose 5 proteins for the follow-up confirmation in the individual plasma samples using immunoblot assay. Four proteins, α1-acid glycoprotein 2, monocyte differentiation antigen CD14, biotinidase (BTD), and glutathione peroxidase 3, showed similar abundance ratio to ICAT result. Using a blind set of plasmas obtained from 21 breast cancer patients and 21 normal healthy controls, we confirmed that BTD was significantly down-regulated in breast cancer plasma (Wilcoxon rank-sum test, p = 0.002). BTD levels were lowered in all cancer grades (I-IV) except cancer grade zero. The area under the receiver operating characteristic curve of BTD was 0.78. Estrogen receptor status (p = 0.940) and progesterone receptor status (p = 0.440) were not associated with the plasma BTD levels. Our study suggests that BTD is a potential serological biomarker for the detection of breast cancer

  20. Potentiometric Sensors Based on Surface Molecular Imprinting: Detection of Cancer Biomarkers and Viruses

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Y.; Zhang, Z; Jain, V; Yi, J; Mueller, S; Sokolov, J; Liu, Z; Levon, K; Rigas, B; Rafailovich, M

    2010-01-01

    The continuing discovery of cancer biomarkers necessitates improved methods for their detection. Molecular imprinting using artificial materials provides an alternative to the detection of a wide range of substances. We applied surface molecular imprinting using self-assembled monolayers to design sensing elements for the detection of cancer biomarkers and other proteins. These elements consist of a gold-coated silicon chip onto which hydroxyl-terminated alkanethiol molecules and template biomolecule are co-adsorbed, where the thiol molecules are chemically bound to the metal substrate and self-assembled into highly ordered monolayers, the biomolecules can be removed, creating the foot-print cavities in the monolayer matrix for this kind of template molecules. Re-adsorption of the biomolecules to the sensing chip changes its potential, which can be measured potentiometrically. We applied this method to the detection of carcinoembryonic antigen (CEA) in both solutions of purified CEA and in the culture medium of a CEA-producing human colon cancer cell line. The CEA assay, validated also against a standard immunoassay, was both sensitive (detection range 2.5-250 ng/mL) and specific (no cross-reactivity with hemoglobin; no response by a non-imprinted sensor). Similar results were obtained for human amylase. In addition, we detected virions of poliovirus in a specific manner (no cross-reactivity to adenovirus, no response by a non-imprinted sensor). Our findings demonstrate the application of the principles of molecular imprinting to the development of a new method for the detection of protein cancer biomarkers and to protein-based macromolecular structures such as the capsid of a virion. This approach has the potential of generating a general assay methodology that could be highly sensitive, specific, simple and likely inexpensive.

  1. Cell cycle arrest biomarkers in human lung cancer cells after treatment with selenium in culture.

    Science.gov (United States)

    Swede, Helen; Dong, Yan; Reid, Mary; Marshall, James; Ip, Clement

    2003-11-01

    In the planning of future intervention trials using chemopreventive agents against lung cancer, it is critical to evaluate the effect on biomarkers implicated specifically in lung carcinogenesis. With the use of the H520 and H522 human lung cancer cell lines, the present study showed that treatment with selenium (in the form of methylseleninic acid) inhibited cell growth, arrested cell cycle progression at G(1), and induced apoptosis as a late event. Because H520 cells were more sensitive to selenium than H522 cells (IC(50) of MSA was 2.5 or 10 micro M for H520 or H522 cells, respectively, at 24 h), a panel of nine cell cycle regulatory proteins known to be involved in G(1)-->S transition was assessed by Western analysis using whole cell lysate from H520 cells. These nine proteins (DP1, cdc25A, cyclin A, cyclin B(1), cyclin D(1), cdk1, cdk5, p21(WAF1), and GADD153) have been reported previously by our laboratory to be modulated by MSA in human breast and prostate cancer cells. Our data showed that only four (DP1, cdc25A, p21(WAF1), and GADD153) of nine biomarkers produced the expected changes after treatment of lung cancer cells with MSA. This finding raises the possibility that the molecular targets sensitive to selenium modulation may be tissue specific. Thus, the selection of selenium biomarkers for evaluation in an intervention trial must be based on empirical data derived from the cancer cell type of interest. PMID:14652289

  2. Circulating DNA as Potential Biomarker for Cancer Individualized Therapy

    Institute of Scientific and Technical Information of China (English)

    Yu Shaorong; Liu Baorui; Lu Jianwei; Feng Jifeng

    2013-01-01

    Cancer individualized therapy often requires for gene mutation analysis of tumor tissue. However, tumor tissue is not always available in clinical practice, particularly from patients with refractory and recurrence disease. Even if patients have sufifcient tumor tissue for detection, as development of cancer, the gene status and drug sensitivity of tumor tissues could also change. Hence, screening mutations from primary tumor tissues becomes useless, it’s necessary to ifnd a surrogate tumor tissue for individualized gene screening. Circulating DNA is digested rapidly from blood, which could provide real-time information of the released fragment and make the real-time detection possible. Therefore, it’s expected that circulating DNA could be a potential tumor biomarker for cancer individualized therapy. This review focuses on the biology and clinical utility of circulating DNA mainly on gene mutation detection. Besides, its current status and possible direction in this research area is summarized and discussed objectively.

  3. Identification of urinary protein biomarkers for tobacco smoking.

    Science.gov (United States)

    Haniff, Aj Nabill; Gam, Lay-Harn

    2016-03-01

    Smoking, passive smoking, and nonsmoking are conditions that give different degrees of stress to the body. In this study, a proteomic technique was used to analyze differentially urinary protein expression between these three groups of subjects. Urinary proteins were precipitated using ammonium sulfate followed by separation according to molecular weights using SDS-PAGE. The gel was stained by Coommassie blue, and the image of the gel was captured for the comparison study. The protein bands that were consistently detected but expressed at different intensity between the smokers and nonsmokers were targeted for further analysis. Three targeted protein bands were excised from the gel, consisting of a unique protein band of smokers and a pair of differentially expressed protein bands from smokers and nonsmokers. The proteins were digested in gel by trypsin. The tryptic peptides were analyzed with ultra performance liquid chromatography-tandem mass spectrometry. Protein identity was determined by the product ion spectrum in the MS/MS scan. Four unique proteins from the smokers, namely, pancreatic alpha amylase, proepidermal growth factor, protein 4.1, and prostatic acid phosphatase, were found to be potential urinary biomarkers to indicate smoking status of a person. PMID:25640279

  4. Comparison of proteomic biomarker panels in urine and serum for ovarian cancer diagnosis

    DEFF Research Database (Denmark)

    Petri, Anette Lykke; Simonsen, Anja Hviid; Høgdall, Estrid; Christensen, Ib Jarle; Kjaer, Susanne Krüger; Yip, Christine; Risum, Signe Normann; Pedersen, Anette Tønnes; Hartwell, Dorte; Fung, Eric T; Høgdall, Claus

    2010-01-01

    The purposes of this study were to confirm previously found candidate epithelial ovarian cancer biomarkers in urine and to compare a paired serum biomarker panel and a urine biomarker panel from the same study cohort with regard to the receiver operating characteristic curve (ROC) area under the ...

  5. Ki-67 biomarker in breast cancer of Indian women

    Directory of Open Access Journals (Sweden)

    Amit V. Patil

    2011-03-01

    Full Text Available Background: Biological markers that reliably predict clinical or pathological response to primary systemic therapy early during a course of chemotherapy may have considerable clinical potential. Aims: Aims of study to evaluated changes in Ki-67 (MIB-1 labeling index and apoptotic index (AI before, during, and after neoadjuvant anthracycline chemotherapy in breast cancer in Indian women. Materials and Methods: Breast cancer tissues were collected from Grant Medical College and Sir J.J. Group of Hospitals, Mumbai, India. Twenty-seven patients receiving neoadjuvant FEC (5-fluorouracil, epirubicin, and cyclophosphamide chemotherapy for operable breast cancer underwent repeat core biopsy after 21 days of treatment. Results: The objective clinical response rate was 56%. Eight patients (31% achieved a pathological response by histopathological criteria; two patients had a near-complete pathological response. Increased day-21 AI was a statistically significant predictor of pathological response (p = 0.049. A strong trend for predicting pathological response was seen with higher Ki-67 indices at day 21 and AI at surgery (p = 0.06 and 0.06, respectively. Conclusion: The clinical utility of early changes in biological marker expression during chemotherapy remains unclear. Until further prospectively validated evidence confirming the reliability of predictive biomarkers is available, clinical decision-making should not be based upon individual biological tumor biomarker profiles.

  6. Cancer risk by combined levels of YKL-40 and C-reactive protein in the general population

    DEFF Research Database (Denmark)

    Allin, Kristine Højgaard; Bojesen, S E; Johansen, J S;

    2012-01-01

    YKL-40 and C-reactive protein (CRP) are biomarkers that may reflect cancer-related subclinical inflammation. We assessed elevated YKL-40 and CRP levels as combined risk predictors for cancer.......YKL-40 and C-reactive protein (CRP) are biomarkers that may reflect cancer-related subclinical inflammation. We assessed elevated YKL-40 and CRP levels as combined risk predictors for cancer....

  7. Protein biomarkers in Parkinson's disease: Focus on cerebrospinal fluid markers and synaptic proteins.

    Science.gov (United States)

    Halbgebauer, Steffen; Öckl, Patrick; Wirth, Katharina; Steinacker, Petra; Otto, Markus

    2016-06-01

    Despite extensive research, to date, no validated biomarkers for PD have been found. This review seeks to summarize studies approaching the detection of biomarker candidates for PD and introduce promising ones in more detail, with special attention to synaptic proteins. To this end, we performed a PubMed search and included studies using proteomic tools (2-dimensional difference in gel electrophoresis and/or mass spectrometry) for the comparison of samples from PD and control patients. We found 27 studies reporting more than 500 differentially expressed proteins in which a total of 28 were detected in 2 and 17 in 3 or more independent studies, including posttranslationally modified proteins. In addition, of these 500 proteins, 25 were found to be brain specific, and 14 were enriched in synapses. Special attention was given to the applicability of the biomarker regarding sampling procedures, that is, using CSF/serum material for diagnosis. Furthermore, presynaptic proteins involved in vesicle membrane fusion seem to be interesting candidates for future analyses. Nonetheless, even though such promising biomarker candidates for PD exist, validation of these biomarkers in large-scale clinical studies is necessary to evaluate the diagnostic potential. © 2016 International Parkinson and Movement Disorder Society. PMID:27134134

  8. Circulating exosomal microRNAs as biomarkers of colon cancer.

    Directory of Open Access Journals (Sweden)

    Hiroko Ogata-Kawata

    Full Text Available PURPOSE: Exosomal microRNAs (miRNAs have been attracting major interest as potential diagnostic biomarkers of cancer. The aim of this study was to characterize the miRNA profiles of serum exosomes and to identify those that are altered in colorectal cancer (CRC. To evaluate their use as diagnostic biomarkers, the relationship between specific exosomal miRNA levels and pathological changes of patients, including disease stage and tumor resection, was examined. EXPERIMENTAL DESIGN: Microarray analyses of miRNAs in exosome-enriched fractions of serum samples from 88 primary CRC patients and 11 healthy controls were performed. The expression levels of miRNAs in the culture medium of five colon cancer cell lines were also compared with those in the culture medium of a normal colon-derived cell line. The expression profiles of miRNAs that were differentially expressed between CRC and control sample sets were verified using 29 paired samples from post-tumor resection patients. The sensitivities of selected miRNAs as biomarkers of CRC were evaluated and compared with those of known tumor markers (CA19-9 and CEA using a receiver operating characteristic analysis. The expression levels of selected miRNAs were also validated by quantitative real-time RT-PCR analyses of an independent set of 13 CRC patients. RESULTS: The serum exosomal levels of seven miRNAs (let-7a, miR-1229, miR-1246, miR-150, miR-21, miR-223, and miR-23a were significantly higher in primary CRC patients, even those with early stage disease, than in healthy controls, and were significantly down-regulated after surgical resection of tumors. These miRNAs were also secreted at significantly higher levels by colon cancer cell lines than by a normal colon-derived cell line. The high sensitivities of the seven selected exosomal miRNAs were confirmed by a receiver operating characteristic analysis. CONCLUSION: Exosomal miRNA signatures appear to mirror pathological changes of CRC patients and

  9. Potentials of plasma NGAL and MIC-1 as biomarker(s in the diagnosis of lethal pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sukhwinder Kaur

    Full Text Available Pancreatic cancer (PC is lethal malignancy with very high mortality rate. Absence of sensitive and specific marker(s is one of the major factors for poor prognosis of PC patients. In pilot studies using small set of patients, secreted acute phase proteins neutrophil gelatinase associated lipocalin (NGAL and TGF-β family member macrophage inhibitory cytokine-1 (MIC-1 are proposed as most potential biomarkers specifically elevated in the blood of PC patients. However, their performance as diagnostic markers for PC, particularly in pre-treatment patients, remains unknown. In order to evaluate the diagnostic efficacy of NGAL and MIC-1, their levels were measured in plasma samples from patients with pre-treatment PC patients (n = 91 and compared it with those in healthy control (HC individuals (n = 24 and patients with chronic pancreatitis (CP, n = 23. The diagnostic performance of these two proteins was further compared with that of CA19-9, a tumor marker commonly used to follow PC progression. The levels of all three biomarkers were significantly higher in PC compared to HCs. The mean (± standard deviation, SD plasma NGAL, CA19-9 and MIC-1 levels in PC patients was 111.1 ng/mL (2.2, 219.2 U/mL (7.8 and 4.5 ng/mL (4.1, respectively. In comparing resectable PC to healthy patients, all three biomarkers were found to have comparable sensitivities (between 64%-81% but CA19-9 and NGAL had a higher specificity (92% and 88%, respectively. For distinguishing resectable PC from CP patients, CA19-9 and MIC-1 were most specific (74% and 78% respectively. CA19-9 at an optimal cut-off of 54.1 U/ml is highly specific in differentiating resectable (stage 1/2 pancreatic cancer patients from controls in comparison to its clinical cut-off (37.1 U/ml. Notably, the addition of MIC-1 to CA19-9 significantly improved the ability to distinguish resectable PC cases from CP (p = 0.029. Overall, MIC-1 in combination with CA19-9 improved the diagnostic

  10. Sputum-Based Molecular Biomarkers for the Early Detection of Lung Cancer: Limitations and Promise

    International Nuclear Information System (INIS)

    Lung cancer is the leading cause of cancer deaths, with an overall survival of 15% at five years. Biomarkers that can sensitively and specifically detect lung cancer at early stage are crucial for improving this poor survival rate. Sputum has been the target for the discovery of non-invasive biomarkers for lung cancer because it contains airway epithelial cells, and molecular alterations identified in sputum are most likely to reflect tumor-associated changes or field cancerization caused by smoking in the lung. Sputum-based molecular biomarkers include morphology, allelic imbalance, promoter hypermethylation, gene mutations and, recently, differential miRNA expression. To improve the sensitivity and reproducibility of sputum-based biomarkers, we recommend standardization of processing protocols, bronchial epithelial cell enrichment, and identification of field cancerization biomarkers

  11. Pathological examination of breast cancer biomarkers: current status in Japan.

    Science.gov (United States)

    Masuda, Shinobu

    2016-07-01

    This article reviews the current status of pathological evaluation for biomarkers in Japan. The introduced issues are the international trends for estimation of biomarkers considering diagnosis and treatment decision, and pathological issues under discussion, and how Japanese Breast Cancer Society (JBCS) members have addressed issues related to pathology and biomarkers evaluation. As topics of immunohistochemical study, (1) ASCO/CAP guidelines, (2) Ki67 and other markers, (3) quantification and image analysis, (4) application of cytologic samples, (5) pre-analytical process, and (6) Japan Pathology Quality Assurance System are introduced. Various phases of concepts, guidelines, and methodologies are co-existed in today's clinical practice. It is expected in near future that conventional methods and molecular procedures will be emerged, and Japanese Quality assurance/Quality control (QA/QC) system will work practically. What we have to do in the next generation are to validate novel procedures, to evaluate the relationship between traditional concepts and newly proposed ideas, to establish a well organized QA/QC system, and to standardize pre-analytical process that are the basis of all procedures using pathological tissues. PMID:25239167

  12. Translating colorectal cancer genetics into clinically useful biomarkers.

    Science.gov (United States)

    Morley-Bunker, A; Walker, L C; Currie, M J; Pearson, J; Eglinton, T

    2016-08-01

    Colorectal cancer (CRC) is a major health problem worldwide accounting for over a million deaths annually. While many patients with Stage II and III CRC can be cured with combinations of surgery, radiotherapy and chemotherapy, this is morbid costly treatment and a significant proportion will suffer recurrence and eventually die of CRC. Increased understanding of the molecular pathogenesis of CRC has the potential to identify high risk patients and target therapy more appropriately. Despite increased understanding of the molecular events underlying CRC development, established molecular techniques have only produced a limited number of biomarkers suitable for use in routine clinical practice to predict risk, prognosis and response to treatment. Recent rapid technological developments, however, have made genomic sequencing of CRC more economical and efficient, creating potential for the discovery of genetic biomarkers that have greater diagnostic, prognostic and therapeutic capabilities for the management of CRC. This paper reviews the current understanding of the molecular pathogenesis of CRC, and summarizes molecular biomarkers that surgeons will encounter in current clinical use as well as those under development in clinical and preclinical trials. New molecular technologies are reviewed together with their potential impact on the understanding of the molecular pathogenesis of CRC and their potential clinical utility in classification, diagnosis, prognosis and targeting of therapy. PMID:26990814

  13. MiRNAs and LincRNAs: Could They Be Considered as Biomarkers in Colorectal Cancer?

    Directory of Open Access Journals (Sweden)

    Jesús Garcia-Foncillas

    2012-01-01

    Full Text Available Recent advances in the field of RNA research have provided compelling evidence implicating microRNA (miRNA and long non-coding RNA molecules in many diverse and substantial biological processes, including transcriptional and post-transcriptional regulation of gene expression, genomic imprinting, and modulation of protein activity. Thus, studies of non-coding RNA (ncRNA may contribute to the discovery of possible biomarkers in human cancers. Considering that the response to chemotherapy can differ amongst individuals, researchers have begun to isolate and identify the genes responsible. Identification of targets of this ncRNA associated with cancer can suggest that networks of these linked to oncogenes or tumor suppressors play pivotal roles in cancer development. Moreover, these ncRNA are attractive drug targets since they may be differentially expressed in malignant versus normal cells and regulate expression of critical proteins in the cell. This review focuses on ncRNAs that are differently expressed in malignant tissue, and discusses some of challenges derived from their use as potential biomarkers of tumor properties.

  14. Circulating microRNAs as Prognostic and Predictive Biomarkers in Patients with Colorectal Cancer

    OpenAIRE

    Jakob Vasehus Schou; Julia Sidenius Johansen; Dorte Nielsen; Simona Rossi

    2016-01-01

    MiRNAs are suggested as promising cancer biomarkers. They are stable and extractable from a variety of clinical tissue specimens (fresh frozen or formalin fixed paraffin embedded tissue) and a variety of body fluids (e.g., blood, urine, saliva). However, there are several challenges that need to be solved, considering their potential as biomarkers in cancer, such as lack of consistency between biomarker panels in independent studies due to lack of standardized sample handling and processing, ...

  15. The Janus serum bank and biomarkers of cancer

    Directory of Open Access Journals (Sweden)

    Randi Gislefoss

    2009-10-01

    Full Text Available The Janus serum bank, established in 1973, contains sera stored at –25 degrees collected from 330,000 originally healthy individuals. The number of cancer cases have increased from zero in 1973 to more than 50,000 in 2005, including invasive and non-invasive cancers. Information on cases have been obtained by coupling the Janus file against the Norwegian Cancer Registry. The sera have been used in over 70 different cancers research projects, usually in case-control studies and in collaboration with national and international research groups. The type of biomarker analysed include antibodies against Chlamydia, CMV, Epstein Barr virus, HPV and Helicobacter pylori. Leptin, long chain fatty acids, androgens and other hormones, vitamins as well as environmental toxins such as organochlorines are other types of cancer biomarkers investigated. Mutation analyses (BRCA-1 etc have been possible using PCR and the trace amounts of DNA remaining in the sera.Janus serum bank ble etablert i 1973 og inneholder sera lagret ved –25 grader, innsamlet fra 330.000 opprinnelig friske personer. Antall krefttilfeller har steget fra null i 1973 til over 50.000 i år 2005, inkludert både invasiv og ikke-invasiv kreft. Informasjon om kasus er tilgjengelig ved å koble Janus-filene mot Kreftregisterets databaser. Serumprøvene er blitt benyttet i over 70 forskjellige kreftforskningsprosjekter, som oftest i kasus-kontroll studier og i samarbeide med en rekke nasjonale og internasjonale forskningsgrupper. Mange ulike biomarkører på kreft er blitt analysert, bl.a. antistoffer mot Chlamydia, CMV, Epstein Barr virus, HPV og Helicobacter pylori. Leptin, lange fettsyrer, androgener og andre hormoner, vitaminer såvel som miljøgifter av typen organiske klorforbindelser er eksempler på andre kreftbiomarkører som er undersøkt. Det har også vært mulig å gjøre mutasjonsanalyser (BRCA-1 etc ved å bruke PCR til å amplifisere opp den spormengden DNA som finnes i serum.

  16. Urinary metalloproteinases: noninvasive biomarkers for breast cancer risk assessment

    DEFF Research Database (Denmark)

    Pories, Susan E; Zurakowski, David; Roy, Roopali;

    2008-01-01

    Matrix metalloproteinases (MMP) and a disintegrin and metalloprotease 12 (ADAM 12) can be detected in the urine of breast cancer patients and provide independent prediction of disease status. To evaluate the potential of urinary metalloproteinases as biomarkers to predict breast cancer risk status......, urine samples from women with known risk marker lesions, atypical hyperplasia and lobular carcinoma in situ (LCIS), were analyzed. Urine samples were obtained from 148 women: 44 women with atypical hyperplasia, 24 women with LCIS, and 80 healthy controls. MMP analysis was done using gelatin zymography...... and ADAM 12 analysis was done via immunoblotting with monospecific antibodies and subsequent densitometric measurement. Positive urinary MMP-9 levels indicated a 5-fold risk of atypical hyperplasia and >13-fold risk of LCIS compared with normal controls. Urinary ADAM 12 levels were significantly...

  17. Exosomal miRNAs as cancer biomarkers and therapeutic targets.

    Science.gov (United States)

    Thind, Arron; Wilson, Clive

    2016-01-01

    Intercommunication between cancer cells and with their surrounding and distant environments is key to the survival, progression and metastasis of the tumour. Exosomes play a role in this communication process. MicroRNA (miRNA) expression is frequently dysregulated in tumour cells and can be reflected by distinct exosomal miRNA (ex-miRNA) profiles isolated from the bodily fluids of cancer patients. Here, the potential of ex-miRNA as a cancer biomarker and therapeutic target is critically analysed. Exosomes are a stable source of miRNA in bodily fluids but, despite a number of methods for exosome extraction and miRNA quantification, their suitability for diagnostics in a clinical setting is questionable. Furthermore, exosomally transferred miRNAs can alter the behaviour of recipient tumour and stromal cells to promote oncogenesis, highlighting a role in cell communication in cancer. However, our incomplete understanding of exosome biogenesis and miRNA loading mechanisms means that strategies to target exosomes or their transferred miRNAs are limited and not specific to tumour cells. Therefore, if ex-miRNA is to be employed in novel non-invasive diagnostic approaches and as a therapeutic target in cancer, two further advances are necessary: in methods to isolate and detect ex-miRNA, and a better understanding of their biogenesis and functions in tumour-cell communication. PMID:27440105

  18. iTRAQ identification of candidate serum biomarkers associated with metastatic progression of human prostate cancer.

    Science.gov (United States)

    Rehman, Ishtiaq; Evans, Caroline A; Glen, Adam; Cross, Simon S; Eaton, Colby L; Down, Jenny; Pesce, Giancarlo; Phillips, Joshua T; Yen, Ow Saw; Thalmann, George N; Wright, Phillip C; Hamdy, Freddie C

    2012-01-01

    A major challenge in the management of patients with prostate cancer is identifying those individuals at risk of developing metastatic disease, as in most cases the disease will remain indolent. We analyzed pooled serum samples from 4 groups of patients (n = 5 samples/group), collected prospectively and actively monitored for a minimum of 5 yrs. Patients groups were (i) histological diagnosis of benign prostatic hyperplasia with no evidence of cancer 'BPH', (ii) localised cancer with no evidence of progression, 'non-progressing' (iii) localised cancer with evidence of biochemical progression, 'progressing', and (iv) bone metastasis at presentation 'metastatic'. Pooled samples were immuno-depleted of the 14 most highly abundant proteins and analysed using a 4-plex iTRAQ approach. Overall 122 proteins were identified and relatively quantified. Comparisons of progressing versus non-progressing groups identified the significant differential expression of 25 proteins (pfactor 1 alpha 1 (eEF1A1), one of the candidates identified, was significantly higher in osteoblasts in close proximity to metastatic tumour cells compared with osteoblasts in control bone (p = 0.0353, Mann Whitney U). Our proteomic approach has identified leads for potentially useful serum biomarkers associated with the metastatic progression of prostate cancer. The panels identified, including eEF1A1 warrant further investigation and validation. PMID:22355332

  19. Circulating microRNAs: Novel biomarkers for esophageal cancer

    Directory of Open Access Journals (Sweden)

    Sheng-Li Zhou, Li-Dong Wang

    2010-05-01

    Full Text Available Esophageal carcinogenesis is a multi-stage process, involving a variety of changes in gene expression and physiological structure change. MicroRNAs (miRNAs are a class of small non-coding endogenous RNA molecules. Recent innovation in miRNAs profiling technology have shed new light on the pathology of esophageal carcinoma (EC, and also heralded great potential for exploring novel biomarkers for both EC diagnosis and treatment. Frequent dysregulation of miRNA in malignancy highlights the study of molecular factors upstream of gene expression following the extensive investigation on elucidating the important role of miRNA in carcinogenesis. We herein present a thorough review of the role of miRNAs in EC, addressing miRNA functions, their putative role as oncogenes or tumor suppressors and their potential target genes. The recent progresses in discovering the quantifiable circulating cancer-associated miRNAs indicate the potential clinical use of miRNAs as novel minimally invasive biomarkers for EC and other cancers. We also discuss the potential role of miRNAs in detection, screening and surveillance of EC as miRNAs can be a potential target in personalized treatment of EC.

  20. Challenges in Using Circulating miRNAs as Cancer Biomarkers

    Directory of Open Access Journals (Sweden)

    Paola Tiberio

    2015-01-01

    Full Text Available In the last years, circulating miRNAs have emerged as a new class of promising cancer biomarkers. Independent studies have shown the feasibility of using these small RNAs as tools for the diagnosis and prognosis of different types of malignancies as well as for predicting and possibly monitoring treatment response. However, despite an initial enthusiasm for their possible clinical application, widespread inconsistencies have been observed among the studies, and miRNA-based tools still represent the object of research within clinical diagnostic or treatment protocols. The poor overlap of results could be explained, at least in part, by preanalytical and analytical variables and donor-related factors that could generate artefacts, impairing an accurate quantification of circulating miRNAs. In fact, critical issues are represented by nonuniform sample choice, handling, and processing, as well as by blood cell contamination in sample preparation and lack of consensus for data normalization. In this review, we address the potential technical biases and individual-related parameters that can influence circulating miRNA studies’ outcome. The exciting potential of circulating miRNAs as cancer biomarkers could confer an important advance in the disease management, but their clinical significance might not be proven without a global consensus of procedures and standardized protocols for their accurate detection.

  1. Clinical relevance of breast cancer-related genes as potential biomarkers for oral squamous cell carcinoma

    International Nuclear Information System (INIS)

    Squamous cell carcinoma of the oral cavity (OSCC) is a common cancer form with relatively low 5-year survival rates, due partially to late detection and lack of complementary molecular markers as targets for treatment. Molecular profiling of head and neck cancer has revealed biological similarities with basal-like breast and lung carcinoma. Recently, we showed that 16 genes were consistently altered in invasive breast tumors displaying varying degrees of aggressiveness. To extend our findings from breast cancer to another cancer type with similar characteristics, we performed an integrative analysis of transcriptomic and proteomic data to evaluate the prognostic significance of the 16 putative breast cancer-related biomarkers in OSCC using independent microarray datasets and immunohistochemistry. Predictive models for disease-specific (DSS) and/or overall survival (OS) were calculated for each marker using Cox proportional hazards models. We found that CBX2, SCUBE2, and STK32B protein expression were associated with important clinicopathological features for OSCC (peritumoral inflammatory infiltration, metastatic spread to the cervical lymph nodes, and tumor size). Consequently, SCUBE2 and STK32B are involved in the hedgehog signaling pathway which plays a pivotal role in metastasis and angiogenesis in cancer. In addition, CNTNAP2 and S100A8 protein expression were correlated with DSS and OS, respectively. Taken together, these candidates and the hedgehog signaling pathway may be putative targets for drug development and clinical management of OSCC patients

  2. Proteomic Profiling of Exosomes Leads to the Identification of Novel Biomarkers for Prostate Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Duijvesz, Diederick; Burnum-Johnson, Kristin E.; Gritsenko, Marina A.; Hoogland, Marije; Vredenbregt-van den Berg, Mirella S.; Willemsen, Rob; Luider, Theo N.; Pasa-Tolic, Ljiljana; Jenster, Guido

    2013-12-31

    Introduction: Current markers for prostate cancer, such as PSA lack specificity. Therefore, novel biomarkers are needed. Unfortunately, biomarker discovery from body fluids is often hampered by the high abundance of many proteins unrelated to disease. An attractive alternative biomarker discovery approach is the isolation of small vesicles (exosomes, ~100 nm). They contain proteins that are specific to the tissue from which they are derived and therefore can be considered as treasure chests for disease-specific marker discovery. Profiling prostate cancer-derived exosomes could reveal new markers for this malignancy. Materials and Methods: Exosomes were isolated from 2 immortalized primary prostate epithelial cells (PNT2C2 and RWPE-1) and 2 PCa cell lines (PC346C and VCaP) by ultracentrifugation. Proteomic analyses utilized a nanoLC coupled with an LTQ-Orbitrap operated in tandem MS (MS/MS) mode, followed by the Accurate Mass and Time (AMT) tag approach. Exosomal proteins were validated by Western blotting. A Tissue Micro Array, containing 481 different PCa samples (radical prostatectomy), was used to correlate candidate markers with several clinical-pathological parameters such as PSA, Gleason score, biochemical recurrence, and (PCa-related) death. Results: Proteomic characterization resulted in the identification of 263 proteins by at least 2 peptides. Specifically analysis of exosomes from PNT2C2, RWPE-1, PC346C, and VCaP identified 248, 233, 169, and 216 proteins, respectively. Statistical analyses revealed 52 proteins differently expressed between PCa and control cells, 9 of which were more abundant in PCa. Validation by Western blotting confirmed a higher abundance of FASN, XPO1 and PDCD6IP (ALIX) in PCa exosomes. The Tissue Micro 4 Array showed strong correlation of higher Gleason scores and local recurrence with increased cytoplasmic XPO1 (P<0.001). Conclusions: Differentially abundant proteins of cell line-derived exosomes make a clear subdivision between

  3. Subtyping of breast cancer using reverse phase protein arrays.

    Science.gov (United States)

    Sonntag, Johanna; Schlüter, Kerstin; Bernhardt, Stephan; Korf, Ulrike

    2014-12-01

    Reverse phase protein arrays (RPPAs) present a robust and sensitive high capacity platform for targeted proteomics that relies on highly specific antibodies to obtain a quantitative readout regarding phosphorylation state and abundance of proteins of interest. This review summarizes the current state of RPPA-based proteomic profiling of breast cancer in the context of existing preanalytical strategies and sample preparation protocols. RPPA-based subtypes identified so far are compared to those obtained by other approaches such as immunohistochemistry, genomics and transcriptomics. Special attention is given to discussing the potential of RPPA for biomarker discovery and biomarker validation. PMID:25400094

  4. Biomarkers for ragwort poisoning in horses: identification of protein targets

    Directory of Open Access Journals (Sweden)

    Beynon Robert J

    2008-08-01

    Full Text Available Abstract Background Ingestion of the poisonous weed ragwort (Senecio jacobea by horses leads to irreversible liver damage. The principal toxins of ragwort are the pyrrolizidine alkaloids that are rapidly metabolised to highly reactive and cytotoxic pyrroles, which can escape into the circulation and bind to proteins. In this study a non-invasive in vitro model system has been developed to investigate whether pyrrole toxins induce specific modifications of equine blood proteins that are detectable by proteomic methods. Results One dimensional gel electrophoresis revealed a significant alteration in the equine plasma protein profile following pyrrole exposure and the formation of a high molecular weight protein aggregate. Using mass spectrometry and confirmation by western blotting the major components of this aggregate were identified as fibrinogen, serum albumin and transferrin. Conclusion These findings demonstrate that pyrrolic metabolites can modify equine plasma proteins. The high molecular weight aggregate may result from extensive inter- and intra-molecular cross-linking of fibrinogen with the pyrrole. This model has the potential to form the basis of a novel proteomic strategy aimed at identifying surrogate protein biomarkers of ragwort exposure in horses and other livestock.

  5. Biomarker-driven trial in metastatic pancreas cancer: feasibility in a multicenter study of saracatinib, an oral Src inhibitor, in previously treated pancreatic cancer

    International Nuclear Information System (INIS)

    Src tyrosine kinases are overexpressed in pancreatic cancers, and the oral Src inhibitor saracatinib has shown antitumor activity in preclinical models of pancreas cancer. We performed a CTEP-sponsored Phase II clinical trial of saracatinib in previously treated pancreas cancer patients, with a primary endpoint of 6-month survival. A Simon MinMax two-stage phase II design was used. Saracatinib (175 mg/day) was administered orally continuously in 28-day cycles. In the unselected portion of the study, 18 patients were evaluable. Only two (11%) patients survived for at least 6 months, and three 6-month survivors were required to move to second stage of study as originally designed. The study was amended as a biomarker-driven trial (leucine rich repeat containing protein 19 [LRRC19] > insulin-like growth factor-binding protein 2 [IGFBP2] “top scoring pairs” polymerase chain reaction [PCR] assay, and PIK3CA mutant) based on preclinical data in a human pancreas tumor explant model. In the biomarker study, archival tumor tissue or fresh tumor biopsies were tested. Biomarker-positive patients were eligible for the study. Only one patient was PIK3CA mutant in a 3′ untranslated region (UTR) portion of the gene. This patient was enrolled in the study and failed to meet the 6-month survival endpoint. As the frequency of biomarker-positive patients was very low (<3%), the study was closed. Although we were unable to conclude whether enriching for a subset of second/third line pancreatic cancer patients treated with a Src inhibitor based on a biomarker would improve 6-month survival, we demonstrate that testing pancreatic tumor samples for a biomarker-driven, multicenter study in metastatic pancreas cancer is feasible

  6. Biomarkers for cancer-related fatigue and adverse reactions to chemotherapy in lung cancer patients

    OpenAIRE

    Sha, Fei; ZHUANG, SHANSHAN; Zhou, Li; Zhang, Liqun; YANG, YUXIAN; ZHANG, SHENGQI; Jiang, Yi; QIU, GUODONG; Chen, Chen; ZHENG, JIETING; ZHANG, SHUYAO

    2014-01-01

    This study was conducted to investigate the biomarkers that appear to be correlated with cancer-related fatigue (CRF) and the adverse reactions (ADRs) to chemotherapy. A total of 100 lung cancer patients were selected and CRF prior to and following chemotherapy was evaluated. The plasma levels of tumor necrosis factor (TNF)-α and interleukin (IL)-1 and the level of 17-hydroxycorticosteroid (17-OHCS) in the urine were analyzed and correlated with CRF and the ADRs associated with chemotherapy. ...

  7. Single-walled carbon nanotube based transparent immunosensor for detection of a prostate cancer biomarker osteopontin

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Abhinav; Hong, Seongkyeol; Singh, Renu [School of Mechanical and Nuclear Engineering, Ulsan National Institute of Science and Technology (UNIST), Ulsan 689-798 (Korea, Republic of); Jang, Jaesung, E-mail: jjang@unist.ac.kr [School of Mechanical and Nuclear Engineering, Ulsan National Institute of Science and Technology (UNIST), Ulsan 689-798 (Korea, Republic of); Department of Biomedical Engineering, Ulsan National Institute of Science and Technology (UNIST), Ulsan 689-798 (Korea, Republic of); School of Materials Science and Engineering, Ulsan National Institute of Science and Technology (UNIST), Ulsan 689-798 (Korea, Republic of)

    2015-04-15

    Highlights: • A transparent CNT immunosensor is presented for detection of a prostate cancer biomarker osteopontin. • This immunosensor showed a highly linear and reproducible behavior from 1 pg mL{sup −1} to 1 μg mL{sup −1}. • The limit of detection of the immunosensor was 0.3 pg mL{sup −1}. • This immunosensor demonstrated high selectivity against bovine serum albumin and human serum. - Abstract: Osteopontin (OPN) is involved in almost all steps of cancer development, and it is being investigated as a potential biomarker for a diagnosis and prognosis of prostate cancer. Here, we report a label-free, highly sensitive and transparent immunosensor based on single-walled carbon nanotubes (SWCNTs) for detection of OPN. A high density of −COOH functionalized SWCNTs was deposited between two gold/indium tin oxide electrodes on a glass substrate by dielectrophoresis. Monoclonal antibodies specific to OPN were covalently immobilized on the SWCNTs. Relative resistance change of the immunosensors was measured as the concentration of OPN in phosphate buffer saline (PBS) and human serum was varied from 1 pg mL{sup −1} to 1 μg mL{sup −1} for different channel lengths of 2, 5, and 10 μm, showing a highly linear and reproducible behavior (R{sup 2} > 97%). These immunosensors were also specific to OPN against another test protein, bovine serum albumin, PBS and human serum, showing that a limit of detection for OPN was 0.3 pg mL{sup −1}. This highly sensitive and transparent immunosensor has a great potential as a simple point-of-care test kit for various protein biomarkers.

  8. Proteomic analysis of gastric cancer and immunoblot validation of potential biomarkers

    Institute of Scientific and Technical Information of China (English)

    Nina Ko(c)evar; Federico Odreman; Alessandro Vindigni; Snje(z)ana Frkovi(c) Grazio; Radovan Komel

    2012-01-01

    AIM:To search for and validate differentially expressed proteins in patients with gastric adenocarcinoma.METHODS:We used two-dimensional gel electrophoresis and mass spectrometry to search for differentially expressed proteins in patients with gastric adenocarcinoma.A set of proteins was validated with immunoblotting.RESULTS:We identified 30 different proteins involved in various biological processes:metabolism,development,death,response to stress,cell cycle,cell communication,transport,and cell motility.Eight proteinswere chosen for further validation by immunoblotting.Our results show that gastrokine-1,39S ribosomal protein L12 (mitochondrial precursor),plasma cell-induced resident endoplasmic reticulum protein,and glutathione S-transferase mu 3 were significantly underexpressed in gastric adenocarcinoma relative to adjacent non-tumor tissue samples.On the other hand,septin-2,ubiquitin-conjugating enzyme E2 N,and transaldolase were significantly overexpressed.Translationally controlled tumor protein was shown to be differentially expressed only in patients with cancer of the gastric cardia/esophageal border.CONCLUSION:This work presents a set of possible diagnostic biomarkers,validated for the first time.It might contribute to the efforts of understanding gastric cancer carcinogenesis.

  9. Biomarker Identification and Pathway Analysis by Serum Metabolomics of Lung Cancer

    Directory of Open Access Journals (Sweden)

    Yingrong Chen

    2015-01-01

    Full Text Available Lung cancer is one of the most common causes of cancer death, for which no validated tumor biomarker is sufficiently accurate to be useful for diagnosis. Additionally, the metabolic alterations associated with the disease are unclear. In this study, we investigated the construction, interaction, and pathways of potential lung cancer biomarkers using metabolomics pathway analysis based on the Kyoto Encyclopedia of Genes and Genomes database and the Human Metabolome Database to identify the top altered pathways for analysis and visualization. We constructed a diagnostic model using potential serum biomarkers from patients with lung cancer. We assessed their specificity and sensitivity according to the area under the curve of the receiver operator characteristic (ROC curves, which could be used to distinguish patients with lung cancer from normal subjects. The pathway analysis indicated that sphingolipid metabolism was the top altered pathway in lung cancer. ROC curve analysis indicated that glycerophospho-N-arachidonoyl ethanolamine (GpAEA and sphingosine were potential sensitive and specific biomarkers for lung cancer diagnosis and prognosis. Compared with the traditional lung cancer diagnostic biomarkers carcinoembryonic antigen and cytokeratin 19 fragment, GpAEA and sphingosine were as good or more appropriate for detecting lung cancer. We report our identification of potential metabolic diagnostic and prognostic biomarkers of lung cancer and clarify the metabolic alterations in lung cancer.

  10. Molecular biomarkers in extrahepatic bile duct cancer patients undergoing chemoradiotherapy for gross residual disease after surgery

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Hyeon Kang; Kim, Kyu Bo; Chie, Eui Kyu; Ha, Sung W. [Seoul National University College of Medicine, Seoul (Korea, Republic of); Park, Hae Jin [Dept. of Radiation Oncology, Soonchunhyang University Hospital, Seoul (Korea, Republic of)

    2012-12-15

    To analyze the outcomes of chemoradiotherapy for extrahepatic bile duct (EHBD) cancer patients who underwent R2 resection or bypass surgery and to identify prognostic factors affecting clinical outcomes, especially in terms of molecular biomarkers. Medical records of 21 patients with EHBD cancer who underwent R2 resection or bypass surgery followed by chemoradiotherapy from May 2001 to June 2010 were retrospectively reviewed. All surgical specimens were re-evaluated by immunohistochemical staining using phosphorylated protein kinase B (pAKT), CD24, matrix metalloproteinase 9 (MMP9), survivin, and {beta}-catenin antibodies. The relationship between clinical outcomes and immunohistochemical results was investigated. At a median follow-up of 20 months, the actuarial 2-year locoregional progression-free, distant metastasis-free and overall survival were 37%, 56%, and 54%, respectively. On univariate analysis using clinicopathologic factors, there was no significant prognostic factor. In the immunohistochemical staining, cytoplasmic staining, and nuclear staining of pAKT was positive in 10 and 6 patients, respectively. There were positive CD24 in 7 patients, MMP9 in 16 patients, survivin in 8 patients, and {beta}-catenin in 3 patients. On univariate analysis, there was no significant value of immunohistochemical results for clinical outcomes. There was no significant association between clinical outcomes of patients with EHBD cancer who received chemoradiotherapy after R2 resection or bypass surgery and pAKT, CD24, MMP9, survivin, and {beta}-catenin. Future research is needed on a larger data set or with other molecular biomarkers.

  11. Biomarker Identification and Pathway Analysis by Serum Metabolomics of Lung Cancer

    OpenAIRE

    2015-01-01

    Lung cancer is one of the most common causes of cancer death, for which no validated tumor biomarker is sufficiently accurate to be useful for diagnosis. Additionally, the metabolic alterations associated with the disease are unclear. In this study, we investigated the construction, interaction, and pathways of potential lung cancer biomarkers using metabolomics pathway analysis based on the Kyoto Encyclopedia of Genes and Genomes database and the Human Metabolome Database to identify the top...

  12. Circulating MicroRNAs as Biomarkers in Biliary Tract Cancers

    Science.gov (United States)

    Letelier, Pablo; Riquelme, Ismael; Hernández, Alfonso H.; Guzmán, Neftalí; Farías, Jorge G.; Roa, Juan Carlos

    2016-01-01

    Biliary tract cancers (BTCs) are a group of highly aggressive malignant tumors with a poor prognosis. The current diagnosis is based mainly on imaging and intraoperative exploration due to brush cytology havinga low sensitivity and the standard markers, such as carcinoembryonic antigen (CEA) and carbohydrate 19-9 (CA19-9), not having enough sensitivity nor specificity to be used in a differential diagnosis and early stage detection. Thus, better non-invasive methods that can distinguish between normal and pathological tissue are needed. MicroRNAs (miRNAs) are small, single-stranded non-coding RNA molecules of ~20–22 nucleotides that regulate relevant physiological mechanisms and can also be involved in carcinogenesis. Recent studies have demonstrated that miRNAs are detectable in multiple body fluids, showing great stability, either free or trapped in circulating microvesicles, such as exosomes. miRNAs are ideal biomarkers that may be used in screening and prognosis in biliary tract cancers, aiding also in the clinical decisions at different stages of cancer treatment. This review highlights the progress in the analysis of circulating miRNAs in serum, plasma and bile as potential diagnostic and prognostic markers of BTCs. PMID:27223281

  13. Role of MGMT as biomarker in colorectal cancer

    Science.gov (United States)

    Inno, Alessandro; Fanetti, Giuseppe; Di Bartolomeo, Maria; Gori, Stefania; Maggi, Claudia; Cirillo, Massimo; Iacovelli, Roberto; Nichetti, Federico; Martinetti, Antonia; de Braud, Filippo; Bossi, Ilaria; Pietrantonio, Filippo

    2014-01-01

    O6-methylguanine DNA methyltransferase (MGMT) gene promoter methylation plays an important role in colorectal carcinogenesis, occurring in about 30%-40% of metastatic colorectal cancer. Its prognostic role has not been defined yet, but loss of expression of MGMT, which is secondary to gene promoter methylation, results in an interesting high response to alkylating agents such as dacarbazine and temozolomide. In a phase 2 study on heavily pre-treated patients with MGMT methylated metastatic colorectal cancer, temozolomide achieved about 30% of disease control rate. Activating mutations of RAS or BRAF genes as well as mismatch repair deficiency may represent mechanisms of resistance to alkylating agents, but a dose-dense schedule of temozolomide may potentially restore sensitivity in RAS-mutant patients. Further development of temozolomide in MGMT methylated colorectal cancer includes investigation of synergic combinations with other agents such as fluoropyrimidines and research for additional biomarkers, in order to better define the role of temozolomide in the treatment of individual patients. PMID:25516857

  14. Urine metabolomic analysis identifies potential biomarkers and pathogenic pathways in kidney cancer.

    Science.gov (United States)

    Kim, Kyoungmi; Taylor, Sandra L; Ganti, Sheila; Guo, Lining; Osier, Michael V; Weiss, Robert H

    2011-05-01

    Kidney cancer is the seventh most common cancer in the Western world, its incidence is increasing, and it is frequently metastatic at presentation, at which stage patient survival statistics are grim. In addition, there are no useful biofluid markers for this disease, such that diagnosis is dependent on imaging techniques that are not generally used for screening. In the present study, we use metabolomics techniques to identify metabolites in kidney cancer patients' urine, which appear at different levels (when normalized to account for urine volume and concentration) from the same metabolites in nonkidney cancer patients. We found that quinolinate, 4-hydroxybenzoate, and gentisate are differentially expressed at a false discovery rate of 0.26, and these metabolites are involved in common pathways of specific amino acid and energetic metabolism, consistent with high tumor protein breakdown and utilization, and the Warburg effect. When added to four different (three kidney cancer-derived and one "normal") cell lines, several of the significantly altered metabolites, quinolinate, α-ketoglutarate, and gentisate, showed increased or unchanged cell proliferation that was cell line-dependent. Further evaluation of the global metabolomics analysis, as well as confirmation of the specific potential biomarkers using a larger sample size, will lead to new avenues of kidney cancer diagnosis and therapy. PMID:21348635

  15. Identification of a novel prostate cancer biomarker, caveolin-1: Implications and potential clinical benefit

    International Nuclear Information System (INIS)

    While prostate cancer is a common disease in men, it is uncommonly life-threatening. To better understand this phenomenon, tumor biologists have sought to elucidate the mechanisms that contribute to the development of virulent prostate cancer. The recent discovery that caveolin-1 (Cav-1) functions as an important oncogene involved in prostate cancer progression reflects the success of this effort. Cav-1 is a major structural coat protein of caveolae, specialized plasma membrane invaginations involved in multiple cellular functions, including molecular transport, cell adhesion, and signal transduction. Cav-1 is aberrantly overexpressed in human prostate cancer, with higher levels evident in metastatic versus primary sites. Intracellular Cav-1 promotes cell survival through activation of Akt and enhancement of additional growth factor pro-survival pathways. Cav-1 is also secreted as a biologically active molecule that promotes cell survival and angiogenesis within the tumor microenvironment. Secreted Cav-1 can be reproducibly detected in peripheral blood using a sensitive and specific immunoassay. Cav-1 levels distinguish men with prostate cancer from normal controls, and preoperative Cav-1 levels predict which patients are at highest risk for relapse following radical prostatectomy for localized disease. Thus, secreted Cav-1 is a promising biomarker in identifying clinically significant prostate cancer

  16. Reproducibility of mass spectrometry based protein profiles for diagnosis of breast cancer across clinical studies

    DEFF Research Database (Denmark)

    Callesen, Anne Kjærgaard; Vach, Werner; Jørgensen, Per E; Cold, Søren; Mogensen, Ole; Kruse, Torben; Jensen, Ole Nørregaard; Madsen, Jonna S

    2008-01-01

    Serum protein profiling by mass spectrometry has achieved attention as a promising technology in oncoproteomics. We performed a systematic review of published reports on protein profiling as a diagnostic tool for breast cancer. The MEDLINE, EMBASE, and COCHRANE databases were searched for origina...... indicating some convergence toward a set of common discriminating, reproducible peaks for breast cancer. These peaks should be further characterized for identification of the protein identity and validated as biomarkers for breast cancer....

  17. Digital image analysis outperforms manual biomarker assessment in breast cancer.

    Science.gov (United States)

    Stålhammar, Gustav; Fuentes Martinez, Nelson; Lippert, Michael; Tobin, Nicholas P; Mølholm, Ida; Kis, Lorand; Rosin, Gustaf; Rantalainen, Mattias; Pedersen, Lars; Bergh, Jonas; Grunkin, Michael; Hartman, Johan

    2016-04-01

    In the spectrum of breast cancers, categorization according to the four gene expression-based subtypes 'Luminal A,' 'Luminal B,' 'HER2-enriched,' and 'Basal-like' is the method of choice for prognostic and predictive value. As gene expression assays are not yet universally available, routine immunohistochemical stains act as surrogate markers for these subtypes. Thus, congruence of surrogate markers and gene expression tests is of utmost importance. In this study, 3 cohorts of primary breast cancer specimens (total n=436) with up to 28 years of survival data were scored for Ki67, ER, PR, and HER2 status manually and by digital image analysis (DIA). The results were then compared for sensitivity and specificity for the Luminal B subtype, concordance to PAM50 assays in subtype classification and prognostic power. The DIA system used was the Visiopharm Integrator System. DIA outperformed manual scoring in terms of sensitivity and specificity for the Luminal B subtype, widely considered the most challenging distinction in surrogate subclassification, and produced slightly better concordance and Cohen's κ agreement with PAM50 gene expression assays. Manual biomarker scores and DIA essentially matched each other for Cox regression hazard ratios for all-cause mortality. When the Nottingham combined histologic grade (Elston-Ellis) was used as a prognostic surrogate, stronger Spearman's rank-order correlations were produced by DIA. Prognostic value of Ki67 scores in terms of likelihood ratio χ(2) (LR χ(2)) was higher for DIA that also added significantly more prognostic information to the manual scores (LR-Δχ(2)). In conclusion, the system for DIA evaluated here was in most aspects a superior alternative to manual biomarker scoring. It also has the potential to reduce time consumption for pathologists, as many of the steps in the workflow are either automatic or feasible to manage without pathological expertise. PMID:26916072

  18. Voltammetric aptasensors for protein disease biomarkers detection: A review.

    Science.gov (United States)

    Meirinho, Sofia G; Dias, Luís G; Peres, António M; Rodrigues, Lígia R

    2016-01-01

    An electrochemical aptasensor is a compact analytical device where the bioreceptor (aptamer) is coupled to a transducer surface to convert a biological interaction into a measurable signal (current) that can be easily processed, recorded and displayed. Since the discovery of the Systematic Evolution of Ligands by Enrichment (SELEX) methodology, the selection of aptamers and their application as bioreceptors has become a promising tool in the design of electrochemical aptasensors. Aptamers present several advantages that highlight their usefulness as bioreceptors such as chemical stability, cost effectiveness and ease of modification towards detection and immobilization at different transducer surfaces. In this review, a special emphasis is given to the potential use of electrochemical aptasensors for the detection of protein disease biomarkers using voltammetry techniques. Methods for the immobilization of aptamers onto electrode surfaces are discussed, as well as different electrochemical strategies that can be used for the design of aptasensors. PMID:27235188

  19. Serum Amyloid A (SAA): a Novel Biomarker for Endometrial Cancer

    Science.gov (United States)

    Cocco, Emiliano; Bellone, Stefania; El-Sahwi, Karim; Cargnelutti, Marilisa; Buza, Natalia; Tavassoli, Fattaneh A.; Schwartz, Peter E.; Rutherford, Thomas J.; Pecorelli, Sergio; Santin, Alessandro D.

    2009-01-01

    Background We investigated the expression of Serum-Amyloid-A (SAA) in endometrial endometrioid carcinoma (EEC), and evaluated its potential as a serum biomarker. Methods SAA gene and protein expression levels were evaluated in EEC and normal endometrial tissues (NEC), by real time-PCR, immunohistochemistry (IHC) and flow cytometry. SAA concentration in 194 serum samples from 50 healthy-women, 42 women with benign diseases and 102 patients including 49 grade-1, 38 grade-2 and 15 grade-3 EEC was also studied by a sensitive bead-based-immunoassay. Results SAA gene expression levels were significantly higher in EEC when compared to NEC (mean-copy-number by RT-PCR = 182 vs 1.9; P=0.001). IHC revealed diffuse cytoplasmic SAA protein staining in poorly differentiated EEC tissues. High intracellular levels of SAA were identified in primary EEC cell lines evaluated by flow cytometry and SAA was found to be actively secreted in vitro. SAA concentrations (μg/ml) had medians of 6.0 in normal healthy females and 6.0 in patients with benign disease (P=0.92). In contrast, SAA values in the serum of EEC patients had a median of 23.7 significantly higher than those of the healthy group (P=0.001) and benign group (P=0.001). Patients harboring G3 EEC were found to have SAA concentrations significantly higher than G1/G2 patients. Conclusions SAA is not only a liver-secreted-protein but is also an EEC-cell product. SAA is expressed and actively secreted by G3-EEC and it is present in high concentration in the serum of EEC patients. SAA may represent a novel biomarker for EEC to monitor disease recurrence and response to therapy. PMID:20041483

  20. Prediction of lung cancer based on serum biomarkers by gene expression programming methods.

    Science.gov (United States)

    Yu, Zhuang; Chen, Xiao-Zheng; Cui, Lian-Hua; Si, Hong-Zong; Lu, Hai-Jiao; Liu, Shi-Hai

    2014-01-01

    In diagnosis of lung cancer, rapid distinction between small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) tumors is very important. Serum markers, including lactate dehydrogenase (LDH), C-reactive protein (CRP), carcino-embryonic antigen (CEA), neurone specific enolase (NSE) and Cyfra21-1, are reported to reflect lung cancer characteristics. In this study classification of lung tumors was made based on biomarkers (measured in 120 NSCLC and 60 SCLC patients) by setting up optimal biomarker joint models with a powerful computerized tool - gene expression programming (GEP). GEP is a learning algorithm that combines the advantages of genetic programming (GP) and genetic algorithms (GA). It specifically focuses on relationships between variables in sets of data and then builds models to explain these relationships, and has been successfully used in formula finding and function mining. As a basis for defining a GEP environment for SCLC and NSCLC prediction, three explicit predictive models were constructed. CEA and NSE are frequently- used lung cancer markers in clinical trials, CRP, LDH and Cyfra21-1 have significant meaning in lung cancer, basis on CEA and NSE we set up three GEP models-GEP 1(CEA, NSE, Cyfra21-1), GEP2 (CEA, NSE, LDH), GEP3 (CEA, NSE, CRP). The best classification result of GEP gained when CEA, NSE and Cyfra21-1 were combined: 128 of 135 subjects in the training set and 40 of 45 subjects in the test set were classified correctly, the accuracy rate is 94.8% in training set; on collection of samples for testing, the accuracy rate is 88.9%. With GEP2, the accuracy was significantly decreased by 1.5% and 6.6% in training set and test set, in GEP3 was 0.82% and 4.45% respectively. Serum Cyfra21-1 is a useful and sensitive serum biomarker in discriminating between NSCLC and SCLC. GEP modeling is a promising and excellent tool in diagnosis of lung cancer. PMID:25422226

  1. DNA Repair Biomarkers Predict Response to Neoadjuvant Chemoradiotherapy in Esophageal Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Alexander, Brian M., E-mail: bmalexander@lroc.harvard.edu [Department of Radiation Oncology, Dana-Farber/Brigham and Women' s Cancer Center, Boston, Massachusetts (United States); Wang Xiaozhe [On-Q-ity, Inc., Waltham, Massachusetts (United States); Niemierko, Andrzej [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Weaver, David T. [On-Q-ity, Inc., Waltham, Massachusetts (United States); Mak, Raymond H. [Department of Radiation Oncology, Dana-Farber/Brigham and Women' s Cancer Center, Boston, Massachusetts (United States); Roof, Kevin S. [Southeast Radiation Oncology, Charlotte, North Carolina (United States); Fidias, Panagiotis [Department of Medicine, Massachusetts General Hospital, Boston, Massachusetts (United States); Wain, John [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States); Choi, Noah C. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)

    2012-05-01

    Purpose: The addition of neoadjuvant chemoradiotherapy prior to surgical resection for esophageal cancer has improved clinical outcomes in some trials. Pathologic complete response (pCR) following neoadjuvant therapy is associated with better clinical outcome in these patients, but only 22% to 40% of patients achieve pCR. Because both chemotherapy and radiotherapy act by inducing DNA damage, we analyzed proteins selected from multiple DNA repair pathways, using quantitative immunohistochemistry coupled with a digital pathology platform, as possible biomarkers of treatment response and clinical outcome. Methods and Materials: We identified 79 patients diagnosed with esophageal cancer between October 1994 and September 2002, with biopsy tissue available, who underwent neoadjuvant chemoradiotherapy prior to surgery at the Massachusetts General Hospital and used their archived, formalin-fixed, paraffin-embedded biopsy samples to create tissue microarrays (TMA). TMA sections were stained using antibodies against proteins in various DNA repair pathways including XPF, FANCD2, PAR, MLH1, PARP1, and phosphorylated MAPKAP kinase 2 (pMK2). Stained TMA slides were evaluated using machine-based image analysis, and scoring incorporated both the intensity and the quantity of positive tumor nuclei. Biomarker scores and clinical data were assessed for correlations with clinical outcome. Results: Higher scores for MLH1 (p = 0.018) and lower scores for FANCD2 (p = 0.037) were associated with pathologic response to neoadjuvant chemoradiation on multivariable analysis. Staining of MLH1, PARP1, XPF, and PAR was associated with recurrence-free survival, and staining of PARP1 and FANCD2 was associated with overall survival on multivariable analysis. Conclusions: DNA repair proteins analyzed by immunohistochemistry may be useful as predictive markers for response to neoadjuvant chemoradiotherapy in patients with esophageal cancer. These results are hypothesis generating and need

  2. DNA Repair Biomarkers Predict Response to Neoadjuvant Chemoradiotherapy in Esophageal Cancer

    International Nuclear Information System (INIS)

    Purpose: The addition of neoadjuvant chemoradiotherapy prior to surgical resection for esophageal cancer has improved clinical outcomes in some trials. Pathologic complete response (pCR) following neoadjuvant therapy is associated with better clinical outcome in these patients, but only 22% to 40% of patients achieve pCR. Because both chemotherapy and radiotherapy act by inducing DNA damage, we analyzed proteins selected from multiple DNA repair pathways, using quantitative immunohistochemistry coupled with a digital pathology platform, as possible biomarkers of treatment response and clinical outcome. Methods and Materials: We identified 79 patients diagnosed with esophageal cancer between October 1994 and September 2002, with biopsy tissue available, who underwent neoadjuvant chemoradiotherapy prior to surgery at the Massachusetts General Hospital and used their archived, formalin-fixed, paraffin-embedded biopsy samples to create tissue microarrays (TMA). TMA sections were stained using antibodies against proteins in various DNA repair pathways including XPF, FANCD2, PAR, MLH1, PARP1, and phosphorylated MAPKAP kinase 2 (pMK2). Stained TMA slides were evaluated using machine-based image analysis, and scoring incorporated both the intensity and the quantity of positive tumor nuclei. Biomarker scores and clinical data were assessed for correlations with clinical outcome. Results: Higher scores for MLH1 (p = 0.018) and lower scores for FANCD2 (p = 0.037) were associated with pathologic response to neoadjuvant chemoradiation on multivariable analysis. Staining of MLH1, PARP1, XPF, and PAR was associated with recurrence-free survival, and staining of PARP1 and FANCD2 was associated with overall survival on multivariable analysis. Conclusions: DNA repair proteins analyzed by immunohistochemistry may be useful as predictive markers for response to neoadjuvant chemoradiotherapy in patients with esophageal cancer. These results are hypothesis generating and need

  3. Intratumour variation of biomarker expression by immunohistochemistry in resectable non-small cell lung cancer

    DEFF Research Database (Denmark)

    Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Ravn, Jesper;

    2013-01-01

    truly reflect the pattern of biomarker expression. It may also be an important factor in chemo resistance, as tumours with heterogeneous biomarker expression may potentially harbour chemo resistant tumour clones. MATERIALS AND METHODS: Immunohistochemical evaluation of the expression of excision repair...... intratumour heterogeneity in 33-87% of tumours examined. This heterogeneity may influence results in studies investigating the therapeutic impact of predictive biomarkers in non-small cell lung cancer (NSCLC)....

  4. Investigating Multi-cancer Biomarkers and Their Cross-predictability in the Expression Profiles of Multiple Cancer Types

    Directory of Open Access Journals (Sweden)

    George C. Tseng

    2009-01-01

    Full Text Available Microarray technology has been widely applied to the analysis of many malignancies, however, integrative analyses across multiple studies are rarely investigated. In this study we performed a meta-analysis on the expression profiles of four published studies analyzing organ donor, benign tissues adjacent to tumor and tumor tissues from liver, prostate, lung and bladder samples. We identified 99 distinct multi-cancer biomarkers in the comparison of all three tissues in liver and prostate and 44 in the comparison of normal versus tumor in liver, prostate and lung. The bladder samples appeared to have a different list of biomarkers from the other three cancer types. The identified multi-cancer biomarkers achieved high accuracy similar to using whole genome in the within-cancer-type prediction. They also performed superior than the one using whole genome in inter-cancer-type prediction. To test the validity of the multi-cancer biomarkers, 23 independent prostate cancer samples were evaluated and 96% accuracy was achieved in inter-study prediction from the original prostate, liver and lung cancer data sets respectively. The result suggests that the compact lists of multi-cancer biomarkers are important in cancer development and represent the common signatures of malignancies of multiple cancer types. Pathway analysis revealed important tumorogenesis functional categories.

  5. Circulating microRNAs as Prognostic and Predictive Biomarkers in Patients with Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Jakob Vasehus Schou

    2016-06-01

    Full Text Available MiRNAs are suggested as promising cancer biomarkers. They are stable and extractable from a variety of clinical tissue specimens (fresh frozen or formalin fixed paraffin embedded tissue and a variety of body fluids (e.g., blood, urine, saliva. However, there are several challenges that need to be solved, considering their potential as biomarkers in cancer, such as lack of consistency between biomarker panels in independent studies due to lack of standardized sample handling and processing, use of inconsistent normalization approaches, and differences in patients populations. Focusing on colorectal cancer (CRC, divergent results regarding circulating miRNAs as prognostic or predictive biomarkers are reported in the literature. In the present review, we summarize the current data on circulating miRNAs as prognostic/predictive biomarkers in patients with localized and metastatic CRC (mCRC.

  6. Biomarkers of ambient air pollution and lung cancer

    DEFF Research Database (Denmark)

    Demetriou, Christiana A; Raaschou-Nielsen, Ole; Loft, Steffen;

    2012-01-01

    these studies, causality assessment can benefit from biomarker research. In the present systematic review, we assess the contribution of intermediate biomarkers in epidemiological studies, to ascertain whether their measurement reinforces causal reasoning. We have reviewed 524 papers which described the...

  7. Proteomics in Cancer Biomarkers Discovery: Challenges and Applications

    Directory of Open Access Journals (Sweden)

    Reem M. Sallam

    2015-01-01

    Full Text Available With the introduction of recent high-throughput technologies to various fields of science and medicine, it is becoming clear that obtaining large amounts of data is no longer a problem in modern research laboratories. However, coherent study designs, optimal conditions for obtaining high-quality data, and compelling interpretation, in accordance with the evidence-based systems biology, are critical factors in ensuring the emergence of good science out of these recent technologies. This review focuses on the proteomics field and its new perspectives on cancer research. Cornerstone publications that have tremendously helped scientists and clinicians to better understand cancer pathogenesis; to discover novel diagnostic and/or prognostic biomarkers; and to suggest novel therapeutic targets will be presented. The author of this review aims at presenting some of the relevant literature data that helped as a step forward in bridging the gap between bench work results and bedside potentials. Undeniably, this review cannot include all the work that is being produced by expert research groups all over the world.

  8. HNRNPC as a candidate biomarker for chemoresistance in gastric cancer.

    Science.gov (United States)

    Huang, Hao; Han, Yong; Zhang, Cheng; Wu, Jian; Feng, Junnan; Qu, Like; Shou, Chengchao

    2016-03-01

    Chemoresistance is a major cause of treatment failure and high mortality in advanced gastric cancer (AGC). Currently, the mechanism of chemoresistance remains unclear, and there is no biomarker to accurately predict the efficacy of chemotherapy. In the present study, we established human gastric cancer (GC) cell lines resistant to 5-fluorouracil (5FU), paclitaxel (TA), or cisplatin (DDP) by gradient drug treatment and generated a novel monoclonal antibody 5B2 targeting heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) overexpressed in chemoresistant GC cells. Overexpressing HNRNPC in GC cells promoted chemoresistance, and knockdown of HNRNPC by small interfering RNA (siRNA) reversed chemoresistance. By utilizing available datasets, we demonstrated that high level of HNRNPC transcript indicated poor overall survival (OS) and free of progression (FP). HNRNPC expression was negatively correlated with OS of GC patients treated with 5FU-based drugs and with time to progression (TTP) of GC patients treated with CF regimen. These data suggest the potential usefulness of HNRNPC as a prognostic and therapeutic marker of GC. PMID:26453116

  9. Proteomic profiling of exosomes leads to the identification of novel biomarkers for prostate cancer

    NARCIS (Netherlands)

    D. Duijvesz (Diederick); K.E. Burnum-Johnson (Kristin); M.A. Gritsenko (Marina); A.M. Hoogland (Marije); M.S. Vredenbregt-van den Berg (Mirella); R. Willemsen (Rob); T.M. Luider (Theo); L. Paša-Tolić (Ljiljana); G.W. Jenster (Guido)

    2013-01-01

    textabstractBackground: Current markers for prostate cancer, such as PSA lack specificity. Therefore, novel biomarkers are needed. Unfortunately, the complexity of body fluids often hampers biomarker discovery. An attractive alternative approach is the isolation of small vesicles, i.e. exosomes, ∼10

  10. Early detection of recurrence after curative resection for colorectal cancer - obstacles when using soluble biomarkers?

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørgen; Jess, Per; Aldulaymi, Bahir Hadi Mohammed;

    2013-01-01

    Abstract Objective. Results from monitoring studies using biomarkers in blood samples aiming at early detection of recurrent colorectal cancer (CRC) are presently evaluated. However, some serological biomarker levels are influenced by the surgical trauma, which may complicate translation of the l...

  11. Multiplexed profiling of secreted proteins for the detection of potential space biomarkers.

    Science.gov (United States)

    Dieriks, Birger; De Vos, Winnok H; Moreels, Marjan; Ghardi, Myriam; Hennekam, Raoul; Broers, Jos L V; Baatout, Sarah; van Oostveldt, Patrick

    2011-01-01

    Space travel exposes astronauts to a plethora of potentially detrimental conditions, such as cosmic radiation and microgravity. As both factors are hard to simulate on Earth, present knowledge remains limited. However, this knowledge is of vital importance, making space flight experiments a necessity for determining the biological effects and the underlying biochemical processes, especially when keeping future long-term interplanetary missions in mind. Instead of estimating the long-term effects, which usually implicate severe endpoints (e.g., cancer) and which are often difficult to attribute, research has shifted to finding representative biomarkers for rapid and sensitive detection of individual radiosensitivity. In this context, an appealing set of candidate markers is the group of secreted proteins, as they exert an intercellular signaling function and are easy to assess. We screened a subset of secreted proteins in cells exposed to space travel by means of multiplex bead array analysis. To determine the cell-specific signatures of the secreted molecules, we compared the conditioned medium of normal fibroblast cells to fibroblasts isolated from a patient with Hutchinson-Gilford Progeria syndrome, which are known to have a perturbed nuclear architecture and DNA damage response. Out of the 88 molecules screened, 20 showed a significant level increase or decrease, with a differential response to space conditions between the two cell types. Among the molecules that were retained, which may prove to be valuable biomarkers, are apolipoprotein C-III, plasminogen activator inhibitor type 1, β-2-microglobulin, ferritin, MMP-3, TIMP-1 and VEGF. PMID:21461557

  12. Detection of protein biomarker using a blood glucose meter.

    Science.gov (United States)

    Lan, Tian; Xiang, Yu; Lu, Yi

    2015-01-01

    mHeath technologies are recognized to play important roles in the future of personal care and medicine. However, their full potentials have not been reached, as most of current technologies are restricted to monitoring physical and behavioral parameters, such as body temperature, heart rate, blood pressure, and physical movement, while direct monitoring of biomarkers in body fluids can provide much more accurate and useful information for medical diagnostics. A major barrier to realizing the full potential of mHealth is the high costs and long cycles of developing mHealth devices capable of monitoring biomarkers in body fluids. To lower the costs and shorten the developmental cycle, we have demonstrated the leveraging of the most successful portable medical monitoring device on the market, the blood glucose meter (BGM), with FDA-approved smartphone technologies that allow for wireless transmission and remote monitoring of a wide range of non-glucose targets. In this protocol, an aptamer-based assay for quantification of interferon-γ (IFN-γ) using an off-the-shelf BGM is described. In this assay, an aptamer-based target recognition system is employed. When IFN-γ binds to the aptamer, it triggers the release of a reporter enzyme, invertase, which can catalyze the conversion of sucrose (not detected by BGM) to glucose. The glucose being produced is then detected using a BGM. The system mimics a competitive enzyme-linked immunosorbent assay (ELISA), where the traditional immunoassay is replaced by an aptamer binding assay; the reporter protein is replaced by invertase, and finally the optical or fluorescence detector is replaced with widely available BGMs. PMID:25626534

  13. Single Step Nanoplasmonic Immunoassay for the Measurement of Protein Biomarkers

    Directory of Open Access Journals (Sweden)

    Shradha Prabhulkar

    2013-02-01

    Full Text Available A nanoplasmonic biosensor for highly-sensitive, single-step detection of protein biomarkers is presented. The principle is based on the utilization of the optical scattering properties of gold nanorods (GNRs conjugated to bio-recognition molecules. The nanoplasmonic properties of the GNRs were utilized to detect proteins using near-infrared light interferometry. We show that the antibody-conjugated GNRs can specifically bind to our model analyte, Glucose Transporter-1 (Glut-1. The signal intensity of back-scattered light from the GNRs bound after incubation, correlated well to the Glut-1 concentration as per the calibration curve. The detection range using this nanoplasmonic immunoassay ranges from 10 ng/mL to 1 ug/mL for Glut-1. The minimal detectable concentration based on the lowest discernable concentration from zero is 10 ng/mL. This nanoplasmonic immunoassay can act as a simple, selective, sensitive strategy for effective disease diagnosis. It offers advantages such as wide detection range, increased speed of analysis (due to fewer incubation/washing steps, and no label development as compared to traditional immunoassay techniques. Our future goal is to incorporate this detection strategy onto a microfluidic platform to be used as a point-of-care diagnostic tool.

  14. A lectin-coupled, targeted proteomic mass spectrometry (MRM MS) platform for identification of multiple liver cancer biomarkers in human plasma.

    Science.gov (United States)

    Ahn, Yeong Hee; Shin, Park Min; Oh, Na Ree; Park, Gun Wook; Kim, Hoguen; Yoo, Jong Shin

    2012-09-18

    Aberrantly glycosylated proteins related to liver cancer progression were captured with specific lectin and identified from human plasma by multiple reaction monitoring (MRM) mass spectrometry as multiple biomarkers for hepatocellular carcinoma (HCC). The lectin fractionation for fucosylated protein glycoforms in human plasma was conducted with a fucose-specific aleuria aurantia lectin (AAL). Following tryptic digestion of the lectin-captured fraction, plasma samples from 30 control cases (including 10 healthy, 10 hepatitis B virus [HBV], and 10 cirrhosis cases) and 10 HCC cases were quantitatively analyzed by MRM to identify which glycoproteins are viable HCC biomarkers. A1AG1, AACT, A1AT, and CERU were found to be potent biomarkers to differentiate HCC plasma from control plasmas. The AUROC generated independently from these four biomarker candidates ranged from 0.73 to 0.92. However, the lectin-coupled MRM assay with multiple combinations of biomarker candidates is superior statistically to those generated from the individual candidates with AUROC more than 0.95, which can be an alternative to the immunoassay inevitably requiring tedious development of multiple antibodies against biomarker candidates to be verified. Eventually the lectin-coupled, targeted proteomic mass spectrometry (MRM MS) platform was found to be efficient to identify multiple biomarkers from human plasma according to cancer progression. PMID:22789673

  15. Mass Spectrometry-Based Proteomics in Molecular Diagnostics: Discovery of Cancer Biomarkers Using Tissue Culture

    OpenAIRE

    Debasish Paul; Avinash Kumar; Akshada Gajbhiye; Santra, Manas K.; Rapole Srikanth

    2013-01-01

    Accurate diagnosis and proper monitoring of cancer patients remain a key obstacle for successful cancer treatment and prevention. Therein comes the need for biomarker discovery, which is crucial to the current oncological and other clinical practices having the potential to impact the diagnosis and prognosis. In fact, most of the biomarkers have been discovered utilizing the proteomics-based approaches. Although high-throughput mass spectrometry-based proteomic approaches like SILAC, 2D-DIGE,...

  16. Plasma Protein Carbonyls and Breast Cancer Risk in Sisters Discordant for Breast Cancer from the New York Site of the Breast Cancer Family Registry

    OpenAIRE

    Zipprich, Jennifer; Terry, Mary Beth; Liao, Yuyan; Agrawal, Meenakshi; Gurvich, Irina; Senie, Ruby; Santella, Regina M.

    2009-01-01

    Reactive Oxygen Species (ROS) are important in the pathogenesis of many diseases, including breast cancer. Several population-based case-control studies have demonstrated that various biomarkers of oxidative stress are associated with an increase in breast cancer risk. We selected sisters discordant for breast cancer (n=645) from the New York site of the Breast Cancer Family Registry to explore factors that contribute to variation in plasma protein carbonyls, and to determine whether this bio...

  17. Serum uPAR as Biomarker in Breast Cancer Recurrence: A Mathematical Model

    Science.gov (United States)

    Hao, Wenrui; Friedman, Avner

    2016-01-01

    There are currently over 2.5 million breast cancer survivors in the United States and, according to the American Cancer Society, 10 to 20 percent of these women will develop recurrent breast cancer. Early detection of recurrence can avoid unnecessary radical treatment. However, self-examination or mammography screening may not discover a recurring cancer if the number of surviving cancer cells is small, while biopsy is too invasive and cannot be frequently repeated. It is therefore important to identify non-invasive biomarkers that can detect early recurrence. The present paper develops a mathematical model of cancer recurrence. The model, based on a system of partial differential equations, focuses on tissue biomarkers that include the plasminogen system. Among them, only uPAR is known to have significant correlation to its concentration in serum and could therefore be a good candidate for serum biomarker. The model includes uPAR and other associated cytokines and cells. It is assumed that the residual cancer cells that survived primary cancer therapy are concentrated in the same location within a region with a very small diameter. Model simulations establish a quantitative relation between the diameter of the growing cancer and the total uPAR mass in the cancer. This relation is used to identify uPAR as a potential serum biomarker for breast cancer recurrence. PMID:27078836

  18. Serum uPAR as Biomarker in Breast Cancer Recurrence: A Mathematical Model.

    Science.gov (United States)

    Hao, Wenrui; Friedman, Avner

    2016-01-01

    There are currently over 2.5 million breast cancer survivors in the United States and, according to the American Cancer Society, 10 to 20 percent of these women will develop recurrent breast cancer. Early detection of recurrence can avoid unnecessary radical treatment. However, self-examination or mammography screening may not discover a recurring cancer if the number of surviving cancer cells is small, while biopsy is too invasive and cannot be frequently repeated. It is therefore important to identify non-invasive biomarkers that can detect early recurrence. The present paper develops a mathematical model of cancer recurrence. The model, based on a system of partial differential equations, focuses on tissue biomarkers that include the plasminogen system. Among them, only uPAR is known to have significant correlation to its concentration in serum and could therefore be a good candidate for serum biomarker. The model includes uPAR and other associated cytokines and cells. It is assumed that the residual cancer cells that survived primary cancer therapy are concentrated in the same location within a region with a very small diameter. Model simulations establish a quantitative relation between the diameter of the growing cancer and the total uPAR mass in the cancer. This relation is used to identify uPAR as a potential serum biomarker for breast cancer recurrence. PMID:27078836

  19. Sushi Domain-Containing Protein 3: A Potential Target for Breast Cancer.

    Science.gov (United States)

    Yu, Zhenghong; Jiang, Enze; Wang, Xinxing; Shi, Yaqin; Shangguan, Anna Junjie; Zhang, Luo; Li, Jie

    2015-06-01

    Aromatase inhibitors (AIs) are the most effective endocrine treatment for estrogen receptor α-positive (ERα+) postmenopausal breast cancer. Identification of biomarkers that are able to predict AIs responsiveness of patients is a key for successful treatment. The currently used biomarkers for tamoxifen responsiveness, which including ERα as well as progesterone receptor can only predict part of the potential responders to AIs treatment. Sushi domain-containing protein 3 (SUSD3) is a potential novel biomarker of AIs responsiveness. The lack of SUSD3 expression in breast cancer tissue can be an important predictor for non-responsiveness to AI. Here we reviewed the property and function of SUSD3, its usage as a biomarker and the practicability for SUSD3 to become a target for immune therapy. We suggest this protein can be potentially measured or targeted for prevention, diagnostic, and therapeutic purposes for estrogen or progesterone-dependent disorders including breast cancer in women. PMID:25556073

  20. A Serum Protein Profile Predictive of the Resistance to Neoadjuvant Chemotherapy in Advanced Breast Cancers*

    OpenAIRE

    Hyung, Seok-Won; Lee, Min Young; Yu, Jong-Han; Shin, Byunghee; Jung, Hee-Jung; Park, Jong-Moon; Han, Wonshik; Lee, Kyung-min; Moon, Hyeong-Gon; Zhang, Hui; Aebersold, Ruedi; Hwang, Daehee; Lee, Sang-Won; Yu, Myeong-Hee; Noh, Dong-Young

    2011-01-01

    Prediction of the responses to neoadjuvant chemotherapy (NACT) can improve the treatment of patients with advanced breast cancer. Genes and proteins predictive of chemoresistance have been extensively studied in breast cancer tissues. However, noninvasive serum biomarkers capable of such prediction have been rarely exploited. Here, we performed profiling of N-glycosylated proteins in serum from fifteen advanced breast cancer patients (ten patients sensitive to and five patients resistant to N...

  1. Biomarker Validation for Aging: Lessons from mtDNA Heteroplasmy Analyses in Early Cancer Detection

    Directory of Open Access Journals (Sweden)

    Peter E. Barker

    2009-11-01

    Full Text Available The anticipated biological and clinical utility of biomarkers has attracted significant interest recently. Aging and early cancer detection represent areas active in the search for predictive and prognostic biomarkers. While applications differ, overlapping biological features, analytical technologies and specific biomarker analytes bear comparison. Mitochondrial DNA (mtDNA as a biomarker in both biological models has been evaluated. However, it remains unclear whether mtDNA changes in aging and cancer represent biological relationships that are causal, incidental, or a combination of both. This article focuses on evaluation of mtDNA-based biomarkers, emerging strategies for quantitating mtDNA admixtures, and how current understanding of mtDNA in aging and cancer evolves with introduction of new technologies. Whether for cancer or aging, lessons from mtDNA based biomarker evaluations are several. Biological systems are inherently dynamic and heterogeneous. Detection limits for mtDNA sequencing technologies differ among methods for low-level DNA sequence admixtures in healthy and diseased states. Performance metrics of analytical mtDNA technology should be validated prior to application in heterogeneous biologically-based systems. Critical in evaluating biomarker performance is the ability to distinguish measurement system variance from inherent biological variance, because it is within the latter that background healthy variability as well as high-value, disease-specific information reside.

  2. Predictive biomarkers for personalised anti-cancer drug use: discovery to clinical implementation.

    Science.gov (United States)

    Alymani, Nayef A; Smith, Murray D; Williams, David J; Petty, Russell D

    2010-03-01

    A priority translational research objective in cancer medicine is the discovery of novel therapeutic targets for solid tumours. Ideally, co-discovery of predictive biomarkers occurs in parallel to facilitate clinical development of agents and ultimately personalise clinical use. However, the identification of clinically useful predictive biomarkers for solid tumours has proven challenging with many initially promising biomarkers failing to translate into clinically useful applications. In particular, the 'failure' of a predictive biomarker has often only become apparent at a relatively late stage in investigation. Recently, the field has recognised the need to develop a robust clinical biomarker development methodology to facilitate the process. This review discusses the recent progress in this area focusing on the key stages in the biomarker development process: discovery, validation, qualification and implementation. Concentrating on predictive biomarkers for selecting systemic therapies for individual patients in the clinic, the advances and progress in each of these stages in biomarker development are outlined and the key remaining challenges are discussed. Specific examples are discussed to illustrate the challenges identified and how they have been addressed. Overall, we find that significant progress has been made towards a formalised biomarker developmental process. This holds considerable promise for facilitating the translation of predictive biomarkers from discovery to clinical implementation. Further enhancements could eventually be found through alignment with regulatory processes. PMID:20138504

  3. Considering Exosomal miR-21 as a Biomarker for Cancer

    Directory of Open Access Journals (Sweden)

    Jian Shi

    2016-03-01

    Full Text Available Cancer is a fatal human disease. Early diagnosis of cancer is the most effective method to prevent cancer development and to achieve higher survival rates for patients. Many traditional diagnostic methods for cancer are still not sufficient for early, more convenient and accurate, and noninvasive diagnosis. Recently, the use of microRNAs (miRNAs, such as exosomal microRNA-21(miR-21, as potential biomarkers was widely reported. This initial systematic review analyzes the potential role of exosomal miR-21 as a general biomarker for cancers. A total of 10 studies involving 318 patients and 215 healthy controls have covered 10 types of cancers. The sensitivity and specificity of pooled studies were 75% (0.70–0.80 and 85% (0.81–0.91, with their 95% confidence intervals (CIs, while the area under the summary receiver operating characteristic curve (AUC was 0.93. Additionally, we examined and evaluated almost all other issues about biomarkers, including cutoff points, internal controls and detection methods, from the literature. This initial meta-analysis indicates that exosomal miR-21 has a strong potential to be used as a universal biomarker to identify cancers, although as a general biomarker the case number for each cancer type is small. Based on the literature, a combination of miRNA panels and other cancer antigens, as well as a selection of appropriate internal controls, has the potential to serve as a more sensitive and accurate cancer diagnosis tool. Additional information on miR-21 would further support its use as a biomarker in cancer.

  4. Considering Exosomal miR-21 as a Biomarker for Cancer.

    Science.gov (United States)

    Shi, Jian

    2016-01-01

    Cancer is a fatal human disease. Early diagnosis of cancer is the most effective method to prevent cancer development and to achieve higher survival rates for patients. Many traditional diagnostic methods for cancer are still not sufficient for early, more convenient and accurate, and noninvasive diagnosis. Recently, the use of microRNAs (miRNAs), such as exosomal microRNA-21(miR-21), as potential biomarkers was widely reported. This initial systematic review analyzes the potential role of exosomal miR-21 as a general biomarker for cancers. A total of 10 studies involving 318 patients and 215 healthy controls have covered 10 types of cancers. The sensitivity and specificity of pooled studies were 75% (0.70-0.80) and 85% (0.81-0.91), with their 95% confidence intervals (CIs), while the area under the summary receiver operating characteristic curve (AUC) was 0.93. Additionally, we examined and evaluated almost all other issues about biomarkers, including cutoff points, internal controls and detection methods, from the literature. This initial meta-analysis indicates that exosomal miR-21 has a strong potential to be used as a universal biomarker to identify cancers, although as a general biomarker the case number for each cancer type is small. Based on the literature, a combination of miRNA panels and other cancer antigens, as well as a selection of appropriate internal controls, has the potential to serve as a more sensitive and accurate cancer diagnosis tool. Additional information on miR-21 would further support its use as a biomarker in cancer. PMID:27043643

  5. RNA-Seq accurately identifies cancer biomarker signatures to distinguish tissue of origin.

    Science.gov (United States)

    Wei, Iris H; Shi, Yang; Jiang, Hui; Kumar-Sinha, Chandan; Chinnaiyan, Arul M

    2014-11-01

    Metastatic cancer of unknown primary (CUP) accounts for up to 5% of all new cancer cases, with a 5-year survival rate of only 10%. Accurate identification of tissue of origin would allow for directed, personalized therapies to improve clinical outcomes. Our objective was to use transcriptome sequencing (RNA-Seq) to identify lineage-specific biomarker signatures for the cancer types that most commonly metastasize as CUP (colorectum, kidney, liver, lung, ovary, pancreas, prostate, and stomach). RNA-Seq data of 17,471 transcripts from a total of 3,244 cancer samples across 26 different tissue types were compiled from in-house sequencing data and publically available International Cancer Genome Consortium and The Cancer Genome Atlas datasets. Robust cancer biomarker signatures were extracted using a 10-fold cross-validation method of log transformation, quantile normalization, transcript ranking by area under the receiver operating characteristic curve, and stepwise logistic regression. The entire algorithm was then repeated with a new set of randomly generated training and test sets, yielding highly concordant biomarker signatures. External validation of the cancer-specific signatures yielded high sensitivity (92.0% ± 3.15%; mean ± standard deviation) and specificity (97.7% ± 2.99%) for each cancer biomarker signature. The overall performance of this RNA-Seq biomarker-generating algorithm yielded an accuracy of 90.5%. In conclusion, we demonstrate a computational model for producing highly sensitive and specific cancer biomarker signatures from RNA-Seq data, generating signatures for the top eight cancer types responsible for CUP to accurately identify tumor origin. PMID:25425966

  6. Biomarkers that currently effect clinical practice in lung cancer: EGFR, ALK, MET, ROS-1 and KRAS

    Directory of Open Access Journals (Sweden)

    GrzegorzJanuszKorpanty

    2014-08-01

    Full Text Available Lung cancer remains the most lethal malignancy in the world. Despite improvements in surgical treatment, systemic therapy and radiotherapy, the 5-year survival rate for all patients diagnosed with lung cancer remains between 15-20%. Newer therapeutic strategies rely on specific molecular alterations, or biomarkers, that provide opportunities for a personalized approach to specific patient populations. Classification of lung cancer is becoming increasingly focused on these biomarkers, which renders the term “non-small cell lung” cancer less clinically useful. Non-small cell lung cancer is now recognized as a complex malignancy and its molecular and genomic diversity allows for patient-centered treatment options. Here we review advances in targeted treatment of lung adenocarcinoma with respect to five clinically relevant biomarkers - EGFR, ALK, MET, ROS-1 and KRAS.

  7. A prospective evaluation of early detection biomarkers for ovarian cancer in the European EPIC cohort

    DEFF Research Database (Denmark)

    Terry, Kathryn L; Schock, Helena; Fortner, Renée T; Hüsing, Anika; Fichorova, Raina N; Yamamoto, Hidemi S; Vitonis, Allison F; Johnson, Theron; Overvad, Kim; Tjønneland, Anne; Boutron-Ruault, Marie-Christine; Mesrine, Sylvie; Severi, Gianluca; Dossus, Laure; Rinaldi, Sabina; Boeing, Heiner; Benetou, Vassiliki; Lagiou, Pagona; Trichopoulou, Antonia; Krogh, Vittorio; Kuhn, Elisabetta; Panico, Salvatore; Bueno-de-Mesquita, H Bas; Onland-Moret, N Charlotte; Peeters, Petra H; Gram, Inger Torhild; Weiderpass, Elisabete; Duell, Eric J; Sanchez, Maria-Jose; Ardanaz, Eva; Etxezarreta, Nerea; Navarro, Carmen; Idahl, Annika; Lundin, Eva; Jirström, Karin; Manjer, Jonas; Wareham, Nicholas J; Khaw, Kay-Tee; Smith Byrne, Karl; Travis, Ruth C; Gunter, Marc J; Merritt, Melissa A; Riboli, Elio; Cramer, Daniel; Kaaks, Rudolf

    2016-01-01

    source of information to evaluate early detection biomarkers. Here we evaluate the most promising ovarian cancer screening biomarkers in prospectively collected samples from the European Prospective Investigation into Cancer and Nutrition (EPIC) study. EXPERIMENTAL DESIGN: We measured CA125, HE4, CA72......PURPOSE: About 60% of ovarian cancers are diagnosed at late stage, when 5-year survival is less than 30% in contrast to 90% for local disease. This has prompted search for early detection biomarkers. For initial testing, specimens taken months or years before ovarian cancer diagnosis are the best.......4 and CA15.3 in 810 invasive epithelial ovarian cancer cases and 1,939 controls. We calculated the sensitivity at 95% and 98% specificity as well as Area under the Receiver Operator Curve (C-statistic) for each marker individually and in combination. Additionally, we evaluated marker performance by...

  8. Identification of multiple novel protein biomarkers shed by human serous ovarian tumors into the blood of immunocompromised mice and verified in patient sera.

    Directory of Open Access Journals (Sweden)

    Lynn A Beer

    Full Text Available The most cancer-specific biomarkers in blood are likely to be proteins shed directly by the tumor rather than less specific inflammatory or other host responses. The use of xenograft mouse models together with in-depth proteome analysis for identification of human proteins in the mouse blood is an under-utilized strategy that can clearly identify proteins shed by the tumor. In the current study, 268 human proteins shed into mouse blood from human OVCAR-3 serous tumors were identified based upon human vs. mouse species differences using a four-dimensional plasma proteome fractionation strategy. A multi-step prioritization and verification strategy was subsequently developed to efficiently select some of the most promising biomarkers from this large number of candidates. A key step was parallel analysis of human proteins detected in the tumor supernatant, because substantially greater sequence coverage for many of the human proteins initially detected in the xenograft mouse plasma confirmed assignments as tumor-derived human proteins. Verification of candidate biomarkers in patient sera was facilitated by in-depth, label-free quantitative comparisons of serum pools from patients with ovarian cancer and benign ovarian tumors. The only proteins that advanced to multiple reaction monitoring (MRM assay development were those that exhibited increases in ovarian cancer patients compared with benign tumor controls. MRM assays were facilely developed for all 11 novel biomarker candidates selected by this process and analysis of larger pools of patient sera suggested that all 11 proteins are promising candidate biomarkers that should be further evaluated on individual patient blood samples.

  9. Current status of predictive biomarkers for neoadjuvant therapy in esophageal cancer

    Institute of Scientific and Technical Information of China (English)

    Norihisa; Uemura; Tadashi; Kondo

    2014-01-01

    Neoadjuvant therapy has been proven to be extremely valuable and is widely used for advanced esophageal cancer. However, a significant proportion of treated patients(60%-70%) does not respond well to neoadjuvant treatments and develop severe adverse effects. Therefore, predictive markers for individualization of multimodality treatments are urgently needed in esophageal cancer. Recently, molecular biomarkers that predict the response to neoadjuvant therapy have been explored in multimodal approaches in esophageal cancer and successful examples of biomarker identification have been reported. In this review, promising candidates for predictive molecular biomarkers developed by using multiple molecular approaches are reviewed. Moreover, treatment strategies based on the status of predicted biomarkers are discussed, while considering the international differences in the clinical background. However, in the absence of adequate treatment options related to the results of the biomarker test, the usefulness of these diagnostic tools is limited and new effective therapies for biomarker-identified nonresponders to cancer treatment should be concurrent with the progress of predictive technologies. Further improvement in the prognosis of esophageal cancer patients can be achieved through the introduction of novel therapeutic approaches in clinical practice.

  10. Similar Source of Differential Blood mRNAs in Lung Cancer and Pulmonary Inflammatory Diseases: Calls for Improved Strategy for Identifying Cancer-Specific Biomarkers

    OpenAIRE

    Hong, Guini; Chen, Beibei; Li, Hongdong; Zhang, Wenjing; Zheng, Tingting; Li, Shan; Shi, Tongwei; Ao, Lu; Guo, Zheng

    2014-01-01

    Background Many studies try to identify cancer diagnostic biomarkers by comparing peripheral whole blood (PWB) of cancer samples and healthy controls, explicitly or implicitly assuming that such biomarkers are potential candidate biomarkers for distinguishing cancer from nonmalignant inflammation-associated diseases. Methods Multiple PWB gene expression profiles for lung cancer/inflammation-associated pulmonary diseases were used for differential mRNAs identification and comparison and for pr...

  11. Chemometrics of differentially expressed proteins from colorectal cancer patients

    Institute of Scientific and Technical Information of China (English)

    Lay-Chin Yeoh; Saravanan Dharmaraj; Boon-Hui Gooi; Manjit Singh; Lay-Harn Gam

    2011-01-01

    AIM: To evaluate the usefulness of differentially expressed proteins from colorectal cancer (CRC) tissues for differentiating cancer and normal tissues. METHODS: A Proteomic approach was used to identify the differentially expressed proteins between CRC and normal tissues. The proteins were extracted using Tris buffer and thiourea lysis buffer (TLB) for extraction of aqueous soluble and membrane-associated proteins, respectively. Chemometrics, namely principal component analysis (PCA) and linear discriminant analysis (LDA), were used to assess the usefulness of these proteins for identifying the cancerous state of tissues. RESULTS: Differentially expressed proteins identified were 37 aqueous soluble proteins in Tris extracts and 24 membrane-associated proteins in TLB extracts. Based on the protein spots intensity on 2D-gel images, PCA by applying an eigenvalue > 1 was successfully used to reduce the number of principal components (PCs) into 12 and seven PCs for Tris and TLB extracts, respectively, and subsequently six PCs, respectively from both the extracts were used for LDA. The LDA classification for Tris extract showed 82.7% of original samples were correctly classified, whereas 82.7% were correctly classified for the cross-validated samples. The LDA for TLB extract showed that 78.8% of original samples and 71.2% of the cross-validated samples were correctly classified. CONCLUSION: The classification of CRC tissues by PCA and LDA provided a promising distinction between normal and cancer types. These methods can possibly be used for identification of potential biomarkers among the differentially expressed proteins identified.

  12. A window-of-opportunity biomarker study of etodolac in resectable breast cancer

    International Nuclear Information System (INIS)

    Observational data show that nonsteroidal anti-inflammatory drug (NSAID) use is associated with a lower rate of breast cancer. We evaluated the effect of etodolac, an FDA-approved NSAID reported to inhibit cyclooxygenase (COX) enzymes and the retinoid X receptor alpha (RXR), on rationally identified potential biomarkers in breast cancer. Patients with resectable breast cancer planned for initial management with surgical resection were enrolled and took 400 mg of etodolac twice daily prior to surgery. Protein and gene expression levels for genes related to COX-2 and RXRα were evaluated in tumor samples from before and after etodolac exposure. Thirty subjects received etodolac and 17 subjects were assayed as contemporaneous or opportunistic controls. After etodolac exposure mean cyclin D1 protein levels, assayed by immunohistochemistry, decreased (P = 0.03). Notably, pre- versus post cyclin D1 gene expression change went from positive to negative with greater duration of etodolac exposure (r = −0.64, P = 0.01). Additionally, etodolac exposure was associated with a significant increase in COX-2 gene expression levels (fold change: 3.25 [95% CI: 1.9, 5.55]) and a trend toward increased β-catenin expression (fold change: 2.03 [95% CI: 0.93, 4.47]). In resectable breast cancer relatively brief exposure to the NSAID etodolac was associated with reduced cyclin D1 protein levels. Effect was also observed on cyclin D1 gene expression with decreasing levels with longer durations of drug exposure. Increased COX-2 gene expression was seen, possibly due to compensatory feedback. These data highlight the utility of even small clinical trials with access to biospecimens for pharmacodynamic studies

  13. Mitochondrial DNA mutations—candidate biomarkers for breast cancer diagnosis in Bangladesh

    OpenAIRE

    Rowshan Ara Begum; Abu Din Ahmed Shahinuzzaman; Atiqur Rahman; Gazi Nurun Nahar Sultana; Chowdhury Faiz Hossain

    2012-01-01

    Breast cancer is a major health problem that affects more than 24% of women in Bangladesh. Further- more, among low-income countries including Bangladesh, individuals have a high risk for developing breast cancer. This study aimed to identify candidate mitochondrial DNA (mtDNA) biomarkers for breast cancer diagnosis in Bangladeshi women to be used as a preventive approach. We screened the blood samples from 24 breast cancer patients and 20 healthy controls to detect polymorphisms in the D-loo...

  14. Current Stem Cell Biomarkers and Their Functional Mechanisms in Prostate Cancer

    Science.gov (United States)

    Zhang, Kaile; Zhou, Shukui; Wang, Leilei; Wang, Jianlong; Zou, Qingsong; Zhao, Weixin; Fu, Qiang; Fang, Xiaolan

    2016-01-01

    Currently there is little effective treatment available for castration resistant prostate cancer, which is responsible for the majority of prostate cancer related deaths. Emerging evidence suggested that cancer stem cells might play an important role in resistance to traditional cancer therapies, and the studies of cancer stem cells (including specific isolation and targeting on those cells) might benefit the discovery of novel treatment of prostate cancer, especially castration resistant disease. In this review, we summarized major biomarkers for prostate cancer stem cells, as well as their functional mechanisms and potential application in clinical diagnosis and treatment of patients. PMID:27447616

  15. Serum Protein Fingerprint of Patients with Pancreatic Cancer by SELDI Technology

    Institute of Scientific and Technical Information of China (English)

    MA Ning; GE Chun-lin; LUAN Feng-ming; YAO Dian-bo; HU Chao-jun; LI Ning; LIU Yong-feng

    2008-01-01

    Objective:To study the serum protein fingerprint of patients with pancreatic cancer and to screen for protein molecules closely related to pancreatic cancer during the onset and progression of the disease using surface-enhanced laser desorption and ionization time of fight mass spectrometry(SELDI-TOF-MS).Methods:Serum samples from 20 pancreatic cancers,20 healthy volunteers and 18 patients with other pancreatic diseases.WCX magnetic beans and PBSII-C protein chips reader(Ciphergen Biosystems Ins.)were used.The protein fingerprint expression of all the Serum samples and the resulting profiles between cancer and normal were analyzed with Biomarker Wizard system.Results:A group of proteomic peaks were detected.Four differently expressed potential biomarkers were identified with the relative molecular weights of 5705 Da,4935 Da,5318 Da and 3243 Da.Among them,two proteins with m/z5705,5318Da down-regulated,and two proteins with m/z 4935,3243 Da were up-regulated in pancreatic cancers.Conclusion:SELDI technology can be used to screen significant proteins of differential expression in the serum of pancreatic cancer patients.These different proteins could be specific biomarkers of the patients with pancreatic cancer in the serum and have the potential value of further investigation.

  16. Noncoding RNAs as potential biomarkers to predict the outcome in pancreatic cancer

    Directory of Open Access Journals (Sweden)

    Jin K

    2015-02-01

    Full Text Available Kaizhou Jin,1–3,* Guopei Luo,1–3,* Zhiwen Xiao,1–3 Zuqiang Liu,1–3 Chen Liu,1–3 Shunrong Ji,1–3 Jin Xu,1–3 Liang Liu,1–3 Jiang Long,1–3 Quanxing Ni,1–3 Xianjun Yu1–3 1Department of Pancreatic and Hepatobiliary Surgery, Fudan University Shanghai Cancer Center, 2Department of Oncology, Shanghai Medical College, Fudan University, 3Pancreatic Cancer Institute, Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Pancreatic ductal adenocarcinoma (PDAC, a common digestive system cancer, is highly malignant and has a poor disease outcome. Currently, all available examination and detection methods cannot accurately predict the clinical outcome. Therefore, it is extremely important to identify novel molecular biomarkers for personalized medication and to significantly improve the overall outcome. The “noncoding RNAs” (ncRNAs are a group of RNAs that do not code for proteins, and they are categorized as structural RNAs and regulatory RNAs. It has been shown that microRNAs and long ncRNAs function as regulatory RNAs to affect the progression of various diseases. Many studies have confirmed a role for ncRNAs in the progression of PDAC during the last few years. Because of the significant role of ncRNAs in PDAC, ncRNA profiling may be used to predict PDAC outcome with high accuracy. This review comprehensively analyzes the value of ncRNAs as potential biomarkers to predict the outcome in PDAC and the possible mechanisms thereof. Keywords: pancreatic ductal adenocarcinoma, microRNA, long noncoding RNA, outcome prediction

  17. Calling Biomarkers in Milk Using a Protein Microarray on Your Smartphone

    OpenAIRE

    Ludwig, S.K.J.; Tokarski, Christian; Stefan N Lang; Ginkel, van, L.A.; Zhu, Hongying; Ozcan, Aydogan; Nielen, M. W. F.

    2015-01-01

    Here we present the concept of a protein microarray-based fluorescence immunoassay for multiple biomarker detection in milk extracts by an ordinary smartphone. A multiplex immunoassay was designed on a microarray chip, having built-in positive and negative quality controls. After the immunoassay procedure, the 48 microspots were labelled with Quantum Dots (QD) depending on the protein biomarker levels in the sample. QD-fluorescence was subsequently detected by the smartphone camera under UV l...

  18. In Vitro Evaluation of Biofield Treatment on Cancer Biomarkers Involved in Endometrial and Prostate Cancer Cell Lines

    OpenAIRE

    Trivedi, Mahendra Kumar

    2015-01-01

    Increasing cancer rates particularly in the developed world are associated with related lifestyle and environmental exposures. Combined immunotherapy and targeted therapies are the main treatment approaches in advanced and recurrent cancer. An alternate approach, energy medicine is increasingly used in life threatening problems to promote human wellness. This study aimed to investigate the effect of biofield treatment on cancer biomarkers involved in human endometrium and prostate cancer cell...

  19. Simultaneous Imaging of Two Different Cancer Biomarkers Using Aptamer-Conjugated Quantum Dots

    Directory of Open Access Journals (Sweden)

    Jonghwan Lee

    2015-04-01

    Full Text Available Studying gene expression profile in a single cancer cell is important because multiple genes are associated with cancer development. Quantum dots (QDs have been utilized as biological probes for imaging and detection. QDs display specific optical and electrical properties that depend on their size that can be applied for imaging and sensing applications. In this study, simultaneous imaging of the cancer biomarkers, tenascin-C and nucleolin, was performed using two types of aptamer-conjugated QDs. The simultaneous imaging of these two different cancer markers in three cancer cell lines was reliable and cell line-specific. Current requirements for cancer imaging technologies include the need for simple preparation methods and the ability to detect multiple cancer biomarkers and evaluate their intracellular localizations. The method employed in this study is a feasible solution to these requirements.

  20. MicroRNA biomarkers in whole blood for detection of pancreatic cancer

    DEFF Research Database (Denmark)

    Schultz, Nicolai A; Dehlendorff, Christian; Jensen, Benny V;

    2014-01-01

    IMPORTANCE Biomarkers for the early diagnosis of patients with pancreatic cancer are needed to improve prognosis. OBJECTIVES To describe differences in microRNA expression in whole blood between patients with pancreatic cancer, chronic pancreatitis, and healthy participants and to identify panels...... of microRNAs for use in diagnosis of pancreatic cancer compared with the cancer antigen 19-9 (CA19-9). DESIGN, SETTING, AND PARTICIPANTS A case-control study that included 409 patients with pancreatic cancer and 25 with chronic pancreatitis who had been included prospectively in the Danish BIOPAC...... (Biomarkers in Patients with Pancreatic Cancer) study (July 2008-October 2012) plus 312 blood donors as healthy participants. The microRNA expressions in pretreatment whole blood RNA samples were collected and analyzed in 3 randomly determined subcohorts: discovery cohort (143 patients with pancreatic cancer...

  1. MRM screening/biomarker discovery with linear ion trap MS: a library of human cancer-specific peptides

    International Nuclear Information System (INIS)

    The discovery of novel protein biomarkers is essential in the clinical setting to enable early disease diagnosis and increase survivability rates. To facilitate differential expression analysis and biomarker discovery, a variety of tandem mass spectrometry (MS/MS)-based protein profiling techniques have been developed. For achieving sensitive detection and accurate quantitation, targeted MS screening approaches, such as multiple reaction monitoring (MRM), have been implemented. MCF-7 breast cancer protein cellular extracts were analyzed by 2D-strong cation exchange (SCX)/reversed phase liquid chromatography (RPLC) separations interfaced to linear ion trap MS detection. MS data were interpreted with the Sequest-based Bioworks software (Thermo Electron). In-house developed Perl-scripts were used to calculate the spectral counts and the representative fragment ions for each peptide. In this work, we report on the generation of a library of 9,677 peptides (p < 0.001), representing ~1,572 proteins from human breast cancer cells, that can be used for MRM/MS-based biomarker screening studies. For each protein, the library provides the number and sequence of detectable peptides, the charge state, the spectral count, the molecular weight, the parameters that characterize the quality of the tandem mass spectrum (p-value, DeltaM, Xcorr, DeltaCn, Sp, no. of matching a, b, y ions in the spectrum), the retention time, and the top 10 most intense product ions that correspond to a given peptide. Only proteins identified by at least two spectral counts are listed. The experimental distribution of protein frequencies, as a function of molecular weight, closely matched the theoretical distribution of proteins in the human proteome, as provided in the SwissProt database. The amino acid sequence coverage of the identified proteins ranged from 0.04% to 98.3%. The highest-abundance proteins in the cellular extract had a molecular weight (MW)<50,000. Preliminary experiments have

  2. Exosome-encapsulated microRNAs as circulating biomarkers for breast cancer.

    Science.gov (United States)

    Joyce, Doireann P; Kerin, Michael J; Dwyer, Róisín M

    2016-10-01

    Breast cancer is a highly prevalent disease, accounting for 29% of invasive cancers in women. Survival from this disease depends on the stage at diagnosis, with patients who are detected earlier having more favourable outcomes. It is because of this that research groups are focusing on the development of a blood-based biomarker for breast cancer. Such biomarkers may facilitate the detection of breast cancer in its infancy before it has spread beyond the primary site. MicroRNAs (miRNAs) have shown immense potential in this setting. These short, non-coding RNA sequences have been shown to be dysregulated in breast cancer. Despite showing immense promise, miRNAs have not been successfully implemented in the clinical setting due to a lack of a standardised approach which has resulted in conflicting results. These challenges may be addressed at least in part through the study of exosomes. The biomarker potential for exosomes holds huge promise and may revolutionise the way in which we diagnose and manage breast cancer. These nanovesicles may be isolated from a variety of bodily fluids, including serum, and their miRNA content has been shown to reflect that of the parent breast cancer cell. This review will highlight the nomenclature and defining characteristics of exosomes, and current methods of isolation of serum-derived exosomes. Initial promising reports on the potential utility of exosomal miRNAs to be used as breast cancer biomarkers will also be addressed. PMID:27170104

  3. Prediagnostic serum levels of inflammatory biomarkers are correlated with future development of lung and esophageal cancer.

    Science.gov (United States)

    Keeley, Brieze R; Islami, Farhad; Pourshams, Akram; Poustchi, Hossein; Pak, Jamie S; Brennan, Paul; Khademi, Hooman; Genden, Eric M; Abnet, Christian C; Dawsey, Sanford M; Boffetta, Paolo; Malekzadeh, Reza; Sikora, Andrew G

    2014-09-01

    This study tests the hypothesis that prediagnostic serum levels of 20 cancer-associated inflammatory biomarkers correlate directly with future development of head and neck, esophageal, and lung cancers in a high-risk prospective cohort. This is a nested case-control pilot study of subjects enrolled in the Golestan Cohort Study, an ongoing epidemiologic project assessing cancer trends in Golestan, Iran. We measured a panel of 20 21 cytokines, chemokines, and inflammatory molecules using Luminex technology in serum samples collected 2 or more years before cancer diagnosis in 78 aerodigestive cancer cases and 81 controls. Data was analyzed using Wilcoxon rank sum test, odds ratios, receiver operating characteristic areas of discrimination, and multivariate analysis. Biomarkers were profoundly and globally elevated in future esophageal and lung cancer patients compared to controls. Odds ratios were significant for association between several biomarkers and future development of esophageal cancer, including interleukin-1Rα (IL-1Ra; 35.9), interferon α2 (IFN-a2; 34.0), fibroblast growth factor-2 (FGF-2; 17.4), and granulocyte/macrophage colony-stimulating factor (GM-CSF; 17.4). The same pattern was observed among future lung cancer cases for G-CSF (27.7), GM-CSF (13.3), and tumor necrosis factor-α (TNF-a; 8.6). By contrast, the majority of biomarkers studied showed no significant correlation with future head and neck cancer development. This study provides the first direct evidence that multiple inflammatory biomarkers are coordinately elevated in future lung and esophageal cancer patients 2 or more years before cancer diagnosis. PMID:25040886

  4. Serum Ferritin as a Prognostic Biomarker for Survival in Relapsed or Refractory Metastatic Colorectal Cancer

    Science.gov (United States)

    Lee, Sookyung; Song, Anna; Eo, Wankyu

    2016-01-01

    Background: This study investigated the prognostic impact of serum ferritin for survival in patients with relapsed or refractory metastatic colorectal cancer (mCRC). Methods: This retrospective cohort study reviewed clinicopathological characteristics and laboratory biomarkers in 120 mCRC patients being treated with Korean Medicine (KM). The overall survival (OS) of patients was calculated using the Kaplan-Meier method, and statistical significance was assessed using the log-rank test. Univariate and multivariate analyses of Cox proportional hazards regression were used to evaluate the prognostic impact for survival in relapsed or refractory mCRC patients. Results: Of the patients, 62.5% had liver metastases, 74.1% underwent greater than second-line chemotherapy, and 80.8% underwent surgery. Median OS was 7.6 months for all patients after the initiation of KM treatment, which was begun 13.7 months, on average, after mCRC diagnosis. Concerning prognostic factors such as the presence of liver metastasis (p = 0.024), high carcinoembryonic antigen level (CEA > 5 ng/mL, p = 0.044), elevated C-reactive protein (CRP ≥ 10.0 mg/L, p = 0.000), high absolute monocyte count (AMC > 413.3 cells/μL, p = 0.034), elevated serum ferritin (ferritin ≥ 150 ng/mL, p = 0.002), low hemoglobin level (Hb 5 ng/mL; HR 2.040, 95% CI 1.203 - 3.460, p = 0.008), and serum ferritin (ferritin ≥ 150 ng/mL; HR 1.763, 95% CI 1.169 - 2.660, p = 0.007) were independent prognostic biomarkers of survival in mCRC patients. Conclusions: These results indicate that serum ferritin acts as an independent prognostic biomarker for survival in relapsed or refractory mCRC patients.

  5. Molecular biomarkers of colorectal cancer: prognostic and predictive tools for clinical practice

    Institute of Scientific and Technical Information of China (English)

    Wei-qin JIANG; Fang-fang FU; Yang-xia LI; Wei-bin WANG; Hao-hao WANG; Hai-ping JIANG; Li-song TENG

    2012-01-01

    Colorectal cancer remains one of the most common types of cancer and leading causes of cancer death worldwide.Although we have made steady progress in chemotherapy and targeted therapy,evidence suggests that the majority of patients undergoing drug therapy experience severe,debilitating,and even lethal adverse drug events which considerably outweigh the benefits.The identification of suitable biomarkers will allow clinicians to deliver the most appropriate drugs to specific patients and spare them ineffective and expensive treatments.Prognostic and predictive biomarkers have been the subjects of many published papers,but few have been widely incorporated into clinical practice.Here,we want to review recent biomarker data related to colorectal cancer,which may have been ready for clinical use.

  6. MicroRNA functional network in pancreatic cancer: From biology to biomarkers of disease

    Indian Academy of Sciences (India)

    Jin Wang; Subrata Sen

    2011-08-01

    MicroRNAs (miRs), the 17- to 25-nucleotide-long non-coding RNAs, regulate expression of approximately 30% of the protein-coding genes at the post-transcriptional level and have emerged as critical components of the complex functional pathway networks controlling important cellular processes, such as proliferation, development, differentiation, stress response' and apoptosis. Abnormal expression levels of miRs, regulating critical cancerassociated pathways, have been implicated to play important roles in the oncogenic processes, functioning both as oncogenes and as tumour suppressor genes. Elucidation of the genetic networks regulated by the abnormally expressing miRs in cancer cells is proving to be extremely significant in understanding the role of these miRs in the induction of malignant-transformation-associated phenotypic changes. As a result, the miRs involved in the oncogenic transformation process are being investigated as novel biomarkers of disease detection and prognosis as well as potential therapeutic targets for human cancers. In this \\article, we review the existing literature in the field documenting the significance of aberrantly expressed miRs in human pancreatic cancer and discuss how the oncogenic miRs may be involved in the genetic networks regulating functional pathways deregulated in this malignancy.

  7. MRM screening/biomarker discovery with linear ion trap MS: a library of human cancer-specific peptides

    Directory of Open Access Journals (Sweden)

    Lazar Iulia M

    2009-03-01

    Full Text Available Abstract Background The discovery of novel protein biomarkers is essential in the clinical setting to enable early disease diagnosis and increase survivability rates. To facilitate differential expression analysis and biomarker discovery, a variety of tandem mass spectrometry (MS/MS-based protein profiling techniques have been developed. For achieving sensitive detection and accurate quantitation, targeted MS screening approaches, such as multiple reaction monitoring (MRM, have been implemented. Methods MCF-7 breast cancer protein cellular extracts were analyzed by 2D-strong cation exchange (SCX/reversed phase liquid chromatography (RPLC separations interfaced to linear ion trap MS detection. MS data were interpreted with the Sequest-based Bioworks software (Thermo Electron. In-house developed Perl-scripts were used to calculate the spectral counts and the representative fragment ions for each peptide. Results In this work, we report on the generation of a library of 9,677 peptides (p a, b, y ions in the spectrum, the retention time, and the top 10 most intense product ions that correspond to a given peptide. Only proteins identified by at least two spectral counts are listed. The experimental distribution of protein frequencies, as a function of molecular weight, closely matched the theoretical distribution of proteins in the human proteome, as provided in the SwissProt database. The amino acid sequence coverage of the identified proteins ranged from 0.04% to 98.3%. The highest-abundance proteins in the cellular extract had a molecular weight (MW Conclusion Preliminary experiments have demonstrated that putative biomarkers, that are not detectable by conventional data dependent MS acquisition methods in complex un-fractionated samples, can be reliable identified with the information provided in this library. Based on the spectral count, the quality of a tandem mass spectrum and the m/z values for a parent peptide and its most abundant daughter

  8. Impacts of Exercise on Prognostic Biomarkers in Lung Cancer Patients

    Science.gov (United States)

    2016-02-18

    Extensive Stage Small Cell Lung Cancer; Healthy, no Evidence of Disease; Limited Stage Small Cell Lung Cancer; Recurrent Non-small Cell Lung Cancer; Recurrent Small Cell Lung Cancer; Stage IA Non-small Cell Lung Cancer; Stage IB Non-small Cell Lung Cancer; Stage IIA Non-small Cell Lung Cancer; Stage IIB Non-small Cell Lung Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Non-small Cell Lung Cancer

  9. Novel non-invasive biomarkers that distinguish between benign prostate hyperplasia and prostate cancer

    International Nuclear Information System (INIS)

    The objective of this study was to discover and to validate novel noninvasive biomarkers that distinguish between benign prostate hyperplasia (BPH) and localized prostate cancer (PCa), thereby helping to solve the diagnostic dilemma confronting clinicians who treat these patients. Quantitative iTRAQ LC/LC/MS/MS analysis was used to identify proteins that are differentially expressed in the urine of men with BPH compared with those who have localized PCa. These proteins were validated in 173 urine samples from patients diagnosed with BPH (N = 83) and PCa (N = 90). Multivariate logistic regression analysis was used to identify the predictive biomarkers. Three proteins, β2M, PGA3, and MUC3 were identified by iTRAQ and validated by immunoblot analyses. Univariate analysis demonstrated significant elevations in urinary β2M (P < 0.001), PGA3 (P = 0.006), and MUC3 (P = 0.018) levels found in the urine of PCa patients. Multivariate logistic regression analysis revealed AUC values ranging from 0.618 for MUC3 (P = 0.009), 0.625 for PGA3 (P < 0.008), and 0.668 for β2M (P < 0.001). The combination of all three demonstrated an AUC of 0.710 (95% CI: 0.631 – 0.788, P < 0.001); diagnostic accuracy improved even more when these data were combined with PSA categories (AUC = 0.812, (95% CI: 0.740 – 0.885, P < 0.001). Urinary β2M, PGA3, and MUC3, when analyzed alone or when multiplexed with clinically defined categories of PSA, may be clinically useful in noninvasively resolving the dilemma of effectively discriminating between BPH and localized PCa. The online version of this article (doi:10.1186/s12885-015-1284-z) contains supplementary material, which is available to authorized users

  10. Detection of cervical cancer biomarker patterns in blood plasma and urine by differential scanning calorimetry and mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Nichola C Garbett

    Full Text Available Improved methods for the accurate identification of both the presence and severity of cervical intraepithelial neoplasia (CIN and extent of spread of invasive carcinomas of the cervix (IC are needed. Differential scanning calorimetry (DSC has recently been shown to detect specific changes in the thermal behavior of blood plasma proteins in several diseases. This methodology is being explored to provide a complementary approach for screening of cervical disease. The present study evaluated the utility of DSC in differentiating between healthy controls, increasing severity of CIN and early and advanced IC. Significant discrimination was apparent relative to the extent of disease with no clear effect of demographic factors such as age, ethnicity, smoking status and parity. Of most clinical relevance, there was strong differentiation of CIN from healthy controls and IC, and amongst patients with IC between FIGO Stage I and advanced cancer. The observed disease-specific changes in DSC profiles (thermograms were hypothesized to reflect differential expression of disease biomarkers that subsequently bound to and affected the thermal behavior of the most abundant plasma proteins. The effect of interacting biomarkers can be inferred from the modulation of thermograms but cannot be directly identified by DSC. To investigate the nature of the proposed interactions, mass spectrometry (MS analyses were employed. Quantitative assessment of the low molecular weight protein fragments of plasma and urine samples revealed a small list of peptides whose abundance was correlated with the extent of cervical disease, with the most striking plasma peptidome data supporting the interactome theory of peptide portioning to abundant plasma proteins. The combined DSC and MS approach in this study was successful in identifying unique biomarker signatures for cervical cancer and demonstrated the utility of DSC plasma profiles as a complementary diagnostic tool to evaluate

  11. Protein breakdown in cancer cachexia.

    Science.gov (United States)

    Sandri, Marco

    2016-06-01

    Skeletal muscle is a highly adaptive tissue, capable of altering muscle fiber size, functional capacity and metabolism in response to physiological stimuli. However, pathological conditions such as cancer growth compromise the mechanisms that regulate muscle homeostasis, resulting in loss of muscle mass, functional impairment and compromised metabolism. This tumor-induced condition is characterized by enhanced muscle protein breakdown and amino acids release that sustain liver gluconeogenesis and tissue protein synthesis. Proteolysis is controlled by the two most important cellular degradation systems, the ubiquitin proteasome and autophagy lysosome. These systems are carefully regulated by different signalling pathways that determine protein and organelle turnover. In this review we will describe the involvement of the ubiquitin proteasome and autophagy lysosome systems in cancer cachexia and the principal signalling pathways that regulate tumor-induced protein breakdown in muscle. PMID:26564688

  12. Rapid point-of-care breath test for biomarkers of breast cancer and abnormal mammograms.

    Directory of Open Access Journals (Sweden)

    Michael Phillips

    Full Text Available BACKGROUND: Previous studies have reported volatile organic compounds (VOCs in breath as biomarkers of breast cancer and abnormal mammograms, apparently resulting from increased oxidative stress and cytochrome p450 induction. We evaluated a six-minute point-of-care breath test for VOC biomarkers in women screened for breast cancer at centers in the USA and the Netherlands. METHODS: 244 women had a screening mammogram (93/37 normal/abnormal or a breast biopsy (cancer/no cancer 35/79. A mobile point-of-care system collected and concentrated breath and air VOCs for analysis with gas chromatography and surface acoustic wave detection. Chromatograms were segmented into a time series of alveolar gradients (breath minus room air. Segmental alveolar gradients were ranked as candidate biomarkers by C-statistic value (area under curve [AUC] of receiver operating characteristic [ROC] curve. Multivariate predictive algorithms were constructed employing significant biomarkers identified with multiple Monte Carlo simulations and cross validated with a leave-one-out (LOO procedure. RESULTS: Performance of breath biomarker algorithms was determined in three groups: breast cancer on biopsy versus normal screening mammograms (81.8% sensitivity, 70.0% specificity, accuracy 79% (73% on LOO [C-statistic value], negative predictive value 99.9%; normal versus abnormal screening mammograms (86.5% sensitivity, 66.7% specificity, accuracy 83%, 62% on LOO; and cancer versus no cancer on breast biopsy (75.8% sensitivity, 74.0% specificity, accuracy 78%, 67% on LOO. CONCLUSIONS: A pilot study of a six-minute point-of-care breath test for volatile biomarkers accurately identified women with breast cancer and with abnormal mammograms. Breath testing could potentially reduce the number of needless mammograms without loss of diagnostic sensitivity.

  13. Biomarkers for Pancreatic Cancer: Is it Ready for Primetime?

    OpenAIRE

    Muhammad Wasif Saif; Minsig Choi; Richard Kim; Amit Mahipal

    2013-01-01

    Pancreatic cancer remains a lethal disease with brief survival especially in patients with advanced disease. Within this decade pancreatic cancer will become the second leading cause of cancer death in the Unites States after lung cancer. It is estimated that 45,220 people will be diagnosed with pancreatic cancer and about 38,460 people will die of pancreatic cancer [1].

  14. Personalized Medicine and Oncology Practice Guidelines: A Case Study of Contemporary Biomarkers in Colorectal Cancer

    OpenAIRE

    Kelley, Robin K; Van Bebber, Stephanie L; Phillips, Kathryn A; Venook, Alan P.

    2011-01-01

    Predictive and prognostic biomarkers offer a potential means to personalize cancer medicine, although many reach the marketplace before they have been validated, and their adoption is often hindered by variable clinical evidence. Because of this variability in supporting evidence, clinical practice guidelines formulated by panels of subspecialty experts may be particularly important in guiding stakeholders’ acceptance and use of new personalized medicine biomarker tests and other nascent tech...

  15. The use of yolk protein as biomarkers for endocrine disruption in molluscs

    DEFF Research Database (Denmark)

    Holbech, Henrik; Kinnberg, Karin Lund; Bjerregaard, Poul;

    of standardized tests in molluscs is that no specific biomarkers or endpoints for endocrine effects have been validated. Some attempts have been made to transfer biomarkers developed for vertebrates – e.g. from fish to molluscs to investigate ED effects. One example is the vertebrate yolk protein...... vitellogenin that is known to be oestrogen dependent in fish. The yolk proteins in molluscs have been proposed to have the same oestrogenic dependence and used as biomarker for oestrogenic EDs. The present work investigates the possible usability of the main yolk protein in three species of molluscs to...... quantify the concentration of the yolk protein in juveniles and adult male and female U. pictorum and U. tumidus and in the hermaphroditic L. stagnalis. With use of immune-histology, the distribution of the proteins in the tissue of the three species was investigated. The ELISAs revealed that the normal...

  16. REG4 Is Highly Expressed in Mucinous Ovarian Cancer: A Potential Novel Serum Biomarker.

    Science.gov (United States)

    Lehtinen, Laura; Vesterkvist, Pia; Roering, Pia; Korpela, Taina; Hattara, Liisa; Kaipio, Katja; Mpindi, John-Patrick; Hynninen, Johanna; Auranen, Annika; Davidson, Ben; Haglund, Caj; Iljin, Kristiina; Grenman, Seija; Siitari, Harri; Carpen, Olli

    2016-01-01

    Preoperative diagnostics of ovarian neoplasms rely on ultrasound imaging and the serum biomarkers CA125 and HE4. However, these markers may be elevated in non-neoplastic conditions and may fail to identify most non-serous epithelial cancer subtypes. The objective of this study was to identify histotype-specific serum biomarkers for mucinous ovarian cancer. The candidate genes with mucinous histotype specific expression profile were identified from publicly available gene-expression databases and further in silico data mining was performed utilizing the MediSapiens database. Candidate biomarker validation was done using qRT-PCR, western blotting and immunohistochemical staining of tumor tissue microarrays. The expression level of the candidate gene in serum was compared to the serum CA125 and HE4 levels in a patient cohort of prospectively collected advanced ovarian cancer. Database searches identified REG4 as a potential biomarker with specificity for the mucinous ovarian cancer subtype. The specific expression within epithelial ovarian tumors was further confirmed by mRNA analysis. Immunohistochemical staining of ovarian tumor tissue arrays showed distinctive cytoplasmic expression pattern only in mucinous carcinomas and suggested differential expression between benign and malignant mucinous neoplasms. Finally, an ELISA based serum biomarker assay demonstrated increased expression only in patients with mucinous ovarian cancer. This study identifies REG4 as a potential serum biomarker for histotype-specific detection of mucinous ovarian cancer and suggests serum REG4 measurement as a non-invasive diagnostic tool for postoperative follow-up of patients with mucinous ovarian cancer. PMID:26981633

  17. Evolving Role of Bone Biomarkers in Castration-Resistant Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Janet E. Brown

    2010-09-01

    Full Text Available The preferential metastasis of prostate cancer cells to bone disrupts the process of bone remodeling and results in lesions that cause significant pain and patient morbidity. Although prostate-specific antigen (PSA is an established biomarker in prostate cancer, it provides only limited information relating to bone metastases and the treatment of metastatic bone disease with bisphosphonates or novel noncytotoxic targeted or biological agents that may provide clinical benefits without affecting PSA levels. As bone metastases develop, factors derived from bone metabolism are released into blood and urine, including N- and C-terminal peptide fragments of type 1 collagen and bone-specific alkaline phosphatase, which represent potentially useful biomarkers for monitoring metastatic bone disease. A number of clinical trials have investigated these bone biomarkers with respect to their diagnostic, prognostic, and predictive values. Results suggest that higher levels of bone biomarkers are associated with an increased risk of skeletal-related events and/or death. As a result of these findings, bone biomarkers are now being increasingly used as study end points, particularly in studies investigating novel agents with putative bone effects. Data from prospective clinical trials are needed to validate the use of bone biomarkers and to confirm that marker levels provide additional information beyond traditional methods of response evaluation for patients with metastatic prostate cancer.

  18. Clinical application of biomarkers in colon cancer: studies on apoptosis, proliferation and the immune system

    OpenAIRE

    Zeestraten, Eliane Cornelia Maria

    2014-01-01

    Colon cancer is a major contributor to can- cer-related mortality worldwide. Death from colon cancer occurs in the majority of cases from widespread metastatic disease. Only 15% of stage II colon cancer patients that develop metastasis will benefit from adjuvant chemotherapy, all of them will suffer from treatment-related toxicity. This makes it essential for the clinician to precisely identify the patient cohort at risk for metastasis. Prognostic biomarkers might improve current staging crit...

  19. MicroRNAs: Promising chemoresistance biomarkers in gastric cancer with diagnostic and therapeutic potential

    OpenAIRE

    Matuszcak, Christiane; Haier, Joerg; Hummel, Richard; Lindner, Kirsten

    2014-01-01

    Gastric cancer (GC) is the fourth most common cancer worldwide and ranks second in global cancer mortality statistics. Perioperative chemotherapy plays an important role in the management and treatment of advanced stage disease. However, response to chemotherapy varies widely, with some patients presenting no or only minor response to treatment. Hence, chemotherapy resistance is a major clinical problem that impacts on outcome. Unfortunately, to date there are no reliable biomarkers available...

  20. Prediagnostic serum levels of inflammatory biomarkers are correlated with future development of lung and esophageal cancer

    OpenAIRE

    Keeley, Brieze R; Islami, Farhad; Pourshams, Akram; Poustchi, Hossein; Pak, Jamie S; Brennan, Paul; Khademi, Hooman; Genden, Eric M.; Abnet, Christian C.; Dawsey, Sanford M.; Boffetta, Paolo; Malekzadeh, Reza; Sikora, Andrew G.

    2014-01-01

    This study tests the hypothesis that prediagnostic serum levels of 20 cancer-associated inflammatory biomarkers correlate directly with future development of head and neck, esophageal, and lung cancers in a high-risk prospective cohort. This is a nested case–control pilot study of subjects enrolled in the Golestan Cohort Study, an ongoing epidemiologic project assessing cancer trends in Golestan, Iran. We measured a panel of 20 21cytokines, chemokines, and inflammatory molecules using Luminex...

  1. RNA-Seq Accurately Identifies Cancer Biomarker Signatures to Distinguish Tissue of Origin1

    OpenAIRE

    Wei, Iris H.; Shi, Yang; Jiang, Hui; Kumar-Sinha, Chandan; Arul M Chinnaiyan

    2014-01-01

    Metastatic cancer of unknown primary (CUP) accounts for up to 5% of all new cancer cases, with a 5-year survival rate of only 10%. Accurate identification of tissue of origin would allow for directed, personalized therapies to improve clinical outcomes. Our objective was to use transcriptome sequencing (RNA-Seq) to identify lineage-specific biomarker signatures for the cancer types that most commonly metastasize as CUP (colorectum, kidney, liver, lung, ovary, pancreas, prostate, and stomach)....

  2. Vascular endothelial growth factor in the circulation in cancer patients may not be a relevant biomarker

    OpenAIRE

    Tatjana M H Niers; Richel, Dick J.; Meijers, Joost C.M.; Schlingemann, Reinier O.

    2011-01-01

    BACKGROUND: Levels of circulating vascular endothelial growth factor (VEGF) have widely been used as biomarker for angiogenic activity in cancer. For this purpose, non-standardized measurements in plasma and serum were used, without correction for artificial VEGF release by platelets activated ex vivo. We hypothesize that "true" circulating (c)VEGF levels in most cancer patients are low and unrelated to cancer load or tumour angiogenesis. METHODOLOGY: We determined VEGF levels in PECT, a medi...

  3. Discovery and identification of Serum Amyloid A protein elevated in lung cancer serum

    Institute of Scientific and Technical Information of China (English)

    DAI SongWei; WANG XiaoMin; LIU LiYun; LIU JiFu; WU ShanShan; HUANG LingYun; XIAO XueYuan; HE DaCheng

    2007-01-01

    Two hundred and eighteen serum samples from 175 lung cancer patients and 43 healthy individuals were analyzed by using Surface Enhaced Laser Desorption/lonization Time of Flight Mass Spectrometry (SELDI-TOF-MS). The data analyzed by both Biomarker WizardTM and Biomarker PatternsTM software showed that a protein peak with the molecular weight of 11.6 kDa significantly increased in lung cancer.Meanwhile, the level of this biomarker was progressively increased with the clinical stages of lung cancer. The candidate biomarker was then obtained from tricine one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis by matching the molecular weight with peaks on WCX2 chips and was identified as Serum Amyloid A protein (SAA) by MALDI/MS-MS and database searching. It was further validated in the same serum samples by immunoprecipitation with commercial SAA antibody.To confirm the SAA differential expression in lung cancer patients, the same set of serum samples was measured by ELISA assay. The result showed that at the cutoff point 0.446 (OD value) on the Receiver Operating Characteristic (ROC) curve, SAA could better discriminate lung cancer from healthy individuals with sensitivity of 84.1% and specificity of 80%. These findings demonstrated that SAA could be characterized as a biomarker related to pathological stages of lung cancer.

  4. [Proteins in cancer multidrug resistance].

    Science.gov (United States)

    Popęda, Marta; Płuciennik, Elżbieta; Bednarek, Andrzej K

    2014-01-01

    Multidrug Resistance (MDR) is defined as insensitivity to administered medicines that are structurally unrelated and have different molecular targets. Cancers possess numerous mechanisms of drug resistance, involving various aspects of cell biology. A pivotal role in this phenomenon is played by proteins--enzymatic or structural parts of the cell. Membrane transporters, including the main members of ABC protein family--P-gp, MRP1 and BCRP, as well as LRP, which builds structure of vaults, determine the multidrug-resistant phenotype by decreasing drug concentration within the cell or modifying its distribution to intracellular compartments. The π isoform of protein enzyme--glutathione S-transferase (GSTP-1), is responsible for excessive intensity of detoxification of cytostatics. A common example of altered drug target site that does not respond to chemotherapy is topoisomerase II α (TopoIIa). Alterations of programmed cell death result from expression of metallothionein (MT)--inhibitor of the process, and cytokeratin 18 (CK18), which, if in high concentration, also prevents apoptosis of cells. Several methods of decreasing activity of these proteins have been developed, aiming to overcome MDR in cancer cells. However, for a variety of reasons, their clinical suitability is still very low, leading to continuous increase in death rate among patients. This paper presents current state of knowledge on the most important examples of proteins responsible for MDR of cancer cells and molecular mechanisms of their action. PMID:24864112

  5. Cell-free microRNAs in blood and other body fluids, as cancer biomarkers.

    Science.gov (United States)

    Ortiz-Quintero, Blanca

    2016-06-01

    The discovery of cell-free microRNAs (miRNAs) in serum, plasma and other body fluids has yielded an invaluable potential source of non-invasive biomarkers for cancer and other non-malignant diseases. miRNAs in the blood and other body fluids are highly stable in biological samples and are resistant to environmental conditions, such as freezing, thawing or enzymatic degradation, which makes them convenient as potential biomarkers. In addition, they are more easily sampled than tissue miRNAs. Altered levels of cell-free miRNAs have been found in every type of cancer analysed, and increasing evidence indicates that they may participate in carcinogenesis by acting as cell-to-cell signalling molecules. This review summarizes the biological characteristics and mechanisms of release of cell-free miRNAs that make them promising candidates as non-invasive biomarkers of cancer. PMID:27218664

  6. Ultrasensitive Detection of Dual Cancer Biomarkers with Integrated CMOS-Compatible Nanowire Arrays.

    Science.gov (United States)

    Lu, Na; Gao, Anran; Dai, Pengfei; Mao, Hongju; Zuo, Xiaolei; Fan, Chunhai; Wang, Yuelin; Li, Tie

    2015-11-17

    A direct, rapid, highly sensitive and specific biosensor for detection of cancer biomarkers is desirable in early diagnosis and prognosis of cancer. However, the existing methods of detecting cancer biomarkers suffer from poor sensitivity as well as the requirement of enzymatic labeling or nanoparticle conjugations. Here, we proposed a two-channel PDMS microfluidic integrated CMOS-compatible silicon nanowire (SiNW) field-effect transistor arrays with potentially single use for label-free and ultrasensitive electrical detection of cancer biomarkers. The integrated nanowire arrays showed not only ultrahigh sensitivity of cytokeratin 19 fragment (CYFRA21-1) and prostate specific antigen (PSA) with detection to at least 1 fg/mL in buffer solution but also highly selectivity of discrimination from other similar cancer biomarkers. In addition, this method was used to detect both CYFRA21-1 and PSA real samples as low as 10 fg/mL in undiluted human serums. With its excellent properties and miniaturization, the integrated SiNW-FET device opens up great opportunities for a point-of-care test (POCT) for quick screening and early diagnosis of cancer and other complex diseases. PMID:26473941

  7. New trends in molecular and cellular biomarker discovery for colorectal cancer

    Science.gov (United States)

    Aghagolzadeh, Parisa; Radpour, Ramin

    2016-01-01

    Colorectal cancer (CRC) is the third leading cause of cancer death worldwide, which is consequence of multistep tumorigenesis of several genetic and epigenetic events. Since CRC is mostly asymptomatic until it progresses to advanced stages, the early detection using effective screening approaches, selection of appropriate therapeutic strategies and efficient follow-up programs are essential to reduce CRC mortalities. Biomarker discovery for CRC based on the personalized genotype and clinical information could facilitate the classification of patients with certain types and stages of cancer to tailor preventive and therapeutic approaches. These cancer-related biomarkers should be highly sensitive and specific in a wide range of specimen(s) (including tumor tissues, patients’ fluids or stool). Reliable biomarkers which enable the early detection of CRC, can improve early diagnosis, prognosis, treatment response prediction, and recurrence risk. Advances in our understanding of the natural history of CRC have led to the development of different CRC associated molecular and cellular biomarkers. This review highlights the new trends and approaches in CRC biomarker discovery, which could be potentially used for early diagnosis, development of new therapeutic approaches and follow-up of patients. PMID:27433083

  8. Bead-based microarray immunoassay for lung cancer biomarkers using quantum dots as labels.

    Science.gov (United States)

    Liu, Lifen; Wu, Simin; Jing, Fengxiang; Zhou, Hongbo; Jia, Chunping; Li, Gang; Cong, Hui; Jin, Qinghui; Zhao, Jianlong

    2016-06-15

    In this study, we developed a multiplex immunoassay system that combines the suspension and planar microarray formats within a single layer of polydimethylsiloxane (PDMS) using soft lithography technology. The suspension format was based on the target proteins forming a sandwich structure between the magnetic beads and the quantum dot (QD) probes through specific antibody-antigen interactions. The planar microarray format was produced by fabricating an array of micro-wells in PDMS. Each micro-well was designed to trap a single microbead and eventually generated a microbead array within the PDMS chamber. The resultant bead-based on-chip assay could be used for simultaneously detecting three lung cancer biomarkers-carcinoembryonic antigen (CEA), fragments of cytokeratin 19 (CYFRA21-1) and neuron-specific enolase (NSE)-in 10 μl of human serum, with a wide linear dynamic range (1.03-111 ng/mL for CEA and CYFRA21-1; 9.26-1000 ng/ml for NSE) and a low detection limit (CEA: 0.19 ng/ml; CYFRA21-1: 0.97 ng/ml; NSE: 0.37 ng/ml; S/N=3). Our micro-well chip does not require complex e-beam lithography or the reactive ion etching process as with existing micro-well systems, which rely on expensive focused ion beam (FIB) milling or optical fiber bundles. Furthermore, the current approach is easy to operate without extra driving equipment such as pumps, and can make parallel detection for multiplexing with rapid binding kinetics, small reagent consumption and low cost. This work has demonstrated the importance of the successful application of on-chip multiplexing sandwich assays for the detection of biomarker proteins. PMID:26852198

  9. Receptor-type protein tyrosine phosphatases in cancer

    Directory of Open Access Journals (Sweden)

    Yu Du

    2015-02-01

    Full Text Available Protein tyrosine phosphatases (PTPs play an important role in regulating cell signaling events in coordination with tyrosine kinases to control cell proliferation, apoptosis, survival, migration, and invasion. Receptor-type protein tyrosine phosphatases (PTPRs are a subgroup of PTPs that share a transmembrane domain with resulting similarities in function and target specificity. In this review, we summarize genetic and epigenetic alterations including mutation, deletion, amplification, and promoter methylation of PTPRs in cancer and consider the consequences of PTPR alterations in different types of cancers. We also summarize recent developments using PTPRs as prognostic or predictive biomarkers and/or direct targets. Increased understanding of the role of PTPRs in cancer may provide opportunities to improve therapeutic approaches.

  10. S-100AND#946; protein as a biomarker in acute hemorrhagic stroke

    OpenAIRE

    Omkar Prasad Baidya; Susmita Chaudhuri; Ksh Gomti Devi

    2014-01-01

    Acute hemorrhagic stroke, a subtype of acute stroke is one of the leading causes of death and disability throughout the world. At present, the diagnosis of acute hemorrhagic stroke is mainly based on Computer Tomography (CT) or Magnetic Resonance Imaging (MRI) but till now no biomarkers are routinely used in acute hemorrhagic stroke management. This article is a critical and descriptive review on the role of S100β protein as a biomarker in acute hemorrhagic stroke. Plasma S-100β lev...

  11. Banking of biological fluids for studies of disease-associated protein biomarkers

    DEFF Research Database (Denmark)

    Rasmussen, Anne-Sofie Schrohl; Würtz, Sidse Ørnbjerg; Kohn, Elise;

    2008-01-01

    biological fluids, especially serum and plasma, intended for study of protein biomarkers. In biomarker studies the process from the decision to take a sample from an individual to the moment the sample is safely placed in the biobank consists of several phases including collection of samples, transport of...... biobank as well as conclusions and clinical recommendations based on analysis of such material may be severely affected....

  12. Peptide and protein biomarkers for type 1 diabetes mellitus

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Qibin; Metz, Thomas O.

    2014-06-10

    A method for identifying persons with increased risk of developing type 1 diabetes mellitus, or having type I diabetes mellitus, utilizing selected biomarkers described herein either alone or in combination. The present disclosure allows for broad based, reliable, screening of large population bases. Also provided are arrays and kits that can be used to perform such methods.

  13. Peptide and protein biomarkers for type 1 diabetes mellitus

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Qibin; Metz, Thomas O.

    2016-08-30

    A method for identifying persons with increased risk of developing type 1 diabetes mellitus, or having type I diabetes mellitus, utilizing selected biomarkers described herein either alone or in combination. The present disclosure allows for broad based, reliable, screening of large population bases. Also provided are arrays and kits that can be used to perform such methods.

  14. Large-scale proteomic identification of S100 proteins in breast cancer tissues

    OpenAIRE

    Cancemi, Patrizia; Di Cara, Gianluca; Albanese, Nadia Ninfa; Costantini, Francesca; Marabeti, Maria Rita; Musso, Rosa; Lupo, Carmelo; Roz, Elena; Pucci-Minafra, Ida

    2010-01-01

    Background Attempts to reduce morbidity and mortality in breast cancer is based on efforts to identify novel biomarkers to support prognosis and therapeutic choices. The present study has focussed on S100 proteins as a potentially promising group of markers in cancer development and progression. One reason of interest in this family of proteins is because the majority of the S100 genes are clustered on a region of human chromosome 1q21 that is prone to genomic rearrangements. Moreover, there ...

  15. Large-scale proteomic identification of S100 proteins in breast cancer tissues

    OpenAIRE

    Cancemi Patrizia; Di Cara Gianluca; Albanese Nadia; Costantini Francesca; Marabeti Maria; Musso Rosa; Lupo Carmelo; Roz Elena; Pucci-Minafra Ida

    2010-01-01

    Abstract Background Attempts to reduce morbidity and mortality in breast cancer is based on efforts to identify novel biomarkers to support prognosis and therapeutic choices. The present study has focussed on S100 proteins as a potentially promising group of markers in cancer development and progression. One reason of interest in this family of proteins is because the majority of the S100 genes are clustered on a region of human chromosome 1q21 that is prone to genomic rearrangements. Moreove...

  16. Comparative proteomic analysis of differentially expressed proteins in human pancreatic cancer tissue

    Institute of Scientific and Technical Information of China (English)

    Jian-Hua Chen; Run-Zhou Ni; Ming-Bing Xiao; Ji-Guang Guo; Jia-Wei Zhou

    2009-01-01

    BACKGROUND:Pancreatic cancer is one of the most common malignant tumors. Early diagnosis of pancreatic cancer is dififcult because of the latent onset and lack of good biomarkers. This study aimed to look for and identify differentially expressed proteins in tissues of pancreatic cancer and adjacent noncancerous tissues by proteomic approaches so as to provide information about possible pancreatic cancer markers and therapeutic targets. METHODS:Proteins extracted from 3 paired adjacent noncancerous and cancerous pancreatic tissue specimens were separated by two-dimensional gel electrophoresis (2-DE). The protein spots exhibiting statistical alternations between the two groups through computerized image analysis were then identiifed by matrix-assisted laser desorption ionization time-of-lfight mass spectrometry (MALDI-TOF-MS). In addition, Western blotting and immunohistochemistry were performed to verify the expression of certain candidate proteins. RESULTS:Twelve proteins were signiifcantly upregulated and 4 were downregulated between cancerous and paired adjacent noncancerous pancreatic tissues. Several proteins (S100A11, Ig gamma-1 chain C region, GSTO1 and peroxiredoxin 4) were found for the ifrst time to be associated with pancreatic cancer. Differential expression of some identiifed proteins was further conifrmed by Western blotting analysis and/or immunohistochemical analysis.CONCLUSIONS:Comparative proteomic analysis using 2-DE and MALDI-TOF-MS is an effective method for identifying differentially expressed proteins that may be the potential diagnostic biomarkers and therapeutic targets for pancreatic cancer.

  17. New Concepts in Cancer Biomarkers: Circulating miRNAs in Liquid Biopsies.

    Science.gov (United States)

    Larrea, Erika; Sole, Carla; Manterola, Lorea; Goicoechea, Ibai; Armesto, María; Arestin, María; Caffarel, María M; Araujo, Angela M; Araiz, María; Fernandez-Mercado, Marta; Lawrie, Charles H

    2016-01-01

    The effective and efficient management of cancer patients relies upon early diagnosis and/or the monitoring of treatment, something that is often difficult to achieve using standard tissue biopsy techniques. Biological fluids such as blood hold great possibilities as a source of non-invasive cancer biomarkers that can act as surrogate markers to biopsy-based sampling. The non-invasive nature of these "liquid biopsies" ultimately means that cancer detection may be earlier and that the ability to monitor disease progression and/or treatment response represents a paradigm shift in the treatment of cancer patients. Below, we review one of the most promising classes of circulating cancer biomarkers: microRNAs (miRNAs). In particular, we will consider their history, the controversy surrounding their origin and biology, and, most importantly, the hurdles that remain to be overcome if they are really to become part of future clinical practice. PMID:27128908

  18. Cell stiffness is a biomarker of the metastatic potential of ovarian cancer cells

    Science.gov (United States)

    Xu, Wenwei; Mezencev, Roman; Kim, Byungkyu; Wang, Lijuan; McDonald, John; Sulchek, Todd; Sulchek Team; McDonald Team

    2013-03-01

    The metastatic potential of cells is an important parameter in the design of optimal strategies for the personalized treatment of cancer. Using atomic force microscopy (AFM), we show that ovarian cancer cells are generally softer and display lower intrinsic variability in cell stiffness than non-malignant ovarian epithelial cells. A detailed study of highly invasive ovarian cancer cells (HEY A8) and their less invasive parental cells (HEY), demonstrates that deformability can serve as an accurate biomarker of metastatic potential. Comparative gene expression profiling indicate that the reduced stiffness of highly metastatic HEY A8 cells is associated with actin cytoskeleton remodeling, microscopic examination of actin fiber structure in these cell lines is consistent with this prediction. Our results indicate that cell stiffness not only distinguishes ovarian cancer cells from non-malignant cells, but may also be a useful biomarker to evaluate the relative metastatic potential of ovarian and perhaps other types of cancer cells.

  19. Identification of an epigenetic biomarker panel with high sensitivity and specificity for colorectal cancer and adenomas

    Directory of Open Access Journals (Sweden)

    Lind Guro E

    2011-07-01

    Full Text Available Abstract Background The presence of cancer-specific DNA methylation patterns in epithelial colorectal cells in human feces provides the prospect of a simple, non-invasive screening test for colorectal cancer and its precursor, the adenoma. This study investigates a panel of epigenetic markers for the detection of colorectal cancer and adenomas. Methods Candidate biomarkers were subjected to quantitative methylation analysis in test sets of tissue samples from colorectal cancers, adenomas, and normal colonic mucosa. All findings were verified in independent clinical validation series. A total of 523 human samples were included in the study. Receiver operating characteristic (ROC curve analysis was used to evaluate the performance of the biomarker panel. Results Promoter hypermethylation of the genes CNRIP1, FBN1, INA, MAL, SNCA, and SPG20 was frequent in both colorectal cancers (65-94% and adenomas (35-91%, whereas normal mucosa samples were rarely (0-5% methylated. The combined sensitivity of at least two positives among the six markers was 94% for colorectal cancers and 93% for adenoma samples, with a specificity of 98%. The resulting areas under the ROC curve were 0.984 for cancers and 0.968 for adenomas versus normal mucosa. Conclusions The novel epigenetic marker panel shows very high sensitivity and specificity for both colorectal cancers and adenomas. Our findings suggest this biomarker panel to be highly suitable for early tumor detection.

  20. AKAP4 is a circulating biomarker for non-small cell lung cancer

    Science.gov (United States)

    Gumireddy, Kiranmai; Li, Anping; Chang, David H.; Liu, Qin; Kossenkov, Andrew V.; Yan, Jinchun; Korst, Robert J.; Nam, Brian T.; Xu, Hua; Zhang, Lin; Ganepola, Ganepola A.P.; Showe, Louise C.; Huang, Qihong

    2015-01-01

    Cancer testis antigens (CTAs) are widely expressed in tumor tissues, circulating tumor cells (CTCs) and in cancer derived exosomes that are frequently engulfed by lymphoid cells. To determine whether tumor derived CTA mRNAs could be detected in RNA from purified peripheral blood mononuclear cells (PBMC) of non-small cell lung cancer (NSCLC) patients, we assayed for the expression of 116 CTAs in PBMC RNA in a discovery set and identified AKAP4 as a potential NSCLC biomarker. We validated AKAP4 as a highly accurate biomarker in a cohort of 264 NSCLCs and 135 controls from 2 different sites including a subset of controls with high risk lung nodules. When all (264) lung cancers were compared with all (135) controls the area under the ROC curve (AUC) was 0.9714. When 136 stage I NSCLC lung cancers are compared with all controls the AUC is 0.9795 and when all lung cancer patients were compared to 27 controls with histologically confirmed benign lung nodules, a comparison of significant clinical importance, the AUC was 0.9825. AKAP4 expression increases significantly with tumor stage, but independent of age, gender, smoking history or cancer subtype. Follow-up studies in a small number of resected NSCLC patients revealed a decrease of AKAP4 expression post-surgical resection that remained low in patients in remission and increased with tumor recurrence. AKAP4 is a highly accurate biomarker for the detection of early stage lung cancer. PMID:26160834

  1. Radiotherapy diagnostic biomarkers in radioresistant human H460 lung cancer stem-like cells.

    Science.gov (United States)

    Yun, Hong Shik; Baek, Jeong-Hwa; Yim, Ji-Hye; Um, Hong-Duck; Park, Jong Kuk; Song, Jie-Young; Park, In-Chul; Kim, Jae-Sung; Lee, Su-Jae; Lee, Chang-Woo; Hwang, Sang-Gu

    2016-02-01

    Tumor cell radioresistance is a major contributor to radiotherapy failure, highlighting the importance of identifying predictive biomarkers for radioresistance. In this work, we established a radioresistant H460 (RR-H460) cell line from parental radiosensitive H460 lung cancer cells by exposure to fractionated radiation. The radiation-resistant, anti-apoptotic phenotype of RR-H460 cell lines was confirmed by their enhanced clonogenic survival and increased expression of the radioresistance genes Hsp90 and Her-3. RR-H460 cells displayed characteristics of cancer stem-like cells (CSCs), including induction of the surface marker CD44 and stem cell markers Nanog, Oct4, and Sox2. RR-H460 cells also exhibited sphere formation and malignant behavior, further supporting a CSC phenotype. Using proteomic analyses, we identified 8 proteins that were up-regulated in RR-H460 CSC lines and therefore potentially involved in radioresistance and CSC-related biological processes. Notably, 4 of these-PAI-2, NOMO2, KLC4, and PLOD3-have not been previously linked to radioresistance. Depletion of these individual genes sensitized RR-H460 cells to radiotoxicity and additively enhancing radiation-induced apoptosis. Our findings suggest the possibility of integrating molecular targeted therapy with radiotherapy as a strategy for resolving the radioresistance of lung tumors. PMID:26901847

  2. MAP17 (PDZKIP1) as a novel prognostic biomarker for laryngeal cancer.

    Science.gov (United States)

    de Miguel-Luken, María-José; Chaves-Conde, Manuel; de Miguel-Luken, Verónica; Muñoz-Galván, Sandra; López-Guerra, José Luis; Mateos, Juan C; Pachón, Jerónimo; Chinchón, David; Suarez, Vladimir; Carnero, Amancio

    2015-05-20

    Larynx cancer organ preservation treatments with chemo and radiotherapy have substantially improved laryngoesophageal dysfunction-free survival. However, both of them lead to a high incidence of acute and chronic toxicities and a significant number of patients relapse. To date, there is no evidence available to establish the group of patients that may benefit from preservation approaches and clinical criteria such as primary tumor extension or pretreatment tracheotomy are not validated. MAP17 is a small non-glycosylated membrane protein overexpressed in carcinomas. The tumoral behavior induced by MAP17 is associated with reactive oxygen species production in which SGLT1 seems involved. In this study we found that the levels of MAP17 were related to clinical findings and survival in a cohort of 58 patients with larynx cancer. MAP17 expression is associated with overall survival (pSGLT (p=0.022) and the combination of high levels of MAP17/SGLT also led to an increased overall survival (p=0,028). These findings suggest that MAP17, alone or in combination with SGLT1, may become a novel predictive biomarker for laryngeal carcinoma. PMID:25788275

  3. Biomarkers to Distinguish Aggressive Cancers from Non-aggressive or Non-progressing Cancer — EDRN Public Portal

    Science.gov (United States)

    Distinguishing aggressive cancers from non-aggressive or non-progressing cancers is an issue of both clinical and public health importance particularly for those cancers with an available screening test. With respect to breast cancer, mammographic screening has been shown in randomized trials to reduce breast cancer mortality, but given the limitations of its sensitivity and specificity some breast cancers are missed by screening. These so called interval detected breast cancers diagnosed between regular screenings are known to have a more aggressive clinical profile. In addition, of those cancers detected by mammography some are indolent while others are more likely to recur despite treatment. The pilot study proposed herein is highly responsive to the EDRN supplement titled “Biomarkers to Distinguish Aggressive Cancers from Nonaggressive or Non-progressing Cancers” in that it addresses both of the research objectives related to these issues outlined in the notice for this supplement: Aim 1: To identify biomarkers in tumor tissue related to risk of interval detected vs. mammography screen detected breast cancer focusing on early stage invasive disease. We will compare gene expression profiles using the whole genome-cDNA-mediated Annealing, Selection, extension and Ligation (DASL) assay of 50 screen detected cancers to those of 50 interval detected cancers. Through this approach we will advance our understanding of the molecular characteristics of interval vs. screen detected breast cancers and discover novel biomarkers that distinguish between them. Aim 2: To identify biomarkers in tumor tissue related to risk of cancer recurrence among patients with screen detected early stage invasive breast cancer. Using the DASL assay we will compare gene expression profiles from screen detected early stage breast cancer that either recurred within five years or never recurred within five years. These two groups of patients will be matched on multiple factors including

  4. Calling Biomarkers in Milk Using a Protein Microarray on Your Smartphone.

    Science.gov (United States)

    Ludwig, Susann K J; Tokarski, Christian; Lang, Stefan N; van Ginkel, Leendert A; Zhu, Hongying; Ozcan, Aydogan; Nielen, Michel W F

    2015-01-01

    Here we present the concept of a protein microarray-based fluorescence immunoassay for multiple biomarker detection in milk extracts by an ordinary smartphone. A multiplex immunoassay was designed on a microarray chip, having built-in positive and negative quality controls. After the immunoassay procedure, the 48 microspots were labelled with Quantum Dots (QD) depending on the protein biomarker levels in the sample. QD-fluorescence was subsequently detected by the smartphone camera under UV light excitation from LEDs embedded in a simple 3D-printed opto-mechanical smartphone attachment. The somewhat aberrant images obtained under such conditions, were corrected by newly developed Android-based software on the same smartphone, and protein biomarker profiles were calculated. The indirect detection of recombinant bovine somatotropin (rbST) in milk extracts based on altered biomarker profile of anti-rbST antibodies was selected as a real-life challenge. RbST-treated and untreated cows clearly showed reproducible treatment-dependent biomarker profiles in milk, in excellent agreement with results from a flow cytometer reference method. In a pilot experiment, anti-rbST antibody detection was multiplexed with the detection of another rbST-dependent biomarker, insulin-like growth factor 1 (IGF-1). Milk extract IGF-1 levels were found to be increased after rbST treatment and correlated with the results obtained from the reference method. These data clearly demonstrate the potential of the portable protein microarray concept towards simultaneous detection of multiple biomarkers. We envisage broad application of this 'protein microarray on a smartphone'-concept for on-site testing, e.g., in food safety, environment and health monitoring. PMID:26308444

  5. Calling Biomarkers in Milk Using a Protein Microarray on Your Smartphone.

    Directory of Open Access Journals (Sweden)

    Susann K J Ludwig

    Full Text Available Here we present the concept of a protein microarray-based fluorescence immunoassay for multiple biomarker detection in milk extracts by an ordinary smartphone. A multiplex immunoassay was designed on a microarray chip, having built-in positive and negative quality controls. After the immunoassay procedure, the 48 microspots were labelled with Quantum Dots (QD depending on the protein biomarker levels in the sample. QD-fluorescence was subsequently detected by the smartphone camera under UV light excitation from LEDs embedded in a simple 3D-printed opto-mechanical smartphone attachment. The somewhat aberrant images obtained under such conditions, were corrected by newly developed Android-based software on the same smartphone, and protein biomarker profiles were calculated. The indirect detection of recombinant bovine somatotropin (rbST in milk extracts based on altered biomarker profile of anti-rbST antibodies was selected as a real-life challenge. RbST-treated and untreated cows clearly showed reproducible treatment-dependent biomarker profiles in milk, in excellent agreement with results from a flow cytometer reference method. In a pilot experiment, anti-rbST antibody detection was multiplexed with the detection of another rbST-dependent biomarker, insulin-like growth factor 1 (IGF-1. Milk extract IGF-1 levels were found to be increased after rbST treatment and correlated with the results obtained from the reference method. These data clearly demonstrate the potential of the portable protein microarray concept towards simultaneous detection of multiple biomarkers. We envisage broad application of this 'protein microarray on a smartphone'-concept for on-site testing, e.g., in food safety, environment and health monitoring.

  6. Molecularly imprinted plasmonic nanosensor for selective SERS detection of protein biomarkers.

    Science.gov (United States)

    Lv, Yongqin; Qin, Yating; Svec, Frantisek; Tan, Tianwei

    2016-06-15

    Molecularly imprinted plasmonic nanosensor has been prepared via the rational design of an ultrathin polymer layer on the surface of gold nanorods imprinted with the target protein. This nanosensor enabled selective fishing-out of the target protein biomarker even from a complex real sample such as human serum. Sensitive SERS detection of the protein biomarkers with a strong Raman enhancement was achieved by formation of protein imprinted gold nanorods aggregates, stacking of protein imprinted gold nanorods onto a glass plate, or self-assembly of protein imprinted gold nanorods into close-packed array. High specificity and sensitivity of this method were demonstrated with a detection limit of at least 10(-8)mol/L for the target protein. This could provide a promising alternative for the currently used immunoassays and fluorescence detection, and offer an ultrasensitive, non-destructive, and label-free technique for clinical diagnosis applications. PMID:26874111

  7. Periostin identified as a potential biomarker of prostate cancer by iTRAQ-proteomics analysis of prostate biopsy

    Directory of Open Access Journals (Sweden)

    Tong Shijun

    2011-04-01

    Full Text Available Abstract Background Proteomics may help us better understand the changes of multiple proteins involved in oncogenesis and progression of prostate cancer(PCa and identify more diagnostic and prognostic biomarkers. The aim of this study was to screen biomarkers of PCa by the proteomics analysis using isobaric tags for relative and absolute quantification(iTRAQ. Methods The patients undergoing prostate biopsies were classified into 3 groups according to pathological results: benign prostate hyperplasia (BPH, n = 20, PCa(n = 20 and BPH with local prostatic intraepithelial neoplasm(PIN, n = 10. Then, all the specimens from these patients were analyzed by iTRAQ and two-dimensional liquid chromatography-tandem mass spectrometry (2DLC-MS/MS. The Gene Ontology(GO function and the transcription regulation networks of the differentially expressed were analyzed by MetaCore software. Western blotting and Immunohistochemical staining were used to analyze the interesting proteins. Result A total of 760 proteins were identified from 13787 distinct peptides, including two common proteins that enjoy clinical application: prostate specific antigen (PSA and prostatic acid phosphatase(PAP. Proteins that expressed differentially between PCa and BPH group were further analyzed. Compared with BPH, 20 proteins were significantly differentially up-regulated (>1.5-fold while 26 were significantly down-regulated in PCa( Conclusion Our study indicates that the iTRAQ technology is a new strategy for global proteomics analysis of the tissues of PCa. A significant up-regulation of periostin in PCa compared to BPH may provide clues for not only a promising biomarker for the prognosis of PCa but also a potential target for therapeutical intervention.

  8. Blinded Validation of Breath Biomarkers of Lung Cancer, a Potential Ancillary to Chest CT Screening

    Science.gov (United States)

    Phillips, Michael; Bauer, Thomas L.; Cataneo, Renee N.; Lebauer, Cassie; Mundada, Mayur; Pass, Harvey I.; Ramakrishna, Naren; Rom, William N.; Vallières, Eric

    2015-01-01

    Background Breath volatile organic compounds (VOCs) have been reported as biomarkers of lung cancer, but it is not known if biomarkers identified in one group can identify disease in a separate independent cohort. Also, it is not known if combining breath biomarkers with chest CT has the potential to improve the sensitivity and specificity of lung cancer screening. Methods Model-building phase (unblinded): Breath VOCs were analyzed with gas chromatography mass spectrometry in 82 asymptomatic smokers having screening chest CT, 84 symptomatic high-risk subjects with a tissue diagnosis, 100 without a tissue diagnosis, and 35 healthy subjects. Multiple Monte Carlo simulations identified breath VOC mass ions with greater than random diagnostic accuracy for lung cancer, and these were combined in a multivariate predictive algorithm. Model-testing phase (blinded validation): We analyzed breath VOCs in an independent cohort of similar subjects (n = 70, 51, 75 and 19 respectively). The algorithm predicted discriminant function (DF) values in blinded replicate breath VOC samples analyzed independently at two laboratories (A and B). Outcome modeling: We modeled the expected effects of combining breath biomarkers with chest CT on the sensitivity and specificity of lung cancer screening. Results Unblinded model-building phase. The algorithm identified lung cancer with sensitivity 74.0%, specificity 70.7% and C-statistic 0.78. Blinded model-testing phase: The algorithm identified lung cancer at Laboratory A with sensitivity 68.0%, specificity 68.4%, C-statistic 0.71; and at Laboratory B with sensitivity 70.1%, specificity 68.0%, C-statistic 0.70, with linear correlation between replicates (r = 0.88). In a projected outcome model, breath biomarkers increased the sensitivity, specificity, and positive and negative predictive values of chest CT for lung cancer when the tests were combined in series or parallel. Conclusions Breath VOC mass ion biomarkers identified lung cancer in a

  9. Identification of Novel Biomarkers for Metastatic Colorectal Cancer Using Angiogenesis-Antibody Array and Intracellular Signaling Array.

    Directory of Open Access Journals (Sweden)

    Seyung Chung

    Full Text Available Colorectal cancer (CRC is one of the three leading causes for cancer mortality. CRC kills over 600,000 people annually worldwide. The most common cause of death from CRC is the metastasis to distant organs. However, biomarkers for CRC metastasis remain ill-defined. We compared primary and metastatic CRC cell lines for their angiogenesis-protein profiles and intracellular signaling profiles to identify novel biomarkers for CRC metastasis. To this end, we used primary and metastatic CRC cell lines as a model system and normal human colon cell line as a control. The angiogenesis profiles two isogenic CRC cell lines, SW480 and SW620, and HT-29 and T84 revealed that VEGF was upregulated in both SW620 and T84 whereas coagulation factor III, IGFBP-3, DPP IV, PDGF AA/AB, endothelin I and CXCL16 were downregulated specifically in metastatic cell lines. Furthermore, we found that TIMP-1, amphiregulin, endostatin, angiogenin were upregulated in SW620 whereas downregulated in T84. Angiogenin was downregulated in T84 and GM-CSF was also downregulated in SW620. To induce CRC cell metastasis, we treated cells with pro-inflammatory cytokine IL-6. Upon IL-6 treatment, epithelial-mesenchymal transition was induced in CRC cells. When DLD-1 and HT-29 cells were treated with IL-6; Akt, STAT3, AMPKα and Bad phosphorylation levels were increased. Interestingly, SW620 showed the same signal activation pattern with IL-6 treatment of HT-29 and DLD-1. Our data suggest that Akt, STAT3, AMPKα and Bad activation can be biomarkers for metastatic colorectal cancer. IL-6 treatment specifically reduced phosphorylation levels of EGFR, HER2 receptor, Insulin R and IGF-1R in receptor tyrosine kinase array study with HT-29. Taken together, we have identified novel biomarkers for metastatic CRC through the angiogenesis-antibody array and intracellular signaling array studies. Present study suggests that those novel biomarkers can be used as CRC prognosis biomarkers, and as

  10. Tissue Microarrays in Non-Small Cell Lung Cancer: Reliability of Immunohistochemically-Determined Biomarkers

    DEFF Research Database (Denmark)

    Pøhl, Mette; Olsen, Karen Ege; Holst, René;

    2014-01-01

    BACKGROUND: The reliability of immunohistochemically-determined biomarkers using tissue microarrays (TMAs) of clinical specimens has long been open to question. Heterogeneity related to tumor biology might compromise determination of accurate biomarker expression in tumors, especially in small core...... biopsies. We evaluated the reliability of immunohistochemical staining scoring in small core biopsies using 11 biomarkers in non-small-cell lung cancer (NSCLC). MATERIALS AND METHODS: Four 1-mm tumor cores from 178 NSCLCs, 2 representing peripheral areas close to the border of normal lung tissue and 2...... representing central areas, were examined. The biomarkers analyzed included p63, p40, cytokeratin 1/5/10/14, cytokeratin 7, thyroid transcription factor-1, napsin A, cyclin-D1, p53, Ki-67, integrin beta-1, and thymidylate synthase. RESULTS: Using a random intercept logistic regression model...

  11. Upregulated expression of human neutrophil peptides 1, 2 and 3 (HNP 1-3 in colon cancer serum and tumours: a biomarker study

    Directory of Open Access Journals (Sweden)

    Olsen Jesper

    2005-01-01

    Full Text Available Abstract Background Molecular markers for localized colon tumours and for prognosis following therapy are needed. Proteomics research is currently producing numerous biomarker studies with clinical potential. We investigate the protein composition of plasma and of tumour extracts with the aim of identifying biomarkers for colon cancer. Methods By Surface Enhanced Laser Desorption/Ionisation – Time Of Flight / Mass spectrometry (SELDI-TOF/MS we compare the protein profiles of colon cancer serum with serum from healthy individuals and the protein profiles of colon tumours with normal colon tissue. By size exclusion chromatography, we investigate the binding of HNP 1-3 to high mass plasma proteins. By microflow we investigate the effect of HNP 1-3 on mammalian cells. Results Human Neutrophil Peptides -1, -2 and -3 (HNP 1-3, also known as alfa-defensin-1, -2 and -3, are present in elevated concentrations in serum from colon cancer patients and in protein extracts from colon tumours. A fraction of HNP 1-3 in serum is bound to unidentified high mass plasma proteins. HNP 1-3 purified from colon tumours are lethal to mammalian cells. Conclusions HNP 1-3 may serve as blood markers for colon cancer in combination with other diagnostic tools. We propose that HNP 1-3 are carried into the bloodstream by attaching to high mass plasma proteins in the tumour microenvironment. We discuss the effect of HNP 1-3 on tumour progression.

  12. Upregulated expression of human neutrophil peptides 1, 2 and 3 (HNP 1-3) in colon cancer serum and tumours: a biomarker study

    International Nuclear Information System (INIS)

    Molecular markers for localized colon tumours and for prognosis following therapy are needed. Proteomics research is currently producing numerous biomarker studies with clinical potential. We investigate the protein composition of plasma and of tumour extracts with the aim of identifying biomarkers for colon cancer. By Surface Enhanced Laser Desorption/Ionisation – Time Of Flight / Mass spectrometry (SELDI-TOF/MS) we compare the protein profiles of colon cancer serum with serum from healthy individuals and the protein profiles of colon tumours with normal colon tissue. By size exclusion chromatography, we investigate the binding of HNP 1-3 to high mass plasma proteins. By microflow we investigate the effect of HNP 1-3 on mammalian cells. Human Neutrophil Peptides -1, -2 and -3 (HNP 1-3), also known as alfa-defensin-1, -2 and -3, are present in elevated concentrations in serum from colon cancer patients and in protein extracts from colon tumours. A fraction of HNP 1-3 in serum is bound to unidentified high mass plasma proteins. HNP 1-3 purified from colon tumours are lethal to mammalian cells. HNP 1-3 may serve as blood markers for colon cancer in combination with other diagnostic tools. We propose that HNP 1-3 are carried into the bloodstream by attaching to high mass plasma proteins in the tumour microenvironment. We discuss the effect of HNP 1-3 on tumour progression

  13. Can Biomarker Assessment on Circulating Tumor Cells Help Direct Therapy in Metastatic Breast Cancer?

    International Nuclear Information System (INIS)

    Circulating tumor cell (CTC) count has prognostic significance in metastatic breast cancer, but the predictive utility of CTCs is uncertain. Molecular studies on CTCs have often been limited by a low number of CTCs isolated from a high background of leukocytes. Improved enrichment techniques are now allowing molecular characterisation of single CTCs, whereby molecular markers on single CTCs may provide a real-time assessment of tumor biomarker status from a blood test or “liquid biopsy”, potentially negating the need for a more invasive tissue biopsy. The predictive ability of CTC biomarker analysis has predominantly been assessed in relation to HER2, with variable and inconclusive results. Limited data exist for other biomarkers, such as the estrogen receptor. In addition to the need to define and validate the most accurate and reproducible method for CTC molecular analysis, the clinical relevance of biomarkers, including gain of HER2 on CTC after HER2 negative primary breast cancer, remains uncertain. This review summarises the currently available data relating to biomarker evaluation on CTCs and its role in directing management in metastatic breast cancer, discusses limitations, and outlines measures that may enable future development of this approach

  14. Can Biomarker Assessment on Circulating Tumor Cells Help Direct Therapy in Metastatic Breast Cancer?

    Directory of Open Access Journals (Sweden)

    Natalie Turner

    2014-03-01

    Full Text Available Circulating tumor cell (CTC count has prognostic significance in metastatic breast cancer, but the predictive utility of CTCs is uncertain. Molecular studies on CTCs have often been limited by a low number of CTCs isolated from a high background of leukocytes. Improved enrichment techniques are now allowing molecular characterisation of single CTCs, whereby molecular markers on single CTCs may provide a real-time assessment of tumor biomarker status from a blood test or “liquid biopsy”, potentially negating the need for a more invasive tissue biopsy. The predictive ability of CTC biomarker analysis has predominantly been assessed in relation to HER2, with variable and inconclusive results. Limited data exist for other biomarkers, such as the estrogen receptor. In addition to the need to define and validate the most accurate and reproducible method for CTC molecular analysis, the clinical relevance of biomarkers, including gain of HER2 on CTC after HER2 negative primary breast cancer, remains uncertain. This review summarises the currently available data relating to biomarker evaluation on CTCs and its role in directing management in metastatic breast cancer, discusses limitations, and outlines measures that may enable future development of this approach.

  15. Can Biomarker Assessment on Circulating Tumor Cells Help Direct Therapy in Metastatic Breast Cancer?

    Energy Technology Data Exchange (ETDEWEB)

    Turner, Natalie [Sandro Pitigliani Medical Oncology Department, Prato Hospital, Istituto Toscano Tumori, Via Ugo Foscolo, Prato, PO 59100 (Italy); Pestrin, Marta [Sandro Pitigliani Medical Oncology Department, Prato Hospital, Istituto Toscano Tumori, Via Ugo Foscolo, Prato, PO 59100 (Italy); Translational Research Laboratory, Prato Hospital, Via Ugo Foscolo, Prato, PO 59100 (Italy); Galardi, Francesca; De Luca, Francesca [Translational Research Laboratory, Prato Hospital, Via Ugo Foscolo, Prato, PO 59100 (Italy); Malorni, Luca [Sandro Pitigliani Medical Oncology Department, Prato Hospital, Istituto Toscano Tumori, Via Ugo Foscolo, Prato, PO 59100 (Italy); Translational Research Laboratory, Prato Hospital, Via Ugo Foscolo, Prato, PO 59100 (Italy); Di Leo, Angelo, E-mail: adileo@usl4.toscana.it [Sandro Pitigliani Medical Oncology Department, Prato Hospital, Istituto Toscano Tumori, Via Ugo Foscolo, Prato, PO 59100 (Italy)

    2014-03-25

    Circulating tumor cell (CTC) count has prognostic significance in metastatic breast cancer, but the predictive utility of CTCs is uncertain. Molecular studies on CTCs have often been limited by a low number of CTCs isolated from a high background of leukocytes. Improved enrichment techniques are now allowing molecular characterisation of single CTCs, whereby molecular markers on single CTCs may provide a real-time assessment of tumor biomarker status from a blood test or “liquid biopsy”, potentially negating the need for a more invasive tissue biopsy. The predictive ability of CTC biomarker analysis has predominantly been assessed in relation to HER2, with variable and inconclusive results. Limited data exist for other biomarkers, such as the estrogen receptor. In addition to the need to define and validate the most accurate and reproducible method for CTC molecular analysis, the clinical relevance of biomarkers, including gain of HER2 on CTC after HER2 negative primary breast cancer, remains uncertain. This review summarises the currently available data relating to biomarker evaluation on CTCs and its role in directing management in metastatic breast cancer, discusses limitations, and outlines measures that may enable future development of this approach.

  16. Electrochemical Sandwich Immunoassay for the Ultrasensitive Detection of Human MUC1 Cancer Biomarker

    Directory of Open Access Journals (Sweden)

    Zahra Taleat

    2013-01-01

    Full Text Available A new electrochemical sandwich immunoassay for the ultrasensitive detection of human MUC1 cancer biomarker using protein G-functionalized magnetic beads (MBs and graphite-based screen-printed electrodes (SPEs was developed. Magnetic beads were employed as the platforms for the immobilization and immunoreaction process. A pair of primary and secondary antibodies was used to capture the MUC1 protein. After labeling with a third antibody conjugated with horseradish peroxidase (HRP, the resulting conjugate was trapped at the surface of the graphite-based SPEs and MUC1 determination was carried out by differential pulse voltammetry (DPV at 0.4 V upon H2O2 addition using acetaminophen (APAP as the redox mediator. A linear relationship was obtained for the detection of human MUC1 over a range of 0–25 ppb with the lowest detection limit of 1.34 ppb when HRP was applied as a label. Preliminary experiments were performed using disposable electrochemical sensors in order to optimize some parameters (i.e., incubation times, concentrations, and blocking agent.

  17. Chromosomal aberrations and SCEs as biomarkers of cancer risk

    Czech Academy of Sciences Publication Activity Database

    Norppa, H.; Bonassi, S.; Hansteen, I. L.; Hagmar, L.; Strömberg, U.; Rössner st., Pavel; Boffetta, P.; Lindholm, C.; Gundy, S.; Lazutka, J.; Cebulska-Wasilewska, A.; Fabiánová, E.; Šrám, Radim; Knudsen, L. E.; Barale, R.; Fucic, A.

    2006-01-01

    Roč. 600, - (2006), s. 37-45. ISSN 0027-5107 Institutional research plan: CEZ:AV0Z50390512 Keywords : biomarkers * chromosomal aberration * sister chromatid exchange Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 4.111, year: 2006

  18. Current Challenges in Development of Differentially Expressed and Prognostic Prostate Cancer Biomarkers

    Directory of Open Access Journals (Sweden)

    Steven M. Lucas

    2012-01-01

    Full Text Available Introduction. Predicting the aggressiveness of prostate cancer at biopsy is invaluable in making treatment decisions. In this paper we review the differential expression of genes and microRNAs identified through microarray analysis as potentially useful markers for prostate cancer prognosis and discuss some of the challenges associated with their development. Methods. A review of the literature was conducted through Medline. Articles were identified through searches of the following terms: “prostate cancer AND differential expression”, “prostate cancer prognosis”, and “prostate cancer AND microRNAs”. Results. Though numerous differentially expressed genes and microRNAs were identified as possible prognostic markers, the significance of several of these genes is either debated due to conflicting results or is not validated in other study populations. A few of the articles constructed predictive nomograms using a panel of biomarkers which require further validation. Challenges to the development of useful markers include different methodology, cancer heterogeneity, and sampling error. These can be overcome by categorizing prognostic factors into particular gene pathways or by supplementing biopsy information with blood or urine-based biomarkers. Conclusion. Though biomarkers based on differential expression offer the potential to improve decision making concerning prostate cancer, further validation of their utility and accuracy at the biopsy level is needed.

  19. Zinc finger proteins in cancer progression

    OpenAIRE

    Jen, Jayu; Wang, Yi-Ching

    2016-01-01

    Zinc finger proteins are the largest transcription factor family in human genome. The diverse combinations and functions of zinc finger motifs make zinc finger proteins versatile in biological processes, including development, differentiation, metabolism and autophagy. Over the last few decades, increasing evidence reveals the potential roles of zinc finger proteins in cancer progression. However, the underlying mechanisms of zinc finger proteins in cancer progression vary in different cancer...

  20. Exercise, weight loss and biomarkers for breast cancer risk

    OpenAIRE

    Gemert, W.A.M. van

    2015-01-01

    Background: Postmenopausal breast cancer is the most prevalent cancer in Western women. There are several known risk factors for postmenopausal breast cancer of which few are lifestyle-related and, thereby, modifiable. These risk factors provide an opportunity for primary prevention. In this thesis, we estimated that one out of four (25.7%) breast cancer cases in the Dutch female population of >40 years is attributable to lifestyle, i.e., overweight/obesity, physical inactivity, alcohol consu...

  1. Potential Biomarkers Found by Protein Profiling May Provide Insight for the Macrovascular Pathogenesis of Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    William C. S. Cho

    2006-01-01

    Full Text Available Diabetes mellitus (DM is an alarming threat to health of mankind, yet its pathogenesis is unclear. The purpose of this study was to find potential biomarkers to serve as indicators for the pathogenesis of DM in a time course manner. Based on our previous findings that oxidative stress occurred at week 8, aorta lysate and sera of 102 streptozotocin (STZ-induced diabetic and 85 control male Sprague-Dawley rats were obtained at the 4th, 8th and 12th week after STZ injection. The protein profiles were studied employing surface-enhanced laser desorption/ionization time-of-flight mass spectrometry technology in attomole sensitivity range. In the aorta, a multiple biomarker panel was discovered at the 4th week. At the 8th week, 4 biomarkers were found, while at the 12th week, 3 biomarkers were identified. In the sera, a triplet of 3 peaks and 2 biomarkers were all discovered to have 100% classification accuracy rate to differentiate the DM and control groups at all time intervals. Besides, 2 biomarkers were also found to have high classification value at week 12. Comparing the aorta and sera from DM and non-DM rats, a bundle of potential biomarkers with significant changes in peak intensities and high classification values were found. Two of the serum biomarkers matched with islet amyloid polypeptide and resistin in the SWISS-PROT knowledgebase. Validation has been conducted using immunoassay kits. These potential biomarkers may provide valuable insight on the pathogenesis of DM and macrovascular complications.

  2. Evolving Role of Bone Biomarkers in Castration-Resistant Prostate Cancer1

    OpenAIRE

    Brown, Janet E.; Sim, Sheryl

    2010-01-01

    The preferential metastasis of prostate cancer cells to bone disrupts the process of bone remodeling and results in lesions that cause significant pain and patient morbidity. Although prostate-specific antigen (PSA) is an established biomarker in prostate cancer, it provides only limited information relating to bone metastases and the treatment of metastatic bone disease with bisphosphonates or novel noncytotoxic targeted or biological agents that may provide clinical benefits without affecti...

  3. Evolving Role of Bone Biomarkers in Castration-Resistant Prostate Cancer

    OpenAIRE

    Brown, Janet E.; Sheryl Sim

    2010-01-01

    The preferential metastasis of prostate cancer cells to bone disrupts the process of bone remodeling and results in lesions that cause significant pain and patient morbidity. Although prostate-specific antigen (PSA) is an established biomarker in prostate cancer, it provides only limited information relating to bone metastases and the treatment of metastatic bone disease with bisphosphonates or novel noncytotoxic targeted or biological agents that may provide clinical benefits without affecti...

  4. Body fluid MMP-2 as a putative biomarker in metastatic breast cancer

    OpenAIRE

    NOH, SEWON; Jung, Jae-Joon; Jung, Minkyu; KIM, KI-HYANG; Lee, Ha-young; WANG, BRANDON; CHO, JOANNA; Kim, Tae Soo; Jeung, Hei-Cheul; Rha, Sun Young

    2012-01-01

    In the present study, we investigated the role of matrix metalloproteinase (MMP)-2 and -9 as novel biomarkers in the body fluid of patients with metastatic breast cancer. We measured the expression of MMPs in 37 samples of body fluid (10 peritoneal and 27 pleural fluids) from metastatic breast cancer patients between 2000 and 2009. Zymography and ELISA assays were used to determine the cut-off level and to quantify MMP expression from a positive control, HT-1080 conditioned media. MMP express...

  5. Urinary high molecular weight matrix metalloproteinases as non-invasive biomarker for detection of bladder cancer

    OpenAIRE

    Mohammed, Mohammed A; Seleim, Manar F; Abdalla, Mohga S.; Sharada, Hayat M; Abdel Wahab, Abdel Hady A.

    2013-01-01

    Background Matrix Metalloproteinases (MMPs) are key molecules for tumor growth, invasion and metastasis. Over-expression of different MMPs in tumor tissues can disturb the homeostasis and increase the level of various body fluids. Many MMPs including high molecular weights (HMWs) were detected in the urine of prostate and bladder cancer patients. Our aim here is to assess the usefulness of HMW MMPs as non invasive biomarkers in bilharzial bladder cancer in Egyptian patients. Methods The activ...

  6. DNA Methylation in Peripheral Blood: A Potential Biomarker for Cancer Molecular Epidemiology

    OpenAIRE

    Li, Lian; Choi, Ji-Yeob; Lee, Kyoung-Mu; Sung, Hyuna; Park, Sue K; Oze, Isao; Pan, Kai-Feng; You, Wei-cheng; Chen, Ying-Xuan; Fang, Jing-Yuan; Matsuo, Keitaro; Kim, Woo Ho; Yuasa, Yasuhito; Kang, Daehee

    2012-01-01

    Aberrant DNA methylation is associated with cancer development and progression. There are several types of specimens from which DNA methylation pattern can be measured and evaluated as an indicator of disease status (from normal biological process to pathologic condition) and even of pharmacologic response to therapy. Blood-based specimens such as cell-free circulating nucleic acid and DNA extracted from leukocytes in peripheral blood may be a potential source of noninvasive cancer biomarkers...

  7. Non-invasive biomarkers in pancreatic cancer diagnosis: what we need versus what we have

    OpenAIRE

    Herreros-Villanueva, Marta; Bujanda, Luis

    2016-01-01

    Pancreatic cancer (PC) is probably the most lethal tumor being forecast as the second most fatal cancer by 2020 in developed countries. Only the earliest forms of the disease are a curable disease but it has to be diagnosed before symptoms starts. Detection at curable phase demands screening intervention for early detection and differential diagnosis. Unfortunately, no successful strategy or image technique has been concluded as effective approach and currently non-invasive biomarkers are the...

  8. Glypican-1 in exosomes as biomarker for early detection of pancreatic cancer

    OpenAIRE

    Herreros-Villanueva, Marta; Bujanda, Luis

    2016-01-01

    On June 24, 2015 Nature published an article entitle “Glypican-1 identifies cancer exosomes and detects early pancreatic cancer’’, which demonstrates that exosomes positives for the proteoglycan glypican-1 (GPC1) are expressed in serum of patients with pancreatic cancer since very early stages but not in benign pancreatic disease. Additionally, these GPC1+ circulating exosomes correlate with tumor burden and could be used as prognostic biomarker in pre and post-surgical patients. The study is...

  9. Can Prostate Specific Antigen Be Used as New Biomarker for Early Diagnosis of Breast Cancer?

    Directory of Open Access Journals (Sweden)

    Seyed Mostafa Shiryazdi

    2015-09-01

    Conclusion: Plasma PSA level is not a reliable biomarker to diagnose breast cancer, though regarding existing scientific evidence, more comprehensive studies are required to consider other features of malignant samples so as to evaluate the role of PSA in differentiating breast neoplastic lesions in a more meticulous way based on the degree of tumor differentiation.

  10. Global DNA hypomethylation in peripheral blood mononuclear cells as a biomarker of cancer risk

    Science.gov (United States)

    Global DNA hypomethylation is an early molecular event in carcinogenesis. Whether methylation measured in peripheral blood mononuclear cells (PBMCs) DNA is a clinically reliable biomarker for early detection or cancer risk assessment is to be established. From an original sample-set of 753 male and...

  11. BMI1, stem cell factor acting as novel serum-biomarker for Caucasian and African-American prostate cancer.

    Directory of Open Access Journals (Sweden)

    Hifzur Rahman Siddique

    Full Text Available BACKGROUND: Lack of reliable predictive biomarkers is a stumbling block in the management of prostate cancer (CaP. Prostate-specific antigen (PSA widely used in clinics has several caveats as a CaP biomarker. African-American CaP patients have poor prognosis than Caucasians, and notably the serum-PSA does not perform well in this group. Further, some men with low serum-PSA remain unnoticed for CaP until they develop disease. Thus, there is a need to identify a reliable diagnostic and predictive biomarker of CaP. Here, we show that BMI1 stem-cell protein is secretory and could be explored for biomarker use in CaP patients. METHODOLOGY/PRINCIPAL FINDINGS: Semi-quantitative analysis of BMI1 was performed in prostatic tissues of TRAMP (autochthonous transgenic mouse model, human CaP patients, and in cell-based models representing normal and different CaP phenotypes in African-American and Caucasian men, by employing immunohistochemistry, immunoblotting and Slot-blotting. Quantitative analysis of BMI1 and PSA were performed in blood and culture-media of siRNA-transfected and non-transfected cells by employing ELISA. BMI1 protein is (i secreted by CaP cells, (ii increased in the apical region of epithelial cells and stromal region in prostatic tumors, and (iii detected in human blood. BMI1 is detectable in blood of CaP patients in an order of increasing tumor stage, exhibit a positive correlation with serum-PSA and importantly is detectable in patients which exhibit low serum-PSA. The clinical significance of BMI1 as a biomarker could be ascertained from observation that CaP cells secrete this protein in higher levels than cells representative of benign prostatic hyperplasia (BPH. CONCLUSIONS/SIGNIFICANCE: BMI1 could be developed as a dual bio-marker (serum and biopsy for the diagnosis and prognosis of CaP in Caucasian and African-American men. Though compelling these data warrant further investigation in a cohort of African-American patients.

  12. Circulating microRNAs as specific biomarkers for breast cancer detection.

    Directory of Open Access Journals (Sweden)

    Enders K O Ng

    Full Text Available BACKGROUND: We previously showed microRNAs (miRNAs in plasma are potential biomarkers for colorectal cancer detection. Here, we aimed to develop specific blood-based miRNA assay for breast cancer detection. METHODOLOGY/PRINCIPAL FINDINGS: TaqMan-based miRNA profiling was performed in tumor, adjacent non-tumor, corresponding plasma from breast cancer patients, and plasma from matched healthy controls. All putative markers identified were verified in a training set of breast cancer patients. Selected markers were validated in a case-control cohort of 170 breast cancer patients, 100 controls, and 95 other types of cancers and then blindly validated in an independent set of 70 breast cancer patients and 50 healthy controls. Profiling results showed 8 miRNAs were concordantly up-regulated and 1 miRNA was concordantly down-regulated in both plasma and tumor tissue of breast cancer patients. Of the 8 up-regulated miRNAs, only 3 were significantly elevated (p<0.0001 before surgery and reduced after surgery in the training set. Results from the validation cohort showed that a combination of miR-145 and miR-451 was the best biomarker (p<0.0001 in discriminating breast cancer from healthy controls and all other types of cancers. In the blind validation, these plasma markers yielded Receiver Operating Characteristic (ROC curve area of 0.931. The positive predictive value was 88% and the negative predictive value was 92%. Altered levels of these miRNAs in plasma have been detected not only in advanced stages but also early stages of tumors. The positive predictive value for ductal carcinoma in situ (DCIS cases was 96%. CONCLUSIONS: These results suggested that these circulating miRNAs could be a potential specific biomarker for breast cancer screening.

  13. Biomarker-guided repurposing of chemotherapeutic drugs for cancer therapy: a novel strategy in drug development

    Directory of Open Access Journals (Sweden)

    Jan eStenvang

    2013-12-01

    Full Text Available Cancer is a leading cause of mortality worldwide and matters are only set to worsen as its incidence continues to rise. Traditional approaches to combat cancer include improved prevention, early diagnosis, optimized surgery, development of novel drugs and honing regimens of existing anti-cancer drugs. Although discovery and development of novel and effective anti-cancer drugs is a major research area, it is well known that oncology drug development is a lengthy process, extremely costly and with high attrition rates. Furthermore, those drugs that do make it through the drug development mill are often quite expensive, laden with severe side-effects and, unfortunately, to date, have only demonstrated minimal increases in overall survival. Therefore, a strong interest has emerged to identify approved non-cancer drugs that possess anti-cancer activity, thus shortcutting the development process. This research strategy is commonly known as drug repurposing or drug repositioning and provides a faster path to the clinics. We have developed and implemented a modification of the standard drug repurposing strategy that we review here; rather than investigating target-promiscuous non-cancer drugs for possible anti-cancer activity, we focus on the discovery of novel cancer indications for already approved chemotherapeutic anti-cancer drugs. Clinical implementation of this strategy is normally commenced at clinical phase II trials and includes pre-treated patients. As the response rates to any non-standard chemotherapeutic drug will be relatively low in such a patient cohort it is a pre-requisite that such testing is based on predictive biomarkers. This review describes our strategy of biomarker-guided repurposing of chemotherapeutic drugs for cancer therapy, taking the repurposing of topoisomerase I inhibitors and topoisomerase I as a potential predictive biomarker as case in point.

  14. Plasma-derived exosomal survivin, a plausible biomarker for early detection of prostate cancer.

    Directory of Open Access Journals (Sweden)

    Salma Khan

    Full Text Available BACKGROUND: Survivin is expressed in prostate cancer (PCa, and its downregulation sensitizes PCa cells to chemotherapeutic agents in vitro and in vivo. Small membrane-bound vesicles called exosomes, secreted from the endosomal membrane compartment, contain RNA and protein that they readily transport via exosome internalization into recipient cells. Recent progress has shown that tumor-derived exosomes play multiple roles in tumor growth and metastasis and may produce these functions via immune escape, tumor invasion and angiogenesis. Furthermore, exosome analysis may provide novel biomarkers to diagnose or monitor PCa treatment. METHODS: Exosomes were purified from the plasma and serum from 39 PCa patients, 20 BPH patients, 8 prostate cancer recurrent and 16 healthy controls using ultracentrifugation and their quantities and qualities were quantified and visualized from both the plasma and the purified exosomes using ELISA and Western blotting, respectively. RESULTS: Survivin was significantly increased in the tumor-derived samples, compared to those from BPH and controls with virtually no difference in the quantity of Survivin detected in exosomes collected from newly diagnosed patients exhibiting low (six or high (nine Gleason scores. Exosome Survivin levels were also higher in patients that had relapsed on chemotherapy compared to controls. CONCLUSIONS: These studies demonstrate that Survivin exists in plasma exosomes from both normal, BPH and PCa subjects. The relative amounts of exosomal Survivin in PCa plasma was significantly higher than in those with pre-inflammatory BPH and control plasma. This differential expression of exosomal Survivin was seen with both newly diagnosed and advanced PCa subjects with high or low-grade cancers. Analysis of plasma exosomal Survivin levels may offer a convenient tool for diagnosing or monitoring PCa and may, as it is elevated in low as well as high Gleason scored samples, be used for early detection.

  15. Development of an Immunosensor Based on Layered Double Hydroxides for MMR Cancer Biomarker Detection.

    Science.gov (United States)

    Hammami, M; Soussou, A; Idoudi, F; Cohen-Bouhacina, T; Bouhaouala-Zahar, B; Baccar, Z M

    2015-10-01

    As a potential biomarker for the investigation of cancer inflammatory profiles, macrophage mannose receptor (MMR, CD206) is herein selected to develop an immunosensor based on layered double hydroxide (LDH). Like an endocyte C-type lectin receptor, MMR plays an important role in immune homeostasis by scavenging unwanted mannose glycoproteins. It attracts a progressive attention thanks to its particularly high expression within the tumor microenvironment. There is a great of interest to develop an immunosensor based on an antibody specific to MMR for detection of stroma versus tumor cells. In this work, we studied the feasibility of high sensitive MMR cancer Screen Printed Electrode (SPE) immunosensor. Working electrode of commercialized SPE was modified by immobilization of specific antibody (anti-MMR) into thin layer of LDH nanomaterials. Structural, morphological, and surface properties of LDHs were studied by X-Ray diffraction, atomic force microscopy and Infrared spectroscopy in ATR. Cyclic Voltammetry technique was used to study interaction between the human recombinant MMR protein (rHu-MMR, NSO derived) and an immobilized antibody into developed immunosensor. High specific response of -11.72 μA/ng.mL(-1) (with a correlation coefficient of R(2)=0.994 ) were obtained in linear range of 0.05 ng/mL to 10.0 ng/mL of specific recombinant antigen. The limit of detection (LOD) was less than 15.0 pg/mL. From these attractive results, the feasibility of an electrochemical immunosensor for cancer was proved. Additional experiments to study stability and reproducibility the immunosensor should be completed in perspective to use these anti-MMR based immunosensors for sensing human MMR in patient biopsies and sera. PMID:26316191

  16. PVT1 Exon 9: A Potential Biomarker of Aggressive Prostate Cancer?

    Science.gov (United States)

    Ilboudo, Adeodat; Chouhan, Jyoti; McNeil, Brian K.; Osborne, Joseph R.; Ogunwobi, Olorunseun O.

    2015-01-01

    Prostate cancer (PCa) is the most commonly diagnosed cancer as well as the greatest source of cancer-related mortality in males of African ancestry (MoAA). Interestingly, this has been shown to be associated with single nucleotide polymorphisms around regions 2 and 3 of the 8q24 human chromosomal region. The non-protein coding gene locus Plasmacytoma Variant Translocation 1 (PVT1) is located at 8q24 and is overexpressed in PCa and, therefore, is also a candidate biomarker to explain the well-known disparity in this group. PVT1 has at least 12 exons that make separate transcripts which may have different functions, all of which are at present unknown in PCa. Our aim was to determine if any PVT1 transcripts play a role in aggressiveness and racial disparity in PCa. We used a panel of seven PCa cell lines including three derived from MoAA. Ribonucleic acid extraction, complementary deoxyribonucleic acid synthesis, and quantitative polymerase chain reaction (qPCR) were performed to evaluate expression of all 12 PVT1 exons. Each qPCR was performed in quadruplicates. At least four separate qPCR experiments were performed. Expression of PVT1 exons was inconsistent except for exon 9. There was no significant difference in exon 9 expression between cell lines derived from Caucasian males (CM), and an indolent cell line derived from MoAA. However, exon 9 expression in the aggressive MDA PCa 2b and E006AA-hT cell lines derived from MoAA was significantly higher than in other cell lines. Consequently, we observed differential expression of exon 9 of PVT1 in a manner that suggests that PVT1 exon 9 may be associated with aggressive PCa in MoAA. PMID:26703666

  17. PVT1 Exon 9: A Potential Biomarker of Aggressive Prostate Cancer?

    Science.gov (United States)

    Ilboudo, Adeodat; Chouhan, Jyoti; McNeil, Brian K; Osborne, Joseph R; Ogunwobi, Olorunseun O

    2016-01-01

    Prostate cancer (PCa) is the most commonly diagnosed cancer as well as the greatest source of cancer-related mortality in males of African ancestry (MoAA). Interestingly, this has been shown to be associated with single nucleotide polymorphisms around regions 2 and 3 of the 8q24 human chromosomal region. The non-protein coding gene locus Plasmacytoma Variant Translocation 1 (PVT1) is located at 8q24 and is overexpressed in PCa and, therefore, is also a candidate biomarker to explain the well-known disparity in this group. PVT1 has at least 12 exons that make separate transcripts which may have different functions, all of which are at present unknown in PCa. Our aim was to determine if any PVT1 transcripts play a role in aggressiveness and racial disparity in PCa. We used a panel of seven PCa cell lines including three derived from MoAA. Ribonucleic acid extraction, complementary deoxyribonucleic acid synthesis, and quantitative polymerase chain reaction (qPCR) were performed to evaluate expression of all 12 PVT1 exons. Each qPCR was performed in quadruplicates. At least four separate qPCR experiments were performed. Expression of PVT1 exons was inconsistent except for exon 9. There was no significant difference in exon 9 expression between cell lines derived from Caucasian males (CM), and an indolent cell line derived from MoAA. However, exon 9 expression in the aggressive MDA PCa 2b and E006AA-hT cell lines derived from MoAA was significantly higher than in other cell lines. Consequently, we observed differential expression of exon 9 of PVT1 in a manner that suggests that PVT1 exon 9 may be associated with aggressive PCa in MoAA. PMID:26703666

  18. Quantitative Assessment of Tissue Biomarkers and Construction of a Model to Predict Outcome in Breast Cancer Using Multiple Imputation

    Directory of Open Access Journals (Sweden)

    John W. Emerson

    2009-01-01

    Full Text Available Missing data pose one of the greatest challenges in the rigorous evaluation of biomarkers. The limited availability of specimens with complete clinical annotation and quality biomaterial often leads to underpowered studies. Tissue microarray studies, for example, may be further handicapped by the loss of data points because of unevaluable staining, core loss, or the lack of tumor in the histospot. This paper presents a novel approach to these common problems in the context of a tissue protein biomarker analysis in a cohort of patients with breast cancer. Our analysis develops techniques based on multiple imputation to address the missing value problem. We first select markers using a training cohort, identifying a small subset of protein expression levels that are most useful in predicting patient survival. The best model is obtained by including both protein markers (including COX6C, GATA3, NAT1, and ESR1 and lymph node status. The use of either lymph node status or the four protein expression levels provides similar improvements in goodness-of-fi t, with both significantly better than a baseline clinical model. Using the same multiple imputation strategy, we then validate the results out-of-sample on a larger independent cohort. Our approach of integrating multiple imputation with each stage of the analysis serves as an example that may be replicated or adapted in future studies with missing values.

  19. Current Challenges in Volatile Organic Compounds Analysis as Potential Biomarkers of Cancer

    Directory of Open Access Journals (Sweden)

    Kamila Schmidt

    2015-01-01

    Full Text Available An early diagnosis and appropriate treatment are crucial in reducing mortality among people suffering from cancer. There is a lack of characteristic early clinical symptoms in most forms of cancer, which highlights the importance of investigating new methods for its early detection. One of the most promising methods is the analysis of volatile organic compounds (VOCs. VOCs are a diverse group of carbon-based chemicals that are present in exhaled breath and biofluids and may be collected from the headspace of these matrices. Different patterns of VOCs have been correlated with various diseases, cancer among them. Studies have also shown that cancer cells in vitro produce or consume specific VOCs that can serve as potential biomarkers that differentiate them from noncancerous cells. This review identifies the current challenges in the investigation of VOCs as potential cancer biomarkers, by the critical evaluation of available matrices for the in vivo and in vitro approaches in this field and by comparison of the main extraction and detection techniques that have been applied to date in this area of study. It also summarises complementary in vivo, ex vivo, and in vitro studies conducted to date in order to try to identify volatile biomarkers of cancer.

  20. PET imaging biomarkers in head and neck cancer

    Energy Technology Data Exchange (ETDEWEB)

    Differding, Sarah; Gregoire, Vincent [Universite Catholique de Louvain, St-Luc University Hospital, Department of Radiation Oncology, and Center for Molecular Imaging, Radiotherapy and Oncology (MIRO), Institut de Recherche Experimentale et Clinique (IREC), Brussels (Belgium); Hanin, Francois-Xavier [Universite Catholique de Louvain, St-Luc University Hospital, Department of Nuclear Medicine, and Center for Molecular Imaging, Radiotherapy and Oncology (MIRO), Institut de Recherche Experimentale et Clinique (IREC), Brussels (Belgium)

    2015-04-01

    In locally advanced head and neck squamous cell carcinoma (HNSCC), the role of imaging becomes more and more critical in the management process. In this framework, molecular imaging techniques such as PET allow noninvasive assessment of a range of tumour biomarkers such as metabolism, hypoxia and proliferation, which can serve different purposes. First, in a pretreatment setting they can influence therapy selection strategies and target delineation for radiation therapy. Second, their predictive and/or prognostic value could help enhance the therapeutic ratio in the management of HNSCC. Third, treatment modification can be performed through the generation of a molecular-based heterogeneous dose distribution with dose escalation to the most resistant parts of the tumour, a concept known as dose painting. Fourth, they are increasingly becoming a tool for monitoring response to therapy. In this review, PET imaging biomarkers used in the routine management of HNSCC or under investigation are discussed. (orig.)

  1. Evaluating the potential of a novel oral lesion exudate collection method coupled with mass spectrometry-based proteomics for oral cancer biomarker discovery

    Directory of Open Access Journals (Sweden)

    Kooren Joel A

    2011-09-01

    Full Text Available Abstract Introduction Early diagnosis of Oral Squamous Cell Carcinoma (OSCC increases the survival rate of oral cancer. For early diagnosis, molecular biomarkers contained in samples collected non-invasively and directly from at-risk oral premalignant lesions (OPMLs would be ideal. Methods In this pilot study we evaluated the potential of a novel method using commercial PerioPaper absorbent strips for non-invasive collection of oral lesion exudate material coupled with mass spectrometry-based proteomics for oral cancer biomarker discovery. Results Our evaluation focused on three core issues. First, using an "on-strip" processing method, we found that protein can be isolated from exudate samples in amounts compatible with large-scale mass spectrometry-based proteomic analysis. Second, we found that the OPML exudate proteome was distinct from that of whole saliva, while being similar to the OPML epithelial cell proteome, demonstrating the fidelity of our exudate collection method. Third, in a proof-of-principle study, we identified numerous, inflammation-associated proteins showing an expected increase in abundance in OPML exudates compared to healthy oral tissue exudates. These results demonstrate the feasibility of identifying differentially abundant proteins from exudate samples, which is essential for biomarker discovery studies. Conclusions Collectively, our findings demonstrate that our exudate collection method coupled with mass spectrometry-based proteomics has great potential for transforming OSCC biomarker discovery and clinical diagnostics assay development.

  2. Elevated C-reactive protein in the diagnosis, prognosis, and cause of cancer

    DEFF Research Database (Denmark)

    Allin, Kristine H; Nordestgaard, Børge G

    2011-01-01

    The aim of this review is to summarize present evidence of an association between circulating levels of C-reactive protein (CRP) and cancer risk, and to evaluate whether elevated circulating CRP levels cause cancer. Additionally, the review provides background information on the acute......-phase response, chronic inflammation, the molecular biology, function and measurement of CRP, circulating levels of CRP in health and disease, the principle of Mendelian randomization, the association between circulating levels of CRP and cancer prognosis, and cancer biomarkers. In the Copenhagen General...... increased risk of death from breast cancer compared to patients with CRP levels...

  3. Combined RASSF1A and RASSF2A Promoter Methylation Analysis as Diagnostic Biomarker for Bladder Cancer

    OpenAIRE

    Wei Meng; Alexander Huebner; Ahmad Shabsigh; Arnab Chakravarti; Tim Lautenschlaeger

    2012-01-01

    Promoter hypermethylation, a widely studied epigenetic event known to influence gene expression levels, has been proposed as a potential biomarker in multiple types of cancer. Clinical diagnostic biomarkers are needed for reliable prediction of bladder cancer recurrence. In this paper, DNA promoter methylation of five C-terminal Ras-association family members (RASSF1A, RASSF2A, RASSF4, RASSF5, and RASSF6) was studied in 64 formalin-fixed paraffin-embedded (FFPE) bladder cancer and normal adja...

  4. Glycoprotein Biomarkers for the Early Detection of Aggressive Prostate Cancer — EDRN Public Portal

    Science.gov (United States)

    The Early Detection Research Network of the NCI is charged with the discovery, development and validation of biomarkers for early detection and prognosis related to neoplastic disease. Our laboratory is an NCI EDRN (U01CA152813) working on "Glycoprotein biomarkers for the early detection of aggressive prostate cancer". This EDRN administratiVE! supplement is a collaboration with Robert Veltri on his project to identify men with very low risk (indolent) prostate cancer (CaP) at the diagnostic biopsy at selection for active surveillance (AS). We will assess biopsy tissue using quantitative nuclear histomorphometric measurements and molecular biomarkers to predict an unexpected catastrophic CaP in such men with indolent CaP. At Johns Hopkins Hospital w1e use the Epstein criteria that includes; PSA density (PSAD) aggressive disease from a AS diagnostic biopsy. Our approach will combine nuclear morphometry measured by digital microscopy with a unique biopsy tissue biomarker profile (DNA content, Ki67, Her2neu, CACND1 and periostin). Fc•r the molecular targets we will us•e a multiplex tissue blot (MTB) immunohistochemistry method. The Aims o'f our work include 1) to utilize retrospective archival biopsy material from 70 AS cases where the outcome was unexpected and disastrous and collect an equal number of AS cases (n=140) and perform assays for morphology and biomarker targi ts proposed, 2) and predict failure using Cox proportional hazards statistical modeling.

  5. Non-invasive biomarkers in pancreatic cancer diagnosis: what we need versus what we have.

    Science.gov (United States)

    Herreros-Villanueva, Marta; Bujanda, Luis

    2016-04-01

    Pancreatic cancer (PC) is probably the most lethal tumor being forecast as the second most fatal cancer by 2020 in developed countries. Only the earliest forms of the disease are a curable disease but it has to be diagnosed before symptoms starts. Detection at curable phase demands screening intervention for early detection and differential diagnosis. Unfortunately, no successful strategy or image technique has been concluded as effective approach and currently non-invasive biomarkers are the hope. Multiple translational research studies have explored minimally or non-invasive biomarkers in biofluids-blood, urine, stool, saliva or pancreatic juice, but diagnostic performance has not been validated yet. Nowadays no biomarker, alone or in combination, has been superior to carbohydrate antigen 19-9 (CA19-9) in sensitivity and specificity. Although the number of novel biomarkers for early diagnosis of PC has been increasing during the last couple of years, no molecular signature is ready to be implemented in clinical routine. Under the uncertain future, miRNAs profiling and methylation status seem to be the most promising biomarkers. However, good results in larger validations are urgently needed before application. Industry efforts through biotech and pharmaceutical companies are urgently required to demonstrate accuracy and validate promising results from basic and translational results. PMID:27162784

  6. Amino acid profiling as a method of discovering biomarkers for early diagnosis of cancer.

    Science.gov (United States)

    Simińska, Edyta; Koba, Marcin

    2016-06-01

    Cancer is one of the main causes of mortality in the world and its early detection significantly increases chances of patients' survival. High cancer mortality rate is caused mainly by late-stage diagnosis and lack of non-invasive and reliable methods for early diagnosis, such as plasma biomarkers. The incidence of cancers in the world still grows so it is crucial to develop a new, faster, high specificity and more sensitive diagnostic technologies. Several recent researchers indicate amino acids as a potential marker for cancer detection. An ideal cancer biomarker should be characterized by high specificity and sensitivity, reliability, ease of measurement and, what is important, ability to detect disease in its early stage. This study is focused on indicating metabolic amino acid profiling as a method of identifying biomarkers for cancer early detection and screening. Presented results are derived from the most recent studies where patients in early, often asymptomatic stages of disease constituted a large percentage of all the patients and, what is important, where researchers have observed alterations in these patients' amino acid profiles. This review is concentrated on analyzing studies on the most common cancers with high mortality rate. Inventing effective methods of early diagnosis is particularly important in case of such diseases. Research presented in this publication is focused on patients with lung, breast and colon cancer. In all analyzed cases, significant changes in the amino acid profile in cancer patients comparing to healthy controls were observed. This study indicates potential of amino acid profiling as method for early cancer detection. PMID:27033065

  7. Reproducibility of mass spectrometry based protein profiles for diagnosis of ovarian cancer across clinical studies

    DEFF Research Database (Denmark)

    Øgendahl Callesen, Anne Kjærgaard; Mogensen, Ole; Jensen, Andreas K; Kruse, Torben A; Martinussen, Torben; Jensen, Ole N; Madsen, Jonna S

    2012-01-01

    The focus of this systematic review is to give an overview of the current status of clinical protein profiling studies using MALDI and SELDI MS platforms in the search for ovarian cancer biomarkers. A total of 34 profiling studies were qualified for inclusion in the review. Comparative analysis o...... article is part of a Special Issue entitled: Clinical Proteomics SI: Clinical Proteomics....

  8. In Silico discovery of transcription factors as potential diagnostic biomarkers of ovarian cancer

    KAUST Repository

    Kaur, Mandeep

    2011-09-19

    Background: Our study focuses on identifying potential biomarkers for diagnosis and early detection of ovarian cancer (OC) through the study of transcription regulation of genes affected by estrogen hormone.Results: The results are based on a set of 323 experimentally validated OC-associated genes compiled from several databases, and their subset controlled by estrogen. For these two gene sets we computationally determined transcription factors (TFs) that putatively regulate transcription initiation. We ranked these TFs based on the number of genes they are likely to control. In this way, we selected 17 top-ranked TFs as potential key regulators and thus possible biomarkers for a set of 323 OC-associated genes. For 77 estrogen controlled genes from this set we identified three unique TFs as potential biomarkers.Conclusions: We introduced a new methodology to identify potential diagnostic biomarkers for OC. This report is the first bioinformatics study that explores multiple transcriptional regulators of OC-associated genes as potential diagnostic biomarkers in connection with estrogen responsiveness. We show that 64% of TF biomarkers identified in our study are validated based on real-time data from microarray expression studies. As an illustration, our method could identify CP2 that in combination with CA125 has been reported to be sensitive in diagnosing ovarian tumors. 2011 Kaur et al; licensee BioMed Central Ltd.

  9. Integrating biomarkers in colorectal cancer trials in the West and China.

    Science.gov (United States)

    Tejpar, Sabine; Shen, Lin; Wang, Xicheng; Schilsky, Richard L

    2015-09-01

    The discovery of biomarkers that provide information on drug efficacy is recognized as essential for successful and cost-effective treatment of cancer. However, biomarker discovery is difficult, and requires multiple independent studies to identify a target that serves as a suitable predictor of efficacy and to ensure appropriate biomarker validation. Clinical trials that are performed, sometimes sequentially, in Europe, the USA or Asia, are often similar in their design, in part owing to regulatory, marketing, or safety considerations. We believe some of these trials offer additional unique opportunities for biomarker discovery or validation. There are multiple hurdles to overcome, such as homogenous tissue acquisition and analysis, defining and aligning biomarker hypotheses across trials, and the need to adapt sample sizes and trial designs. Nevertheless, we believe that a collaborative engagement of the academic, regulatory and pharmaceutical community can go a long way in addressing these issues and producing more-rapid results in the field of personalized medicine. In this Perspectives, we describe our views on the current fragmented approach to biomarker discovery and validation in relevant trials run within our own regions-that is, Europe, China, and the USA-and hope this article serves as a base for further reflection. PMID:25963094

  10. Evaluation of yolk protein as biomarkers for endocrine disruption in molluscs

    DEFF Research Database (Denmark)

    Morthorst, Jane Ebsen; Holbech, Henrik; Kinnberg, Karin Lund;

    in fish for decades. Vitellogenin (vtg) is mainly present in females, however, vtg synthesis can be induced by estrogens and EDCs in juveniles and males. During the last decade yolk protein has been used as biomarker in bivalve studies and alkali-labile phosphate (ALP) has been the applied method to...... indirectly estimate vtg levels. ALP was developed as an indirect method for determination of vtg in fish before more reliable and specific methods like ELISA (Enzyme-Linked Immuno Sorbent Assay) were developed. The use of yolk protein as biomarker in molluscs is based on the assumptions that vtg synthesis is...... biomarker for estrogenic exposure in molluscs by exposing the freshwater bivalve U. tumidus to 17β-estradiol (E2) (57, 164 and 512 ng/L) for eight weeks during their reproductive phase. Histological examination of the gonads revealed that E2 did not cause intersex and the ELISA revealed that the normal sex...

  11. Xenograft assessment of predictive biomarkers for standard head and neck cancer therapies

    International Nuclear Information System (INIS)

    Head and neck squamous cell carcinoma (HNSCC) remains a challenging cancer to treat with overall 5-year survival on the order of 50–60%. Therefore, predictive biomarkers for this disease would be valuable to provide more effective and individualized therapeutic approaches for these patients. While prognostic biomarkers such as p16 expression correlate with outcome; to date, no predictive biomarkers have been clinically validated for HNSCC. We generated xenografts in immunocompromised mice from six established HNSCC cell lines and evaluated response to cisplatin, cetuximab, and radiation. Tissue microarrays were constructed from pre- and posttreatment tumor samples derived from each xenograft experiment. Quantitative immunohistochemistry was performed using a semiautomated imaging and analysis platform to determine the relative expression of five potential predictive biomarkers: epidermal growth factor receptor (EGFR), phospho-EGFR, phospho-Akt, phospho-ERK, and excision repair cross-complementation group 1 (ERCC1). Biomarker levels were compared between xenografts that were sensitive versus resistant to a specific therapy utilizing a two-sample t-test with equal standard deviations. Indeed the xenografts displayed heterogeneous responses to each treatment, and we linked a number of baseline biomarker levels to response. This included low ERCC1 being associated with cisplatin sensitivity, low phospho-Akt correlated with cetuximab sensitivity, and high total EGFR was related to radiation resistance. Overall, we developed a systematic approach to identifying predictive biomarkers and demonstrated several connections between biomarker levels and treatment response. Despite these promising initial results, this work requires additional preclinical validation, likely involving the use of patient-derived xenografts, prior to moving into the clinical realm for confirmation among patients with HNSCC

  12. Identification of Potential Glycoprotein Biomarkers in Estrogen Receptor Positive (ER+ and Negative (ER- Human Breast Cancer Tissues by LC-LTQ/FT-ICR Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Suzan M. Semaan, Xu Wang, Alan G. Marshall, Qing-Xiang Amy Sang

    2012-01-01

    Full Text Available Breast cancer is the second most fatal cancer in American women. To increase the life expectancy of patients with breast cancer new diagnostic and prognostic biomarkers and drug targets must be identified. A change in the glycosylation on a glycoprotein often causes a change in the function of that glycoprotein; such a phenomenon is correlated with cancerous transformation. Thus, glycoproteins in human breast cancer estrogen receptor positive (ER+ tissues and those in the more advanced stage of breast cancer, estrogen receptor negative (ER- tissues, were compared. Glycoproteins showing differences in glycosylation were examined by 2-dimensional gel electrophoresis with double staining (glyco- and total protein staining and identified by reversed-phase nano-liquid chromatography coupled with a hybrid linear quadrupole ion trap/ Fourier transform ion cyclotron resonance mass spectrometer. Among the identified glycosylated proteins are alpha 1 acid glycoprotein, alpha-1-antitrypsin, calmodulin, and superoxide dismutase mitochondrial precursor that were further verified by Western blotting for both ER+ and ER- human breast tissues. Results show the presence of a possible glycosylation difference in alpha-1-antitrypsin, a potential tumor-derived biomarker for breast cancer progression, which was expressed highest in the ER- samples.

  13. Collections of simultaneously altered genes as biomarkers of cancer cell drug response.

    Science.gov (United States)

    Masica, David L; Karchin, Rachel

    2013-03-15

    Computational analysis of cancer pharmacogenomics data has resulted in biomarkers predictive of drug response, but the majority of response is not captured by current methods. Methods typically select single biomarkers or groups of related biomarkers but do not account for response that is strictly dependent on many simultaneous genetic alterations. This shortcoming reflects the combinatorics and multiple-testing problem associated with many-body biologic interactions. We developed a novel approach, Multivariate Organization of Combinatorial Alterations (MOCA), to partially address these challenges. Extending on previous work that accounts for pairwise interactions, the approach rapidly combines many genomic alterations into biomarkers of drug response, using Boolean set operations coupled with optimization; in this framework, the union, intersection, and difference Boolean set operations are proxies of molecular redundancy, synergy, and resistance, respectively. The algorithm is fast, broadly applicable to cancer genomics data, is of immediate use for prioritizing cancer pharmacogenomics experiments, and recovers known clinical findings without bias. Furthermore, the results presented here connect many important, previously isolated observations. PMID:23338612

  14. Biomarkers in bladder cancer: A metabolomic approach using in vitro and ex vivo model systems.

    Science.gov (United States)

    Rodrigues, Daniela; Jerónimo, Carmen; Henrique, Rui; Belo, Luís; de Lourdes Bastos, Maria; de Pinho, Paula Guedes; Carvalho, Márcia

    2016-07-15

    Metabolomics has recently proved to be useful in the area of biomarker discovery for cancers in which early diagnostic and prognostic biomarkers are urgently needed, as is the case of bladder cancer (BC). This article presents a comprehensive review of the literature on the metabolomic studies on BC, highlighting metabolic pathways perturbed in this disease and the altered metabolites as potential biomarkers for BC detection. Current disease model systems used in the study of BC metabolome include in vitro-cultured cancer cells, ex vivo neoplastic bladder tissues and biological fluids, mainly urine but also blood serum/plasma, from BC patients. The major advantages and drawbacks of each model system are discussed. Based on available data, it seems that BC metabolic signature is mainly characterized by alterations in metabolites related to energy metabolic pathways, particularly glycolysis, amino acid and fatty acid metabolism, known to be crucial for cell proliferation, as well as glutathione metabolism, known to be determinant in maintaining cellular redox balance. In addition, purine and pyrimidine metabolism as well as carnitine species were found to be altered in BC. Finally, it is emphasized that, despite the progress made in respect to novel biomarkers for BC diagnosis, there are still some challenges and limitations that should be addressed in future metabolomic studies to ensure their translatability to clinical practice. PMID:26804544

  15. Serial Patterns of Ovarian Cancer Biomarkers in a Prediagnosis Longitudinal Dataset

    Directory of Open Access Journals (Sweden)

    Oleg Blyuss

    2015-01-01

    Full Text Available Early detection of ovarian cancer through screening may have impact on mortality from the disease. Approaches based on CA125 cut-off have not been effective. Longitudinal algorithms such as the Risk of Ovarian Cancer Algorithm (ROCA to interpret CA125 have been shown to have higher sensitivity and specificity than a single cut-off. The aim of this study was to investigate whether other ovarian cancer-related biomarkers, Human Epididymis 4 (HE4, glycodelin, mesothelin, matrix metalloproteinase 7 (MMP7, and cytokeratin 19 fragment (CYFRA 21-1, could improve the performance of CA125 in detecting ovarian cancer earlier. Serum samples (single and serial predating diagnosis from 47 women taking part in the UK Collaborative Trial of Ovarian Cancer Screening (UKCTOCS who went on to develop primary invasive ovarian, fallopian tube, or peritoneal cancer (index cancer (170 samples and 179 matched controls (893 samples were included in the study. A multiplex immunobased assay platform (Becton Dickinson allowing simultaneous measurement of the six serum markers was used. The area under the ROC curve for the panel of three biomarkers (CA125, HE4, and glycodelin was higher than for CA125 alone for all analysed time groups, indicating that these markers can improve on sensitivity of CA125 alone for ovarian cancer detection.

  16. Circulating microRNAs as minimally invasive biomarkers for cancer theragnosis and prognosis

    Directory of Open Access Journals (Sweden)

    William C. S. Cho

    2011-02-01

    Full Text Available Novel cancer biomarker discovery is urgently needed for cancer theragnosis and prognosis, and among the many possible types of samples, blood is regarded to be ideal for this discovery as it can be collected easily in a minimally invasive manner. Results of the last few years have ascertained the quantification of microRNA (miRNA as a promising approach for the detection and prognostication of cancer. Indeed, an increasing number of studies have shown that circulating cancer-associated miRNAs are readily measured in plasma or serum and they can robustly discriminate cancer patients from healthy controls, as well as distinguishing between good-prognosis and poor-prognosis patients. Furthermore, recent findings also suggest the potential of circulating miRNAs in the screening, monitoring, and treatment of cancer. This article summarizes the most significant and latest discoveries of original researches on circulating miRNAs involvement in cancer, focusing on the potential of circulating miRNAs as minimally invasive biomarkers for cancer theragnosis and prognosis.

  17. The Progress and Prospects of Putative Biomarkers for Liver Cancer Stem Cells in Hepatocellular Carcinoma.

    Science.gov (United States)

    Xiang, Yan; Yang, Ting; Pang, Bing-Yao; Zhu, Ying; Liu, Yong-Ning

    2016-01-01

    Accumulating evidence suggests that hepatocellular carcinoma (HCC) is organized by liver cancer stem cells (LCSCs), which are a subset of cells with "stem-like" characteristics. Identification of the LCSCs is a fundamental and important problem in HCC research. LCSCs have been investigated by various stem cell biomarkers. There is still lack of consensus regarding the existence of a "global" marker for LCSCs in HCC. In this review article, we summarize the progress and prospects of putative biomarkers for LCSCs in the past decades, which is essential to develop future therapies targeting CSCs and to predict prognosis and curative effect of these therapies. PMID:27610139

  18. Application of biomarkers in cancer risk management: evaluation from stochastic clonal evolutionary and dynamic system optimization points of view.

    Directory of Open Access Journals (Sweden)

    Xiaohong Li

    2011-02-01

    Full Text Available Aside from primary prevention, early detection remains the most effective way to decrease mortality associated with the majority of solid cancers. Previous cancer screening models are largely based on classification of at-risk populations into three conceptually defined groups (normal, cancer without symptoms, and cancer with symptoms. Unfortunately, this approach has achieved limited successes in reducing cancer mortality. With advances in molecular biology and genomic technologies, many candidate somatic genetic and epigenetic "biomarkers" have been identified as potential predictors of cancer risk. However, none have yet been validated as robust predictors of progression to cancer or shown to reduce cancer mortality. In this Perspective, we first define the necessary and sufficient conditions for precise prediction of future cancer development and early cancer detection within a simple physical model framework. We then evaluate cancer risk prediction and early detection from a dynamic clonal evolution point of view, examining the implications of dynamic clonal evolution of biomarkers and the application of clonal evolution for cancer risk management in clinical practice. Finally, we propose a framework to guide future collaborative research between mathematical modelers and biomarker researchers to design studies to investigate and model dynamic clonal evolution. This approach will allow optimization of available resources for cancer control and intervention timing based on molecular biomarkers in predicting cancer among various risk subsets that dynamically evolve over time.

  19. Investigation of prostate cancer cells using NADH and Tryptophan as biomarker: multiphoton FLIM-FRET microscopy

    Science.gov (United States)

    Rehman, Shagufta; O'Melia, Meghan J.; Wallrabe, Horst; Svindrych, Zdenek; Chandra, Dhyan; Periasamy, Ammasi

    2016-03-01

    Fluorescence Lifetime Imaging (FLIM) can be used to understand the metabolic activity in cancer. Prostate cancer is one of the leading cancers in men in the USA. This research focuses on FLIM measurements of NAD(P)H and Tryptophan, used as biomarkers to understand the metabolic activity in prostate cancer cells. Two prostate cancers and one normal cell line were used for live-cell FLIM measurements on Zeiss780 2P confocal microscope with SPCM FLIM board. Glucose uptake and glycolysis proceeds about ten times faster in cancer than in non-cancerous tissues. Therefore, we assessed the glycolytic activity in the prostate cancer in comparison to the normal cells upon glucose stimulation by analyzing the NAD(P)H and Trp lifetime distribution and efficiency of energy transfer (E%). Furthermore, we treated the prostate cancer cells with 1μM Doxorubicin, a commonly used anti-cancer chemotherapeutic. Increase in NADH a2%, an indicator of increased glycolysis and increased E% between Trp and NAD(P)H were seen upon glucose stimulation for 30min. The magnitude of shift to the right for NAD(P)H a2% and E% distribution was higher in prostate cancer versus the normal cells. Upon treatment with Doxorubicin decrease in cellular metabolism was seen at 15 and 30 minutes. The histogram for NAD(P)H a2% post-treatment for prostate cancer cells showed a left shift compared to the untreated control suggesting decrease in glycolysis and metabolic activity opposite to what was observed after glucose stimulation. Hence, NAD(P)H and Trp lifetimes can be used biomarkers to understand metabolic activity in prostate cancer and upon chemotherapeutic interventions.

  20. Total Protein of Whole Saliva as a Biomarker of Anaerobic Threshold

    Science.gov (United States)

    Bortolini, Miguel Junior Sordi; De Agostini, Guilherme Gularte; Reis, Ismair Teodoro; Lamounier, Romeu Paulo Martins Silva; Blumberg, Jeffrey B.; Espindola, Foued Salmen

    2009-01-01

    Saliva provides a convenient and noninvasive matrix for assessing specific physiological parameters, including some biomarkers of exercise. We investigated whether the total protein concentration of whole saliva (TPWS) would reflect the anaerobic threshold during an incremental exercise test. After a warm-up period, 13 nonsmoking men performed a…

  1. DNA methylome and the complexity of discovering prostate cancer biomarkers

    Institute of Scientific and Technical Information of China (English)

    Shahriar Koochekpour

    2011-01-01

    @@ Prostate cancer (PCa) remains the most common malignancy and a leading cause of cancer-related deaths in men.Molecular discrimination at an early stage between indolent and aggressive primary tumors in pathologically confirmed PCa is required to develop personalized therapeutic interventions.

  2. Multiplexed detection of lung cancer biomarkers based on quantum dots and microbeads.

    Science.gov (United States)

    Wu, Simin; Liu, Lifen; Li, Gong; Jing, Fengxiang; Mao, Hongju; Jin, Qinghui; Zhai, Wanyin; Zhang, Hongfeng; Zhao, Jianlong; Jia, Chunping

    2016-08-15

    We have developed a multiplexed fluoroimmunoassay of three lung cancer biomarkers based on multicolor quantum dots (QDs) as detection elements and micro-magnetic beads as immune carriers. QDs have the ability to simplify multiplexed analysis. In our method, the fluorescent signals derived from three cross-talk-free QD conjugated probes with emission maxima at 525, 585 and 625nm could be analyzed to determine the concentrations of the target proteins. With this system, fragments of cytokeratin 19 (CYRFA 21-1), carcinoembryonic antigen (CEA), and neuron-specific enolase (NSE), were simultaneously detected in a single sample with a low detection limit down to the 1.0ng/mL level (364pg/mL for CYRFA 21-1, 38pg/mL for CEA, 370pg/mL for NSE in a single detection). Additional advantages of the presented method include ease of operation, low cost, and a very low sample volume (20µL). PMID:27260434

  3. Immunoprofiles of 11 Biomarkers Using Tissue Microarrays Identify Prognostic Subgroups in Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Thomas Knösel

    2005-08-01

    Full Text Available BACKGROUND, AIMS: Genomewide expression profiling has identified a number of genes expressed at higher levels in colorectal cancer (CRC than in normal tissues. Our objectives in this study were: 1 to test whether genes were also distinct on the protein level; 2 to evaluate these biomarkers in a series of well-characterized CRCs;, 3 to apply hierarchical cluster analysis to the immunohistochemical data. METHODS: Tissue microarrays (TMAs comprising 351 CRC specimens from 270 patients were constructed to evaluate the genes Adam10, CyclinD1, Annexinll, NFKB, Casein-kinase-2-beta (CK2B, YB-1, P32, Rad51, c-fos, IGFBP4, Connexin26 (Cx26. In total, 3,797 samples were analyzed. RESULTS: Unsupervised hierarchical clustering discovered subgroups of CRC that differed by tumor stage, survival. KaplanMeier analysis showed that reduced Cx26 expression was significantly associated with shorter patient survival, higher tumor grade (G1/G2vs G3, P = .02, Adam10 expression with a higher tumor stage (pT1/2vs pT3/4, P = .04. CONCLUSIONS: Our study highlights the potential of TMAs for a higher-dimensional analysis by evaluating serial sections of the same tissue core (three-dimensional TMA analysis. In addition, it endorses the use of immunohistochemistry supplemented by hierarchical clustering for the identification of tumor subgroups with diagnostic, prognostic signatures.

  4. Pyruvate carboxylase as a sensitive protein biomarker for exogenous steroid chemicals

    International Nuclear Information System (INIS)

    Assessing protein responses to endocrine disrupting chemicals is critical for understanding the mechanisms of chemical action and for the assessment of hazards. In this study, the response of the liver proteome of male rare minnows (Gobiocypris rarus) treated with 17β-estradiol (E2) and females treated with 17α-methyltestosterone (MT) were analyzed. A total of 23 and 24 proteins were identified with differential expression in response to E2 and MT, respectively. Pyruvate carboxylase (PC) was the only common differentially expressed protein in both males and females after E2- and MT-treatments. The mRNA as well as the protein levels of PC were significantly down-regulated compared with that of the controls (p < 0.05). Our results suggest that endocrine disruptors interfere with genes and proteins of the TCA cycle and PC may be a sensitive biomarker of exposure to exogenous steroid chemicals in the liver of fish. - Highlights: • The hepatic proteomes of rare minnow (Gobiocypris rarus) exposed to E2 and MT were analyzed. • Differentially expressed proteins (23 and 24 respectively) were identified following E2 and MT exposure. • Four differentially expressed proteins associated with chemical stimulus were characterized. • PC was identified as a responsive biomarker for both estrogens and androgens. - Our results suggest PC may be a sensitive biomarker of exposure to exogenous steroid chemicals in the liver of fish

  5. Are Blood-Based Protein Biomarkers for Alzheimer's Disease also Involved in Other Brain Disorders?:A Systematic Review

    OpenAIRE

    Chiam, Justin Tao Wen; Dobson, Richard James Butler; Kiddle, Steven John; Sattlecker, Martina

    2015-01-01

    Background: Alzheimer's disease (AD) biomarkers are urgently needed for both early and accurate diagnosis and prediction of disease progression. Past research has studied blood-based proteins as potential AD biomarkers, revealing many candidate proteins. To date only limited effort has been made to investigate the disease specificity of AD candidate proteins and whether these proteins are also involved in other neurodegenerative or psychiatric conditions.Objective: This review seeks to determ...

  6. Multi-transcript profiling in archival diagnostic prostate cancer needle biopsies to evaluate biomarkers in non-surgically treated men

    OpenAIRE

    Kachroo, Naveen; Warren, Anne Y; Gnanapragasam, Vincent J.

    2014-01-01

    Background Most biomarkers in prostate cancer have only been evaluated in surgical cohorts. The value of these biomarkers in a different therapy context remains unclear. Our objective was to test a panel of surgical biomarkers for prognostic value in men treated by external beam radiotherapy (EBRT) and primary androgen deprivation therapy (PADT). Methods The Fluidigm® PCR array was used for multi-transcript profiling of laser microdissected tumours from archival formalin-fixed diagnostic biop...

  7. Personalized Circulating Tumor DNA Biomarkers Dynamically Predict Treatment Response and Survival In Gynecologic Cancers.

    Directory of Open Access Journals (Sweden)

    Elena Pereira

    Full Text Available High-grade serous ovarian and endometrial cancers are the most lethal female reproductive tract malignancies worldwide. In part, failure to treat these two aggressive cancers successfully centers on the fact that while the majority of patients are diagnosed based on current surveillance strategies as having a complete clinical response to their primary therapy, nearly half will develop disease recurrence within 18 months and the majority will die from disease recurrence within 5 years. Moreover, no currently used biomarkers or imaging studies can predict outcome following initial treatment. Circulating tumor DNA (ctDNA represents a theoretically powerful biomarker for detecting otherwise occult disease. We therefore explored the use of personalized ctDNA markers as both a surveillance and prognostic biomarker in gynecologic cancers and compared this to current FDA-approved surveillance tools.Tumor and serum samples were collected at time of surgery and then throughout treatment course for 44 patients with gynecologic cancers, representing 22 ovarian cancer cases, 17 uterine cancer cases, one peritoneal, three fallopian tube, and one patient with synchronous fallopian tube and uterine cancer. Patient/tumor-specific mutations were identified using whole-exome and targeted gene sequencing and ctDNA levels quantified using droplet digital PCR. CtDNA was detected in 93.8% of patients for whom probes were designed and levels were highly correlated with CA-125 serum and computed tomography (CT scanning results. In six patients, ctDNA detected the presence of cancer even when CT scanning was negative and, on average, had a predictive lead time of seven months over CT imaging. Most notably, undetectable levels of ctDNA at six months following initial treatment was associated with markedly improved progression free and overall survival.Detection of residual disease in gynecologic, and indeed all cancers, represents a diagnostic dilemma and a potential

  8. Personalized Circulating Tumor DNA Biomarkers Dynamically Predict Treatment Response and Survival In Gynecologic Cancers

    Science.gov (United States)

    Anand, Sanya; Sebra, Robert; Catalina Camacho, Sandra; Garnar-Wortzel, Leopold; Nair, Navya; Moshier, Erin; Wooten, Melissa; Uzilov, Andrew; Chen, Rong; Prasad-Hayes, Monica; Zakashansky, Konstantin; Beddoe, Ann Marie; Schadt, Eric; Dottino, Peter; Martignetti, John A.

    2015-01-01

    Background High-grade serous ovarian and endometrial cancers are the most lethal female reproductive tract malignancies worldwide. In part, failure to treat these two aggressive cancers successfully centers on the fact that while the majority of patients are diagnosed based on current surveillance strategies as having a complete clinical response to their primary therapy, nearly half will develop disease recurrence within 18 months and the majority will die from disease recurrence within 5 years. Moreover, no currently used biomarkers or imaging studies can predict outcome following initial treatment. Circulating tumor DNA (ctDNA) represents a theoretically powerful biomarker for detecting otherwise occult disease. We therefore explored the use of personalized ctDNA markers as both a surveillance and prognostic biomarker in gynecologic cancers and compared this to current FDA-approved surveillance tools. Methods and Findings Tumor and serum samples were collected at time of surgery and then throughout treatment course for 44 patients with gynecologic cancers, representing 22 ovarian cancer cases, 17 uterine cancer cases, one peritoneal, three fallopian tube, and one patient with synchronous fallopian tube and uterine cancer. Patient/tumor-specific mutations were identified using whole-exome and targeted gene sequencing and ctDNA levels quantified using droplet digital PCR. CtDNA was detected in 93.8% of patients for whom probes were designed and levels were highly correlated with CA-125 serum and computed tomography (CT) scanning results. In six patients, ctDNA detected the presence of cancer even when CT scanning was negative and, on average, had a predictive lead time of seven months over CT imaging. Most notably, undetectable levels of ctDNA at six months following initial treatment was associated with markedly improved progression free and overall survival. Conclusions Detection of residual disease in gynecologic, and indeed all cancers, represents a diagnostic

  9. MicroRNA-18a as a promising biomarker for cancer detection: a meta-analysis

    OpenAIRE

    Jin, Shan; Tan, Shi-Sheng; Li, Hang

    2015-01-01

    Patients with cancer discovered at an early stage have relatively high survival rates. Increasing researches have shown the potential of detecting dysregulated microRNA-18a (miR-18a) to diagnose cancer. However, non-uniform results in previous studies were found. Thus, this meta-analysis was conducted to further explore the clinical applicability of miR-18a as an ideal biomarker for cancer detection. Suitable articles were obtained from online databases like PubMed, Embase, Cochrane, CBM and ...

  10. Expression of Two Basic mRNA Biomarkers in Peripheral Blood of Patients with Non-Small Cell Lung Cancer Detected by Real-Time RT-PCR, Individually and Simultaneously

    OpenAIRE

    Karimi, Shirin; Mohamadnia, Abdolreza; Nadji, Seyed Alireza; Yadegarazari, Reza; Khosravi, Adnan; Bahrami, Naghmeh; Saidijam, Massoud

    2015-01-01

    Introduction: Although extensive research has been conducted on lung cancer markers, a singular clinically applicable marker has not been found yet. The objective of this study was to evaluate the sensitivity and the specificity of carcinoembryonic antigen (CEA) mRNA and lung-specific X protein (LUNX) mRNA biomarkers in peripheral blood to detect lung cancer individually and simultaneously. Methods: Thirty patients affected by lung cancer and 30 healthy individuals were studied in this resear...

  11. Integration of Known DNA, RNA and Protein Biomarkers Provides Prediction of Anti-TNF Response in Rheumatoid Arthritis

    DEFF Research Database (Denmark)

    Folkersen, Lasse; Brynedal, Boel; Marcela Diaz-Gallo, Lina;

    2016-01-01

    high-throughput RNA sequencing, DNA genotyping, extensive proteomics and flow cytometry measurements, as well as comprehensive clinical phenotyping. Literature review identified 2 proteins, 52 single-nucleotide polymorphisms (SNPs) and 72 gene-expression biomarkers that had previously been proposed as...... predictors of TNF inhibitor response (∆DAS28-CRP). RESULTS: From these published TNFi biomarkers we found that 2 protein, 2 SNP and 8 mRNA biomarkers could be replicated in the 59 TNF initiating patients. Combining these replicated biomarkers into a single signature we found that we could explain 51% of the...

  12. Physical Activity, Exercise, and Mammalian Testis Function: Emerging Preclinical Protein Biomarker and Integrative Biology Insights.

    Science.gov (United States)

    Gomes, Mariana; Freitas, Maria João; Fardilha, Margarida

    2015-09-01

    Exercise and physical activity have long been recognized for health promotion and to delay the onset of many pathological situations such as diabetes and cancers. Still, there appears to be an upper limit on the beneficial health effects regarding intensity and frequency of exercise training. In humans, the effect of exercise training in the male reproductive system has been studied mainly through the analysis of semen quality parameters, with inconsistent results. Less is known on molecular biomarkers of exercise-related changes in testis at the protein/proteome level. This review offers an in-depth analysis on the small scale protein studies available primarily from the preclinical studies and interprets their functional impact on the reproductive health with a view to humans. In all, exercise training in preclinical models seems to negatively modulate, in the course of health, critical functions that directly affect spermatogenesis, such as testosterone biosynthesis, energy supply, and antioxidant system components. Exercise training induces apoptosis, leading to the impairment of spermatogenesis and, consequently, to male infertility. In pathological conditions, an improvement in the testicular functions is observed by increases in steroidogenic enzymes and antioxidant defenses, and reductions in activity of inflammatory pathways. Importantly, the mechanisms by which exercise training modulates the reproductive function are far from being fully understood. The analyses of the testis proteome in varying exercise conditions would inform the molecular mechanisms involved and identify putative theranostics opportunities. Such future research is a cornerstone for health promotion in the pursuit of reproductive health informed by omics systems sciences. PMID:26284990

  13. AGE metabolites: a biomarker linked to cancer disparity?

    Science.gov (United States)

    Foster, Dion; Spruill, Laura; Walter, Katherine R; Nogueira, Lourdes M; Fedarovich, Hleb; Turner, Ryan Y; Ahmed, Mahtabuddin; Salley, Judith D; Ford, Marvella E; Findlay, Victoria J; Turner, David P

    2014-10-01

    Socioeconomic and environmental influences are established factors promoting cancer disparity, but the contribution of biologic factors is not clear. We report a mechanistic link between carbohydrate-derived metabolites and cancer that may provide a biologic consequence of established factors of cancer disparity. Glycation is the nonenzymatic glycosylation of carbohydrates to macromolecules, which produces reactive metabolites called advanced glycation end products (AGE). A sedentary lifestyle and poor diet all promote disease and the AGE accumulation pool in our bodies and also increase cancer risk. We examined AGE metabolites in clinical specimens of African American and European American patients with prostate cancer and found a higher AGE concentration in these specimens among African American patients when compared with European American patients. Elevated AGE levels corresponded with expression of the receptor for AGE (RAGE or AGER). We show that AGE-mediated increases in cancer-associated processes are dependent upon RAGE. Aberrant AGE accumulation may represent a metabolic susceptibility difference that contributes to cancer disparity. PMID:25053712

  14. The centrality of cancer proteins in human protein-protein interaction network: a revisit.

    Science.gov (United States)

    Xiong, Wei; Xie, Luyu; Zhou, Shuigeng; Liu, Hui; Guan, Jihong

    2014-01-01

    Topological analysis of protein-protein interaction (PPI) networks has been widely applied to the investigation on cancer mechanisms. However, there is still a debate on whether cancer proteins exhibit more topological centrality compared to the other proteins in the human PPI network. To resolve this debate, we first identified four sets of human proteins, and then mapped these proteins into the yeast PPI network by homologous genes. Finally, we compared these proteins' properties in human and yeast PPI networks. Experiments over two real datasets demonstrated that cancer proteins tend to have higher degree and smaller clustering coefficient than non-cancer proteins. Experimental results also validated that cancer proteins have larger betweenness centrality compared to the other proteins on the STRING dataset. However, on the BioGRID dataset, the average betweenness centrality of cancer proteins is larger than that of disease and control proteins, but smaller than that of essential proteins. PMID:24878726

  15. Biomarkers for Early Detection a nd Screening in Pancreatic Cancer Highlights from the “45 th ASCO Annual Meeting”. Orlando, FL, USA. May 29 - June 2, 2009

    Directory of Open Access Journals (Sweden)

    Christopher J Hoimes

    2009-07-01

    Full Text Available Pancreatic cancer is the second most frequent gastrointestinal malignancy with an unabated mortality that reflects the advanced stage of presentation. Detection of early disease through screening likely is the best way to meaningfully prolong survival. The development of biomarkers for screening holds enormous promise for increasing early detection and impacting mortality. Many biomarkers have been studied including the serum protein carbohydrate antigen 19-9, vascular endothelial growth factor, and nuclear factor kappa B, however, still no blood test or other fluid analysis reliably predicts patients with disease. The authors review abstracts from the 2009 annual meeting of the American Society of Clinical Oncology, Orlando, FL, U.S.A., that report evidence for early detection using a salivary biomarker array (#4630; a mucin epitope to PAM4 (#4613; a plasma nucleotide marker of hypoxia, miR-210 (#4624; and a cleavage product of complement pathway component C3b, iC3b (#4626. The meeting featured pancreatic cancer in over 100 research abstracts, of which, four are reviewed that focus on potential markers for early detection. When applied to a population of high risk patients, biomarkers of early pancreatic cancer could provide a minimally invasive way of identifying patients that require further evaluation using endoscopic tools. These molecular beacons may even be found to be sufficiently sensitive, specific, and cost effective to be applied to a broader population of patients.

  16. A Novel Biomarker Panel Examining Response to Gemcitabine with or without Erlotinib for Pancreatic Cancer Therapy in NCIC Clinical Trials Group PA.3.

    Directory of Open Access Journals (Sweden)

    David B Shultz

    Full Text Available NCIC Clinical Trials Group PA.3 was a randomized control trial that demonstrated improved overall survival (OS in patients receiving erlotinib in addition to gemcitabine for locally advanced or metastatic pancreatic cancer. Prior to therapy, patients had plasma samples drawn for future study. We sought to identify biomarkers within these samples.Using the proximity ligation assay (PLA, a probe panel was built from commercially available antibodies for 35 key proteins selected from a global genetic analysis of pancreatic cancers, and used to quantify protein levels in 20 uL of patient plasma. To determine if any of these proteins levels independently associated with OS, univariate and mulitbaraible Cox models were used. In addition, we examined the associations between biomarker expression and disease stage at diagnosis using Fisher's exact test. The correlation between Erlotinib sensitivity and each biomarkers was assessed using a test of interaction between treatment and biomarker.Of the 569 eligible patients, 480 had samples available for study. Samples were randomly allocated into training (251 and validation sets (229. Among all patients, elevated levels of interleukin-8 (IL-8, carcinoembryonic antigen (CEA, hypoxia-inducible factor 1-alpha (HIF-1 alpha, and interleukin-6 were independently associated with lower OS, while IL-8, CEA, platelet-derived growth factor receptor alpha and mucin-1 were associated with metastatic disease. Patients with elevated levels of receptor tyrosine-protein kinase erbB-2 (HER2 expression had improved OS when treated with erlotinib compared to placebo. In conclusion, PLA is a powerful tool for identifying biomarkers from archived, small volume serum samples. These data may be useful to stratify patient outcomes regardless of therapeutic intervention.ClinicalTrials.gov NCT00040183.

  17. Molecular profiling of childhood cancer: Biomarkers and novel therapies

    Directory of Open Access Journals (Sweden)

    Federica Saletta

    2014-06-01

    General significance: The increasing recognition of the heterogeneity of molecular causes of cancer favors the continued development of molecularly targeted agents, and their transfer to pediatric and adolescent populations.

  18. Detection of cell surface calreticulin as a potential cancer biomarker using near-infrared emitting gold nanoclusters.

    Science.gov (United States)

    Ramesh, Bala Subramaniyam; Giorgakis, Emmanouil; Lopez-Davila, Victor; Dashtarzheneha, Ashkan Kamali; Loizidou, Marilena

    2016-07-15

    Calreticulin (CRT) is a cytoplasmic calcium-binding protein. The aim of this study was to investigate CRT presence in cancer with the use of fluorescent gold nanoclusters (AuNCs) and to explore AuNC synthesis using mercaptosuccinic acid (MSA) as a coating agent. MSA-coated AuNCs conferred well-dispersed, bio-stable, water-soluble nanoparticles with bioconjugation capacity and 800-850 nm fluorescence after broad-band excitation. Cell-viability assay revealed good AuNC tolerability. A native CRT amino-terminus corresponding peptide sequence was synthesised and used to generate rabbit site-specific antibodies. Target specificity was demonstrated with antibody blocking in colorectal and breast cancer cell models; human umbilical vein endothelial cells served as controls. We demonstrated a novel route of AuNC/MSA manufacture and CRT presence on colonic and breast cancerous cell surface. AuNCs served as fluorescent bio-probes specifically recognising surface-bound CRT. These results are promising in terms of AuNC application in cancer theranostics and CRT use as surface biomarker in human cancer. PMID:27255548

  19. Detection of cell surface calreticulin as a potential cancer biomarker using near-infrared emitting gold nanoclusters

    Science.gov (United States)

    Subramaniyam Ramesh, Bala; Giorgakis, Emmanouil; Lopez-Davila, Victor; Kamali Dashtarzheneha, Ashkan; Loizidou, Marilena

    2016-07-01

    Calreticulin (CRT) is a cytoplasmic calcium-binding protein. The aim of this study was to investigate CRT presence in cancer with the use of fluorescent gold nanoclusters (AuNCs) and to explore AuNC synthesis using mercaptosuccinic acid (MSA) as a coating agent. MSA-coated AuNCs conferred well-dispersed, bio-stable, water-soluble nanoparticles with bioconjugation capacity and 800–850 nm fluorescence after broad-band excitation. Cell-viability assay revealed good AuNC tolerability. A native CRT amino-terminus corresponding peptide sequence was synthesised and used to generate rabbit site-specific antibodies. Target specificity was demonstrated with antibody blocking in colorectal and breast cancer cell models; human umbilical vein endothelial cells served as controls. We demonstrated a novel route of AuNC/MSA manufacture and CRT presence on colonic and breast cancerous cell surface. AuNCs served as fluorescent bio-probes specifically recognising surface-bound CRT. These results are promising in terms of AuNC application in cancer theranostics and CRT use as surface biomarker in human cancer.

  20. Hereditary Colorectal Cancer: Registration, Screening and Prognostic Biomarker Analysis

    OpenAIRE

    Barrow, Paul

    2015-01-01

    Aims: The purpose of the research was to investigate the benefits of a hereditary colorectal cancer registry in the management of patients and families with Lynch syndrome. In study one, a systematic review was performed to quantify the impact of registration and screening on colorectal cancer (CRC) incidence and mortality, with comparison between familial adenomatous polyposis (FAP) and Lynch syndrome (LS). In study two, a regional Lynch syndrome registry was utilised to evaluate the uptake ...

  1. Genetic and protein biomarkers in blood for the improved detection of GH abuse.

    Science.gov (United States)

    Ferro, P; Ventura, R; Pérez-Mañá, C; Farré, M; Segura, J

    2016-09-01

    Human Growth Hormone (hGH, somatotropin) is one of the relevant forbidden substances to be detected in sport drug testing. Since the appearance of recombinant hGH (rhGH) in the 80's, its expansion and availability through the black market have increased, so the detection of its abuse continues to be a challenge at present. New techniques or biomarkers that are robust, reliable, sensitive and allowing a large detection time window are welcome. rhGH produces an increase of insulin-like growth factor 1 (IGF-1). FN1 (fibronectin 1) and RAB31 (member of RAS oncogene family) genes have been suggested as two potential biomarkers for IGF-1 abuse. Following this line, in the present study some genetic and proteomic approaches have been performed with fourteen healthy male subjects treated with rhGH (which produces increase of IGF-1 concentrations) to study FN1 gene, FN1 protein, RAB31 gene and RAB31 protein as potential biomarkers for rhGH abuse. The results showed that both, RAB31 and FN1 genes and FN1 protein could be potential biomarkers for rhGH administration. Preliminary assessments of gender, age, acute sport activities and GHRP-2 (pralmorelin, a rhGH releasing peptide) influence suggest they are not relevant confounding factors. Thus, the selected markers present high sensitivity and a larger detection window for rhGH detection than IGF-1 itself. PMID:27243825

  2. Recent patents and advances in genomic biomarker discovery for colorectal cancers.

    Science.gov (United States)

    Quyun, Chen; Ye, Zhiyun; Lin, Sheng-Cai; Lin, Biaoyang

    2010-06-01

    Colorectal cancer (CRC) is the third most common cancer in the world. Early diagnosis of colorectal cancer is the key to reducing the death rate of CRC patients. Predicting the response to current therapeutic modalities of CRC will also have a great impact on patient care. This review summarizes recent advances and patents in biomarker discovery in CRC under five major categories; including genomic changes, expression changes, mutations, epigenetic changes and microRNAs. The interesting patents include: 1) a patent for a method to differentiate normal exfoliated cells from cancer cells based on whether they were subjected to apoptosis and DNA degradation; 2) A model (PM-33 multiple molecular marker model) based on expression changes of up-regulation of the MDM2, DUSP6, and NFl genes down-regulation of the RNF4, MMD and EIF2S3 genes, which achieved an 88% sensitivity, and an 82% specificity for CRC diagnosis; 3) gene mutations in PTEN, KRAS, PIK3CA for predicting the response to anti-EGFR therapies, a common drug used for CRC treatment; 4) patents on epigenetic changes of ITGA4, SEPT9, ALX4, TFAP2E FOXL2, SARM1, ID4 etc. and many key miRNAs. Finally, future directions in the fields were commented on or suggested, including the combination of multiple categories of biomarkers and pathway central or network-based biomarker panels. PMID:20426761

  3. ellipsoidFN: a tool for identifying a heterogeneous set of cancer biomarkers based on gene expressions.

    Science.gov (United States)

    Ren, Xianwen; Wang, Yong; Chen, Luonan; Zhang, Xiang-Sun; Jin, Qi

    2013-02-01

    Computationally identifying effective biomarkers for cancers from gene expression profiles is an important and challenging task. The challenge lies in the complicated pathogenesis of cancers that often involve the dysfunction of many genes and regulatory interactions. Thus, sophisticated classification model is in pressing need. In this study, we proposed an efficient approach, called ellipsoidFN (ellipsoid Feature Net), to model the disease complexity by ellipsoids and seek a set of heterogeneous biomarkers. Our approach achieves a non-linear classification scheme for the mixed samples by the ellipsoid concept, and at the same time uses a linear programming framework to efficiently select biomarkers from high-dimensional space. ellipsoidFN reduces the redundancy and improves the complementariness between the identified biomarkers, thus significantly enhancing the distinctiveness between cancers and normal samples, and even between cancer types. Numerical evaluation on real prostate cancer, breast cancer and leukemia gene expression datasets suggested that ellipsoidFN outperforms the state-of-the-art biomarker identification methods, and it can serve as a useful tool for cancer biomarker identification in the future. The Matlab code of ellipsoidFN is freely available from http://doc.aporc.org/wiki/EllipsoidFN. PMID:23262226

  4. miRNAs as potential biomarkers in early breast cancer detection following mammography.

    Science.gov (United States)

    Fu, Sidney W; Lee, Woojin; Coffey, Caitrin; Lean, Alexa; Wu, Xiaoling; Tan, Xiaohui; Man, Yan-Gao; Brem, Rachel F

    2016-01-01

    Breast cancer is the most common cancer among American women, except for skin cancers. About 12 % women in the United States will develop invasive breast cancer during their lifetime. Currently one of the most accepted model/theories is that ductal breast cancer (most common type of breast cancer) follows a linear progression: from normal breast epithelial cells to ductal hyperplasia to atypical ductal hyperplasia (ADH) to ductal carcinoma in situ (DCIS), and finally to invasive ductal carcinoma (IDC). Distinguishing pure ADH diagnosis from DCIS and/or IDC on mammography, and even combined with follow-up core needle biopsy (CNB) is still a challenge. Therefore subsequent surgical excision cannot be avoided to make a definitive diagnosis. MicroRNAs (miRNAs) are a highly abundant class of endogenous non-coding RNAs, which contribute to cancer initiation and progression, and are differentially expressed between normal and cancer tissues. They can function as either tumor suppressors or oncogenes. With accumulating evidence of the role of miRNAs in breast cancer progression, including our own studies, we sought to summarize the nature of early breast lesions and the potential use of miRNA molecules as biomarkers in early breast cancer detection. In particular, miRNA biomarkers may potentially serve as a companion tool following mammography screening and CNB. In the long-term, a better understanding of the molecular mechanisms underlying the miRNA signatures associated with breast cancer development could potentially result in the development of novel strategies for disease prevention and therapy. PMID:26819702

  5. Promising Urinary Protein Biomarkers for the Early Detection of Hepatocellular Carcinoma among High-Risk Hepatitis C Virus Egyptian Patients

    Directory of Open Access Journals (Sweden)

    Moemen AK Abdalla, Yousef Haj-Ahmad

    2012-01-01

    Full Text Available Hepatocellular Carcinoma is a major healthcare problem, representing the third most common cause of cancer-related mortality worldwide. There are 130 million Hepatitis C virus infected patients worldwide who are at a high-risk for developing Hepatocellular Carcinoma. Due to the fact that reliable parameters and/or tools for the early detection of Hepatocellular Carcinoma among high-risk individuals are severely lacking, Hepatocellular Carcinoma patients are always diagnosed at a late stage where surgical solutions or effective treatment are not possible. Urine was collected from 106 Hepatitis C infected patients patients, 32 of whom had already developed Hepatocellular Carcinoma and 74 patients who were diagnosed as Hepatocellular Carcinoma -free at the time of initial sample collection. In addition to these patients, urine samples were also collected from 12 healthy control individuals. Total urinary proteins were isolated from the urine samples and LC-MS/MS was used to identify potential protein HCC biomarker candidates. This was followed by validating relative expression levels of proteins present in urine among all the patients using quantitative real time-PCR. This approach revealed that significant over-expression of three proteins: DJ-1, Chromatin Assembly Factor-1 (CAF-1 and Heat Shock Protein 60 (HSP60, was a characteristic event among Hepatocellular Carcinoma - post Hepatitis C virus infected patients. As a single-based Hepatocellular Carcinoma biomarker, CAF-1 over-expression identified Hepatocellular Carcinoma among Hepatitis C virus infected patients with a specificity of 90%, sensitivity of 66% and with an overall diagnostic accuracy of 78%. Moreover, the CAF-1/HSP60 tandem identified Hepatocellular Carcinoma among Hepatitis C virus infected patients with a specificity of 92%, sensitivity of 61% and with an overall diagnostic accuracy of 77%.

  6. Promising Urinary Protein Biomarkers for the Early Detection of Hepatocellular Carcinoma among High-Risk Hepatitis C Virus Egyptian Patients.

    Science.gov (United States)

    Abdalla, Moemen Ak; Haj-Ahmad, Yousef

    2012-01-01

    Hepatocellular Carcinoma is a major healthcare problem, representing the third most common cause of cancer-related mortality worldwide. There are 130 million Hepatitis C virus infected patients worldwide who are at a high-risk for developing Hepatocellular Carcinoma. Due to the fact that reliable parameters and/or tools for the early detection of Hepatocellular Carcinoma among high-risk individuals are severely lacking, Hepatocellular Carcinoma patients are always diagnosed at a late stage where surgical solutions or effective treatment are not possible. Urine was collected from 106 Hepatitis C infected patients patients, 32 of whom had already developed Hepatocellular Carcinoma and 74 patients who were diagnosed as Hepatocellular Carcinoma -free at the time of initial sample collection. In addition to these patients, urine samples were also collected from 12 healthy control individuals. Total urinary proteins were isolated from the urine samples and LC-MS/MS was used to identify potential protein HCC biomarker candidates. This was followed by validating relative expression levels of proteins present in urine among all the patients using quantitative real time-PCR. This approach revealed that significant over-expression of three proteins: DJ-1, Chromatin Assembly Factor-1 (CAF-1) and Heat Shock Protein 60 (HSP60), was a characteristic event among Hepatocellular Carcinoma - post Hepatitis C virus infected patients. As a single-based Hepatocellular Carcinoma biomarker, CAF-1 over-expression identified Hepatocellular Carcinoma among Hepatitis C virus infected patients with a specificity of 90%, sensitivity of 66% and with an overall diagnostic accuracy of 78%. Moreover, the CAF-1/HSP60 tandem identified Hepatocellular Carcinoma among Hepatitis C virus infected patients with a specificity of 92%, sensitivity of 61% and with an overall diagnostic accuracy of 77%. PMID:23074380

  7. Discovery of protein profiles for differentiated thyroid cancer using SELDI TOF MS

    International Nuclear Information System (INIS)

    Low sensitivity of diagnostic whole body iodine scintigraphy and intermediate range of serum thyroglobulin (Tg) with or without anti-Tg antibody make it difficult to select the patients with differentiated thyroid cancer who need further treatment. Surfaced Enhanced Laser Desorption /Ionization - Time of Flight - Mass Spectrometry (SELDI TOF MS) is a useful method to evaluate cancer proteome, biomarkers and patterns of biomarkers. In this preliminary study, we evaluated and developed protein profiles for the discrimination between patients with differentiated thyroid cancer and non-cancer controls using SELDI technology. Serum samples from 10 healthy controls and from 14 patients with papillary thyroid cancer before thyroidectomy were analyzed by SELDI MS. Multiple protein peaks detected were analyzed by the computer software to develop a classifier for separating cancer patients form controls. The classifier was then challenged to 24 serum samples to determine the validity and accuracy of the classification system. All patients with papillary thyroid cancer had no other concomitant cancer or thyroiditis. Their serum Tg concentration was 55.8 (1.5 - 249.7) and 2 patients had extra-thyroidal extension. According to the SELDI analysis, protein peaks at 3696 Da, 4178 Da, and 8149 Da were more prominent in cancer patients than controls in various degrees. Among those, protein peak at 4178 Da was determined as classifier by computer software, and the sensitivity, specificity and accuracy for discrimination of cancer patients from controls was 92.9% (13/14), 90% (9/10) and 91.7% respectively. This preliminary study suggests that serum protein profiles of differentiated thyroid cancer can be used for differentiation between cancer patients and non-cancer controls. And further clinical studies in various test sets will offer useful information in selecting patients who require treatment

  8. Multiplexed electrochemical protein detection and translation to personalized cancer diagnostics.

    Science.gov (United States)

    Rusling, James F

    2013-06-01

    Measuring diagnostic panels of multiple proteins promises a new, personalized approach to early detection and therapy of diseases like cancer. Levels of biomarker proteins in patient serum can provide a continually updated record of disease status. Research in electrochemical detection of proteins has produced exquisitely sensitive approaches. Most utilize ELISA-like sandwich immunoassays incorporating various aspects of nanotechnology. Several of these ultrasensitive methodologies have been extended to microfluidic multiplexed protein detection, but engineered solutions are needed to measure more proteins in a single device from a small patient sample such as a drop of blood or tissue lysate. To achieve clinical or point-of-care (POC) use, simplicity and low cost are essential. In multiplexed microfluidic immunoassays, required reagent additions and washing steps pose a significant problem calling for creative engineering. A grand challenge is to develop a general cancer screening device to accurately measure 50-100 proteins in a simple, cost-effective fashion. This will require creative solutions to simplified reagent addition and multiplexing. PMID:23635325

  9. Automated assessment of bilateral breast volume asymmetry as a breast cancer biomarker during mammographic screening

    Science.gov (United States)

    Williams, Alex C.; Hitt, Austin; Voisin, Sophie; Tourassi, Georgia

    2013-03-01

    The biological concept of bilateral symmetry as a marker of developmental stability and good health is well established. Although most individuals deviate slightly from perfect symmetry, humans are essentially considered bilaterally symmetrical. Consequently, increased fluctuating asymmetry of paired structures could be an indicator of disease. There are several published studies linking bilateral breast size asymmetry with increased breast cancer risk. These studies were based on radiologists' manual measurements of breast size from mammographic images. We aim to develop a computerized technique to assess fluctuating breast volume asymmetry in screening mammograms and investigate whether it correlates with the presence of breast cancer. Using a large database of screening mammograms with known ground truth we applied automated breast region segmentation and automated breast size measurements in CC and MLO views using three well established methods. All three methods confirmed that indeed patients with breast cancer have statistically significantly higher fluctuating asymmetry of their breast volumes. However, statistically significant difference between patients with cancer and benign lesions was observed only for the MLO views. The study suggests that automated assessment of global bilateral asymmetry could serve as a breast cancer risk biomarker for women undergoing mammographic screening. Such biomarker could be used to alert radiologists or computer-assisted detection (CAD) systems to exercise increased vigilance if higher than normal cancer risk is suspected.

  10. Major cancer protein amplifies global gene expression

    Science.gov (United States)

    Scientists may have discovered why a protein called MYC can provoke a variety of cancers. Like many proteins associated with cancer, MYC helps regulate cell growth. A new study carried out by researchers at the National Institutes of Health and colleagues

  11. Identification and validation of oncologic miRNA biomarkers for luminal A-like breast cancer.

    Directory of Open Access Journals (Sweden)

    Ailbhe M McDermott

    Full Text Available INTRODUCTION: Breast cancer is a common disease with distinct tumor subtypes phenotypically characterized by ER and HER2/neu receptor status. MiRNAs play regulatory roles in tumor initiation and progression, and altered miRNA expression has been demonstrated in a variety of cancer states presenting the potential for exploitation as cancer biomarkers. Blood provides an excellent medium for biomarker discovery. This study investigated systemic miRNAs differentially expressed in Luminal A-like (ER+PR+HER2/neu- breast cancer and their effectiveness as oncologic biomarkers in the clinical setting. METHODS: Blood samples were prospectively collected from patients with Luminal A-like breast cancer (n = 54 and controls (n = 56. RNA was extracted, reverse transcribed and subjected to microarray analysis (n = 10 Luminal A-like; n = 10 Control. Differentially expressed miRNAs were identified by artificial neural network (ANN data-mining algorithms. Expression of specific miRNAs was validated by RQ-PCR (n = 44 Luminal A; n = 46 Control and potential relationships between circulating miRNA levels and clinicopathological features of breast cancer were investigated. RESULTS: Microarray analysis identified 76 differentially expressed miRNAs. ANN revealed 10 miRNAs for further analysis (miR-19b, miR-29a, miR-93, miR-181a, miR-182, miR-223, miR-301a, miR-423-5p, miR-486-5 and miR-652. The biomarker potential of 4 miRNAs (miR-29a, miR-181a, miR-223 and miR-652 was confirmed by RQ-PCR, with significantly reduced expression in blood of women with Luminal A-like breast tumors compared to healthy controls (p = 0.001, 0.004, 0.009 and 0.004 respectively. Binary logistic regression confirmed that combination of 3 of these miRNAs (miR-29a, miR-181a and miR-652 could reliably differentiate between cancers and controls with an AUC of 0.80. CONCLUSION: This study provides insight into the underlying molecular portrait of Luminal A-like breast

  12. Embracing an integromic approach to tissue biomarker research in cancer: Perspectives and lessons learned

    OpenAIRE

    Li, Gerald; Bankhead, Peter; Dunne, Philip D.; O'Reilly, Paul G; James, Jacqueline A.; Salto-Tellez, Manuel; Hamilton, Peter; McArt, Darragh G.

    2016-01-01

    Modern approaches to biomedical research and diagnostics targeted towards precision medicine are generating ‘big data’ across a range of high-throughput experimental and analytical platforms. Integrative analysis of this rich clinical, pathological, molecular and imaging data represents one of the greatest bottlenecks in biomarker discovery research in cancer and other diseases. Following on from the publication of our successful framework for multimodal data amalgamation and integrative anal...

  13. Composite Biomarkers For Non-invasive Screening, Diagnosis And Prognosis Of Colorectal Cancer

    KAUST Repository

    Mansour, Hicham

    2014-09-11

    The present invention concerns particular biomarkers for diagnosing and/or prognosticating colorectal cancer, in particular in a non-invasive manner. The methods and compositions concern analysis of methylation patterns of one or more genes from a set of 29 genes identified as described herein. In certain embodiments, the gene set includes at least P15.INK4b, SST, GAS7, CNRIP1, and PIK3CG.

  14. Tissue Biomarkers in Prognostication of Serous Ovarian Cancer following Neoadjuvant Chemotherapy

    OpenAIRE

    Binny Khandakar; Sandeep R Mathur; Lalit Kumar; Sunesh Kumar; Siddhartha Datta Gupta; Venkateswaran K Iyer; Kalaivani, M.

    2014-01-01

    Serous ovarian cancer (SOC) is a significant cause of morbidity and mortality in females with poor prognosis because of advanced stage at presentation. Recently, neoadjuvant chemotherapy (NACT) is being used for management of advanced SOC, but role of tissue biomarkers in prognostication following NACT is not well established. The study was conducted on advanced stage SOC patients (n = 100) that were treated either conventionally (n = 50) or with NACT (n = 50), followed by surgery. In order t...

  15. Radiotherapy diagnostic biomarkers in radioresistant human H460 lung cancer stem-like cells

    OpenAIRE

    Yun, Hong Shik; Baek, Jeong-Hwa; Yim, Ji-Hye; Um, Hong-Duck; Park, Jong Kuk; Song, Jie-Young; Park, In-Chul; KIM, JAE-SUNG; Lee, Su-Jae; Lee, Chang-Woo; Hwang, Sang-Gu

    2016-01-01

    ABSTRACT Tumor cell radioresistance is a major contributor to radiotherapy failure, highlighting the importance of identifying predictive biomarkers for radioresistance. In this work, we established a radioresistant H460 (RR-H460) cell line from parental radiosensitive H460 lung cancer cells by exposure to fractionated radiation. The radiation-resistant, anti-apoptotic phenotype of RR-H460 cell lines was confirmed by their enhanced clonogenic survival and increased expression of the radioresi...

  16. Biomarkers of endometrial cancer and related gynaecological malignancies

    NARCIS (Netherlands)

    Seeber, L.M.S.

    2010-01-01

    In the Western World, endometrial cancer is the most common malignancy of the female genital tract. Endometrioid endometrial carcinoma (EEC or Type I tumour), accounts for approximately 75% of cases. Type II tumours, of which uterine papillary serous carcinoma (UPSC) is the most common subtype, are

  17. Biomarkers of Aspergillus spores: Strain typing and protein identification

    Czech Academy of Sciences Publication Activity Database

    Šulc, Miroslav; Pešlová, Kateřina; Žabka, Martin; Hajdúch, M.; Havlíček, Vladimír

    2009-01-01

    Roč. 280, 1-3 (2009), s. 162-168. ISSN 1387-3806 R&D Projects: GA MŠk LC07017; GA ČR GP203/05/P575 Institutional research plan: CEZ:AV0Z50200510 Keywords : aspergillus * spore * protein Subject RIV: EE - Microbiology, Virology Impact factor: 2.117, year: 2009

  18. Surfactant protein D, Club cell protein 16, Pulmonary and activation-regulated chemokine, C-reactive protein, and Fibrinogen biomarker variation in chronic obstructive lung disease

    DEFF Research Database (Denmark)

    Johansson, Sofie Lock; Vestbo, J.; Sorensen, G. L.

    2014-01-01

    assessment of patients, prediction of risk, and guidance of treatment. The aim of this review is to provide a comprehensive summary of observations for a selection of recently investigated pulmonary inflammatory biomarkers (Surfactant protein D (SP-D), Club cell protein 16 (CC-16), and Pulmonary and...

  19. Mutant p53 proteins alter cancer cell secretome and tumour microenvironment: Involvement in cancer invasion and metastasis.

    Science.gov (United States)

    Cordani, Marco; Pacchiana, Raffaella; Butera, Giovanna; D'Orazi, Gabriella; Scarpa, Aldo; Donadelli, Massimo

    2016-07-01

    An ever-increasing number of studies highlight the role of mutant p53 proteins in the alteration of cancer cell secretome and in the modification of tumour microenvironment, sustaining an invasive phenotype of cancer cell. The knowledge of the molecular mechanisms underlying the interplay between mutant p53 proteins and the microenvironment is becoming fundamental for the identification of both efficient anticancer therapeutic strategies and novel serum biomarkers. In this review, we summarize the novel findings concerning the regulation of secreted molecules by cancer cells bearing mutant TP53 gene. In particular, we highlight data from available literature, suggesting that mutant p53 proteins are able to (i) alter the secretion of enzymes involved in the modulation of extracellular matrix components; (ii) alter the secretion of inflammatory cytokines; (iii) increase the extracellular acidification; and (iv) regulate the crosstalk between cancer and stromal cells. PMID:27045472

  20. Systematic review and meta-analysis of tumor biomarkers in predicting prognosis in esophageal cancer

    International Nuclear Information System (INIS)

    Esophageal cancer (EC) is a frequently occurring cancer with poor prognosis despite combined therapeutic strategies. Many biomarkers have been proposed as predictors of adverse events. We sought to assess the prognostic value of biomarkers in predicting the overall survival of esophageal cancer and to help guide personalized cancer treatment to give patients the best chance at remission. We conducted a systematic review and meta-analysis of the published literature to summarize evidence for the discriminatory ability of prognostic biomarkers for esophageal cancer. Relevant literature was identified using the PubMed database on April 11, 2012, and conformed to the REMARK criteria. The primary endpoint was overall survival and data were synthesized with hazard ratios (HRs). We included 109 studies, exploring 13 different biomarkers, which were subjected to quantitative meta-analysis. Promising markers that emerged for the prediction of overall survival in esophageal squamous cell cancer included VEGF (18 eligible studies, n = 1476, HR = 1.85, 95% CI, 1.55-2.21), cyclin D1 (12 eligible studies, n = 1476, HR = 1.82, 95% CI, 1.50-2.20), Ki-67 (3 eligible studies, n = 308, HR = 1.11, 95% CI, 0.70-1.78) and squamous cell carcinoma antigen (5 eligible studies, n = 700, HR = 1.28, 95% CI, 0.97-1.69); prognostic markers for esophageal adenocarcinoma included COX-2 (2 eligible studies, n = 235, HR = 3.06, 95% CI, 2.01-4.65) and HER-2 (3 eligible studies, n = 291, HR = 2.15, 95% CI, 1.39-3.33); prognostic markers for uncategorized ECs included p21 (9 eligible studies, n = 858, HR = 1.27, 95% CI, 0.75-2.16), p53 (31 eligible studies, n = 2851, HR = 1.34, 95% CI, 1.21-1.48), CRP (8 eligible studies, n = 1382, HR = 2.65, 95% CI, 1.64-4.27) and hemoglobin (5 eligible studies, n = 544, HR = 0.91, 95% CI, 0.83-1.00). Although some modest bias cannot be excluded, this review supports the involvement of biomarkers to be associated with EC overall survival

  1. Amyloid-related biomarkers and axonal damage proteins in parkinsonian syndromes

    DEFF Research Database (Denmark)

    Bech, Sara; Hjermind, Lena E; Salvesen, Lisette;

    2012-01-01

    the diagnosing of PS. We investigated the levels of the light subunit of neurofilament triplet protein (NF-L), total tau and phosphorylated tau, amyloid-ß(1-42), and the soluble a- and ß-cleaved fragments of amyloid precursor proteins in a cohort of patients with various PS.......Clinical differentiation between parkinsonian syndromes (PS) remains a challenge despite well-established clinical diagnostic criteria. Specific diagnostic biomarkers have yet to be identified, though in recent years, studies have been published on the aid of certain brain related proteins (BRP) in...

  2. Influence of Long-Distance Bicycle Riding on Serum/Urinary Biomarkers of Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Zbynek Heger

    2016-03-01

    Full Text Available Herein, we present a study focused on the determination of the influence of long-distance (53 km bicycle riding on levels of chosen biochemical urinary and serum prostate cancer (PCa biomarkers total prostate-specific antigen (tPSA, free PSA (fPSA and sarcosine. Fourteen healthy participants with no evidence of prostate diseases, in the age range from 49–57 years with a median of 52 years, underwent physical exercise (mean race time of 150 ± 20 min, elevation increase of 472 m and pre- and post-ride blood/urine sampling. It was found that bicycle riding resulted in elevated serum uric acid (p = 0.001, median 271.76 vs. 308.44 µmol/L pre- and post-ride, respectively, lactate (p = 0.01, median 2.98 vs. 4.8 mmol/L and C-reactive protein (p = 0.01, 0.0–0.01 mg/L. It is noteworthy that our work supports the studies demonstrating an increased PSA after mechanical manipulation of the prostate. The subjects exhibited either significantly higher post-ride tPSA (p = 0.002, median 0.69 vs. 1.1 ng/mL pre- and post-ride, respectively and fPSA (p = 0.028, median 0.25 vs. 0.35 ng/mL. Contrary to that, sarcosine levels were not significantly affected by physical exercise (p = 0.20, median 1.64 vs. 1.92 µmol/mL for serum sarcosine, and p = 0.15, median 0.02 µmol/mmol of creatinine vs. 0.01 µmol/mmol of creatinine for urinary sarcosine. Taken together, our pilot study provides the first evidence that the potential biomarker of PCa—sarcosine does not have a drawback by means of a bicycle riding-induced false positivity, as was shown in the case of PSA.

  3. Influence of Long-Distance Bicycle Riding on Serum/Urinary Biomarkers of Prostate Cancer.

    Science.gov (United States)

    Heger, Zbynek; Gumulec, Jaromir; Ondrak, Ales; Skoda, Jan; Zitka, Zdenek; Cernei, Natalia; Masarik, Michal; Zitka, Ondrej; Adam, Vojtech

    2016-01-01

    Herein, we present a study focused on the determination of the influence of long-distance (53 km) bicycle riding on levels of chosen biochemical urinary and serum prostate cancer (PCa) biomarkers total prostate-specific antigen (tPSA), free PSA (fPSA) and sarcosine. Fourteen healthy participants with no evidence of prostate diseases, in the age range from 49-57 years with a median of 52 years, underwent physical exercise (mean race time of 150 ± 20 min, elevation increase of 472 m) and pre- and post-ride blood/urine sampling. It was found that bicycle riding resulted in elevated serum uric acid (p = 0.001, median 271.76 vs. 308.44 µmol/L pre- and post-ride, respectively), lactate (p = 0.01, median 2.98 vs. 4.8 mmol/L) and C-reactive protein (p = 0.01, 0.0-0.01 mg/L). It is noteworthy that our work supports the studies demonstrating an increased PSA after mechanical manipulation of the prostate. The subjects exhibited either significantly higher post-ride tPSA (p = 0.002, median 0.69 vs. 1.1 ng/mL pre- and post-ride, respectively) and fPSA (p = 0.028, median 0.25 vs. 0.35 ng/mL). Contrary to that, sarcosine levels were not significantly affected by physical exercise (p = 0.20, median 1.64 vs. 1.92 µmol/mL for serum sarcosine, and p = 0.15, median 0.02 µmol/mmol of creatinine vs. 0.01 µmol/mmol of creatinine for urinary sarcosine). Taken together, our pilot study provides the first evidence that the potential biomarker of PCa-sarcosine does not have a drawback by means of a bicycle riding-induced false positivity, as was shown in the case of PSA. PMID:26999116

  4. Plasma levels of the MMP-9:TIMP-1 complex as prognostic biomarker in breast cancer

    DEFF Research Database (Denmark)

    Thorsen, Stine Buch; Christensen, Sarah Louise T; Würtz, Sidse Ørnbjerg;

    2013-01-01

    Worldwide more than one million women are annually diagnosed with breast cancer. A considerable fraction of these women receive systemic adjuvant therapy; however, some are cured by primary surgery and radiotherapy alone. Prognostic biomarkers guide stratification of patients into different risk...... groups and hence improve management of breast cancer patients. Plasma levels of Matrix Metalloproteinase-9 (MMP-9) and its natural inhibitor Tissue inhibitor of metalloproteinase-1 (TIMP-1) have previously been associated with poor patient outcome and resistance to certain forms of chemotherapy. To...

  5. Surface plasmon resonance imaging for parallelized detection of protein biomarkers

    Czech Academy of Sciences Publication Activity Database

    Piliarik, Marek; Párová, Lucie; Vaisocherová, Hana; Homola, Jiří

    Vol. 7356. Bellingham, Washington : SPIE, 2009 - (Baldini, F.; Homola, J.; Lieberman, R.), 73560D1-73560D8 ISBN 9780819476302. ISSN 0277-786X. - (Proceedings of SPIE. 7356). [Optical Sensors 2009. Praha (CZ), 20.04.2009-22.04.2009] R&D Projects: GA AV ČR KAN200670701 Institutional research plan: CEZ:AV0Z20670512 Keywords : Surface plasmon resonance imaging * Biosensor * Protein detection Subject RIV: JB - Sensors, Measurment, Regulation

  6. The novel prostate cancer antigen 3 (PCA3 biomarker

    Directory of Open Access Journals (Sweden)

    Andreas Bourdoumis

    2010-12-01

    Full Text Available PCA3 is a prostate specific, nonprotein coding RNA that is significantly over expressed in prostate cancer, without any correlation to prostatic volume and/or other prostatic diseases (e.g. prostatitis. It can now easily be measured in urine with a novel transcription-mediated amplification based test. Quantification of PCA3 mRNA levels can predict the outcome of prostatic biopsies with a higher specificity rate in comparison to PSA. Several studies have demonstrated that PCA3 can be used as a prognostic marker of prostate cancer, especially in conjunction with other predictive markers. Novel PCA3-based nomograms have already been introduced into clinical practice. PCA3 test may be of valuable help in several PSA quandary situations such as negative prostatic biopsies, concomitant prostatic diseases, and active surveillance. Results from relevant clinical studies, comparative with PSA, are warranted in order to confirm the perspective of PCA3 to substitute PSA.

  7. Circulating Biomarkers in Advanced Colorectal Cancer Patients Randomly Assigned to Three Bevacizumab-Based Regimens

    Directory of Open Access Journals (Sweden)

    Antonia Martinetti

    2014-08-01

    Full Text Available The need to identify biomarkers for bevacizumab-based treatment in advanced colorectal cancer is imperative. The aim of this study was to investigate the prognostic role of circulating VEGF, PDGF, SDF-1, osteopontin and CEA in patients randomly assigned to three bevacizumab-based regimens. Plasma samples from 50 patients treated at a single Institution were analysed using the multiplex assay BioPlex™ 2200 (Bio-Rad Laboratories, Inc, Berkeley, CA, USA at baseline, before first three cycles and subsequently every three cycles until disease progression. Prognostic analyses of baseline values were performed using multivariable Cox models, including disease extension >10 cm or ≤10 cm (measured as the sum of the diameters for all target lesions as adjustment factor. The association between progression-free and overall survival and biomarkers modulation during treatment was studied using multivariable Cox models, which included summary statistics synthesizing during-treatment modulation together with disease extension. The biomarkers significantly associated with disease extension were baseline CEA (p = 0.012 and SDF-1 (p = 0.030. High values of VEGF and SDF-1 tended to be associated with worse prognosis, especially in terms of overall survival. The negative prognostic trend was more marked for baseline CEA as compared to other biomarkers; increasing values during treatment was significantly related to worse prognosis independently of disease extension (p = 0.007 and 0.016 for progression-free and overall survival, respectively. VEGF is related to bevacizumab pharmacodynamics and is associated to other angiogenic cytokines; some of the proposed biomarkers such as SDF-1 and CEA should be further validated for prognosis assessment and monitoring of bevacizumab-based treatment of advanced colorectal cancer.

  8. Biomarkers of endometrial cancer and related gynaecological malignancies

    OpenAIRE

    Seeber, L.M.S.

    2010-01-01

    In the Western World, endometrial cancer is the most common malignancy of the female genital tract. Endometrioid endometrial carcinoma (EEC or Type I tumour), accounts for approximately 75% of cases. Type II tumours, of which uterine papillary serous carcinoma (UPSC) is the most common subtype, are less common. Since classification as EEC or UPSC has therapeutic and prognostic implications, it is important to make the proper diagnosis. UPSC share their aggressive clinical behaviour and their ...

  9. Impact of biospecimens handling on biomarker research in breast cancer

    Directory of Open Access Journals (Sweden)

    Callari Maurizio

    2009-11-01

    Full Text Available Abstract Background Gene expression profiling is moving from the research setting to the practical clinical use. Gene signatures able to correctly identify high risk breast cancer patients as well as to predict response to treatment are currently under intense investigation. While technical issues dealing with RNA preparation, choice of array platforms, statistical analytical tools are taken into account, the tissue collection process is seldom considered. The time elapsed between surgical tissue removal and freezing of samples for biological characterizations is rarely well defined and/or recorded even for recently stored samples, despite the publications of standard operating procedures for biological sample collection for tissue banks. Methods Breast cancer samples from 11 patients were collected immediately after surgical removal and subdivided into aliquots. One was immediately frozen and the others were maintained at room temperature for respectively 2, 6 and 24 hrs. RNA was extracted and gene expression profile was determined using cDNA arrays. Phosphoprotein profiles were studied in parallel. Results Delayed freezing affected the RNA quality only in 3 samples, which were not subjected to gene profiling. In the 8 breast cancer cases with apparently intact RNA also in sample aliquots frozen at delayed times, 461 genes were modulated simply as a function of freezing timing. Some of these genes were included in gene signatures biologically and clinically relevant for breast cancer. Delayed freezing also affected detection of phosphoproteins, whose pattern may be crucial for clinical decision on target-directed drugs. Conclusion Time elapsed between surgery and freezing of samples appears to have a strong impact and should be considered as a mandatory variable to control for clinical implications of inadequate tissue handling.

  10. Role of MGMT as biomarker in colorectal cancer

    OpenAIRE

    Inno, Alessandro; Fanetti, Giuseppe; Di Bartolomeo, Maria; Gori, Stefania; Maggi, Claudia; Cirillo, Massimo; Iacovelli, Roberto; Nichetti, Federico; Martinetti, Antonia; de Braud, Filippo; Bossi, Ilaria; Pietrantonio, Filippo

    2014-01-01

    O6-methylguanine DNA methyltransferase (MGMT) gene promoter methylation plays an important role in colorectal carcinogenesis, occurring in about 30%-40% of metastatic colorectal cancer. Its prognostic role has not been defined yet, but loss of expression of MGMT, which is secondary to gene promoter methylation, results in an interesting high response to alkylating agents such as dacarbazine and temozolomide. In a phase 2 study on heavily pre-treated patients with MGMT methylated metastatic co...

  11. Bioconjugated lanthanide luminescent helicates as multilabels for lab-on-a-chip detection of cancer biomarkers.

    Science.gov (United States)

    Fernández-Moreira, Vanesa; Song, Bo; Sivagnanam, Venkataragavalu; Chauvin, Anne-Sophie; Vandevyver, Caroline D B; Gijs, Martin; Hemmilä, Ilkka; Lehr, Hans-Anton; Bünzli, Jean-Claude G

    2010-01-01

    The lanthanide binuclear helicate [Eu(2)(L(C2(CO(2)H)))(3)] is coupled to avidin to yield a luminescent bioconjugate EuB1 (Q = 9.3%, tau((5)D(0)) = 2.17 ms). MALDI/TOF mass spectrometry confirms the covalent binding of the Eu chelate and UV-visible spectroscopy allows one to determine a luminophore/protein ratio equal to 3.2. Bio-affinity assays involving the recognition of a mucin-like protein expressed on human breast cancer MCF-7 cells by a biotinylated monoclonal antibody 5D10 to which EuB1 is attached via avidin-biotin coupling demonstrate that (i) avidin activity is little affected by the coupling reaction and (ii) detection limits obtained by time-resolved (TR) luminescence with EuB1 and a commercial Eu-avidin conjugate are one order of magnitude lower than those of an organic conjugate (FITC-streptavidin). In the second part of the paper, conditions for growing MCF-7 cells in 100-200 microm wide microchannels engraved in PDMS are established; we demonstrate that EuB1 can be applied as effectively on this lab-on-a-chip device for the detection of tumour-associated antigens as on MCF-7 cells grown in normal culture vials. In order to exploit the versatility of the ligand used for self-assembling [Ln(2)(L(C2(CO(2)H)))(3)] helicates, which sensitizes the luminescence of both Eu(III) and Tb(III) ions, a dual on-chip assay is proposed in which estrogen receptors (ERs) and human epidermal growth factor receptors (Her2/neu) can be simultaneously detected on human breast cancer tissue sections. The Ln helicates are coupled to two secondary antibodies: ERs are visualized by red-emitting EuB4 using goat anti-mouse IgG and Her2/neu receptors by green-emitting TbB5 using goat anti-rabbit IgG. The fact that the assay is more than 6 times faster and requires 5 times less reactants than conventional immunohistochemical assays provides essential advantages over conventional immunohistochemistry for future clinical biomarker detection. PMID:20024180

  12. Impedimetric Detection of Mutant p53 Biomarker-Driven Metastatic Breast Cancers under Hyposmotic Pressure

    OpenAIRE

    Shi, Menglu; Shtraizent, Nataly; Polotskaia, Alla; Bargonetti, Jill; Matsui, Hiroshi

    2014-01-01

    In cancer cells, the oncogenic mutant p53 (mtp53) protein is present at high levels and gain-of-function (GOF) activities with more expression of mtp53 proteins contribute to tumor growth and metastasis. Robust analytical approaches that probe the degree of metastasis of cancer cells in connection with the mtp53 activity will be extremely useful not only for establishing a better cancer prognosis but also understanding the fundamental mechanism of mtp53 oncogenic action. Here we assessed the ...

  13. Biomarker-specific conjugated nanopolyplexes for the active coloring of stem-like cancer cells

    Science.gov (United States)

    Hong, Yoochan; Lee, Eugene; Choi, Jihye; Haam, Seungjoo; Suh, Jin-Suck; Yang, Jaemoon

    2016-06-01

    Stem-like cancer cells possess intrinsic features and their CD44 regulate redox balance in cancer cells to survive under stress conditions. Thus, we have fabricated biomarker-specific conjugated polyplexes using CD44-targetable hyaluronic acid and redox-sensible polyaniline based on a nanoemulsion method. For the most sensitive recognition of the cellular redox at a single nanoparticle scale, a nano-scattering spectrum imaging analyzer system was introduced. The conjugated polyplexes showed a specific targeting ability toward CD44-expressing cancer cells as well as a dramatic change in its color, which depended on the redox potential in the light-scattered images. Therefore, these polyaniline-based conjugated polyplexes as well as analytical processes that include light-scattering imaging and measurements of scattering spectra, clearly establish a systematic method for the detection and monitoring of cancer microenvironments.

  14. Biomarker-specific conjugated nanopolyplexes for the active coloring of stem-like cancer cells.

    Science.gov (United States)

    Hong, Yoochan; Lee, Eugene; Choi, Jihye; Haam, Seungjoo; Suh, Jin-Suck; Yang, Jaemoon

    2016-06-01

    Stem-like cancer cells possess intrinsic features and their CD44 regulate redox balance in cancer cells to survive under stress conditions. Thus, we have fabricated biomarker-specific conjugated polyplexes using CD44-targetable hyaluronic acid and redox-sensible polyaniline based on a nanoemulsion method. For the most sensitive recognition of the cellular redox at a single nanoparticle scale, a nano-scattering spectrum imaging analyzer system was introduced. The conjugated polyplexes showed a specific targeting ability toward CD44-expressing cancer cells as well as a dramatic change in its color, which depended on the redox potential in the light-scattered images. Therefore, these polyaniline-based conjugated polyplexes as well as analytical processes that include light-scattering imaging and measurements of scattering spectra, clearly establish a systematic method for the detection and monitoring of cancer microenvironments. PMID:27098318

  15. Effects of dietary protein and glycaemic index on biomarkers of bone turnover in children

    DEFF Research Database (Denmark)

    Dalskov, Stine-Mathilde; Müller, Martha; Ritz, Christian;

    2014-01-01

    For decades, it has been debated whether high protein intake compromises bone mineralisation, but no long-term randomised trial has investigated this in children. In the family-based, randomised controlled trial DiOGenes (Diet, Obesity and Genes), we examined the effects of dietary protein and...... glycaemic index (GI) on biomarkers of bone turnover and height in children aged 5-18 years. In two study centres, families with overweight parents were randomly assigned to one of five ad libitum-energy, low-fat (25-30 % energy (E%)) diets for 6 months: low protein/low GI; low protein/high GI; high protein....../low GI; high protein/high GI; control. They received dietary instructions and were provided all foods for free. Children, who were eligible and willing to participate, were included in the study. In the present analyses, we included children with data on plasma osteocalcin or urinary N...

  16. Ultrasensitive Detection of Low-Abundance Protein Biomarkers by Mass Spectrometry Signal Amplification Assay.

    Science.gov (United States)

    Du, Ruijun; Zhu, Lina; Gan, Jinrui; Wang, Yuning; Qiao, Liang; Liu, Baohong

    2016-07-01

    A mass spectrometry signal amplification method is developed for the ultrasensitive and selective detection of low-abundance protein biomarkers by utilizing tag molecules on gold nanoparticles (AuNPs). EpCAM and thrombin as model targets are captured by specific aptamers immobilized on the AuNPs. With laser desorption/ionization time-of-flight mass spectrometry (LDI-TOF MS), the mass tag molecules are detected to represent the protein biomarkers. Benefiting from the MS signal amplification, the assay can achieve a limit of detection of 100 aM. The method is further applied to detect thrombin in fetal bovine serum and EpCAM in cell lysates to demonstrate its selectivity and feasibility in complex biological samples. With the high sensitivity and specificity, the protocol shows great promise for providing a new route to single-cell analysis and early disease diagnosis. PMID:27253396

  17. B-Cell Activating Factor as a Cancer Biomarker and Its Implications in Cancer-Related Cachexia

    Directory of Open Access Journals (Sweden)

    Michal Rihacek

    2015-01-01

    Full Text Available B-cell activating factor (BAFF is a cytokine and adipokine of the TNF ligand superfamily. The main biological function of BAFF in maintaining the maturation of B-cells to plasma cells has recently made it a target of the first FDA-approved selective BAFF antibody, belimumab, for the therapy of systemic lupus erythematosus. Concomitantly, the role of BAFF in cancer has been a subject of research since its discovery. Here we review BAFF as a biomarker of malignant disease activity and prognostic factor in B-cell derived malignancies such as multiple myeloma. Moreover, anti-BAFF therapy seems to be a promising approach in treatment of B-cell derived leukemias/lymphomas. In nonhematologic solid tumors, BAFF may contribute to cancer progression by mechanisms both dependent on and independent of BAFF’s proinflammatory role. We also describe ongoing research into the pathophysiological link between BAFF and cancer-related cachexia. BAFF has been shown to contribute to inflammation and insulin resistance which are known to worsen cancer cachexia syndrome. Taking all the above together, BAFF is emerging as a biomarker of several malignancies and a possible hallmark of cancer cachexia.

  18. Candidate serum biomarkers for early intestinal cancer using 15N metabolic labeling and quantitative proteomics in the ApcMin/+ mouse.

    Science.gov (United States)

    Ivancic, Melanie M; Huttlin, Edward L; Chen, Xiaodi; Pleiman, Jennifer K; Irving, Amy A; Hegeman, Adrian D; Dove, William F; Sussman, Michael R

    2013-09-01

    Current screening procedures for colorectal cancer are imperfect and highly invasive and result in increased mortality rates due to low compliance. The goal of the experiments reported herein is to identify potential blood-based biomarkers indicative of early stage intestinal cancers using the ApcMin/+ mouse model of intestinal cancer as an experimental system. Serum proteins from tumor-bearing ApcMin/+ mice were quantitatively compared to tumor-free Apc+/+ wild-type mice via in anima metabolic labeling with 14N/15N-labeled Spirulina algae and an LTQ Orbitrap mass spectrometer. Out of 1116 total serum proteins quantified, this study identified 40 that were differentially expressed and correlated with the increase in intestinal neoplasms. A subset of these differentially expressed proteins underwent a secondary quantitative screen using selected reaction monitoring-mass spectrometry with stable isotope-labeled peptides. Using both quantitative techniques, we identified MGAM and COL1A1 as downregulated and ITIH3 and F5 as upregulated in serum. All but COL1A1 were similarly differentially expressed in the mRNA of neoplastic colonic tissues of ApcMin/+ mice compared to normal wild-type tissue. These differentially expressed proteins identified in the ApcMin/+ mouse model have provided a set of candidate biomarkers for future validation screens in humans. PMID:23924158

  19. Warehousing re-annotated cancer genes for biomarker meta-analysis.

    Science.gov (United States)

    Orsini, M; Travaglione, A; Capobianco, E

    2013-07-01

    Translational research in cancer genomics assigns a fundamental role to bioinformatics in support of candidate gene prioritization with regard to both biomarker discovery and target identification for drug development. Efforts in both such directions rely on the existence and constant update of large repositories of gene expression data and omics records obtained from a variety of experiments. Users who interactively interrogate such repositories may have problems in retrieving sample fields that present limited associated information, due for instance to incomplete entries or sometimes unusable files. Cancer-specific data sources present similar problems. Given that source integration usually improves data quality, one of the objectives is keeping the computational complexity sufficiently low to allow an optimal assimilation and mining of all the information. In particular, the scope of integrating intraomics data can be to improve the exploration of gene co-expression landscapes, while the scope of integrating interomics sources can be that of establishing genotype-phenotype associations. Both integrations are relevant to cancer biomarker meta-analysis, as the proposed study demonstrates. Our approach is based on re-annotating cancer-specific data available at the EBI's ArrayExpress repository and building a data warehouse aimed to biomarker discovery and validation studies. Cancer genes are organized by tissue with biomedical and clinical evidences combined to increase reproducibility and consistency of results. For better comparative evaluation, multiple queries have been designed to efficiently address all types of experiments and platforms, and allow for retrieval of sample-related information, such as cell line, disease state and clinical aspects. PMID:23639751

  20. Validation Processes of Protein Biomarkers in Serum—A Cross Platform Comparison

    Directory of Open Access Journals (Sweden)

    Harald Seitz

    2012-09-01

    Full Text Available Due to insufficient biomarker validation and poor performances in diagnostic assays, the candidate biomarker verification process has to be improved. Multi-analyte immunoassays are the tool of choice for the identification and detailed validation of protein biomarkers in serum. The process of identification and validation of serum biomarkers, as well as their implementation in diagnostic routine requires an application of independent immunoassay platforms with the possibility of high-throughput. This review will focus on three main multi-analyte immunoassay platforms: planar microarrays, multiplex bead systems and, array-based surface plasmon resonance (SPR chips. Recent developments of each platform will be discussed for application in clinical proteomics, principles, detection methods, and performance strength. The requirements for specific surface functionalization of assay platforms are continuously increasing. The reasons for this increase is the demand for highly sensitive assays, as well as the reduction of non-specific adsorption from complex samples, and with it high signal-to-noise-ratios. To achieve this, different support materials were adapted to the immobilized biomarker/ligand, allowing a high binding capacity and immobilization efficiency. In the case of immunoassays, the immobilized ligands are proteins, antibodies or peptides, which exhibit a diversity of chemical properties (acidic/alkaline; hydrophobic/hydrophilic; secondary or tertiary structure/linear. Consequently it is more challenging to develop immobilization strategies necessary to ensure a homogenous covered surface and reliable assay in comparison to DNA immobilization. New developments concerning material support for each platform are discussed especially with regard to increase the immobilization efficiency and reducing the non-specific adsorption from complex samples like serum and cell lysates.

  1. Serum protein profiles as potential biomarkers for infectious disease status in pigs

    OpenAIRE

    Koene Miriam GJ; Mulder Han A; Stockhofe-Zurwieden Norbert; Kruijt Leo; Smits Mari A

    2012-01-01

    Abstract Background In veterinary medicine and animal husbandry, there is a need for tools allowing the early warning of diseases. Preferably, tests should be available that warn farmers and veterinarians during the incubation periods of disease and before the onset of clinical signs. The objective of this study was to explore the potential of serum protein profiles as an early biomarker for infectious disease status. Serum samples were obtained from an experimental pig model for porcine circ...

  2. Host Protein Biomarkers Identify Active Tuberculosis in HIV Uninfected and Co-infected Individuals

    OpenAIRE

    Achkar, Jacqueline M.; Laetitia Cortes; Pascal Croteau; Corey Yanofsky; Marija Mentinova; Isabelle Rajotte; Michael Schirm; Yiyong Zhou; Ana Paula Junqueira-Kipnis; Kasprowicz, Victoria O.; Michelle Larsen; René Allard; Joanna Hunter; Eustache Paramithiotis

    2015-01-01

    Biomarkers for active tuberculosis (TB) are urgently needed to improve rapid TB diagnosis. The objective of this study was to identify serum protein expression changes associated with TB but not latent Mycobacterium tuberculosis infection (LTBI), uninfected states, or respiratory diseases other than TB (ORD). Serum samples from 209 HIV uninfected (HIV−) and co-infected (HIV+) individuals were studied. In the discovery phase samples were analyzed via liquid chromatography and mass spectrometry...

  3. Comparison of Protein Expression Profiles of Different Stages of Lymph Nodes Metastasis in Breast Cancer

    Directory of Open Access Journals (Sweden)

    Hui-Hua Lee, Chu-Ai Lim, Yew-Teik Cheong, Manjit Singh, Lay-Harn Gam

    2012-01-01

    Full Text Available Breast cancer is the most common cancer among women worldwide. Breast cancer metastasis primarily happens through lymphatic system, where the extent of lymph node metastasis is the major factor influencing staging, prognosis and therapeutic decision of the disease. We aimed to study the protein expression changes in different N (regional lymph nodes stages of breast cancer. Protein expression profiles of breast cancerous and adjacent normal tissues were mapped by proteomics approach that comprises of two-dimensional polyacrylamide gel electrophoresis (2D-PAGE and tandem mass spectrometry (LC-MS/MS analysis. Calreticulin and tropomyosin alpha 3 chains were the common up-regulated proteins in N0, N1 and N2 stages of breast cancer. Potential biomarker for each N stage was HSP 70 for N0, 80 k protein H precursor and PDI for N1 stage while 78 kDa glucose-regulated protein was found useful for N2 stage. In addition, significant up-regulation of PDI A3 was detected only in the metastasized breast cancer. The up-regulation expression of these proteins in cancerous tissues can potentially use as indicators for diagnosis, treatment and prognosis of different N stages of breast cancer.

  4. Correlations between diffusion-weighted imaging and breast cancer biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Martincich, Laura; Deantoni, Veronica; Bertotto, Ilaria; Liotti, Michele; Regge, Daniele [Unit of Radiology, Institute for Cancer Research and Treatment (IRCC), Candiolo, Turin (Italy); Redana, Stefania; Rossi, Valentina; Aglietta, Massimo; Montemurro, Filippo [Institute for Cancer Research and Treatment (IRCC), Division of Medical Oncology, Candiolo, Turin (Italy); Kubatzki, Franziska; Ponzone, Riccardo [Institute for Cancer Research and Treatment (IRCC), Division of Gynecological Oncology, Candiolo, Turin (Italy); Sarotto, Ivana [Unit of Pathology, Institute for Cancer Research and Treatment (IRCC), Candiolo, Turin (Italy)

    2012-07-15

    We evaluated whether the apparent diffusion coefficient (ADC) provided by diffusion-weighted imaging (DWI) varies according to biological features in breast cancer. DWI was performed in 190 patients undergoing dynamic contrast-enhanced magnetic resonance imaging (MRI) for local staging. For each of the 192 index cancers we studied the correlation between ADC and classical histopathological and immunohistochemical breast tumour features (size, histological type, grade, oestrogen receptor [ER] and Ki-67 expression, HER2 status). ADC was compared with immunohistochemical surrogates of the intrinsic subtypes (Luminal A; Luminal B; HER2-enriched; triple-negative). Correlations were analysed using the Mann-Whitney U and Kruskal-Wallis H tests. A weak, statistically significant correlation was observed between ADC values and the percentage of ER-positive cells (-0.168, P = 0.020). Median ADC values were significantly higher in ER-negative than in ER-positive tumours (1.110 vs 1.050 x 10{sup -3} mm{sup 2}/s, P = 0.015). HER2-enriched tumours had the highest median ADC value (1.190 x 10{sup -3} mm{sup 2}/s, range 0.950-2.090). Multiple comparisons showed that this value was significantly higher than that of Luminal A (1.025 x 10{sup -3} mm{sup 2}/s [0.700-1.340], P = 0.004) and Luminal B/HER2-negative (1.060 x 10{sup -3} mm{sup 2}/s [0.470-2.420], P = 0.008) tumours. A trend towards statistical significance (P = 0.018) was seen with Luminal B/HER2-positive tumours. ADC values vary significantly according to biological tumour features, suggesting that cancer heterogeneity influences imaging parameters. (orig.)

  5. Using LongSAGE to Detect Biomarkers of Cervical Cancer Potentially Amenable to Optical Contrast Agent Labelling

    Directory of Open Access Journals (Sweden)

    Julie M. Kneller

    2007-01-01

    Full Text Available Sixteen longSAGE libraries from four different clinical stages of cervical intraepithelial neoplasia have enabled us to identify novel cell-surface biomarkers indicative of CIN stage. By comparing gene expression profiles of cervical tissue at early and advanced stages of CIN, several genes are identified to be novel genetic markers. We present fifty-six cell-surface gene products differentially expressed during progression of CIN. These cell surface proteins are being examined to establish their capacity for optical contrast agent binding. Contrast agent visualization will allow real-time assessment of the physiological state of the disease process bringing vast benefi t to cancer care. The data discussed in this publication have been submitted to NCBIs Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/ and are accessible through GEO Series accession number GSE6252.

  6. Evaluation of serum procathepsin B, cystatin B and cystatin C as possible biomarkers of ovarian cancer

    Directory of Open Access Journals (Sweden)

    Elena A. Gashenko

    2013-08-01

    Full Text Available Objectives. To evaluate procathepsin B, as well as endogenous inhibitors of cysteine proteases (cystatin B and cystatin C in biological fluids as possible biomarkers of ovarian cancer. To observe levels of serum procathepsin B in different age groups. Study design. The sample (N=27 of women with gynaecological tumours included 18 patients with ovarian cancer (n=18 and 9 patients with benign ovarian tumours (n=9; 72 healthy women were in the control group. All patients were treated in Novosibirsk Regional Oncological Center, Russia. Serum samples of healthy women (n=40 aged 18–70 years were used as controls for common biomarker of ovarian cancer CA-125. In the Procathepsin B study, serum samples of healthy women (n=32 aged 18–40 years (n=14, 41–55 years (n=10 and 56–80 (n=8 years were used as controls. Methods. Common biomarker of ovarian cancer, CA-125, was assayed by using a commercial kit (Vector, Koltsovo, Novosibirsk Region, Russia. Procathepsin B was measured by means of a commercial kit for human procathepsin B (R&D, USA; cystatin C was measured by commercial ELISA kits for human (BioVendor, Czechia; cystatin B was measured by ELISA kits for human (USCN Life Science Inc., Wuhan, China. Statistical analysis was performed by one-way ANOVA (Statistica 10 Program. Results. In the control group, serum procathepsin B concentration did not reveal age dependency. In the ovarian cancer group, both levels of serum procathepsin B and standard biomarker CA-125 increased significantly (both p<0.001 compared with the control group. In the benign ovarian tumour group, serum procathepsin B (p<0.001 and CA-125 (p=0.004 increased about 2.5- and 8-fold compared to the control group. Serum cystatin B level increased up to 1.7-fold in the ovarian cancer group compared to the control group. The increase of serum CA-125 was about 3.5-fold higher (p=0.017 and procathepsin B was 1.8-fold higher (p<0.05 in the ovarian cancer group compared to the benign

  7. Screening for colorectal cancer risk biomarkers related to diet

    OpenAIRE

    Da Pieve, Chiara; Moore, Sharon; Velasco, Maria

    2010-01-01

    Background: Red and processed meat are associated with high risks of colorectal cancer due to the endogenous formation of O6-carboxymethyl guanine (O6CMG), a potent carcinogen. The aim of our research is to develop liquid chromatography tandem mass spectrometry (LC-MS/MS) analytical methods for the measurement of the DNA adducts, such as O6CMG and its nucleoside O6-carboxymethyl deoxyguanosine (O6CMdG), in urine samples and correlate it to different diets. Methods: Urine samples were coll...

  8. Aberrant p16 promoter hypermethylation in bronchial mucosae as a biomarker for the early detection of lung cancer

    Institute of Scientific and Technical Information of China (English)

    XIE Guang-shun; HOU Ai-rong; LI Long-yun; GAO Yan-ning; CHENG Shu-jun

    2006-01-01

    @@ Lung cancer is the leading cause of cancer related death in the world and its mortality could be greatly reduced by diagnosis and treatment in its early stages. Effective tools for the early detection of lung cancer and its high risk factors remain a major challenge. Biomarkers that detect lung cancer in its early stages or identify its pretumour lesions,enabling early therapeutic intervention, would be invaluable to improve its dismal prognosis.

  9. Detection of Melanoma Cancer Biomarker Dimethyl Disulfide Using Cavity Ringdown Spectroscopy at 266 nm.

    Science.gov (United States)

    Wang, Zhennan; Sun, Meixiu; Wang, Chuji

    2016-06-01

    Skin cells emit volatile organic compounds (VOCs), and some of them can be used as biomarkers for screening specific diseases. Dimethyl disulfide (DMDS) has been recently reported as a biomarker of melanoma skin cancer (Kwak et al. "Volatile Biomarkers from Human Melanoma Cells". J. Chromatogr. B. 2013. 931: 90-96.). With the motivation of diagnosing melanoma using DMDS as its biomarker, we explore the potential of measuring DMDS using an advanced laser spectroscopic technique as an alternative method. We report on the first DMDS measurements using an experimental system based on cavity ringdown spectroscopy (CRDS). The test samples were mixtures of DMDS vapor and nitrogen in different concentrations. Two sampling methods were investigated to dilute the DMDS sample to low concentrations for ringdown measurements. The results showed that the ringdown system responded to various DMDS concentrations linearly and a theoretical detection limit of sub-ppb (parts per billion) could be achieved at the absorption wavelength of 266 nm. This ringdown system exhibited a high dynamic range for DMDS measurements, from ppm (parts per million) to ppt (parts per trillion) levels, given different laser wavelengths used. The feasibility of developing a portable melanoma screening sensor using the CRDS technique was also demonstrated in this study. PMID:27076515

  10. AFP, PIVKAII, GP3, SCCA-1 and follisatin as surveillance biomarkers for hepatocellular cancer in non-alcoholic and alcoholic fatty liver disease

    International Nuclear Information System (INIS)

    The incidence and mortality of hepatocellular cancer (HCC) complicating alcoholic and non-alcoholic fatty liver diseases (ALD and NAFLD) is rising in western societies. Despite knowing the at risk populations for HCC development, the lack of sensitive and specific means of surveillance hampers disease detection at curable stages. The most widely used serum HCC marker is alpha-fetoprotein (AFP), while PIVKA-II, glypican-3 (GP3) and Squamous Cell Carcinoma Antigen -1 (SCCA-1) have been proposed as new biomarkers. Assessment of these HCC biomarkers has largely been performed in patients with viral hepatitis. We conducted a cross sectional study assessing the value of these serum proteins, as well a novel candidate biomarker -follistatin – in patients with HCC arising on a background of ALD or NAFLD. Pre-treatment serum samples from 50 patients with HCC arising on a background of ALD (n = 31) or NAFLD (n = 19) were assessed by specific ELISA assay for PIVKAII, Glypican-3, SCCA-1 and Follistatin. Results were compared and contrasted with a control patient group with biopsy proven steatohepatitis-related cirrhosis (n = 41). The diagnostic accuracy of each of the candidate biomarkers was evaluated using receiver operating characteristic (ROC) curve analysis, reporting the area under the curve (AUC) and its 95% confidence interval (CI). Performance was compared to that of the established biomarker, AFP. Serum levels of all proteins were assessed by specific ELISA assays. GP3, SCCA-1 and follistatin had no HCC surveillance benefit in these patients. AFP and PIVKAII were superior to the other markers, particularly in combination. We conclude that while novel means of surveillance are urgently required, the combination of AFP and PIVKAII for HCC is an improvement on AFP alone in ALD/NAFLD patients. Furthermore, our data in this homogenous subset of patients- particularly that confirming no role for SCCA-1 – suggests that the choice of optimal biomarkers for HCC

  11. Application of proteome technology in screening biomarkers associated with gastric cancer%蛋白质组技术在胃癌相关标志物筛查中的应用

    Institute of Scientific and Technical Information of China (English)

    Chibo Liu; Yong Liang; Haibao Wang; Chunqin Pan

    2008-01-01

    Objective:To initially explore the application of proteome technologies in study of serum,to establish two-dimensional gel electrophoresis (2-DE) profiles of human gastric cancer serum and paired normal serum,and to screen and identify differentially expressed proteins in poorly-differentiated gastric cancer serum and paired normal serum,in which try to find out significant biomarker candidates for gastric cancer.Methods:2-DE was adopted to separate the total proteins of poorly-differentiated gastric cancer serum and paired normal serum.After staining and analyzing by ImageMaster 2D Elite software,the differentially expressed proteins were identified by matrix-assisted laser desorption/ionization-time of flight- mass spectrometry (MALDI-TOF-MS).Results:2-DE serum profiles with high resolution were obtained.Five protein spots were found as differentially-expressed proteins and identified as Serpin B6 (Placental thrombin inhibitor) Cytoplasmic antiproteinase (CAP)(Protease inhibitor6) (P1-6),Septin-1 (LARP) (Serologically defined breast cancer antigen NY-BR-24),Kallikrein-6 precursor (Protease M) (Neurosin) (Zyme) (SP59),Hemoglobin beta chain,Hemoglobin beta chain and Beta-defensin 108 precursor (Beta-defensin 8) (DEFB-8).Conclusion:The differential proteins were demonstrated to present in poorly-differentiated gastric cancer serum and paired normal serum.The molecular biomarkers associated with poorly differentiated gastric cancer could be possibly identified by the high throughput screening proteome technology.

  12. Biomarker and animal models for assessment of retinoid efficacy in cancer chemoprevention

    Institute of Scientific and Technical Information of China (English)

    Richard M NILES

    2007-01-01

    Vitamin A is essential for normal growth and development. Epidemiology and laboratory studies suggest that decreased vitamin A levels and defective metabo-lisrn/action may contribute to the genesis of certain cancers. Based on this information, natural and synthetic derivatives of vitamin A (retinoids) have been used for chemoprevention of cancer. Retinoids have had some success in the chemoprevention of leukoplakia and in the decreased incidence of second prima-ties in head and neck cancer. There is little information on biomarkers that can be used to assess the efficacy of the chemopreventive activity of retinoids. The ability of retinoids to induce RARb has been consistently shown to correlate with the response of cells and tissues to retinoic acid, but few other biomarkers have been certified as indicators of retinoid activity. In light of the failure of the ATBC and CARET clinical intervention trials for chemoprevention of lung cancer, greater use of animal models for chemoprevention studies is necessary. The potential combination of phytochemicals that inhibit DNA methyltransferase activity with retinoids holds promise for more effective chemoprevention of retinoid-unrespon-sive premalignant lesions.

  13. Cytochrome P450 1A1 genetic polymorphisms as cancer biomarkers

    Directory of Open Access Journals (Sweden)

    A Bag

    2015-01-01

    Full Text Available Phase I metabolic enzyme CYP1A1 plays an important role in xenobiotics metabolism and has been extensively studied as a cancer risk biomarker. CYP1A1 is polymorphic and its four variants, e.g., CYP1A1* 2 A, CYP1A1* 2C, CYP1A1* 3 and CYP1A1* 4 with trivial names m1, m2, m3, and m4 respectively, are most commonly studied for cancer link. Gene- gene interaction studies combining polymorphisms of this enzyme with those of phase II detoxifying enzymes, especially glutathione S- transferases (GSTs revealed greater risk for cancer susceptibility. Variants of CYP1A1 have also been found to be associated with chemotherapeutic adverse- effects. Results of these studies, however, remained largely contradictory mainly because of lack of statistical power due to involvement of small sample size. Strongly powered experimental designs involving gene- gene, gene- environment interactions are required in order to validate CYP1A1 as reliable cancer- biomarker.

  14. Exosomes are fingerprints of originating cells: potential biomarkers for ovarian cancer

    Directory of Open Access Journals (Sweden)

    Kobayashi M

    2015-03-01

    Full Text Available Miharu Kobayashi, Gregory E Rice, Jorge Tapia, Murray D Mitchell, Carlos Salomon Exosome Biology Laboratory, Centre for Clinical Diagnostics, University of Queensland Centre for Clinical Research, Royal Brisbane and Women's Hospital, Brisbane, QLD, Australia. Abstract: The past decade has seen an extraordinary explosion of research in the field of extracellular vesicles, especially in a specific type of extracellular vesicles originating from endosomal compartments, called exosomes. Exosomes are a specific subtype of secreted vesicles that are defined as small (~30–120 nm but very stable membrane vesicles that are released from a wide range of cells, including normal and cancer cells. As the content of exosomes is cell type specific, it is believed that they are a "fingerprint" of the releasing cell and its metabolic status. We hypothesized that the exosomes and their specific exosomal content (eg, microribonucleic acid represent a precious biomedical tool and may be used as biomarkers for the diagnosis and prognosis of malignant tumors. In addition, exosomes may modify the phenotype of the parent and/or target cell by transferring pro-oncogenic molecules to induce cancerous phenotype of recipient cells and contribute to the formation of the premetastatic niche. The mechanism involved in these phenomena remains unclear; however, inclusion of signaling mediators into exosomes or exosome release may reduce their intracellular bioavailability in the parent cell, thereby altering cell phenotype and their metastatic potential. The aim of this review therefore is to analyze the biogenesis and role of exosomes from tumor cells, focusing primarily on ovarian cancer. Ovarian cancer is the most lethal gynecologic cancer, and an effective early diagnosis has the potential to improve patient survival. Ovarian cancer currently lacks a reliable method for early detection, however, exosomes have received great attention as potential biomarkers and mediators

  15. Mitochondrial DNA mutations—candidate biomarkers for breast cancer diagnosis in Bangladesh

    Institute of Scientific and Technical Information of China (English)

    Gazi Nurun Nahar Sultana; Atiqur Rahman; Abu Din Ahmed Shahinuzzaman; Rowshan Ara Begum; Chowdhury Faiz Hossain

    2012-01-01

    Breast cancer is a major health problem that affects more than 24% of women in Bangladesh.Furthermore,among low-income countries including Bangladesh,individuals have a high risk for developing breast cancer.This study aimed to identify candidate mitochondrial DNA (mtDNA) biomarkers for breast cancer diagnosis in Bangladeshi women to be used as a preventive approach.We screened the blood samples from 24 breast cancer patients and 20 healthy controls to detect polymorphisms in the D-loop and the ND3- and ND4-coding regions of mtDNA by direct sequencing.Among 14 distinct mutations,10 polymorphisms were found in the D-loop,3 were found in the ND3-coding region,and 1 was found in the ND4-coding region.The frequency of two novel polymorphisms in the D-loop,one at position 16290 (T-ins) and the other at position 16293 (A-del),was higher in breast cancer patients than in control subjects (position 16290:odds ratio =6.011,95% confidence interval =1.2482 to 28.8411,P =0.002; position 16293:odds ratio =5.6028,95% confidence interval =1.4357 to 21.8925,P =0.010).We also observed one novel mutation in the ND3-coding region at position 10316 (A > G) in 69% of breast cancer patients but not in control subjects.The study suggests that two novel polymorphisms in the D-loop may be candidate biomarkers for breast cancer diagnosis in Bangladeshi women.

  16. Mitochondrial DNA mutations--candidate biomarkers for breast cancer diagnosis in Bangladesh

    Directory of Open Access Journals (Sweden)

    Rowshan Ara Begum

    2012-09-01

    Full Text Available Breast cancer is a major health problem that affects more than 24% of women in Bangladesh. Further- more, among low-income countries including Bangladesh, individuals have a high risk for developing breast cancer. This study aimed to identify candidate mitochondrial DNA (mtDNA biomarkers for breast cancer diagnosis in Bangladeshi women to be used as a preventive approach. We screened the blood samples from 24 breast cancer patients and 20 healthy controls to detect polymorphisms in the D-loop and the ND3- and ND4-coding regions of mtDNA by direct sequencing. Among 14 distinct mutations, 10 polymorphisms were found in the D-loop, 3 were found in the ND3-coding region, and 1 was found in the ND4-coding region. The frequency of two novel polymorphisms in the D-loop, one at position 16290 (T-ins and the other at position 16293 (A-del, was higher in breast cancer patients than in control subjects (position 16290: odds ratio = 6.011, 95% confidence interval = 1.2482 to 28.8411, P = 0.002; position 16293: odds ratio = 5.6028, 95% confidence interval = 1.4357 to 21.8925, P = 0.010. We also observed one novel mutation in the ND3-coding region at position 10316 (A > G in 69% of breast cancer patients but not in control subjects. The study suggests that two novel polymorphisms in the D-loop may be candidate biomarkers for breast cancer diagnosis in Bangladeshi women.

  17. Identification of biomarkers for cervical cancer in peripheral blood lymphocytes using oligonucleotide microarrays

    Institute of Scientific and Technical Information of China (English)

    SHENG Jie; ZHANG Wei-yuan

    2010-01-01

    Background Oligonucleotide microarrays are increasingly being used to identify gene expression profiles that associated with complex genetic diseases. Peripheral lymphocytes communicate with cells and extracellular matrixes in almost all tissues and organs in human body, suggesting that the gene expression profiles in peripheral lymphocytes may reflect the presence of disease in the body. This study aimed to identify molecular biomarkers for cervical cancer in peripheral blood lymphocytes by using oligonucleotide microarrays.Methods Total RNA was extracted from peripheral blood lymphocytes of 24 early stage cervical cancer patients and 18 healthy controls. We used 22K Human Genome microarrays to profile peripheral blood lymphocytes from 4 early stage cervical cancer patients and compared their gene expression profiles with those from 3 healthy controls. Differentially expressed genes would be identified if they had adjusted P values of less than 0.05 and a groupwise average fold change greater than 1.5 or less than 0.67. Then the selected 5 genes were validated in the remaining 20 early stage cervical cancer patients and the 15 healthy controls by using real-time reverse-transcription polymerase chain reaction (RT-PCR).Results Genes identified by the gene selection program expressed differently between the blood samples of the early stage cervical cancer patients and those of the healthy controls. To validate the gene expression data, 5 genes were analyzed by real-time RT-PCR. In three of the 5 identified genes, tenasin-c (TNC), nuceolin (NCL), and enolase 2 (ENO2) showed a significant up-regulation in the blood samples of the early stage cervical cancer patients versus that of the healthy controls.Conclusions The up-regulation of TNC, NCL, and ENO2 in peripheral blood may be used to identify novel blood biomarkers for detecting cervical cancer in a clinically accessible surrogate tissue, and thus to provide a possibility to develop a noninvasive and predictive

  18. Towards an animal model of ovarian cancer: cataloging chicken blood proteins using combinatorial peptide ligand libraries coupled with shotgun proteomic analysis for translational research.

    Science.gov (United States)

    Ma, Yingying; Sun, Zeyu; de Matos, Ricardo; Zhang, Jing; Odunsi, Kunle; Lin, Biaoyang

    2014-05-01

    Epithelial ovarian cancer is the most deadly gynecological cancer around the world, with high morbidity in industrialized countries. Early diagnosis is key in reducing its morbidity rate. Yet, robust biomarkers, diagnostics, and animal models are still limited for ovarian cancer. This calls for broader omics and systems science oriented diagnostics strategies. In this vein, the domestic chicken has been used as an ovarian cancer animal model, owing to its high rate of developing spontaneous epithelial ovarian tumors. Chicken blood has thus been considered a surrogate reservoir from which cancer biomarkers can be identified. However, the presence of highly abundant proteins in chicken blood has compromised the applicability of proteomics tools to study chicken blood owing to a lack of immunodepletion methods. Here, we demonstrate that a combinatorial peptide ligand library (CPLL) can efficiently remove highly abundant proteins from chicken blood samples, consequently doubling the number of identified proteins. Using an integrated CPLL-1DGE-LC-MSMS workflow, we identified a catalog of 264 unique proteins. Functional analyses further suggested that most proteins were coagulation and complement factors, blood transport and binding proteins, immune- and defense-related proteins, proteases, protease inhibitors, cellular enzymes, or cell structure and adhesion proteins. Semiquantitative spectral counting analysis identified 10 potential biomarkers from the present chicken ovarian cancer model. Additionally, many human homologs of chicken blood proteins we have identified have been independently suggested as diagnostic biomarkers for ovarian cancer, further triangulating our novel observations reported here. In conclusion, the CPLL-assisted proteomic workflow using the chicken ovarian cancer model provides a feasible platform for translational research to identify ovarian cancer biomarkers and understand ovarian cancer biology. To the best of our knowledge, we report here

  19. Protein Biomarkers for Insulin Resistance and Type 2 Diabetes Risk in Two Large Community Cohorts.

    Science.gov (United States)

    Nowak, Christoph; Sundström, Johan; Gustafsson, Stefan; Giedraitis, Vilmantas; Lind, Lars; Ingelsson, Erik; Fall, Tove

    2016-01-01

    Insulin resistance (IR) is a precursor of type 2 diabetes (T2D), and improved risk prediction and understanding of the pathogenesis are needed. We used a novel high-throughput 92-protein assay to identify circulating biomarkers for HOMA of IR in two cohorts of community residents without diabetes (n = 1,367) (mean age 73 ± 3.6 years). Adjusted linear regression identified cathepsin D and confirmed six proteins (leptin, renin, interleukin-1 receptor antagonist [IL-1ra], hepatocyte growth factor, fatty acid-binding protein 4, and tissue plasminogen activator [t-PA]) as IR biomarkers. Mendelian randomization analysis indicated a positive causal effect of IR on t-PA concentrations. Two biomarkers, IL-1ra (hazard ratio [HR] 1.28, 95% CI 1.03-1.59) and t-PA (HR 1.30, 1.02-1.65) were associated with incident T2D, and t-PA predicted 5-year transition to hyperglycemia (odds ratio 1.30, 95% CI 1.02-1.65). Additional adjustment for fasting glucose rendered both coefficients insignificant and revealed an association between renin and T2D (HR 0.79, 0.62-0.99). LASSO regression suggested a risk model including IL-1ra, t-PA, and the Framingham Offspring Study T2D score, but prediction improvement was nonsignificant (difference in C-index 0.02, 95% CI -0.08 to 0.12) over the T2D score only. In conclusion, proteomic blood profiling indicated cathepsin D as a new IR biomarker and suggested a causal effect of IR on t-PA. PMID:26420861

  20. Diagnostic accuracy of serum biomarkers for head and neck cancer: A systematic review and meta-analysis.

    Science.gov (United States)

    Guerra, Eliete Neves Silva; Rêgo, Daniela Fortunato; Elias, Silvia Taveira; Coletta, Ricardo D; Mezzomo, Luis André Mendonça; Gozal, David; De Luca Canto, Graziela

    2016-05-01

    Serum biomarkers could be helpful to characterize head and neck squamous cell carcinoma (HNSCC). Thus, the purpose of this systematic review and meta-analysis was to determine the diagnostic capability of serum biomarkers in the assessment of HNSCC patients. Studies were gathered by searching LILACS, PubMed, Science Direct, Scopus and Web of Science up to April 10th, 2015. Studies that focused on serum biomarkers in the diagnosis of HNSCC compared with controls were considered. Sixty-five studies were identified, and the sample size included 9098 subjects. Combined biomarkers demonstrated improved accuracy than those tested individually. Therefore, 12.8% of single and 34.3% of combined indicated that serum biomarkers discriminate patients with HNSCC from controls. The combined biomarkers with better diagnostic capability included Epidermal growth factor receptor (EGFR)+Cyclin D1 and squamous cell cancer-associated antigen (SCCA)+EGFR+Cyclin D1. Beta2-microglobin may also be a promising single biomarker for future studies. Serum biomarkers can be potentially useful in the diagnosis of HNSCC. However, further research is required to validate these biomarkers. PMID:26971993

  1. High-sensitive factor I and C-reactive protein based biomarkers for coronary artery disease

    OpenAIRE

    Zhao, Qing; Du, Jian-Shi; Han, Dong-Mei; Ma, Ying

    2014-01-01

    An analysis of high-sensitive factor I and C-reactive proteins as biomarkers for coronary artery disease has been performed from 19 anticipated cohort studies that included 21,567 participants having no information about coronary artery disease. Besides, the clinical implications of statin therapy initiated due to assessment of factor I and C-reactive proteins have also been modeled during studies. The measure of risk discrimination (C-index) was increased (by 0.0101) as per the prognostic mo...

  2. Relevance of circulating nucleosomes and oncological biomarkers for predicting response to transarterial chemoembolization therapy in liver cancer patients

    Directory of Open Access Journals (Sweden)

    Durner Jürgen

    2011-05-01

    Full Text Available Abstract Background Transarterial chemoembolization (TACE therapy is an effective locoregional treatment in hepatocellular cancer (HCC patients. For early modification of therapy, markers predicting therapy response are urgently required. Methods Here, sera of 50 prospectively and consecutively included HCC patients undergoing 71 TACE therapies were taken before and 3 h, 6 h and 24 h after TACE application to analyze concentrations of circulating nucleosomes, cytokeratin-19 fragments (CYFRA 21-1, alpha fetoprotein (AFP, C-reactive protein (CRP and several liver biomarkers, and to compare these with radiological response to therapy. Results While nucleosomes, CYFRA 21-1, CRP and some liver biomarkers increased already 24 h after TACE, percental changes of nucleosome concentrations before and 24 h after TACE and pre- and posttherapeutic values of AFP, gamma-glutamyl-transferase (GGT and alkaline phosphatase (AP significantly indicated the later therapy response (39 progression versus 32 no progression. In multivariate analysis, nucleosomes (24 h, AP (24 h and TACE number were independent predictive markers. The risk score of this combination model achieved an AUC of 81.8% in receiver operating characteristic (ROC curves and a sensitivity for prediction of non-response to therapy of 41% at 97% specificity, and of 72% at 78% specificity. Conclusion Circulating nucleosomes and liver markers are valuable tools for early estimation of the efficacy of TACE therapy in HCC patients.

  3. Relevance of circulating nucleosomes and oncological biomarkers for predicting response to transarterial chemoembolization therapy in liver cancer patients

    International Nuclear Information System (INIS)

    Transarterial chemoembolization (TACE) therapy is an effective locoregional treatment in hepatocellular cancer (HCC) patients. For early modification of therapy, markers predicting therapy response are urgently required. Here, sera of 50 prospectively and consecutively included HCC patients undergoing 71 TACE therapies were taken before and 3 h, 6 h and 24 h after TACE application to analyze concentrations of circulating nucleosomes, cytokeratin-19 fragments (CYFRA 21-1), alpha fetoprotein (AFP), C-reactive protein (CRP) and several liver biomarkers, and to compare these with radiological response to therapy. While nucleosomes, CYFRA 21-1, CRP and some liver biomarkers increased already 24 h after TACE, percental changes of nucleosome concentrations before and 24 h after TACE and pre- and posttherapeutic values of AFP, gamma-glutamyl-transferase (GGT) and alkaline phosphatase (AP) significantly indicated the later therapy response (39 progression versus 32 no progression). In multivariate analysis, nucleosomes (24 h), AP (24 h) and TACE number were independent predictive markers. The risk score of this combination model achieved an AUC of 81.8% in receiver operating characteristic (ROC) curves and a sensitivity for prediction of non-response to therapy of 41% at 97% specificity, and of 72% at 78% specificity. Circulating nucleosomes and liver markers are valuable tools for early estimation of the efficacy of TACE therapy in HCC patients

  4. Synthesis and characterization of a HAp-based biomarker with controlled drug release for breast cancer.

    Science.gov (United States)

    González, Maykel; Merino, Ulises; Vargas, Susana; Quintanilla, Francisco; Rodríguez, Rogelio

    2016-04-01

    A biocompatible hybrid porous polymer-ceramic material was synthesized to be used as a biomarker in the treatment of breast cancer. This device was equipped with the capacity to release medicaments locally in a controlled manner. The biomaterial was Hydroxyapatite(HAp)-based and had a controlled pore size and pore volume fraction. It was implemented externally using a sharp end and a pair of barbed rings placed opposite each other to prevent relative movement once implanted. The biomarker was impregnated with cis-diamine dichloride platinum (II) [Cl2-Pt-(NH3)2]; the rate of release was obtained using inductively coupled plasma atomic emission spectroscopy (ICP-AES), and release occurred over the course of three months. Different release profiles were obtained as a function of the pore volume fraction. The biomaterial was characterized using scanning electron microscopy (SEM) and Raman spectroscopy. PMID:26838911

  5. Reproducible cancer biomarker discovery in SELDI-TOF MS using different pre-processing algorithms.

    Directory of Open Access Journals (Sweden)

    Jinfeng Zou

    Full Text Available BACKGROUND: There has been much interest in differentiating diseased and normal samples using biomarkers derived from mass spectrometry (MS studies. However, biomarker identification for specific diseases has been hindered by irreproducibility. Specifically, a peak profile extracted from a dataset for biomarker identification depends on a data pre-processing algorithm. Until now, no widely accepted agreement has been reached. RESULTS: In this paper, we investigated the consistency of biomarker identification using differentially expressed (DE peaks from peak profiles produced by three widely used average spectrum-dependent pre-processing algorithms based on SELDI-TOF MS data for prostate and breast cancers. Our results revealed two important factors that affect the consistency of DE peak identification using different algorithms. One factor is that some DE peaks selected from one peak profile were not detected as peaks in other profiles, and the second factor is that the statistical power of identifying DE peaks in large peak profiles with many peaks may be low due to the large scale of the tests and small number of samples. Furthermore, we demonstrated that the DE peak detection power in large profiles could be improved by the stratified false discovery rate (FDR control approach and that the reproducibility of DE peak detection could thereby be increased. CONCLUSIONS: Comparing and evaluating pre-processing algorithms in terms of reproducibility can elucidate the relationship among different algorithms and also help in selecting a pre-processing algorithm. The DE peaks selected from small peak profiles with few peaks for a dataset tend to be reproducibly detected in large peak profiles, which suggests that a suitable pre-processing algorithm should be able to produce peaks sufficient for identifying useful and reproducible biomarkers.

  6. Cerebrospinal fluid proteomics and protein biomarkers in frontotemporal lobar degeneration: Current status and future perspectives.

    Science.gov (United States)

    Oeckl, Patrick; Steinacker, Petra; Feneberg, Emily; Otto, Markus

    2015-07-01

    Frontotemporal lobar degeneration (FTLD) comprises a spectrum of rare neurodegenerative diseases with an estimated prevalence of 15-22 cases per 100,000 persons including the behavioral variant of frontotemporal dementia (bvFTD), progressive non-fluent aphasia (PNFA), semantic dementia (SD), FTD with motor neuron disease (FTD-MND), progressive supranuclear palsy (PSP) and corticobasal syndrome (CBS). The pathogenesis of the diseases is still unclear and clinical diagnosis of FTLD is hampered by overlapping symptoms within the FTLD subtypes and with other neurodegenerative diseases such as Alzheimer's disease (AD) and Parkinson's disease (PD). Intracellular protein aggregates in the brain are a major hallmark of FTLD and implicate alterations in protein metabolism or function in the disease's pathogenesis. Cerebrospinal fluid (CSF) which surrounds the brain can be used to study changes in neurodegenerative diseases and to identify disease-related mechanisms or neurochemical biomarkers for diagnosis. In the present review, we will give an overview of the current literature on proteomic studies in CSF of FTLD patients. Reports of targeted and unbiased proteomic approaches are included and the results are discussed in regard of their informative value about disease pathology and the suitability to be used as diagnostic biomarkers. Finally, we will give some future perspectives on CSF proteomics and a list of candidate biomarkers which might be interesting for validation in further studies. This article is part of a Special Issue entitled: Neuroproteomics: Applications in neuroscience and neurology. PMID:25526887

  7. Evaluation of candidate biomarkers to predict cancer cell sensitivity or resistance to PARP-1 inhibitor treatment

    DEFF Research Database (Denmark)

    Oplustilova, L.; Wolanin, K.; Bartkova, J.;

    2012-01-01

    (ADp-ribose) polymerase-1 (PARP-1), an enzyme critical for repair pathways alternative to HR. While promising, treatment with PARP-1 inhibitors (PARP-1i) faces some hurdles, including (1) acquired resistance, (2) search for other sensitizing, non-BRCA1/2 cancer defects and (3) lack of biomarkers to predict response......Impaired DNA damage response pathways may create vulnerabilities of cancer cells that can be exploited therapeutically. One such selective vulnerability is the sensitivity of BRCA1- or BRCA2-defective tumors (hence defective in DNA repair by homologous recombination, HR) to inhibitors of the poly...... to PARP-1i. Here we addressed these issues using PARP-1i on 20 human cell lines from carcinomas of the breast, prostate, colon, pancreas and ovary. Aberrations of the Mre11-Rad50-Nbs1 (MRN) complex sensitized cancer cells to PARP-1i, while p53 status was less predictive, even in response to PARP-1i...

  8. Large-scale proteomic identification of S100 proteins in breast cancer tissues

    International Nuclear Information System (INIS)

    Attempts to reduce morbidity and mortality in breast cancer is based on efforts to identify novel biomarkers to support prognosis and therapeutic choices. The present study has focussed on S100 proteins as a potentially promising group of markers in cancer development and progression. One reason of interest in this family of proteins is because the majority of the S100 genes are clustered on a region of human chromosome 1q21 that is prone to genomic rearrangements. Moreover, there is increasing evidence that S100 proteins are often up-regulated in many cancers, including breast, and this is frequently associated with tumour progression. Samples of breast cancer tissues were obtained during surgical intervention, according to the bioethical recommendations, and cryo-preserved until used. Tissue extracts were submitted to proteomic preparations for 2D-IPG. Protein identification was performed by N-terminal sequencing and/or peptide mass finger printing. The majority of the detected S100 proteins were absent, or present at very low levels, in the non-tumoral tissues adjacent to the primary tumor. This finding strengthens the role of S100 proteins as putative biomarkers. The proteomic screening of 100 cryo-preserved breast cancer tissues showed that some proteins were ubiquitously expressed in almost all patients while others appeared more sporadic. Most, if not all, of the detected S100 members appeared reciprocally correlated. Finally, from the perspective of biomarkers establishment, a promising finding was the observation that patients which developed distant metastases after a three year follow-up showed a general tendency of higher S100 protein expression, compared to the disease-free group. This article reports for the first time the comparative proteomic screening of several S100 protein members among a large group of breast cancer patients. The results obtained strongly support the hypothesis that a significant deregulation of multiple S100 protein members is

  9. Large-scale proteomic identification of S100 proteins in breast cancer tissues

    Directory of Open Access Journals (Sweden)

    Cancemi Patrizia

    2010-09-01

    Full Text Available Abstract Background Attempts to reduce morbidity and mortality in breast cancer is based on efforts to identify novel biomarkers to support prognosis and therapeutic choices. The present study has focussed on S100 proteins as a potentially promising group of markers in cancer development and progression. One reason of interest in this family of proteins is because the majority of the S100 genes are clustered on a region of human chromosome 1q21 that is prone to genomic rearrangements. Moreover, there is increasing evidence that S100 proteins are often up-regulated in many cancers, including breast, and this is frequently associated with tumour progression. Methods Samples of breast cancer tissues were obtained during surgical intervention, according to the bioethical recommendations, and cryo-preserved until used. Tissue extracts were submitted to proteomic preparations for 2D-IPG. Protein identification was performed by N-terminal sequencing and/or peptide mass finger printing. Results The majority of the detected S100 proteins were absent, or present at very low levels, in the non-tumoral tissues adjacent to the primary tumor. This finding strengthens the role of S100 proteins as putative biomarkers. The proteomic screening of 100 cryo-preserved breast cancer tissues showed that some proteins were ubiquitously expressed in almost all patients while others appeared more sporadic. Most, if not all, of the detected S100 members appeared reciprocally correlated. Finally, from the perspective of biomarkers establishment, a promising finding was the observation that patients which developed distant metastases after a three year follow-up showed a general tendency of higher S100 protein expression, compared to the disease-free group. Conclusions This article reports for the first time the comparative proteomic screening of several S100 protein members among a large group of breast cancer patients. The results obtained strongly support the hypothesis

  10. Development of micro immunosensors to study genomic and proteomic biomarkers related to cancer and Alzheimer's disease

    Science.gov (United States)

    Prabhulkar, Shradha

    A report from the National Institutes of Health defines a disease biomarker as a "characteristic that is objectively measured and evaluated as an indicator of normal biologic processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention." Early diagnosis is a crucial factor for incurable disease such as cancer and Alzheimer's disease (AD). During the last decade researchers have discovered that biochemical changes caused by a disease can be detected considerably earlier as compared to physical manifestations/symptoms. In this dissertation electrochemical detection was utilized as the detection strategy as it offers high sensitivity/specificity, ease of operation, and capability of miniaturization and multiplexed detection. Electrochemical detection of biological analytes is an established field, and has matured at a rapid pace during the last 50 years and adapted itself to advances in micro/nanofabrication procedures. Carbon fiber microelectrodes were utilized as the platform sensor due to their high signal to noise ratio, ease and low-cost of fabrication, biocompatibility, and active carbon surface which allows conjugation with biorecognition moieties. This dissertation specifically focuses on the detection of 3 extensively validated biomarkers for cancer and AD. Firstly, vascular endothelial growth factor (VEGF) a cancer biomarker was detected using a one-step, reagentless immunosensing strategy. The immunosensing strategy allowed a rapid and sensitive means of VEGF detection with a detection limit of about 38 pg/mL with a linear dynamic range of 0--100 pg/mL. Direct detection of AD-related biomarker amyloid beta (Abeta) was achieved by exploiting its inherent electroactivity. The quantification of the ratio of Abeta1-40/42 (or Abeta ratio) has been established as a reliable test to diagnose AD through human clinical trials. Triple barrel carbon fiber microelectrodes were used to simultaneously detect Abeta1-40 and Abeta1-42 in

  11. γ-Glutamyl semialdehyde and 2-amino-adipic semialdehyde: biomarkers of oxidative damage to proteins

    DEFF Research Database (Denmark)

    Daneshvar, B.; Frandsen, H.; Autrup, Herman

    1997-01-01

    Reactive oxygen species are formed in the body by several natural processes and by induced oxidative stress. The reactive oxygen species may react with the various biomolecules of the body, including proteins. In order to assess the impact of oxidative damage to proteins, we have tried to identify...... oxidized amino acids in blood proteins which might serve as biomarkers of oxidative damage. When oxidative damage is induced into bovine serum albumin by metal-catalysed oxidation systems, the aldehyde groups formed can be derivatized by fluoresceinamine (FINH2). Following acid hydrolysis of FINH2...... or Pro, while AAS is an oxidation product of Lys. When oxidative stress was induced in rats by treatments with t-butyl hydroperoxide or acrolein, rat plasma protein levels of GGS and AAS were found to be significantly higher compared with control rats. The AAS-content in serum albumin or in total...

  12. Label-free electrical detection of ovarian cancer biomarker CA-125 with a novel nanoscale coaxial array

    Science.gov (United States)

    Archibald, Michelle; Rizal, Binod; Cai, Dong; Connolly, Timothy; Burns, Michael; Naughton, Michael; Chiles, Thomas

    2013-03-01

    Technologies to detect early stage cancer would provide significant benefit to cancer disease patients. Clinical measurement of biomarkers offers the promise of a noninvasive and cost effective screening for early stage detection. We have developed a novel 3-dimensional nanocavity array for the detection of human cancer biomarkers. This all-electronic diagnostic sensor is based on a nanoscale coaxial array architecture that enables molecular-level detection. Each individual sensor in the array is a vertically-oriented coaxial capacitor, whose capacitance is measurably changed when target molecules enter the coax annulus. The coaxial array facilitates electrical-based detection in response to antibody or molecular imprint based recognition of a specific cancer biomarker, thereby providing a label-free, non-optical measurement. Here, we describe this nanoscale 3D architecture and its application to the detection of the ovarian cancer biomarker CA-125. We report our efforts on the development of molecular detection of CA-125 based on antibody-functionalized nanocoax arrays as well as molecular imprints. The results demonstrate the feasibility of using these arrays as ultrasensitive devices to detect a wide range of molecular targets, including disease biomarkers. Supported by the NIH grants NCI CA137681 and NIAID AI100216.

  13. The PCA and LDA Analysis on the Differential Expression of Proteins in Breast Cancer

    Directory of Open Access Journals (Sweden)

    Seng Liang

    2010-01-01

    Full Text Available Breast cancer is a leading cause of mortality in women. In Malaysia, it is the most common cancer to affect women. The most common form of breast cancer is infiltrating ductal carcinoma (IDC. A proteomic approach was undertaken to identify protein profile changes between cancerous and normal breast tissues from 18 patients. Two protein extracts; aqueous soluble and membrane associated protein extracts were studied. Thirty four differentially expressed proteins were identified. The intensities of the proteins were used as variables in PCA and reduced data of six principal components (PC were subjected to LDA in order to evaluate the potential of these proteins as collective biomarkers for breast cancer. The protein intensities of SEC13-like 1 (isoform b and calreticulin contributed the most to the first PC while the protein intensities of fibrinogen beta chain precursor and ATP synthase D chain contributed the most to the second PC. Transthyretin precursor and apolipoprotein A-1 precursor contributed the most to the third PC. The results of LDA indicated good classification of samples into normal and cancerous types when the first 6 PCs were used as the variables. The percentage of correct classification was 91.7% for the originally grouped tissue samples and 88.9% for cross-validated samples.

  14. MicroRNA dysregulation as a prognostic biomarker in colorectal cancer

    International Nuclear Information System (INIS)

    Colorectal cancer (CRC) is one of the most potentially curable cancers, yet it remains the fourth most common overall cause of cancer death worldwide. The identification of robust molecular prognostic biomarkers can refine the conventional tumor–node–metastasis staging system, avoid understaging of tumor, and help pinpoint patients with early-stage CRC who may benefit from aggressive treatments. Recently, epigenetic studies have provided new molecular evidence to better categorize the CRC subtypes and predict clinical outcomes. In this review, we summarize recent findings concerning the prognostic potential of microRNAs (miRNAs) in CRC. We first discuss the prognostic value of three tissue miRNAs (miR-21-5p, miR-29-3p, miR-148-3p) that have been examined in multiple studies. We also summarize the dysregulation of miRNA processing machinery DICER in CRC and its association with risk for mortality. We also reviewe the potential application of miRNA-associated single-nucleotide polymorphisms as prognostic biomarkers for CRC, especially the miRNA-associated polymorphism in the KRAS gene. Last but not least, we discuss the microsatellite instability-related miRNA candidates. Among all these candidates, miR-21-5p is the most promising prognostic marker, yet further prospective validation studies are required before it can go into clinical usage

  15. Merging person-specific bio-markers for predicting oral cancer recurrence through an ontology.

    Science.gov (United States)

    Salvi, Dario; Picone, Marco; Arredondo, María Teresa; Cabrera-Umpierrez, María Fernanda; Esteban, Ángel; Steger, Sebastian; Poli, Tito

    2013-01-01

    One of the major problems related to cancer treatment is its recurrence. Without knowing in advance how likely the cancer will relapse, clinical practice usually recommends adjuvant treatments that have strong side effects. A way to optimize treatments is to predict the recurrence probability by analyzing a set of bio-markers. The NeoMark European project has identified a set of preliminary bio-markers for the case of oral cancer by collecting a large series of data from genomic, imaging, and clinical evidence. This heterogeneous set of data needs a proper representation in order to be stored, computed, and communicated efficiently. Ontologies are often considered the proper mean to integrate biomedical data, for their high level of formality and for the need of interoperable, universally accepted models. This paper presents the NeoMark system and how an ontology has been designed to integrate all its heterogeneous data. The system has been validated in a pilot in which data will populate the ontology and will be made public for further research. PMID:22955869

  16. miRNAs and Other Epigenetic Changes as Biomarkers in Triple Negative Breast Cancer

    Directory of Open Access Journals (Sweden)

    Andrea Mathe

    2015-11-01

    Full Text Available Triple negative breast cancer (TNBC is characterised by the lack of receptors for estrogen (ER, progesterone (PR, and human epidermal growth factor 2 (HER2. Since it cannot be treated by current endocrine therapies which target these receptors and due to its aggressive nature, it has one of the worst prognoses of all breast cancer subtypes. The only treatments remain chemo- and/or radio-therapy and surgery and because of this, novel biomarkers or treatment targets are urgently required to improve disease outcomes. MicroRNAs represent an attractive candidate for targeted therapies against TNBC, due to their natural ability to act as antisense interactors and regulators of entire gene sets involved in malignancy and their superiority over mRNA profiling to accurately classify disease. Here we review the current knowledge regarding miRNAs as biomarkers in TNBC and their potential use as therapeutic targets in this disease. Further, we review other epigenetic changes and interactions of these changes with microRNAs in this breast cancer subtype, which may lead to the discovery of new treatment targets for TNBC.

  17. Molecular biomarker discovery and physiological assessment of skeletal muscle in cancer cachexia

    OpenAIRE

    Stephens, Nathan Andrew

    2014-01-01

    Cachexia affects up to two thirds of all cancer patients with progressive disease. It is a syndrome characterised by weight-loss, anorexia, fatigue, asthenia, peripheral oedema, and is responsible for around 20% of cancer deaths. Cachectic patients suffer loss of both muscle mass and adipose tissue (with comparative sparing of visceral protein) and the lean tissue loss appears resistant to nutritional support. Progress in the treatment of cancer cachexia has been hampered due t...

  18. CIP2A protein expression in high-grade, high-stage bladder cancer

    International Nuclear Information System (INIS)

    Bladder cancer is one of the most common cancers in the United States. Numerous markers have been evaluated for suitability of bladder cancer detection and surveillance. However, few of them are acceptable as a routine tool. Therefore, there exists a continuing need for an assay that detects the presence of bladder cancer in humans. It would be advantageous to develop an assay with a protein that is associated with the development of bladder cancer. We have identified the cancerous inhibitor of PP2A (CIP2A) protein as a novel bladder cancer biomarker. In this study, Western blot analysis was used to assess the expression level of CIP2A protein in bladder cancer cell lines and bladder cancer patient tissues (n = 43). Our studies indicated CIP2A protein was abundantly expressed in bladder cancer cell lines but not in nontumor epithelial cell lines. Furthermore, CIP2A was specifically expressed in transitional cell carcinoma (TCC) of the bladder tumor tissues but not in adjacent nontumor bladder tissue. Our data showed that CIP2A protein detection in high-grade TCC tissues had a sensitivity of 65%, which is 3.4-fold higher than that seen in low-grade TCC tissues (19%). The level of CIP2A protein expression increased with the stage of disease (12%, 27%, 67%, and 100% for pTa, pT1, pT2, and pT3 tumor, respectively). In conclusion, our studies suggest that CIP2A protein is specifically expressed in human bladder tumors. CIP2A is preferentially expressed in high-grade and high-stage TCC tumors, which are high-risk and invasive tumors. Our studies reported here support the role of CIP2A in bladder cancer progression and its usefulness for the surveillance of recurrence or progression of human bladder cancer

  19. Tenascin-W is a better cancer biomarker than tenascin-C for most human solid tumors

    Directory of Open Access Journals (Sweden)

    Brellier Florence

    2012-09-01

    Full Text Available Abstract Background Tenascins are large glycoproteins found in the extracellular matrix of many embryonic and adult tissues. Tenascin-C is a well-studied biomarker known for its high overexpression in the stroma of most solid cancers. Tenascin-W, the least studied member of the family, is highly expressed in the stroma of colon and breast tumors and in gliomas, but not in the corresponding normal tissues. Other solid tumors have not been analyzed. The present study was undertaken to determine whether tenascin-W could serve as a cancer-specific extracellular matrix protein in a broad range of solid tumors. Methods We analyzed the expression of tenascin-W and tenascin-C by immunoblotting and by immunohistochemistry on multiple frozen tissue microarrays of carcinomas of the pancreas, kidney and lung as well as melanomas and compared them to healthy tissues. Results From all healthy adult organs tested, only liver and spleen showed detectable levels of tenascin-W, suggesting that tenascin-W is absent from most human adult organs under normal, non-pathological conditions. In contrast, tenascin-W was detectable in the majority of melanomas and their metastases, as well as in pancreas, kidney, and lung carcinomas. Comparing lung tumor samples and matching control tissues for each patient revealed a clear overexpression of tenascin-W in tumor tissues. Although the number of samples examined is too small to draw statistically significant conclusions, there seems to be a tendency for increased tenascin-W expression in higher grade tumors. Interestingly, in most tumor types, tenascin-W is also expressed in close proximity to blood vessels, as shown by CD31 co-staining of the samples. Conclusions The present study extends the tumor biomarker potential of tenascin-W to a broad range of solid tumors and shows its accessibility from the blood stream for potential therapeutic strategies.

  20. Extracellular vesicles – biomarkers and effectors of the cellular interactome in cancer

    Directory of Open Access Journals (Sweden)

    Janusz eRak

    2013-03-01

    Full Text Available In multicellular organisms both health and disease are defined by patterns of communications between the constituent cells. In addition to networks of soluble mediators, cells are also programmed to exchange complex messages pre-assembled as multimolecular cargo of membraneous structures known extracellular vesicles (EV. Several biogenetic pathways produce EVs with different properties and known as exosomes, ectosomes and apoptotic bodies. In cancer, EVs carry molecular signatures and effectors of the disease, such as mutant oncoproteins, oncogenic transcripts, microRNA and DNA sequences. Intercellular trafficking of such EVs (oncosomes may contribute to horizontal cellular transformation, phenotypic reprogramming and functional re-education of recipient cells, both locally and systemically. The EV-mediated, reciprocal molecular exchange also includes tumor suppressors, phosphoproteins, proteases, growth factors and bioactive lipids, all of which participate in the functional integration of multiple cells and their collective involved in tumor angiogenesis, inflammation, immunity, coagulopathy, mobilization of bone marrow derived effectors, metastasis, drug resistance or cellular stemness. In cases where the EV involvement is rate limiting their production and uptake may represent and unexplored anticancer therapy target. Moreover, oncosomes circulating in biofluids of cancer patients offer an unprecedented, remote and non-invasive access to crucial molecular information about cancer cells, including their driver mutations, classifiers, molecular subtypes, therapeutic targets and biomarkers of drug resistance. New nanotechnologies are being developed to exploit this unique biomarker platform. Indeed, embracing the notion that human cancers are defined not only by processes occurring within cancer cells, but also between them, and amidst the altered tumor and systemic microenvironment may open new diagnostic and therapeutic opportunities.

  1. Targeted biomarker profiling of matched primary and metastatic estrogen receptor positive breast cancers.

    Directory of Open Access Journals (Sweden)

    Erica B Schleifman

    Full Text Available Patients with newly diagnosed, early stage estrogen receptor positive (ER+ breast cancer often show disease free survival in excess of five years following surgery and systemic adjuvant therapy. An important question is whether diagnostic tumor tissue from the primary lesion offers an accurate molecular portrait of the cancer post recurrence and thus may be used for predictive diagnostic purposes for patients with relapsed, metastatic disease. As the class I phosphatidylinositol 3' kinase (PI3K pathway is frequently activated in ER+ breast cancer and has been linked to acquired resistance to hormonal therapy, we hypothesized pathway status could evolve over time and treatment. Biomarker analyses were conducted on matched, asynchronous primary and metastatic tumors from 77 patients with ER+ breast cancer. We examined whether PIK3CA and AKT1 alterations or PTEN and Ki67 levels showed differences between primary and metastatic samples. We also sought to look more broadly at gene expression markers reflective of proliferation, molecular subtype, and key receptors and signaling pathways using an mRNA analysis platform developed on the Fluidigm BioMark™ microfluidics system to measure the relative expression of 90 breast cancer related genes in formalin-fixed paraffin-embedded (FFPE tissue. Application of this panel of biomarker assays to matched tumor pairs showed a high concordance between primary and metastatic tissue, with generally few changes in mutation status, proliferative markers, or gene expression between matched samples. The collection of assays described here has been optimized for FFPE tissue and may have utility in exploratory analyses to identify patient subsets responsive to targeted therapies.

  2. Serum level of interleukin-17 and interleukin-35 as a biomarker for diagnosis of thyroid cancer

    Directory of Open Access Journals (Sweden)

    Yi Lu

    2015-01-01

    Full Text Available Objective: The aim of this study was to evaluate the serum level of interleukin-17 (IL-17 and IL-35 in thyroid cancer patients and its diagnostic value as a biomarker. Methods: Sixty-one thyroid carcinoma patients were recruited from January 2012 to December 2014 in our hospital. Of the 61 included cases, 42 subjects were pathology confirmed with thyroid cancer and other 19 cases were diagnosed with thyroid adenoma. The serum level of IL-17 and IL-35 were compared between the two groups. The diagnosed sensitivity, specificity, and receiver operating characteristic curve (ROC for serum IL-17 and IL-35 were evaluated according to Bayes theorem. Results: The serum level of IL-17 were 16.3 ± 4.1 pg/ml and 9.4 ± 3.6 pg/ml for the thyroid cancer and thyroid adenoma patients respectively, with statistical difference (P < 0.05. The serum level of IL-35 were 48.8 ± 7.8 pg/ml and 62.3 ± 9.6 pg/ml for the thyroid cancer and thyroid adenoma patients, respectively, which indicated that the thyroid adenoma group was much higher with statistical difference (P < 0.05. The diagnosis sensitivity and specificity for serum IL-17 were 71.4% and 80.2% at the cutoff value of 12.1 pg/ml with the area under the ROC of 0.8239. The diagnosis sensitivity and specificity for serum IL-35 were 76.8% and 82.4% at the cutoff value of 57.6 pg/ml with the area under the ROC of 0.8722. Conclusion: The serum level of IL-17 and IL-35 was significantly different between thyroid cancer and thyroid adenoma patients, which could be a potential biomarker for the diagnosis of malignant thyroid tumor.

  3. The Effect of Atorvastatin on Breast Cancer Biomarkers in High-Risk Women.

    Science.gov (United States)

    Ji, YongLi; Rounds, Tiffany; Crocker, Abigail; Sussman, Betsy; Hovey, Russell C; Kingsley, Fonda; Muss, Hyman B; Garber, Judy E; Wood, Marie E

    2016-05-01

    Statins have the potential to reduce breast cancer incidence and recurrence as shown in both epidemiologic and laboratory studies. The purpose of this study was to evaluate the effect of a lipophilic statin, atorvastatin, on breast cancer biomarkers of risk [mammographic density (MD) and insulin growth factor 1 (IGF-1)] in high-risk premenopausal women.Premenopausal women at increased risk for breast cancer received either 40 mg of atorvastatin or placebo for 1 year. Biomarker assessment was performed prior to initiation and at completion of study medication. MD was determined using both Breast Imaging Reporting and Data System and the visual analogue scale. Serum IGF-1 was determined by ELISA assay at the end of the study.Sixty-three women were enrolled between December 2005 and May 2010. Sixteen (25%) women withdrew. The mean age of participants was 43 (range, 35-50), 100% were white, and the average body mass index (BMI) was 26.4. The statin group demonstrated a significant decrease in cholesterol and low-density lipoprotein (LDL), suggesting compliance with study medication. After accounting for BMI, there was no difference in change in MD between groups. There was a significant increase in serum IGF-1 in the statin group.In this multi-institutional randomized prospective clinical trial of premenopausal women at increased risk for breast cancer, we did not see an effect of atorvastatin on MD. Further investigation of statins may be warranted; however, design of prior trials and potential mechanism of action of the agent need to be considered in the design of future trials. Cancer Prev Res; 9(5); 379-84. ©2016 AACR. PMID:26908565

  4. Spermine and citrate as metabolic biomarkers for assessing prostate cancer aggressiveness.

    Directory of Open Access Journals (Sweden)

    Guro F Giskeødegård

    Full Text Available Separating indolent from aggressive prostate cancer is an important clinical challenge for identifying patients eligible for active surveillance, thereby reducing the risk of overtreatment. The purpose of this study was to assess prostate cancer aggressiveness by metabolic profiling of prostatectomy tissue and to identify specific metabolites as biomarkers for aggressiveness. Prostate tissue samples (n = 158, 48 patients with a high cancer content (mean: 61.8% were obtained using a new harvesting method, and metabolic profiles of samples representing different Gleason scores (GS were acquired by high resolution magic angle spinning magnetic resonance spectroscopy (HR-MAS. Multivariate analysis (PLS, PLS-DA and absolute quantification (LCModel were used to examine the ability to predict cancer aggressiveness by comparing low grade (GS = 6, n = 30 and high grade (GS≥7, n = 81 cancer with normal adjacent tissue (n = 47. High grade cancer tissue was distinguished from low grade cancer tissue by decreased concentrations of spermine (p = 0.0044 and citrate (p = 7.73·10(-4, and an increase in the clinically applied (total choline+creatine+polyamines/citrate (CCP/C ratio (p = 2.17·10(-4. The metabolic profiles were significantly correlated to the GS obtained from each tissue sample (r = 0.71, and cancer tissue could be distinguished from normal tissue with sensitivity 86.9% and specificity 85.2%. Overall, our findings show that metabolic profiling can separate aggressive from indolent prostate cancer. This holds promise for the benefit of applying in vivo magnetic resonance spectroscopy (MRS within clinical MR imaging investigations, and HR-MAS analysis of transrectal ultrasound-guided biopsies has a potential as an additional diagnostic tool.

  5. Multidrug Resistance Proteins (MRPs) and Cancer Therapy.

    Science.gov (United States)

    Zhang, Yun-Kai; Wang, Yi-Jun; Gupta, Pranav; Chen, Zhe-Sheng

    2015-07-01

    The ATP-binding cassette (ABC) transporters are members of a protein superfamily that are known to translocate various substrates across membranes, including metabolic products, lipids and sterols, and xenobiotic drugs. Multidrug resistance proteins (MRPs) belong to the subfamily C in the ABC transporter superfamily. MRPs have been implicated in mediating multidrug resistance by actively extruding chemotherapeutic substrates. Moreover, some MRPs are known to be essential in physiological excretory or regulatory pathways. The importance of MRPs in cancer therapy is also implied by their clinical insights. Modulating the function of MRPs to re-sensitize chemotherapeutic agents in cancer therapy shows great promise in cancer therapy; thus, multiple MRP inhibitors have been developed recently. This review article summarizes the structure, distribution, and physiological as well as pharmacological function of MRP1-MRP9 in cancer chemotherapy. Several novel modulators targeting MRPs in cancer therapy are also discussed. PMID:25840885

  6. Advances in multiplexed MRM-based protein biomarker quantitation toward clinical utility.

    Science.gov (United States)

    Percy, Andrew J; Chambers, Andrew G; Yang, Juncong; Hardie, Darryl B; Borchers, Christoph H

    2014-05-01

    Accurate and rapid protein quantitation is essential for screening biomarkers for disease stratification and monitoring, and to validate the hundreds of putative markers in human biofluids, including blood plasma. An analytical method that utilizes stable isotope-labeled standard (SIS) peptides and selected/multiple reaction monitoring-mass spectrometry (SRM/MRM-MS) has emerged as a promising technique for determining protein concentrations. This targeted approach has analytical merit, but its true potential (in terms of sensitivity and multiplexing) has yet to be realized. Described herein is a method that extends the multiplexing ability of the MRM method to enable the quantitation 142 high-to-moderate abundance proteins (from 31mg/mL to 44ng/mL) in undepleted and non-enriched human plasma in a single run. The proteins have been reported to be associated to a wide variety of non-communicable diseases (NCDs), from cardiovascular disease (CVD) to diabetes. The concentrations of these proteins in human plasma are inferred from interference-free peptides functioning as molecular surrogates (2 peptides per protein, on average). A revised data analysis strategy, involving the linear regression equation of normal control plasma, has been instituted to enable the facile application to patient samples, as demonstrated in separate nutrigenomics and CVD studies. The exceptional robustness of the LC/MS platform and the quantitative method, as well as its high throughput, makes the assay suitable for application to patient samples for the verification of a condensed or complete protein panel. This article is part of a Special Issue entitled: Biomarkers: A Proteomic Challenge. PMID:23806606

  7. Hybrids of a Genetically Engineered Antibody and a Carbon Nanotube Transistor for Detection of Prostate Cancer Biomarkers

    CERN Document Server

    Lerner, Mitchell B; Pazina, Tatiana; Dailey, Jennifer; Goldsmith, Brett R; Robinson, Matthew K; Johnson, A T Charlie

    2013-01-01

    We developed a novel detection method for osteopontin (OPN), a new biomarker for prostate cancer, by attaching a genetically engineered single chain variable fragment (scFv) protein with high binding affinity for OPN to a carbon nanotube field-effect transistor (NTFET). Chemical functionalization using diazonium salts is used to covalently attach scFv to NT-FETs, as confirmed by atomic force microscopy, while preserving the activity of the biological binding site for OPN. Electron transport measurements indicate that functionalized NT-FET may be used to detect the binding of OPN to the complementary scFv protein. A concentration-dependent increase in the source-drain current is observed in the regime of clinical significance, with a detection limit of approximately 30 fM. The scFv-NT hybrid devices exhibit selectivity for OPN over other control proteins. These devices respond to the presence of OPN in a background of concentrated bovine serum albumin, without loss of signal. Based on these observations, the d...

  8. Circulating Fibroblast Growth Factor 21 (Fgf21) as Diagnostic and Prognostic Biomarker in Renal Cancer

    Science.gov (United States)

    Knott, ME; Minatta, JN; Roulet, L; Gueglio, G; Pasik, L; Ranuncolo, SM; Nuñez, M; Puricelli, L; De Lorenzo, MS

    2016-01-01

    Background The finding of new biomarkers is needed to have a better sub-classification of primary renal tumors (RCC) as well as more reliable predictors of outcome and therapy response. In this study, we evaluated the role of circulating FGF21, an endocrine factor, as a diagnostic and prognostic biomarker for ccRCC. Materials and Methods Serum samples from healthy controls (HC), clear cell and chromophobe RCC cancer patients were obtained from the serum biobank “Biobanco Público de Muestras Séricas Oncológicas” (BPMSO) of the “Instituto de Oncología “Ángel H. Roffo”. Serum FGF21 and leptin were measured by ELISA while other metabolic markers were measured following routinely clinical procedures. Results One of our major findings was that FGF21 levels were significantly increased in ccRCC patients compared with HC. Moreover, we showed an association between the increased serum FGF21 levels and the shorter disease free survival in a cohort of 98 ccRCC patients, after adjustment for other predictors of outcome. Conclusion Our results suggest that higher FGF21 serum level is an independent prognostic biomarker, associated with worse free-disease survival. PMID:27358750

  9. Circulating 25-Hydroxyvitamin D, Vitamin D Binding Protein, and Risk of Prostate Cancer

    OpenAIRE

    Weinstein, Stephanie J.; Mondul, Alison M.; Kopp, William; Rager, Helen; Virtamo, Jarmo; Albanes, Demetrius

    2012-01-01

    We recently reported a significant positive association between 25-hydroxyvitamin D [25(OH)D], the accepted biomarker of vitamin D status, and prostate cancer risk. To further elucidate this association, we examined the influence of vitamin D binding protein (DBP), the primary transporter of vitamin D compounds in the circulation. Prediagnostic serum concentrations of DBP were assayed for 950 cases and 964 matched controls with existing 25(OH)D measurements within the Alpha-Tocopherol, Beta-C...

  10. S-100AND#946; protein as a biomarker in acute hemorrhagic stroke

    Directory of Open Access Journals (Sweden)

    Omkar Prasad Baidya

    2014-02-01

    Full Text Available Acute hemorrhagic stroke, a subtype of acute stroke is one of the leading causes of death and disability throughout the world. At present, the diagnosis of acute hemorrhagic stroke is mainly based on Computer Tomography (CT or Magnetic Resonance Imaging (MRI but till now no biomarkers are routinely used in acute hemorrhagic stroke management. This article is a critical and descriptive review on the role of S100β protein as a biomarker in acute hemorrhagic stroke. Plasma S-100β level increases significantly in acute hemorrhagic stroke patients when compared to the normal subjects. Beside, the plasma S-100β can be correlated to the volume of hemorrhage in brain measured by plane CT scan. Plasma S-100β is an useful biomarker in acute hemorrhagic stroke and can be used for estimation of volume of hemorrhage in brain in acute hemorrhagic stroke patients. Thus, S-100β can be useful as an alternative to CT scan/MRI in diagnosis and in taking therapeutic decision in acute hemorrhagic stroke management. [Int J Res Med Sci 2014; 2(1.000: 13-15

  11. Elevated expressions of myeloid-related proteins-8 and -14 are danger biomarkers for lupus nephritis.

    Science.gov (United States)

    Tantivitayakul, P; Benjachat, T; Somparn, P; Leelahavanichkul, A; Kittikovit, V; Hirankarn, N; Pisitkun, T; Avihingsanon, Y

    2016-01-01

    Myeloid-related proteins, MRP-8 and -14, which have been identified as molecules that mediate the danger signaling in innate immune response, are also known as the DAMPs (damage associated molecular pattern molecules). The proteins were found in infiltrating macrophages and neutrophils at inflammatory sites. Their expression was correlated with severe forms of glomerulonephritis. Therefore, this study examined whether or not MRP-8 and -14 can be used as biomarkers for identifying severely active lupus nephritis (LN). Total blood leukocyte samples and renal biopsy tissues from a prospective cohort of LN patients were used to determine mRNA and protein expression levels of MRP-8 and -14. The mRNA levels of MRP-8 and -14 in total blood leukocytes were significantly higher in active LN patients than quiescent LN patients and healthy controls. Moreover, the mRNA levels of MRP-8 and -14 in the total blood leukocytes and kidney tissues were significantly correlated with therapeutic response and the mRNA expression levels in the kidney were associated with an early loss of the kidney function. MRP-8 and -14 can be used as non-invasive prognostic biomarkers in patients with LN. PMID:26223295

  12. Noncoding RNA Expression Aberration Is Associated with Cancer Progression and Is a Potential Biomarker in Esophageal Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Hidetaka Sugihara

    2015-11-01

    Full Text Available Esophageal cancer is one of the most common cancers worldwide. Esophageal squamous cell carcinoma (ESCC is the major histological type of esophageal cancer in Eastern Asian countries. Several types of noncoding RNAs (ncRNAs function as key epigenetic regulators of gene expression and are implicated in various physiological processes. Unambiguous evidence indicates that dysregulation of ncRNAs is deeply implicated in carcinogenesis, cancer progression and metastases of various cancers, including ESCC. The current review summarizes recent findings on the ncRNA-mediated mechanisms underlying the characteristic behaviors of ESCC that will help support the development of biomarkers and the design of novel therapeutic strategies.

  13. Diagnostic protein biomarkers for severe, moderate and mild traumatic brain injury

    Science.gov (United States)

    Streeter, Jackson; Hayes, Ronald L.; Wang, Kevin K. W.

    2011-06-01

    Traumatic Brain Injury (TBI) is a major problem in military and civilian medicine. Yet, there are no simple non-invasive diagnostics for TBI. Our goal is to develop and clinically validate blood-based biomarker assays for the diagnosis, prognosis and management of mild, moderate and severe TBI patients. These assays will ultimately be suitable for deployment to far-forward combat environments. Using a proteomic and systems biology approach, we identified over 20 candidate biomarkers for TBI and developed robust ELISAs for at least 6 candidate biomarkers, including Ubiquitin C-terminal hydrolase- L1 (UCH-L1), Glial Fibrillary Acidic Protein (GFAP) and a 145 kDa breakdown products of αII-spectrin (SBDP 145) generated by calpain proteolysis. In a multi-center feasibility study (Biomarker Assessment For Neurotrauma Diagnosis And Improved Triage System (BANDITS), we analyzed CSF and blood samples from 101 adult patients with severe TBI [Glasgow Coma Scale (GCS) <= 8] at 6 sites and analyzed 27 mild TBI patients and 5 moderate TBI patients [GCS 9-15] from 2 sites in a pilot study. We identified that serum levels of UCH-L1, GFAP and SBDP145 have strong diagnostic and prognostic properties for severe TBI over controls. Similarly initial post-TBI serum levels (< 6 h) of UCH-L1 and GFAP have diagnostic characteristics for moderate and mild TBI. We are now furthering assay production, refining assay platforms (both benchtop and point-ofcare/ handheld) and planning a pivotal clinical study to seek FDA approval of these TBI diagnostic assays.

  14. Global histone post-translational modifications and cancer:Biomarkers for diagnosis,prognosis and treatment?

    Institute of Scientific and Technical Information of China (English)

    Shafqat; Ali; Khan; Divya; Reddy; Sanjay; Gupta

    2015-01-01

    Global alterations in epigenetic landscape are now recognized as a hallmark of cancer. Epigenetic mechanismssuch as DNA methylation,histone modifications,nucleosome positioning and non-coding RNAs are proven to have strong association with cancer. In particular,covalent post-translational modifications of histone proteins are known to play an important role in chromatin remodeling and thereby in regulation of gene expression. Further,histone modifications have also been associated with different aspects of carcinogenesis and have been studied for their role in the better management of cancer patients. In this review,we will explore and discuss how histone modifications are involved in cancer diagnosis,prognosis and treatment.

  15. Muscle-Derived Proteins as Serum Biomarkers for Monitoring Disease Progression in Three Forms of Muscular Dystrophy

    OpenAIRE

    Burch, Peter M.; Pogoryelova, Oksana; Goldstein, Richard; Bennett, Donald; Guglieri, Michela; Straub, Volker; Bushby, Kate; Lochmüller, Hanns; Morris, Carl

    2015-01-01

    Background Identifying translatable, non-invasive biomarkers of muscular dystrophy that better reflect the disease pathology than those currently available would aid the development of new therapies, the monitoring of disease progression and the response to therapy. Objective The goal of this study was to evaluate a panel of serum protein biomarkers with the potential to specifically detect skeletal muscle injury. Method Serum concentrations of skeletal troponin I (sTnI), myosin light chain 3...

  16. Proteomic biomarkers predicting lymph node involvement in serum of cervical cancer patients. Limitations of SELDI-TOF MS

    Directory of Open Access Journals (Sweden)

    Van Gorp Toon

    2012-06-01

    Full Text Available Abstract Background Lymph node status is not part of the staging system for cervical cancer, but provides important information for prognosis and treatment. We investigated whether lymph node status can be predicted with proteomic profiling. Material & methods Serum samples of 60 cervical cancer patients (FIGO I/II were obtained before primary treatment. Samples were run through a HPLC depletion column, eliminating the 14 most abundant proteins ubiquitously present in serum. Unbound fractions were concentrated with spin filters. Fractions were spotted onto CM10 and IMAC30 surfaces and analyzed with surface-enhanced laser desorption time of flight (SELDI-TOF mass spectrometry (MS. Unsupervised peak detection and peak clustering was performed using MASDA software. Leave-one-out (LOO validation for weighted Least Squares Support Vector Machines (LSSVM was used for prediction of lymph node involvement. Other outcomes were histological type, lymphvascular space involvement (LVSI and recurrent disease. Results LSSVM models were able to determine LN status with a LOO area under the receiver operating characteristics curve (AUC of 0.95, based on peaks with m/z values 2,698.9, 3,953.2, and 15,254.8. Furthermore, we were able to predict LVSI (AUC 0.81, to predict recurrence (AUC 0.92, and to differentiate between squamous carcinomas and adenocarcinomas (AUC 0.88, between squamous and adenosquamous carcinomas (AUC 0.85, and between adenocarcinomas and adenosquamous carcinomas (AUC 0.94. Conclusions Potential markers related with lymph node involvement were detected, and protein/peptide profiling support differentiation between various subtypes of cervical cancer. However, identification of the potential biomarkers was hampered by the technical limitations of SELDI-TOF MS.

  17. Cancer Biomarkers from Genome-Scale DNA Methylation: Comparison of Evolutionary and Semantic Analysis Methods

    Directory of Open Access Journals (Sweden)

    Ioannis Valavanis

    2015-11-01

    Full Text Available DNA methylation profiling exploits microarray technologies, thus yielding a wealth of high-volume data. Here, an intelligent framework is applied, encompassing epidemiological genome-scale DNA methylation data produced from the Illumina’s Infinium Human Methylation 450K Bead Chip platform, in an effort to correlate interesting methylation patterns with cancer predisposition and, in particular, breast cancer and B-cell lymphoma. Feature selection and classification are employed in order to select, from an initial set of ~480,000 methylation measurements at CpG sites, predictive cancer epigenetic biomarkers and assess their classification power for discriminating healthy versus cancer related classes. Feature selection exploits evolutionary algorithms or a graph-theoretic methodology which makes use of the semantics information included in the Gene Ontology (GO tree. The selected features, corresponding to methylation of CpG sites, attained moderate-to-high classification accuracies when imported to a series of classifiers evaluated by resampling or blindfold validation. The semantics-driven selection revealed sets of CpG sites performing similarly with evolutionary selection in the classification tasks. However, gene enrichment and pathway analysis showed that it additionally provides more descriptive sets of GO terms and KEGG pathways regarding the cancer phenotypes studied here. Results support the expediency of this methodology regarding its application in epidemiological studies.

  18. Scientific basis of biomarkers and benefits of functional foods for reduction of disease risk: cancer.

    Science.gov (United States)

    Rafter, Joseph J

    2002-11-01

    One of the most promising areas for the development of functional foods lies in modification of the activity of the gastrointestinal tract by use of probiotics, prebiotics and synbiotics. While a myriad of healthful effects have been attributed to the probiotic lactic acid bacteria, perhaps the most controversial remains that of anticancer activity. However, it must be emphasised that, to date, there is no direct experimental evidence for cancer suppression in man as a result of consumption of lactic cultures in fermented or unfermented dairy products, although there is a wealth of indirect evidence, based largely on laboratory studies. Presently, there are a large number of biomarkers available for assessing colon cancer risk in dietary intervention studies, which are validated to varying degrees. These include colonic mucosal markers, faecal water markers and immunological markers. Overwhelming evidence from epidemiological, in vivo, in vitro and clinical trial data indicates that a plant-based diet can reduce the risk of chronic disease, particularly cancer. It is now clear that there are components in a plant-based diet other than traditional nutrients that can reduce cancer risk. More than a dozen classes of these biologically active plant chemicals, now known as 'phytochemicals', have been identified. Although the vast number of naturally occurring health-enhancing substances appear to be of plant origin, there are a number of physiologically active components in animal products (such as the probiotics referred to above) that deserve attention for their potential role in cancer prevention. PMID:12495463

  19. Chromosomal aberrations in lymphocytes predict human cancer: a report from the European Study Group on Cytogenetic Biomarkers and Health (ESCH)

    DEFF Research Database (Denmark)

    Hagmar, L; Bonassi, S; Strömberg, U; Brøgger, A; Knudsen, Lisbeth E.; Norppa, H; Reuterwall, C

    1998-01-01

    .35-2.89) was obtained for those with a high CA frequency level, whereas the SMRs for those with medium or low did not noticeably differ from unity. Cox's proportional hazards models gave no evidence that the effect of CAs on total cancer incidence/mortality was modified by gender, age at test, or time since...... test. No association was seen between the SCEs or the MN frequencies and subsequent cancer incidence/mortality. The present study further supports our previous observation on the cancer predictivity of the CA biomarker, which seems to be independent of age at test, gender, and time since test. The risk...... patterns were similar within each national cohort. This result suggests that the frequency of CAs in peripheral blood lymphocytes is a relevant biomarker for cancer risk in humans, reflecting either early biological effects of genotoxic carcinogens or individual cancer susceptibility....

  20. DEK over expression as an independent biomarker for poor prognosis in colorectal cancer

    International Nuclear Information System (INIS)

    The DEK protein is related to chromatin reconstruction and gene transcription, and plays an important role in cell apoptosis. High expression levels of the human DEK gene have been correlated with numerous human malignancies. This study explores the roles of DEK in tumor progression and as a prognostic determinant of colorectal cancer. Colorectal cancer specimens from 109 patients with strict follow-up, and colorectal adenomas from 52 patients were selected for analysis of DEK protein by immunohistochemistry. The correlations between DEK over expression and the clinicopathological features of colorectal cancers were evaluated by Chi-square test and Fisher’s exact tests. The survival rates were calculated by the Kaplan-Meier method, and the relationship between prognostic factors and patient survival was also analyzed by the Cox proportional hazard models. DEK protein showed a nuclear immunohistochemical staining pattern in colorectal cancers. The strongly positive rate of DEK protein was 48.62% (53/109) in colorectal cancers, which was significantly higher than that in either adjacent normal colon mucosa (9.17%, 10/109) or colorectal adenomas (13.46%, 7/52). DEK over expression in colorectal cancers was positively correlated with tumor size, grade, lymph node metastasis, serosal invasion, late stage, and disease-free survival- and 5-year survival rates. Further analysis showed that patients with late stage colorectal cancer and high DEK expression had worse survival rates than those with low DEK expression. Moreover, multivariate analysis showed high DEK expression, serosal invasion, and late stage are significant independent risk factors for mortality in colorectal cancer. DEK plays an important role in the progression of colorectal cancers and it is an independent poor prognostic factor of colorectal cancers

  1. Prognostic and Predictive Biomarkers in Colorectal Cancer. From the Preclinical Setting to Clinical Practice.

    Science.gov (United States)

    Maurel, Joan; Postigo, Antonio

    2015-01-01

    Colorectal cancer (CRC) is the second largest cause of cancer mortality in Western countries, mostly due to metastasis. Understanding the natural history and prognostic factors in patients with metastatic CRC (mCRC) is essential for the optimal design of clinical trials. The main prognostic factors currently used in clinical practice are related to tumor behavior (e.g., white blood counts, levels of lactate dehydrogenase, levels of alkaline phosphatase) disease extension (e.g., presence of extrahepatic spread, number of organs affected) and general functional status (e.g., performance status as defined by the Eastern Cooperative Oncology Group). However, these parameters are not always sufficient to establish appropriate therapeutic strategies. First-line therapy in mCRC combines conventional chemotherapy (CHT) (e.g., FOLFOX, FOLFIRI, CAPOX) with a number of agents targeted to specific signaling pathways (TA) (e.g., panitumumab and cetuximab for cases KRAS/NRAS WT, and bevacizumab). Although the response rate to this combination regime exceeds 50%, progression of the disease is almost universal and only less than 10% of patients are free of disease at 2 years. Current clinical trials with second and third line therapy include new TA, such as tyrosin-kinase receptors inhibitors (MET, HER2, IGF-1R), inhibitors of BRAF, MEK, PI3K, AKT, mTORC, NOTCH and JAK1/JAK2, immunotherapy modulators and check point inhibitors (anti-PD-L1 and anti- PD1). Despite the identification of multiple prognostic and predictive biomarkers and signatures, it is still unclear how expression of many of these biomarkers is modulated by CHT and/or TA, thus potentially affecting response to treatment. In this review we analyzed how certain biomarkers in tumor cells and microenvironment influence the response to new TA and immune-therapies strategies in mCRC pre-treated patients. PMID:26452385

  2. Identification of five serum protein markers for detection of ovarian cancer by antibody arrays.

    Directory of Open Access Journals (Sweden)

    Weidong Jiang

    Full Text Available BACKGROUND: Protein and antibody arrays have emerged as a promising technology to study protein expression and protein function in a high-throughput manner. These arrays also represent a new opportunity to profile protein expression levels in cancer patients' samples and to identify useful biosignatures for clinical diagnosis, disease classification, prediction, drug development and patient care. We applied antibody arrays to discover a panel of proteins which may serve as biomarkers to distinguish between patients with ovarian cancer and normal controls. METHODOLOGY/PRINCIPAL FINDINGS: Using a case-control study design of 34 ovarian cancer patients and 53 age-matched healthy controls, we profiled the expression levels of 174 proteins using antibody array technology and determined the CA125 level using ELISA. The expression levels of those proteins were analyzed using 3 discriminant methods, including artificial neural network, classification tree and split-point score analysis. A panel of 5 serum protein markers (MSP-alpha, TIMP-4, PDGF-R alpha, and OPG and CA125 was identified, which could effectively detect ovarian cancer with high specificity (95% and high sensitivity (100%, with AUC =0.98, while CA125 alone had an AUC of 0.87. CONCLUSIONS/SIGNIFICANCE: Our pilot study has shown the promising set of 5 serum markers for ovarian cancer detection.

  3. Identification of biomarkers for intake of protein from meat, dairy products and grains : a controlled dietary intervention study

    NARCIS (Netherlands)

    Altorf-van der Kuil, Wieke; Brink, Elizabeth J.; Boetje, Martine; Siebelink, Els; Bijlsma, Sabina; Engberink, Marielle F.; van 't Veer, Pieter; Tome, Daniel; Bakker, Stephan J. L.; van Baak, Marleen A.; Geleijnse, Johanna M.

    2013-01-01

    In the present controlled, randomised, multiple cross-over dietary intervention study, we aimed to identify potential biomarkers for dietary protein from dairy products, meat and grain, which could be useful to estimate intake of these protein types in epidemiological studies. After 9 d run-in, thir

  4. Identification of biomarkers for intake of protein from meat, dairy products and grains: A controlled dietary intervention study

    NARCIS (Netherlands)

    Altorf-van der Kuil, W.; Brink, E.J.; Boetje, M.; Siebelink, E.; Bijlsma, S.; Engberink, M.F.; Veer, P.V.'.; Tomé, D.; Bakker, S.J.L.; Baak, M.A. van; Geleijnse, J.M.

    2013-01-01

    In the present controlled, randomised, multiple cross-over dietary intervention study, we aimed to identify potential biomarkers for dietary protein from dairy products, meat and grain, which could be useful to estimate intake of these protein types in epidemiological studies. After 9 d run-in, thir

  5. Identification of biomarkers for intake of protein from meat, dairy products and grains: a controlled dietary intervention study

    NARCIS (Netherlands)

    Altorf-van der Kuil, W.; Brink, E.J.; Boetje, M.; Siebelink, E.; Bijlsma, S.; Engberink, M.F.; Tome, D.; Bakker, S.J.; Baak, van M.A.; Geleijnse, J.M.; Veer, van 't P.

    2013-01-01

    In the present controlled, randomised, multiple cross-over dietary intervention study, we aimed to identify potential biomarkers for dietary protein from dairy products, meat and grain, which could be useful to estimate intake of these protein types in epidemiological studies. After 9 d run-in, thir

  6. Protein signature for non-small cell lung cancer prognosis

    Science.gov (United States)

    Liu, Wei; Wu, Yong; Wang, Libo; Gao, Ling; Wang, Yingping; Liu, Xiaoliang; Zhang, Kai; Song, Jena; Wang, Hongxia; Bayer, Thomas A; Glaser, Laurel; Sun, Yezhou; Zhang, Weijia; Cutaia, Michael; Zhang, David Y; Ye, Fei

    2014-01-01

    Background: Current histopathological classification and TNM staging have limited accuracy in predicting survival and stratifying patients for appropriate treatment. The goal of the study is to determine whether the expression pattern of functionally important regulatory proteins can add additional values for more accurate classification and prognostication of non-small lung cancer (NSCLC). Methods: The expression of 108 proteins and phosphoproteins in 30 paired NSCLC samples were assessed using Protein Pathway Array (PPA). The differentially expressed proteins were further confirmed using a tissue microarray (TMA) containing 94 NSCLC samples and were correlated with clinical data and survival. Results: Twelve of 108 proteins (p-CREB(Ser133), p-ERK1/2(Thr202/Tyr204), Cyclin B1, p-PDK1(Ser241), CDK4, CDK2, HSP90, CDC2p34, β-catenin, EGFR, XIAP and PCNA) were selected to build the predictor to classify normal and tumor samples with 97% accuracy. Five proteins (CDC2p34, HSP90, XIAP, CDK4 and CREB) were confirmed to be differentially expressed between NSCLC (n=94) and benign lung tumor (n=19). Over-expression of CDK4 and HSP90 in tumors correlated with a favorable overall survival in all NSCLC patients and the over-expression of p-CREB(Ser133) and CREB in NSCLC correlated with a favorable survival in smokers and those with squamous cell carcinoma, respectively. Finally, the four proteins (CDK4, HSP90, p-CREB and CREB) were used to calculate the risk score of each individual patient with NSCLC to predict survival. Conclusion: In summary, our data demonstrated a broad disturbance of functionally important regulatory proteins in NSCLC and some of these can be selected as clinically useful biomarkers for diagnosis, classification and prognosis. PMID:24959380

  7. Salivary microRNAs as promising biomarkers for detection of esophageal cancer.

    Directory of Open Access Journals (Sweden)

    Zijun Xie

    Full Text Available BACKGROUND AND PURPOSE: Tissue microRNAs (miRNAs can detect cancers and predict prognosis. Several recent studies reported that tissue, plasma, and saliva miRNAs share similar expression profiles. In this study, we investigated the discriminatory power of salivary miRNAs (including whole saliva and saliva supernatant for detection of esophageal cancer. MATERIALS AND METHODS: By Agilent microarray, six deregulated miRNAs from whole saliva samples from seven patients with esophageal cancer and three healthy controls were selected. The six selected miRNAs were subjected to validation of their expression levels by RT-qPCR using both whole saliva and saliva supernatant samples from an independent set of 39 patients with esophageal cancer and 19 healthy controls. RESULTS: Six miRNAs (miR-10b*, miR-144, miR-21, miR-451, miR-486-5p, and miR-634 were identified as targets by Agilent microarray. After validation by RT-qPCR, miR-10b*, miR-144, and miR-451 in whole saliva and miR-10b*, miR-144, miR-21, and miR-451 in saliva supernatant were significantly upregulated in patients, with sensitivities of 89.7, 92.3, 84.6, 79.5, 43.6, 89.7, and 51.3% and specificities of 57.9, 47.4, 57.9%, 57.9, 89.5, 47.4, and 84.2%, respectively. CONCLUSIONS: We found distinctive miRNAs for esophageal cancer in both whole saliva and saliva supernatant. These miRNAs possess discriminatory power for detection of esophageal cancer. Because saliva collection is noninvasive and convenient, salivary miRNAs show great promise as biomarkers for detection of esophageal cancer in areas at high risk.

  8. Dynamic application of microprojection arrays to skin induces circulating protein extravasation for enhanced biomarker capture and detection.

    Science.gov (United States)

    Coffey, Jacob W; Meliga, Stefano C; Corrie, Simon R; Kendall, Mark A F

    2016-04-01

    Surface modified microprojection arrays are a needle-free alternative to capture circulating biomarkers from the skin in vivo for diagnosis. The concentration and turnover of biomarkers in the interstitial fluid, however, may limit the amount of biomarker that can be accessed by microprojection arrays and ultimately their capture efficiency. Here we report that microprojection array insertion induces protein extravasation from blood vessels and increases the concentration of biomarkers in skin, which can synergistically improve biomarker capture. Regions of blood vessels in skin were identified in the upper dermis and subcutaneous tissue by multi-photon microscopy. Insertion of microprojection array designs with varying projection length (40-190 μm), density (5000-20,408 proj.cm(-2)) and array size (4-36 mm(2)) did not affect the degree of extravasation. Furthermore, the location of extravasated protein did not correlate with projection penetration to these highly vascularised regions, suggesting extravasation was not caused by direct puncture of blood vessels. Biomarker extravasation was also induced by dynamic application of flat control surfaces, and varied with the impact velocity, further supporting this conclusion. The extravasated protein distribution correlated well with regions of high mechanical stress generated during insertion, quantified by finite element models. Using this approach to induce extravasation prior to microprojection array-based biomarker capture, anti-influenza IgG was captured within a 2 min application time, demonstrating that extravasation can lead to rapid biomarker sampling and significantly improved microprojection array capture efficiency. These results have broad implications for the development of transdermal devices that deliver to and sample from the skin. PMID:26826791

  9. Cytoskeletal proteins in the cerebrospinal fluid as biomarker of multiple sclerosis.

    Science.gov (United States)

    Madeddu, Roberto; Farace, Cristiano; Tolu, Paola; Solinas, Giuliana; Asara, Yolande; Sotgiu, Maria Alessandra; Delogu, Lucia Gemma; Prados, Jose Carlos; Sotgiu, Stefano; Montella, Andrea

    2013-02-01

    The axonal cytoskeleton is a finely organized system, essential for maintaining the integrity of the axon. Axonal degeneration is implicated in the pathogenesis of unremitting disability of multiple sclerosis (MS). Purpose of this study is to evaluate levels of cytoskeletal proteins such as neurofilament light protein (NFL), glial fibrillary acidic protein (GFAP), and β-tubulin (β-Tub) isoforms II and III in the cerebrospinal fluid (CSF) of MS patients and their correlation with MS clinical indices. CSF levels of cytoskeletal proteins were determined in 51 patients: 33 with MS and 18 with other neurological diseases (OND). NFL, GFAP and β-Tub II proteins were significantly higher (p 0.05) was found between MS and OND with regard to β-Tub III. Interestingly, levels of β-Tub III and NFL were higher in progressive than in remitting MS forms; on the contrary, higher levels of β-Tub II and GFAP were found in remitting MS forms. However, with the exception of β-Tub III, all proteins tend to decrease their CSF levels concomitantly with the increasing disability (EDSS) score. Overall, our results might indicate β-Tub II as a potential candidate for diagnostic and β-Tub III as a possible prognostic biomarker of MS. Therefore, further analyses are legitimated and desirable. PMID:22362332

  10. Screening biomarkers of bladder cancer using combined miRNA and mRNA microarray analysis.

    Science.gov (United States)

    Jin, Ning; Jin, Xuefei; Gu, Xinquan; Na, Wanli; Zhang, Muchun; Zhao, Rui

    2015-08-01

    Biomarkers, such as microRNAs (miRNAs) may be useful for the diagnosis of bladder cancer. In order to understand the molecular mechanisms underlying bladder cancer, differentially expressed miRNAs (DE-miRNAs) and their target genes in bladder cancer were analyzed. In the present study, miRNA and mRNA expression profiles (GSE40355) were obtained from the Gene Expression Omnibus. These consisted of healthy bladder samples (n=8) and urothelial carcinoma samples (low-grade, n=8 and high-grade, n=8). DE-miRNAs and differentially expressed genes (DEGs) were identified using the limma package and the Benjamin and Hochberg method from the multtest package in R. Target genes of DE-miRNAs were screened. Associations between DEGs were investigated using STRING, and an interaction network was constructed using Cytoscape. Functional and pathway enrichment analyses were performed for DEGs from the interaction network. 87 DE-miRNAs and 2058 DEGs were screened from low-grade bladder cancer samples, and 40 DE-miRNAs and 2477 DEGs were screened from high-grade bladder cancer samples. DE-target genes were significantly associated with the regulation of cell apoptosis. Bladder cancer, non-small cell lung cancer and pancreatic cancer biological pathways were found to be enriched. The results of the present study demonstrated that E2F transcription factor 1, which is targeted by miR-106b, and cyclin-dependent kinase inhibitor 2A (CDKN2A) and V-Erb-B2 avian erythroblastic leukemia viral oncogene homolog-2, which are targeted by miR-125b, participate in the bladder cancer pathway. In conclusion, DE-miRNAs in bladder cancer tissue samples and DE-targeted genes, such as miR-106b and CDKN2A, which were identified in the present study, may provide the basis for targeted therapy for breast cancer and enhance understanding of its pathogenesis. PMID:25955758

  11. The proteomics of colorectal cancer: identification of a protein signature associated with prognosis.

    Directory of Open Access Journals (Sweden)

    Donna O'Dwyer

    Full Text Available Colorectal cancer is one of the commonest types of cancer and there is requirement for the identification of prognostic biomarkers. In this study protein expression profiles have been established for colorectal cancer and normal colonic mucosa by proteomics using a combination of two dimensional gel electrophoresis with fresh frozen sections of paired Dukes B colorectal cancer and normal colorectal mucosa (n = 28, gel image analysis and high performance liquid chromatography-tandem mass spectrometry. Hierarchical cluster analysis and principal components analysis showed that the protein expression profiles of colorectal cancer and normal colonic mucosa clustered into distinct patterns of protein expression. Forty-five proteins were identified as showing at least 1.5 times increased expression in colorectal cancer and the identity of these proteins was confirmed by liquid chromatography-tandem mass spectrometry. Fifteen proteins that showed increased expression were validated by immunohistochemistry using a well characterised colorectal cancer tissue microarray containing 515 primary colorectal cancer, 224 lymph node metastasis and 50 normal colonic mucosal samples. The proteins that showed the greatest degree of overexpression in primary colorectal cancer compared with normal colonic mucosa were heat shock protein 60 (p<0.001, S100A9 (p<0.001 and translationally controlled tumour protein (p<0.001. Analysis of proteins individually identified 14-3-3β as a prognostic biomarker (χ² = 6.218, p = 0.013, HR = 0.639, 95%CI 0.448-0.913. Hierarchical cluster analysis identified distinct phenotypes associated with survival and a two-protein signature consisting of 14-3-3β and aldehyde dehydrogenase 1 was identified as showing prognostic significance (χ² = 7.306, p = 0.007, HR = 0.504, 95%CI 0.303-0.838 and that remained independently prognostic (p = 0.01, HR = 0.416, 95%CI 0.208-0.829 in a multivariate model.

  12. TMPRSS2-ERG -specific transcriptional modulation is associated with prostate cancer biomarkers and TGF-β signaling

    International Nuclear Information System (INIS)

    TMPRSS2-ERG gene fusions occur in about 50% of all prostate cancer cases and represent promising markers for molecular subtyping. Although TMPRSS2-ERG fusion seems to be a critical event in prostate cancer, the precise functional role in cancer development and progression is still unclear. We studied large-scale gene expression profiles in 47 prostate tumor tissue samples and in 48 normal prostate tissue samples taken from the non-suspect area of clinical low-risk tumors using Affymetrix GeneChip Exon 1.0 ST microarrays. Comparison of gene expression levels among TMPRSS2-ERG fusion-positive and negative tumors as well as benign samples demonstrated a distinct transcriptional program induced by the gene fusion event. Well-known biomarkers for prostate cancer detection like CRISP3 were found to be associated with the gene fusion status. WNT and TGF-β/BMP signaling pathways were significantly associated with genes upregulated in TMPRSS2-ERG fusion-positive tumors. The TMPRSS2-ERG gene fusion results in the modulation of transcriptional patterns and cellular pathways with potential consequences for prostate cancer progression. Well-known biomarkers for prostate cancer detection were found to be associated with the gene fusion. Our results suggest that the fusion status should be considered in retrospective and future studies to assess biomarkers for prostate cancer detection, progression and targeted therapy

  13. TMPRSS2-ERG -specific transcriptional modulation is associated with prostate cancer biomarkers and TGF-β signaling

    Directory of Open Access Journals (Sweden)

    Brase Jan C

    2011-12-01

    Full Text Available Abstract Background TMPRSS2-ERG gene fusions occur in about 50% of all prostate cancer cases and represent promising markers for molecular subtyping. Although TMPRSS2-ERG fusion seems to be a critical event in prostate cancer, the precise functional role in cancer development and progression is still unclear. Methods We studied large-scale gene expression profiles in 47 prostate tumor tissue samples and in 48 normal prostate tissue samples taken from the non-suspect area of clinical low-risk tumors using Affymetrix GeneChip Exon 1.0 ST microarrays. Results Comparison of gene expression levels among TMPRSS2-ERG fusion-positive and negative tumors as well as benign samples demonstrated a distinct transcriptional program induced by the gene fusion event. Well-known biomarkers for prostate cancer detection like CRISP3 were found to be associated with the gene fusion status. WNT and TGF-β/BMP signaling pathways were significantly associated with genes upregulated in TMPRSS2-ERG fusion-positive tumors. Conclusions The TMPRSS2-ERG gene fusion results in the modulation of transcriptional patterns and cellular pathways with potential consequences for prostate cancer progression. Well-known biomarkers for prostate cancer detection were found to be associated with the gene fusion. Our results suggest that the fusion status should be considered in retrospective and future studies to assess biomarkers for prostate cancer detection, progression and targeted therapy.

  14. Role of Uncoupling Proteins in Cancer

    International Nuclear Information System (INIS)

    Uncoupling proteins (UCPs) are a family of inner mitochondrial membrane proteins whose function i