
Sample records for camp-regulated guanine nucleotide

  1. Signal transduction by guanine nucleotide binding proteins. (United States)

    Spiegel, A M


    High affinity binding of guanine nucleotides and the ability to hydrolyze bound GTP to GDP are characteristics of an extended family of intracellular proteins. Subsets of this family include cytosolic initiation and elongation factors involved in protein synthesis, and cytoskeletal proteins such as tubulin (Hughes, S.M. (1983) FEBS Lett. 164, 1-8). A distinct subset of guanine nucleotide binding proteins is membrane-associated; members of this subset include the ras gene products (Ellis, R.W. et al. (1981) Nature 292, 506-511) and the heterotrimeric G-proteins (also termed N-proteins) (Gilman, A.G. (1984) Cell 36, 577-579). Substantial evidence indicates that G-proteins act as signal transducers by coupling receptors (R) to effectors (E). A similar function has been suggested but not proven for the ras gene products. Known G-proteins include Gs and Gi, the G-proteins associated with stimulation and inhibition, respectively, of adenylate cyclase; transducin (TD), the G-protein coupling rhodopsin to cGMP phosphodiesterase in rod photoreceptors (Bitensky, M.W. et al. (1981) Curr. Top. Membr. Transp. 15, 237-271; Stryer, L. (1986) Annu. Rev. Neurosci. 9, 87-119), and Go, a G-protein of unknown function that is highly abundant in brain (Sternweis, P.C. and Robishaw, J.D. (1984) J. Biol. Chem. 259, 13806-13813; Neer, E.J. et al. (1984) J. Biol. Chem. 259, 14222-14229). G-proteins also participate in other signal transduction pathways, notably that involving phosphoinositide breakdown. In this review, I highlight recent progress in our understanding of the structure, function, and diversity of G-proteins. PMID:2435586

  2. Quantitative Analysis of Guanine Nucleotide Exchange Factors (GEFs) as Enzymes


    Randazzo, Paul A.; Jian, Xiaoying; Chen, Pei-Wen; Zhai, Peng; Soubias, Olivier; Northup, John K.


    The proteins that possess guanine nucleotide exchange factor (GEF) activity, which include about ~800 G protein coupled receptors (GPCRs), 1 15 Arf GEFs, 2 81 Rho GEFs, 3 8 Ras GEFs, 4 and others for other families of GTPases, 5 catalyze the exchange of GTP for GDP on all regulatory guanine nucleotide binding proteins. Despite their importance as catalysts, relatively few exchange factors (we are aware of only eight for ras superfamily members) have been rigorously characterized kinetically. ...

  3. Analysis of Guanine Nucleotide Binding and Exchange Kinetics of the Escherichia coli GTPase Era


    Sullivan, S M; Mishra, R.; Neubig, R. R.; Maddock, J. R.


    Era is an essential Escherichia coli guanine nucleotide binding protein that appears to play a number of cellular roles. Although the kinetics of Era guanine nucleotide binding and hydrolysis have been described, guanine nucleotide exchange rates have never been reported. Here we describe a kinetic analysis of guanine nucleotide binding, exchange, and hydrolysis by Era using the fluorescent mant (N-methyl-3′-O-anthraniloyl) guanine nucleotide analogs. The equilibrium binding constants (KD) fo...

  4. Activated Ras interacts with the Ral guanine nucleotide dissociation stimulator.


    Hofer, F.; Fields, S; Schneider, C; Martin, G S


    The yeast two-hybrid system was used to identify proteins that interact with Ras. The H-Ras protein was found to interact with a guanine nucleotide dissociation stimulator (GDS) that has been previously shown to regulate guanine nucleotide exchange on another member of the Ras protein family, Ral. The interaction is mediated by the C-terminal, noncatalytic segment of the RalGDS and can be detected both in vivo, using the two-hybrid system, and in vitro, with purified recombinant proteins. The...

  5. Spatiotemporal regulation of Rap guanine nucleotide exchange factors

    NARCIS (Netherlands)

    Consonni, S.V.


    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs

  6. Scambio, a novel guanine nucleotide exchange factor for Rho


    Groffen John; Senadheera Dinithi; Haataja Leena; Hemmeryckx Bianca; Curtis Christina; Heisterkamp Nora


    Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is lo...

  7. Spatiotemporal regulation of Rap guanine nucleotide exchange factors


    Consonni, S.V.


    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs function as activators of G-proteins by promoting their GTP-bound state while GAPs serve as inhibitors by increasing the rate of GTP hydrolysis. Our understanding of the mechanisms of regulation o...

  8. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John


    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  9. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane


    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  10. Interaction of mammalian mitochondrial elongation factor EF-Tu with guanine nucleotides.


    Cai, Y. C.; Bullard, J. M.; Thompson, N L; Spremulli, L L


    Elongation factor Tu (EF-Tu) promotes the binding of aminoacyl-tRNA (aa-tRNA) to the acceptor site of the ribosome. During the elongation cycle, EF-Tu interacts with guanine nucleotides, aa-tRNA and its nucleotide exchange factor (EF-Ts). Quantitative determination of the equilibrium dissociation constants that govern the interactions of mammalian mitochondrial EF-Tu (EF-Tu(mt)) with guanine nucleotides was the focus of the work reported here. Equilibrium dialysis with [3H]GDP was used to mea...

  11. Neutralizing monoclonal antibody against ras oncogene product p21 which impairs guanine nucleotide exchange.


    Hattori, S; Clanton, D J; Satoh, T.; Nakamura, S.; Kaziro, Y; Kawakita, M; Shih, T Y


    The neutralizing monoclonal antibody Y13-259 severely hampers the nucleotide exchange reaction between p21-bound and exogenous guanine nucleotides but does not interfere with the association of GDP to p21. These results suggest that the nucleotide exchange reaction is critical for p21 function. Interestingly, the v-ras p21 has a much faster dissociation rate than the p21 of the c-ras proto-oncogene.

  12. Kinetic Analysis of the Guanine Nucleotide Exchange Activity of TRAPP, a Multimeric Ypt1p Exchange Factor


    Chin, Harvey F.; Cai, Yiying; Menon, Shekar; Ferro-Novick, Susan; Reinisch, Karin M; De La Cruz, Enrique M.


    The TRAPP complexes, large multimeric assemblies that function in membrane traffic, are guanine nucleotide exchange factors (GEF) that activate the Rab GTPase Ypt1p. Here we measured the rate and equilibrium constants that define the interaction of Ypt1p with guanine nucleotide (GDP and GTP/GMPPNP) and the core TRAPP subunits required for GEF activity. These parameters allowed us to identify the kinetic and thermodynamic basis by which TRAPP catalyzes nucleotide exchange from Ypt1p. Nucleotid...


    Lifescience Database Archive (English)

    Full Text Available FIELD NO 608941 FIELD TI 608941 GUANINE NUCLEOTIDE-BINDING PROTEIN, GAMMA-3; GNG3 FIELD TX DESCR ... D.: Mice with deficiency of G protein gamma-3 are lean ... and have seizures. Molec. Cell. Biol. 24: 7758-776 ...

  14. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125I-[Tyr1]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg2+. When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125I-[Tyr1]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  15. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  16. Molecular Evolution of the Rab-Escort-Protein/Guanine-Nucleotide-Dissociation-Inhibitor Superfamily


    Alory, Christelle; Balch, William E.


    Prenylation of Rab GTPases regulating vesicle traffic by Rab geranylgeranyltransferase (RabGGTase) requires a complex formed by the association of newly synthesized Rab proteins with Rab-escort-protein (REP), the choroideremia-gene-product that is mutated in disease, leading to loss of vision. After delivery to the membrane by the REP–Rab complex, subsequent recycling to the cytosol requires the REP-related guanine-nucleotide-dissociation-inhibitor (GDI). Although REP and GDI share common Rab...

  17. The emerging role of guanine nucleotide exchange factors in ALS and other neurodegenerative diseases


    Droppelmann, Cristian A.; Campos-Melo, Danae; Volkening, Kathryn; Strong, Michael J.


    Small GTPases participate in a broad range of cellular processes such as proliferation, differentiation, and migration. The exchange of GDP for GTP resulting in the activation of these GTPases is catalyzed by a group of enzymes called guanine nucleotide exchange factors (GEFs), of which two classes: Dbl-related exchange factors and the more recently described dedicator of cytokinesis proteins family exchange factors. Increasingly, deregulation of normal GEF activity or function has been assoc...

  18. Collagen phagocytosis is regulated by the guanine nucleotide exchange factor Vav2


    Arora, P. D.; Marignani, P A; McCulloch, C. A.


    Collagen phagocytosis is a crucial α2β1-integrin-dependent process that mediates extracellular matrix remodeling by fibroblasts. We showed previously that after initial contact with collagen, activated Rac1 accelerates collagen phagocytosis but the Rac guanine nucleotide exchange factors (GEFs) that regulate Rac are not defined. We examined here the GEFs that regulate collagen phagocytosis in mouse fibroblasts. Collagen binding enhanced Rac1 activity (5–20 min) but not Cdc42 or RhoA activity....

  19. Superoxide Inhibits Guanine Nucleotide Exchange Factor (GEF) Action on Ras, but not on Rho, through Desensitization of Ras to GEF


    Wey, Michael; Phan, Vinh; Yepez, Gerardo; Heo, Jongyun


    Ras and Rho GTPases are molecular switches for various vital cellular signaling pathways. Overactivation of these GTPases often causes development of cancer. Guanine nucleotide exchange factors (GEFs) and oxidants function to upregulate these GTPases through facilitation of guanine nucleotide exchange (GNE) of these GTPases. However, the effect of oxidants on GEF functions, or vice versa, has not been known. We show that, via targeting Ras Cys51, an oxidant inhibits the catalytic action of Cd...

  20. Amino acid residues in the CDC25 guanine nucleotide exchange factor critical for interaction with Ras.


    Park, W.; Mosteller, R D; Broek, D.


    Previously we found that negatively charged residues at positions 62, 63, and 69 of H-Ras are involved in binding to the CDC25 guanine nucleotide exchange factor (GEF). Using site-directed mutagenesis, we have changed conserved, positively charged residues of CDC25GEF to glutamic acid. We find the nonfunctional CDC25R1374E mutant and the nonfunctional H-RasE63K mutant cooperate in suppression of the loss of CDC25 function in Saccharomyces cerevisiae. Also, peptides corresponding to residues 1...

  1. The CDC25 protein of Saccharomyces cerevisiae promotes exchange of guanine nucleotides bound to ras.


    Jones, S; Vignais, M L; Broach, J R


    The product of the CDC25 gene of Saccharomyces cerevisiae, in its capacity as an activator of the RAS/cyclic AMP pathway, is required for initiation of the cell cycle. In this report, we provide an identification of Cdc25p, the product of the CDC25 gene, and evidence that it promotes exchange of guanine nucleotides bound to Ras in vitro. Extracts of strains containing high levels of Cdc25p catalyze both removal of GDP from and the concurrent binding of GTP to Ras. This same activity is also o...

  2. Amphetamine alters Ras-guanine nucleotide-releasing factor expression in the rat striatum in vivo


    Parelkar, Nikhil K.; Jiang, Qian; Chu, Xiang-Ping; Guo, Ming-Lei; Mao, Li-Min; WANG, John Q.


    Ras-guanine nucleotide-releasing factors (Ras-GRFs) are densely expressed in neurons of the mammalian brain. As a Ras-specific activator predominantly concentrated at synaptic sites, Ras-GRFs activate the Ras-mitogen-activated protein kinase (Ras-MAPK) cascade in response to changing synaptic inputs, thereby modifying a variety of cellular and synaptic activities. While the Ras-MAPK cascade in the limbic reward circuit is well-known to be sensitive to dopamine inputs, the sensitivity of its u...

  3. BIG2, A Guanine Nucleotide Exchange Factor for ADP-Ribosylation Factors: Its Localization to Recycling Endosomes and Implication in the Endosome IntegrityD⃞


    Shin, Hye-Won; Morinaga, Naoko; NODA, Masatoshi; Nakayama, Kazuhisa


    Small GTPases of the ADP-ribosylation factor (ARF) family play a key role in membrane trafficking by regulating coated vesicle formation, and guanine nucleotide exchange is essential for the ARF function. Brefeldin A blocks the ARF-triggered coat assembly by inhibiting the guanine nucleotide exchange on ARFs and causes disintegration of the Golgi complex and tubulation of endosomal membranes. BIG2 is one of brefeldin A-inhibited guanine nucleotide exchange factors for the ARF GTPases and is a...

  4. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human

    Energy Technology Data Exchange (ETDEWEB)

    Blatt, C.; Eversole-Cire, P.; Cohn, V.H.; Zollman, S.; Fournier, R.E.K.; Mohandas, L.T.; Nesbitt, M.; Lugo, T.; Jones, D.T.; Reed, R.R.; Weiner, L.P.; Sparkes, R.S.; Simon, M.I. (Weizmann Institute, Rehovoth (Israel))


    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding {alpha}-subunit proteins, two different {beta} subunits, and one {gamma} subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The {beta} subunits were also assigned-GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extend of the G{alpha} gene family and may help in attempts to correlate specific genetic diseases and with genes corresponding to G proteins.

  5. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human. (United States)

    Blatt, C; Eversole-Cire, P; Cohn, V H; Zollman, S; Fournier, R E; Mohandas, L T; Nesbitt, M; Lugo, T; Jones, D T; Reed, R R


    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding alpha-subunit proteins, two different beta subunits, and one gamma subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The beta subunits were also assigned--GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extent of the G alpha gene family and may help in attempts to correlate specific genetic diseases with genes corresponding to G proteins. PMID:2902634

  6. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction. (United States)

    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana


    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  7. Molecular determinants of the interaction between coxsackievirus protein 3A and guanine nucleotide exchange factor GBF1.

    NARCIS (Netherlands)

    Wessels, E.; Duijsings, D.; Lanke, K.H.W.; Melchers, W.J.G.; Jackson, C.L.; Kuppeveld, F.J.M. van


    The 3A protein of coxsackievirus B3 (CVB3), a small membrane protein that forms homodimers, inhibits endoplasmic reticulum-to-Golgi complex transport. Recently, we described the underlying mechanism by showing that the CVB3 3A protein binds to and inhibits the function of GBF1, a guanine nucleotide

  8. Kinetics of the interactions between yeast elongation factors 1A and 1Balpha, guanine nucleotides, and aminoacyl-tRNA

    DEFF Research Database (Denmark)

    Gromadski, Kirill B; Schümmer, Tobias; Strømgaard, Anne;


    The interactions of elongation factor 1A (eEF1A) from Saccharomyces cerevisiae with elongation factor 1Balpha (eEF1Balpha), guanine nucleotides, and aminoacyl-tRNA were studied kinetically by fluorescence stopped-flow. eEF1A has similar affinities for GDP and GTP, 0.4 and 1.1 microm, respectively...... no significant binding, indicating that eEF1A has similar tRNA binding properties as its prokaryotic homolog, EF-Tu. Udgivelsesdato: 2007-Dec-7......The interactions of elongation factor 1A (eEF1A) from Saccharomyces cerevisiae with elongation factor 1Balpha (eEF1Balpha), guanine nucleotides, and aminoacyl-tRNA were studied kinetically by fluorescence stopped-flow. eEF1A has similar affinities for GDP and GTP, 0.4 and 1.1 microm, respectively...... guanine nucleotides. At the concentrations of nucleotides and factors prevailing in the cell, the overall exchange rate is expected to be in the range of 6 s(-1), which is compatible with the rate of protein synthesis in the cell. eEF1A.GTP binds Phe-tRNA(Phe) with a K(d) of 3 nm, whereas eEF1A.GDP shows...

  9. Guanine nucleotide exchange factor H1 can be a new biomarker of melanoma (United States)

    Shi, Jie; Guo, Bingyu; Zhang, Yu; Hui, Qiang; Chang, Peng; Tao, Kai


    Guanine nucleotide exchange factor H1 (GEF-H1), which couples microtubule dynamics to RhoA activation, is a microtubule-regulated exchange factor. Studies have shown that GEF-H1 can be involved in various cancer pathways; however, the clinical significance of GEF-H1 expression and functions in melanoma has not been established. In this study, we investigated the relationship between clinical outcomes and GEF-H1 functions in melanoma. A total of 60 cases of different grades of melanoma samples were used to detect the expression of GEF-H1. Results showed that both messenger RNA and protein levels of GEF-H1 were significantly higher in high-grade melanomas. Furthermore, patients with high GEF-H1 expression had a shorter overall survival (22 months) than patients with low level of GEF-H1 expression (33.38 months). We also found that GEF-H1 can promote the proliferation and metastasis of melanoma cells. In summary, these results suggested that GEF-H1 may be a valuable biomarker for assessing the degree and prognosis of melanoma following surgery.

  10. Arf6 guanine-nucleotide exchange factor cytohesin-2 regulates myelination in nerves. (United States)

    Torii, Tomohiro; Ohno, Nobuhiko; Miyamoto, Yuki; Kawahara, Kazuko; Saitoh, Yurika; Nakamura, Kazuaki; Takashima, Shou; Sakagami, Hiroyuki; Tanoue, Akito; Yamauchi, Junji


    In postnatal development of the peripheral nervous system (PNS), Schwann cells differentiate to insulate neuronal axons with myelin sheaths, increasing the nerve conduction velocity. To produce the mature myelin sheath with its multiple layers, Schwann cells undergo dynamic morphological changes. While extracellular molecules such as growth factors and cell adhesion ligands are known to regulate the myelination process, the intracellular molecular mechanism underlying myelination remains unclear. In this study, we have produced Schwann cell-specific conditional knockout mice for cytohesin-2, a guanine-nucleotide exchange factor (GEF) specifically activating Arf6. Arf6, a member of the Ras-like protein family, participates in various cellular functions including cell morphological changes. Cytohesin-2 knockout mice exhibit decreased Arf6 activity and reduced myelin thickness in the sciatic nerves, with decreased expression levels of myelin protein zero (MPZ), the major myelin marker protein. These results are consistent with those of experiments in which Schwann cell-neuronal cultures were treated with pan-cytohesin inhibitor SecinH3. On the other hand, the numbers of Ki67-positive cells in knockout mice and controls are comparable, indicating that cytohesin-2 does not have a positive effect on cell numbers. Thus, signaling through cytohesin-2 is required for myelination by Schwann cells, and cytohesin-2 is added to the list of molecules known to underlie PNS myelination. PMID:25824033

  11. The Guanine Nucleotide Exchange Factor ARNO mediates the activation of ARF and phospholipase D by insulin

    Directory of Open Access Journals (Sweden)

    Fluharty Eric


    Full Text Available Abstract Background Phospholipase D (PLD is involved in many signaling pathways. In most systems, the activity of PLD is primarily regulated by the members of the ADP-Ribosylation Factor (ARF family of GTPases, but the mechanism of activation of PLD and ARF by extracellular signals has not been fully established. Here we tested the hypothesis that ARF-guanine nucleotide exchange factors (ARF-GEFs of the cytohesin/ARNO family mediate the activation of ARF and PLD by insulin. Results Wild type ARNO transiently transfected in HIRcB cells was translocated to the plasma membrane in an insulin-dependent manner and promoted the translocation of ARF to the membranes. ARNO mutants: ΔCC-ARNO and CC-ARNO were partially translocated to the membranes while ΔPH-ARNO and PH-ARNO could not be translocated to the membranes. Sec7 domain mutants of ARNO did not facilitate the ARF translocation. Overexpression of wild type ARNO significantly increased insulin-stimulated PLD activity, and mutations in the Sec7 and PH domains, or deletion of the PH or CC domains inhibited the effects of insulin. Conclusions Small ARF-GEFs of the cytohesin/ARNO family mediate the activation of ARF and PLD by the insulin receptor.

  12. Ric-8A, a Gα protein guanine nucleotide exchange factor potentiates taste receptor signaling

    Directory of Open Access Journals (Sweden)

    Claire J Fenech


    Full Text Available Taste receptors for sweet, bitter and umami tastants are G-protein coupled receptors (GPCRs. While much effort has been devoted to understanding G-protein-receptor interactions and identifying the components of the signalling cascade downstream of these receptors, at the level of the G-protein the modulation of receptor signal transduction remains relatively unexplored. In this regard a taste-specific regulator of G-protein signaling (RGS, RGS21, has recently been identified. To study whether guanine nucleotide exchange factors (GEFs are involved in the transduction of the signal downstream of the taste GPCRs we investigated the expression of Ric-8A and Ric-8B in mouse taste cells and their interaction with G-protein subunits found in taste buds. Mammalian Ric-8 proteins were initially identified as potent GEFs for a range of Gα subunits and Ric-8B has recently been shown to amplify olfactory signal transduction. We find that both Ric-8A and Ric-8B are expressed in a large portion of taste bud cells and that most of these cells contain IP3R-3 a marker for sweet, umami and bitter taste receptor cells. Ric-8A interacts with Gα-gustducin and Gαi2 through which it amplifies the signal transduction of hTas2R16, a receptor for bitter compounds. Overall, these findings are consistent with a role for Ric-8 in mammalian taste signal transduction.

  13. Proteomic analysis of Rac1 signaling regulation by guanine nucleotide exchange factors. (United States)

    Marei, Hadir; Carpy, Alejandro; Macek, Boris; Malliri, Angeliki


    The small GTPase Rac1 is implicated in various cellular processes that are essential for normal cell function. Deregulation of Rac1 signaling has also been linked to a number of diseases, including cancer. The diversity of Rac1 functioning in cells is mainly attributed to its ability to bind to a multitude of downstream effectors following activation by Guanine nucleotide Exchange Factors (GEFs). Despite the identification of a large number of Rac1 binding partners, factors influencing downstream specificity are poorly defined, thus hindering the detailed understanding of both Rac1's normal and pathological functions. In a recent study, we demonstrated a role for 2 Rac-specific GEFs, Tiam1 and P-Rex1, in mediating Rac1 anti- versus pro-migratory effects, respectively. Importantly, via conducting a quantitative proteomic screen, we identified distinct changes in the Rac1 interactome following activation by either GEF, indicating that these opposing effects are mediated through GEF modulation of the Rac1 interactome. Here, we present the full list of identified Rac1 interactors together with functional annotation of the differentially regulated Rac1 binding partners. In light of this data, we also provide additional insights into known and novel signaling cascades that might account for the GEF-mediated Rac1-driven cellular effects. PMID:27152953

  14. Lpg0393 of Legionella pneumophila Is a Guanine-Nucleotide Exchange Factor for Rab5, Rab21 and Rab22 (United States)

    Sohn, Young-Sik; Shin, Ho-Chul; Park, Wei Sun; Ge, Jianning; Kim, Chan-Hee; Lee, Bok Luel; Do Heo, Won; Jung, Jae U.; Rigden, Daniel John; Oh, Byung-Ha


    Legionella pneumophila, a human intracellular pathogen, encodes about 290 effector proteins that are translocated into host cells through a secretion machinery. Some of these proteins have been shown to manipulate or subvert cellular processes during infection, but functional roles of a majority of them remain unknown. Lpg0393 is a newly identified Legionella effector classified as a hypothetical protein. Through X-ray crystallographic analysis, we show that Lpg0393 contains a Vps9-like domain, which is structurally most similar to the catalytic core of human Rabex-5 that activates the endosomal Rab proteins Rab5, Rab21 and Rab22. Consistently, Lpg0393 exhibited a guanine-nucleotide exchange factor activity toward the endosomal Rabs. This work identifies the first example of a bacterial guanine-nucleotide exchange factor that is active towards the Rab5 sub-cluster members, implying that the activation of these Rab proteins might be advantageous for the intracellular survival of Legionella. PMID:25821953

  15. Host-deficiency in Vav 2/3 guanine nucleotide exchange factors impairs tumor growth, survival, and angiogenesis in vivo


    Brantley-Sieders, Dana M.; Zhuang, Guanglei; Vaught, David; Freeman, Tanner; Hwang, Yoonha; Hicks, Donna; Chen, Jin


    Vav guanine nucleotide exchange factors (GEFs) modulate changes in cytoskeletal organization through activation of Rho, Rac, and Cdc42 small GTPases. While Vav1 expression is restricted to the immune system, Vav2 and 3 are expressed in several tissues, including highly vascularized organs. Here, we provide the first evidence that Vav2 and Vav3 function within the tumor microenvironment to promote tumor growth, survival, and neovascularization. Host Vav2/3-deficiency reduced microvascular dens...

  16. RINL, Guanine Nucleotide Exchange Factor Rab5-Subfamily, Is Involved in the EphA8-Degradation Pathway with Odin


    Hiroaki Kajiho; Shinichi Fukushima; Kenji Kontani; Toshiaki Katada


    The Rab family of small guanosine triphosphatases (GTPases) plays a vital role in membrane trafficking. Its active GTP-bound state is driven by guanine nucleotide-exchange factors (GEFs). Ras and Rab interactor (or Ras interaction/interference)-like (RINL), which contains a conserved VPS9 domain critical for GEF action, was recently identified as a new Rab5 subfamily GEF in vitro. However, its detailed function and interacting molecules have not yet been fully elucidated. Here we found that R...

  17. Expression of the wild-type p53 antioncogene induces guanine nucleotide-dependent stem cell division kinetics.


    Sherley, J L; Stadler, P B; Johnson, D. R.


    The predominant type of cell division in adult mammals is renewal growth. Renewing stem cells in somatic tissues undergo continuous asymmetric divisions. One new daughter cell retains the division potential of the original stem cell, while the other differentiates into a functional constituent of the tissue. Disruptions of this process lead to the development of human cancers. We show that through a guanine nucleotide-dependent mechanism, the p53 antioncogene can induce exponentially dividing...

  18. Sestrins Function as Guanine Nucleotide Dissociation Inhibitors for Rag GTPases to Control mTORC1 Signaling


    Peng, Min; Yin, Na; Li, Ming O.


    Mechanistic target of rapamycin complex 1 (mTORC1) integrates diverse environmental signals to control cellular growth and organismal homeostasis. In response to nutrients, Rag GTPases recruit mTORC1 to the lysosome to be activated, but how Rags are regulated remains incompletely understood. Here we show that Sestrins bind to the heterodimeric RagA/B-RagC/D GTPases, and function as guanine nucleotide dissociation inhibitors (GDIs) for RagA/B. Sestrin overexpression inhibits amino acid-induced...

  19. Age-related guanine nucleotide exchange factor, mouse Zizimin2, induces filopodia in bone marrow-derived dendritic cells


    Sakabe Isamu; Asai Azusa; Iijima Junko; Maruyama Mitsuo


    Abstract Background We recently isolated and identified Zizimin2 as a functional factor that is highly expressed in murine splenic germinal center B cells after immunization with T-cell-dependent antigen. Zizimin2 was revealed to be a new family member of Dock (dedicator of cytokinesis), Dock11, which is the guanine nucleotide exchange factor for Cdc42, a low-molecular-weight GTPase. However, the molecular function of Zizimin2 in acquired immunity has not been elucidated. Results In this stud...

  20. The Guanine Nucleotide Exchange Factor SWAP-70 Modulates the Migration and Invasiveness of Human Malignant Glioma Cells12


    SEOL, HO JUN; Smith, Christian A.; Salhia, Bodour; Rutka, James T.


    The malignant glioma is the most common primary human brain tumor. Its tendency to invade away from the primary tumor mass is considered a leading cause of tumor recurrence and treatment failure. Accordingly, the molecular pathogenesis of glioma invasion is currently under investigation. Previously, we examined a gene expression array database comparing human gliomas to nonneoplastic controls and identified several Rac guanine nucleotide exchange factors with differential expression. Here, we...

  1. The guanine nucleotide exchange factor RIC8 regulates conidial germination through Gα proteins in Neurospora crassa.

    Directory of Open Access Journals (Sweden)

    Carla J Eaton

    Full Text Available Heterotrimeric G protein signaling is essential for normal hyphal growth in the filamentous fungus Neurospora crassa. We have previously demonstrated that the non-receptor guanine nucleotide exchange factor RIC8 acts upstream of the Gα proteins GNA-1 and GNA-3 to regulate hyphal extension. Here we demonstrate that regulation of hyphal extension results at least in part, from an important role in control of asexual spore (conidia germination. Loss of GNA-3 leads to a drastic reduction in conidial germination, which is exacerbated in the absence of GNA-1. Mutation of RIC8 leads to a reduction in germination similar to that in the Δgna-1, Δgna-3 double mutant, suggesting that RIC8 regulates conidial germination through both GNA-1 and GNA-3. Support for a more significant role for GNA-3 is indicated by the observation that expression of a GTPase-deficient, constitutively active gna-3 allele in the Δric8 mutant leads to a significant increase in conidial germination. Localization of the three Gα proteins during conidial germination was probed through analysis of cells expressing fluorescently tagged proteins. Functional TagRFP fusions of each of the three Gα subunits were constructed through insertion of TagRFP in a conserved loop region of the Gα subunits. The results demonstrated that GNA-1 localizes to the plasma membrane and vacuoles, and also to septa throughout conidial germination. GNA-2 and GNA-3 localize to both the plasma membrane and vacuoles during early germination, but are then found in intracellular vacuoles later during hyphal outgrowth.

  2. Multisite phosphorylation of the guanine nucleotide exchange factor Cdc24 during yeast cell polarization.

    Directory of Open Access Journals (Sweden)

    Stephanie C Wai

    Full Text Available BACKGROUND: Cell polarization is essential for processes such as cell migration and asymmetric cell division. A common regulator of cell polarization in most eukaryotic cells is the conserved Rho GTPase, Cdc42. In budding yeast, Cdc42 is activated by a single guanine nucleotide exchange factor, Cdc24. The mechanistic details of Cdc24 activation at the onset of yeast cell polarization are unclear. Previous studies have suggested an important role for phosphorylation of Cdc24, which may regulate activity or function of the protein, representing a key step in the symmetry breaking process. METHODOLOGY/PRINCIPAL FINDINGS: Here, we directly ask whether multisite phosphorylation of Cdc24 plays a role in its regulation. We identify through mass spectrometry analysis over thirty putative in vivo phosphorylation sites. We first focus on sites matching consensus sequences for cyclin-dependent and p21-activated kinases, two kinase families that have been previously shown to phosphorylate Cdc24. Through site-directed mutagenesis, yeast genetics, and light and fluorescence microscopy, we show that nonphosphorylatable mutations of these consensus sites do not lead to any detectable consequences on growth rate, morphology, kinetics of polarization, or localization of the mutant protein. We do, however, observe a change in the mobility shift of mutant Cdc24 proteins on SDS-PAGE, suggesting that we have indeed perturbed its phosphorylation. Finally, we show that mutation of all identified phosphorylation sites does not cause observable defects in growth rate or morphology. CONCLUSIONS/SIGNIFICANCE: We conclude that lack of phosphorylation on Cdc24 has no overt functional consequences in budding yeast. Yeast cell polarization may be more tightly regulated by inactivation of Cdc42 by GTPase activating proteins or by alternative methods of Cdc24 regulation, such as conformational changes or oligomerization.

  3. The selective phosphorylation of a guanine nucleotide-binding regulatory protein

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, K.E.


    Receptor-activated signal transduction pathways regulate the responsiveness of cells to external stimuli. These transduction pathways themselves are subject to regulation, most commonly by phosphorylation. Guanine nucleotide-binding regulatory proteins (G Proteins), as requisite signal transducing elements for many plasma membrane receptors, are considered likely targets for regulation by phosphorylation. Protein kinase C (PKC) has been shown to phosphorylate the {alpha} subunit of G{sub i} and other G proteins in solution. However, the occurrence of the phosphorylation of G{sub 1} within intact cells in response to activation of PKC has not been rigorously demonstrated. In this thesis, the extent to which the {alpha} subunits of G{sub i} undergo phosphorylation within human platelets in response to activation of PKC was examined by means of radiolabeling and immunoprecipitation. Incubation of platelets with phorbol-12-myristate-13-acetate (PMA), a potent activator of PKC, promoted the phosphorylation of several proteins within saponin-permeabilized and intact platelets incubated with ({gamma}{sup 32}P)ATP and ({sup 32}P)H{sub 3}PO{sub 4}, respectively. None of the phosphoproteins, however, were precipitated by either of two antisera containing antibodies differing in specificities for epitopes within G{sub i{alpha}}-despite precipitation of a substantial fraction of the subunit itself. In contrast, other antisera, containing antibodies specific for the recently describe G{sub z{alpha}}, or antibodies for both G{sub z{alpha}} and G{sub i{alpha}}, precipitated a 40-kDa phosphoprotein.

  4. Guanine nucleotide-binding proteins that enhance choleragen ADP-ribosyltransferase activity: nucleotide and deduced amino acid sequence of an ADP-ribosylation factor cDNA.


    Price, S R; Nightingale, M.; Tsai, S C; Williamson, K. C.; Adamik, R; H. C. Chen; Moss, J; M. Vaughan


    Three (two soluble and one membrane) guanine nucleotide-binding proteins (G proteins) that enhance ADP-ribosylation of the Gs alpha stimulatory subunit of the adenylyl cyclase (EC complex by choleragen have recently been purified from bovine brain. To further define the structure and function of these ADP-ribosylation factors (ARFs), we isolated a cDNA clone (lambda ARF2B) from a bovine retinal library by screening with a mixed heptadecanucleotide probe whose sequence was based on th...

  5. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    International Nuclear Information System (INIS)

    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A)+ RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A)+ RNA are consistent with the presence of at least two, and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs

  6. Guanine-Centric Self-Assembly of Nucleotides in Water: An Important Consideration in Prebiotic Chemistry


    Cassidy, Lauren M.; Burcar, Bradley T.; Stevens, Wyatt; Moriarty, Elizabeth M.; McGown, Linda B.


    Investigations of plausible prebiotic chemistry on early Earth must consider not only chemical reactions to form more complex products such as proto-biopolymers but also reversible, molecular self-assembly that would influence the availability, organization, and sequestration of reactant molecules. The self-assembly of guanosine compounds into higher-order structures and lyotropic liquid crystalline “gel” phases through formation of hydrogen-bonded guanine tetrads (G-tetrads) is one such cons...

  7. Escherichia coli cell division protein FtsZ is a guanine nucleotide binding protein.


    Mukherjee, A; Dai, K; Lutkenhaus, J


    FtsZ is an essential cell division protein in Escherichia coli that forms a ring structure at the division site under cell cycle control. The dynamic nature of the FtsZ ring suggests possible similarities to eukaryotic filament forming proteins such as tubulin. In this study we have determined that FtsZ is a GTP/GDP binding protein with GTPase activity. A short segment of FtsZ is homologous to a segment in tubulin believed to be involved in the interaction between tubulin and guanine nucleoti...

  8. The PDZ domain of the guanine nucleotide exchange factor PDZGEF directs binding to phosphatidic acid during brush border formation.

    Directory of Open Access Journals (Sweden)

    Sarah V Consonni

    Full Text Available PDZGEF is a guanine nucleotide exchange factor for the small G protein Rap. It was recently found that PDZGEF contributes to establishment of intestinal epithelial polarity downstream of the kinase Lkb1. By binding to phosphatidic acid enriched at the apical membrane, PDZGEF locally activates Rap2a resulting in induction of brush border formation via a pathway that includes the polarity players TNIK, Mst4 and Ezrin. Here we show that the PDZ domain of PDZGEF is essential and sufficient for targeting PDZGEF to the apical membrane of polarized intestinal epithelial cells. Inhibition of PLD and consequently production of phosphatidic acid inhibitis targeting of PDZGEF to the plasma membrane. Furthermore, localization requires specific positively charged residues within the PDZ domain. We conclude that local accumulation of PDZGEF at the apical membrane during establishment of epithelial polarity is mediated by electrostatic interactions between positively charged side chains in the PDZ domain and negatively charged phosphatidic acid.

  9. Influence of morphine on levels of type Ⅱ inhibitory guanine nucleotide binding protein in primary hippocampal neurons

    Institute of Scientific and Technical Information of China (English)

    Qinghua Wu; Qiang Fu; Xinhua Wang; Jianhua Zhao; Liwei Liu; Shirong Tang


    BACKGROUND: The pharmacological action of opioid drugs is related to signal transduction of inhibitory guanine nucleotide binding protein.OBJECTIVE: To quantitatively and qualitatively analyze the influence of morphine on levels of type Ⅱ inhibitory guanine nucleotide binding protein (Gi2 protein) in primary cultured hippocampal neurons at different time points.DESIGN, TIME AND SETTING: A randomized controlled study, which was performed at the Department of Neurobiology, Changzheng Hospital, Second Military Medical University of Chinese PLA between September 2002 and March 2004.MATERIALS: Cerebral hippocampal neurons were obtained from newborn SD rats at 1-2 days of age. Biotin-antibody Ⅱ-avidin fluorescein isothiocyanate (Avidin-FITC) was purchased from Sigma Company (USA) and the Gi2 protein polyclonal antibody from Santa Cruz Biochemistry Company (USA).METHODS: Seven days after culture, mature hippocampal neurons were randomly divided into six groups: 4-, 8-, 16-, 24-, and 48-hour morphine groups, and a blank control group. Neurons in the morphine groups Received morphine (10μmol/L), which could cause alterations of G-protein mRNA and cAMP expression in the prefrontal cortex. Neurons in the blank control group were given the same volume of saline.MAIN OUTCOME MEASURES: Gi2 protein levels were detected by an immunofluorescence technique, and were analyzed by the image analytic system with the use of green fluorescence intensity.RESULTS: Gi2 protein levels in hippocampal neurons gradually decreased in the 4-, 8-, 16-, 24-, and 48-hour morphine groups. In particular, Gi2 protein levels in the 16-, 24-, and 48-hour morphine groups were significantly lower than that in the blank control group (P<0.05-0.01).CONCLUSION: Morphine may decrease Gi2 protein level in primary hippocampal neurons, and the decreasing trend is positively related to morphine-induced time.

  10. Guanine Nucleotide-Binding Proteins of the G(12) Family Shape Immune Functions by Controlling CD4(+) T Cell Adhesiveness and Motility

    NARCIS (Netherlands)

    S. Herroeder; P. Reichardt; A. Sassmann; B. Zimmermann; D. Jaeneke; J. Hoeckner; M.W. Hollmann; K.D. Fischer; S. Vogt; R. Grosse; N. Hogg; M. Gunzer; S. Offermanns; N. Wettschureck


    Integrin-mediated adhesion plays a central role in T cell trafficking and activation. Genetic inactivation of the guanine nucleotide-binding (G) protein alpha-subunits G alpha(12) and G alpha(13) resulted in an increased activity of integrin leukocyte-function-antigen-1 in murine CD4(+) T cells. The

  11. The Roles of Guanine Nucleotide Binding Proteins in Health and Disease

    Directory of Open Access Journals (Sweden)

    A.O. Ibegbu


    Full Text Available G-proteins are important mediators of cellular and tissue functions and are characterised by a recognition site for Guanine Triphosphate (GTP, Guanine Diphosphate (GDP and possess intrinsic GTPase activity. They play important roles in signal transduction responsible for cytoskeletal remodelling, cellular differentiation and vesicular transport. They are made up of three types namely, the small G-proteins, the sensors and the heterotrimeric G-proteins. The G-protein heterotrimers consist of G-alpha (G", G-beta (G$ and G-gamma (G( subunits. Each heterotrimeric G-protein have different subunits and the combination of these subunits define the specific role of each G -protein. The activation of G" subunits regulates the activity of effector enzymes and ion channels while G$( subunits function in the regulation of mitogen-activated protein kinase (MAP-kinase pathway. The G-protein-mediated signal transduction is important in the regulation of a cells morphological and physiological response to external stimuli. MAPKs are involved in the phosphorylation of transcription factors that stimulate gene transcription. G"s stimulates adenylate cyclase, thereby increasing cyclic adenosine monophosphate (cAMP leading to the phosphorylation and subsequent activation of Ca2+ channels. G proteins are involved in disease pathology through several mechanisms which interfere with the G protein activity. Other disease pathologies associated with abnormal mutations in G proteins can interfere with signal transduction pathways which may involve signal transmission that is either excessive, by augmentation o f G protein function, or insufficient, via inactivation of G proteins.

  12. The domain architecture of large guanine nucleotide exchange factors for the small GTP-binding protein Arf

    Directory of Open Access Journals (Sweden)

    Geldner Niko


    Full Text Available Abstract Background Small G proteins, which are essential regulators of multiple cellular functions, are activated by guanine nucleotide exchange factors (GEFs that stimulate the exchange of the tightly bound GDP nucleotide by GTP. The catalytic domain responsible for nucleotide exchange is in general associated with non-catalytic domains that define the spatio-temporal conditions of activation. In the case of small G proteins of the Arf subfamily, which are major regulators of membrane trafficking, GEFs form a heterogeneous family whose only common characteristic is the well-characterized Sec7 catalytic domain. In contrast, the function of non-catalytic domains and how they regulate/cooperate with the catalytic domain is essentially unknown. Results Based on Sec7-containing sequences from fully-annotated eukaryotic genomes, including our annotation of these sequences from Paramecium, we have investigated the domain architecture of large ArfGEFs of the BIG and GBF subfamilies, which are involved in Golgi traffic. Multiple sequence alignments combined with the analysis of predicted secondary structures, non-structured regions and splicing patterns, identifies five novel non-catalytic structural domains which are common to both subfamilies, revealing that they share a conserved modular organization. We also report a novel ArfGEF subfamily with a domain organization so far unique to alveolates, which we name TBS (TBC-Sec7. Conclusion Our analysis unifies the BIG and GBF subfamilies into a higher order subfamily, which, together with their being the only subfamilies common to all eukaryotes, suggests that they descend from a common ancestor from which species-specific ArfGEFs have subsequently evolved. Our identification of a conserved modular architecture provides a background for future functional investigation of non-catalytic domains.

  13. Identification and characterization of the unique guanine nucleotide exchange factor, SmgGDS, in vascular smooth muscle cells. (United States)

    Thill, Rebecca; Campbell, William B; Williams, Carol L


    The guanine nucleotide exchange factor (GEF), SmgGDS, promotes nucleotide exchange by several GTPases in both the Ras and Rho families, especially by RhoA. Because RhoA plays an important role in regulating the contraction of vascular smooth muscle cells (VSMC), we examined the expression and function of SmgGDS in VSMC. SmgGDS is expressed in primary rat aortic smooth muscle (ASM) cells, primary bovine coronary artery smooth muscle (BCASM) cells, and the immortalized A7r5 line of rat ASM cells. Down regulation of SmgGDS expression by siRNA transfection resulted in a decrease of RhoA-GTP levels, enhanced cell spreading, and loss of the characteristic elongated morphology of VSMC. A similar morphology was also observed following treatment with the Rho-kinase inhibitor, Y27632. In contrast, cells with reduced RhoA expression exhibit an elongated shape. Subsequent immunofluorescent staining revealed a disruption of the myosin filament organization in the cells with reduced SmgGDS expression. Further studies analyzed the effect of SmgGDS siRNA transfection on the contraction of A7r5 cells and BCASM cells, which is also a Rho-regulated pathway. Transfection of SmgGDS siRNA or RhoA siRNA resulted in an impaired ability of the A7r5 and BCASM cells to undergo contraction in a collagen gel matrix. However, phosphorylation of the myosin-binding subunit of myosin phosphatase (MYPT1) or the light chain of myosin II (MLC) was not altered by downregulating expression of either SmgGDS or RhoA GTPase. Taken together these results identify SmgGDS as a novel regulator of myosin organization and contraction in VSMC. PMID:18348285

  14. Expanding functions of GIT Arf GTPase-activating proteins, PIX Rho guanine nucleotide exchange factors and GIT-PIX complexes. (United States)

    Zhou, Wu; Li, Xiaobo; Premont, Richard T


    The GIT proteins, GIT1 and GIT2, are GTPase-activating proteins (inactivators) for the ADP-ribosylation factor (Arf) small GTP-binding proteins, and function to limit the activity of Arf proteins. The PIX proteins, α-PIX and β-PIX (also known as ARHGEF6 and ARHGEF7, respectively), are guanine nucleotide exchange factors (activators) for the Rho family small GTP-binding protein family members Rac1 and Cdc42. Through their multi-domain structures, GIT and PIX proteins can also function as signaling scaffolds by binding to numerous protein partners. Importantly, the constitutive association of GIT and PIX proteins into oligomeric GIT-PIX complexes allows these two proteins to function together as subunits of a larger structure that coordinates two distinct small GTP-binding protein pathways and serves as multivalent scaffold for the partners of both constituent subunits. Studies have revealed the involvement of GIT and PIX proteins, and of the GIT-PIX complex, in numerous fundamental cellular processes through a wide variety of mechanisms, pathways and signaling partners. In this Commentary, we discuss recent findings in key physiological systems that exemplify current understanding of the function of this important regulatory complex. Further, we draw attention to gaps in crucial information that remain to be filled to allow a better understanding of the many roles of the GIT-PIX complex in health and disease. PMID:27182061

  15. ELMO1 and Dock180, a bipartite Rac1 guanine nucleotide exchange factor, promote human glioma cell invasion. (United States)

    Jarzynka, Michael J; Hu, Bo; Hui, Kwok-Min; Bar-Joseph, Ifat; Gu, Weisong; Hirose, Takanori; Haney, Lisa B; Ravichandran, Kodi S; Nishikawa, Ryo; Cheng, Shi-Yuan


    A distinct feature of malignant gliomas is the intrinsic ability of single tumor cells to disperse throughout the brain, contributing to the failure of existing therapies to alter the progression and recurrence of these deadly brain tumors. Regrettably, the mechanisms underlying the inherent invasiveness of glioma cells are poorly understood. Here, we report for the first time that engulfment and cell motility 1 (ELMO1) and dedicator of cytokinesis 1 (Dock180), a bipartite Rac1 guanine nucleotide exchange factor (GEF), are evidently linked to the invasive phenotype of glioma cells. Immunohistochemical analysis of primary human glioma specimens showed high expression levels of ELMO1 and Dock180 in actively invading tumor cells in the invasive areas, but not in the central regions of these tumors. Elevated expression of ELMO1 and Dock180 was also found in various human glioma cell lines compared with normal human astrocytes. Inhibition of endogenous ELMO1 and Dock180 expression significantly impeded glioma cell invasion in vitro and in brain tissue slices with a concomitant reduction in Rac1 activation. Conversely, exogenous expression of ELMO1 and Dock180 in glioma cells with low level endogenous expression increased their migratory and invasive capacity in vitro and in brain tissue. These data suggest that the bipartite GEF, ELMO1 and Dock180, play an important role in promoting cancer cell invasion and could be potential therapeutic targets for the treatment of diffuse malignant gliomas. PMID:17671188

  16. RINL, guanine nucleotide exchange factor Rab5-subfamily, is involved in the EphA8-degradation pathway with odin.

    Directory of Open Access Journals (Sweden)

    Hiroaki Kajiho

    Full Text Available The Rab family of small guanosine triphosphatases (GTPases plays a vital role in membrane trafficking. Its active GTP-bound state is driven by guanine nucleotide-exchange factors (GEFs. Ras and Rab interactor (or Ras interaction/interference-like (RINL, which contains a conserved VPS9 domain critical for GEF action, was recently identified as a new Rab5 subfamily GEF in vitro. However, its detailed function and interacting molecules have not yet been fully elucidated. Here we found that RINL has GEF activity for the Rab5 subfamily proteins by measuring their GTP-bound forms in cultured cells. We also found that RINL interacts with odin, a member of the ankyrin-repeat and sterile-alpha motif (SAM domain-containing (Anks protein family. In addition, the Eph tyrosine kinase receptor EphA8 formed a ternary complex with both RINL and odin. Interestingly, RINL expression in cultured cells reduced EphA8 levels in a manner dependent on both its GEF activity and interaction with odin. In addition, knockdown of RINL increased EphA8 level in HeLa cells. Our findings suggest that RINL, as a GEF for Rab5 subfamily, is implicated in the EphA8-degradation pathway via its interaction with odin.

  17. A molecular dynamics study of Hras-GTP and GDP complexes: The properties of water molecules around guanine nucleotide (United States)

    Miyakawa, T.; Morikawa, R.; Takasu, M.; Sugimori, K.; Kawaguchi, K.; Saito, H.; Nagao, H.


    We study the structures of Hras-GTP and Hras-GDP complexes in water in order to investigate the mechanism of hydrolysis of GTP in the Hras-GTP complex. Understanding of the mechanism of hydrolysis of GTP in the Hras-GTP complex plays a key role in overcoming the human cancer. We performed molecular dynamics (MD) simulations of Hras-GTP complex and Hras-GDP complex in water using AMBER03 parameters and our calculated parameters around Mg2+. Using the trajectories of the MD simulations, we calculated the radial distribution functions of water molecules around the phosphorus atoms in guanine nucleotide in each complex. We also calculated the radius of the first hydration sphere, the averaged number of water molecules in the first hydration sphere, and the distribution of duration time of water molecules in the first hydration sphere. We also calculated the distribution of water molecules with respect to the angle around the PG in GTP and PB in GDP. It is suggested that the hydrolysis is triggered by water molecules attacking γ-phosphate from the direction rotated 35° to the O1B from the axis defined by PG and O3B.

  18. Reconstitution of rate brain μ opioid receptors with purified guanine nucleotide-binding regulatory proteins, Gi and Go

    International Nuclear Information System (INIS)

    Reconstitution of purified μ opioid receptors with purified guanine nucleotide-binding regulatory proteins (G proteins) was investigated. The purified μ opioid receptor (pI 5.6) migrated as a single Mr 58,000 polypeptide by NaDodSO4/PAGE, a value identical to that obtained by affinity cross-linking purified μ receptors. When purified μ receptors were reconstituted with purified Gi, the G protein that mediates the inhibition of adenylate cyclase, the displacement of [3H]naloxone binding by [D-Ala2,MePhe4,Gly-ol5]enkephalin was increased 215-fold; this increase was abolished by adding 100 μM guanosine 5'-[γ-thio]triphosphate. Similar increases in agonist displacement of [3H]naloxone binding (33-fold) and its abolition by guanosine 5'-[γ-thio]triphosphate were observed with Go, the G protein of unknown function, but not with the v-Ki-ras protein p.21. The stoichiometry was such that the stimulation of 1 mol of μ receptor led to the binding of [3H]guanosine 5'-[β,γ-imido]triphosphate to 2.5 mol of Gi or to 1.37 mol of Go. These results suggest that the purified μ opioid receptor is functionally coupled to Gi and Go in the reconstituted phospholipid vesicles

  19. Total synthesis and expression of a gene for the alpha-subunit of bovine rod outer segment guanine nucleotide-binding protein (transducin).


    Sakmar, T P; Khorana, H G


    To facilitate structure-function studies by site-specific mutagenesis, we have synthesized a gene for the alpha-subunit of the bovine rod outer segment (ROS) guanine nucleotide-binding protein (transducin). The gene codes for the native amino acid sequence and contains, by design, 38 unique restriction sites which are uniformly spaced. This enables mutagenesis in any part of the gene by restriction fragment replacement. The gene is 1076 base pairs in length. It was constructed from 44 synthet...

  20. Activation of Rac1 by the Guanine Nucleotide Exchange Factor Dck1 Is Required for Invasive Filamentous Growth in the Pathogen Candida albicans


    Hope, Hannah; Bogliolo, Stéphanie; Arkowitz, Robert A; Bassilana, Martine


    Rho G proteins and their regulators are critical for cytoskeleton organization and cell morphology in all eukaryotes. In the opportunistic pathogen Candida albicans, the Rho G proteins Cdc42 and Rac1 are required for the switch from budding to filamentous growth in response to different stimuli. We show that Dck1, a protein with homology to the Ced-5, Dock180, myoblast city family of guanine nucleotide exchange factors, is necessary for filamentous growth in solid media, similar to Rac1. Our ...

  1. Mammalian Mon2/Ysl2 regulates endosome-to-Golgi trafficking but possesses no guanine nucleotide exchange activity toward Arl1 GTPase (United States)

    Mahajan, Divyanshu; Boh, Boon Kim; Zhou, Yan; Chen, Li; Cornvik, Tobias Carl; Hong, Wanjin; Lu, Lei


    Arl1 is a member of Arf family small GTPases that is essential for the organization and function of Golgi complex. Mon2/Ysl2, which shares significant homology with Sec7 family Arf guanine nucleotide exchange factors, was poorly characterized in mammalian cells. Here, we report the first in depth characterization of mammalian Mon2. We found that Mon2 localized to trans-Golgi network which was dependent on both its N and C termini. The depletion of Mon2 did not affect the Golgi localized or cellular active form of Arl1. Furthermore, our in vitro assay demonstrated that recombinant Mon2 did not promote guanine nucleotide exchange of Arl1. Therefore, our results suggest that Mon2 could be neither necessary nor sufficient for the guanine nucleotide exchange of Arl1. We demonstrated that Mon2 was involved in endosome-to-Golgi trafficking as its depletion accelerated the delivery of furin and CI-M6PR to Golgi after endocytosis.

  2. Guanine nucleotide-binding protein subunit beta-2-like 1, a new Annexin A7 interacting protein

    Energy Technology Data Exchange (ETDEWEB)

    Du, Yue; Meng, Jinyi; Huang, Yuhong; Wu, Jun; Wang, Bo; Ibrahim, Mohammed M.; Tang, Jianwu, E-mail:


    Highlights: • RACK1 formed a complex with Annexin A7. • Depletion of RACK1 inhibited the proliferation, migration and invasion. • RACK1 RNAi abolished RACK1-Annexin A7 interaction. • RACK1-Annexin A7 may play a role in regulating the metastatic potentials. - Abstract: We report for the first time that Guanine nucleotide-binding protein subunit beta-2-like 1 (RACK1) formed a complex with Annexin A7. Hca-F and Hca-P are a pair of syngeneic mouse hepatocarcinoma cell lines established and maintained in our laboratory. Our previous study showed that both Annexin A7 and RACK1 were expressed higher in Hca-F (lymph node metastasis >70%) than Hca-P (lymph node metastasis <30%). Suppression of Annexin A7 expression in Hca-F cells induced decreased migration and invasion ability. In this study, knockdown of RACK1 by RNA interference (RNAi) had the same impact on metastasis potential of Hca-F cells as Annexin A7 down-regulation. Furthermore, by co-immunoprecipitation and double immunofluorescence confocal imaging, we found that RACK1 was in complex with Annexin A7 in control cells, but not in the RACK1-down-regulated cells, indicating the abolishment of RACK1-Annexin A7 interaction in Hca-F cells by RACK1 RNAi. Taken together, these results suggest that RACK1-Annexin A7 interaction may be one of the means by which RACK1 and Annexin A7 influence the metastasis potential of mouse hepatocarcinoma cells in vitro.

  3. Guanine nucleotide-binding protein subunit beta-2-like 1, a new Annexin A7 interacting protein

    International Nuclear Information System (INIS)

    Highlights: • RACK1 formed a complex with Annexin A7. • Depletion of RACK1 inhibited the proliferation, migration and invasion. • RACK1 RNAi abolished RACK1-Annexin A7 interaction. • RACK1-Annexin A7 may play a role in regulating the metastatic potentials. - Abstract: We report for the first time that Guanine nucleotide-binding protein subunit beta-2-like 1 (RACK1) formed a complex with Annexin A7. Hca-F and Hca-P are a pair of syngeneic mouse hepatocarcinoma cell lines established and maintained in our laboratory. Our previous study showed that both Annexin A7 and RACK1 were expressed higher in Hca-F (lymph node metastasis >70%) than Hca-P (lymph node metastasis <30%). Suppression of Annexin A7 expression in Hca-F cells induced decreased migration and invasion ability. In this study, knockdown of RACK1 by RNA interference (RNAi) had the same impact on metastasis potential of Hca-F cells as Annexin A7 down-regulation. Furthermore, by co-immunoprecipitation and double immunofluorescence confocal imaging, we found that RACK1 was in complex with Annexin A7 in control cells, but not in the RACK1-down-regulated cells, indicating the abolishment of RACK1-Annexin A7 interaction in Hca-F cells by RACK1 RNAi. Taken together, these results suggest that RACK1-Annexin A7 interaction may be one of the means by which RACK1 and Annexin A7 influence the metastasis potential of mouse hepatocarcinoma cells in vitro

  4. Identification and localization of two brefeldin A-inhibited guanine nucleotide-exchange proteins for ADP-ribosylation factors in a macromolecular complex


    Yamaji, Ryoichi; Adamik, Ronald; Takeda, Kazuyo; Togawa, Akira; Pacheco-Rodriguez, Gustavo; Ferrans, Victor J.; Moss, Joel; Vaughan, Martha


    Two brefeldin A (BFA)-inhibited guanine nucleotide-exchange proteins for ADP-ribosylation factors, 200-kDa BIG1 and 190-kDa BIG2, were copurified from bovine brain cytosol associated with >670-kDa macromolecular complexes. When observed by immunofluorescence in HeLa S3 and HepG2 cells, endogenous BIG1 and coexpressed BIG2 were distributed in a punctate pattern throughout the cytosol, and also concentrated in the perinuclear region, where endogenous BIG1 and BIG2 each partially colocalized wit...

  5. Structural basis for mutual relief of the Rac guanine nucleotide exchange factor DOCK2 and its partner ELMO1 from their autoinhibited forms


    Hanawa-Suetsugu, Kyoko; Kukimoto-Niino, Mutsuko; Mishima-Tsumagari, Chiemi; Akasaka, Ryogo; Ohsawa, Noboru; Sekine, Shun-ichi; Ito, Takuhiro; Tochio, Naoya; Koshiba, Seizo; Kigawa, Takanori; Terada, Takaho; Shirouzu, Mikako; Nishikimi, Akihiko; Uruno, Takehito; Katakai, Tomoya


    DOCK2, a hematopoietic cell-specific, atypical guanine nucleotide exchange factor, controls lymphocyte migration through ras-related C3 botulinum toxin substrate (Rac) activation. Dedicator of cytokinesis 2–engulfment and cell motility protein 1 (DOCK2•ELMO1) complex formation is required for DOCK2-mediated Rac signaling. In this study, we identified the N-terminal 177-residue fragment and the C-terminal 196-residue fragment of human DOCK2 and ELMO1, respectively, as the mutual binding region...

  6. A Burkholderia pseudomallei type III secreted protein, BopE, facilitates bacterial invasion of epithelial cells and exhibits guanine nucleotide exchange factor activity


    M.P. Stevens; Friebel, A; Taylor, L A; Wood, M W; Brown, P. J.; Hardt, W D; Galyov, E E


    We report the characterization of BopE, a type III secreted protein that is encoded adjacent to the Burkholderia pseudomallei bsa locus and is homologous to Salmonella enterica SopE/SopE2. Inactivation of bopE impaired bacterial entry into HeLa cells, indicating that BopE facilitates invasion. Consistent with this notion, BopE expressed in eukaryotic cells induced rearrangements in the subcortical actin cytoskeleton, and purified BopE exhibited guanine nucleotide exchange factor activity for ...

  7. A guanine nucleotide-binding protein mediates the inhibition of voltage-dependent calcium current by somatostatin in a pituitary cell line.


    Lewis, D L; Weight, F F; Luini, A


    Somatostatin reduces voltage-dependent Ca2+ current (ICa) and intracellular free Ca2+ concentration in the AtT-20/D16-16 pituitary cell line. We tested whether guanine nucleotide-binding proteins (G or N proteins) are involved in the signal transduction mechanism between the somatostatin receptor and voltage-dependent Ca2+ channels. Treatment of the cells with pertussis toxin, which selectively ADP ribosylates the GTP binding proteins Gi and Go and suppresses the ability of Gi to couple inhib...

  8. The t-complex-encoded guanine nucleotide exchange factor Fgd2 reveals that two opposing signaling pathways promote transmission ratio distortion in the mouse


    Bauer, Hermann; Véron, Nathalie; Willert, Jürgen; Herrmann, Bernhard G.


    Transmission ratio distortion (TRD), the preferential inheritance of the t haplotype from t/+ males, is caused by the cooperative effect of four t-complex distorters (Tcd1–4) and the single t-complex responder (Tcr) on sperm motility. Here we show that Fgd2, encoding a Rho guanine nucleotide exchange factor, maps to the Tcd2 region. The t allele of Fgd2 is overexpressed in testis compared with wild type. A loss-of-function allele of Fgd2 generated by gene targeting reduces the transmission ra...

  9. Translationally controlled tumor protein acts as a guanine nucleotide dissociation inhibitor on the translation elongation factor eEF1A


    Cans, Christophe; Passer, Brent J.; Shalak, Vyacheslav; Nancy-Portebois, Vanessa; Crible, Virginie; Amzallag, Nathalie; Allanic, David; Tufino, Rowena; Argentini, Manuela; Moras, Dino; Fiucci, Giusy; Goud, Bruno; Mirande, Marc; Amson, Robert; Telerman, Adam


    Recently, we demonstrated that the expression levels of the translationally controlled tumor protein (TCTP) were strongly down-regulated at the mRNA and protein levels during tumor reversion/suppression and by the activation of p53 and Siah-1. To better characterize the function of TCTP, a yeast two-hybrid hunt was performed. Subsequent analysis identified the translation elongation factor, eEF1A, and its guanine nucleotide exchange factor, eEF1Bβ, as TCTP-interacting partners. In vitro and i...

  10. Unmasking of magnesium-dependent high-affinity binding sites for [dAla2, dLeu5]enkephalin after pretreatment of brain membranes with guanine nucleotides.


    Chang, K.J.; Blanchard, S G; Cuatrecasas, P


    The regulation of mu- and delta-opiate receptors by guanine nucleotides and cations was studied by examining the binding of [3H][DAla2, DLeu5]enkephalin to rat brain membranes. The binding to mu-opiate receptors could be suppressed by 1 microM [DPro4]morphiceptin, a highly specific mu-agonist, thus permitting separate assessment of delta-opiate receptor binding. GTP, GDP, and the nonhydrolyzable analogs 5'-guanylyl imidodiphosphate (Gpp[NH]p) and guanosine 5'-O-(2-thiodiphosphate) (GDP-S) eff...

  11. eIF2B promotes eIF5 dissociation from eIF2•GDP to facilitate guanine nucleotide exchange for translation initiation


    Jennings, Martin D.; Zhou, Yu; Mohammad-Qureshi, Sarah S.; Bennett, David; Pavitt, Graham D.


    Protein synthesis factor eIF2 delivers initiator tRNA to the ribosome. Two proteins regulate its G-protein cycle: eIF5 has both GTPase-activating protein (GAP) and GDP dissociation inhibitor (GDI) functions, and eIF2B is the guanine nucleotide exchange factor (GEF). Jennings et al. now establish a second activity for eIF2B (as a GDI displacement factor [GDF]) and demonstrate that this function is independent of its GEF activity. This study suggests that eIF2B is a bifunctional protein and def...

  12. Mammalian Mon2/Ysl2 regulates endosome-to-Golgi trafficking but possesses no guanine nucleotide exchange activity toward Arl1 GTPase


    Divyanshu Mahajan; Boon Kim Boh; Yan Zhou; Li Chen; Tobias Carl Cornvik; Wanjin Hong; Lei Lu


    Arl1 is a member of Arf family small GTPases that is essential for the organization and function of Golgi complex. Mon2/Ysl2, which shares significant homology with Sec7 family Arf guanine nucleotide exchange factors, was poorly characterized in mammalian cells. Here, we report the first in depth characterization of mammalian Mon2. We found that Mon2 localized to trans-Golgi network which was dependent on both its N and C termini. The depletion of Mon2 did not affect the Golgi localized or ce...

  13. GBF1, a guanine nucleotide exchange factor for Arf, is crucial for coxsackievirus B3 RNA replication.

    NARCIS (Netherlands)

    Lanke, K.H.W.; Schaar, H.M. van der; Belov, G.A.; Feng, Q.; Duijsings, D.; Jackson, C.L.; Ehrenfeld, E.; Kuppeveld, F.J.M. van


    The replication of enteroviruses is sensitive to brefeldin A (BFA), an inhibitor of endoplasmic reticulum-to-Golgi network transport that blocks activation of guanine exchange factors (GEFs) of the Arf GTPases. Mammalian cells contain three BFA-sensitive Arf GEFs: GBF1, BIG1, and BIG2. Here, we show

  14. ELMO1 and Dock180, a Bipartite Rac1 Guanine Nucleotide Exchange Factor, Promote Human Glioma Cell Invasion


    Jarzynka, Michael J.; Hu, Bo; Hui, Kwok-Min; Bar-Joseph, Ifat; Gu, Weisong; Hirose, Takanori; Haney, Lisa B.; Ravichandran, Kodi S.; Nishikawa, Ryo; Cheng, Shi-Yuan


    A distinct feature of malignant gliomas is the intrinsic ability of single tumor cells to disperse throughout the brain, contributing to the failure of existing therapies to alter the progression and recurrence of these deadly brain tumors. Regrettably, the mechanisms underlying the inherent invasiveness of glioma cells are poorly understood. Here, we report for the first time that engulfment and cell motility 1 (ELMO1) and dedicator of cytokinesis 1 (Dock180), a bipartite Rac1 guanine nucleo...

  15. Guanine nucleotide exchange factor αPIX leads to activation of the Rac 1 GTPase/glycogen phosphorylase pathway in interleukin (IL)-2-stimulated T cells

    DEFF Research Database (Denmark)

    Llavero, Francisco; Urzelai, Bakarne; Osinalde, Nerea;


    . More specifically, αPIX, a known guanine nucleotide exchange factor for the small GTPases of the Rho family, preferentially Rac 1, mediates PYGM activation in Kit 225 T cells stimulated with IL-2. Using directed mutagenesis, phosphorylation of αPIX Rho-GEF serines 225 and 488 is required for activation...... of the Rac 1/PYGM pathway. IL-2-stimulated serine phosphorylation was corroborated in Kit 225 T cells cultures. A parallel pharmacological and genetic approach identified PKCθ as the serine/threonine kinase responsible for αPIX serine phosphorylation. The phosphorylated state of αPIX was required to...... activate first Rac 1 and subsequently PYGM. These results demonstrate that the IL-2 receptor activation, among other early events, leads to activation of PKCθ. To activate Rac 1 and consequently PYGM, PKCθ phosphorylates αPIX in T cells. The biological significance of this PKCθ/αPIX/Rac 1 GTPase...

  16. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E. (Fitzsimons Army Medical Center, Aurora, CO (USA))


    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.

  17. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    International Nuclear Information System (INIS)

    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of [G-3H] hypoxanthine (Hy) into [3H] labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate [3H] ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation

  18. Structural basis for mutual relief of the Rac guanine nucleotide exchange factor DOCK2 and its partner ELMO1 from their autoinhibited forms. (United States)

    Hanawa-Suetsugu, Kyoko; Kukimoto-Niino, Mutsuko; Mishima-Tsumagari, Chiemi; Akasaka, Ryogo; Ohsawa, Noboru; Sekine, Shun-ichi; Ito, Takuhiro; Tochio, Naoya; Koshiba, Seizo; Kigawa, Takanori; Terada, Takaho; Shirouzu, Mikako; Nishikimi, Akihiko; Uruno, Takehito; Katakai, Tomoya; Kinashi, Tatsuo; Kohda, Daisuke; Fukui, Yoshinori; Yokoyama, Shigeyuki


    DOCK2, a hematopoietic cell-specific, atypical guanine nucleotide exchange factor, controls lymphocyte migration through ras-related C3 botulinum toxin substrate (Rac) activation. Dedicator of cytokinesis 2-engulfment and cell motility protein 1 (DOCK2•ELMO1) complex formation is required for DOCK2-mediated Rac signaling. In this study, we identified the N-terminal 177-residue fragment and the C-terminal 196-residue fragment of human DOCK2 and ELMO1, respectively, as the mutual binding regions, and solved the crystal structure of their complex at 2.1-Å resolution. The C-terminal Pro-rich tail of ELMO1 winds around the Src-homology 3 domain of DOCK2, and an intermolecular five-helix bundle is formed. Overall, the entire regions of both DOCK2 and ELMO1 assemble to create a rigid structure, which is required for the DOCK2•ELMO1 binding, as revealed by mutagenesis. Intriguingly, the DOCK2•ELMO1 interface hydrophobically buries a residue which, when mutated, reportedly relieves DOCK180 from autoinhibition. We demonstrated that the ELMO-interacting region and the DOCK-homology region 2 guanine nucleotide exchange factor domain of DOCK2 associate with each other for the autoinhibition, and that the assembly with ELMO1 weakens the interaction, relieving DOCK2 from the autoinhibition. The interactions between the N- and C-terminal regions of ELMO1 reportedly cause its autoinhibition, and binding with a DOCK protein relieves the autoinhibition for ras homolog gene family, member G binding and membrane localization. In fact, the DOCK2•ELMO1 interface also buries the ELMO1 residues required for the autoinhibition within the hydrophobic core of the helix bundle. Therefore, the present complex structure reveals the structural basis by which DOCK2 and ELMO1 mutually relieve their autoinhibition for the activation of Rac1 for lymphocyte chemotaxis. PMID:22331897

  19. The Bipartite Rac1 Guanine Nucleotide Exchange Factor Engulfment and Cell Motility 1/Dedicator of Cytokinesis 180 (Elmo1/Dock180) Protects Endothelial Cells from Apoptosis in Blood Vessel Development

    NARCIS (Netherlands)

    Schaeker, Kathrin; Bartsch, Susanne; Patry, Christian; Stoll, Sandra J.; Hillebrands, Jan-Luuk; Wieland, Thomas; Kroll, Jens


    Engulfment and cell motility 1/dedicator of cytokinesis 180 (Elmol/Dock180) is a bipartite guanine nucleotide exchange factor for the monomeric GTPase Ras-related C3 botulinum toxin substrate 1 (Racl). Elmol/Dock180 regulates Racl activity in a specific spatiotemporal manner in endothelial cells (EC

  20. Crystallization and crystallographic analysis of yeast Sec2p, a guanine nucleotide-exchange factor for the yeast Rab GTPase Sec4p

    International Nuclear Information System (INIS)

    Crystal structure of a triple mutant (M115L, K121M, T142M) of SeMet-labelled Sec2p, a GEF for Rab GTPase, has been solved by SAD. Control of the selenium sites by mutagenesis much improved the resolution of the SeMet-labelled crystals. Sec2p is a guanine nucleotide-exchange factor (GEF) for the yeast Rab GTPase Sec4p. Sec2p accelerates GDP release from Sec4p and promotes GDP–GTP exchange for Sec4p activation. In order to elucidate this nucleotide-exchange mechanism using X-ray crystallography, three constructs of native Sec2p (Sec21–160p, Sec218–160p and Sec231–160p) and three constructs of selenomethionine-labelled Sec2p [Sec231–160p, Sec231–160p (M115L) and Sec231–160p (M115L, K121M, T142M)] were crystallized. These six crystals diffracted to 8.8, 4.8, 2.6, 4.0, 3.3 and 3.0 Å resolution, respectively. The data set from the SeMet-labelled Sec231–160p (M115L, K121M, T142M) crystal was processed for SAD phasing; the crystal belonged to space group P212121, with unit-cell parameters a = 101.9, b = 176.6, c = 181.5 Å

  1. Cyclin-dependent kinase 5 activates guanine nucleotide exchange factor GIV/Girdin to orchestrate migration-proliferation dichotomy. (United States)

    Bhandari, Deepali; Lopez-Sanchez, Inmaculada; To, Andrew; Lo, I-Chung; Aznar, Nicolas; Leyme, Anthony; Gupta, Vijay; Niesman, Ingrid; Maddox, Adam L; Garcia-Marcos, Mikel; Farquhar, Marilyn G; Ghosh, Pradipta


    Signals propagated by receptor tyrosine kinases (RTKs) can drive cell migration and proliferation, two cellular processes that do not occur simultaneously--a phenomenon called "migration-proliferation dichotomy." We previously showed that epidermal growth factor (EGF) signaling is skewed to favor migration over proliferation via noncanonical transactivation of Gαi proteins by the guanine exchange factor (GEF) GIV. However, what turns on GIV-GEF downstream of growth factor RTKs remained unknown. Here we reveal the molecular mechanism by which phosphorylation of GIV by cyclin-dependent kinase 5 (CDK5) triggers GIV's ability to bind and activate Gαi in response to growth factors and modulate downstream signals to establish a dichotomy between migration and proliferation. We show that CDK5 binds and phosphorylates GIV at Ser1674 near its GEF motif. When Ser1674 is phosphorylated, GIV activates Gαi and enhances promigratory Akt signals. Phosphorylated GIV also binds Gαs and enhances endosomal maturation, which shortens the transit time of EGFR through early endosomes, thereby limiting mitogenic MAPK signals. Consequently, this phosphoevent triggers cells to preferentially migrate during wound healing and transmigration of cancer cells. When Ser1674 cannot be phosphorylated, GIV cannot bind either Gαi or Gαs, Akt signaling is suppressed, mitogenic signals are enhanced due to delayed transit time of EGFR through early endosomes, and cells preferentially proliferate. These results illuminate how GIV-GEF is turned on upon receptor activation, adds GIV to the repertoire of CDK5 substrates, and defines a mechanism by which this unusual CDK orchestrates migration-proliferation dichotomy during cancer invasion, wound healing, and development. PMID:26286990

  2. Cyclin-dependent kinase 5 activates guanine nucleotide exchange factor GIV/Girdin to orchestrate migration–proliferation dichotomy (United States)

    Bhandari, Deepali; Lopez-Sanchez, Inmaculada; To, Andrew; Lo, I-Chung; Aznar, Nicolas; Leyme, Anthony; Gupta, Vijay; Niesman, Ingrid; Maddox, Adam L.; Garcia-Marcos, Mikel; Farquhar, Marilyn G.; Ghosh, Pradipta


    Signals propagated by receptor tyrosine kinases (RTKs) can drive cell migration and proliferation, two cellular processes that do not occur simultaneously—a phenomenon called “migration–proliferation dichotomy.” We previously showed that epidermal growth factor (EGF) signaling is skewed to favor migration over proliferation via noncanonical transactivation of Gαi proteins by the guanine exchange factor (GEF) GIV. However, what turns on GIV-GEF downstream of growth factor RTKs remained unknown. Here we reveal the molecular mechanism by which phosphorylation of GIV by cyclin-dependent kinase 5 (CDK5) triggers GIV's ability to bind and activate Gαi in response to growth factors and modulate downstream signals to establish a dichotomy between migration and proliferation. We show that CDK5 binds and phosphorylates GIV at Ser1674 near its GEF motif. When Ser1674 is phosphorylated, GIV activates Gαi and enhances promigratory Akt signals. Phosphorylated GIV also binds Gαs and enhances endosomal maturation, which shortens the transit time of EGFR through early endosomes, thereby limiting mitogenic MAPK signals. Consequently, this phosphoevent triggers cells to preferentially migrate during wound healing and transmigration of cancer cells. When Ser1674 cannot be phosphorylated, GIV cannot bind either Gαi or Gαs, Akt signaling is suppressed, mitogenic signals are enhanced due to delayed transit time of EGFR through early endosomes, and cells preferentially proliferate. These results illuminate how GIV-GEF is turned on upon receptor activation, adds GIV to the repertoire of CDK5 substrates, and defines a mechanism by which this unusual CDK orchestrates migration–proliferation dichotomy during cancer invasion, wound healing, and development. PMID:26286990

  3. Distinct subcellular localization of alternative splicing variants of EFA6D, a guanine nucleotide exchange factor for Arf6, in the mouse brain. (United States)

    Fukaya, Masahiro; Ohta, Shingo; Hara, Yoshinobu; Tamaki, Hideaki; Sakagami, Hiroyuki


    EFA6D (guanine nucleotide exchange factor for ADP-ribosylation factor 6 [Arf6]D) is also known as EFA6R, Psd3, and HCA67. It is the fourth member of the EFA6 family with guanine nucleotide exchange activity for Arf6, a small guanosine triphosphatase (GTPase) that regulates endosomal trafficking and actin cytoskeleton remodeling. We propose a classification and nomenclature of 10 EFA6D variants deposited in the GenBank database as EFA6D1a, 1b, 1c, 1d, 1s, 2a, 2b, 2c, 2d, and 2s based on the combination of N-terminal and C-terminal insertions. Polymerase chain reaction analysis showed the expression of all EFA6D variants except for variants a and d in the adult mouse brain. Immunoblotting analysis with novel variant-specific antibodies showed the endogenous expression of EFA6D1b, EFA6D1c, and EFA6D1s at the protein level, with the highest expression being EFA6D1s, in the brain. Immunoblotting analysis of forebrain subcellular fractions showed the distinct subcellular distribution of EFA6D1b/c and EFA6D1s. The immunohistochemical analysis revealed distinct but overlapping immunoreactive patterns between EFA6D1b/c and EFA6D1s in the mouse brain. In immunoelectron microscopic analyses of the hippocampal CA3 region, EFA6D1b/c was present predominantly in the mossy fiber axons of dentate granule cells, whereas EFA6D1s was present abundantly in the cell bodies, dendritic shafts, and spines of hippocampal pyramidal cells. These results provide the first anatomical evidence suggesting the functional diversity of EFA6D variants, particularly EFA6D1b/c and EFA6D1s, in neurons. J. Comp. Neurol. 524:2531-2552, 2016. © 2016 Wiley Periodicals, Inc. PMID:27241101

  4. FgMon1, a guanine nucleotide exchange factor of FgRab7, is important for vacuole fusion, autophagy and plant infection in Fusarium graminearum (United States)

    Li, Ying; Li, Bing; Liu, Luping; Chen, Huaigu; Zhang, Haifeng; Zheng, Xiaobo; Zhang, Zhengguang


    The Ccz1-Mon1 protein complex, the guanine nucleotide exchange factor (GEF) of the late endosomal Rab7 homolog Ypt7, is required for the late step of multiple vacuole delivery pathways, such as cytoplasm-to-vacuole targeting (Cvt) pathway and autophagy processes. Here, we identified and characterized the yeast Mon1 homolog in Fusarium graminearum, named FgMon1. FgMON1 encodes a trafficking protein and is well conserved in filamentous fungi. Targeted gene deletion showed that the ∆Fgmon1 mutant was defective in vegetative growth, asexual/sexual development, conidial germination and morphology, plant infection and deoxynivalenol production. Cytological examination revealed that the ∆Fgmon1 mutant was also defective in vacuole fusion and autophagy, and delayed in endocytosis. Yeast two hybrid and in vitro GST-pull down assays approved that FgMon1 physically interacts with a Rab GTPase FgRab7 which is also important for the development, infection, membrane fusion and autophagy in F. graminearum. FgMon1 likely acts as a GEF of FgRab7 and constitutively activated FgRab7 was able to rescue the defects of the ∆Fgmon1 mutant. In summary, our study provides evidences that FgMon1 and FgRab7 are critical components that modulate vesicle trafficking, endocytosis and autophagy, and thereby affect the development, plant infection and DON production of F. graminearum. PMID:26657788

  5. In vivo expression of the Arf6 Guanine-nucleotide exchange factor cytohesin-1 in mice exhibits enhanced myelin thickness in nerves. (United States)

    Torii, Tomohiro; Miyamoto, Yuki; Onami, Naoko; Tsumura, Hideki; Nemoto, Noriko; Kawahara, Katsumasa; Kato, Minoru; Kotera, Jun; Nakamura, Kazuaki; Tanoue, Akito; Yamauchi, Junji


    The myelin sheath consists of a unique multiple layer structure that acts as an insulator between neuronal axons to enhance the propagation of the action potential. In neuropathies such as demyelinating or dismyelinating diseases, chronic demyelination and defective remyelination occur repeatedly, leading to more severe neuropathy. As yet, little is known about the possibility of drug target-specific medicine for such diseases. In the developing peripheral nervous system (PNS), myelin sheaths form as Schwann cells wrap individual axons. It is thought that the development of a drug promoting myelination by Schwann cells would provide effective therapy against peripheral nerve disorders: to test such treatment, genetically modified mice overexpressing the drug target molecules are needed. We previously identified an Arf6 activator, the guanine-nucleotide exchange factor cytohesin-1, as the signaling molecule controlling myelination of peripheral axons by Schwann cells; yet, the important issue of whether cytohesin-1 itself promotes myelin thickness in vivo has remained unclear. Herein, we show that, in mouse PNS nerves, Schwann cell-specific expression of wild-type cytohesin-1 exhibits enhanced myelin thickness. Downstream activation of Arf6 is also seen in these transgenic mice, revealing the involvement of the cytohesin-1 and Arf6 signaling unit in promoting myelination. These results suggest that cytohesin-1 may be a candidate for the basis of a therapy for peripheral neuropathies through its enhancement of myelin thickness. PMID:23636892

  6. Distinct Functions for Arf Guanine Nucleotide Exchange Factors at the Golgi Complex: GBF1 and BIGs Are Required for Assembly and Maintenance of the Golgi Stack and trans-Golgi Network, Respectively


    Manolea, Florin; Claude, Alejandro; Chun, Justin; Rosas, Javier; Melançon, Paul


    We examined the relative function of the two classes of guanine nucleotide exchange factors (GEFs) for ADP-ribosylation factors that regulate recruitment of coat proteins on the Golgi complex. Complementary overexpression and RNA-based knockdown approaches established that GBF1 regulates COPI recruitment on cis-Golgi compartments, whereas BIGs appear specialized for adaptor proteins on the trans-Golgi. Knockdown of GBF1 and/or COPI did not prevent export of VSVGtsO45 from the endoplasmic reti...

  7. Role of a guanine nucleotide-binding protein in. cap alpha. /sub 1/-adrenergic receptor-mediated Ca/sup 2 +/ mobilization in DDT/sub 1/ MF-2 cells

    Energy Technology Data Exchange (ETDEWEB)

    Cornett, L.E.; Norris, J.S.


    In this study the mechanisms involved in ..cap alpha../sub 1/-adrenergic receptor-mediated Ca/sup 2 +/ mobilization at the level of the plasma membrane were investigated. Stimulation of /sup 45/Ca/sup 2 +/ efflux from saponin-permeabilized DDT/sub 1/ MF-2 cells was observed with the addition of either the ..cap alpha../sub 1/-adrenergic agonist phenylephrine and guanosine-5'-triphosphate or the nonhydrolyzable guanine nucleotide guanylyl-imidodiphosphate. In the presence of (/sup 32/P) NAD, pertussis toxin was found to catalyze ADP-ribosylation of a M/sub r/ = 40,500 (n = 8) peptide in membranes prepared from DDT/sub 1/, MF-2 cells, possibly the ..cap alpha..-subunit of N/sub i/. However, stimulation of unidirectional /sup 45/Ca/sup 2 +/ efflux by phenylephrine was not affected by previous treatment of cells with 100 ng/ml pertussis toxin. These data suggest that the putative guanine nucleotide-binding protein which couples the ..cap alpha../sub 1/-adrenergic receptor to Ca/sup 2 +/ mobilization in DDT/sub 1/ MF-2 cells is not a pertussis toxin substrate and may possibly be an additional member of guanine nucleotide binding protein family.

  8. Insights into the Molecular Activation Mechanism of the RhoA-specific Guanine Nucleotide Exchange Factor, PDZRhoGEF

    Energy Technology Data Exchange (ETDEWEB)

    Bielnicki, Jakub A.; Shkumatov, Alexander V.; Derewenda, Urszula; Somlyo, Avril V.; Svergun, Dmitri I.; Derewenda, Zygmunt S. (EMBL); (UV)


    PDZRhoGEF (PRG) belongs to a small family of RhoA-specific nucleotide exchange factors that mediates signaling through select G-protein-coupled receptors via G{alpha}{sub 12/13} and activates RhoA by catalyzing the exchange of GDP to GTP. PRG is a multidomain protein composed of PDZ, regulators of G-protein signaling-like (RGSL), Dbl-homology (DH), and pleckstrin-homology (PH) domains. It is autoinhibited in cytosol and is believed to undergo a conformational rearrangement and translocation to the membrane for full activation, although the molecular details of the regulation mechanism are not clear. It has been shown recently that the main autoregulatory elements of PDZRhoGEF, the autoinhibitory 'activation box' and the 'GEF switch,' which is required for full activation, are located directly upstream of the catalytic DH domain and its RhoA binding surface, emphasizing the functional role of the RGSL-DH linker. Here, using a combination of biophysical and biochemical methods, we show that the mechanism of PRG regulation is yet more complex and may involve an additional autoinhibitory element in the form of a molten globule region within the linker between RGSL and DH domains. We propose a novel, two-tier model of autoinhibition where the activation box and the molten globule region act synergistically to impair the ability of RhoA to bind to the catalytic DH-PH tandem. The molten globule region and the activation box become less ordered in the PRG-RhoA complex and dissociate from the RhoA-binding site, which may constitute a critical step leading to PRG activation.

  9. Architecture of the eIF2B regulatory subcomplex and its implications for the regulation of guanine nucleotide exchange on eIF2. (United States)

    Kuhle, Bernhard; Eulig, Nora K; Ficner, Ralf


    Eukaryal translation initiation factor 2B (eIF2B) acts as guanine nucleotide exchange factor (GEF) for eIF2 and forms a central target for pathways regulating global protein synthesis. eIF2B consists of five non-identical subunits (α-ϵ), which assemble into a catalytic subcomplex (γ, ϵ) responsible for the GEF activity, and a regulatory subcomplex (α, β, δ) which regulates the GEF activity under stress conditions. Here, we provide new structural and functional insight into the regulatory subcomplex of eIF2B (eIF2B(RSC)). We report the crystal structures of eIF2Bβ and eIF2Bδ from Chaetomium thermophilum as well as the crystal structure of their tetrameric eIF2B(βδ)2 complex. Combined with mutational and biochemical data, we show that eIF2B(RSC) exists as a hexamer in solution, consisting of two eIF2Bβδ heterodimers and one eIF2Bα2 homodimer, which is homologous to homohexameric ribose 1,5-bisphosphate isomerases. This homology is further substantiated by the finding that eIF2Bα specifically binds AMP and GMP as ligands. Based on our data, we propose a model for eIF2B(RSC) and its interactions with eIF2 that is consistent with previous biochemical and genetic data and provides a framework to better understand eIF2B function, the molecular basis for Gcn(-), Gcd(-) and VWM/CACH mutations and the evolutionary history of the eIF2B complex. PMID:26384431

  10. Structural Basis for the Failure of the C1 Domain of Ras Guanine Nucleotide Releasing Protein 2 (RasGRP2) to Bind Phorbol Ester with High Affinity. (United States)

    Czikora, Agnes; Lundberg, Daniel J; Abramovitz, Adelle; Lewin, Nancy E; Kedei, Noemi; Peach, Megan L; Zhou, Xiaoling; Merritt, Raymond C; Craft, Elizabeth A; Braun, Derek C; Blumberg, Peter M


    The C1 domain represents the recognition module for diacylglycerol and phorbol esters in protein kinase C, Ras guanine nucleotide releasing protein (RasGRP), and related proteins. RasGRP2 is exceptional in that its C1 domain has very weak binding affinity (Kd = 2890 ± 240 nm for [(3)H]phorbol 12,13-dibutyrate. We have identified four amino acid residues responsible for this lack of sensitivity. Replacing Asn(7), Ser(8), Ala(19), and Ile(21) with the corresponding residues from RasGRP1/3 (Thr(7), Tyr(8), Gly(19), and Leu(21), respectively) conferred potent binding affinity (Kd = 1.47 ± 0.03 nm) in vitro and membrane translocation in response to phorbol 12-myristate 13-acetate in LNCaP cells. Mutant C1 domains incorporating one to three of the four residues showed intermediate behavior with S8Y making the greatest contribution. Binding activity for diacylglycerol was restored in parallel. The requirement for anionic phospholipid for [(3)H]phorbol 12,13-dibutyrate binding was determined; it decreased in going from the single S8Y mutant to the quadruple mutant. The full-length RasGRP2 protein with the mutated C1 domains also showed strong phorbol ester binding, albeit modestly weaker than that of the C1 domain alone (Kd = 8.2 ± 1.1 nm for the full-length protein containing all four mutations), and displayed translocation in response to phorbol ester. RasGRP2 is a guanyl exchange factor for Rap1. Consistent with the ability of phorbol ester to induce translocation of the full-length RasGRP2 with the mutated C1 domain, phorbol ester enhanced the ability of the mutated RasGRP2 to activate Rap1. Modeling confirmed that the four mutations helped the binding cleft maintain a stable conformation. PMID:27022025

  11. Rac1 Activation Caused by Membrane Translocation of a Guanine Nucleotide Exchange Factor in Akt2-Mediated Insulin Signaling in Mouse Skeletal Muscle.

    Directory of Open Access Journals (Sweden)

    Nobuyuki Takenaka

    Full Text Available Insulin-stimulated glucose uptake in skeletal muscle is mediated by the glucose transporter GLUT4, which is translocated to the plasma membrane following insulin stimulation. Several lines of evidence suggested that the protein kinase Akt2 plays a key role in this insulin action. The small GTPase Rac1 has also been implicated as a regulator of insulin-stimulated GLUT4 translocation, acting downstream of Akt2. However, the mechanisms whereby Akt2 regulates Rac1 activity remain obscure. The guanine nucleotide exchange factor FLJ00068 has been identified as a direct regulator of Rac1 in Akt2-mediated signaling, but its characterization was performed mostly in cultured myoblasts. Here, we provide in vivo evidence that FLJ00068 indeed acts downstream of Akt2 as a Rac1 regulator by using mouse skeletal muscle. Small interfering RNA knockdown of FLJ00068 markedly diminished GLUT4 translocation to the sarcolemma following insulin administration or ectopic expression of a constitutively activated mutant of either phosphoinositide 3-kinase or Akt2. Additionally, insulin and these constitutively activated mutants caused the activation of Rac1 as shown by immunofluorescent microscopy using a polypeptide probe specific to activated Rac1 in isolated gastrocnemius muscle fibers and frozen sections of gastrocnemius muscle. This Rac1 activation was also abrogated by FLJ00068 knockdown. Furthermore, we observed translocation of FLJ00068 to the cell periphery following insulin stimulation in cultured myoblasts. Localization of FLJ00068 in the plasma membrane in insulin-stimulated, but not unstimulated, myoblasts and mouse gastrocnemius muscle was further affirmed by subcellular fractionation and subsequent immunoblotting. Collectively, these results strongly support a critical role of FLJ00068 in Akt2-mediated Rac1 activation in mouse skeletal muscle insulin signaling.

  12. Coordinated regulation by two VPS9 domain-containing guanine nucleotide exchange factors in small GTPase Rab5 signaling pathways in fission yeast

    International Nuclear Information System (INIS)

    The small GTPase Rab5 is reported to regulate various cellular functions, such as vesicular transport and endocytosis. VPS9 domain-containing proteins are thought to activate Rab5(s) by their guanine-nucleotide exchange activities. Numerous VPS9 proteins have been identified and are structurally conserved from yeast to mammalian cells. However, the functional relationships among VPS9 proteins in cells remain unclear. Only one Rab5 and two VPS9 proteins were identified in the Schizosaccharomyces pombe genome. Here, we examined the cellular function of two VPS9 proteins and the relationship between these proteins in cellular functions. Vps901-GFP and Vps902-GFP exhibited dotted signals in vegetative and differentiated cells. vps901 deletion mutant (Δvps901) cells exhibited a phenotype deficient in the mating process and responses to high concentrations of ions, such as calcium and metals, and Δvps901Δvps902 double mutant cells exhibited round cell shapes similar to ypt5-909 (Rab5 mutant allele) cells. Deletion of both vps901 and vps902 genes completely abolished the mating process and responses to various stresses. A lack of vacuole formation and aberrant inner cell membrane structures were also observed in Δvps901Δvps902 cells by electron microscopy. These data strongly suggest that Vps901 and Vps902 are cooperatively involved in the regulation of cellular functions, such as cell morphology, sexual development, response to ion stresses, and vacuole formation, via Rab5 signaling pathways in fission yeast cells. - Highlights: • Roles of Rab5 activator VPS9 proteins in cellular functions. • Cooperation between VPS9 proteins in Rab5 signaling pathway. • Roles of each VPS9 protein in Rab5 signaling pathway are discussed

  13. Coordinated regulation by two VPS9 domain-containing guanine nucleotide exchange factors in small GTPase Rab5 signaling pathways in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta [Department of Biology, Graduate School of Science, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan); Kagiwada, Satoshi [Department of Biological Sciences, Faculty of Science, Nara Women' s University, Kitauoyanishi-machi, Nara 630-8506 (Japan); Shimazu, Sayuri [Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan); Takegawa, Kaoru [Department of Bioscience and Biotechnology, Graduate School of Bioresource and Bioenvironmental Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Noguchi, Tetsuko [Department of Biological Sciences, Faculty of Science, Nara Women' s University, Kitauoyanishi-machi, Nara 630-8506 (Japan); Miyamoto, Masaaki, E-mail: [Department of Biology, Graduate School of Science, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan)


    The small GTPase Rab5 is reported to regulate various cellular functions, such as vesicular transport and endocytosis. VPS9 domain-containing proteins are thought to activate Rab5(s) by their guanine-nucleotide exchange activities. Numerous VPS9 proteins have been identified and are structurally conserved from yeast to mammalian cells. However, the functional relationships among VPS9 proteins in cells remain unclear. Only one Rab5 and two VPS9 proteins were identified in the Schizosaccharomyces pombe genome. Here, we examined the cellular function of two VPS9 proteins and the relationship between these proteins in cellular functions. Vps901-GFP and Vps902-GFP exhibited dotted signals in vegetative and differentiated cells. vps901 deletion mutant (Δvps901) cells exhibited a phenotype deficient in the mating process and responses to high concentrations of ions, such as calcium and metals, and Δvps901Δvps902 double mutant cells exhibited round cell shapes similar to ypt5-909 (Rab5 mutant allele) cells. Deletion of both vps901 and vps902 genes completely abolished the mating process and responses to various stresses. A lack of vacuole formation and aberrant inner cell membrane structures were also observed in Δvps901Δvps902 cells by electron microscopy. These data strongly suggest that Vps901 and Vps902 are cooperatively involved in the regulation of cellular functions, such as cell morphology, sexual development, response to ion stresses, and vacuole formation, via Rab5 signaling pathways in fission yeast cells. - Highlights: • Roles of Rab5 activator VPS9 proteins in cellular functions. • Cooperation between VPS9 proteins in Rab5 signaling pathway. • Roles of each VPS9 protein in Rab5 signaling pathway are discussed.

  14. The nuclear guanine nucleotide exchange factors Ect2 and Net1 regulate RhoB-mediated cell death after DNA damage.

    Directory of Open Access Journals (Sweden)

    Melissa C Srougi

    Full Text Available Commonly used antitumor treatments, including radiation and chemotherapy, function by damaging the DNA of rapidly proliferating cells. However, resistance to these agents is a predominant clinical problem. A member of the Rho family of small GTPases, RhoB has been shown to be integral in mediating cell death after ionizing radiation (IR or other DNA damaging agents in Ras-transformed cell lines. In addition, RhoB protein expression increases after genotoxic stress, and loss of RhoB expression causes radio- and chemotherapeutic resistance. However, the signaling pathways that govern RhoB-induced cell death after DNA damage remain enigmatic. Here, we show that RhoB activity increases in human breast and cervical cancer cell lines after treatment with DNA damaging agents. Furthermore, RhoB activity is necessary for DNA damage-induced cell death, as the stable loss of RhoB protein expression using shRNA partially protects cells and prevents the phosphorylation of c-Jun N-terminal kinases (JNKs and the induction of the pro-apoptotic protein Bim after IR. The increase in RhoB activity after genotoxic stress is associated with increased activity of the nuclear guanine nucleotide exchange factors (GEFs, Ect2 and Net1, but not the cytoplasmic GEFs p115 RhoGEF or Vav2. Importantly, loss of Ect2 and Net1 via siRNA-mediated protein knock-down inhibited IR-induced increases in RhoB activity, reduced apoptotic signaling events, and protected cells from IR-induced cell death. Collectively, these data suggest a mechanism involving the nuclear GEFs Ect2 and Net1 for activating RhoB after genotoxic stress, thereby facilitating cell death after treatment with DNA damaging agents.

  15. The distinct role of guanine nucleotide exchange factor Vav1 in Bcl-2 transcription and apoptosis inhibition in Jurkat leukemia T cells

    Institute of Scientific and Technical Information of China (English)

    Jie YIN; Ya-juan WAN; Shi-yang LI; Ming-juan DU; Cui-zhu ZHANG; Xing-long ZHOU; You-jia CAO


    Aim: To investigate a novel function of proto-oncogene Vavl in the apoptosis of human leukemia Jurkat cells.Methods: Jurkat cells,Jurkat-derived vavl-null cells(J.Vavl)and Vavl-reconstituted J.WT cells were treated with a Fas agonist antibody,IgM clone CH11.Apoptosis was determined using propidium iodide(PI)staining,Annexin-V staining,DNA fragmentation,cleavage of caspase 3/caspase 8,and poly(ADP-ribose)polymerase(PARP).Mitochondria transmembrane potential(Δψm)was measured using DiOC6(3)staining.Transcription and expression of the Bcl-2 family of proteins were evaluated using semi-quantitative RT-PCR and Western blot,respectively.Bcl-2 promoter activity was analyzed using luciferase reporter assays.Results: Cells lacking Vav1 were more sensitive to Fas-mediated apoptosis than Jurkat and J.WT cells.J.Vav1 cells lost mitochondria transmembrane potential(Δψm)more rapidly upon Fas induction.These phenotypes could be rescued by re-expression of Vav1 in J.Vav1 cells.The expression of Vav1 increased the transcription of pro-survival Bcl-2.The guanine nucleotide exchange activity of Vav1was required for enhancing Bcl-2 promoter activity,and the Vav1 downstream substrate,small GTPase Rac2,was likely involved in the control of Bcl-2 expression.Conclusion: Vav1 protects Jurkat cells from Fas-mediated apoptosis by promoting Bcl-2 transcription through its GEF activity.

  16. Reconstitution of rate brain /mu/ opioid receptors with purified guanine nucleotide-binding regulatory proteins, G/sub i/ and G/sub o/

    Energy Technology Data Exchange (ETDEWEB)

    Ueda, Hiroshi; Harada, Hitoshi; Nozaki, Masakatsu; Katada, Toshiaki; Ui, Michio; Satoh, Masamichi; Takagi, Hiroshi


    Reconstitution of purified /mu/ opioid receptors with purified guanine nucleotide-binding regulatory proteins (G proteins) was investigated. The purified /mu/ opioid receptor (pI 5.6) migrated as a single M/sub r/ 58,000 polypeptide by NaDodSO/sub 4//PAGE, a value identical to that obtained by affinity cross-linking purified /mu/ receptors. When purified /mu/ receptors were reconstituted with purified G/sub i/, the G protein that mediates the inhibition of adenylate cyclase, the displacement of (/sup 3/H)naloxone binding by (D-Ala/sup 2/,MePhe/sup 4/,Gly-ol/sup 5/)enkephalin was increased 215-fold; this increase was abolished by adding 100 /mu/M guanosine 5'-(/gamma/-thio)triphosphate. Similar increases in agonist displacement of (/sup 3/H)naloxone binding (33-fold) and its abolition by guanosine 5'-(/gamma/-thio)triphosphate were observed with G/sub o/, the G protein of unknown function, but not with the v-Ki-ras protein p.21. The stoichiometry was such that the stimulation of 1 mol of /mu/ receptor led to the binding of (/sup 3/H)guanosine 5'-(/beta/,/gamma/-imido)triphosphate to 2.5 mol of G/sub i/ or to 1.37 mol of G/sub o/. These results suggest that the purified /mu/ opioid receptor is functionally coupled to G/sub i/ and G/sub o/ in the reconstituted phospholipid vesicles.

  17. [3H]WB4101 labels the 5-HT1A serotonin receptor subtype in rat brain. Guanine nucleotide and divalent cation sensitivity

    International Nuclear Information System (INIS)

    In the presence of a 30 nM prazosin mask, [3H]-2-(2,6-dimethoxyphenoxyethyl) aminomethyl-1,4-benzodioxane ([3H]WB4101) can selectively label 5-HT1 serotonin receptors. Serotonin exhibits high affinity (Ki = 2.5 nM) and monophasic competition for [3H] WB4101 binding in cerebral cortex. We have found a significant correlation (r = 0.96) between the affinities of a number of serotonergic and nonserotonergic compounds at [3H]WB4101-binding sites in the presence of 30 nM prazosin and [3H] lysergic acid diethylamide ([3H]LSD)-labeled 5-HT1 serotonin receptors in homogenates of rat cerebral cortex. Despite similar pharmacological profiles, distribution studies indicate that, in the presence of 5 mM MgSO4, the Bmax of [3H]WB4101 is significantly lower than the Bmax of [3H]LSD in various brain regions. WB4101 competition for [3H] LSD-labeled 5-HT1 receptors fits best to a computer-derived model assuming two binding sites, with the KH for WB4101 being similar to the KD of [3H]WB4101 binding derived from saturation experiments. This suggests that [3H]WB4101 labels only one of the subtypes of the 5-HT1 serotonin receptors labeled by [3H]LSD. The selective 5-HT1A serotonin receptor antagonist, spiperone, and the selective 5-HT1A agonist, 8-hydroxy-2-(di-n-propylamino) tetraline, exhibit high affinity and monophasic competition for [3H]WB4101 but compete for multiple [3H]LSD 5-HT1 binding sites. These data indicate that [3H]WB4101 selectively labels the 5-HT1A serotonin receptor, whereas [3H] LSD appears to label both the 5-HT1A and the 5-HT1B serotonin receptor subtypes. The divalent cations, Mn2+, Mg2+, and Ca2+ were found to markedly increase the affinity and Bmax of [3H]WB4101 binding in cerebral cortex. Conversely, the guanine nucleotides guanylylimidodiphosphate and GTP, but not the adenosine nucleotide ATP, markedly reduce the Bmax of [3H]WB4101 binding

  18. GNOM-LIKE 2, Encoding an Adenosine Diphosphate-Ribosylation Factor-Guanine Nucleotide Exchange Factor Protein Homologous to GNOM and GNL1, is Essential for Pollen Germination in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Dong-Jie Jia; Xi Cao; Wei Wang; Xiao-Yun Tan; Xue-Qin Zhang; Li-Qun Chen; De Ye


    In flowering plants, male gametes are delivered to female gametophytes by pollen tubes. Although it is important for sexual plant reproduction, little is known about the genetic mechanism that controls pollen germination and pollen tube growth. Here we report the identification and characterization of two novel mutants, gnom-like 2.1 (gnl2-1) and gn12-2 in Arabidopsis thaliana, in which the pollen grains failed to germinate in vitro and in vivo. GNL2 encodes a protein homologous to the adenosine diphosphate-ribosylation factor-guanine nucleotide exchange factors, GNOM and GNL1 that are involved in endosomal recycling and endoplasmic reticulum-Golgi vesicular trafficking, it was prolifically expressed in pollen grains and pollen tubes. The results of the present study suggest that GNL2 plays an important role in pollen germination.

  19. Biological Function of the Guanine Nucleotide Exchange Factor C3G%鸟嘌呤核苷酸交换因子C3G生物学功能研究进展

    Institute of Scientific and Technical Information of China (English)

    吴国金; 安输; 杨洋; 刘莹; 徐天瑞; 郭晓汐


    Crk SH3域结合鸟嘌呤核苷酸交换因子[v-Crk sarcoma virus CT10 oncogene homolog (avian) SH3-domain-binding guanine nucleotide exchange factor,C3G]属于鸟嘌呤核苷酸交换因子(guanine nucleotide exchange factors,GEFs),是一种在细胞内普遍表达的蛋白质分子.C3G激活小GTP酶并参与各种信号所触发的通路,对哺乳动物胚胎发育和许多组织的细胞功能来说,都是必不可少的.C3G参与细胞的黏附和迁移,细胞连接的维持,突起的生长等需要细胞骨架重构重要生物功能的调控.在细胞信号转导通路中,C3G的功能不仅依赖其催化活性,更重要的是,C3G在不同细胞类型中与不同的蛋白质相互作用,从而激活相应的信号转导通路.该文总结了目前C3G研究的最新进展,并概述了C3G的不同表达亚型对癌症、心脏病的影响及其生物功能背后的分子作用机制.对C3G及其相互作用蛋白质的研究将为卵巢癌、心脏病等疾病的诊断和治疗提供重要的科学依据.

  20. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function.

    Directory of Open Access Journals (Sweden)

    Zhi Liu

    Full Text Available The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N2-dG adducts in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue-DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of

  1. Specificities and pH profiles of adenine and hypoxanthine-guanine-xanthine phosphoribosyltransferases (nucleotide synthases) of the thermoacidophile archaeon Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Jensen, Kristine Steen; Rasmussen, Mads Skytte;


    Two open reading frames in the genome of Sulfolobus solfataricus (SSO2341 and SSO2424) were cloned and expressed in E. coli. The protein products were purified and their enzymatic activity characterized. Although SSO2341 was annotated as a gene (gpT-1) encoding a 6-oxopurine phosphoribosyltransfe......Two open reading frames in the genome of Sulfolobus solfataricus (SSO2341 and SSO2424) were cloned and expressed in E. coli. The protein products were purified and their enzymatic activity characterized. Although SSO2341 was annotated as a gene (gpT-1) encoding a 6-oxopurine...... phosphoribosyltransferase (PRTase), the protein product turned out to be a PRTase highly specific for adenine and we suggest that the reading frame should be renamed apT. The other reading frame SSO2424 (gpT-2) proved to be a true 6-oxopurine PRTase active with hypoxanthine, xanthine and guanine as substrates, and we.......5, while maximal activity with xanthine was observed at pH 7.5. We discuss likely reasons why SSO2341 in S. solfataricus and similar open reading frames in other Crenarchaeota could not be identified as genes encoding APRTase....

  2. An adenine-to-guanine nucleotide change in the IRES SL-IV domain of picornavirus/hepatitis C chimeric viruses leads to a nonviable phenotype

    International Nuclear Information System (INIS)

    The inability for the internal ribosomal entry site (IRES) of hepatitis C virus (HCV) to be readily studied in the context of viral replication has been circumvented by constructing chimeras such as with poliovirus (PV), in which translation of the genome polyprotein is under control of the HCV IRES. During our attempts to configure the PV/HCV chimera for our drug discovery efforts, we discovered that an adenine- (A) to-guanine (G) change at nt 350 in domain IV of the HCV IRES resulted in a nonviable phenotype. Similarly, a mengovirus (MV)/HCV chimera using the same configuration with a G at nt 350 (G-350) was found to be nonviable. In contrast, a bovine viral diarrhea virus (BVDV)/HCV chimera remained viable with G-350 in the HCV IRES insert. Second-site, resuscitating mutations were identified from the G-350 PV/HCV and MV/HCV viruses after blind passaging. For both viruses, the resuscitating mutations involved destabilization of domain IV in the HCV IRES. The nonviability of G-350 in the picornavirus/HCV chimeric background might be linked to translation efficiency as indicated by analyses with dual reporter and PV/HCV replicon constructs

  3. Guanine nucleotide dissociation inhibitor activity of the triple GoLoco motif protein G18: alanine-to-aspartate mutation restores function to an inactive second GoLoco motif. (United States)

    Kimple, Randall J; Willard, Francis S; Hains, Melinda D; Jones, Miller B; Nweke, Gift K; Siderovski, David P


    GoLoco ('Galpha(i/o)-Loco' interaction) motif proteins have recently been identified as novel GDIs (guanine nucleotide dissociation inhibitors) for heterotrimeric G-protein alpha subunits. G18 is a member of the mammalian GoLoco-motif gene family and was uncovered by analyses of human and mouse genomes for anonymous open-reading frames. The encoded G18 polypeptide is predicted to contain three 19-amino-acid GoLoco motifs, which have been shown in other proteins to bind Galpha subunits and inhibit spontaneous nucleotide release. However, the G18 protein has thus far not been characterized biochemically. Here, we have cloned and expressed the G18 protein and assessed its ability to act as a GDI. G18 is capable of simultaneously binding more than one Galpha(i1) subunit. In binding assays with the non-hydrolysable GTP analogue guanosine 5'-[gamma-thio]triphosphate, G18 exhibits GDI activity, slowing the exchange of GDP for GTP by Galpha(i1). Only the first and third GoLoco motifs within G18 are capable of interacting with Galpha subunits, and these bind with low micromolar affinity only to Galpha(i1) in the GDP-bound form, and not to Galpha(o), Galpha(q), Galpha(s) or Galpha12. Mutation of Ala-121 to aspartate in the inactive second GoLoco motif of G18, to restore the signature acidic-glutamine-arginine tripeptide that forms critical contacts with Galpha and its bound nucleotide [Kimple, Kimple, Betts, Sondek and Siderovski (2002) Nature (London) 416, 878-881], results in gain-of-function with respect to Galpha binding and GDI activity. PMID:14656218

  4. Leukemia-associated Rho guanine-nucleotide exchange factor is not critical for RhoA regulation, yet is important for platelet activation and thrombosis in mice


    Christopher M Williams; Harper, Matthew T.; Goggs, Robert A N; Walsh, Tony G.; Offermanns, S.; Poole, Alastair W.


    Summary Background RhoA is an important regulator of platelet responses downstream of Gα13, yet we still know little about its regulation in platelets. Leukemia‐associated Rho guanine‐nucleotide exchange factor (GEF [LARG]), a RhoA GEF, is highly expressed in platelets and may constitute a major upstream activator of RhoA. To this end, it is important to determine the role of LARG in platelet function and thrombosis. Methods and results Using a platelet‐specific gene knockout, we show that th...

  5. The Bipartite Rac1 Guanine Nucleotide Exchange Factor Engulfment and Cell Motility 1/Dedicator of Cytokinesis 180 (Elmo1/Dock180) Protects Endothelial Cells from Apoptosis in Blood Vessel Development* (United States)

    Schäker, Kathrin; Bartsch, Susanne; Patry, Christian; Stoll, Sandra J.; Hillebrands, Jan-Luuk; Wieland, Thomas; Kroll, Jens


    Engulfment and cell motility 1/dedicator of cytokinesis 180 (Elmo1/Dock180) is a bipartite guanine nucleotide exchange factor for the monomeric GTPase Ras-related C3 botulinum toxin substrate 1 (Rac1). Elmo1/Dock180 regulates Rac1 activity in a specific spatiotemporal manner in endothelial cells (ECs) during zebrafish development and acts downstream of the Netrin-1/Unc5-homolog B (Unc5B) signaling cascade. However, mechanistic details on the pathways by which Elmo1/Dock180 regulates endothelial function and vascular development remained elusive. In this study, we aimed to analyze the vascular function of Elmo1 and Dock180 in human ECs and during vascular development in zebrafish embryos. In vitro overexpression of Elmo1 and Dock180 in ECs reduced caspase-3/7 activity and annexin V-positive cell number upon induction of apoptosis. This protective effect of Elmo1 and Dock180 is mediated by activation of Rac1, p21-activated kinase (PAK) and AKT/protein kinase B (AKT) signaling. In zebrafish, Elmo1 and Dock180 overexpression reduced the total apoptotic cell and apoptotic EC number and promoted the formation of blood vessels during embryogenesis. In conclusion, Elmo1 and Dock180 protect ECs from apoptosis by the activation of the Rac1/PAK/AKT signaling cascade in vitro and in vivo. Thus, Elmo1 and Dock180 facilitate blood vessel formation by stabilization of the endothelium during angiogenesis. PMID:25586182

  6. The bipartite rac1 Guanine nucleotide exchange factor engulfment and cell motility 1/dedicator of cytokinesis 180 (elmo1/dock180) protects endothelial cells from apoptosis in blood vessel development. (United States)

    Schäker, Kathrin; Bartsch, Susanne; Patry, Christian; Stoll, Sandra J; Hillebrands, Jan-Luuk; Wieland, Thomas; Kroll, Jens


    Engulfment and cell motility 1/dedicator of cytokinesis 180 (Elmo1/Dock180) is a bipartite guanine nucleotide exchange factor for the monomeric GTPase Ras-related C3 botulinum toxin substrate 1 (Rac1). Elmo1/Dock180 regulates Rac1 activity in a specific spatiotemporal manner in endothelial cells (ECs) during zebrafish development and acts downstream of the Netrin-1/Unc5-homolog B (Unc5B) signaling cascade. However, mechanistic details on the pathways by which Elmo1/Dock180 regulates endothelial function and vascular development remained elusive. In this study, we aimed to analyze the vascular function of Elmo1 and Dock180 in human ECs and during vascular development in zebrafish embryos. In vitro overexpression of Elmo1 and Dock180 in ECs reduced caspase-3/7 activity and annexin V-positive cell number upon induction of apoptosis. This protective effect of Elmo1 and Dock180 is mediated by activation of Rac1, p21-activated kinase (PAK) and AKT/protein kinase B (AKT) signaling. In zebrafish, Elmo1 and Dock180 overexpression reduced the total apoptotic cell and apoptotic EC number and promoted the formation of blood vessels during embryogenesis. In conclusion, Elmo1 and Dock180 protect ECs from apoptosis by the activation of the Rac1/PAK/AKT signaling cascade in vitro and in vivo. Thus, Elmo1 and Dock180 facilitate blood vessel formation by stabilization of the endothelium during angiogenesis. PMID:25586182

  7. Establishment of lung cancer cell strain for stable expression of RAS guanine nucleotide releasing factor 2%稳定表达RAS鸟苷酸释放因子2肺癌细胞株的建立

    Institute of Scientific and Technical Information of China (English)

    王勇; 陈虹; 卜友泉


    Objective To construct a eukaryotic expression vector for RAS guanine nucleotide releasing factor 2 (RASGR-F2), tagged with GFP, and establish a lung cell strain for stable expression of RASGRF2. Methods Plasmid RASGRF2-pCMV6-Myc-DDK was digested with Sgf I and Not I , and RASGRF2 gene fragment was recovered and subcloned into vector pCMV6-GFP. Lung cancer HI299 cells were transfected with the constructed recombinant plasmid RASGRF2-pCMV6-GFP and observed for location of RASGRF2 protein under invert fluorescent microscope. The cell strain for stable expression of RASGRF2 was established by G418 screening, and the expression of RASGRF2 was determined by RT-PCR and Western blot. Results Restriction analysis and sequencing proved that RASGRF2 gene was successfully cloned into eukaryotic expression vector pCMV6-GFP. Recombinant RASGRF2-GFP protein was mainly expressed in cytoplasm of HI299 cells. RT-PCR and Western blot showed that RASGRF2 was stably expressed in HI299 cells. Conclusion The lung cancer cell strain for stable expression of RASGRF2 gene was successfully established, which laid a foundation of further study on function of RASGRF2 gene.%目的 构建带有GFP标签的RAS鸟苷酸释放因子2(RAS guanine nucleotide releasing factor 2,RASGRF2)真核表达质粒,并建立稳定表达RASGRF2的肺癌细胞株.方法 用Sgf Ⅰ和Not Ⅰ双酶切RASGRF2-pCMV6-Myc-DDK质粒,回收RASGRF2基因片段,亚克隆入pCMV6-GFP载体中,构建重组表达质粒RASGRF2-pCMV6-GFP,转染肿瘤细胞H1299,倒置荧光显微镜下观察RASGRF2蛋白的定位.经G418筛选并建立稳定表达RASGRF2的细胞株,RT-PCR及Western blot法检测RASGRF2的表达.结果 经双酶切及测序证实RASGRF2基因成功克隆至真核表达载体pCMV6-GFP中;重组RASGRF2-GFP蛋白在H1299细胞中主要在胞质中表达;经RT-PCR及Western blot证实,RASGRF2在H1299细胞中稳定表达.结论 成功建立了稳定表达RASGRF2基因的肺癌细胞株,为进一步研究RASGRF2

  8. Epidermal growth factor (urogastrone)-mediated phosphorylation of a 35-kDa substrate in human placental membranes: relationship to the β subunit of the guanine nucleotide regulatory complex

    International Nuclear Information System (INIS)

    The authors have identified a component of about 35 kDa (pp35), present in human placental membrane preparations, that is a substrate for epidermal growth factor urogastrone) [EGF(Uro)]-mediated phosphorylation. The EGF(Uro)-stimulated phosphorylation of pp35 was calcium-dependent and was markedly enhanced in membranes prepared in the presence (but not in the absence) of calcium. The [32P]-phosphate incorporated into pp35 in the presence of EGF(Uro) was alkali-stable and was present as O4-phosphotyrosine. Under identical conditions, insulin did not stimulate pp35 phosphorylation. Either in its native or in its phosphorylated form, pp35 could be released from the membranes in the presence of calcium-chelating agents (EDTA/EGTA); and EGF(Uro)-stimulated phosphorylation was reconstituted by adding back EDTA/EGTA eluates to EDTA/EGTA-washed membranes in the presence of calcium. The properties of pp35 were similar if not identical to those of β-35, a 35-kDa polypeptide similar to the β subunit of the guanine nucleotide-binding oligomers that stimulate (G/sub s/) or inhibit (G/sub i/) the adenylate cyclase system. In contrast, the addition of β subunits derived from rabbit liver G/sub i/ or bovine transducin did not result in phosphorylation of a 35-kDa substrate in the reconstituted system. They conclude that the human placental pp35 substrate likely represents the placental equivalent of the β-35 protein. The data point to a possible link between those receptors involved in growth-factor action and the regulatory systems that utilize GTP-binding proteins as transducing elements

  9. Follicle-stimulating hormone receptor-mediated uptake of 45Ca2+ by cultured rat Sertoli cells does not require activation of cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding proteins or adenylate cyclase

    International Nuclear Information System (INIS)

    We have previously reported that FSH stimulates flux of 45Ca2+ into cultured Sertoli cells from immature rats via voltage-sensitive and voltage-independent calcium channels. In the present study, we show that this effect of FSH does not require cholera toxin (CT)- or pertussis toxin (PT)-sensitive guanine nucleotide binding (G) protein or activation of adenylate cyclase (AC). Significant stimulation of 45Ca2+ influx was observed within 1 min, and maximal response (3.2-fold over basal levels) was achieved within 2 min after exposure to FSH. FSH-stimulated elevations in cellular cAMP paralleled increases in 45Ca2+ uptake, suggesting a possible coupling of AC activation to 45Ca2+ influx. (Bu)2cAMP, however, was not able to enhance 45Ca2+ uptake over basal levels at a final concentration of 1000 microM, although a concentration-related increase in androstenedione conversion to estradiol was evident. Exposure of Sertoli cells to CT (10 ng/ml) consistently stimulated basal levels of androstenedione conversion to estradiol but had no effect on basal levels of 45Ca2+ uptake. Similarly, CT had no effect on FSH-induced 45Ca2+ uptake, but potentiated FSH-stimulated estradiol synthesis. PT (10 ng/ml) augmented basal and FSH-stimulated estradiol secretion without affecting 45Ca2+ influx. The adenosine analog N6-phenylisopropyladenosine, which binds to Gi-coupled adenosine receptors on Sertoli cells, inhibited FSH-stimulated androgen conversion to estradiol in a dose-related (1-1000 nM) manner, but FSH-stimulated 45Ca2+ influx remained unchanged. Our results show that in contrast to FSH-stimulated estradiol synthesis, the flux of 45Ca2+ into Sertoli cells in response to FSH is not mediated either directly or indirectly by CT- or PT-sensitive G protein, nor does it require activation of AC. Our data further suggest that the FSH receptor itself may function as a calcium channel

  10. EPR spectroelectrochemical investigation of guanine radical formation and environment effects


    C. Ribaut; Bordeau, G.; Perio, Pierre; Reybier, K; Sartor, V.; Reynes, O.; Fabre, P. L.; Chouini-Lalanne, N.


    Guanine radical detection was carried out by a new convenient and efficient method coupling electron paramagnetic resonance spectroscopy and indirect electro-oxidation of guanine in different biological environments, from the free nucleotide to several types of DNA substrates. Compared to the widely used photoirradiation method, this method appeared more selective in the choice of the electrochemical mediator. Carried out in presence of a ruthenium mediator and PBN as spin trap, this method r...

  11. Novel Riboswitch Ligand Analogs as Selective Inhibitors of Guanine-Related Metabolic Pathways


    Mulhbacher, Jérôme; Brouillette, Eric; Allard, Marianne; Fortier, Louis-Charles; Malouin, François; Lafontaine, Daniel A.


    Riboswitches are regulatory elements modulating gene expression in response to specific metabolite binding. It has been recently reported that riboswitch agonists may exhibit antimicrobial properties by binding to the riboswitch domain. Guanine riboswitches are involved in the regulation of transport and biosynthesis of purine metabolites, which are critical for the nucleotides cellular pool. Upon guanine binding, these riboswitches stabilize a 5′-untranslated mRNA structure that causes trans...

  12. In vitro generated antibodies specific for telomeric guanine-quadruplex DNA react with Stylonychia lemnae macronuclei


    Schaffitzel, Christiane; Berger, Imre; Postberg, Jan; Hanes, Jozef; Lipps, Hans J; Plückthun, Andreas


    Most eukaryotic telomeres contain a repeating motif with stretches of guanine residues that form a 3′-terminal overhang extending beyond the telomeric duplex region. The telomeric repeat of hypotrichous ciliates, d(T4G4), forms a 16-nucleotide 3′-overhang. Such sequences can adopt parallel-stranded as well as antiparallel-stranded quadruplex conformations in vitro. Although it has been proposed that guanine-quadruplex conformations may have important cellular roles including telomere function...

  13. PtdIns(3,4,5)P3-dependent Rac Exchanger 1 (PREX1) Rac-Guanine Nucleotide Exchange Factor (GEF) Activity Promotes Breast Cancer Cell Proliferation and Tumor Growth via Activation of Extracellular Signal-regulated Kinase 1/2 (ERK1/2) Signaling. (United States)

    Liu, Heng-Jia; Ooms, Lisa M; Srijakotre, Nuthasuda; Man, Joey; Vieusseux, Jessica; Waters, JoAnne E; Feng, Yue; Bailey, Charles G; Rasko, John E J; Price, John T; Mitchell, Christina A


    PtdIns(3,4,5)P3-dependent Rac exchanger 1 (PREX1) is a Rac-guanine nucleotide exchange factor (GEF) overexpressed in a significant proportion of human breast cancers that integrates signals from upstream ErbB2/3 and CXCR4 membrane surface receptors. However, the PREX1 domains that facilitate its oncogenic activity and downstream signaling are not completely understood. We identify that ERK1/2 MAPK acts downstream of PREX1 and contributes to PREX1-mediated anchorage-independent cell growth. PREX1 overexpression increased but its shRNA knockdown decreased ERK1/2 phosphorylation in response to EGF/IGF-1 stimulation, resulting in induction of the cell cycle regulators cyclin D1 and p21(WAF1/CIP1) PREX1-mediated ERK1/2 phosphorylation, anchorage-independent cell growth, and cell migration were suppressed by inhibition of MEK1/2/ERK1/2 signaling. PREX1 overexpression reduced staurosporine-induced apoptosis whereas its shRNA knockdown promoted apoptosis in response to staurosporine or the anti-estrogen drug tamoxifen. Expression of wild-type but not GEF-inactive PREX1 increased anchorage-independent cell growth. In addition, mouse xenograft studies revealed that expression of wild-type but not GEF-dead PREX1 resulted in the formation of larger tumors that displayed increased phosphorylation of ERK1/2 but not AKT. The impaired anchorage-independent cell growth, apoptosis, and ERK1/2 signaling observed in stable PREX1 knockdown cells was restored by expression of wild-type but not GEF-dead-PREX1. Therefore, PREX1-Rac-GEF activity is critical for PREX1-dependent anchorage-independent cell growth and xenograft tumor growth and may represent a possible therapeutic target for breast cancers that exhibit PREX1 overexpression. PMID:27358402

  14. Chlamydomonas reinhardtii telomere repeats form unstable structures involving guanine-guanine base pairs.


    Petracek, M E; Berman, J.


    Unusual DNA structures involving four guanines in a planar formation (guanine tetrads) are formed by guanine-rich (G-rich) telomere DNA and other G-rich sequences (reviewed in (1)) and may be important in the structure and function of telomeres. These structures result from intrastrand and/or interstrand Hoogsteen base pairs between the guanines. We used the telomeric repeat of Chlamydomonas reinhardtii, TTTTAGGG, which contains 3 guanines and has a long interguanine A + T tract, to determine...

  15. Endogenous melatonin and oxidatively damaged guanine in DNA

    Directory of Open Access Journals (Sweden)

    Poulsen Henrik E


    Full Text Available Abstract Background A significant body of literature indicates that melatonin, a hormone primarily produced nocturnally by the pineal gland, is an important scavenger of hydroxyl radicals and other reactive oxygen species. Melatonin may also lower the rate of DNA base damage resulting from hydroxyl radical attack and increase the rate of repair of that damage. This paper reports the results of a study relating the level of overnight melatonin production to the overnight excretion of the two primary urinary metabolites of the repair of oxidatively damaged guanine in DNA. Methods Mother-father-daughter(s families (n = 55 were recruited and provided complete overnight urine samples. Total overnight creatinine-adjusted 6-sulphatoxymelatonin (aMT6s/Cr has been shown to be highly correlated with total overnight melatonin production. Urinary 8-oxo-7,8-dihydro-guanine (8-oxoGua results from the repair of DNA or RNA guanine via the nucleobase excision repair pathway, while urinary 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG may possibly result from the repair of DNA guanine via the nucleotide excision repair pathway. Total overnight urinary levels of 8-oxodG and 8-oxoGua are therefore a measure of total overnight guanine DNA damage. 8-oxodG and 8-oxoGua were measured using a high-performance liquid chromatography-electrospray ionization tandem mass spectrometry assay. The mother, father, and oldest sampled daughter were used for these analyses. Comparisons between the mothers, fathers, and daughters were calculated for aMT6s/Cr, 8-oxodG, and 8-oxoGua. Regression analyses of 8-oxodG and 8-oxoGua on aMT6s/Cr were conducted for mothers, fathers, and daughters separately, adjusting for age and BMI (or weight. Results Among the mothers, age range 42-80, lower melatonin production (as measured by aMT6s/CR was associated with significantly higher levels of 8-oxodG (p Conclusion Low levels of endogenous melatonin production among older individuals may lead to

  16. Small guanine nucleotide-binding protein Rho and myocardial function

    Institute of Scientific and Technical Information of China (English)

    Jun REN; Cindy X FANG


    RhoA and Rho-kinase (ROCK) participate in a wide variety of cell signal functions such as cell growth, smooth and cardiac muscle contraction, cytoskeleton rearrangement, cell migration and proliferation. In vascular smooth muscle cells,RhoA and ROCK play an important role in Ca2+ sensitization and regulate vascular smooth muscle tone. In the heart, RhoA and ROCK mediate hypertrophic response leading to cardiac hypertrophy. Recent cellular and molecular biology studies using ROCK inhibitors such as Y-27632 and fasudil have indicated a pivotal role of the RhoA-ROCK cascade in many aspects of cardiovascular function such as cardiac hypertrophy and ventricular remodeling following myocardial infarction. Inhibition of the RhoA-ROCK signaling pathway may be a suitable target for a number of cardiovascular diseases including hypertension, atherosclerosis, diabetes and hypertrophic heart failure. This review focuses on the current understanding of the RhoA-ROCK signal pathway in heart diseases and discusses the use of ROCK inhibitors as therapeutic agents for heart diseases ranging from hypertensive cardiomyopathy to heart failure.

  17. Nucleotide Capacitance Calculation for DNA Sequencing


    Lu, Jun-Qiang; Zhang, X.-G.


    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine, and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nanogap electrode may not be sufficient to be used as a standalone method for rapid DNA sequencing, the capaci...

  18. Preparation and bioevaluation of 99mTc-carbonyl complex of guanine

    International Nuclear Information System (INIS)

    The aim of this study is to prepare radiolabeled guanine with 99mTc(CO)3+ core. For this purpose, guanine has been radiolabeled with 99mTc(CO)3+ core. Quality control study of radiolabeled guanine molecule with 99mTc(CO)3+ core was performed by thin layer radio chromatography (TLRC) and high performance liquid radio chromatography (HPLRC). The results showed that the radiolabeling yield was quite high (94 ± 3%). Beside that 99mTc(CO)3-Gua complex has showed good in vitro stability during the 24 h period. Radiopharmaceutical potential of this complex was evaluated in Wistar Albino Rats. It was concluded that 99mTc(CO)3-Gua could be used as a nucleotide radiopharmaceutical for in vivo applications. (author)

  19. The Emerging Role of Guanine Exchange Factors in ALS and other neurodegenerative diseases


    Cristian eDroppelmann; Danae eCampos-Melo; Kathryn eVolkening; Michael Joseph Strong


    Small GTPases participate in a broad range of cellular processes such as proliferation, differentiation and migration. The exchange of GDP for GTP resulting in the activation of these GTPases is catalyzed by a group of enzymes called guanine nucleotide exchange factors (GEFs), of which two classes: Dbl-related exchange factors and the more recently described Dock family exchange factors. Increasingly, deregulation of normal GEF activity or function has been associated with a broad range of di...

  20. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens


    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  1. Chemisorption of Guanine on Cu(110) (United States)

    Matos, Jeronimo; Kara, Abdelkader


    We use density functional theory (PBE) to calculate the adsorption of a guanine molecule on Cu(110). At saturation coverage, guanine adsorbs tilted with the oxygen atom strongly bound to one of the surface atoms at a height of 2.12 Å above this surface atom with a binding energy of 430 meV/molecule. The substrate top layer atoms show a buckling of 0.22 Å , while the molecule experiences a twist from the flat configuration in the gas phase. The dz 2 state of the copper atom -that is bound to the oxygen atom- presents an enhancement in its density near the Fermi level. We calculated a drop in the work function of 0.34 eV upon adsorption of guanine on Cu(110). These effects classify this system as chemisorption.

  2. Regulation of Salmonella typhimurium pyr Gene Expression: Effect of Changing Both Purine and Pyrimidine Nucleotide Pools

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank


    permit manipulation of the intracellular pools of both pyrimidine and purine nucleotides. The results identify the effectory purine compound as being a guanine nucleotide; it is probably GTP, but it may be GDP or GMP. The synthesis of carbamoylphosphate synthase, encoded by pyrA, and particularly...

  3. Formation of guanine ribonucleotidyl-(3'-5')-adenosine in a flavinogenic strain of Eremothecium ashbyii. (United States)

    Mitsuda, H; Nishikawa, Y; Nakajima, K


    The addition of caffeine caused the accumulation of a new nucleotide compound simultaneously with the rigid inhibition of ribofalvin production in non-growing cells of Eremothecium ashbyii. In the present study we tried to identify the structure of the nucleotide compound using non-growing cells of the mold. 1) It became possible to obtain a large amount of mycelia by masscultivation in a reagent tank. 2) A new nucleotide compound, referred to as compound A in the paper, was extracted with perchloric acid solution and purified by the following subsequent procedures: 1) Dowex 1 x 2 (HCOO-) column, 2) charcoal treatment, 3) DEAE-Sephadex A25 (CI-) column, 4) Dowex 1 x 2 (C1-) column, and 5) DEAE-Sephadex A25 (HCO3-) column. 3) The structure of the new nucleotide compound was proved to be guanine ribonucleotidyl-(3'-5')-adenosine (GpA) from the results of the following analyses: 1) alkaline degradation, 2) UV-spectra, IR-spectra and NMR-spectra, and 3) enzymatic treatments with RNase T2 and phosphodiesterase. 4) The roles of caffeine and guanine ribonucleotidyl-(3'-5')-adenosine in connection with flavinogenesis of this mold were discussed. PMID:182940

  4. Guanine adsorption on the Cu(110) surface

    Czech Academy of Sciences Publication Activity Database

    Feyer, V.; Plekan, O.; Šutara, F.; Cháb, Vladimír; Matolín, V.; Prince, K. C.


    Roč. 605, 3-4 (2011), s. 361-365. ISSN 0039-6028 R&D Projects: GA AV ČR IAA100100905 Institutional research plan: CEZ:AV0Z10100521 Keywords : guanine * copper * chemisorption * hydrogen bond Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.994, year: 2011

  5. Identification of small molecule compounds with higher binding affinity to guanine deaminase (cypin) than guanine


    Fernández, José R.; Sweet, Eric S; Welsh, William J.; Firestein, Bonnie L


    Guanine deaminase (GDA; cypin) is an important metalloenzyme that processes the first step in purine catabolism, converting guanine to xanthine by hydrolytic deamination. In higher eukaryotes, GDA also plays an important role in the development of neuronal morphology by regulating dendritic arborization. In addition to its role in the maturing brain, GDA is thought to be involved in proper liver function since increased levels of GDA activity have been correlated with liver disease and transp...

  6. Extent of intramolecular pi stacks in aqueous solution in mixed-ligand copper(II) complexes formed by heteroaromatic amines and the anticancer and antivirally active 9[2-(phosphonomethoxy)ethyl]guanine (PMEG). A comparison with related acyclic nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Blindauer, C. A.; Sigel, A.; Operschall, B. P.; Griesser, R.; Holý, Antonín; Sigel, H.


    Roč. 103, SI (2016), s. 248-260. ISSN 0277-5387 Institutional support: RVO:61388963 Keywords : anticancer activity * antivirals * aromatic-ring stacking * isomeric equilibria * nucleotide analogues Subject RIV: CC - Organic Chemistry Impact factor: 2.011, year: 2014

  7. The CBS subdomain of inosine 5’-monophosphate dehydrogenase regulates purine nucleotide turnover†


    Pimkin, Maxim; Markham, George D.


    Inosine 5’-monophosphate dehydrogenase (IMPDH) catalyzes the rate limiting step in guanine nucleotide biosynthesis. IMPDH has an evolutionary conserved CBS subdomain of unknown function. The subdomain can be deleted without impairing the in vitro IMPDH catalytic activity and is the site for mutations associated with human retinitis pigmentosa. A guanine-prototrophic Escherichia coli strain, MP101, was constructed with the subdomain sequence deleted from the chromosomal gene for IMPDH. The ATP...

  8. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    Directory of Open Access Journals (Sweden)

    Michael Fasullo


    Full Text Available Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases.

  9. Fluorescence enhancement of DNA-silver nanoclusters from guanine proximity

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, Hsin-chih [Los Alamos National Laboratory; Sharma, Jaswinder [Los Alamos National Laboratory; Yoo, Hyojong [Los Alamos National Laboratory; Martinez, Jennifer S [Los Alamos National Laboratory


    Oligonucleotide-templated, silver nanoclusters (DNA/Ag NCs) are a versatile set of fluorophores and have already been used for live cell imaging, detection of specific metal ions, and single-nucleotide variation identification. Compared to commonly used organic dyes, these fluorescent nanoclusters have much better photostability and are often a few times brighter. Owing to their small size, simple preparation, and biocompatibility (i.e. made of nontoxic metals), DNA/Ag NCs should find more applications in biological imaging and chemical detection in the years to come. While clearly promising as new fluorophores, DNA/Ag NCs possess a unique and poorly understood dynamic process not shared by organic dyes or photoluminescent nanocrystals - the conversion among different NC species due to silver oxidation/reduction or NC regrouping. While this environmental sensitivity can be viewed as a drawback, in the appropriate context, it can be used as a sensor or reporter. Often reversible, conversions among different NC species have been found to depend upon a number of factors, including time, temperature, oxygen and salt content. In this communication, we report significant fluorescence enhancement of DNA/Ag NCs via interactions with guanine-rich DNA sequences. Moreover, we demonstrated this property can be used for sensitive detection of specific target DNA from a human oncogene (i.e. Braf gene).

  10. IR spectra of guanine and hypoxanthine isolated molecules (United States)

    Sheina, G. G.; Stepanian, S. G.; Radchenko, E. D.; Blagoi, Yu. P.


    High resolution spectra of guanine, hypoxanthine, isocytosine, 2-aminopyrimidine and their deutero- and methyl derivatives obtained in Ar matrices by the low temperature IR spectroscopy method are reported. Normal modes of enol tautomers of guanine, 9-CH 3-guanine, hypoxanthine and 2-aminopurine are calculated. Force fields are the same as for purine. Results calculated are used to interpret the experimental spectra. Keto—enol tautomerism is shown to exist in guanine and hypoxanthine, the proportions of enol tautomer being 50 and 5%, respectively. Possible biological applications of the results obtained are discussed.

  11. Cyclic nucleotide regulation of cardiac sympatho-vagal responsiveness. (United States)

    Li, Dan; Paterson, David J


    Cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) are now recognized as important intracellular signalling molecules that modulate cardiac sympatho-vagal balance in the progression of heart disease. Recent studies have identified that a significant component of autonomic dysfunction associated with several cardiovascular pathologies resides at the end organ, and is coupled to impairment of cyclic nucleotide targeted pathways linked to abnormal intracellular calcium handling and cardiac neurotransmission. Emerging evidence also suggests that cyclic nucleotide coupled phosphodiesterases (PDEs) play a key role limiting the hydrolysis of cAMP and cGMP in disease, and as a consequence this influences the action of the nucleotide on its downstream biological target. In this review, we illustrate the action of nitric oxide-CAPON signalling and brain natriuretic peptide on cGMP and cAMP regulation of cardiac sympatho-vagal transmission in hypertension and ischaemic heart disease. Moreover, we address how PDE2A is now emerging as a major target that affects the efficacy of soluble/particulate guanylate cyclase coupling to cGMP in cardiac dysautonomia. PMID:26915722

  12. Acyclic Immucillin Phosphonates. Second-Generation Inhibitors of Plasmodium falciparum Hypoxanthine- Guanine-Xanthine Phosphoribosyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Hazelton, Keith Z. [Yeshiva Univ., New York, NY (United States); Ho, Meng-Chaio [Yeshiva Univ., New York, NY (United States); Cassera, Maria B. [Yeshiva Univ., New York, NY (United States); Clinch, Keith [Industrial Research Ltd., Lower Hutt (New Zealand); Crump, Douglas R. [Industrial Research Ltd., Lower Hutt (New Zealand); Rosario Jr., Irving [Yeshiva Univ., New York, NY (United States); Merino, Emilio F. [Yeshiva Univ., New York, NY (United States); Almo, Steve C. [Yeshiva Univ., New York, NY (United States); Tyler, Peter C. [Industrial Research Ltd., Lower Hutt (New Zealand); Schramm, Vern L. [Yeshiva Univ., New York, NY (United States)


    We found that Plasmodium falciparum is the primary cause of deaths from malaria. It is a purine auxotroph and relies on hypoxanthine salvage from the host purine pool. Purine starvation as an antimalarial target has been validated by inhibition of purine nucleoside phosphorylase. Hypoxanthine depletion kills Plasmodium falciparum in cell culture and in Aotus monkey infections. Hypoxanthine-guanine-xanthine phosphoribosyltransferase (HGXPRT) from P. falciparum is required for hypoxanthine salvage by forming inosine 5'-monophosphate, a branchpoint for all purine nucleotide synthesis in the parasite. We present a class of HGXPRT inhibitors, the acyclic immucillin phosphonates (AIPs), and cell permeable AIP prodrugs. The AIPs are simple, potent, selective, and biologically stable inhibitors. The AIP prodrugs block proliferation of cultured parasites by inhibiting the incorporation of hypoxanthine into the parasite nucleotide pool and validates HGXPRT as a target in malaria.

  13. The Emerging Role of Guanine Exchange Factors in ALS and other neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Cristian eDroppelmann


    Full Text Available Small GTPases participate in a broad range of cellular processes such as proliferation, differentiation and migration. The exchange of GDP for GTP resulting in the activation of these GTPases is catalyzed by a group of enzymes called guanine nucleotide exchange factors (GEFs, of which two classes: Dbl-related exchange factors and the more recently described Dock family exchange factors. Increasingly, deregulation of normal GEF activity or function has been associated with a broad range of disease states, including neurodegeneration and neurodevelopmental disorders. In this review, we examine this evidence with special emphasis on the novel role of Rho guanine nucleotide exchange factor (RGNEF/p190RhoGEF in the pathogenesis of amyotrophic lateral sclerosis (ALS. RGNEF is the first neurodegeneration-linked GEF that regulates not only RhoA GTPase activation but also functions as an RNA binding protein that directly acts with low molecular weight neurofilament (NEFL mRNA 3’UTR to regulate its stability. This dual role for RGNEF, coupled with the increasing understanding of the key role for GEFs in modulating the GTPase function in cell survival suggests a prominent role for GEFs in mediating a critical balance between cytotoxicity and neuroprotection which, when disturbed, contributes to neuronal loss.

  14. Chlorophyll fluorescence control in microalgae by biogenic guanine crystals (United States)

    Miyashita, Yuito; Iwasaka, Masakazu; Endo, Hirotoshi


    Magnetic fields were applied to water suspensions of guanine crystals to induce changes in light scattering as a possible way to control photosynthesis in microalgae. The effect of guanine microcrystals with and without an applied magnetic field on the photosynthesis of a unicellular microalgae (plant), Pleurochrysis. carterae (P. carterae), was investigated by examining chlorophyll fluorescence. The fluorescence intensity at 600-700 nm of the photosynthetic cells increased remarkably when the concentration ratio of guanine microcrystals was 10 times larger than that of the cells. This increase in fluorescence occurred reproducibly and was proportional to the amount of guanine microcrystals added. It is speculated that the guanine microcrystals enhance the intensity of the excitation light on the cells by concentrating the excitation light or prolonging the time of light exposure to the cells. Moreover, applying a 500-mT magnetic field allowed modulation of the fluorescence intensity, depending on the direction of the fluorescence light.

  15. Experimental observation of guanine tautomers with VUV photoionization

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jia; Kostko, Oleg; Nicolas, Christophe; Tang, Xiaonan; Belau, Leonid; de Vries, Mattanjah S.; Ahmed, Musahid


    Two methods of preparing guanine in the gas phase, thermal vaporization and laser desorption, have been investigated. The guanine generated by each method is entrained in a molecular beam, single photon ionized with tunable VUV synchrotron radiation, and analyzed using reflectron mass spectrometry. The recorded photoionization efficiency (PIE) curves show a dramatic difference for experiments performed via thermal vaporization compared to laser desorption. The calculated vertical and adiabatic ionization energies for the eight lowest lying tautomers of guanine suggest the experimental observations arise from different tautomers being populated in the two different experimental methods.

  16. The guanine exchange factor Gartenzwerg and the small GTPase Arl1 function in the same pathway with Arfaptin during synapse growth


    Leo Chang; Tabita Kreko-Pierce; Eaton, Benjamin A.


    ABSTRACT The generation of neuronal morphology requires transport vesicles originating from the Golgi apparatus (GA) to deliver specialized components to the axon and dendrites. Drosophila Arfaptin is a membrane-binding protein localized to the GA that is required for the growth of the presynaptic nerve terminal. Here we provide biochemical, cellular and genetic evidence that the small GTPase Arl1 and the guanine-nucleotide exchange factor (GEF) Gartenzwerg are required for Arfaptin function ...

  17. Exploring the characterization tools of Guanine-Quadruplexes. (United States)

    Kaushik, Mahima; Kaushik, Shikha; Kukreti, Shrikant


    Occurrence of guanine-rich sequences throughout the genome at specific locations like chromosomal ends (telomeres), promoters and Untranslated regions (UTR's) is very well documented. Quite recently, visualization of guanine-quadruplex in human and mammalian cells have also provided a very significant evidence for the in vivo existence of guanine-quadruplex, reconfirming their biological relevance in cellular processes like replication, transcription, recombination, etc. Guanine quadruplexes have enormous potential of exhibiting various topologies which differ, by number/ orientation of strands or loop orientations etc. Some relatively new polymorphic structures like 3+1 quadruplex, G-triplex, and Tri-G-quadruplex have also been proposed for the guanine-rich sequences. Various biochemical and biophysical techniques have been used to characterize these multistranded DNA structures. An extensive review of the mechanistic models of the already existing and newly emerging techniques is actually required, which may further facilitate our understanding about these structures. This review aims to summarize some of these techniques along with their requirements and limitations, which might further give some insights for the fine tuning of the solution and environmental conditions needed for facilitating guanine-quadruplex formation. PMID:26709787

  18. PolyGuanine methacrylate cryogels for ribonucleic acid purification. (United States)

    Köse, Kazım; Uzun, Lokman


    The isolation and purification of ribonucleic acid have attracted attention recently for the understanding of the functions in detail because of the necessity for the treatment of genetic diseases. In this study, guanine-incorporated polymeric cryogels were developed to obtain highly purified ribonucleic acid. The satisfactory purification performance was achieved with the guanine-incorporated poly (2-hydroxyethyl methacrylate-guanine methacrylate) cryogels. The most crucial advantages to use guanine as a functional monomer are to obtain a real natural interaction between guanine on the polymeric material and cytosine on the ribonucleic acid. Moreover, using cryogel with a highly porous structure and high swelling ratio provide advantages of getting more water within the structure to get more analyte to interact. The characterization of cryogels has proved the success of the synthesis and the perfect natural interaction to be taken place between the ligand (guanine methacrylate) and the cytosine in the ribonucleic acid molecules. Although the pores within the structure of cryogels are small, they provide efficient and fast adsorption. The chromatographic separation performance was investigated for different conditions (pH, temperature etc.). The desorption ratio and reusability were also analyzed at the end of the five adsorption-desorption cycles with no significant changes. PMID:27004613

  19. Capturing Transient Endoperoxide in the Singlet Oxygen Oxidation of Guanine. (United States)

    Lu, Wenchao; Liu, Jianbo


    The chemistry of singlet O2 toward the guanine base of DNA is highly relevant to DNA lesion, mutation, cell death, and pathological conditions. This oxidative damage is initiated by the formation of a transient endoperoxide through the Diels-Alder cycloaddition of singlet O2 to the guanine imidazole ring. However, no endoperoxide formation was directly detected in native guanine or guanosine, even at -100 °C. Herein, gas-phase ion-molecule scattering mass spectrometry was utilized to capture unstable endoperoxides in the collisions of hydrated guanine ions (protonated or deprotonated) with singlet O2 at ambient temperature. Corroborated by results from potential energy surface exploration, kinetic modeling, and dynamics simulations, various aspects of endoperoxide formation and transformation (including its dependence on guanine ionization and hydration states, as well as on collision energy) were determined. This work has pieced together reaction mechanisms, kinetics, and dynamics data concerning the early stage of singlet O2 induced guanine oxidation, which is missing from conventional condensed-phase studies. PMID:26813583

  20. Exploitation of the Low Fidelity of Human Immunodeficiency Virus Type 1 (HIV-1) Reverse Transcriptase and the Nucleotide Composition Bias in the HIV-1 Genome To Alter the Drug Resistance Development of HIV


    Balzarini, Jan; Camarasa, Maria-José; Pérez-Pérez, Maria-Jesus; San-Félix, Ana; Velázquez, Sonsoles; Perno, Carlo-Federico; De Clercq, Erik; Anderson, John N.; Karlsson, Anna


    The RNA genome of the lentivirus human immunodeficiency virus type 1 (HIV-1) is significantly richer in adenine nucleotides than the statistically equal distribution of the four different nucleotides that is expected. This compositional bias may be due to the guanine-to-adenine (G→A) nucleotide hypermutation of the HIV genome, which has been explained by dCTP pool imbalances during reverse transcription. The adenine nucleotide bias together with the poor fidelity of HIV-1 reverse transcriptas...

  1. Guanine nucleotide binding proteins in zucchini seedlings: Characterization and interactions with the NPA receptor

    International Nuclear Information System (INIS)

    A microsomal membrane preparation from hypocotyls of dark-grown Cucurbita pepo L. seedlings contains specific high-affinity binding sites for the non-hydrolyzable GTP analog guanosine 5'-[γ-thio] triphosphate (GTP-γ-S). Both the binding affinity and the pattern of binding specificity for GTP and GTP analogs are similar to animal G-proteins, and two zucchini membrane proteins are recognized in western blots by antiserum specific for the σ subunit of platelet Gs protein. GTP-γ-S can increase specific naphthylphthalamic acid (NPA) binding in zucchini microsomal membrane preparations, with its stimulation increasing with large tissue age. Al+3 and F- agents known to activate G-proteins - decreased NPA specific binding by ca. 15%. In tests of in vitro auxin transport employing zucchini plasma membrane vesicles, AlF-4 strongly inhibited 3H-indoleacetic acid nor accumulation; GTP-γ-S effects on this system will be discussed

  2. Guanine nucleotide regulation of dopamine receptor agonist affinity states in rat estradiol-induced pituitary tumors

    Energy Technology Data Exchange (ETDEWEB)

    Di Paolo, T.; Falardeau, P.


    The authors have investigated dopamine (DA) receptor agonist high- and low-affinity states in female rate estradiol-induced prolactin (PRL)-secreting pituitary tumors and intact pituitary tissue. Estradiol treatment increased the anterior pituitary weight 9-fold and plasma prolactin levels 74-fold and these measures are correlated (R = 0.745, n = 73, p < 0.001). Competition for (/sup 3/H)-spiperone binding to the DA receptor by apomorphine was compared in normal and adenomatous pituitary tissue. The inhibition constants (Ki) and the proportions of the two apomorphine sites are unchanged in tumors compared to intact pituitary tissue. Guanosine 5'-(..beta..-..gamma..-imino)triphosphate (Gpp(NH)p) causes complete conversion of the high into low affinity dopaminergic agonist site in normal pituitary and in tumors. These results suggest that rats with primary estradiol-induced pituitary tumors have normal and functional DA receptors. 9 references, 2 tables.

  3. A potential role for guanine nucleotide-binding protein in the regulation of endosomal proton transport.


    Gurich, R W; Codina, J; DuBose, T D


    The effects of guanosine 5'-triphosphate (GTP) and GTP-gamma-S, known activators of GTP binding proteins, on proton transport were investigated in endosome-enriched vesicles (endosomes). Endosomes were prepared from rabbit renal cortex following the intravenous injection of FITC-dextran. The rate of intravesicular acidification was determined by measuring changes in fluorescence of FITC-dextran. Both GTP and GTP-gamma-S stimulated significantly the initial rate of proton transport. In contras...

  4. Guanine nucleotide regulation of dopamine receptor agonist affinity states in rat estradiol-induced pituitary tumors

    International Nuclear Information System (INIS)

    The authors have investigated dopamine (DA) receptor agonist high- and low-affinity states in female rate estradiol-induced prolactin (PRL)-secreting pituitary tumors and intact pituitary tissue. Estradiol treatment increased the anterior pituitary weight 9-fold and plasma prolactin levels 74-fold and these measures are correlated (R = 0.745, n = 73, p 3H]-spiperone binding to the DA receptor by apomorphine was compared in normal and adenomatous pituitary tissue. The inhibition constants (Ki) and the proportions of the two apomorphine sites are unchanged in tumors compared to intact pituitary tissue. Guanosine 5'-[β-γ-imino]triphosphate (Gpp(NH)p) causes complete conversion of the high into low affinity dopaminergic agonist site in normal pituitary and in tumors. These results suggest that rats with primary estradiol-induced pituitary tumors have normal and functional DA receptors. 9 references, 2 tables

  5. Mobilization of late-endosomal cholesterol is inhibited by Rab guanine nucleotide dissociation inhibitor. (United States)

    Hölttä-Vuori, M; Määttä, J; Ullrich, O; Kuismanen, E; Ikonen, E


    Cholesterol entering cells in low-density lipoproteins (LDL) via receptor-mediated endocytosis is transported to organelles of the late endocytic pathway for degradation of the lipoprotein particles. The fate of the free cholesterol released remains poorly understood, however. Recent observations suggest that late-endosomal cholesterol sequestration is regulated by the dynamics of lysobisphosphatidic acid (LBPA)-rich membranes [1]. Genetic studies have pinpointed a protein, Niemann-Pick C-1 (NPC-1), that is required for the mobilization of late-endosomal/lysosomal cholesterol by an unknown mechanism [2]. Here, we report the removal of accumulated cholesterol by overexpression of the NPC-1 protein in NPC-1-deficient fibroblasts from patients with Niemann-Pick disease, and in normal fibroblasts upon release of a progesterone-induced block of cholesterol transport. We show that late-endosomal/lysosomal cholesterol mobilization is specifically inhibited by microinjection of Rab GDP-dissociation inhibitor (Rab-GDI). Moreover, clearance of the cholesterol deposits by NPC-1 in patients' fibroblasts is accompanied by the redistribution of LBPA and of a lysosomal hydrolase that utilizes the mannose-6-phosphate receptor. Our results reveal, for the first time, the involvement of a specific molecular component of the membrane-trafficking machinery in cholesterol transport and the coupling of late-endosomal cholesterol egress to the trafficking of other lipid and protein cargo. PMID:10662671

  6. Characterization of oxidative guanine damage and repair in mammalian telomeres.

    Directory of Open Access Journals (Sweden)

    Zhilong Wang


    Full Text Available 8-oxo-7,8-dihydroguanine (8-oxoG and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG are among the most common oxidative DNA lesions and are substrates for 8-oxoguanine DNA glycosylase (OGG1-initiated DNA base excision repair (BER. Mammalian telomeres consist of triple guanine repeats and are subject to oxidative guanine damage. Here, we investigated the impact of oxidative guanine damage and its repair by OGG1 on telomere integrity in mice. The mouse cells were analyzed for telomere integrity by telomere quantitative fluorescence in situ hybridization (telomere-FISH, by chromosome orientation-FISH (CO-FISH, and by indirect immunofluorescence in combination with telomere-FISH and for oxidative base lesions by Fpg-incision/Southern blot assay. In comparison to the wild type, telomere lengthening was observed in Ogg1 null (Ogg1(-/- mouse tissues and primary embryonic fibroblasts (MEFs cultivated in hypoxia condition (3% oxygen, whereas telomere shortening was detected in Ogg1(-/- mouse hematopoietic cells and primary MEFs cultivated in normoxia condition (20% oxygen or in the presence of an oxidant. In addition, telomere length abnormalities were accompanied by altered telomere sister chromatid exchanges, increased telomere single- and double-strand breaks, and preferential telomere lagging- or G-strand losses in Ogg1(-/- mouse cells. Oxidative guanine lesions were increased in telomeres in Ogg1(-/- mice with aging and primary MEFs cultivated in 20% oxygen. Furthermore, oxidative guanine lesions persisted at high level in Ogg1(-/- MEFs after acute exposure to hydrogen peroxide, while they rapidly returned to basal level in wild-type MEFs. These findings indicate that oxidative guanine damage can arise in telomeres where it affects length homeostasis, recombination, DNA replication, and DNA breakage repair. Our studies demonstrate that BER pathway is required in repairing oxidative guanine damage in telomeres and maintaining telomere integrity

  7. Reactivity of chitosan derivatives and their interaction with guanine: A computational study

    Indian Academy of Sciences (India)

    Bhabesh Chandra Deka; Pradip Kr Bhattacharyya


    The present study delves into the reactivity of a few chitosan derivatives (CSDs) and their interaction with guanine in vacuum and in different phases. Increase in the polarity of the solvent lowers reactivity of the chosen derivatives (evaluated by using reactivity descriptors). Interaction between the CSDs and guanine (measured by interaction energy) weakens in solvent media and CSD-guanine interaction is weaker than the interaction between guanine and unmodified chitosan (CS). Chemical stability of CSD-guanine adducts remains similar to that of CS-guanine adduct in both polar and non-polar media. Moreover, CSD-guanine adducts exhibit comparable thermodynamic stability (quantified by free energy of solvation, Gsol) to that of unmodified CS-guanine adduct in non-polar solvent but in polar medium they are immensely destabilized in comparison to CS-guanine adduct. Observed theoretical results are expected to provide guidance for future relevant experimental research on gene delivery by CS derivatives.

  8. Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase


    Maynes, Jason T.; Yuan, Richard G.; Snyder, Floyd F.


    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a Km of ...

  9. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels


    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  10. A two-step nucleotide-flipping mechanism enables kinetic discrimination of DNA lesions by AGT


    Hu, Jie; Ma, Ao; Dinner, Aaron R.


    O6-alkylguanine-DNA alkyltransferase (AGT) repairs damage to the human genome by flipping guanine and thymine bases into its active site for irreversible transfer of alkyl lesions to Cys-145, but how the protein identifies its targets has remained unknown. Understanding molecular recognition in this system, which can serve as a paradigm for the many nucleotide-flipping proteins that regulate genes and repair DNA in all kingdoms of life, is particularly important given that inhibitors are in c...

  11. Repair of triplex-directed DNA alkylation by nucleotide excision repair


    Ziemba, Amy; Derosier, L. Chris; Methvin, Russell; Song, Chun-Yan; Clary, Eric; Kahn, Wendy; Milesi, David; Gorn, Vladimir; Reed, Mike; Ebbinghaus, Scot


    Triplex-forming oligonucleotides (TFOs) are being investigated as highly specific DNA binding agents to inhibit the expression of clinically relevant genes. So far, they have been shown to inhibit transcription from the HER-2/neu gene in vitro, whereas their use in vivo has been studied to a limited extent. This study uses a TFO–chlorambucil (chl) conjugate capable of forming site-specific covalent guanine adducts within the HER-2/neu promoter. We demonstrate that nucleotide excision repair (...

  12. Piperidine nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Kovačková, Soňa; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Lyon : Université de Lyon, 2010, s. 315-316. [International Roundtable on Nucleosides, Nucleotides and Nucleic Acids. IRT 2010. Lyon (FR), 29.08.2010-03.09.2010] Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate analogs * piperidine nucleosides * piperidine nucleotides Subject RIV: CC - Organic Chemistry

  13. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide (United States)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.


    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  14. The guanine exchange factor Gartenzwerg and the small GTPase Arl1 function in the same pathway with Arfaptin during synapse growth

    Directory of Open Access Journals (Sweden)

    Leo Chang


    Full Text Available The generation of neuronal morphology requires transport vesicles originating from the Golgi apparatus (GA to deliver specialized components to the axon and dendrites. Drosophila Arfaptin is a membrane-binding protein localized to the GA that is required for the growth of the presynaptic nerve terminal. Here we provide biochemical, cellular and genetic evidence that the small GTPase Arl1 and the guanine-nucleotide exchange factor (GEF Gartenzwerg are required for Arfaptin function at the Golgi during synapse growth. Our data define a new signaling pathway composed of Arfaptin, Arl1, and Garz, required for the generation of normal synapse morphology.

  15. Theoretical Investigation on the Geometries and Properties of Guanine-BX3 (X = F, Cl) Complex

    Institute of Scientific and Technical Information of China (English)


    Geometries and binding energies were predicted at the B3LYP/6-311+G* level for the guanine-BX3 (X = F, Cl) systems and four isomers with no imaginary frequencies have been obtained for both guanine-BF3 and guanine-BCl3, respectively. Single energy calculations using much larger basis sets (6-311+G(2df,p) and aug-cc-pVDZ were carried out as well. It was found that the most stable isomer of guanine-BF3 is BF3 connected to N3 of guanine with the stabilization energy of -19.93 kcal/mol (BSSE corrected), while that of guanine-BCl3 is BCl3 connected to O10 of guanine having stabilization energy of -15.02 kcal/mol at the same level. The analyses for the combining interaction between BX3 and guanine with the atom-in-molecules theory (AIM) and natural bond orbital (NBO) methods have been performed. The results indicated that all the isomers are formed with σ-p type interactions between guanine and BX3, in which pyridine-type nitrogen or carbonyl oxygen or nitrogen atom of amino group offers its lone pair electrons to the empty p orbital of boron atom and the concomitance of charge transfer from guanine to BX3 has occurred. Still, one or two hydrogen bonds exist in some isomers of guanine-BX3 system and contribute to the stability of complex systems. Frequency analysis suggested that the stretching vibration of BX3 undergoes a red shift in complexes. Guanine-BF3 complex is more stable than guanine-BCl3 although the B-Y (Y=N, O) bond distance in the latter is shorter.

  16. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis GenBank blastx search ... result Result of blastx search ... against GenBank amino a ... cid sequence kome_genbank_blastx_search kome_genbank_blastx_search _result ...

  17. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis GenBank blastn search ... result Result of blastn search ... against GenBank nucleot ... ide sequence kome_genbank_blastn_search kome_genbank_blastn_search _result ...

  18. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis PLACE search result Result of signal search against PLACE : cis-acting regul ... atory DNA elements Database ... kome_place_search_res ...

  19. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against japonica genome... sequence kome_japonica_genome_blast_search_result ...

  20. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Indica genome blast search result Result of blastn search against Indica genome... sequence (top hit only) kome_indica_genome_blast_search_result ...

  1. Isolation and characterization of human liver guanine deaminase. (United States)

    Gupta, N K; Glantz, M D


    Guanine deaminase (EC, guanine aminohydrolase [GAH]) was purified 3248-fold from human liver to homogeneity with a specific activity of 21.5. A combination of ammonium sulfate fractionation, and DEAE-cellulose, hydroxylapatite, and affinity chromatography with guanine triphosphate ligand were used to purify the enzyme. The enzyme was a dimer protein of a molecular weight of 120,000 with each subunit of 59,000 as determined by gel filtration and sodium dodecyl sulfate-gel electrophoresis. Isoelectric focusing gave a pI of 4.76. It was found to be an acidic protein, as evidenced by the amino acid analysis, enriched with glutamate, aspartate, alanine and glycine. It showed a sharp pH optimum of 8.0. The apparent Km for guanine was determined to be 1.53 X 10(-5) M at pH 6.0 and 2 X 10(-4) M for 8-azaguanine as a substrate at pH 6.0. The enzyme was found to be sensitive to p-hydroxymercuribenzoate inhibition with a Ki of 1.53 X 10(-5) M and a Ki of 5 X 10(-5) M with 5-aminoimidazole-4-carboxamide as an inhibitor. The inhibition with iodoacetic acid showed only a 7% loss in the activity at 1 X 10(-4) M and a 24% loss at 1 X 10(-3) M after 30 min of incubation, whereas p-hydroxymercuribenzoate incubation for 30 min resulted in a 91% loss of activity at a concentration of 1 X 10(-4) M. Guanine was the substrate for all of the inhibition studies. The enzyme was observed to be stable up to 40 degrees C, with a loss of almost all activity at 65 degrees C with 30 min incubation. Two pKa values were obtained at 5.85 and 8.0. Analysis of the N-terminal amino acid proved to be valine while the C-terminal residue was identified as alanine. PMID:3966794

  2. Nucleotide diversity in gorillas.


    Yu, Ning; Jensen-Seaman, Michael I.; Chemnick, Leona; Ryder, Oliver; Li, Wen-Hsiung


    Comparison of the levels of nucleotide diversity in humans and apes may provide valuable information for inferring the demographic history of these species, the effect of social structure on genetic diversity, patterns of past migration, and signatures of past selection events. Previous DNA sequence data from both the mitochondrial and the nuclear genomes suggested a much higher level of nucleotide diversity in the African apes than in humans. Noting that the nuclear DNA data from the apes we...

  3. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases


    Rogers, Faye A.; Lloyd, Janice A; Tiwari, Meetu Kaushik


    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-r...

  4. Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides.


    Pon, R T; Damha, M J; Ogilvie, K K


    Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphora...

  5. The Role of Gene Duplication in the Evolution of Purine Nucleotide Salvage Pathways (United States)

    Becerra, Arturo; Lazcano, Antonio


    Purine nucleotides are formed de novo by a widespread biochemical route that may be of monophyletic origin, or are synthesized from preformed purine bases and nucleosides through different salvage pathways. Three monophyletic sets of purine salvage enzymes, each of which catalyzes mechanistically similar reactions, can be identified: (a) adenine-, xanthine-, hypoxanthine- and guanine-phosphoribosyltransferases, which are all homologous among themselves, as well as to nucleoside phosphorylases; (b) adenine deaminase, adenosine deaminase, and adenosine monophophate deaminase; and (c) guanine reductase and inosine monophosphate dehydrogenase. These homologies support the idea that substrate specificity is the outcome of gene duplication, and that the purine nucleotide salvage pathways were assembled by a patchwork process that probably took place before the divergence of the three cell domains (Bacteria, Archaea, and Eucarya). Based on the ability of adenine PRTase to catalyze the condensation of PRPP with 4-aminoimidazole-5-carboxamide (AICA), a simpler scheme of purine nucleotide biosynthesis is presented. This hypothetical route requires the prior evolution of PRPP biosynthesis. Since it has been argued that PRPP, nucleosides, and nucleotides are susceptible to hydrolysis, they are very unlikely prebiotic compounds. If this is the case, it implies that many purine salvage pathways appeared only after the evolution of phosphorylated sugar biosynthetic pathways made ribosides available.

  6. Structural and Functional Studies on Nucleotide Excision Repair From Recognition to Incision.

    Energy Technology Data Exchange (ETDEWEB)

    Caroline Kisker


    Maintenance of the correct genetic information is crucial for all living organisms because mutations are the primary cause of hereditary diseases, as well as cancer and may also be involved in aging. The importance of genomic integrity is underscored by the fact that 80 to 90% of all human cancers are ultimately due to DNA damage. Among the different repair mechanisms that have evolved to protect the genome, nucleotide excision repair (NER) is a universal pathway found in all organisms. NER removes a wide variety of bulky DNA adducts including the carcinogenic cyclobutane pyrimidine dimers induced by UV radiation, benzo(a)pyrene-guanine adducts caused by smoking and the guanine-cisplatin adducts induced by chemotherapy. The importance of this repair mechanism is reflected by three severe inherited diseases in humans, which are due to defects in NER: xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy.

  7. Piperidine nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Manchester : University of Manchester, 2009. s. 50-50. [Nucleic Acids at the Chemistry - Biology Interface. 07.09.2009-08.09.2009, Manchester] R&D Projects: GA MZd NR9138; GA MŠk 2B06065 Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate * piperidine nucleosides * nucleotides Subject RIV: CC - Organic Chemistry

  8. Guanine-based photonic crystals in fish scales form from an amorphous precursor. (United States)

    Gur, Dvir; Politi, Yael; Sivan, Berta; Fratzl, Peter; Weiner, Steve; Addadi, Lia


    Starting from disorder: anhydrous guanine crystals compose the photonic arrays responsible for the skin and scale iridescence found in Japanese Koi fish. These guanine crystals were found to form in intracellular vesicles through an amorphous precursor phase. A combined cryo-SEM and synchrotron radiation X-ray diffraction study showed the evolution of the crystals in great detail. PMID:22951999

  9. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  10. Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy (United States)

    Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie


    Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct

  11. Self-assembled guanine ribbons as wide-bandgap semiconductors (United States)

    di Felice, Rosa; Calzolari, Arrigo; Molinari, Elisa; Garbesi, Anna; Rinaldi, Ross; Maruccio, Giuseppe; Cingolani, Roberto


    We present a new class of biomolecular wide-bandgap semiconductors, that spontaneously form by the self-assembling of deoxyguanosine molecules (a modified DNA base) in the solid state. Their deposition onto planar metallic nanocircuits allows the fabrication of hybrid nanodiodes and metal/semiconductor/metal devices. By means of first-principle calculations, we describe the structure and the electronic properties of stacked guanine ribbons. We discuss the formation of extended Bloch orbitals, resulting from the superposition of base-localized states, as a function of H-bonding and π-π coupling. The oveall band-like conduction is affected by a dipole-field that spontaneously arise along the ribb n axis. Our theoretical model explains both the basic transport mechanism and the current-voltage characteristics of the devices.

  12. Piperidine nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    -, č. 52 (2008), s. 587-587. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MŠk LC512 Grant ostatní: GA MZd(CZ) NR9138 Institutional research plan: CEZ:AV0Z40550506 Keywords : piperidine * nucleosidation * phosphonate Subject RIV: CC - Organic Chemistry

  13. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg;


    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification and...... briefly describe the methods that are preferred for SNP typing in forensic genetics. In addition, we will illustrate how SNPs can be used as investigative leads in the police investigation by discussing the use of ancestry informative markers and forensic DNA phenotyping. Modern DNA sequencing...

  14. Aquifex aeolicus tRNA (N2,N2-Guanine)-dimethyltransferase (Trm1) Catalyzes Transfer of Methyl Groups Not Only to Guanine 26 but Also to Guanine 27 in tRNA*


    Awai, Takako; Kimura, Satoshi; Tomikawa, Chie; Ochi, Anna; Ihsanawati,; Bessho, Yoshitaka; Yokoyama, Shigeyuki; Ohno, Satoshi; Nishikawa, Kazuya; Yokogawa, Takashi; Suzuki, Tsutomu; Hori, Hiroyuki


    Transfer RNA (N2,N2-guanine)-dimethyltransferase (Trm1) catalyzes N2,N2-dimethylguanine formation at position 26 (m22G26) in tRNA. In the reaction, N2-guanine at position 26 (m2G26) is generated as an intermediate. The trm1 genes are found only in archaea and eukaryotes, although it has been reported that Aquifex aeolicus, a hyper-thermophilic eubacterium, has a putative trm1 gene. To confirm whether A. aeolicus Trm1 has tRNA methyltransferase activity, we purified recombinant Trm1 protein. I...

  15. Solubilization and hydrodynamic characterization of guanine nucleotide sensitive vasoactive intestinal peptide-receptor complexes from rat intestine

    International Nuclear Information System (INIS)

    The purpose of this work was to solubilize vasoactive intestinal peptide (VIP) receptors from rat small intestinal plasma membranes and to analyze the nature and function of its molecular form(s) in a nondenaturing environment. Membranes were incubated with 3 nM 125I-VIP, washed, and treated with 1% Triton X-100. Chromatography on Sephadex G-50 showed that 60% of the extractable radioactivity was eluted with macromolecular components in the void volume. This radioactive material was dramatically reduced when 1μM unlabeled VIP was present in the incubation medium or when membranes were pretreated with trypsin or dithiothreitol. Macromolecular components that had bound 125I-VIP were further chromatographed on Sephacryl S-300. Two peaks were observed: a major one (80%) and a minor one (20%) with Stokes radii of 5.2 and 3.1 nm, respectively. After cholera toxin catalyzed [32P]ADP-ribosylation of membranes, chromatography of solubilized material on Sephacryl S-300 showed that a peak of 32P radioactivity was coeluted with the 5.2-nm component. SDS-PAGE analysis revealed the presence in this peak of the Mr 42,000 α subunit of the Gs protein. Sucrose density gradient ultracentrifugation of the 5.1- and 3.1-nm components isolated on Sephacryl S-300 showed that they displayed apparent sedimentation coefficients of 6.7 and 3.9 S, respectively. From these results, the molecular weight of both components was estimated to be 152,000 and 54,000, respectively. It was concluded that intestinal VIP-receptor complexes of Mr 54,000 were solubilized in a major form of Mr 152,000 containing a Gs protein that was sensitive to GTP regulation

  16. Pioneer Axon Navigation Is Controlled by AEX-3, a Guanine Nucleotide Exchange Factor for RAB-3 in Caenorhabditis elegans. (United States)

    Bhat, Jaffar M; Hutter, Harald


    Precise and accurate axon tract formation is an essential aspect of brain development. This is achieved by the migration of early outgrowing axons (pioneers) allowing later outgrowing axons (followers) to extend toward their targets in the embryo. In Caenorhabditis elegans the AVG neuron pioneers the right axon tract of the ventral nerve cord, the major longitudinal axon tract. AVG is essential for the guidance of follower axons and hence organization of the ventral nerve cord. In an enhancer screen for AVG axon guidance defects in a nid-1/Nidogen mutant background, we isolated an allele of aex-3 aex-3 mutant animals show highly penetrant AVG axon navigation defects. These defects are dependent on a mutation in nid-1/Nidogen, a basement membrane component. Our data suggest that AEX-3 activates RAB-3 in the context of AVG axon navigation. aex-3 genetically acts together with known players of vesicular exocytosis: unc-64/Syntaxin, unc-31/CAPS, and ida-1/IA-2. Furthermore our genetic interaction data suggest that AEX-3 and the UNC-6/Netrin receptor UNC-5 act in the same pathway, suggesting AEX-3 might regulate the trafficking and/or insertion of UNC-5 at the growth cone to mediate the proper guidance of the AVG axon. PMID:27116976

  17. The Putative Guanine Nucleotide Exchange Factor RicA Mediates Upstream Signaling for Growth and Development in Aspergillus


    Kwon, Nak-Jung; Park, Hee-Soo; Jung, Seunho; Kim, Sun Chang; Yu, Jae-Hyuk


    Heterotrimeric G proteins (G proteins) govern growth, development, and secondary metabolism in various fungi. Here, we characterized ricA, which encodes a putative GDP/GTP exchange factor for G proteins in the model fungus Aspergillus nidulans and the opportunistic human pathogen Aspergillus fumigatus. In both species, ricA mRNA accumulates during vegetative growth and early developmental phases, but it is not present in spores. The deletion of ricA results in severely impaired colony growth ...

  18. Guanosine nucleotide precursor for flavinogenesis of Eremothecium Ashbyii. (United States)

    Mitsuda, H; Nakajima, K


    The purine precursor in the riboflavin biosynthetic pathway in Eremothecium ashbyii was examined using a guanine analogue, 8-azaguanine, with non-growing cell systems. 1. Riboflavin formation in the culture filtrate was determined at 0, 5, 10 and 20 hr after start of the incubation of the non-growing cells in the presence of xanthine or 8-azaguanine (1 mM, respectively). At 20 hr of incubation, the addition of xanthine stimulated riboflavin formation by 36% and the addition of 8-azaguanine inhibited the formation by 57%. 2. Acid soluble nucleotide pools in the cells were followed at 0, 5, 10 and 20 hr of the incubation period in the presence of xanthine or 8-azaguanine by means of anion exchange column chromatography. The result showed that the GTP pool changed markedly despite the fact that the adenosine nucleotide pool was almost constant irrespective of the presence or absence of these purines till 10 hr of incubation. But, the decrease of the former was overcome in part by the addition of flavinogenic xanthine. Furthermore, the total amounts of GTP and guanosine accumulated in cells in the presence of 8-azaguanine reached the maximum already at 5 hr, attaining a level twice as much as the GTP contents of the control. 3. The role of guanosine nucleotide pool in riboflavin formation was further examined using 8-azaguanine. In this experiment the drug was added to the suspension of non-growing cells at 3 hr or 6 hr after the incubation was started and the reaction was continued till the 12th hr. A more clear-cut correlationship between riboflavin formation and guanosine nucleotide pool was oberved by this experiment. The guanosine nucleotide pool (consisting of GMP, GDP and GTP) increased simultaneously with the inhibition of riboflavin formation. Of the guanosine nucleotides pools, the GMP pool increased 2.7 times above normal upon the addition of 8-azaguanine during the incubation for 6 hr and 5.3 fold for 9 hr. While, the GTP pool increased 1.9 fold above

  19. G-quartet type self-assembly of guanine functionalized single-walled carbon nanotubes (United States)

    Singh, Prabhpreet; Venkatesh, V.; Nagapradeep, N.; Verma, Sandeep; Bianco, Alberto


    The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy.The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy. Electronic supplementary information (ESI) available: Experimental procedures for the synthesis and characterization of the precursors and MWCNT conjugates. See DOI: 10.1039/c2nr11849a

  20. An assay for transient gene expression in transfected Drosophila cells, using [3H]guanine incorporation.


    Burke, J F; Sinclair, J H; Sang, J. H.; Ish-Horowicz, D.


    We have developed an assay for transient gene expression using a dominant-selectable marker previously employed to transform Drosophila cultured cells. Drosophila hydei cells transfected with a functional Escherichia coli xanthine guanine phosphoribosyl transferase gene (gpt), under the control of the long terminal repeats (LTRs) of the copia transposable element, rapidly incorporate guanine into acid-precipitable counts. Autoradiographic analysis in situ shows that approximately 20% of cells...

  1. A novel method for detecting 7-methyl guanine reveals aberrant methylation levels in Huntington disease


    Thomas, Beena; Matson, Samantha; Chopra, Vanita; Sun, Liping; Sharma, Swati; Hersch, Steven; Rosas, H. Diana; Scherzer, Clemens; Ferrante, Robert; Matson, Wayne


    Guanine methylation is a ubiquitous process affecting DNA and various RNA species. N-7 guanine methylation (7-MG), though relatively less studied, could have a significant role in normal transcriptional regulation as well as in the onset and development of pathological conditions. The lack of a sensitive method to accurately quantify trace amounts of altered bases like 7-MG, has been a major deterrent in delineating its biological function(s). Here we report the development of methods to dete...

  2. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  3. Template polymerization of nucleotide analogues (United States)

    Orgel, L. E.


    Recent work on the template-directed reactions of the natural D-nucleotides has made it clear that l-nucleotides and nucleotide-like derivatives of other sugars would strongly inhibit the formation of long oligonucleotides. Consequently, attention is focusing on molecules simpler than nucleotides that might have acted as monomers of an information transfer system. We have begun a general exploration of the template directed reactions of diverse peptide analogues. I will present work by Dr. Taifeng Wu on oxidative oligomerization of phosphorothioates and of Dr. Mary Tohidi on the cyclic polymerization of nucleoside and related cyclic pyrophosphates.

  4. The glycine brace: a component of Rab, Rho, and Ran GTPases associated with hinge regions of guanine- and phosphate-binding loops

    Directory of Open Access Journals (Sweden)

    Neuwald Andrew F


    Full Text Available Abstract Background Ras-like GTPases function as on-off switches in intracellular signalling pathways and include the Rab, Rho/Rac, Ran, Ras, Arf, Sar and Gα families. How these families have evolutionarily diverged from each other at the sequence level provides clues to underlying mechanisms associated with their functional specialization. Results Bayesian analysis of divergent patterns within a multiple alignment of Ras-like GTPase sequences identifies a structural component, termed here the glycine brace, as the feature that most distinguishes Rab, Rho/Rac, Ran and (to some degree Ras family GTPases from other Ras-like GTPases. The glycine brace consists of four residues: An aromatic residue that forms a stabilizing CH-π interaction with a conserved glycine at the start of the guanine-binding loop; a second aromatic residue, which is nearly always a tryptophan, that likewise forms stabilizing CH-π and NH-π interactions with a glycine at the start of the phosphate-binding P-loop; and two other residues (typically an aspartate and a serine or threonine that, together with a conserved buried water molecule, form a network of interactions connecting the two aromatic residues. Conclusion It is proposed that the two glycine residues function as hinges and that the glycine brace influences guanine nucleotide binding and release by interacting with these hinges.

  5. Crystal structure of Leishmania tarentolae hypoxanthine-guanine phosphoribosyltransferase

    Directory of Open Access Journals (Sweden)

    Oliva Glaucius


    Full Text Available Abstract Background Hypoxanthine-guanine phosphoribosyltransferase (HGPRT (EC is a central enzyme in the purine recycling pathway. Parasitic protozoa of the order Kinetoplastida cannot synthesize purines de novo and use the salvage pathway to synthesize purine bases, making this an attractive target for antiparasitic drug design. Results The glycosomal HGPRT from Leishmania tarentolae in a catalytically active form purified and co-crystallized with a guanosine monophosphate (GMP in the active site. The dimeric structure of HGPRT has been solved by molecular replacement and refined against data extending to 2.1 Å resolution. The structure reveals the contacts of the active site residues with GMP. Conclusion Comparative analysis of the active sites of Leishmania and human HGPRT revealed subtle differences in the position of the ligand and its interaction with the active site residues, which could be responsible for the different reactivities of the enzymes to allopurinol reported in the literature. The solution and analysis of the structure of Leishmania HGPRT may contribute to further investigations leading to a full understanding of this important enzyme family in protozoan parasites.

  6. Human Immunodeficiency Virus Type 1 Nef Recruits the Guanine Exchange Factor Vav1 via an Unexpected Interface into Plasma Membrane Microdomains for Association with p21-Activated Kinase 2 Activity▿


    Rauch, Susanne; Pulkkinen, Kati; Saksela, Kalle; Fackler, Oliver T.


    Alterations of T-cell receptor signaling by human immunodeficiency virus type 1 (HIV-1) Nef involve its association with a highly active subpopulation of p21-activated kinase 2 (PAK2) within a dynamic signalosome assembled in detergent-insoluble membrane microdomains. Nef-PAK2 complexes contain the GTPases Rac and Cdc42 as well as a factor providing guanine nucleotide exchange factor (GEF) activity for Rac/Cdc42. However, the identity of this GEF has remained controversial. Previous studies s...

  7. Nucleotide discrimination with DNA immobilized in the MspA nanopore. (United States)

    Manrao, Elizabeth A; Derrington, Ian M; Pavlenok, Mikhail; Niederweis, Michael; Gundlach, Jens H


    Nanopore sequencing has the potential to become a fast and low-cost DNA sequencing platform. An ionic current passing through a small pore would directly map the sequence of single stranded DNA (ssDNA) driven through the constriction. The pore protein, MspA, derived from Mycobacterium smegmatis, has a short and narrow channel constriction ideally suited for nanopore sequencing. To study MspA's ability to resolve nucleotides, we held ssDNA within the pore using a biotin-NeutrAvidin complex. We show that homopolymers of adenine, cytosine, thymine, and guanine in MspA exhibit much larger current differences than in α-hemolysin. Additionally, methylated cytosine is distinguishable from unmethylated cytosine. We establish that single nucleotide substitutions within homopolymer ssDNA can be detected when held in MspA's constriction. Using genomic single nucleotide polymorphisms, we demonstrate that single nucleotides within random DNA can be identified. Our results indicate that MspA has high signal-to-noise ratio and the single nucleotide sensitivity desired for nanopore sequencing devices. PMID:21991340

  8. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara


    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  9. A new rapid amplification of cDNA ends method for extremely guanine plus cytosine-rich genes. (United States)

    Shi, Xianzong; Jarvis, Donald L


    Rapid amplification of cDNA ends (RACE) is widely used to determine the 5'- and 3'-terminal nucleotide sequences of genes. Many different RACE methods have been developed to meet various requirements, but none addresses the difficult problems that arise when trying to isolate the ends of extremely guanine plus cytosine (GC)-rich genes. In this study, we found that we were unable to isolate the correct 5' or 3' end of an insect gene, which appeared to include extremely GC-rich sequences, using current RACE methods. Thus, we developed a new RACE method that can be used for this purpose. This new method entails first-strand cDNA synthesis at 70 degrees C with Thermo-X reverse transcriptase in the presence of homoectoine, followed by a polymerase chain reaction with 98 degrees C denaturation steps and Phusion DNA polymerase in the presence of 1M betaine and 5% dimethyl sulfoxide (DMSO). The use of these conditions yielded 5'- and 3'-RACE products that were approximately 80% GC over 213 and 162bp, respectively, and included shorter internal regions of 82 to 89% GC. PMID:16875657

  10. Plasma Hypoxanthine-Guanine Phosphoribosyl Transferase Activity in Bottlenose Dolphins Contributes to Avoiding Accumulation of Non-recyclable Purines (United States)

    López-Cruz, Roberto I.; Crocker, Daniel E.; Gaxiola-Robles, Ramón; Bernal, Jaime A.; Real-Valle, Roberto A.; Lugo-Lugo, Orlando; Zenteno-Savín, Tania


    Marine mammals are exposed to ischemia/reperfusion and hypoxia/reoxygenation during diving. During oxygen deprivation, adenosine triphosphate (ATP) breakdown implies purine metabolite accumulation, which in humans is associated with pathological conditions. Purine recycling in seals increases in response to prolonged fasting and ischemia. Concentrations of metabolites and activities of key enzymes in purine metabolism were examined in plasma and red blood cells from bottlenose dolphins (Tursiops truncatus) and humans. Hypoxanthine and inosine monophosphate concentrations were higher in plasma from dolphins than humans. Plasma hypoxanthine-guanine phosphoribosyl transferase (HGPRT) activity in dolphins suggests an elevated purine recycling rate, and a mechanism for avoiding accumulation of non-recyclable purines (xanthine and uric acid). Red blood cell concentrations of hypoxanthine, adenosine diphosphate, ATP and guanosine triphosphate were lower in dolphins than in humans; adenosine monophosphate and nicotinamide adenine dinucleotide concentrations were higher in dolphins. HGPRT activity in red blood cells was higher in humans than in dolphins. The lower concentrations of purine catabolism and recycling by-products in plasma from dolphins could be beneficial in providing substrates for recovery of ATP depleted during diving or vigorous swimming. These results suggest that purine salvage in dolphins could be a mechanism for delivering nucleotide precursors to tissues with high ATP and guanosine triphosphate requirements. PMID:27375492

  11. Examination of the effect of the annealing cation on higher order structures containing guanine or isoguanine repeats


    Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.


    Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. ...

  12. Fluorescence quenching effect of guanine interacting with water-soluble cationic porphyrin

    Energy Technology Data Exchange (ETDEWEB)

    Makarska-Bialokoz, Magdalena, E-mail:


    The process of association between 5,10,15,20-tetrakis[4-(trimethylammonio)phenyl]-21H,23H-porphine tetra-p-tosylate (H{sub 2}TTMePP) and guanine has been studied both in NaOH solution and TRIS buffer analysing its absorption and steady-state fluorescence spectra. The fluorescence quenching effect observed during interactions porphyrin-guanine points at the fractional accessibility of the fluorophore for the quencher. The association and fluorescence quenching constants are of the order of magnitude of 10{sup 5} mol{sup −1}. The fluorescence lifetimes and the quantum yields of the porphyrin monoanion form were established. The results demonstrate that guanine can interact with H{sub 2}TTMePP at basic pH and through formation of stacking complexes is able to quench its ability to emission. -- Highlights: • Association study of water soluble cationic porphyrin with guanine. • Porphyrin absorption spectra undergo the bathochromic and hypochromic effects. • Guanine interacts with porphyrin in inhibiting manner, quenching its emission. • Fluorescence quenching process is static with fractional accessibility of porphyrin. • The association and fluorescence quenching constants were calculated.

  13. Highly sensitive and selective fluorescent assay for guanine based on the Cu2 +/eosin Y system (United States)

    Shi, Huimin; Cui, Yi; Gong, Yijun; Feng, Suling


    A fluorescent probe has been developed for the determination of guanine based on the quenched fluorescence signal of Cu2 +/eosin Y. Cu2 + interacted with eosin Y, resulting in fluorescence quenching. Subsequently, with the addition of guanine to the Cu2 +/eosin Y system, guanine reacted with Cu2 + to form 1:1 chelate cation, which further combined with eosin Y to form a 1:1 ternary ion-association complex by electrostatic attraction and hydrophobic interaction, resulting in significant decrease of the fluorescence. Hence, a fluorescent system was constructed for rapid, sensitive and selective detection of guanine with a detection limit as low as 1.5 nmol L- 1 and a linear range of 3.3-116 nmol L- 1. The method has been applied satisfactorily to the determination of guanine in DNA and urine samples with the recoveries from 98.7% to 105%. This study significantly expands the realm of application of ternary ion-association complex in fluorescence probe.

  14. Theoretical Study of the Photophysics of 8-Vinylguanine, an Isomorphic Fluorescent Analogue of Guanine. (United States)

    Kochman, Michał A; Pola, Martina; Miller, R J Dwayne


    Paving the way for the application of the algebraic-diagrammatic construction scheme of second-order (ADC(2)) to systems based on the guanine chromophore, we demonstrate the this excited-state electronic structure method provides a realistic description of the photochemistry of 9H-guanine, in close agreement with the benchmark provided by the CASPT2 method. We then proceed to apply the ADC(2) method to the photochemistry of 8-vinylguanine (8vG), a minimally modified analogue of guanine which, unlike the naturally occurring nucleobase, displays intense fluorescence, indicative of a much longer-lived excited electronic state. The emissive electronic state of 8vG is identified as an ππ*-type intramolecular charge transfer (ICT) state, in which a charge of roughly -0.2 e is transferred from the guanine moiety onto the vinyl substituent. The main radiationless deactivation pathway competing with fluorescence is predicted to involve the molecule leaving the minimum on the ICT ππ* state, and reaching a region of the S1 adiabatic state where it resembles the La ππ* state of unmodified 9H-guanine. The topology of the La ππ* region of the S1 state favors subsequent internal conversion at a crossing seam with the ground electronic state. The sensitivity of this process to environment polarity may explain the experimentally observed fluorescence quenching of 8vG upon incorporation in single- and double-stranded DNA. PMID:27427772

  15. Hypoxanthine-guanine phosophoribosyltransferase (HPRT deficiency: Lesch-Nyhan syndrome

    Directory of Open Access Journals (Sweden)

    Puig Juan G


    Full Text Available Abstract Deficiency of hypoxanthine-guanine phosphoribosyltransferase (HPRT activity is an inborn error of purine metabolism associated with uric acid overproduction and a continuum spectrum of neurological manifestations depending on the degree of the enzymatic deficiency. The prevalence is estimated at 1/380,000 live births in Canada, and 1/235,000 live births in Spain. Uric acid overproduction is present inall HPRT-deficient patients and is associated with lithiasis and gout. Neurological manifestations include severe action dystonia, choreoathetosis, ballismus, cognitive and attention deficit, and self-injurious behaviour. The most severe forms are known as Lesch-Nyhan syndrome (patients are normal at birth and diagnosis can be accomplished when psychomotor delay becomes apparent. Partial HPRT-deficient patients present these symptoms with a different intensity, and in the least severe forms symptoms may be unapparent. Megaloblastic anaemia is also associated with the disease. Inheritance of HPRT deficiency is X-linked recessive, thus males are generally affected and heterozygous female are carriers (usually asymptomatic. Human HPRT is encoded by a single structural gene on the long arm of the X chromosome at Xq26. To date, more than 300 disease-associated mutations in the HPRT1 gene have been identified. The diagnosis is based on clinical and biochemical findings (hyperuricemia and hyperuricosuria associated with psychomotor delay, and enzymatic (HPRT activity determination in haemolysate, intact erythrocytes or fibroblasts and molecular tests. Molecular diagnosis allows faster and more accurate carrier and prenatal diagnosis. Prenatal diagnosis can be performed with amniotic cells obtained by amniocentesis at about 15–18 weeks' gestation, or chorionic villus cells obtained at about 10–12 weeks' gestation. Uric acid overproduction can be managed by allopurinol treatment. Doses must be carefully adjusted to avoid xanthine lithiasis. The

  16. Electronic transitions of guanine tautomers, their stacked dimers, trimers and sodium complexes (United States)

    Kushwaha, P. S.; Kumar, Anil; Mishra, P. C.


    Planar and nonplanar geometries of the keto-N9H and keto-N7H tautomers of the guanine base of DNA as well as the hydrogen bonded complexes of these species with three water molecules each were optimized using the density functional theory at the B3LYP/6-31G ∗ ∗ level. Geometries of the isolated bases were also optimized using the ab initio approach at the MP2/6-31G ∗ ∗ level. The isolated keto-N9H and keto-N7H tautomers as well as their hydrogen bonded complexes with three water molecules each were solvated in bulk water employing the polarized continuum model (PCM) of the self-consistent reaction field theory (SCRF). Stacked dimers and trimers of both the tautomers of guanine were generated by placing the planar forms of the species at a fixed distance of 3.5 Å from the neighboring one and rotating one molecule with respect to the other by 110° for the keto-N9H form and 90° for the keto-N7H form which corresponded to total energy minima at the B3LYP/6-31G ∗ ∗ level. Geometry optimization for the cation of the monomer of guanine was performed at the same level of theory, and its solvation in bulk water was treated using the PCM model of the SCRF theory. The geometries of complexes of the two tautomers of guanine with a Na + ion each were optimized at the B3LYP/6-31G ∗ ∗ level, and the Na + ion is predicted to bind with the keto-N9H tautomer preferentially. While the complex of the keto-N7H form of guanine with three water molecules in gas phase is slightly more stable than the corresponding complex of the keto-N9H form of guanine, the reverse is true in bulk water. Stacking interactions enhance the relative stability of the keto-N9H tautomer over that of the keto-N7H tautomer, suggesting that in bulk solutions, the former would be dominant. Electronic spectra of the isolated tautomers of guanine, those of their complexes with three water molecules each, the (keto-n9h and keto-n7h) cation of guanine, the complexes of the tautomers with a Na + ion

  17. Electrocatalytic activity of oxidation products of guanine and 5'-GMP towards the oxidation of NADH

    International Nuclear Information System (INIS)

    We have studied the potential electrocatalytic activity towards the oxidation of NADH of several oxidation products of guanine and its derivative guanosine-5'-monophosphate (5'-GMP) on pyrolytic graphite electrodes (PGE). The distribution of products generated strongly depends on the experimental conditions. Our investigations focused on the oxidation products that are adsorbed on the electrode surface, are redox active and, exhibited electrocatalytic activity toward the oxidation of NADH. These compounds were electrochemically and kinetically characterized in terms of dependence of the formal potential on pH and electron transfer rate constant (ks). The voltammetric and catalytic behavior of both guanine and 5'-GMP oxidation products was compared with that of other guanine derivatives we have previously studied. Some mechanistic aspects concerning the generation of the catalysts are also discussed

  18. Synthesis of a Pseudodisaccharide α-C-Glycosidically Linked to an 8-Alkylated Guanine

    Directory of Open Access Journals (Sweden)

    Jan Duchek


    Full Text Available The synthesis of stable guanofosfocin analogues has attracted considerable attention in the past 15 years. Several guanofosfocin analogues mimicking the three constitutional elements of mannose, ribose, and guanine were designed and synthesized. Interest in ether-linked pseudodisaccharides and 8-alkylated guanines is increasing, due to their potential applications in life science. In this article, a novel guanofosfocin analogue 6, an ether-linked pseudodisaccharide connected α-C-glycosidically to an 8-alkylated guanine, was synthesized in a 10-longest linear step sequence from known diol 13, resulting in an overall yield of 26%. The key steps involve the ring-opening of cyclic sulfate 8 by alkoxide generated from 7 and a reductive cyclization of 4-N-acyl-2,4-diamino-5-nitrosopyrimidine 19 to form compound 6.

  19. Nucleotide sequence analysis of the hypervariable region III of mitochondrial DNA in Thais. (United States)

    Thongngam, Punlop; Leewattanapasuk, Worraanong; Bhoopat, Tanin; Sangthong, Padchanee


    This study analyzed the nucleotide sequences of the hypervariable region III (HVRIII) of mitochondrial DNA in Thai individuals. Buccal swab samples were randomly obtained from 100 healthy, unrelated, adult (18-60 years old), volunteer donors living in Thailand. Eighteen different haplotypes were found, of which 11 haplotypes were unique. The most frequent haplotypes observed were 522D-523D. Nucleotide transition from Thymine (T) to Cytosine (C) at position 489 (43%) was the most frequent substitution. Nucleotide transversions were also observed at position 433 (Adenine (A) to C, 1%) and position 499 (Guanine (G) to C, 1%). Fifty-three samples presented nucleotide insertion and deletion of C and A (CA) at position 514-523. Insertion of 1AC (3%) and 2AC (2%) were observed. Deletion of 1CA (53%) and 2CA (2%) at position 514-523 were revealed. The deletion of T at position 459 was observed. The haplotype diversity, random match probability, and discrimination power were calculated to be 0.7770, 0.2308, and 0.7692, respectively. PMID:27107562

  20. Functionalization of single-walled carbon nanotubes with uracil, guanine, thymine and L-alanine (United States)

    Silambarasan, D.; Iyakutti, K.; Vasu, V.


    Experimental investigation of functionalization of oxidized single-walled carbon nanotubes (OSWCNTs) with three nucleic acid bases such as uracil, guanine, thymine and one amino acid, L-alanine is carried out. Initially, the SWCNTs are oxidized by acid treatment. Further, the oxidized SWCNTs are effectively functionalized with aforementioned biological compounds by ultrasonication. The diameter of OSWCNTs has increased after the adsorption of biological compounds. The cumulative Π-Π stacking, hydrogen bond and polar interaction are the key factors to realize the adsorption. The amount of adsorption of each biological compound is estimated. The adsorption of guanine is more among all the four biological compounds.

  1. Spin transport and polarization properties of manganese-doped dual-guanine molecule


    Simchi, Hamidreza; Esmaeilzadeh, Mahdi; Mazidabadi, Hossein; Nourozi, Mohammad


    We study the spin transport and polarization properties of manganese-doped dual-guanine molecules connected to graphene leads using non-equilibrium Green's function method. It is shown that a manganese doped dual-guanine molecule is a biological semiconductor and behaves as a prefect spin filter. We show that this semiconductor can behave as a spin switch when the Rashba spin-orbit interaction is considered. In addition, it is shown that, a large conductance is observed due to the Fano-Kondo-...

  2. Ligand-induced folding of the guanine-sensing riboswitch is controlled by a combined predetermined induced fit mechanism

    NARCIS (Netherlands)

    Ottink, O.M.; Rampersad, S.M.; Tessari, M.; Zaman, G.J.; Heus, H.A.; Wijmenga, S.S.


    All known guanine-sensing riboswitches regulate gene expression by specifically binding to guanine (G) or related analogs with high affinity to switch off transcription. The aptamers of this class of riboswitches are characterized by three helices (P1-P3), surrounding a central core of phylogenetica

  3. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  4. [Interaction of divalent cadmium ions with nucleotides and native DNA]. (United States)

    Sorokin, V A; Valeev, V A; Gladchenko, G O; Sysa, I V


    Complex formation of Cd2+ ions with 2'-deoxy-5'-phosphates of canonical bases and their riboanalogues in water solution is studied by the method of differential UV-spectroscopy. It is stated that the atoms coordinating Cd2+ in complexes are N7 of dGMP and GMP, dAMP and AMP, N1 of adenine derivatives, N3 of dCMP. No interaction with base heteroatoms of UMP and dTMP is found. O2' present in the structure of the sugar ring has a weak influence on the Cd2+ ion binding to purine nucleotides. It manifests itself strongly in the complexes with cytosine derivatives: cadmium does not interact with N3 of CMP and poly-C practically. In the last case O2 is a centre coordinating Cd2+ ions. The interaction with this atom induces the melting of polynucleotide helical parts. At the high cadmium concentration poly-C forms compact particles. The main centre binding Cd2+ ions in DNA is N7 of guanines. Noncooperative interaction with these centres results in the internal protonation of N3C of GC-pairs. This is not followed with the disordering of the DNA helical structure. PMID:9181783

  5. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases. (United States)

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik


    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  6. Theoretical and Experimental Study of Valence-Shell Ionization Spectra of Guanine (United States)

    Zaytseva, Irina L.; Trofimov, Alexander B.; Schirmer, Jochen; Plekan, Oksana; Feyer, Vitaliy; Richter, Robert; Coreno, Marcello; Prince, Kevin C.


    The full valence-shell ionization spectra of the four most stable guanine tautomers were studied theoretically. The third-order algebraic-diagrammatic construction (ADC(3)) method for the one-particle Green's function was used to calculate the energies and relative intensities of the vertical ionization transitions. For low-lying transitions, the influence of planar and nonplanar guanine configurations on the ionization energies, as well as the convergence of the results with respect to basis set was studied at the level of the outer-valence Green's function (OVGF) approximation scheme. The results of the calculations were used to interpret recent synchrotron radiation valence-shell photoionization spectra of guanine in the gas phase under thermal equilibrium conditions. The photoelectron spectrum was modeled by summing individual tautomer spectra weighted by Boltzmann population ratios (BPR) of tautomers from our previous high-level ab initio thermochemical calculations. The theoretical spectra are in good agreement with the experimental results, providing assignments of most observed structures and offering insight into tautomerism of guanine in the gas phase. The first six molecular orbitals give rise to single-hole states with a binding energy of about 7-12 eV. At higher binding energy the spectral features are mainly due to satellite states.

  7. Hypoxanthine-guanine phosphoribosyltransferase: characteristics of the mutant enzyme in erythrocytes from patients with the Lesch-Nyhan syndrome. (United States)

    Arnold, W J; Meade, J C; Kelley, W N


    The Lesch-Nyhan syndrome is characterized clinically by choreoathetosis, spasticity, selfmutilation, and mental and growth retardation. Biochemically, there is a striking reduction of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) activity in affected individuals. We have examined erythrocytes from 14 patients with the Lesch-Nyhan syndrome for the presence of hypoxanthine-guanine phosphoribosyltransferase activity and enzyme protein. In contrast to the usual finding of no detectable hypoxanthine-guanine phosphoribosyltransferase activity, we have found low levels (0.002-0.79 nmoles/mg protein per hr) of hypoxanthine-guanine phosphoribosyltransferase activity in erythrocyte lysates from five of these patients. In three of the five patients, hypoxanthine-guanine phosphoribosyltransferase activity appeared to be substantially more labile in vivo than normal using erythrocytes which had been separated according to their density (age). Immunochemical studies using a monospecific antiserum prepared from a homogeneous preparation of normal human erythrocyte hypoxanthine-guanine phosphoribosyltransferase revealed immunoreactive protein (CRM) in hemolysate from all 14 patients with the Lesch-Nyhan syndrome. The immunoreactive protein from each patient gave a reaction of complete identity with normal erythrocyte hypoxanthine-guanine phosphoribosyltransferase and was present in quantities equal to those observed in normal erythrocytes. In addition, a constant amount of CRM was found in erythrocytes of increasing density (age) from patients with the Lesch-Nyhan syndrome despite the decreasing hypoxanthine-guanine phosphoribosyltransferase activity. These studies confirm previous data which indicate that the mutations leading to the Lesch-Nyhan syndrome are usually, if not always on the structural gene coding for hypoxanthine-guanine phosphoribosyltransferase. In addition, although the mutant proteins appear to be present in normal amounts, they are often very labile in

  8. Nitrogen K-edge X-ray absorption near edge structure (XANES) spectra of purine-containing nucleotides in aqueous solution (United States)

    Shimada, Hiroyuki; Fukao, Taishi; Minami, Hirotake; Ukai, Masatoshi; Fujii, Kentaro; Yokoya, Akinari; Fukuda, Yoshihiro; Saitoh, Yuji


    The N K-edge X-ray absorption near edge structure (XANES) spectra of the purine-containing nucleotide, guanosine 5'-monophosphate (GMP), in aqueous solution are measured under various pH conditions. The spectra show characteristic peaks, which originate from resonant excitations of N 1s electrons to π* orbitals inside the guanine moiety of GMP. The relative intensities of these peaks depend on the pH values of the solution. The pH dependence is explained by the core-level shift of N atoms at specific sites caused by protonation and deprotonation. The experimental spectra are compared with theoretical spectra calculated by using density functional theory for GMP and the other purine-containing nucleotides, adenosine 5'-monophosphate, and adenosine 5'-triphosphate. The N K-edge XANES spectra for all of these nucleotides are classified by the numbers of N atoms with particular chemical bonding characteristics in the purine moiety.

  9. Expression of microRNAs in Horse Plasma and Their Characteristic Nucleotide Composition. (United States)

    Lee, Seungwoo; Hwang, Seungwoo; Yu, Hee Jeong; Oh, Dayoung; Choi, Yu Jung; Kim, Myung-Chul; Kim, Yongbaek; Ryu, Doug-Young


    MicroRNAs (miRNAs) in blood plasma are stable under high levels of ribonuclease activity and could function in tissue-to-tissue communication, suggesting that they may have distinctive structural characteristics compared with non-circulating miRNAs. In this study, the expression of miRNAs in horse plasma and their characteristic nucleotide composition were examined and compared with non-plasma miRNAs. Highly expressed plasma miRNA species were not part of the abundant group of miRNAs in non-plasma tissues, except for the eca-let-7 family. eca-miR-486-5p, -92a, and -21 were among the most abundant plasma miRNAs, and their human orthologs also belong to the most abundant group of miRNAs in human plasma. Uracil and guanine were the most common nucleotides of both plasma and non-plasma miRNAs. Cytosine was the least common in plasma and non-plasma miRNAs, although levels were higher in plasma miRNAs. Plasma miRNAs also showed higher expression levels of miRNAs containing adenine and cytosine repeats, compared with non-plasma miRNAs. These observations indicate that miRNAs in the plasma have a unique nucleotide composition. PMID:26731407

  10. Expression of microRNAs in Horse Plasma and Their Characteristic Nucleotide Composition.

    Directory of Open Access Journals (Sweden)

    Seungwoo Lee

    Full Text Available MicroRNAs (miRNAs in blood plasma are stable under high levels of ribonuclease activity and could function in tissue-to-tissue communication, suggesting that they may have distinctive structural characteristics compared with non-circulating miRNAs. In this study, the expression of miRNAs in horse plasma and their characteristic nucleotide composition were examined and compared with non-plasma miRNAs. Highly expressed plasma miRNA species were not part of the abundant group of miRNAs in non-plasma tissues, except for the eca-let-7 family. eca-miR-486-5p, -92a, and -21 were among the most abundant plasma miRNAs, and their human orthologs also belong to the most abundant group of miRNAs in human plasma. Uracil and guanine were the most common nucleotides of both plasma and non-plasma miRNAs. Cytosine was the least common in plasma and non-plasma miRNAs, although levels were higher in plasma miRNAs. Plasma miRNAs also showed higher expression levels of miRNAs containing adenine and cytosine repeats, compared with non-plasma miRNAs. These observations indicate that miRNAs in the plasma have a unique nucleotide composition.

  11. Expression of microRNAs in Horse Plasma and Their Characteristic Nucleotide Composition (United States)

    Lee, Seungwoo; Hwang, Seungwoo; Yu, Hee Jeong; Oh, Dayoung; Choi, Yu Jung; Kim, Myung-Chul; Kim, Yongbaek; Ryu, Doug-Young


    MicroRNAs (miRNAs) in blood plasma are stable under high levels of ribonuclease activity and could function in tissue-to-tissue communication, suggesting that they may have distinctive structural characteristics compared with non-circulating miRNAs. In this study, the expression of miRNAs in horse plasma and their characteristic nucleotide composition were examined and compared with non-plasma miRNAs. Highly expressed plasma miRNA species were not part of the abundant group of miRNAs in non-plasma tissues, except for the eca-let-7 family. eca-miR-486-5p, -92a, and -21 were among the most abundant plasma miRNAs, and their human orthologs also belong to the most abundant group of miRNAs in human plasma. Uracil and guanine were the most common nucleotides of both plasma and non-plasma miRNAs. Cytosine was the least common in plasma and non-plasma miRNAs, although levels were higher in plasma miRNAs. Plasma miRNAs also showed higher expression levels of miRNAs containing adenine and cytosine repeats, compared with non-plasma miRNAs. These observations indicate that miRNAs in the plasma have a unique nucleotide composition. PMID:26731407

  12. Rapid magnetic wiper featuring biogenic guanine particles: Magnetic non-contact switching of opto-fluidic mirrors featuring biogenic guanine crystals (United States)

    Iwasaka, M.; Mizukawa, Y.; Miyashita, Y.


    In the present study, we prepared a diamagnetic fluid with magnetically controlled visual transparency. Light scattering control by the magnetic orientation of organic and diamagnetic microcrystals was applied for developing a functional diamagnetic fluid, by controlling its turbidity and transparency. The light scattering fluid was prepared by guanine crystal particles suspension (GPS), which were collected from the scales of goldfish, in an aqueous solution. It is revealed that GPS can control light scattering with magnetic fields. The method we developed can be utilized for controlling the visibility of light-reflective objects by using magnetic fields on a millitesla scale.

  13. Applications of adenine nucleotide measurements in oceanography (United States)

    Holm-Hansen, O.; Hodson, R.; Azam, F.


    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  14. Nucleotides in neuroregeneration and neuroprotection. (United States)

    Miras-Portugal, M Teresa; Gomez-Villafuertes, Rosa; Gualix, Javier; Diaz-Hernandez, Juan Ignacio; Artalejo, Antonio R; Ortega, Felipe; Delicado, Esmerilda G; Perez-Sen, Raquel


    Brain injury generates the release of a multitude of factors including extracellular nucleotides, which exhibit bi-functional properties and contribute to both detrimental actions in the acute phase and also protective and reparative actions in the later recovery phase to allow neuroregeneration. A promising strategy toward restoration of neuronal function is based on activation of endogenous adult neural stem/progenitor cells. The implication of purinergic signaling in stem cell biology, including regulation of proliferation, differentiation, and cell death has become evident in the last decade. In this regard, current strategies of acute transplantation of ependymal stem/progenitor cells after spinal cord injury restore altered expression of P2X4 and P2X7 receptors and improve functional locomotor recovery. The expression of both receptors is transcriptionally regulated by Sp1 factor, which plays a key role in the startup of the transcription machinery to induce regeneration-associated genes expression. Finally, general signaling pathways triggered by nucleotide receptors in neuronal populations converge on several intracellular kinases, such as PI3K/Akt, GSK3 and ERK1,2, as well as the Nrf-2/heme oxigenase-1 axis, which specifically link them to neuroprotection. In this regard, regulation of dual specificity protein phosphatases can become novel mechanism of actions for nucleotide receptors that associate them to cell homeostasis regulation. This article is part of the Special Issue entitled 'Purines in Neurodegeneration and Neuroregeneration'. PMID:26359530

  15. Thermodynamic Potential for the Abiotic Synthesis of Adenine, Cytosine, Guanine, Thymine, Uracil, Ribose, and Deoxyribose in Hydrothermal Systems

    NARCIS (Netherlands)

    LaRowe, D.E.; Regnier, P.


    The thermodynamic potential for the abiotic synthesis of the five common nucleobases (adenine, cytosine, guanine, thymine, and uracil) and two monosaccharides (ribose and deoxyribose) from formaldehyde and hydrogen cyanide has been quantified under temperature, pressure, and bulk composition conditi

  16. O 6-(4-bromothenyl)guanine reverses temozolomide resistance in human breast tumour MCF-7 cells and xenografts


    Clemons, M.; Kelly, J.; Watson, A.J.; Howell, A.; McElhinney, R S; McMurry, T B H; Margison, G P


    Tumour resistance to chemotherapy involving methylating agents such as DTIC (dacarbazine) and temozolomide is linked to expression of the DNA repair protein O 6-alkylguanine-DNA alkyltransferase (MGMT). There is considerable interest in improving the efficacy of such O 6-alkylating chemotherapy by the prior inactivation of MGMT. We have examined the effect of the modified guanine base, O 6-(4-bromothenyl)guanine (PaTrin-2, Patrin™, Lomeguatrib) on MGMT activity and cell or xenograft tumour gr...

  17. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.


    Endo, T.; Uratani, B; Freese, E.


    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic ch...

  18. Activation of transfer RNA-guanine ribosyltransferase by protein kinase C.


    Morris, R C; Brooks, B. J.; Eriotou, P; Kelly, D F; Sagar, S.; Hart, K L; Elliott, M.S.


    Transfer RNA-guanine ribosyltransferase (TGRase) irreversibly incorporates queuine into the first position in the anticodon of four tRNA isoacceptors. Rat brain protein kinase C (PKC) was shown to stimulate rat liver TGRase activity. TGRase preparations derived from rat liver have been observed to decrease in activity over time in storage at -20 or -70 degrees C. Contamination of the samples by phosphatases was indicated by a p-nitrophenylphosphate conversion test. The addition of micromolar ...

  19. Benchmark Theoretical and Experimental Study on N-15 NMR Shifts of Oxidatively Damaged Guanine

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Šála, Michal; Klepetářová, Blanka; Šebera, Jakub; Fukal, Jiří; Holečková, Veronika; Tanaka, Y.; Nencka, Radim; Sychrovský, Vladimír


    Roč. 120, č. 5 (2016), s. 915-925. ISSN 1520-6106 R&D Projects: GA ČR GA13-27676S; GA ČR GA15-11223S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * DFT calculations * oxidatively damaged guanine * hOGG1 Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.302, year: 2014

  20. Structure-function Relationships in Human Hypoxanthine-guanine Phosphoribosyltransferase (HGPRT) by Random Mutagenesis

    Institute of Scientific and Technical Information of China (English)


    @@ Introduction Hypoxanthine-guanine phosphoribosyltransferase ( HGPRT, EC ) is a key enzyme of the purine salvage pathway, which allows recycling of purine bases into DNA and RNA. It is widely distributed in nature and has been studied both in prokaryotes and eukaryotes. In humans, a complete lack of HGPRT activity causes the Lesch-Nyhan syndrome, which is characterized by hyperuricaemia and neural disorders, including mental retardation and compulsive self-mutilation behavior[1].

  1. Structure–function analysis of vaccinia virus mRNA cap (guanine-N7) methyltransferase


    Zheng, Sushuang; Shuman, Stewart


    The guanine-N7 methyltransferase domain of vaccinia virus mRNA capping enzyme is a heterodimer composed of a catalytic subunit and a stimulatory subunit. Structure–function analysis of the catalytic subunit by alanine scanning and conservative substitutions (49 mutations at 25 amino acids) identified 12 functional groups essential for methyltransferase activity in vivo, most of which were essential for cap methylation in vitro. Defects in cap binding were demonstrated for a subset of lethal m...

  2. N‐methylmesoporphyrin IX fluorescence as a reporter of strand orientation in guanine quadruplexes


    Sabharwal, Navin C.; Savikhin, Victoria; Turek‐Herman, Joshua R.; Nicoludis, John M.; Szalai, Veronika A.; Yatsunyk, Liliya A.


    Guanine quadruplexes (GQ) are four‐stranded DNA structures formed by guanine‐rich DNA sequences. The formation of GQs inhibits cancer cell growth, although the detection of GQs in vivo has proven difficult, in part because of their structural diversity. The development of GQ‐selective fluorescent reporters would enhance our ability to quantify the number and location of GQs, ultimately advancing biological studies of quadruplex relevance and function. N‐methylmesoporphyrin IX (NMM) interacts ...

  3. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte (United States)

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10‑7 to 10‑3 Ω‑1 cm‑1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries.

  4. Inosine Nucleobase Acts as Guanine in Interactions with Protein Side Chains. (United States)

    Hajnic, Matea; Ruiter, Anita de; Polyansky, Anton A; Zagrovic, Bojan


    A central intermediate in purine catabolism, the inosine nucleobase hypoxanthine is also one of the most abundant modified nucleobases in RNA and plays key roles in the regulation of gene expression and determination of cell fate. It is known that hypoxanthine acts as guanine when interacting with other nucleobases and base pairs most favorably with cytosine. However, its preferences when it comes to interactions with amino acids remain unknown. Here we present for the first time the absolute binding free energies and the associated interaction modes between hypoxanthine and all standard, non-glycyl/non-prolyl amino acid side chain analogs as derived from molecular dynamics simulations and umbrella sampling in high- and low-dielectric environments. We illustrate the biological relevance of the derived affinities by providing a quantitative explanation for the specificity of hypoxanthine-guanine phosphoribosyltransferase, a key enzyme in the purine salvage pathway. Our results demonstrate that in its affinities for protein side chains, hypoxanthine closely matches guanine, much more so than its precursor adenine. PMID:27093234

  5. The research progress on function of Ras guanyl nucleotide releasing protein family%Ras 鸟苷酸释放蛋白家族的功能研究新进展

    Institute of Scientific and Technical Information of China (English)

    杨柳; 陶娟; 涂亚庭


    Ras鸟苷酸释放蛋白家族(Ras guanyl nucleotide releasing proteins ,RasGRPs)是鸟嘌呤核苷酸交换因子(guanine nucleotide exchange factors ,GEFs)中的一员,由4种类型的蛋白质组成。 RasGRPs能通过交换鸟嘌呤核苷酸将Ras蛋白从无活性的GDP形式变成有活性的GTP形式,从而活化Ras。4种不同类型的RasGRP蛋白拥有共同的分子结构。其结构包括一个由Ras 交换中心和CDC25区域组成的催化中心,同时还拥有一对非典型的EF臂及C1端。异常表达的不同RasGRP蛋白在不同的疾病发病过程中发挥作用。%Ras guanyl nucleotide releasing proteins ( RasGRPs) were one of guanine nucleotide exchange factors .They consist of four types of proteins .RasGRPs can activate Ras from GDP form to GTP form through the exchange of guanine nucleotide .Four differ-ent types of RasGRP proteins share a common molecular structure .The structure consists of a catalytic center including Ras exchange centers and CDC25 region.They also have a pair of atypical EF arms and C 1 side.The abnormal expressions of different RasGRP pro-teins play a role in different diseases .

  6. Nucleotide excision repair in humans. (United States)

    Spivak, Graciela


    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process. PMID:26388429

  7. Comparative genomic analysis reveals a critical role of de novo nucleotide biosynthesis for Saccharomyces cerevisiae virulence.

    Directory of Open Access Journals (Sweden)

    Roberto Pérez-Torrado

    Full Text Available In recent years, the number of human infection cases produced by the food related species Saccharomyces cerevisiae has increased. Whereas many strains of this species are considered safe, other 'opportunistic' strains show a high degree of potential virulence attributes and can cause infections in immunocompromised patients. Here we studied the genetic characteristics of selected opportunistic strains isolated from dietary supplements and also from patients by array comparative genomic hybridization. Our results show increased copy numbers of IMD genes in opportunistic strains, which are implicated in the de novo biosynthesis of the purine nucleotides pathway. The importance of this pathway for virulence of S. cerevisiae was confirmed by infections in immunodeficient murine models using a GUA1 mutant, a key gene of this pathway. We show that exogenous guanine, an end product of this pathway in its triphosphorylated form, increases the survival of yeast strains in ex vivo blood infections. Finally, we show the importance of the DNA damage response that activates dNTP biosynthesis in yeast cells during ex vivo blood infections. We conclude that opportunistic yeasts may use an enhanced de novo biosynthesis of the purine nucleotides pathway to increase survival and favor infections in the host.

  8. Inhibitory effects promoted by 5'-nucleotides on the ecto-3'-nucleotidase activity of Leishmania amazonensis. (United States)

    Freitas-Mesquita, Anita Leocadio; Gomes, Marta T; Vieira, Danielle P; Paes-Vieira, Lisvane; Nascimento, Michelle T C; Lopes, Angela H C S; Meyer-Fernandes, José Roberto


    The protozoan parasite Leishmania amazonensis is the etiological agent of cutaneous leishmaniasis. During its life cycle, the flagellated metacyclic promastigote forms are transmitted to vertebrate hosts by sandfly bites, and they develop into amastigotes inside macrophages, where they multiply. L. amazonensis possesses a bifunctional enzyme, called 3'-nucleotidase/nuclease (3'NT/NU), which is able to hydrolyze extracellular 3'-monophosphorylated nucleosides and nucleic acids. 3'NT/NU plays an important role in the generation of extracellular adenosine and has been described as a key enzyme in the acquisition of purines by trypanosomatids. Furthermore, it has been observed that 3'NT/NU also plays a valuable role in the establishment of parasitic infection. In this context, this study aimed to investigate the modulation of the 3'-nucleotidase (3'NT) activity of L. amazonensis by several nucleotides. It was observed that 3'NT activity is inhibited by micromolar concentrations of guanosine and guanine nucleotides. The inhibition promoted by 5'-GMP on the 3'NT activity of L. amazonensis is reversible and uncompetitive because the addition of the inhibitor decreased the kinetic parameters Km and Vmax. Finally, we found that the addition of 5'-GMP is able to reverse the stimulation promoted by 3'-AMP in a macrophage-parasite interaction assay. The determination of compounds that can inhibit the 3'NT activity of Leishmania is very important because this enzyme does not occur in mammals, making it a potential therapeutic target. PMID:27531705

  9. Fragmentation of the adenine and guanine molecules induced by electron collisions

    International Nuclear Information System (INIS)

    Secondary electron emission is the most important stage in the mechanism of radiation damage to DNA biopolymers induced by primary ionizing radiation. These secondary electrons ejected by the primary electron impacts can produce further ionizations, initiating an avalanche effect, leading to genome damage through the energy transfer from the primary objects to sensitive biomolecular targets, such as nitrogenous bases, saccharides, and other DNA and peptide components. In this work, the formation of positive and negative ions of purine bases of nucleic acids (adenine and guanine molecules) under the impact of slow electrons (from 0.1 till 200 eV) is studied by the crossed electron and molecular beams technique. The method used makes it possible to measure the molecular beam intensity and determine the total cross-sections for the formation of positive and negative ions of the studied molecules, their energy dependences, and absolute values. It is found that the maximum cross section for formation of the adenine and guanine positive ions is reached at about 90 eV energy of the electron beam and their absolute values are equal to 2.8 × 10−15 and 3.2 × 10−15 cm2, respectively. The total cross section for formation of the negative ions is 6.1 × 10−18 and 7.6 × 10−18 cm2 at the energy of 1.1 eV for adenine and guanine, respectively. The absolute cross-section values for the molecular ions are measured and the cross-sections of dissociative ionization are determined. Quantum chemical calculations are performed for the studied molecules, ions and fragments for interpretation of the crossed beams experiments

  10. Topoisomerase IB of Deinococcus radiodurans resolves guanine quadruplex DNA structures in vitro

    Indian Academy of Sciences (India)

    Swathi Kota; Hari S Misra


    Deinococcus radiodurans genome contains a large number of guanine repeats interrupted by a few non-guanine bases, termed G motifs. Some of these G motifs were shown forming guanine quadruplex (G4) DNA structure in vitro. How is the formation and relaxation of G4 DNA regulated in the genome of D. radiodurans is not known and is worth investigating. Here, we showed that the topoisomerase lb of D. radiodurans (DraTopolB) could change the electrophoretic mobility of fast migrating intramolecular rec-G4 DNA into the slow migrating species. DraTopolB also reduced the positive ellipticity in circular diachroism (CD) spectra of intramolecular rec-G4 DNA structures stabilized by K+. On the contrary, when DraTopolB is incubated with G-motifs annealed without K+, it showed neither any change in electrophoretic mobility nor was ellipticity of the CD spectra affected. DNA synthesis by Taq DNA polymerase through G4 DNA structure was attenuated in the presence of G4 DNA binding drugs, which was abrogated by DraTopolB. This implies that DraTopolB could destabilize the G4 DNA structure, which is required for G4 drugs binding and stabilization. Camptothecin treatment inhibited DraTopolB activity on intramolecular G4 DNA structures. These results suggested that DraTopolB can relax intramolecular G4 DNA structure in vitro and it may be one such protein that could resolve G4 DNA under normal growth conditions in D. radiodurans.

  11. Ab Initio Study of the Electron Transfer in an Ionized Stacked Complex of Guanines (United States)

    Cauët, Emilie; Liévin, Jacques


    The charge transfer process in an ionized stacking of two consecutive guanines (G5'G3')+ has been studied by means of state-averaged CASSCF/MRCI and RASSCF/RASPT2 calculations. The ground and two first excited states of the radical cation have been characterized, and the topology of the corresponding potential energy surfaces (PESs) has been studied as a function of all intermolecular geometrical parameters. The results demonstrate that the charge transfer process in (G5'G3')+ is governed by the avoiding crossing between the ground and first excited states of the complex. Relative translation motions of both guanines in their molecular planes are shown to lead to the charge migration between G5' and G3'. Five stationary points (three minima and two saddle points) have been characterized along the reaction path describing the passage of the positive charge from G5' to G3'. The global minimum on the PES is found to correspond to the charge configuration G5'+G3'. The existence of an intermediate minimum along the reaction path has been established, characterizing a structure where the positive charge is equally distributed between the two guanines. The calculated energy profile allowed us to determine the height of the potential energy barrier (7.33 kcal/mol) and to evaluate the electronic coupling at a geometry close to the avoiding crossing (3.6 kcal/mol). Test calculations showed that the topology of the ground state PES of the complex GG+ is qualitatively conserved upon optimization of the intramolecular geometrical parameters of the stationary points.

  12. Effect of 10-T magnetic fields on structural colors in guanine crystals of fish scales (United States)

    Iwasaka, M.; Miyashita, Y.; Kudo, M.; Kurita, S.; Owada, N.


    This work reports the magnetically modulated structural colors in the chromatophore of goldfish scales under static magnetic fields up to 10 T. A fiber optic system for spectroscopy measurements and a CCD microscope were set in the horizontal bore of a 10-T superconducting magnet. One leaf of a fish scale was set in a glass chamber, exposed to visible light from its side direction, and then static magnetic fields were applied perpendicular to the surface of the scale. In addition, an optical fiber for spectroscopy was directed perpendicular to the surface. During the magnetic field sweep-up, the aggregate of guanine thin plates partially showed a rapid light quenching under 0.26 to 2 T; however, most of the thin plates continued to scatter the side-light and showed changing iridescence, which was displayed individually by each guanine plate. For example, an aggregate in the chromatophore exhibited a dynamic change in structural color from white-green to dark blue when the magnetic fields changed from 2 to 10 T. The spectrum profile, which was obtained by the fiber optic system, confirmed the image color changes under magnetic field exposure. Also, a linearly polarized light transmission was measured on fish scales by utilizing an optical polarizer and analyzer. The transmitted polarized light intensities increased in the range of 500-550 nm compared to the intensity at 700 nm during the magnetic field sweep-up. These results indicate that the multi-lamella structure of nano-mirror plates in guanine hexagonal micro-plates exhibit diamagnetically modulated structure changes, and its light interference is affected by strong magnetic fields.

  13. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  14. Direct Experimental Observation of the Low Ionization Potentials of Guanine in Free Oligonucleotides by Using Photoelectron Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Xin; Wang, Xue B.; Vorpagel, Erich R.; Wang, Lai S.


    Photodetachment photoelectron spectroscopy is used to probe the electronic structure of mono-, di-, and trinucleotide anions in the gas phase. A weak and well defined threshold band was observed in the photoelectron spectrum of 2' -deoxyguanosine 5' -mono-phosphate at a much lower ionization energy than the other three mononucleotides. Density function theory calculations revealed that this unique spectral feature is caused by electron-detachment from a ? orbital of the guanine base on 2? ?deoxyguanosine 5? ?monophosphate, whereas the lowest ionization channel for the other three mononucleotides takes place from the phosphate group. This low-energy feature was shown to be a ?fingerprint? in all the spectra of dinucleotides and trinucleotides that contain the guanine base. The current experiment provides direct spectroscopic evidence that the guanine base is the site with the lowest ionization potential in oligonucleotides and DNA and is consistent with the fact that guanine is most susceptible to oxidation to give the guanine cation in DNA damage.

  15. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants. (United States)

    Endo, T; Uratani, B; Freese, E


    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic chart of the purine salvage pathway of Bacillus subtilis. PMID:6408059

  16. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments


    Mantaj, Julia; Jackson, Paul J. M.; Rahman, Khondaker M.; Thurston, David E.


    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal...

  17. Pt(II) and Pd(II) complexes of isocytosine and guanine ligands


    Gupta, Deepali


    The central idea behind the present project was the synthesis of the cationic di- and trinucleotide analogs with a positively charged Pt2+ backbone. The nucleobases can attach to the metal centers either through a) N1 (unsubstituted isocytosine base), via b) N9 (unsubstituted guanine base), c) N7 (9-EtGH) or d) N9 (7-MeGH) These cationic oligonucleotides are expected to be kinetically robust. Moreover, the nucleobases attached to the metal centers are forced in a more or les...

  18. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte


    Dipak Dutta; N. Nagapradeep; Haijin Zhu; Maria Forsyth; Sandeep Verma; Aninda J. Bhattacharyya


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high l...

  19. Solvent effect on the anharmonic vibrational frequencies in guanine-cytosine base pair (United States)

    Bende, A.; Muntean, C. M.


    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by considering the DFT method together with the Polarizable Continuum Model (PCM) using PBE and B3PW91 exchange-correlation functionals and triple-ζ valence basis set. We investigate the importance of anharmonic corrections for the vibrational modes taking into account the solvent effect of the water environment. In particular, the unusual anharmonic effect of the H+ vibration in the case of the Hoogsteen base pair configuration is discussed.

  20. Monitoring one-electron photo-oxidation of guanine in DNA crystals using ultrafast infrared spectroscopy (United States)

    Hall, James P.; Poynton, Fergus E.; Keane, Páraic M.; Gurung, Sarah P.; Brazier, John A.; Cardin, David J.; Winter, Graeme; Gunnlaugsson, Thorfinnur; Sazanovich, Igor V.; Towrie, Michael; Cardin, Christine J.; Kelly, John M.; Quinn, Susan J.


    To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl-DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.

  1. Oxidatively generated damage to the guanine moiety of DNA: Mechanistic aspects and formation in cells

    International Nuclear Information System (INIS)

    Nuclear DNA and other molecules in living systems are continuously exposed to endogenously generated oxygen species. Such species range from the unreactive superoxide radical (O2.-)-the precursor of hydrogen peroxide (H2O2)-to the highly reactive hydroxyl radical (OH.). Exogenous chemical and physical agents, such as ionizing radiation and the UVA component of solar light, can also oxidatively damage both the bases and the 2-deoxyribose moieties of cellular DNA. Over the last two decades, researchers have made major progress in understanding the oxidation degradation pathways of DNA that are most likely to occur from either oxidative metabolism or exposure to various exogenous agents. In the first part of this Account, we describe the mechanistic features of one-electron oxidation reactions of the guanine base in isolated DNA and related model compounds. These reactions illustrate the complexity of the various degradation pathways involved. Then, we briefly survey the analytical methods that can detect low amounts of oxidized bases and nucleosides in cells as they are formed. Recent data on the formation of oxidized guanine residues in cellular DNA following exposure to UVA light, ionizing radiation, and high-intensity UV pulses are also provided. We discuss these chemical reactions in the context of (OH.) radical, singlet oxygen, and two-quantum photoionization processes. (authors)

  2. Reactions of the OOH radical with guanine: Mechanisms of formation of 8-oxoguanine and other products (United States)

    Kumar, Nagendra; Shukla, P. K.; Mishra, P. C.


    The mutagenic product 8-oxoguanine (8-oxoGua) is formed due to intermediacy of peroxyl (OOR) radicals in lipid peroxidation and protein oxidation-induced DNA damage. The mechanisms of these reactions are not yet understood properly. Therefore, in the present study, the mechanisms of formation of 8-oxoGua and other related products due to the reaction of the guanine base of DNA with the hydroperoxyl radical (OOH) were investigated theoretically employing the B3LYP and BHandHLYP hybrid functionals of density functional theory and the polarizable continuum model for solvation. It is found that the reaction of the OOH radical with guanine can occur following seven different mechanisms leading to the formation of various products including 8-oxoGua, its radicals, 5-hydroxy-8-oxoguanine and CO 2. The mechanism that yields 8-oxoGua as an intermediate and 5-hydroxy-8-oxoGua as the final product was found to be energetically most favorable.

  3. Free radical formation in crystals of guanine hydrochloride dihydrate: an ESR and ENDOR study

    International Nuclear Information System (INIS)

    Radiation-induced free radical formation in single crystals of guanine hydrochloride dihydrate has been studied at temperatures between 20 and 300 K using ESR and ENDOR spectroscopy. At low temperatures three radical species are trapped. Two of these are the C8 H-addition radical R1 previously analysed by Alexander and Gordy (1967) and the O6-protonated anion radical R2. The third species (R4) remains unidentified. Upon annealing at 280 K for an extended period the protonated anion R2 transforms into a new radical R3 which exhibits a well-defined hyperfine pattern but still could not be identified unambiguously. Also radical R4 probably transforms into a new radical (R5) upon such treatment. One proton coupling due to R5 was detected. A scheme of radical reactions incorporating these five radicals is proposed. This scheme also suggests that differences in radical formation between the monohydrate and dihydrate crystals of guanine hydrochloride depends upon differences in the hydrogen bonding network. (author)

  4. SynArfGEF is a guanine nucleotide exchange factor for Arf6 and localizes preferentially at post-synaptic specializations of inhibitory synapses


    Fukaya, M; Kamata, A.; Hara, Y; Tamaki, H.; Katsumata, O.; Ito, N.; Takeda, S.; Hata, Y; Suzuki, T.; Watanabe, M.(Niigata University, 950-2181, Niigata, Japan); Harvey, R J; Sakagami, H.


    SynArfGEF, also known as BRAG3 or IQSEC3, is a member of the brefeldin A-resistant Arf-GEF/IQSEC family and was originally identified by screening for mRNA species associated with the post-synaptic density fraction. In this study, we demonstrate that synArfGEF activates Arf6, using Arf pull down and transferrin incorporation assays. Immunohistochemical analysis reveals that synArfGEF is present in somata and dendrites as puncta in close association with inhibitory synapses, whereas immunoelec...

  5. SynArfGEF is a guanine nucleotide exchange factor for Arf6 and localizes preferentially at post-synaptic specializations of inhibitory synapses. (United States)

    Fukaya, Masahiro; Kamata, Akifumi; Hara, Yoshinobu; Tamaki, Hideaki; Katsumata, Osamu; Ito, Naoki; Takeda, Shin'ichi; Hata, Yutaka; Suzuki, Tatsuo; Watanabe, Masahiko; Harvey, Robert J; Sakagami, Hiroyuki


    SynArfGEF, also known as BRAG3 or IQSEC3, is a member of the brefeldin A-resistant Arf-GEF/IQSEC family and was originally identified by screening for mRNA species associated with the post-synaptic density fraction. In this study, we demonstrate that synArfGEF activates Arf6, using Arf pull down and transferrin incorporation assays. Immunohistochemical analysis reveals that synArfGEF is present in somata and dendrites as puncta in close association with inhibitory synapses, whereas immunoelectron microscopic analysis reveals that synArfGEF localizes preferentially at post-synaptic specializations of symmetric synapses. Using yeast two-hybrid and pull down assays, we show that synArfGEF is able to bind utrophin/dystrophin and S-SCAM/MAGI-2 scaffolding proteins that localize at inhibitory synapses. Double immunostaining reveals that synArfGEF co-localizes with dystrophin and S-SCAM in cultured hippocampal neurons and cerebellar cortex, respectively. Both β-dystroglycan and S-SCAM were immunoprecipitated from brain lysates using anti-synArfGEF IgG. Taken together, these findings suggest that synArfGEF functions as a novel regulator of Arf6 at inhibitory synapses and associates with the dystrophin-associated glycoprotein complex and S-SCAM. PMID:21198641

  6. Genetic deficiency of the α subunit of the guanine nucleotide-binding protein G/sub s/ as the molecular basis for Albright hereditary osteodystrophy

    International Nuclear Information System (INIS)

    Patients who have pseudohypoparathyroidism type I associated with Albright hereditary osteodystrophy commonly have a genetic deficiency of the α subunit of the G protein that stimulated adenylyl cyclase αG/sub s/. To discover the molecular mechanism that causes αG/sub s/ deficiency in these patients, the authors examined eight kindreds with one or more members affected with Albright hereditary osteodystrophy or pseudohypoparathyroidism and αG/sub s/ deficiency. In these families, αG/sub s/, deficiency and the Albright hereditary osteodystrophy phenotype were transmitted together in a dominant inheritance pattern. Using a cDNA hybridization probe for αG/sub s/, restriction analysis with several analysis with several endonucleases showed no abnormalities of restriction fragments or gene dosage. RNA blot and dot blot analysis of total RNA from cultured fibroblasts obtained from the patients revealed ∼ 50% reduced mRNA levels for αG/sub s/ in affected members of six of the pedigrees but normal levels in affected members of the two other pedigrees, compared to mRNA levels in fibroblasts from unaffected individuals. By contrast, mRNA levels encoding the α subunit of the G protein that inhibits adenylyl cyclase were not altered. These findings suggest that several molecular mechanisms produce αG/sub s/ deficiency in patients with pseudohypoparathyroidism type Ia and that major gene rearrangements or deletions are not a common cause for αG/sub s/ deficiency in pseudohypoparathyroidism type I

  7. Phytoestrogens regulate mRNA and protein levels of guanine nucleotide-binding protein, beta-1 subunit (GNB1) in MCF-7 cells. (United States)

    Naragoni, Srivatcha; Sankella, Shireesha; Harris, Kinesha; Gray, Wesley G


    Phytoestrogens (PEs) are non-steroidal ligands, which regulate the expression of number of estrogen receptor-dependent genes responsible for a variety of biological processes. Deciphering the molecular mechanism of action of these compounds is of great importance because it would increase our understanding of the role(s) these bioactive chemicals play in prevention and treatment of estrogen-based diseases. In this study, we applied suppression subtractive hybridization (SSH) to identify genes that are regulated by PEs through either the classic nuclear-based estrogen receptor or membrane-based estrogen receptor pathways. SSH, using mRNA from genistein (GE) treated MCF-7 cells as testers, resulted in a significant increase in GNB1 mRNA expression levels as compared with 10 nM 17beta estradiol or the no treatment control. GNB1 mRNA expression was up regulated two- to fivefold following exposure to 100.0 nM GE. Similarly, GNB1 protein expression was up regulated 12- to 14-fold. GE regulation of GNB1 was estrogen receptor-dependent, in the presence of the anti-estrogen ICI-182,780, both GNB1 mRNA and protein expression were inhibited. Analysis of the GNB1 promoter using ChIP assay showed a PE-dependent association of estrogen receptor alpha (ERalpha) and beta (ERbeta) to the GNB1 promoter. This association was specific for ERalpha since association was not observed when the cells were co-incubated with GE and the ERalpha antagonist, ICI. Our data demonstrate that the levels of G-protein, beta-1 subunit are regulated by PEs through an estrogen receptor pathway and further suggest that PEs may control the ratio of alpha-subunit to beta/gamma-subunits of the G-protein complex in cells. J. Cell. Physiol. 219: 584-594, 2009. (c) 2009 Wiley-Liss, Inc. PMID:19170076

  8. Phytoestrogens Regulate mRNA and Protein Levels of Guanine Nucleotide-Binding Protein, Beta-1 Subunit (GNB1) in MCF-7 Cells


    Naragoni, Srivatcha; Sankella, Shireesha; Harris, Kinesha; Gray, Wesley G.


    Phytoestrogens (PEs) are non-steroidal ligands which regulate the expression of number of estrogen receptor-dependent genes responsible for a variety of biological processes. Deciphering the molecular mechanism of action of these compounds is of great importance because it would increase our understanding of the role(s) these bioactive chemicals play in prevention and treatment of estrogen-based diseases. In this study, we applied suppression subtractive hybridization (SSH) to identify genes ...

  9. Antibody of predetermined specificity to a carboxy-terminal region of H-ras gene products inhibits their guanine nucleotide-binding function.


    Srivastava, S. K.; Lacal, J C; Reynolds, S.H.; Aaronson, S A


    The high prevalence of ras oncogenes in human tumors has given increasing impetus to efforts aimed at elucidating the structure and function of their p21 products. To identify functionally important domains of the p21 protein, antibodies were generated against synthetic peptides corresponding to various regions of the protein. Antibodies directed against a synthetic peptide fragment corresponding to amino acid residues 161 to 176 in the carboxy-terminal region of the H-ras-encoded p21 molecul...

  10. A viral protein that blocks Arf1-mediated COP-I assembly by inhibiting the guanine nucleotide exchange factor GBF1.

    NARCIS (Netherlands)

    Wessels, E.; Duijsings, D.M.; Niu, T.K.; Neumann, S.; Oorschot, V.M.J.; Lange, F. de; Lanke, K.H.W.; Klumperman, J.; Henke, A.; Jackson, C.L.; Melchers, W.J.G.; Kuppeveld, F.J.M. van


    Many viruses modify cellular processes for their own benefit. The enterovirus 3A protein inhibits endoplasmic reticulum (ER)-to-Golgi transport, a function previously suggested to be important for viral suppression of immune responses. Here, we show that a virus carrying a 3A protein defective in in

  11. Evidence that GCD6 and GCD7, translational regulators of GCN4, are subunits of the guanine nucleotide exchange factor for eIF-2 in Saccharomyces cerevisiae.


    Bushman, J L; Asuru, A I; Matts, R L; Hinnebusch, A G


    Starvation of the yeast Saccharomyces cerevisiae for an amino acid signals increased translation of GCN4, a transcriptional activator of amino acid biosynthetic genes. We have isolated and characterized the GCD6 and GCD7 genes and shown that their products are required to repress GCN4 translation under nonstarvation conditions. We find that both GCD6 and GCD7 show sequence similarities to components of a high-molecular-weight complex (the GCD complex) that appears to be the yeast equivalent o...

  12. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  13. Sublingual nucleotides and immune response to exercise

    Directory of Open Access Journals (Sweden)

    Ostojic Sergej M


    Full Text Available Abstract Evidence exists regarding the potential role of exogenous nucleotides as regulators of the immune function in physically active humans, yet the potential use of nucleotides has been hindered by their low bioavailability after oral administration. We conducted a double-blind, placebo-controlled, randomized trial to assess the effect of sublingual nucleotides (50 mg/day on salivary and serum immunity indicators as compared to placebo, both administered to healthy males aged 20 to 25 years for 14 days. Sublingual administration of nucleotides for 14 days increased serum immunoglobulin A, natural killer cells count and cytotoxic activity, and offset the post-exercise drop of salivary immunoglobulins and lactoferrin (P  0.05. It seems that sublingual administration of nucleotides for two weeks considerably affected immune function in healthy males.

  14. Mutagenicity associated with O6-methylguanine-DNA damage and mechanism of nucleotide flipping by AGT during repair (United States)

    Jena, N. R.; Bansal, Manju


    Methylated guanine damage at O6 position (i.e. O6MG) is dangerous due to its mutagenic and carcinogenic character that often gives rise to G:C-A:T mutation. However, the reason for this mutagenicity is not known precisely and has been a matter of controversy. Further, although it is known that O6-alkylguanine-DNA alkyltransferase (AGT) repairs O6MG paired with cytosine in DNA, the complete mechanism of target recognition and repair is not known completely. All these aspects of DNA damage and repair have been addressed here by employing high level density functional theory in gas phase and aqueous medium. It is found that the actual cause of O6MG mediated mutation may arise due to the fact that DNA polymerases incorporate thymine opposite to O6MG, misreading the resulting O6MG:T complex as an A:T base pair due to their analogous binding energies and structural alignments. It is further revealed that AGT mediated nucleotide flipping occurs in two successive steps. The intercalation of the finger residue Arg128 into the DNA double helix and its interaction with the O6MG:C base pair followed by rotation of the O6MG nucleotide are found to be crucial for the damage recognition and nucleotide flipping.

  15. Mutagenicity associated with O6-methylguanine-DNA damage and mechanism of nucleotide flipping by AGT during repair

    International Nuclear Information System (INIS)

    Methylated guanine damage at O6 position (i.e. O6MG) is dangerous due to its mutagenic and carcinogenic character that often gives rise to G:C–A:T mutation. However, the reason for this mutagenicity is not known precisely and has been a matter of controversy. Further, although it is known that O6-alkylguanine-DNA alkyltransferase (AGT) repairs O6MG paired with cytosine in DNA, the complete mechanism of target recognition and repair is not known completely. All these aspects of DNA damage and repair have been addressed here by employing high level density functional theory in gas phase and aqueous medium. It is found that the actual cause of O6MG mediated mutation may arise due to the fact that DNA polymerases incorporate thymine opposite to O6MG, misreading the resulting O6MG:T complex as an A:T base pair due to their analogous binding energies and structural alignments. It is further revealed that AGT mediated nucleotide flipping occurs in two successive steps. The intercalation of the finger residue Arg128 into the DNA double helix and its interaction with the O6MG:C base pair followed by rotation of the O6MG nucleotide are found to be crucial for the damage recognition and nucleotide flipping

  16. Structural Basis for Bulky-Adduct DNA-Lesion Recognition by the Nucleotide Excision Repair Protein Rad14. (United States)

    Simon, Nina; Ebert, Charlotte; Schneider, Sabine


    Heterocyclic aromatic amines react with purine bases and result in bulky DNA adducts that cause mutations. Such structurally diverse lesions are substrates for the nucleotide excision repair (NER). It is thought that the NER machinery recognises and verifies distorted DNA conformations, also involving the xeroderma pigmentosum group A and C proteins (XPA, XPC) that act as a scaffold between the DNA substrate and several other NER proteins. Here we present the synthesis of DNA molecules containing the polycyclic, aromatic amine C8-guanine lesions acetylaminophenyl, acetylaminonaphthyl, acetylaminoanthryl, and acetylaminopyrenyl, as well as their crystal structures in complex with the yeast XPA homologue Rad14. This work further substantiates the indirect lesion-detection mechanism employed by the NER system that recognises destabilised and deformable DNA structures. PMID:27223336

  17. Bacillus subtilis guanine deaminase is encoded by the yknA gene and is induced during growth with purines as the nitrogen source

    DEFF Research Database (Denmark)

    Nygaard, Per; Bedsted, Søren; Andersen, Kasper A.K.;


    Bacillus subtilis can utilize the purine bases adenine, hypoxanthine and xanthine as nitrogen sources. The utilization of guanine as a nitrogen source is reported here. The first step is the deamination of guanine to xanthine catalysed by guanine deaminase (GDEase). To isolate mutants defective in...

  18. The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best. (United States)

    Zaccaria, F; Paragi, G; Fonseca Guerra, C


    The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity. PMID:27185388

  19. Thermodynamic potential for the abiotic synthesis of Adenine, Cytosine, Guanine, Thymine, Uracil, Ribose, and Deoxyribose in hydrothermal systems


    Larowe, D. E.; Regnier, P.


    The thermodynamic potential for the abiotic synthesis of the five common nucleobases (adenine, cytosine, guanine, thymine, and uracil) and two monosaccharides (ribose and deoxyribose) from formaldehyde and hydrogen cyanide has been quantified under temperature, pressure, and bulk composition conditions that are representative of hydrothermal systems. The activities of the precursor molecules (formaldehyde and hydrogen cyanide) required to evaluate the thermodynamics of biomolecule synthesis w...

  20. Herpes simplex virus-mediated human hypoxanthine-guanine phosphoribosyltransferase gene transfer into neuronal cells

    Energy Technology Data Exchange (ETDEWEB)

    Palella, T.D.; Silverman, L.J.; Schroll, C.T.; Homa, F.L.; Levine, M.; Kelley, W.N.


    The virtually complete deficiency of the purine salvage enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT) results in a devastating neurological disease, Lesch-Nyhan syndrome. Transfer of the HPRT gene into fibroblasts and lymphoblasts in vitro and into hematopoietic cells in vivo has been accomplished by other groups with retroviral-derived vectors. It appears to be necessary, however, to transfer the HPRT gene into neuronal cells to correct the neurological dysfunction of this disorder. The neurotropic virus herpes simplex virus type 1 has features that make it suitable for use as a vector to transfer the HPRT gene into neuronal tissue. This report describes the isolation of an HPRT-deficient rat neuroma cell line, designated B103-4C, and the construction of a recombinant herpes simplex virus type 1 that contained human HPRT cDNA. These recombinant viruses were used to infect B103-4C cells. Infected cells expressed HPRT activity which was human in origin.


    Directory of Open Access Journals (Sweden)

    GIORGIO Selma


    Full Text Available In this study we investigated the effect of 8-Bromoguanosine, an immunostimulatory compound, on the cytotoxicity of macrophages against Leishmania amazonensis in an in vitro system. The results showed that macrophages treated with 8-Bromoguanosine before or after infection are capable to reduce parasite load, as monitored by the number of amastigotes per macrophage and the percentage of infected cells (i.e. phagocytic index. Since 8-Bromoguanosine was not directly toxic to the promastigotes, it was concluded that the ribonucleoside induced macrophage activation. Presumably, 8-Bromoguanosine primed macrophages by inducing interferon alpha and beta which ultimately led to L. amazonensis amastigote killing. The results suggest that guanine ribonucleosides may be useful to treat infections with intracellular pathogens.

  2. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I;


    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminate...

  3. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)


    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  4. Guanine-based purines modulate the effect of L-NAME on learning and memory in rats. (United States)

    Giuliani, P; Buccella, S; Ballerini, P; Ciccarelli, R; D'Alimonte, I; Cicchitti, S; Petragnani, N; Natale, S; Iacovella, G; Caciagli, F; Di Iorio, P


    Guanosine has been reported to exert neuroprotective effects. We recently reported that, following intraperitoneal (i.p.) injection to rats, it resulted to be widely distributed. Its metabolic product guanine also rapidly increased in all the tissues, including brain, after i.p. injection of guanosine and consistently we found a significant enzymatic activity of a soluble purine nucleoside phosphorylase in the plasma of the treated animals. In this study the effect of per os administration of guanosine or guanine to rats submitted to passive avoidance task has been evaluated. Guanosine (4 and 8 mg/kg) administered pretraining impaired retention in the passive avoidance task and was unable to prevent the amnesic effect caused by 100 mg/kg N-omega-nitro-l-arginine methyl ester (L-NAME), an inhibitor of the nitric oxide synthase (NOS) known to reduce the capability of treated animals to acquire or retain informations in several learning tasks. On the contrary, guanine (4 and 8 mg/kg), which per se did not modify the latency to step-trough in the passive avoidance task, when administered pretraining 15 min before L-NAME prevented, in a dose dependent manner, the amnesic effect of the NOS inhibitor. Moreover the nucleobase was able to rescue the memory trace also when administered after training. Neither guanosine nor guanine had effects on locomotor activity. These results indicate that guanine can exert important biological activities which may be different from those mediated by its precursor guanosine, thus this evenience should be taken into account when the biological effects of guanosine are evaluated. PMID:23241935

  5. In vitro incorporation of LNA nucleotides. (United States)

    Veedu, Rakesh N; Vester, Birte; Wengel, Jesper


    An LNA modified nucleoside triphosphate 1 was synthesized in order to investigate its potential to act as substrate for DNA strand synthesis by polymerases. Primer extension assays for the incorporation experiments revealed that Phusion High Fidelity DNA polymerase is an efficient enzyme for incorporation of the LNA nucleotide and for extending strand to full length. It was also observed that pfu DNA polymerase could incorporate the LNA nucleotide but it failed to extend the strand to a full length product. PMID:18058567

  6. Analysis of Sequence Conservation at Nucleotide Resolution


    Asthana, Saurabh; Roytberg, Mikhail; Stamatoyannopoulos, John; Sunyaev, Shamil R.


    One of the major goals of comparative genomics is to understand the evolutionary history of each nucleotide in the human genome sequence, and the degree to which it is under selective pressure. Ascertainment of selective constraint at nucleotide resolution is particularly important for predicting the functional significance of human genetic variation and for analyzing the sequence substructure of cis-regulatory sequences and other functional elements. Current methods for analysis of sequence ...

  7. Regulation of mammalian nucleotide metabolism and biosynthesis. (United States)

    Lane, Andrew N; Fan, Teresa W-M


    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer. PMID:25628363

  8. Acyclic nucleoside phosphonates as inhibitors of mycobacterium tuberculosis hypoxanthine-guanine phosphoribosyltransferase: Crystal structures and antituberculosis activity

    Czech Academy of Sciences Publication Activity Database

    Hocková, Dana; Eng, W. S.; Špaček, Petr; Janeba, Zlatko; West, N. P.; Woods, K.; Naesens, L. M. J.; Keough, D. T.; Guddat, L. W.

    Newport: Gordon Research Conference, 2015. [Nucleosides, Nucleotides & Oligonucleotides. Gordon Research Conference 2015. 28.06.2015-03.07.2015, Newport] Institutional support: RVO:61388963 Keywords : nucleotide analogues * enzyme inhibitors * tuberculosis Subject RIV: CC - Organic Chemistry

  9. Complex formation of cadmium with sugar residues, nucleobases, phosphates, nucleotides, and nucleic acids. (United States)

    Sigel, Roland K O; Skilandat, Miriam; Sigel, Astrid; Operschall, Bert P; Sigel, Helmut


    Cadmium(II), commonly classified as a relatively soft metal ion, prefers indeed aromatic-nitrogen sites (e.g., N7 of purines) over oxygen sites (like sugar-hydroxyl groups). However, matters are not that simple, though it is true that the affinity of Cd(2+) towards ribose-hydroxyl groups is very small; yet, a correct orientation brought about by a suitable primary binding site and a reduced solvent polarity, as it is expected to occur in a folded nucleic acid, may facilitate metal ion-hydroxyl group binding very effectively. Cd(2+) prefers the guanine(N7) over the adenine(N7), mainly because of the steric hindrance of the (C6)NH(2) group in the adenine residue. This Cd(2+)-(N7) interaction in a guanine moiety leads to a significant acidification of the (N1)H meaning that the deprotonation reaction occurs now in the physiological pH range. N3 of the cytosine residue, together with the neighboring (C2)O, is also a remarkable Cd(2+) binding site, though replacement of (C2)O by (C2)S enhances the affinity towards Cd(2+) dramatically, giving in addition rise to the deprotonation of the (C4)NH(2) group. The phosphodiester bridge is only a weak binding site but the affinity increases further from the mono- to the di- and the triphosphate. The same also holds for the corresponding nucleotides. Complex stability of the pyrimidine-nucleotides is solely determined by the coordination tendency of the phosphate group(s), whereas in the case of purine-nucleotides macrochelate formation takes place by the interaction of the phosphate-coordinated Cd(2+) with N7. The extents of the formation degrees of these chelates are summarized and the effect of a non-bridging sulfur atom in a thiophosphate group (versus a normal phosphate group) is considered. Mixed ligand complexes containing a nucleotide and a further mono- or bidentate ligand are covered and it is concluded that in these species N7 is released from the coordination sphere of Cd(2+). In the case that the other ligand

  10. Proofreading of misincorporated nucleotides in DNA transcription. (United States)

    Voliotis, Margaritis; Cohen, Netta; Molina-París, Carmen; Liverpool, Tanniemola B


    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighboring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction. PMID:22643861

  11. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    NARCIS (Netherlands)

    Wolters, Justina. C.; Roelfes, Johannes; Poolman, Bert


    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  12. Highly Sensitive Bacteria Quantification Using Immunomagnetic Separation and Electrochemical Detection of Guanine-Labeled Secondary Beads

    Directory of Open Access Journals (Sweden)

    Harikrishnan Jayamohan


    Full Text Available In this paper, we report the ultra-sensitive indirect electrochemical detection of E. coli O157:H7 using antibody functionalized primary (magnetic beads for capture and polyguanine (polyG oligonucleotide functionalized secondary (polystyrene beads as an electrochemical tag. Vacuum filtration in combination with E. coli O157:H7 specific antibody modified magnetic beads were used for extraction of E. coli O157:H7 from 100 mL samples. The magnetic bead conjugated E. coli O157:H7 cells were then attached to polyG functionalized secondary beads to form a sandwich complex (magnetic bead/E. coli secondary bead. While the use of magnetic beads for immuno-based capture is well characterized, the use of oligonucleotide functionalized secondary beads helps combine amplification and potential multiplexing into the system. The antibody functionalized secondary beads can be easily modified with a different antibody to detect other pathogens from the same sample and enable potential multiplexing. The polyGs on the secondary beads enable signal amplification up to 10\\(^{8}\\ guanine tags per secondary bead (\\(7.5\\times10^{6}\\ biotin-FITC per secondary bead, 20 guanines per oligonucleotide bound to the target (E. coli. A single-stranded DNA probe functionalized reduced graphene oxide modified glassy carbon electrode was used to bind the polyGs on the secondary beads. Fluorescent imaging was performed to confirm the hybridization of the complex to the electrode surface. Differential pulse voltammetry (DPV was used to quantify the amount of polyG involved in the hybridization event with tris(2,2'-bipyridineruthenium(II (Ru(bpy\\(_{3}^{2+}\\ as the mediator. The amount of polyG signal can be correlated to the amount of E. coli O157:H7 in the sample. The method was able to detect concentrations of E. coli O157:H7 down to 3 CFU/100 mL, which is 67 times lower than the most sensitive technique reported in literature. The signal to noise ratio for this work was 3

  13. Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

    Directory of Open Access Journals (Sweden)

    Manjula Pandey


    Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

  14. Role of cysteine residues in the redox-regulated oligomerization and nucleotide binding to EhRabX3. (United States)

    Chandra, Mintu; Datta, Sunando


    The enteric protozoan parasite, Entamoeba histolytica, an etiological agent of amebiasis, is involved in the adhesion and destruction of human tissues. Worldwide, the parasite causes about 50 million cases of amebiasis and 100,000 deaths annually. EhRabX3, a unique amoebic Rab GTPase with tandem G-domains, possesses an unusually large number of cysteine residues in its N-terminal domain. Crystal structure of EhRabX3 revealed an intra-molecular disulfide bond between C39 and C163 which is critical for maintaining the 3-dimensional architecture and biochemical function of this protein. The remaining six cysteine residues were found to be surface exposed and predicted to be involved in inter-molecular disulfide bonds. In the current study, using biophysical and mutational approaches, we have investigated the role of the cysteine residues in the assembly of EhRabX3 oligomer. The self-association of EhRabX3 is found to be redox sensitive, in vitro. Furthermore, the oligomeric conformation of EhRabX3 failed to bind and exchange the guanine nucleotide, indicating structural re-organization of the active site. Altogether, our results provide valuable insights into the redox-dependent oligomerization of EhRabX3 and its implication on nucleotide binding. PMID:27485554

  15. Pyrrolidine analogues of nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Rejman, Dominik; Pohl, Radek; Kovačková, Soňa; Kočalka, Petr; Švenková, Alžběta; Šanderová, Hana; Krásný, Libor; Rosenberg, Ivan

    -, č. 52 (2008), s. 577-578. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MZd NR9138 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50200510; CEZ:AV0Z50520514 Keywords : pyrrolidine * nucleoside * nucleotide Subject RIV: CC - Organic Chemistry

  16. Dehydromonocrotaline generates sequence-selective N-7 guanine alkylation and heat and alkali stable multiple fragment DNA crosslinks.


    Pereira, T N; Webb, R I; Reilly, P E; Seawright, A. A.; Prakash, A S


    Monocrotaline is a pyrrolizidine alkaloid known to cause toxicity in humans and animals. Its mechanism of biological action is still unclear although DNA crosslinking has been suggested to a play a role in its activity. In this study we found that an active metabolite of monocrotaline, dehydromonocrotaline (DHM), alkylates guanines at the N7 position of DNA with a preference for 5'-GG and 5'-GA sequences. In addition, it generates piperidine- and heat-resistant multiple DNA crosslinks, as con...

  17. Direct experimental observation of the low ionization potentials of guanine in free oligonucleotides by using photoelectron spectroscopy


    Yang, Xin; Wang, Xue-Bin; Vorpagel, Erich R.; Wang, Lai-Sheng


    Photodetachment photoelectron spectroscopy is used to probe the electronic structure of mono-, di-, and trinucleotide anions in the gas phase. A weak and well defined threshold band was observed in the photoelectron spectrum of 2′-deoxyguanosine 5′-monophosphate at a much lower ionization energy than the other three mononucleotides. Density function theory calculations revealed that this unique spectral feature is caused by electron-detachment from a π orbital of the guanine base on 2′-deoxyg...

  18. Role for DNA Polymerase κ in the Processing of N2-N2-Guanine Interstrand Cross-links*S⃞


    Minko, Irina G.; Harbut, Michael B.; Kozekov, Ivan D.; Kozekova, Albena; Jakobs, Petra M.; Olson, Susan B; Moses, Robb E.; Harris, Thomas M.; Rizzo, Carmelo J.; Lloyd, R. Stephen


    Although there exists compelling genetic evidence for a homologous recombination-independent pathway for repair of interstrand cross-links (ICLs) involving translesion synthesis (TLS), biochemical support for this model is lacking. To identify DNA polymerases that may function in TLS past ICLs, oligodeoxynucleotides were synthesized containing site-specific ICLs in which the linkage was between N2-guanines, similar to cross-links formed by mitomycin C and enals. Here, ...

  19. Deletion of one nucleotide within the homonucleotide tract present in the hsdS gene alters the DNA sequence specificity of type I restriction-modification system NgoAV. (United States)

    Adamczyk-Poplawska, Monika; Lower, Michal; Piekarowicz, Andrzej


    As a result of a frameshift mutation, the hsdS locus of the NgoAV type IC restriction and modification (RM) system comprises two genes, hsdS(NgoAV1) and hsdS(NgoAV2). The specificity subunit, HsdS(NgoAV), the product of the hsdS(NgoAV1) gene, is a naturally truncated form of an archetypal specificity subunit (208 N-terminal amino acids instead of 410). The presence of a homonucleotide tract of seven guanines (poly[G]) at the 3' end of the hsdS(NgoAV1) gene makes the NgoAV system a strong candidate for phase variation, i.e., stochastic addition or reduction in the guanine number. We have constructed mutants with 6 guanines instead of 7 and demonstrated that the deletion of a single nucleotide within the 3' end of the hsdS(NgoAV1) gene restored the fusion between the hsdS(NgoAV1) and hsdS(NgoAV2) genes. We have demonstrated that such a contraction of the homonucleotide tract may occur in vivo: in a Neisseria gonorrhoeae population, a minor subpopulation of cells appeared to have only 6 guanines at the 3' end of the hsdS(NgoAV1) gene. Escherichia coli cells carrying the fused gene and expressing the NgoAVΔ RM system were able to restrict λ phage at a level comparable to that for the wild-type NgoAV system. NgoAV recognizes the quasipalindromic interrupted sequence 5'-GCA(N(8))TGC-3' and methylates both strands. NgoAVΔ recognizes DNA sequences 5'-GCA(N(7))GTCA-3' and 5'-GCA(N(7))CTCA-3', although the latter sequence is methylated only on the complementary strand within the 5'-CTCA-3' region of the second recognition target sequence. PMID:21984785

  20. Deletion of One Nucleotide within the Homonucleotide Tract Present in the hsdS Gene Alters the DNA Sequence Specificity of Type I Restriction-Modification System NgoAV▿† (United States)

    Adamczyk-Poplawska, Monika; Lower, Michal; Piekarowicz, Andrzej


    As a result of a frameshift mutation, the hsdS locus of the NgoAV type IC restriction and modification (RM) system comprises two genes, hsdSNgoAV1 and hsdSNgoAV2. The specificity subunit, HsdSNgoAV, the product of the hsdSNgoAV1 gene, is a naturally truncated form of an archetypal specificity subunit (208 N-terminal amino acids instead of 410). The presence of a homonucleotide tract of seven guanines (poly[G]) at the 3′ end of the hsdSNgoAV1 gene makes the NgoAV system a strong candidate for phase variation, i.e., stochastic addition or reduction in the guanine number. We have constructed mutants with 6 guanines instead of 7 and demonstrated that the deletion of a single nucleotide within the 3′ end of the hsdSNgoAV1 gene restored the fusion between the hsdSNgoAV1 and hsdSNgoAV2 genes. We have demonstrated that such a contraction of the homonucleotide tract may occur in vivo: in a Neisseria gonorrhoeae population, a minor subpopulation of cells appeared to have only 6 guanines at the 3′ end of the hsdSNgoAV1 gene. Escherichia coli cells carrying the fused gene and expressing the NgoAVΔ RM system were able to restrict λ phage at a level comparable to that for the wild-type NgoAV system. NgoAV recognizes the quasipalindromic interrupted sequence 5′-GCA(N8)TGC-3′ and methylates both strands. NgoAVΔ recognizes DNA sequences 5′-GCA(N7)GTCA-3′ and 5′-GCA(N7)CTCA-3′, although the latter sequence is methylated only on the complementary strand within the 5′-CTCA-3′ region of the second recognition target sequence. PMID:21984785

  1. Electrodeposition of Prussian Blue Nanoparticles on Electro- chemically Reduced Graphene Oxide and Synergistically Elec- trocatalytic Activity toward Guanine

    Institute of Scientific and Technical Information of China (English)

    杨涛; 关茜; 马苏艳; 李乾和; 焦奎


    In this paper, a simple and reliable fabrication method about electrochemically reduced graphene oxide (ERGNO)-prussian blue (PB) nanocomposite was proposed for determination of guanine. Due to its unique struc- tural, physical and chemical properties, ERGNO, which was fabricated on the carbon paste electrode (CPE) before- hand through electrochemical reduction of graphene oxide, was selected as a compatible precursor for next-step PB electrodeposition. Electrochemical behaviors of the resulted PB/ERGNO/CPE were investigated by electrochemical impedance spectroscopy (EIS), cyclic voltammetry (CV) and differential pulse voltammetry (DPV). The electro- chemical results showed that PB/ERGNO/CPE exhibited good electrochemical performances. The electrocatalytic results of guanine further illustrated that graphene prompted the electrocatalytie ability of PB via the redox shift between PB and prussian yellow (PY) in the potential range from 0.5 to 1.2 V, which has not been widely adopted in the PB based electrochemical sensors. The detection limit of guanine could be calculated to be 1.0 × 10^-8 mol/L. It means this PB/ERGNO/CPE platform is quite sensitive and can be readily applied in biosensor field.

  2. Mutagenic Effects Induced by the Attack of NO2 Radical to the Guanine-Cytosine Base Pair (United States)

    Cerón-Carrasco, José Pedro; Requena, Alberto; Zúñiga, José; Jacquemin, Denis


    We investigate the attack of the nitrogen dioxide radical (NO2) to the guanine-cytosine (GC) base pair and the subsequent tautomeric reactions able to induce mutations, by means of density functional theory (DFT) calculations. The conducted simulations allow us to identify the most reactive sites of the GC base pair. Indeed, the computed relative energies demonstrate that the addition of the NO2 radical to the C8 position of the guanine base forms to the most stable adduct. Although the initial adducts might evolve to non-canonical structures via inter-base hydrogen bonds rearrangements, the probability for the proton exchange to occur lies in the same range as that observed for undamaged DNA. As a result, tautomeric errors in NO2-attacked DNA arises at the same rate as in canonical DNA, with no macroscopic impact on the overall stability of DNA. The potential mutagenic effects of the GC-NO2 radical adducts likely involve side reactions, e.g., the GC deprotonation to the solvent, rather than proton exchange between guanine and cytosine basis.

  3. Promoter hypermethylation of methyl guanine methyl transferase in lung cancer patients of Kashmir valley

    Directory of Open Access Journals (Sweden)

    Sheikh Mohd Shaffi


    Full Text Available Context: MGMT, is a DNA repair protein involved in removing the mutagenic and cytotoxic adducts from O 6 -guanine in DNA, which otherwise can lead to the mutation, primarily due to the tendency of O 6 -methylguanine to pair with thymine during replication, resulting in the conversion of GC to AT pairs, if left unrepaired due to epigenetic silencing of its promoter. Aims: To study the status of MGMT in Kashmiri lung cancer patients Materials and Methods: In this study we analyzed the promoter status of this gene in 50 lung cancer patients using methylation specific-PCR and confirmed by restriction digestion. Results: The promoter was found to be methylated in 52% of the cases, more in male patients (54.2% than in female patients (46.6%. When stratified according to smoking status, current smokers showed a strong association with methylation (OR = 6.0, P = 0.005 than former and never smokers. We also compared the promoter methylation of the MGMT gene with pesticide exposure, and found that patients with pesticide exposure had statistically significant (OR = 7.7 and P = 0.003 association with promoter methylation. Conclusions: Our results indicate that MGMT promoter methylation is associated with smoking exposure and there appears to be an association of MGMT promoter methylation with pesticide exposure in Kashmiri lung cancer patients.

  4. Synthesis and Biological Properties of Caffeic Acid-PNA Dimers Containing Guanine

    Directory of Open Access Journals (Sweden)

    Antonio Fiorentino


    Full Text Available Caffeic acid (CA; 3,4-dihydroxycinnamic acid is endowed with high antioxidant activity. CA derivatives (such as amides have gained a lot of attention due to their antioxidative, antitumor and antimicrobial properties as well as stable characteristics. Caffeoyl-peptide derivatives showed different antioxidant activity depending on the type and the sequence of amino acid used. For these reasons, we decided to combine CA with Peptide Nucleic Acid (PNA to test whether the new PNA-CA amide derivatives would result in an improvement or gain of CA’s biological (i.e., antioxidant, cytotoxic, cytoprotective properties. We performed the synthesis and characterization of seven dimer conjugates with various combinations of nucleic acid bases and focused NMR studies on the model compound ga-CA dimer. We demonstrate that PNA dimers containing guanine conjugated to CA exhibited different biological activities depending on composition and sequence of the nucleobases. The dimer ag-CA protected HepG2, SK-B-NE(2, and C6 cells from a cytotoxic dose of hydrogen peroxide (H2O2.

  5. Nitrogen K-edge X-ray absorption near edge structure (XANES) spectra of purine-containing nucleotides in aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Shimada, Hiroyuki; Fukao, Taishi; Minami, Hirotake; Ukai, Masatoshi [Department of Applied Physics, Tokyo University of Agriculture and Technology, Koganei-shi, Tokyo 184-8588 (Japan); Fujii, Kentaro; Yokoya, Akinari [Advanced Science Research Center, Japan Atomic Energy Agency, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Fukuda, Yoshihiro; Saitoh, Yuji [Synchrotron Radiation Research Center, Japan Atomic Energy Agency, Sayo-gun, Hyougo 679-5148 (Japan)


    The N K-edge X-ray absorption near edge structure (XANES) spectra of the purine-containing nucleotide, guanosine 5{sup ′}-monophosphate (GMP), in aqueous solution are measured under various pH conditions. The spectra show characteristic peaks, which originate from resonant excitations of N 1s electrons to π* orbitals inside the guanine moiety of GMP. The relative intensities of these peaks depend on the pH values of the solution. The pH dependence is explained by the core-level shift of N atoms at specific sites caused by protonation and deprotonation. The experimental spectra are compared with theoretical spectra calculated by using density functional theory for GMP and the other purine-containing nucleotides, adenosine 5{sup ′}-monophosphate, and adenosine 5{sup ′}-triphosphate. The N K-edge XANES spectra for all of these nucleotides are classified by the numbers of N atoms with particular chemical bonding characteristics in the purine moiety.

  6. Hybridization chain reaction modulated DNA-hosted silver nanoclusters for fluorescent identification of single nucleotide polymorphisms in the let-7 miRNA family. (United States)

    Qiu, Xue; Wang, Pei; Cao, Zhijuan


    A simple microRNA (miRNA) detection system based on hybridization chain reaction (HCR) has been developed using highly fluorescent DNA-hosted silver (Ag) nanoclusters. In this assay, a new type of hairpin DNA probe (MB1) containing a poly-cytosine nucleotide loop is designed and used as one of the HCR monomers, which is also demonstrated to be an ideal template for in situ synthesis of highly fluorescent Ag nanoclusters. Correspondingly, another HCR monomer (MB2) contains a poly-guanine nucleotide sticky end. Two monomers are stable to coexist in solution until the introduction of the initiator strand (let-7a) triggers a cascade of hybridization events that yields nicked double helices analogous. By taking advantage of HCR, a small amount of let-7a leads to the conformational change of a large amount of MB1, which results in the decrease of fluorescent signal greatly. Overall, this label-free, enzyme-free method allows the sensitive detection of let-7a with high specificity towards single nucleotide polymorphisms in the let-7 miRNA family. In addition, the simple "mix and measure" assay can be extended to detect other types of targets upon slight modification, and thus provides a tool for the early diagnosis and risk assessment of malignancy. PMID:24836018

  7. Measurements of single nucleotide electronic states as nanoelectronic fingerprints for identification of DNA nucleobases, their protonated and unprotonated states, isomers, and tautomers. (United States)

    Ribot, Josep Casamada; Chatterjee, Anushree; Nagpal, Prashant


    Several nanoelectronic techniques have been explored to distinguish the sequence of nucleic acids in DNA macromolecules. Identification of unique electronic signatures using nanopore conductance, tunneling spectroscopy, or other nanoelectronic techniques depends on electronic states of the DNA nucleotides. While several experimental and computational studies have focused on interaction of nucleobases with different substrates, the effect of nucleic acid biochemistry on its electronic properties has been largely unexplored. Here, we present correlated measurements of frontier molecular orbitals and higher-order electronic states for four DNA nucleobases (adenine, cytosine, thymine, and guanine), and first-principle quantum chemical density functional theoretical (DFT) computations. Using different pH conditions in our experiments, we show that small changes in the biochemical state of these nucleic acids strongly affect the intrinsic electronic structure, measured using scanning tunneling spectroscopy (STS). In our experimental measurements and computations, significant differences were observed between the position of frontier orbitals and higher-energy states between protonated and unprotonated nucleic acids, isomers, and different keto-enol tautomer's formed in these nucleotides, leading to their facile identification. Furthermore, we show unique "electronic fingerprints" for all nucleotides (A, G, T, C) using STS, with most distinct states identified at acidic pH. These results can have important implications for identification of nucleic acid sequences in DNA molecules using a high-throughput nanoelectronic identification technique. PMID:25793310

  8. The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.


    Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.

  9. Pre-thymic somatic mutation leads to high mutant frequency at hypoxanthine-guanine phosphoribosyltransferase gene

    Energy Technology Data Exchange (ETDEWEB)

    Jett, J. [Lawrence Livermore National Lab., CA (United States)


    While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.

  10. The use of photosensitizers to selectively generate radiation-induced guanine decomposition products

    Energy Technology Data Exchange (ETDEWEB)

    Buchko, G.W.; Weinfeld, M. [Cross Cancer Inst., Edmonton, Alberta (Canada). Dept. of Radiobiology; Berger, M.; Cadet, J.; Raoul, S. [Centre d`Etudes Nucleaires de Grenoble (France). Lab. des Lesions des Acides Nucleiques


    Free radicals generated in vivo through biological processes, including photosensitization, may lead to oxidative damage to cellular DNA. Such photosensitizer-mediated damage to DNA occurs through two principal competitive mechanisms, labeled type 1 and type 2, depending on the process by which an excited photosensitizer decays from its triplet state back to the ground state. Type 1 mechanisms involve initial electron or hydrogen transfer by the excited photosensitizer to, or from, the substrate (DNA) to generate free radicals. Type 2 mechanisms involve the initial generation of singlet oxygen by the excited photosensitizer which subsequently reacts with the substrate to generate unstable peroxidic intermediates. Although in both cases the primary target in DNA is the guanine base, the two mechanisms generate a different set of photoproducts. The lesions 2-amino-5-[(3,5-di-O-acetyl-2-deoxy-{beta}-D-erythro-pentofuran-osyl)-amino]-4H-imidazol-4-one and its major decomposition product, 2,2-diamino-4-[(3,5-di-O-acetyl-2-deoxy-{beta}-D-erythro-pentofuranosyl)amino]-5(2H)-oxazolone, have previously been identified and characterized following the exposure of 3{prime},5{prime}-di-O-acetyl-2{prime}-deoxyguanosine to OH radicals in aerated aqueous solution. In this report the authors more fully characterize 2-amino-5-[(2-deoxy-{beta}-D-erythropentofuranosyl)amino]-4H-imidazol-4-one (dIZ) and its major decomposition product, 2,2-diamino-4-[(2-deoxy-{beta}-D-erythro-pentofuranosyl)amino]-5(2H)-oxazolone (dZ), obtained from the {gamma}-radiolysis of the non-acetyled nucleoside, 2{prime}-deoxyguanosine (dG), in aerated aqueous solution.

  11. Pyrrolidine nucleotides conformationally constrained via hydrogen bonding

    Czech Academy of Sciences Publication Activity Database

    Pohl, Radek; Poštová Slavětínská, Lenka; Rejman, Dominik

    Praha : Institute of Organic Chemistry and Biochemistry AS CR, v. v. i, 2014 - (Hocek, M.), s. 352-353 ISBN 978-80-86241-50-0. - (Collection Symposium Series. 14). [Symposium on Chemistry of Nucleic Acid Components /16./. Český Krumlov (CZ), 08.06.2014-13.06.2014] R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : pyrrolidine nucleotides * PMEA * hydrogen bond Subject RIV: CC - Organic Chemistry

  12. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek


    Roč. 10, Aug 22 (2014), s. 1967-1980. ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014

  13. Mitochondrial Adenine Nucleotide Transport and Cardioprotection


    Das, Samarjit; Steenbergen, Charles


    Mitochondria are highly metabolically active cell organelles that not only act as the powerhouse of the cell by supplying energy through ATP production, but also play a destructive role by initiating cell death pathways. Growing evidence recognizes that mitochondrial dysfunction is one of the major causes of cardiovascular disease. Under de-energized conditions, slowing of adenine nucleotide transport in and out of the mitochondria significantly attenuates myocardial ischemia-reperfusion inju...

  14. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung


    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  15. Nucleotide Manipulatives to Illustrate the Central Dogma†


    Sonja B. Yung; Todd P. Primm


    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  16. Visualization of cyclic nucleotide dynamics in neurons

    Directory of Open Access Journals (Sweden)

    Kirill eGorshkov


    Full Text Available The second messengers cAMP and cGMP transduce many neuromodulatory signals from hormones and neurotransmitters into specific functional outputs. Their production, degradation and signaling are spatiotemporally regulated to achieve high specificity in signal transduction. The development of genetically encodable fluorescent biosensors has provided researchers with useful tools to study these versatile second messengers and their downstream effectors with unparalleled spatial and temporal resolution in cultured cells and living animals. In this review, we introduce the general design of these fluorescent biosensors and describe several of them in more detail. Then we discuss a few examples of using cyclic nucleotide fluorescent biosensors to study regulation of neuronal function and finish with a discussion of advances in the field. Although there has been significant progress made in understanding how the specific signaling of cyclic nucleotide second messengers is achieved, the mechanistic details in complex cell types like neurons are only just beginning to surface. Current and future fluorescent protein reporters will be essential to elucidate the role of cyclic nucleotide signaling dynamics in the functions of individual neurons and their networks.

  17. Multiphasic interactions between nucleotides and target proteins

    CERN Document Server

    Nissen, Per


    The nucleotides guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) bind to target proteins to promote bacterial survival (Corrigan et al. 2016). Thus, the binding of the nucleotides to RsgA, a GTPase, inhibits the hydrolysis of GTP. The dose response, taken to be curvilinear with respect to the logarithm of the inhibitor concentration, is instead much better (P<0.001 when the 6 experiments are combined) represented as multiphasic, with high to exceedingly high absolute r values for the straight lines, and with transitions in the form of non-contiguities (jumps). Profiles for the binding of radiolabeled nucleotides to HprT and Gmk, GTP synthesis enzymes, were, similarly, taken to be curvilinear with respect to the logarithm of the protein concentration. However, the profiles are again much better represented as multiphasic than as curvilinear (the P values range from 0.047 to <0.001 for each of the 8 experiments for binding of ppGpp and pppGpp to HprT). The binding of GTP to HprT and ...

  18. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.


    Roč. 107, č. 22 (2003), s. 5349-5356. ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant ostatní: Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  19. A Sensitive Cyclic Nucleotide Phosphodiesterase Assay for Transient Enzyme Kinetics

    NARCIS (Netherlands)

    Lookeren Campagne, Michiel M. van; Haastert, Peter J.M. van


    A new assay for cyclic nucleotide phosphodiesterase has been developed by using reverse-phase column chromatography for the separation of product and substrate of the enzymatic reaction. The polar 5'-nucleotides are not retarded by the column, while the more lipophilic cyclic nucleotides bind to the

  20. Preparation of a sol-gel-derived carbon nanotube ceramic electrode by microwave irradiation and its application for the determination of adenine and guanine

    Energy Technology Data Exchange (ETDEWEB)

    Abbaspour, Abdolkarim, E-mail: [Department of Chemistry, College of Sciences, Shiraz University, Shiraz, Fars 71456-85464 (Iran, Islamic Republic of); Ghaffarinejad, Ali [Department of Chemistry, College of Sciences, Shiraz University, Shiraz, Fars 71456-85464 (Iran, Islamic Republic of)


    In this study, microwave irradiation was used for the fast preparation (min) of a sol-gel-derived carbon nanotube ceramic electrode (MW-CNCE). For confirmation of the preparation of the ceramic by MW irradiation, Fourier transform infrared, X-ray diffraction spectra and scanning electron microscopy images of the produced ceramic were compared with those of conventional ceramic (which is produced by drying the ceramic in air for 48 h). The electrochemical behavior of MW-CNCE in nicotinamide adenine dinucleotide, L-cysteine, adenine and guanine was compared with that of a conventional sol-gel-derived carbon nanotube ceramic electrode (CNCE). In all systems, similar peak potentials and lower background currents were obtained with respect to CNCE. Finally, the MW-CNCE was used for the simultaneous determination of adenine and guanine using differential pulse voltammetry. The linear ranges of 0.1-10 and 0.1-20 muM were obtained for adenine and guanine, respectively. These results are comparable with some modified electrodes that have recently been reported for the determination of adenine and guanine, with the advantage that the proposed electrode did not contain modifier. In addition, the proposed electrode was successfully used for the oxidation of adenine and guanine in DNA, and the detection limit for this measurement was 0.05 mug mL{sup -1} DNA.

  1. Comparison of Transition Metal-Mediated Oxidation Reactions of Guanine in Nucleoside and Single-Stranded Oligodeoxynucleotide Contexts


    Ghude, Pranjali; Schallenberger, Mark A.; Fleming, Aaron M.; Muller, James G.; Burrows, Cynthia J.


    As the most readily oxidized of DNA’s four natural bases, guanine is a prime target for attack by reactive oxygen species (ROS) and transition metal-mediated oxidants. The oxidation products of a modified guanosine nucleoside and of a single-stranded oligodeoxynucleotide, 5′-d(TTTTTTTGTTTTTTT)-3′ have been studied using oxidants that include CoII, NiII, and IrIV compounds as well as photochemically generated oxidants such as sulphate radical, electron-transfer agents (riboflavin) and singlet ...

  2. A label-free electrochemical sensor for detection of mercury(II) ions based on the direct growth of guanine nanowire. (United States)

    Huang, Yan Li; Gao, Zhong Feng; Jia, Jing; Luo, Hong Qun; Li, Nian Bing


    A simple, sensitive and label-free electrochemical sensor is developed for detection of Hg(2+) based on the strong and stable T-Hg(2+)-T mismatches. In the presence of Mg(2+), the parallel G-quadruplex structures could be specifically recognized and precipitated in parallel conformation. Therefore, the guanine nanowire was generated on the electrode surface, triggering the electrochemical H2O2-mediated oxidation of 3,3',5,5'-tetramethylbenzidine (TMB). In this research, a new method of signal amplification for the quantitative detection of Hg(2+) was described based on the direct growth of guanine nanowire via guanine nanowire. Under optimum conditions, Hg(2+) was detected in the range of 100pM-100nM, and the detection limit is 33pM. Compared to the traditional single G-quadruplex label unit, this electrochemical sensor showed high sensitivity and selectivity for detecting Hg(2+). PMID:26835893

  3. Nucleotide Excision Repair in Caenorhabditis elegans


    Hannes Lans; Wim Vermeulen


    Nucleotide excision repair (NER) plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vi...

  4. Nucleotide sequence of Klebsiella pneumoniae lac genes.


    Buvinger, W E; Riley, M


    The nucleotide sequences of the Klebsiella pneumoniae lacI and lacZ genes and part of the lacY gene were determined, and these genes were located and oriented relative to one another. The K. pneumoniae lac operon is divergent in that the lacI and lacZ genes are oriented head to head, and complementary strands are transcribed. Besides base substitutions, the lacZ genes of K. pneumoniae and Escherichia coli have suffered short distance shifts of reading frame caused by additions or deletions or...

  5. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.


    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called......, thus allowing repair proteins to efficiently access DNA. On the other hand, after completion of the repair, the chromatin must be returned to its previous undamaged state. Chromatin remodeling can refer to three separate but interconnected processes, histone post-translational modifications, insertion...

  6. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit


    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  7. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization (United States)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao


    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

  8. Crystal structures of Apo and GMP bound hypoxanthine-guanine phosphoribosyltransferase from Legionella pneumophila and the implications in gouty arthritis. (United States)

    Zhang, Nannan; Gong, Xiaojian; Lu, Min; Chen, Xiaofang; Qin, Ximing; Ge, Honghua


    Hypoxanthine-guanine phosphoribosyltransferase (HGPRT) (EC reversibly catalyzes the transfer of the 5-phophoribosyl group from 5-phosphoribosyl-alpha-1-pyrophosphate (PRPP) to hypoxanthine or guanine to form inosine monophosphate (IMP) or guanosine monophosphate (GMP) in the purine salvage pathway. To investigate the catalytic mechanism of this enzyme in the intracellular pathogen Legionella pneumophila, we determined the crystal structures of the L. pneumophila HGPRT (LpHGPRT) both in its apo-form and in complex with GMP. The structures reveal that LpHGPRT comprises a core domain and a hood domain which are packed together to create a cavity for GMP-binding and the enzymatic catalysis. The binding of GMP induces conformational changes of the stable loop II. This new binding site is closely related to the Gout arthritis-linked human HGPRT mutation site (Ser103Arg). Finally, these structures of LpHGPRT provide insights into the catalytic mechanism of HGPRT. PMID:26968365

  9. A single nucleotide polymorphism in NEUROD1 is associated with production traits in Nelore beef cattle. (United States)

    de Oliveira, P S N; Tizioto, P C; Malago, W; do Nascimento, M L; Cesar, A S M; Diniz, W J S; de Souza, M M; Lanna, D P D; Tullio, R R; Mourão, G B; de A Mudadu, M; Coutinho, L L; de A Regitano, L C


    Feed efficiency and carcass characteristics are late-measured traits. The detection of molecular markers associated with them can help breeding programs to select animals early in life, and to predict breeding values with high accuracy. The objective of this study was to identify polymorphisms in the functional and positional candidate gene NEUROD1 (neurogenic differentiation 1), and investigate their associations with production traits in reference families of Nelore cattle. A total of 585 steers were used, from 34 sires chosen to represent the variability of this breed. By sequencing 14 animals with extreme residual feed intake (RFI) values, seven single nucleotide polymorphisms (SNPs) in NEUROD1 were identified. The investigation of marker effects on the target traits RFI, backfat thickness (BFT), ribeye area (REA), average body weight (ABW), and metabolic body weight (MBW) was performed with a mixed model using the restricted maximum likelihood method. SNP1062, which changes cytosine for guanine, had no significant association with RFI or REA. However, we found an additive effect on ABW (P ≤ 0.05) and MBW (P ≤ 0.05), with an estimated allele substitution effect of -1.59 and -0.93 kg0.75, respectively. A dominant effect of this SNP for BFT was also found (P ≤ 0.010). Our results are the first that identify NEUROD1 as a candidate that affects BFT, ABW, and MBW. Once confirmed, the inclusion of this SNP in dense panels may improve the accuracy of genomic selection for these traits in Nelore beef cattle as this SNP is not currently represented on SNP chips. PMID:27420997

  10. Echinacoside induces apoptotic cancer cell death by inhibiting the nucleotide pool sanitizing enzyme MTH1

    Directory of Open Access Journals (Sweden)

    Dong L


    Full Text Available Liwei Dong,1 Hongge Wang,1 Jiajing Niu,1 Mingwei Zou,2 Nuoting Wu,1 Debin Yu,1 Ye Wang,1 Zhihua Zou11Key Laboratory for Molecular Enzymology and Engineering of the Ministry of Education, National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, Jilin Province, People’s Republic of China; 2Department of Psychology, College of Liberal Arts and Social Sciences, University of Houston, Houston, TX, USA Abstract: Inhibition of the nucleotide pool sanitizing enzyme MTH1 causes extensive oxidative DNA damages and apoptosis in cancer cells and hence may be used as an anticancer strategy. As natural products have been a rich source of medicinal chemicals, in the present study, we used the MTH1-catalyzed enzymatic reaction as a high-throughput in vitro screening assay to search for natural compounds capable of inhibiting MTH1. Echinacoside, a compound derived from the medicinal plants Cistanche and Echinacea, effectively inhibited the catalytic activity of MTH1 in an in vitro assay. Treatment of various human cancer cell lines with Echinacoside resulted in a significant increase in the cellular level of oxidized guanine (8-oxoguanine, while cellular reactive oxygen species level remained unchanged, indicating that Echinacoside also inhibited the activity of cellular MTH1. Consequently, Echinacoside treatment induced an immediate and dramatic increase in DNA damage markers and upregulation of the G1/S-CDK inhibitor p21, which were followed by marked apoptotic cell death and cell cycle arrest in cancer but not in noncancer cells. Taken together, these studies identified a natural compound as an MTH1 inhibitor and suggest that natural products can be an important source of anticancer agents. Keywords: Echinacoside, MTH1, 8-oxoG, DNA damage, apoptosis, cell cycle arrest

  11. The role of topoisomerase I in suppressing genome instability associated with a highly transcribed guanine-rich sequence is not restricted to preventing RNA:DNA hybrid accumulation


    Yadav, Puja; Owiti, Norah; Kim, Nayun


    Highly transcribed guanine-run containing sequences, in Saccharomyces cerevisiae, become unstable when topoisomerase I (Top1) is disrupted. Topological changes, such as the formation of extended RNA:DNA hybrids or R-loops or non-canonical DNA structures including G-quadruplexes has been proposed as the major underlying cause of the transcription-linked genome instability. Here, we report that R-loop accumulation at a guanine-rich sequence, which is capable of assembling into the four-stranded...

  12. Single nucleotide polymorphism of prolactin gene exon two in ducks of Pekin, Mojosari and Pekin Mojosari crossbred

    Directory of Open Access Journals (Sweden)



    Full Text Available Prolactin gene plays crucial role in the reproduction and egg production of birds. The objectives of this study were to characterize single nucleotide polymorphism in partial intron and coding region of duck prolactin gene. Blood samples were collected from 168 ducks consisted of 19 Pekin, 36 Mojosari, and 113 of their crossbreds collected from Indonesian Research Institute for Animal Production (IRIAP. Primer pairs for the coding regions in prolactin gene were self designed based on the duck genomic sequence database (GeneBank: AB158611.1. PCR products based on DNA of prolactin gene exon two was amplified approximately 400 bp. There is one base insertion of Adenin at the position of 2001 bp intron two region of duck prolactin. Homology test based on BLAST method indicated 99% identity with duck refference (Code Access GeneBank: AB158611.1. Adenin composition in all of duck samples was higher than refference. Triplet hydrogen bonds between Guanine and Cytosin pairs was higher than those at duplet hydrogen bonds between Adenine and Thymine. All duck samples were homozigous and monomorphyc.

  13. Structure of the Hsp110:Hsc70 Nucleotide Exchange Machine


    Schuermann, Jonathan P.; Jiang, Jianwen; Cuellar, Jorge; Llorca, Oscar; Wang, Liping; Gimenez, Luis E.; Jin, Suping; Taylor, Alexander B.; Demeler, Borries; Morano, Kevin A.; Hart, P. John; Valpuesta, Jose M.; Lafer, Eileen M.; Sousa, Rui


    Hsp70s mediate protein folding, translocation, and macromolecular complex remodeling reactions. Their activities are regulated by proteins that exchange ADP for ATP from the nucleotide-binding domain (NBD) of the Hsp70. These nucleotide exchange factors (NEFs) include the Hsp110s, which are themselves members of the Hsp70 family. We report the structure of an Hsp110:Hsc70 nucleotide exchange complex. The complex is characterized by extensive protein:protein interactions and symmetric bridging...

  14. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao


    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  15. A computational study of a recreated G protein-GEF reaction intermediate competent for nucleotide exchange: fate of the Mg ion.

    Directory of Open Access Journals (Sweden)

    Mériam Ben Hamida-Rebaï

    Full Text Available Small G-proteins of the superfamily Ras function as molecular switches, interacting with different cellular partners according to their activation state. G-protein activation involves the dissociation of bound GDP and its replacement by GTP, in an exchange reaction that is accelerated and regulated in the cell by guanine-nucleotide exchange factors (GEFs. Large conformational changes accompany the exchange reaction, and our understanding of the mechanism is correspondingly incomplete. However, much knowledge has been derived from structural studies of blocked or inactive mutant GEFs, which presumably closely represent intermediates in the exchange reaction and yet which are by design incompetent for carrying out the nucleotide exchange reaction. In this study we have used comparative modelling to recreate an exchange-competent form of a late, pre-GDP-ejection intermediate species in Arf1, a well-characterized small G-protein. We extensively characterized three distinct models of this intermediate using molecular dynamics simulations, allowing us to address ambiguities related to the mutant structural studies. We observed in particular the unfavorable nature of Mg2+ associated forms of the complex and the establishment of closer Arf1-GEF contacts in its absence. The results of this study shed light on GEF-mediated activation of this small G protein and on predicting the fate of the Mg ion at a critical point in the exchange reaction. The structural models themselves furnish additional targets for interfacial inhibitor design, a promising direction for exploring potentially druggable targets with high biological specificity.

  16. Quantum processes in 8-Oxo-Guanine-Ru(bipyridine)32+ photosynthetic systems of artificial minimal cells (United States)

    Tamulis, Arvydas; Grigalavicius, Mantas; Krisciukaitis, Sarunas; Medzevicius, Giedrius


    Density functional theory methods were used to investigate various self-assembled photoactive bioorganic systems of interest for artificial minimal cells. The cell systems studied are based on nucleotides or their compounds and consisted of up to 123 atoms (not including the associated water or methanol solvent shells) and are up to 2.5 nm in diameter. The electron correlation interactions responsible for the weak hydrogen and Van derWaals chemical bonds increase due to the addition of a polar solvent (water or methanol). The precursor fatty acid molecules of the system also play a critical role in the quantum mechanical interaction based self-assembly of the photosynthetic center and the functioning of the photosynthetic processes of the artificial minimal cells. The distances between the separated sensitizer, fatty acid precursor, and methanol molecules are comparable to Van derWaals and hydrogen bonding radii. As a result the associated electron correlation interactions compress the overall system, resulting in an even smaller gap between the highest occupied molecular orbital (HOMO), and lowest unoccupied molecular orbital (LUMO) electron energy levels and photoexcited electron tunnelling occurs from the sensitizer (either Ru(bpy)32+ or [Ru(bpy)2(4-Bu-4'-Me-2,2'-bpy)]2++ derivatives) to the precursor fatty acid molecules (notation used: Me = methyl; Bu = butyl; bpy = bipyridine). The shift of the absorption spectrum to the red for the artificial protocell photosynthetic centers might be considered as the measure of the complexity of these systems.

  17. A colorimetric method for the determination of lead(II) ions using gold nanoparticles and a guanine-rich oligonucleotide

    International Nuclear Information System (INIS)

    We have developed a colorimetric method for the determination of Pb(II) ions. It is based on the use of gold nanoparticles and a guanine-rich synthetic oligonucleotide. On addition of Pb(II), the color of the solution turns from red to blue. The ratio of the UV-vis absorption at 630 nm and 525 nm is proportional to the concentration of Pb(II) ions in the range from 10 to 100 nM, and the detection limit is 20 nM. Other metal ions do not interfere if present in up to a 10-fold molar excess. The method was successfully applied to the detection of Pb(II) in lake water and urine. The recovery in case of spiked samples is 92%. The results show that this method is sensitive, simple and fast. (author)

  18. Atomic-Scale Insight into Tautomeric Recognition, Separation, and Interconversion of Guanine Molecular Networks on Au(111). (United States)

    Zhang, Chi; Xie, Lei; Wang, Likun; Kong, Huihui; Tan, Qinggang; Xu, Wei


    Although tautomerization may directly affect the chemical or biological properties of molecules, real-space investigation on the tautomeric behaviors of organic molecules in a larger area of molecular networks has been scarcely reported. In this paper, we choose guanine (G) molecule as a model system. From the interplay of high-resolution scanning tunneling microscopy (STM) imaging and density functional theory (DFT) calculations, we have successfully achieved the tautomeric recognition, separation, and interconversion of G molecular networks (formed by two tautomeric forms G/9H and G/7H) with the aid of NaCl on the Au(111) surface in ultrahigh vacuum (UHV) conditions. Our results may serve as a prototypical system to provide important insights into tautomerization related issues, which should be intriguing to biochemistry, pharmaceutics, and other related fields. PMID:26322860

  19. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field. (United States)

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah


    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field. PMID:26999445

  20. Red meat enhances the colonic formation of the DNA adduct O6-carboxymethyl guanine: implications for colorectal cancer risk. (United States)

    Lewin, Michelle H; Bailey, Nina; Bandaletova, Tanya; Bowman, Richard; Cross, Amanda J; Pollock, Jim; Shuker, David E G; Bingham, Sheila A


    Red meat is associated with increased risk of colorectal cancer and increases the endogenous formation of N-nitrosocompounds (NOC). To investigate the genotoxic effects of NOC arising from red meat consumption, human volunteers were fed high (420 g) red meat, vegetarian, and high red meat, high-fiber diets for 15 days in a randomized crossover design while living in a volunteer suite, where food was carefully controlled and all specimens were collected. In 21 volunteers, there was a consistent and significant (P vegetarian diet as measured by apparent total NOC (ATNC) in feces. In colonic exfoliated cells, the percentage staining positive for the NOC-specific DNA adduct, O(6)-carboxymethyl guanine (O(6)CMG) was significantly (P colorectal cancer. PMID:16452248

  1. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field (United States)

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah


    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds’ vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field. PMID:26999445

  2. Human immunodeficiency virus type 1 Nef recruits the guanine exchange factor Vav1 via an unexpected interface into plasma membrane microdomains for association with p21-activated kinase 2 activity. (United States)

    Rauch, Susanne; Pulkkinen, Kati; Saksela, Kalle; Fackler, Oliver T


    Alterations of T-cell receptor signaling by human immunodeficiency virus type 1 (HIV-1) Nef involve its association with a highly active subpopulation of p21-activated kinase 2 (PAK2) within a dynamic signalosome assembled in detergent-insoluble membrane microdomains. Nef-PAK2 complexes contain the GTPases Rac and Cdc42 as well as a factor providing guanine nucleotide exchange factor (GEF) activity for Rac/Cdc42. However, the identity of this GEF has remained controversial. Previous studies suggested the association of Nef with at least three independent GEFs, Vav, DOCK2/ELMO1, and betaPix. Here we used a broad panel of approaches to address which of these GEFs is involved in the functional interaction of Nef with PAK2 activity. Biochemical fractionation and confocal microscopy revealed that Nef recruits Vav1, but not DOCK2/ELMO1 or betaPix, to membrane microdomains. Transient RNAi knockdown, analysis of cell lines defective for expression of Vav1 or DOCK2 as well as use of a betaPix binding-deficient PAK2 variant confirmed a role for Vav1 but not DOCK2 or betaPix in Nef's association with PAK2 activity. Nef-mediated microdomain recruitment of Vav1 occurred independently of the Src homology 3 domain binding PxxP motif, which is known to connect Nef to many cellular signaling processes. Instead, a recently described protein interaction surface surrounding Nef residue F195 was identified as critical for Nef-mediated raft recruitment of Vav1. These results identify Vav1 as a relevant component of the Nef-PAK2 signalosome and provide a molecular basis for the role of F195 in formation of a catalytically active Nef-PAK2 complex. PMID:18094167

  3. DNA damage by the sulfate radical anion: hydrogen abstraction from the sugar moiety versus one-electron oxidation of guanine. (United States)

    Roginskaya, Marina; Mohseni, Reza; Ampadu-Boateng, Derrick; Razskazovskiy, Yuriy


    The products of oxidative damage to double-stranded (ds) DNA initiated by photolytically generated sulfate radical anions SO4(•-) were analyzed using reverse-phase (RP) high-performance liquid chromatography (HPLC). Relative efficiencies of two major pathways were compared: production of 8-oxoguanine (8oxoG) and hydrogen abstraction from the DNA 2-deoxyribose moiety (dR) at C1,' C4,' and C5' positions. The formation of 8oxoG was found to account for 87% of all quantified lesions at low illumination doses. The concentration of 8oxoG quickly reaches a steady state at about one 8oxoG per 100 base pairs due to further oxidation of its products. It was found that another guanine oxidation product identified as 2-amino-5-(2'-alkylamino)-4H-imidazol-4-one (X) was released in significant quantities from its tentative precursor 2-amino-5-[(2'-deoxy-β-d-erythro-pentofuranosyl)amino]-4H-imidazol-4-one (dIz) upon treatment with primary amines in neutral solutions. The linear dose dependence of X release points to the formation of dIz directly from guanine and not through oxidation of 8oxoG. The damage to dR was found to account for about 13% of the total damage, with majority of lesions (33%) originating from the C4' oxidation. The contribution of C1' oxidation also turned out to be significant (17% of all dR damages) despite of the steric problems associated with the abstraction of the C1'-hydrogen. However, no evidence of base-to-sugar free valence transfer as a possible alternative to direct hydrogen abstraction at C1' was found. PMID:27043476

  4. Performance characteristics of guanine incorporated PVDF-HFP/PEO polymer blend electrolytes with binary iodide salts for dye-sensitized solar cells (United States)

    Senthil, R. A.; Theerthagiri, J.; Madhavan, J.; Arof, A. K.


    In this work, we have investigated the influence of guanine as an organic dopant in dye-sensitized solar cell (DSSC) based on poly(vinylidinefluoride-co-hexafluoropropylene) (PVDF-HFP)/polyethylene oxide (PEO) polymer blend electrolyte along with binary iodide salts (potassium iodide (KI) and tetrabutylammonium iodide (TBAI)) and iodine (I2). The PVDF-HFP/KI + TBAI/I2, PVDF-HFP/PEO/KI + TBAI/I2 and guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 electrolytes were prepared by solution casting technique using DMF as solvent. The PVDF-HFP/KI + TBAI/I2 electrolyte showed an ionic conductivity value of 9.99 × 10-5 Scm-1, whereas, it was found to be increased to 4.53 × 10-5 Scm-1 when PEO was blended with PVDF-HFP/KI + TBAI/I2 electrolyte. However, a maximum ionic conductivity value of 3.67 × 10-4 Scm-1 was obtained for guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 blend electrolyte. The photovoltaic properties of all these polymer electrolytes in DSSCs were characterized. As a consequence, the power conversion efficiency of the guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 electrolyte based DSSC was significantly improved to 4.98% compared with PVDF-HFP/PEO/KI + TBAI/I2 electrolyte based DSSC (2.46%). These results revealed that the guanine can be an effective organic dopant to enhance the performance of DSSCs.

  5. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus


    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  6. Prebiotic nucleotide synthesis demonstration of a geologically plausible pathway

    NARCIS (Netherlands)

    Schwartz, A.W.; Veen, van der M.; Bisseling, T.; Chittenden, G.J.


    Mineral phosphate (apatite) is activated for the synthesis of nucleotides when dilute solutions containing nucleoside and ammonium oxalate are evaporated in its presence. A natural, igneous fluorapatite was found to be even more effective in nucleotide synthesis than the more soluble hydroxylapatite

  7. Nucleotide sequence of cloned rat serum albumin messenger RNA.


    Sargent, T D; Yang, M; Bonner, J.


    The nucleotide sequences of the recombinant DNA inserts of three bacterial plasmid clones containing nearly all of the rat serum albumin mRNA have been determined. A statistical analysis of the nucleotide sequence reveals a pattern of repeated internal homology that confirms the "intragenic triplication" model of albumin evolution.

  8. Nucleotide Excision Repair in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Hannes Lans


    Full Text Available Nucleotide excision repair (NER plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vitro and live cell experiments, particularly using model systems such as bacteria, yeast, and mammalian cell cultures. In recent years, the versatility of the nematode C. elegans to study DNA damage response (DDR mechanisms including NER has become increasingly clear. In particular, C. elegans seems to be a convenient tool to study NER during the UV response in vivo, to analyze this process in the context of a developing and multicellular organism, and to perform genetic screening. Here, we will discuss current knowledge gained from the use of C. elegans to study NER and the response to UV-induced DNA damage.

  9. Software for tag single nucleotide polymorphism selection

    Directory of Open Access Journals (Sweden)

    Stram Daniel O


    Full Text Available Abstract This paper reviews the theoretical basis for single nucleotide polymorphism (SNP tagging and considers the use of current software made freely available for this task. A distinction between haplotype block-based and non-block-based approaches yields two classes of procedures. Analysis of two different sets of SNP genotype data from the HapMap is used to judge the practical aspects of using each of the programs considered, as well as to make some general observations about the performance of the programs in finding optimal sets of tagging SNPs. Pairwise R2 methods, while the simplest of those considered, do tend to pick more tagging SNPs than are strictly needed to predict unmeasured (non-tagging SNPs, since a combination of two or more tagging SNPs can form a prediction of SNPs that have no direct (pairwise surrogate. Block-based methods that exploit the linkage disequilibrium structure within haplotype blocks exploit this sort of redundancy, but run a risk of over-fitting if used without some care. A compromise approach which eliminates the need first to analyse block structure, but which still exploits simple relationships between SNPs, appears promising.

  10. Nucleotide Phosphohydrolase in Purified Vaccinia Virus (United States)

    Munyon, William; Paoletti, Enzo; Ospina, Julio; Grace, James T.


    Purified infectious vaccinia virus has been shown to contain an enzyme or enzymes that remove the terminal phosphate group from adenosine triphosphate (ATP), guanosine triphosphate (GTP), uridine triphosphate (UTP), and cytidine triphosphate (CTP). The Km for ATP of this enzyme is 5.5 × 10−4m, and the relative rates of the reaction with ATP, GTP, UTP, and CTP are 1.00, 0.34, 0.15, and 0.29, respectively. The virus enzyme does not react with any of the diphosphates. The rate of the reaction is proportional to the amount of virus added and is linear for 130 min. The virus nucleotide phosphohydrolase activity is greatly stimulated by Mg++ and very slightly stimulated by Ca++. The small residual activity observed in the absence of divalent cations is completely inhibited by ethylenediaminetetraacetic acid. Neither Na+ nor K+ ions, nor any mixture of these, was found to stimulate the reaction significantly, and ouabain, at 10−4m, inhibited the reaction by only 27%. The response of the vaccinia enzyme to mono- and divalent cations and to ouabain indicates that the vaccinia enzyme has different properties from those associated with microsomes and mitochondria. PMID:4986904

  11. Design and characterization of N2-arylaminopurines which selectively inhibit replicative DNA synthesis and replication-specific DNA polymerases: guanine derivatives active on mammalian DNA polymerase alpha and bacterial DNA polymerase III.


    Wright, G E; Baril, E F; Brown, V M; Brown, N C


    The 2-amino substituted derivatives of guanine, N2-(p-n-butylphenyl)guanine (BuPG) and N2-(3',4'-trimethylenephenyl) guanine (TMPG), were synthesized and found to selectively inhibit, respectively, HeLa cell DNA polymerase alpha (po1 alpha) and B. subtilis DNA polymerase III (po1 III). Both purines, like their corresponding uracil analogs, BuAu and TMAU (2,9), were specifically competitive with dGTP in their inhibitory action on their target polymerases. BuPG, the pol alpha-specific purine, w...

  12. Cardiac Na+ Current Regulation by Pyridine Nucleotides (United States)

    Liu, Man; Sanyal, Shamarendra; Gao, Ge; Gurung, Iman S.; Zhu, Xiaodong; Gaconnet, Georgia; Kerchner, Laurie J.; Shang, Lijuan L.; Huang, Christopher L-H.; Grace, Andrew; London, Barry; Dudley, Samuel C.


    Rationale Mutations in glycerol-3-phosphate dehydrogenase 1-like (GPD1-L) protein reduce cardiac Na+ current (INa) and cause Brugada Syndrome (BrS). GPD1-L has >80% amino acid homology with glycerol-3-phosphate dehydrogenase, which is involved in nicotinamide adenine dinucleotide (NAD)-dependent energy metabolism. Objective Therefore, we tested whether NAD(H) could regulate human cardiac sodium channels (Nav1.5). Methods and Results HEK293 cells stably expressing Nav1.5 and rat neonatal cardiomyocytes were used. The influence of NADH/NAD+ on arrhythmic risk was evaluated in wild-type or SCN5A+/− mouse heart. A280V GPD1-L caused a 2.48 ± 0.17-fold increase in intracellular NADH level (P<0.001). NADH application or co-transfection with A280V GPD1-L resulted in decreased INa (0.48 ± 0.09 or 0.19 ±0.04 of control group, respectively; P<0.01), which was reversed by NAD+, chelerythrine, or superoxide dismutase (SOD). NAD+ antagonism of the Na+ channel downregulation by A280V GPD1-L or NADH was prevented by a protein kinase A (PKA) inhibitor, PKAI6–22. The effects of NADH and NAD+ were mimicked by a phorbol ester and forskolin, respectively. Increasing intracellular NADH was associated with an increased risk of ventricular tachycardia (VT) in wild-type mouse hearts. Extracellular application of NAD+ to SCN5A+/− mouse hearts ameliorated the risk of VT. Conclusions Our results show that Nav1.5 is regulated by pyridine nucleotides, suggesting a link between metabolism and INa. This effect required protein kinase C (PKC) activation and was mediated by oxidative stress. NAD+ could prevent this effect by activating PKA. Mutations of GPD1-L may downregulate Nav1.5 by altering the oxidized to reduced NAD(H) balance. PMID:19745168

  13. Empirical Bayes analysis of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ickstadt Katja


    Full Text Available Abstract Background An important goal of whole-genome studies concerned with single nucleotide polymorphisms (SNPs is the identification of SNPs associated with a covariate of interest such as the case-control status or the type of cancer. Since these studies often comprise the genotypes of hundreds of thousands of SNPs, methods are required that can cope with the corresponding multiple testing problem. For the analysis of gene expression data, approaches such as the empirical Bayes analysis of microarrays have been developed particularly for the detection of genes associated with the response. However, the empirical Bayes analysis of microarrays has only been suggested for binary responses when considering expression values, i.e. continuous predictors. Results In this paper, we propose a modification of this empirical Bayes analysis that can be used to analyze high-dimensional categorical SNP data. This approach along with a generalized version of the original empirical Bayes method are available in the R package siggenes version 1.10.0 and later that can be downloaded from Conclusion As applications to two subsets of the HapMap data show, the empirical Bayes analysis of microarrays cannot only be used to analyze continuous gene expression data, but also be applied to categorical SNP data, where the response is not restricted to be binary. In association studies in which typically several ten to a few hundred SNPs are considered, our approach can furthermore be employed to test interactions of SNPs. Moreover, the posterior probabilities resulting from the empirical Bayes analysis of (prespecified interactions/genotypes can also be used to quantify the importance of these interactions.

  14. A flow injection analysis coupled dual electrochemical detector for selective and simultaneous detection of guanine and adenine

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • First study for simultaneous determination of guanine (G) and adenine (A) using a dual electrode. • Separation-less flow-injection analysis technique was introduced for G and A. • This method is selective and no interference by the presence of other DNA bases (T and C). • DNA hybridization process and meat real sample analysis were demonstrated. - Abstract: Adenine (A) and guanine (G), important bases of nucleic acids, are often analyzed by separation coupled spectroscopic detection methods. Herein, we are demonstrated a new flow-injection analysis (FIA) coupled dual electrochemical detector (DECD), where a chitosan-carbon nanofiber (Chit-CNF) modified glassy carbon electrode prepared by a simple technique and pH 7 phosphate buffer solution as a carrier system, for separation-less quantification of G and A. This method is highly selective and no interference by the presence of the other DNA bases (Thymine and Cytosine). The FIA-DECD was operated at two different operating potentials, E1 = 0.80 V and E2 = 0.95 V vs Ag/AgCl, where G and {G + A} get oxidized, respectively. Amount of A was calculated from the difference between the FIA current signals, measured at E20.95V and E10.80V. The GCE/Chit-CNF was characterized by cyclic voltammetry with potassium ferricyanide system and Raman spectroscopy. The modified electrode showed unique electron-transfer feature with metal like conductivity. Under an optimal condition, FIA-DECD showed linear calibration plots for G and A in a concentration range, 200 nM—50 μM with current sensitivity values 13.83 ± 0.48 and 4.84 ± 0.11 nA μM−1 respectively. Calculated detection limit (signal-to-noise ratio = 3) values were 46.8 nM and 73.8 nM for G and A respectively. Applicability of the present technique was further demonstrated by detecting G and A in beef kidney sample and DNA hybridization process

  15. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed


    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  16. A Theoretical Study of the Binding of [Re6Se8(OH2(H2O4] Rhenium Clusters to DNA Purine Base Guanine

    Directory of Open Access Journals (Sweden)

    Leonor Alvarado-Soto


    Full Text Available Hexanuclear rhenium complexes are promising candidates for use as antitumor drugs. However, to date, there has been no investigation into the nature of their binding to DNA. In this study, density functional theory (DFT was used to examine the binding of [Re6Se8(OH2(H2O4] to the DNA purine base guanine. The geometrical structures of cluster-guanine adducts in water were modeled at the zero order regular approximation (ZORA-PW91 level. Calculating the bond energies allowed us to compare the cis and trans forms of the cluster, and a possible manners of interaction between [Re6Se8(OH2(H2O3] clusters and DNA was obtained and explained.

  17. Multiscale QM/MM Molecular Dynamics Study on the First Steps of Guanine-Damage by Free Hydroxyl Radicals in Solution

    CERN Document Server

    Abolfath, Ramin M; Rajnarayanam, R; Brabec, Thomas; Kodym, Reinhard; Papiez, Lech


    Understanding the damage of DNA bases from hydrogen abstraction by free OH radicals is of particular importance to reveal the effect of hydroxyl radicals produced by the secondary effect of radiation. Previous studies address the problem with truncated DNA bases as ab-initio quantum simulation required to study such electronic spin dependent processes are computationally expensive. Here, for the first time, we employ a multiscale and hybrid Quantum-Mechanical-Molecular-Mechanical simulation to study the interaction of OH radicals with guanine-deoxyribose-phosphate DNA molecular unit in the presence of water where all the water molecules and the deoxyribose-phosphate fragment are treated with the simplistic classical Molecular-Mechanical scheme. Our result illustrates that the presence of water strongly alters the hydrogen-abstraction reaction as the hydrogen bonding of OH radicals with water restricts the relative orientation of the OH-radicals with respective to the the DNA base (here guanine). This results ...

  18. Experimental and first-principles investigation of the adsorption and entrapping of guanine with SiO2 clusters of sol-gel silicate material for understanding DNA photodamage. (United States)

    Chandraboss, V L; Karthikeyan, B; Senthilvelan, S


    We report a first principles density functional theoretical (DFT) investigation of guanine (G) adsorption onto SiO2 clusters, viz., Si2O4, Si3O6, Si4O8 and Si5O10 in terms of geometry, binding energy (EB), binding site, energy gap (Eg), and electronic and spectral properties. Guanine entrapped within a Si9O18 cluster was also studied in terms of geometry, energy gap (Eg), electronic and spectral properties. We observed that the most stable forms of the cluster were Si5O10 and Si9O18. Guanine adsorbed onto SiO2 (G-SiO2) and guanine entrapped within SiO2 (GE-SiO2) were analyzed by the B3LYP/LanL2DZ method. The HOMO-LUMO energies illustrate that charge transfer from ligand to metal (L → M) occurs in G-SiO2 clusters as guanine to SiO2. The composite of guanine with nanostructured silica material was prepared by simple precipitation and chemical sol-gel processes. The prepared G-SiO2 and GE-SiO2 composites were characterized by FT-IR and FE-SEM with EDX analysis. The resulting experimental evidence is included for better understanding the guanine adsorption and entrapment. The adsorption and entrapping of G-SiO2 and GE-SiO2 was also confirmed by UV-vis spectroscopy. Experimental results are compared with the DFT results. Furthermore, the sol-gel silicate material used to protect the DNA base (guanine) from UVA-irradiation has been highlighted. PMID:25875309

  19. Novel repair activities of AlkA (3-methyladenine DNA glycosylase II) and endonuclease VIII for xanthine and oxanine, guanine lesions induced by nitric oxide and nitrous acid


    Terato, Hiroaki; Masaoka, Aya; Asagoshi, Kenjiro; Honsho, Akiko; Ohyama, Yoshihiko; Suzuki, Toshinori; Yamada, Masaki; Makino, Keisuke; Yamamoto, Kazuo; Ide, Hiroshi


    Nitrosation of guanine in DNA by nitrogen oxides such as nitric oxide (NO) and nitrous acid leads to formation of xanthine (Xan) and oxanine (Oxa), potentially cytotoxic and mutagenic lesions. In the present study, we have examined the repair capacity of DNA N-glycosylases from Escherichia coli for Xan and Oxa. The nicking assay with the defined substrates containing Xan and Oxa revealed that AlkA [in combination with endonuclease (Endo) IV] and Endo VIII recognized Xan in the tested enzymes....

  20. mRNA:guanine-N7 cap methyltransferases: identification of novel members of the family, evolutionary analysis, homology modeling, and analysis of sequence-structure-function relationships


    Radlinska Monika; Feder Marcin; Bujnicki Janusz M; Rychlewski Leszek


    Abstract Background The 5'-terminal cap structure plays an important role in many aspects of mRNA metabolism. Capping enzymes encoded by viruses and pathogenic fungi are attractive targets for specific inhibitors. There is a large body of experimental data on viral and cellular methyltransferases (MTases) that carry out guanine-N7 (cap 0) methylation, including results of extensive mutagenesis. However, a crystal structure is not available and cap 0 MTases are too diverged from other MTases o...

  1. Nucleotide Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...rtio About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Nucleotide Sequence - KOME | LSDB Archive ...

  2. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal;


    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including the...... interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods for...... manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  3. Association study of nonsynonymous single nucleotide polymorphisms in schizophrenia

    DEFF Research Database (Denmark)

    Carrera, Noa; Arrojo, Manuel; Sanjuán, Julio;


    Genome-wide association studies using several hundred thousand anonymous markers present limited statistical power. Alternatively, association studies restricted to common nonsynonymous single nucleotide polymorphisms (nsSNPs) have the advantage of strongly reducing the multiple testing problem...

  4. Crystalline guanine adducts of natural and synthetic trioxacarcins suggest a common biological mechanism and reveal a basis for the instability of trioxacarcin A. (United States)

    Pröpper, Kevin; Dittrich, Birger; Smaltz, Daniel J; Magauer, Thomas; Myers, Andrew G


    X-ray crystallographic characterization of products derived from natural and fully synthetic trioxacarcins, molecules with potent antiproliferative effects, illuminates aspects of their reactivity and mechanism of action. Incubation of the fully synthetic trioxacarcin analog 3, which lacks one of the carbohydrate residues present in the natural product trioxacarcin A (1) as well as oxygenation at C2 and C4 yet retains potent antiproliferative effects, with the self-complimentary duplex oligonucleotide d(AACCGGTT) led to production of a crystalline covalent guanine adduct (6). Adduct 6 is closely analogous to gutingimycin (2), the previously reported guanine adduct derived from incubation of natural trioxacarcin A (1) with duplex DNA, suggesting that 3 and 1 likely share a common basis of cytotoxicity. In addition, we isolated a novel, dark-red crystalline guanine adduct (7) from incubation of trioxacarcin A itself with the self-complimentary duplex oligonucleotide d(CGTATACG). Crystallographic analysis suggests that 7 is an anthraquinone derivative, which we propose arises by a sequence of guanosine alkylation within duplex DNA, depurination, base-catalyzed elimination of the trioxacarcinose A carbohydrate residue, and oxidative rearrangement to form an anthraquinone. We believe that this heretofore unrecognized chemical instability of natural trioxacarcins may explain why trioxacarcin analogs lacking C4 oxygenation exhibit superior chemical stabilities yet, as evidenced by structure 3, retain a capacity to form lesions with duplex DNA. PMID:25176186

  5. Tissue-specific accelerated aging in nucleotide excision repair deficiency


    Laura J. Niedernhofer


    Nucleotide excision repair (NER) is a multi-step DNA repair mechanism that removes helix-distorting modified nucleotides from the genome. NER is divided into two subpathways depending on the location of DNA damage in the genome and how it is first detected. Global genome NER identifies and repairs DNA lesions throughout the genome. This subpathway of NER primarily protects against the accumulation of mutations in the genome. Transcription-coupled (TC) NER rapidly repairs lesions in the transc...

  6. Nucleotide sequence and genome organization of carnation mottle virus RNA.


    Guilley, H; Carrington, J C; Balàzs, E; Jonard, G; Richards, K; Morris, T J


    The complete nucleotide sequence of carnation mottle genomic RNA (4003 nucleotides) is presented. The sequence was determined for cloned cDNA copies of viral RNA containing over 99% of the sequence and was completed by direct sequence analysis of RNA and cDNA transcripts. The sequence contains two long open reading frames which together can account for observed translation products. One translation product would arise by suppression of an amber termination codon and the sequence raises the po...

  7. Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides


    Pasternak, Anna; Wengel, Jesper


    Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4...

  8. A glassy carbon electrode modified with poly(eriochrome black T) for sensitive determination of adenine and guanine

    International Nuclear Information System (INIS)

    A thin film of poly(eriochrome black T) was deposited on the surface of glassy carbon electrode by cyclic voltammetry, and this system is shown to enable the sensitive determination of adenine (A) and guanine (G). Scanning electron microscopy, Fourier transform infrared spectroscopy and electrochemical impedance spectroscopy were carried out to characterize the film which exhibits excellent electrocatalytic activity toward the oxidation of A and G in 0.1 M phosphate buffer solution (pH 4.0). Square wave voltammetry reveals an oxidation peak at 1084 mV whose current is linearly related to the concentration of A in the range from 0.05 to 1.00 μM. The oxidation peak for G occurs at 788 mV, and its current is linearly related to the concentration of G in the range from 0.025 to 1.00 μM. The detection limits are 0.017 μM for A and 0.008 μM for G (at S/N = 3), respectively. The modified electrode displays good reproducibility and selectivity for the determination of A and G. The sensor was applied to quantify A and G in fish sperm DNA with satisfactory results. (author)

  9. Evidence that Natural Selection is the Primary Cause of the Guanine-cytosine Content Variation in Rice Genes

    Institute of Scientific and Technical Information of China (English)

    Xiaoli Shi; Xiyin Wang; Zhe Li; Qihui Zhu; Ji Yang; Song Ge; Jingchu Luo


    Cereal genes are classified into two distinct classes according to the guanine-cytosine (GC) content at the third codon sites (GC3). Natural selection and mutation bias have been proposed to affect the GC content. However, there has been controversy about the cause of GC variation. Here, we characterized the GC content of 1 092 paralogs and other single-copy genes in the duplicated chromosomal regions of the rice genome (ssp. indica) and classified the paralogs into GC3-rich and GC3-poor groups. By referring to out-group sequences from Arabidopsis and maize, we confirmed that the average synonymous substitution rate of the GC3-rich genes is significantly lower than that of the GC3-poor genes. Furthermore,we explored the other possible factors corresponding to the GC variation including the length of coding sequences, the number of exons in each gene, the number of genes in each family, the location of genes on chromosomes and the protein functions. Consequently, we propose that natural selection rather than mutation bias was the primary cause of the GC variation.

  10. An introduction to recurrent nucleotide interactions in RNA. (United States)

    Sweeney, Blake A; Roy, Poorna; Leontis, Neocles B


    RNA secondary structure diagrams familiar to molecular biologists summarize at a glance the folding of RNA chains to form Watson–Crick paired double helices. However, they can be misleading: First of all, they imply that the nucleotides in loops and linker segments, which can amount to 35% to 50% of a structured RNA, do not significantly interact with other nucleotides. Secondly, they give the impression that RNA molecules are loosely organized in three-dimensional (3D) space. In fact, structured RNAs are compactly folded as a result of numerous long-range, sequence-specific interactions, many of which involve loop or linker nucleotides. Here, we provide an introduction for students and researchers of RNA on the types, prevalence, and sequence variations of inter-nucleotide interactions that structure and stabilize RNA 3D motifs and architectures, using Escherichia coli (E. coli) 16S ribosomal RNA as a concrete example. The picture that emerges is that almost all nucleotides in structured RNA molecules, including those in nominally single-stranded loop or linker regions, form specific interactions that stabilize functional structures or mediate interactions with other molecules. The small number of noninteracting, ‘looped-out’ nucleotides make it possible for the RNA chain to form sharp turns. Base-pairing is the most specific interaction in RNA as it involves edge-to-edge hydrogen bonding (H-bonding) of the bases. Non-Watson–Crick base pairs are a significant fraction (30% or more) of base pairs in structured RNAs. PMID:25664365

  11. Nucleotide-sugar transporters: structure, function and roles in vivo

    Directory of Open Access Journals (Sweden)

    Handford M.


    Full Text Available The glycosylation of glycoconjugates and the biosynthesis of polysaccharides depend on nucleotide-sugars which are the substrates for glycosyltransferases. A large proportion of these enzymes are located within the lumen of the Golgi apparatus as well as the endoplasmic reticulum, while many of the nucleotide-sugars are synthesized in the cytosol. Thus, nucleotide-sugars are translocated from the cytosol to the lumen of the Golgi apparatus and endoplasmic reticulum by multiple spanning domain proteins known as nucleotide-sugar transporters (NSTs. These proteins were first identified biochemically and some of them were cloned by complementation of mutants. Genome and expressed sequence tag sequencing allowed the identification of a number of sequences that may encode for NSTs in different organisms. The functional characterization of some of these genes has shown that some of them can be highly specific in their substrate specificity while others can utilize up to three different nucleotide-sugars containing the same nucleotide. Mutations in genes encoding for NSTs can lead to changes in development in Drosophila melanogaster or Caenorhabditis elegans, as well as alterations in the infectivity of Leishmania donovani. In humans, the mutation of a GDP-fucose transporter is responsible for an impaired immune response as well as retarded growth. These results suggest that, even though there appear to be a fair number of genes encoding for NSTs, they are not functionally redundant and seem to play specific roles in glycosylation.

  12. Acyclic nucleoside phosphonates as inhibitors of hypoxanthine-guanine-(xanthine) phosphoribosyltransferase: new anti-malarial chemotherapy leads

    Czech Academy of Sciences Publication Activity Database

    Hocková, Dana; Holý, Antonín; Česnek, Michal; Baszczyňski, Ondřej; Tichý, Tomáš; Krečmerová, Marcela; Janeba, Zlatko; Skinner-Adams, T.; Naesens, L.; Keough, D. T.; de Jersey, J.; Guddat, L. W.

    Praha : ČSCH, 2011. s. 21-21. [Pokroky v organické, bioorganické a farmaceutické chemii - "Liblice 2011" /46./. 11.11.2011-13.11.2011, Lázně Bělohrad] R&D Projects: GA ČR GAP207/11/0108; GA MŠk 1M0508 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotide analogues * antiviral activity * antiplasmodial activity * acyclic nucleoside phosphonates Subject RIV: CC - Organic Chemistry

  13. [Nucleotide sequence determination of yeast mitochondrial phenylalanine-tRNA]. (United States)

    Martin, R; Sibler, A P; Schneller, J M; Keith, G; Stahl, A J; Dirheimer, G


    The primary structure of mitochondrial tRNAPhe from Saccharomyces cerevisiae, purified by two-dimensional polyacrylamide gel electrophoresis, was determined using, standard procedures on in vivo 32P-labeled tRNA, as well as the new 5'-end postlabeling techniques. We propose a cloverleaf model which allows for tertiary interaction between cytosine in position 46 and guanine in position 15 and maximizes base pairing in the psi C stem, thus excluding the uracile in position 50 from base pairing in the psi C stem. Comparison of the primary structure of this tRNA with all other known procaryotic, chloroplastic or cytoplasmic tRNAsPhe sequences does not lead to any conclusion about the endosymbiotic theory of mitochondria evolution. PMID:103657

  14. (/sup 3/H)dihydroergotamine as a high-affinity, slowly dissociating radioligand for 5-HT1B binding sites in rat brain membranes: evidence for guanine nucleotide regulation of agonist affinity states

    Energy Technology Data Exchange (ETDEWEB)

    Hamblin, M.W.; Ariani, K.; Adriaenssens, P.I.; Ciaranello, R.D.


    (/sup 3/H)Dihydroergotamine (DE) labels a population of binding sites in rat brain membranes with an affinity of approximately 70 pM in both hippocampus (maximal binding at saturation (Bmax) = 340 fmol/mg of protein) and cerebral cortex (Bmax = 250 fmol/mg of protein). Specific binding typically comprises about 97% of total binding at the Kd of the radioligand when nonspecific binding is determined in the presence of 100 nM unlabeled DE. Association kinetics at 37 degrees C are consistent with a uniform association rate constant for all sites labeled. Specific binding is completely reversible with addition of excess unlabeled DE, but dissociation does not proceed with simple first-order kinetics, suggesting the presence of more than one discrete binding site. Competition studies with selective drugs reveal alpha adrenergic, 5-HT1A and 5-HT1B components of (/sup 3/H)DE specific binding. When phentolamine (500 nM) is included to block alpha receptors and DPAT (100 nM) or spiroxatrine (500 nM) is included to block 5-HT1A receptors, specific binding is exclusively to sites with drug affinities characteristic of 5-HT1B receptors. Under these 5-HT1B-selective conditions, (/sup 3/H)DE binding is about 90% specific, with a Kd of about 50 to 60 pM and a Bmax of 96 fmol/mg of protein in hippocampus and 77 fmol/mg of protein in cortex. (/sup 3/H)DE binding to 5-HT1B sites is very slowly dissociable, with a T1/2 of greater than 2 h at 37 degrees C. 5-HT1B antagonists and DE itself yield competition curves at (/sup 3/H)DE-labeled 5-HT1B sites that are adequately fit assuming a single site in nonlinear regression analysis. Addition of 100 microM guanylyl 5'-imidodiphosphate appears to convert nearly all 5-HT1B sites to those having low affinity for agonists while having a much smaller effect on the binding of (/sup 3/H)DE.

  15. Formation of 8-hydroxy(deoxy)guanosine and generation of strand breaks at guanine residues in DNA by singlet oxygen

    International Nuclear Information System (INIS)

    Singlet molecular oxygen (1O2) was generated in aqueous solution (H2O or D2O) at 37 C by the thermal dissociation of the endoperoxide of 3,3'-(1,4-naphthylidene) dipropionate (NDPO2). Guanosine and deoxyguanosine quench 1O2 with overall quenching rate constants of 6.2 x 106 M-1 s-1 and 5.2 x 106 M-1 s-1, respectively. Reaction with 1O2 results in the formation of 8-hydroxyguanosine (8-OH-Guo) and 8-hydroxydeoxyguanosine (8-OH-dGuo), respectively, with a yield of 1.5% at 1 mM substrate with an NDPO2 concentration of 40 mM; a corresponding 8-hydroxy derivative is not formed from deoxyadenosine. in D2O the yield of 8-OH-Guo is 1.5-fold that in H2O. Sodium azide suppresses 8-OH-Guo and 8-OH-dGuo production. in contrast, the hydroxyl radical scavengers, tert-butanol, 2-propanol, or sodium formate, do not decrease the production of the 8-OH derivatives. The formation of 8-OH derivatives is significantly increased (2-5-fold) by thiols such as dithiothreitol, glutathione, cysteine, and cysteamine. With use of a plasmid containing a fragment of the mouse metallothionein 1 promoter (pMTP3') and a novel end-labeling technique, the position of 1O2-induced single-strand breaks in DNA was examined. Strand breaks occur selectively at dGuo; no major differences (hot spots) were observed between individual guanines

  16. The housekeeping gene hypoxanthine guanine phosphoribosyltransferase (HPRT regulates multiple developmental and metabolic pathways of murine embryonic stem cell neuronal differentiation.

    Directory of Open Access Journals (Sweden)

    Tae Hyuk Kang

    Full Text Available The mechanisms by which mutations of the purinergic housekeeping gene hypoxanthine guanine phosphoribosyltransferase (HPRT cause the severe neurodevelopmental Lesch Nyhan Disease (LND are poorly understood. The best recognized neural consequences of HPRT deficiency are defective basal ganglia expression of the neurotransmitter dopamine (DA and aberrant DA neuronal function. We have reported that HPRT deficiency leads to dysregulated expression of multiple DA-related developmental functions and cellular signaling defects in a variety of HPRT-deficient cells, including human induced pluripotent stem (iPS cells. We now describe results of gene expression studies during neuronal differentiation of HPRT-deficient murine ESD3 embryonic stem cells and report that HPRT knockdown causes a marked switch from neuronal to glial gene expression and dysregulates expression of Sox2 and its regulator, genes vital for stem cell pluripotency and for the neuronal/glial cell fate decision. In addition, HPRT deficiency dysregulates many cellular functions controlling cell cycle and proliferation mechanisms, RNA metabolism, DNA replication and repair, replication stress, lysosome function, membrane trafficking, signaling pathway for platelet activation (SPPA multiple neurotransmission systems and sphingolipid, sulfur and glycan metabolism. We propose that the neural aberrations of HPRT deficiency result from combinatorial effects of these multi-system metabolic errors. Since some of these aberrations are also found in forms of Alzheimer's and Huntington's disease, we predict that some of these systems defects play similar neuropathogenic roles in diverse neurodevelopmental and neurodegenerative diseases in common and may therefore provide new experimental opportunities for clarifying pathogenesis and for devising new potential therapeutic targets in developmental and genetic disease.

  17. Modulation of B-cell receptor and microenvironment signaling by a guanine exchange factor in B-cell malignancies

    Institute of Scientific and Technical Information of China (English)

    Wei Liao; Sanjai Sharma


    Objective: Chronic lymphocytic leukemia (CLL) and mantle cell lymphoma (MCL) cells over-express a guanine exchange factor (GEF), Rasgrf-1. This GEF increases active Ras as it catalyzes the removal of GDP from Ras so that GTP can bind and activate Ras. This study aims to study the mechanism of action of Rasgrf-1 in B-cell malignancies. Methods: N-terminus truncated Rasgrf-1 variants have a higher GEF activity as compared to the full-length transcript therefore a MCL cell line with stable over-expression of truncated Rasgrf-1 was established. The B-cell receptor (BCR) and chemokine signaling pathways were compared in the Rasgrf-1 over-expressing and a control transfected cell line. Results: Cells over-expressing truncated form of Rasgrf-1 have a higher proliferative rate as compared to control transfected cells. BCR was activated by lower concentrations of anti-IgM antibody in Rasgrf-1 over-expressing cells as compared to control cells indicating that these cells are more sensitive to BCR signaling. BCR signaling also phosphorylates Rasgrf-1 that further increases its GEF function and amplifies BCR signaling. This activation of Rasgrf-1 in over-expressing cells resulted in a higher expression of phospho-ERK, AKT, BTK and PKC-alpha as compared to control cells. Besides BCR, Rasgrf-1 over-expressing cells were also more sensitive to microenvironment stimuli as determined by resistance to apoptosis, chemotaxis and ERK pathway activation. Conclusions: This GEF protein sensitizes B-cells to BCR and chemokine mediated signaling and also upregulates a number of other signaling pathways which promotes growth and survival of these cells.

  18. Phosphorus-33-labeled nucleotide 5'-triphosphates: Applications in DNA analysis

    International Nuclear Information System (INIS)

    Synthesis of [γ-33P] adenosine 5'-triphosphate and [α-33P]2'-deoxyadenosine 5'-triphosphate was accomplished in a way similar to the preparation of 32P-labeled nucleotides. These nucleotides were then used in a variety of molecular biological applications. The techniques of DNA sequencing and nucleic acid hybridization were used to evaluate potential applications for 33P labeled nucleotides. The 33P nucleotides were compared with the 32P and 35S nucleotide equivalents for the ability to serve as substrates for various enzymes used to label DNA, T4-bacteriophage polynucleotide kinase, E. coli DNA polymerase, and T7 DNA polymerase. The products of there reactions were either separated by polyacrylamide gel electrophoresis (DNA sequencing) or used as hybridization probes on a nylon membrane. The isotopically labeled DNA was detected by autoradiography on X-ray film. The film was evaluated for relative sensitivity of the film versus time for each isotope and the sharpness or resolution of the exposed bands on the film

  19. Dynamics of Charge Transfer in Ordered and Chaotic Nucleotide Sequences

    CERN Document Server

    Fialko, N S


    Charge transfer is considered in systems composed of a donor, an acceptor and bridge sites of (AT) nucleotide pairs. For a bridge consisting of 180 (AT) pairs, three cases are dealt with: a uniform case, when all the nucleotides in each strand are identical; an ordered case, when nucleotides in each DNA strand are arranged in an orderly fashion; a chaotic case, when (AT) and (TA) pairs are arranged randomly. It is shown that in all the cases a charge transfer from a donor to an acceptor can take place. All other factors being equal, the transfer is the most efficient in the uniform case, the ordered and chaotic cases are less and the least efficient, accordingly. The results obtained are in agreement with experimental data on long-range charge transfer in DNA.

  20. Fluorescence chemosensors with pyrene and their interaction with nucleotide phosphate

    Institute of Scientific and Technical Information of China (English)

    李华平; 汪鹏飞; 吴世康


    A group of fluorescence chemosensor with pyrene, compounds (Ⅰ), (Ⅱ) and (Ⅲ), were synthesized The fluorescence spectra and the lifetime of these compounds were carefully measured. The fluorescence quenching spec tra of pyrenyl butyric acid, compounds (Ⅰ), (Ⅱ) and (Ⅲ) by different nucleotide phosphates, AMP ADP, ATP dTTP, were also recorded and studied. The quenching and the stability constants were calculated by Stern-Volmer equa tion and eq. (2), respectively. The mechanism of interaction between fluorescence chemosensor and nucleotide phos phate was didscussed based on the comparison of the results obtained with the CPK model of free molecules of these com pounds in the ground state.

  1. Exogenous Nucleotides Antagonize the Developmental Toxicity of Ethanol In Vitro


    Jie Zhao; Jia-Xi Zhao; Ya-Jun Xu


    The objective of this study was to assess whether nucleotides supplementation in vitro could suppress ethanol-induced developmental toxicity in mouse. The models of whole embryo culture (WEC) and midbrain (MB) cell micromass culture were used in this study. In WEC system, exposure to 4.0 mg/mL ethanol for 48 h yielded various developmental malformations of the mice embryos. Nucleotides supplementation (0.16, 0.80, 4.00, 20.00, and 100.00 mg/L) improved the growth parameters to some extent, an...

  2. Biocuration of functional annotation at the European nucleotide archive. (United States)

    Gibson, Richard; Alako, Blaise; Amid, Clara; Cerdeño-Tárraga, Ana; Cleland, Iain; Goodgame, Neil; Ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Pallreddy, Swapna; Pakseresht, Nima; Rajan, Jeena; Rosselló, Marc; Silvester, Nicole; Smirnov, Dmitriy; Toribio, Ana Luisa; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy


    The European Nucleotide Archive (ENA; is a repository for the submission, maintenance and presentation of nucleotide sequence data and related sample and experimental information. In this article we report on ENA in 2015 regarding general activity, notable published data sets and major achievements. This is followed by a focus on sustainable biocuration of functional annotation, an area which has particularly felt the pressure of sequencing growth. The importance of functional annotation, how it can be submitted and the shifting role of the biocurator in the context of increasing volumes of data are all discussed. PMID:26615190

  3. Investigation of specificity determinants in bacterial tRNA-guanine transglycosylase reveals queuine, the substrate of its eucaryotic counterpart, as inhibitor.

    Directory of Open Access Journals (Sweden)

    Inna Biela

    Full Text Available Bacterial tRNA-guanine transglycosylase (Tgt catalyses the exchange of the genetically encoded guanine at the wobble position of tRNAs(His,Tyr,Asp,Asn by the premodified base preQ1, which is further converted to queuine at the tRNA level. As eucaryotes are not able to synthesise queuine de novo but acquire it through their diet, eucaryotic Tgt directly inserts the hypermodified base into the wobble position of the tRNAs mentioned above. Bacterial Tgt is required for the efficient pathogenicity of Shigella sp, the causative agent of bacillary dysentery and, hence, it constitutes a putative target for the rational design of anti-Shigellosis compounds. Since mammalian Tgt is known to be indirectly essential to the conversion of phenylalanine to tyrosine, it is necessary to create substances which only inhibit bacterial but not eucaryotic Tgt. Therefore, it seems of utmost importance to study selectivity-determining features within both types of proteins. Homology models of Caenorhabditis elegans Tgt and human Tgt suggest that the replacement of Cys158 and Val233 in bacterial Tgt (Zymomonas mobilis Tgt numbering by valine and accordingly glycine in eucaryotic Tgt largely accounts for the different substrate specificities. In the present study we have created mutated variants of Z. mobilis Tgt in order to investigate the impact of a Cys158Val and a Val233Gly exchange on catalytic activity and substrate specificity. Using enzyme kinetics and X-ray crystallography, we gained evidence that the Cys158Val mutation reduces the affinity to preQ1 while leaving the affinity to guanine unaffected. The Val233Gly exchange leads to an enlarged substrate binding pocket, that is necessary to accommodate queuine in a conformation compatible with the intermediately covalently bound tRNA molecule. Contrary to our expectations, we found that a priori queuine is recognised by the binding pocket of bacterial Tgt without, however, being used as a substrate.

  4. Efficacy of different doses of atorvastatin treatment on serum levels of 8-hydroxy-guanin (8-OHdG) and cardiac function in patients with ischemic cardiomyopathy


    Jin, Yu; Qiu, Chunguang; Zheng, Qiangsun; Ling LIU; Liu, Zhiqiang; Yi WANG


    Objective: To compare the efficacy of 40 mg and l0 mg atorvastatin on serum levels of 8-Hydroxy-Guanin (8-OHdG) and the cardiac function in patients with ischemic cardiomyopathy (ICM). Methods: One hundred twenty three hospitalized ICM patients and 120 healthy controls were included in this study. All subjects were randomly divided into two groups: 10 mg/d atorvastatin group (n=62) and 40 mg/d atorvastatin group (n=61). Serum levels of C-reactive protein (CRP), creatine kinase, glutamic-pyruv...

  5. Dissecting the influence of Mg2+ on 3D architecture and ligand-binding of the guanine-sensing riboswitch aptamer domain


    Buck, Janina; Noeske, Jonas; Wöhnert, Jens; Schwalbe, Harald


    Long-range tertiary interactions determine the three-dimensional structure of a number of metabolite-binding riboswitch RNA elements and were found to be important for their regulatory function. For the guanine-sensing riboswitch of the Bacillus subtilis xpt-pbuX operon, our previous NMR-spectroscopic studies indicated pre-formation of long-range tertiary contacts in the ligand-free state of its aptamer domain. Loss of the structural pre-organization in a mutant of this RNA (G37A/C61U) result...

  6. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O; Paludan, K; Marcker, K A


    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  7. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms (United States)

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.


    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  8. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)


    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  9. DNA Nucleotides Detection via capacitance properties of Graphene (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash


    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  10. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A;


    protective effect is not mediated via those receptors. We found that a wide variety of triphosphate and diphosphate nucleotides (TTP, ITP, deoxyGTP, and GDP), provided significant cardioprotective effect. GMP, guanosine, and ribose phosphate provided no cardioprotective effect. Moreover, we observed that tri...

  11. NMR study of conformationally restricted acylic phosphonate nucleotides

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Pohl, Radek; Rejman, Dominik

    Hersonissos : -, 2013. s. 609-609. [EUROMAR 2013. A European Magnetic Resonance Meeting. 30.06.2013-05.07.2013, Hersonissos] R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : acyclic phosphonate nucleotides * conformation * pyrrolidine ring * NMR spectra * PSEUROT program * pD dependence * molecular modeling Subject RIV: CB - Analytical Chemistry, Separation

  12. Nucleotide diversity and linkage disequilibrium in balsam poplar (Populus balsamifera). (United States)

    Olson, Matthew S; Robertson, Amanda L; Takebayashi, Naoki; Silim, Salim; Schroeder, William R; Tiffin, Peter


    *Current perceptions that poplars have high levels of nucleotide variation, large effective population sizes, and rapid decay of linkage disequilibrium are based primarily on studies from one poplar species, Populus tremula. *We analysed 590 gene fragments (average length 565 bp) from each of 15 individuals from different populations from throughout the range of Populus balsamifera. *Nucleotide diversity (theta(total) = 0.0028, pi = 0.0027) was low compared with other trees and model agricultural systems. Patterns of nucleotide diversity and site frequency spectra were consistent with purifying selection on replacement and intron sites. When averaged across all loci we found no evidence for decay of linkage disequilibrium across 750 bp, consistent with the low estimates of the scaled recombination parameter, rho = 0.0092. *Compared with P. tremula, a well studied congener with a similar distribution, P. balsamifera has low diversity and low effective recombination, both of which indicate a lower effective population size in P. balsamifera. Patterns of diversity and linkage indicate that there is considerable variation in population genomic patterns among poplar species and unlike P. tremula, association mapping techniques in balsam poplar should consider sampling single nucleotide polymorphisms (SNPs) at well-spaced intervals. PMID:20122131

  13. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin;


    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from the...

  14. Nucleotide excision repair by dual incisions in plants. (United States)

    Canturk, Fazile; Karaman, Muhammet; Selby, Christopher P; Kemp, Michael G; Kulaksiz-Erkmen, Gulnihal; Hu, Jinchuan; Li, Wentao; Lindsey-Boltz, Laura A; Sancar, Aziz


    Plants use light for photosynthesis and for various signaling purposes. The UV wavelengths in sunlight also introduce DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts [(6-4)PPs] that must be repaired for the survival of the plant. Genome sequencing has revealed the presence of genes for both CPD and (6-4)PP photolyases, as well as genes for nucleotide excision repair in plants, such as Arabidopsis and rice. Plant photolyases have been purified, characterized, and have been shown to play an important role in plant survival. In contrast, even though nucleotide excision repair gene homologs have been found in plants, the mechanism of nucleotide excision repair has not been investigated. Here we used the in vivo excision repair assay developed in our laboratory to demonstrate that Arabidopsis removes CPDs and (6-4)PPs by a dual-incision mechanism that is essentially identical to the mechanism of dual incisions in humans and other eukaryotes, in which oligonucleotides with a mean length of 26-27 nucleotides are removed by incising ∼20 phosphodiester bonds 5' and 5 phosphodiester bonds 3' to the photoproduct. PMID:27071131

  15. Cyclization of nucleotide analogues as an obstacle to polymerization (United States)

    Hill, A. R. Jr; Nord, L. D.; Orgel, L. E.; Robins, R. K.


    Cyclization of activated nucleotide analogues by intramolecular phosphodiester-bond formation is likely to compete very effectively with template-directed condensation except in the cases of ribo- and arabinonucleotides. This could have excluded derivatives of most sugars from growing polyribonucleotide chains and thus reduced chain-termination in prebiotic polynucleotide synthesis.

  16. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder (United States)

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.


    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  17. Novel modified nucleobases, nucleosides and nucleotides: biological activity and applications

    Czech Academy of Sciences Publication Activity Database

    Hocek, Michal

    Louvain-La Neuve : -, 2007. PL4. [ Organic Chemistry , Present and Future. 10.04.2007-13.04.2007, Louvain-La-Neuve] R&D Projects: GA MŠk 1M0508; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleobases * nucleosides * nucleotides Subject RIV: CC - Organic Chemistry


    NARCIS (Netherlands)



    1 The response of C2C12 mouse myotubes to stimulation with adenosine triphosphate (ATP) and other nucleotides was studied by measuring changes in membrane potential. 2 A transient hyperpolarization followed by a slowly declining depolarization of the cells was observed in the presence of ATP (10-mu-

  19. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    Full Text Available BACKGROUND: The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis. CONCLUSIONS/SIGNIFICANCE: Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  20. High-throughput profiling of nucleotides and nucleotide sugars to evaluate their impact on antibody N-glycosylation. (United States)

    Villiger, Thomas K; Steinhoff, Robert F; Ivarsson, Marija; Solacroup, Thomas; Stettler, Matthieu; Broly, Hervé; Krismer, Jasmin; Pabst, Martin; Zenobi, Renato; Morbidelli, Massimo; Soos, Miroslav


    Recent advances in miniaturized cell culture systems have facilitated the screening of media additives on productivity and protein quality attributes of mammalian cell cultures. However, intracellular components are not routinely measured due to the limited throughput of available analytical techniques. In this work, time profiling of intracellular nucleotides and nucleotide sugars of CHO-S cell fed-batch processes in a micro-scale bioreactor system was carried out using a recently developed high-throughput method based on matrix-assisted laser desorption/ionization (MALDI) time-of-flight mass spectrometry (TOF-MS). Supplementation of various media additives significantly altered the intracellular nucleotides and nucleotide sugars that are inextricably linked to the process of glycosylation. The results revealed that UDP-Gal synthesis appeared to be particularly limiting whereas the impact of elevated UDP-GlcNAc and GDP-Fuc levels on the final glycosylation patterns was only marginally important. In contrast, manganese and asparagine supplementation altered the glycan profiles without affecting intracellular components. The combination of miniaturized cell cultures and high-throughput analytical techniques serves therefore as a useful tool for future quality driven media optimization studies. PMID:27131894

  1. Causes and consequences of plant radio-resistance. Formation of DNA basis lesions and self-repairing activity of one of them, the 8-oxo-7,8-dihydro-guanine in Arabidopsis thaliana

    International Nuclear Information System (INIS)

    In this research thesis, the author first explains how and why DNA is injured when it is submitted to an oxidizing stress, and describes precisely the formation and the biological consequences of lesions of DNA bases, the 8-oxo-7,8-dihydro-guanine (8-oxoGua). She describes the repairing activities of the oxidized DNA, and more particularly the repairing of 8-oxoGua, in prokaryotes as well as in yeast, mammals and plants. Methodologies used are described, together with the repair activities of the 8-oxo-7,8-dihydro-guanine following a biochemical type approach and a molecular biology approach

  2. Modification of survival of gamma irradiated mice by adenosine nucleotides

    International Nuclear Information System (INIS)

    The administration prior to irradiation of adenosine triphosphate (ATP) or other adenosine nucleotides, singly or in combination, increased the radioresistance of mice. Post-irradiation treatment with the adenosine nucleotides had no effect on the survival of the irradiated mice. Dose reduction factors of 2.32 could be obtained by pretreatment of mice with the following combination of protective agents: S-2(4-aminobutylamino)ethyl phosphorothioic aced (WR 2822), cysteamine (MEA) and ATP. Since cyclic AMP levels were unchanged in the spleen or gut by administration of cysteamine and other protectors it is unlikely that the increase in protection was due to changes in cyclic AMP levels. The calcium salt of ATP provided a higher level of protection than the ATP alone, indicating that the protective mechanism of ATP is probably not related to anoxia. (orig.)

  3. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D;


    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that...

  4. Nucleotide analogs based on pentaerythritol — An hypothesis (United States)

    Schwartz, Alan W.


    The synthesis of ribose and ribose-based nucleotides under reasonable prebiotic conditions has not been achieved. Glycerol has been suggested as a structural unit that might have preceded ribose in the evolutionary emergence of RNA. Template-directed oligomerizations of nucleotide analogs based on glycerol, however, have been only partially successful. Recent studies on the effect of ultraviolet irradiation of formaldehyde solutions have shown that the reduced sugar pentaerythritol is formed with great specificity. I argue that pentaerythritol is potentially capable of being converted by simple chemistry into a series of nucleoside analogs related to barbituric acid. These analogs may be able to take part in nucleic acid-like interactions and could therefore be of potential interest as a new class of candidates as RNA precursors.

  5. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.


    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  6. The nucleotide exchange factors of Hsp70 molecular chaperone

    Directory of Open Access Journals (Sweden)

    Andreas eBracher


    Full Text Available Molecular chaperones of the Hsp70 family form an important hub in the cellular protein folding networks in bacteria and eukaryotes, connecting translation with the downstream machineries of protein folding and degradation. The Hsp70 folding cycle is driven by two types of cochaperones: J-domain proteins stimulate ATP hydrolysis by Hsp70, while nucleotide exchange factors (NEFs promote replacement of Hsp70-bound ADP with ATP. Bacteria and organelles of bacterial origin have only one known NEF type for Hsp70, GrpE. In contrast, a large diversity of Hsp70 NEFs has been discovered in the eukaryotic cell. These NEFs belong to the Hsp110/Grp170, HspBP1/Sil1 and BAG domain protein families. In this short review we compare the structures and molecular mechanisms of nucleotide exchange factors for Hsp70 and discuss how these cochaperones contribute to protein folding and quality control in the cell.

  7. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)


    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  8. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water. (United States)

    Cafferty, Brian J; Fialho, David M; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V


    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life. PMID:27108699

  9. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water (United States)

    Cafferty, Brian J.; Fialho, David M.; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V.


    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life. PMID:27108699

  10. iCLIP: Protein–RNA interactions at nucleotide resolution


    Huppertz I; Attig J; D'Ambrogio A.; Eastonb L; Sibley CR; Sugimoto Y; Tajnik M; K\\xf6nig J; Ule J


    RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein-RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA c...

  11. Synthesis of sugar-nucleotide analogs as potential glycosyltransferase inhibitors

    Czech Academy of Sciences Publication Activity Database

    Kóšiová, Ivana; Koiš, P.; Rosenberg, Ivan


    Roč. 101, č. 11 (2007), s. 949-950. ISSN 0009-2770. [Pokroky v organické, bioorganické a farmaceutické chemii /42./. 16.11.2007-18.11.2007, Liblice] R&D Projects: GA ČR GA202/05/0628 Grant ostatní: SSTAA(SK) APVV-51-046505 Institutional research plan: CEZ:AV0Z40550506 Keywords : glycosylation * glycosyltransferase * nucleotide analogs * nucleoside phosphonates Subject RIV: CC - Organic Chemistry

  12. Conformation of pyrrolidine ring in pyrrolidine nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Pohl, Radek; Buděšínský, Miloš; Rejman, Dominik; Kočalka, Petr; Rosenberg, Ivan

    Praha : Institute of Organic Chemistry and Biochemistry ASCR, 2008 - (Hocek, M.), s. 435-436 ISBN 978-80-86241-29-6. - (Collection Symposium Series. 10). [Symposium on Chemistry of Nucleic Acid Components /14./. Český Krumlov (CZ), 08.06.2008-13.06.2008] R&D Projects: GA MŠk 2B06065 Institutional research plan: CEZ:AV0Z40550506 Keywords : NMR spectroscopy * conformation analysis * nucleotides Subject RIV: CC - Organic Chemistry

  13. Isolation and nucleotide sequence of the gene encoding human rhodopsin.


    Nathans, J; Hogness, D S


    We have isolated and completely sequenced the gene encoding human rhodopsin. The coding region of the human rhodopsin gene is interrupted by four introns, which are located at positions analogous to those found in the previously characterized bovine rhodopsin gene. The amino acid sequence of human rhodopsin, deduced from the nucleotide sequence of its gene, is 348 residues long and is 93.4% homologous to that of bovine rhodopsin. Interestingly, those portions of the polypeptide chain predicte...

  14. Single nucleotide polymorphisms of complement component 5 and periodontitis


    L. Chai; Zee, KY; Song, YQ; Leung, WK


    BACKGROUND AND OBJECTIVE: Polymorphisms of host defence genes might increase one's risks for periodontitis. This study investigated whether tagging single nucleotide polymorphisms (SNPs) of the gene encoding complement component 5 (C5) are associated with periodontitis in a Hong Kong Chinese population. MATERIAL AND METHODS: Eleven tagging SNPs of 229 patients with at least moderate periodontitis and 207 control subjects without periodontitis were genotyped using an i-plexGOLD MassARRAY mass-...

  15. Utilizing Single Nucleotide Polymorphism Analysis in Determining Parentage of Cattle


    Elbert, Nicole M.


    Parentage identification within cattle herds is an important aspect of record keeping. It is essential for accurate registration within a purebred association and decision making for production purposes, such as replacement heifer and sire selection. Methods used to identify parentage have evolved from utilizing blood protein antigens, restriction fragment length polymorphism (RFLP) and microsatellites to the current technology of analyzing DNA profiles for differing single nucleotide polymor...

  16. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.


    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  17. Haplotype Information and Linkage Disequilibrium Mapping for Single Nucleotide Polymorphisms


    Lu, Xin; Niu, Tianhua; Liu, Jun


    Single nucleotide polymorphisms in the human genome have become an increasingly popular topic in that their analyses promise to be a key step toward personalized medicine. We investigate two related questions, how much the haplotype information contributes to linkage disequilibrium (LD) mapping and whether an in silico haplotype construction preceding the LD analysis can help. For disease gene mapping, using both simulated and real data sets on cystic fibrosis and the Alzheimer disease, we re...

  18. Haplotype Information and Linkage Disequilibrium Mapping for Single Nucleotide Polymorphisms


    Lu, Xin; Niu, Tianhua; Liu, Jun S.


    Single nucleotide polymorphisms in the human genome have become an increasingly popular topic in that their analyses promise to be a key step toward personalized medicine. We investigate two related questions, how much the haplotype information contributes to linkage disequilibrium (LD) mapping and whether an in silico haplotype construction preceding the LD analysis can help. For disease gene mapping, using both simulated and real data sets on cystic fibrosis and the Alzheimer disease,...

  19. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts


    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; NISHIHARA, Tatsuji; Kawamoto, Tatsuo


    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontob...

  20. MGMT expression: insights into its regulation. 2. Single nucleotide polymorphisms


    Iatsyshyna A. P.; Pidpala O. V.; Lukash L. L.


    High intra- and interindividual variations in the expression levels of the human O6-methylguanine-DNA methyltransferase (MGMT) gene have been observed. This DNA repair enzyme can be a cause of resistance of cancer cells to alkylating chemotherapy. It has been studied the association of single nucleotide polymorphisms (SNPs) of MGMT with the risk for different types of cancer, progression-free survival in patients with cancer treated with alkylating chemotherapy, as well as an effect of SNPs o...

  1. A Simple Strategy for Glycosyltransferase-Catalyzed Aminosugar Nucleotide Synthesis


    Zhang, Jianjun; Singh, Shanteri; Hughes, Ryan R.; Zhou, Maoquan; Sunkara, Manjula; Morris, Andrew J.; Thorson, Jon S.


    A set of 2-chloro-4-nitrophenyl glucosamino/xylosaminosides were synthesized and assessed as potential substrates in the context of glycosyltransferase-catalyzed formation of the corresponding UDP/TDP-α-D-glucosamino-/xylosaminosugars and single vessel transglycosylation reactions with a model acceptor. This study highlights a robust platform for aminosugar nucleotide synthesis and reveals OleD Loki as a proficient catalyst for U/TDP-aminosugar synthesis and utilization.

  2. Single nucleotide polymorphisms predict symptom severity of autism spectrum disorder


    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H


    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs) can predict symptom severity of autism spectrum disorder (ASD). We divided 118 ASD children into a mild/moderate autism group (n = 65) and a severe a...

  3. SSE: a nucleotide and amino acid sequence analysis platform


    Simmonds Peter


    Abstract Background There is an increasing need to develop bioinformatic tools to organise and analyse the rapidly growing amount of nucleotide and amino acid sequence data in organisms ranging from viruses to eukaryotes. Finding A simple sequence editor (SSE) was developed to create an integrated environment where sequences can be aligned, annotated, classified and directly analysed by a number of built-in bioinformatic programs. SSE incorporates a sequence editor for the creation of sequenc...

  4. Analysis of Single Nucleotide Polymorphism Panels for Bovine DNA Identification


    Blanchard, Kimberly A.


    Single nucleotide polymorphisms (SNPs) are single base-pair variations that exist between individuals. There are approximately a million or more SNPs located throughout the genome of each individual animal. Therefore, by taking advantage of these unique polymorphisms, SNPs can be used to resolve questions of unknown parentage in the livestock industry. Currently a panel of 88 SNPs, obtained from a panel of 121 SNPs originally created by USDA-MARC, is commercially available from Fluidigm®. The...

  5. Monovar: single-nucleotide variant detection in single cells. (United States)

    Zafar, Hamim; Wang, Yong; Nakhleh, Luay; Navin, Nicholas; Chen, Ken


    Current variant callers are not suitable for single-cell DNA sequencing, as they do not account for allelic dropout, false-positive errors and coverage nonuniformity. We developed Monovar (, a statistical method for detecting and genotyping single-nucleotide variants in single-cell data. Monovar exhibited superior performance over standard algorithms on benchmarks and in identifying driver mutations and delineating clonal substructure in three different human tumor data sets. PMID:27088313

  6. The effect of mitochondrial dysfunction on cytosolic nucleotide metabolism

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Lykke, Anne; Rasmussen, Lene Juel


    Several enzymes of the metabolic pathways responsible for metabolism of cytosolic ribonucleotides and deoxyribonucleotides are located in mitochondria. Studies described in this paper suggest dysfunction of the mitochondria to affect these metabolic pathways and limit the available levels of...... cytosolic ribonucleotides and deoxyribonucleotides, which in turn can result in aberrant RNA and DNA synthesis. Mitochondrial dysfunction has been linked to genomic instability, and it is possible that the limiting effect of mitochondrial dysfunction on the levels of nucleotides and resulting aberrant RNA...

  7. Single-nucleotide polymorphism identification and genotyping in Camelina sativa


    Singh, Ravinder; Bollina, Venkatesh; Higgins, Erin E.; Clarke, Wayne E.; Eynck, Christina; Sidebottom, Christine; Gugel, Richard; Snowdon, Rod; Parkin, Isobel A. P.


    Camelina sativa, a largely relict crop, has recently returned to interest due to its potential as an industrial oilseed. Molecular markers are key tools that will allow C. sativa to benefit from modern breeding approaches. Two complementary methodologies, capture of 3′ cDNA tags and genomic reduced-representation libraries, both of which exploited second generation sequencing platforms, were used to develop a low density (768) Illumina GoldenGate single nucleotide polymorphism (SNP) array. Th...

  8. Genome-wide patterns of nucleotide polymorphism in domesticated rice.

    Directory of Open Access Journals (Sweden)

    Ana L Caicedo


    Full Text Available Domesticated Asian rice (Oryza sativa is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models to explain contemporary patterns of polymorphisms in rice, including a (i selectively neutral population bottleneck model, (ii bottleneck plus migration model, (iii multiple selective sweeps model, and (iv bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been the dominant demographic model for domesticated species, cannot explain the derived nucleotide polymorphism site frequency spectrum in rice. Instead, a bottleneck model that incorporates selective sweeps, or a more complex demographic model that includes subdivision and gene flow, are more plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that selection results only in a local signature of variation.

  9. Nucleotide Sequencing and Identification of Some Wild Mushrooms

    Directory of Open Access Journals (Sweden)

    Sudip Kumar Das


    Full Text Available The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India was amplified using ITS1 (Internal Transcribed Spacers 1 and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base of Amanita hemibapha [CN (Chota Nagpur 1, % identity 99 (JX844716.1], Amanita sp. [CN 2, % identity 98 (JX844763.1], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1], Termitomyces sp. [CN 4, % identity 90 (JF746992.1], Termitomyces sp. [CN 5, % identity 99 (GU001667.1], T. microcarpus [CN 6, % identity 82 (EF421077.1], Termitomyces sp. [CN 7, % identity 76 (JF746993.1], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  10. A Fluorimetric Readout Reporting the Kinetics of Nucleotide-Induced Human Ribonucleotide Reductase Oligomerization


    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A.; Aye, Yimon


    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typicall...

  11. Performance-enhancing effects of dietary nucleotides: do mitochondria play a role?

    Directory of Open Access Journals (Sweden)

    Sergej M. Ostojic


    Full Text Available Nucleotides are group of natural biomonomeric molecules and novel dietary supplements with performance-enhancing attributes. However, their mechanisms of action and target biological structures are poorly understood and identified. This short paper overviews the possible role of mitochondria during the utilization of nucleotides for exercise performance. Mitochondria-related effects of nucleotides have been identified, along with obstacles for dietary nucleotides delivery to the organelle.

  12. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    Energy Technology Data Exchange (ETDEWEB)

    McCready, Paula M. (Tracy, CA); Radnedge, Lyndsay (San Mateo, CA); Andersen, Gary L. (Berkeley, CA); Ott, Linda L. (Livermore, CA); Slezak, Thomas R. (Livermore, CA); Kuczmarski, Thomas A. (Livermore, CA)


    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  13. Identification of the Structural Features of Guanine Derivatives as MGMT Inhibitors Using 3D-QSAR Modeling Combined with Molecular Docking. (United States)

    Sun, Guohui; Fan, Tengjiao; Zhang, Na; Ren, Ting; Zhao, Lijiao; Zhong, Rugang


    DNA repair enzyme O⁶-methylguanine-DNA methyltransferase (MGMT), which plays an important role in inducing drug resistance against alkylating agents that modify the O⁶ position of guanine in DNA, is an attractive target for anti-tumor chemotherapy. A series of MGMT inhibitors have been synthesized over the past decades to improve the chemotherapeutic effects of O⁶-alkylating agents. In the present study, we performed a three-dimensional quantitative structure activity relationship (3D-QSAR) study on 97 guanine derivatives as MGMT inhibitors using comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) methods. Three different alignment methods (ligand-based, DFT optimization-based and docking-based alignment) were employed to develop reliable 3D-QSAR models. Statistical parameters derived from the models using the above three alignment methods showed that the ligand-based CoMFA (Qcv² = 0.672 and Rncv² = 0.997) and CoMSIA (Qcv² = 0.703 and Rncv² = 0.946) models were better than the other two alignment methods-based CoMFA and CoMSIA models. The two ligand-based models were further confirmed by an external test-set validation and a Y-randomization examination. The ligand-based CoMFA model (Qext² = 0.691, Rpred² = 0.738 and slope k = 0.91) was observed with acceptable external test-set validation values rather than the CoMSIA model (Qext² = 0.307, Rpred² = 0.4 and slope k = 0.719). Docking studies were carried out to predict the binding modes of the inhibitors with MGMT. The results indicated that the obtained binding interactions were consistent with the 3D contour maps. Overall, the combined results of the 3D-QSAR and the docking obtained in this study provide an insight into the understanding of the interactions between guanine derivatives and MGMT protein, which will assist in designing novel MGMT inhibitors with desired activity. PMID:27347909

  14. Identification of the Structural Features of Guanine Derivatives as MGMT Inhibitors Using 3D-QSAR Modeling Combined with Molecular Docking

    Directory of Open Access Journals (Sweden)

    Guohui Sun


    Full Text Available DNA repair enzyme O6-methylguanine-DNA methyltransferase (MGMT, which plays an important role in inducing drug resistance against alkylating agents that modify the O6 position of guanine in DNA, is an attractive target for anti-tumor chemotherapy. A series of MGMT inhibitors have been synthesized over the past decades to improve the chemotherapeutic effects of O6-alkylating agents. In the present study, we performed a three-dimensional quantitative structure activity relationship (3D-QSAR study on 97 guanine derivatives as MGMT inhibitors using comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods. Three different alignment methods (ligand-based, DFT optimization-based and docking-based alignment were employed to develop reliable 3D-QSAR models. Statistical parameters derived from the models using the above three alignment methods showed that the ligand-based CoMFA (Qcv2 = 0.672 and Rncv2 = 0.997 and CoMSIA (Qcv2 = 0.703 and Rncv2 = 0.946 models were better than the other two alignment methods-based CoMFA and CoMSIA models. The two ligand-based models were further confirmed by an external test-set validation and a Y-randomization examination. The ligand-based CoMFA model (Qext2 = 0.691, Rpred2 = 0.738 and slope k = 0.91 was observed with acceptable external test-set validation values rather than the CoMSIA model (Qext2 = 0.307, Rpred2 = 0.4 and slope k = 0.719. Docking studies were carried out to predict the binding modes of the inhibitors with MGMT. The results indicated that the obtained binding interactions were consistent with the 3D contour maps. Overall, the combined results of the 3D-QSAR and the docking obtained in this study provide an insight into the understanding of the interactions between guanine derivatives and MGMT protein, which will assist in designing novel MGMT inhibitors with desired activity.

  15. n-Nucleotide circular codes in graph theory. (United States)

    Fimmel, Elena; Michel, Christian J; Strüngmann, Lutz


    The circular code theory proposes that genes are constituted of two trinucleotide codes: the classical genetic code with 61 trinucleotides for coding the 20 amino acids (except the three stop codons {TAA,TAG,TGA}) and a circular code based on 20 trinucleotides for retrieving, maintaining and synchronizing the reading frame. It relies on two main results: the identification of a maximal C(3) self-complementary trinucleotide circular code X in genes of bacteria, eukaryotes, plasmids and viruses (Michel 2015 J. Theor. Biol. 380, 156-177. (doi:10.1016/j.jtbi.2015.04.009); Arquès & Michel 1996 J. Theor. Biol. 182, 45-58. (doi:10.1006/jtbi.1996.0142)) and the finding of X circular code motifs in tRNAs and rRNAs, in particular in the ribosome decoding centre (Michel 2012 Comput. Biol. Chem. 37, 24-37. (doi:10.1016/j.compbiolchem.2011.10.002); El Soufi & Michel 2014 Comput. Biol. Chem. 52, 9-17. (doi:10.1016/j.compbiolchem.2014.08.001)). The univerally conserved nucleotides A1492 and A1493 and the conserved nucleotide G530 are included in X circular code motifs. Recently, dinucleotide circular codes were also investigated (Michel & Pirillo 2013 ISRN Biomath. 2013, 538631. (doi:10.1155/2013/538631); Fimmel et al. 2015 J. Theor. Biol. 386, 159-165. (doi:10.1016/j.jtbi.2015.08.034)). As the genetic motifs of different lengths are ubiquitous in genes and genomes, we introduce a new approach based on graph theory to study in full generality n-nucleotide circular codes X, i.e. of length 2 (dinucleotide), 3 (trinucleotide), 4 (tetranucleotide), etc. Indeed, we prove that an n-nucleotide code X is circular if and only if the corresponding graph [Formula: see text] is acyclic. Moreover, the maximal length of a path in [Formula: see text] corresponds to the window of nucleotides in a sequence for detecting the correct reading frame. Finally, the graph theory of tournaments is applied to the study of dinucleotide circular codes. It has full equivalence between the combinatorics

  16. The nucleotide sequence and genome organization of Plasmopara halstedii virus

    Directory of Open Access Journals (Sweden)

    Göpfert Jens C


    Full Text Available Abstract Background Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Methods Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. Results The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2 were established. RNA1 consisted of 2793 nucleotides (nt exclusive its 3' poly(A tract and a single open-reading frame (ORF1 of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR of 18 nt and a 3' untranslated region (3' UTR of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A tract and a second ORF (ORF2 of 1128 nt. ORF2 coded for the single viral coat protein (CP and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb and RNA2 (ca. 1.4 kb were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. Conclusions The results showed the presence of a single and new

  17. A Method for Quantification of Nucleotides and Nucleotide Analogues in Thymidine Kinase Assays Utilizing Lanthanum Phosphate Co-Precipitation


    Gammon, ST; Bernstein, M; Schuster, DP; Piwnica-Worms, D


    Current methodologies for quantifying radiolabeled nucleoside monophosphates and nucleoside analogues result in high retention of unphosphorylated guanosine nucleosides in the case of lanthanum chloride precipitation or inconsistent retention of nucleotides in the case of DEAE cellulose filter papers. This study describes an innovative method for quantifying TK activity that is compatible with both purine and pyrimidine nucleoside analogues by utilizing lanthanum phosphate co-precipitation at...

  18. Correlated ab inito Study of Nucleic Acid Bases and Their Tautomers in the Gas Phase, in a Microhydrated Environment and in Aqueous Solution. Guanine: Surprising Stabilization of Rare Tautomers in Aqueous Solution

    Czech Academy of Sciences Publication Activity Database

    Hanus, Michal; Ryjáček, Filip; Kubař, Tomáš; Bogdan, T. V.; Trygubenko, S. A.; Kabeláč, Martin; Hobza, Pavel


    Roč. 125, č. 25 (2003), s. 7678-7688. ISSN 0002-7863 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : nucleic acid bases * gas phase * guanine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.516, year: 2003

  19. Quantum processes in 8-Oxo-Guanine-Ru(bipyridine){3/2+} photosynthetic systems of artificial minimal cells (United States)

    Tamulis, Arvydas; Grigalavicius, Mantas; Krisciukaitis, Sarunas; Medzevicius, Giedrius


    Density functional theory methods were used to investigate various self-assembled photoactive bioorganic systems of interest for artificial minimal cells. The cell systems studied are based on nucleotides or their compounds and consisted of up to 123 atoms (not including the associated water or methanol solvent shells) and are up to 2.5 nm in diameter. The electron correlation interactions responsible for the weak hydrogen and Van derWaals chemical bonds increase due to the addition of a polar solvent (water or methanol). The precursor fatty acid molecules of the system also play a critical role in the quantum mechanical interaction based self-assembly of the photosynthetic center and the functioning of the photosynthetic processes of the artificial minimal cells. The distances between the separated sensitizer, fatty acid precursor, and methanol molecules are comparable to Van derWaals and hydrogen bonding radii. As a result the associated electron correlation interactions compress the overall system, resulting in an even smaller gap between the highest occupied molecular orbital (HOMO), and lowest unoccupied molecular orbital (LUMO) electron energy levels and photoexcited electron tunnelling occurs from the sensitizer (either Ru(bpy){3/2+} or [Ru(bpy)2(4-Bu-4'-Me-2,2'-bpy)]2++ derivatives) to the precursor fatty acid molecules (notation used: Me = methyl; Bu = butyl; bpy = bipyridine). The shift of the absorption spectrum to the red for the artificial protocell photosynthetic centers might be considered as the measure of the complexity of these systems.

  20. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine-cytosine base pair: Ring-polymer and classical molecular dynamics simulations (United States)

    Minoshima, Yusuke; Seki, Yusuke; Takayanagi, Toshiyuki; Shiga, Motoyuki


    The dynamical process of electron attachment to a guanine-cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  1. Reactivities of radicals of adenine and guanine towards reactive oxygen species and reactive nitrogen oxide species: OH rad and NO 2rad (United States)

    Agnihotri, Neha; Mishra, P. C.


    Reactions of radicals of the DNA bases with reactive oxygen species and reactive nitrogen oxide species produce mutagenic products. We have studied reactivities of all the carbon sites of radicals of adenine A(-H) rad and guanine G(-H) rad obtained by removal of H-atoms from their nitrogen sites towards OH rad and NO 2rad . We studied stabilities of A(-H) rad and G(-H) rad and binding energies of their adducts with each of OH rad and NO 2rad using density functional theoretic and MP2 calculations employing the AUG-cc-pVDZ basis set. Solvation in aqueous media was treated using the polarization continuum model. The results obtained explain experimental observations.

  2. AHPG: 9-[(1-amino-3-hydroxy-2-propoxy)methyl]guanine. Synthesis, biological evaluation, and biochemical mechanism of action in the L1210 cell system

    International Nuclear Information System (INIS)

    This thesis involved the synthesis, biological evaluation, and determination of the mechanism of cytotoxicity of 9-[(1-amino-3-hydroxy-2-propoxy)methyl]guanine, AHPG. This acyclic nucleoside was synthesized by a novel route and purified by state-of-the-art chromatography. The antimetabolite was screened for cytotoxic activity and was found to be most effective against L1210 cells among those systems tested. Initial biochemical studies in this system indicated that AHPG significantly decreased the incorporation of amino acids into L1210 acid-insoluble material without altering the incorporation of precursor molecules into DNA or RNA. Electrophoretic analysis of the nuclear and cytoplasmic proteins formed in the presence of drug indicated that this effect was a generalized phenomenon. Additionally, AHPG was found not to alter amino acid transport into L1210 cells. Since AHPG is a modified precursor of DNA and RNA, it was essential to evaluate the influence of this agent on these macromolecules. DNA and RNA were isolated from L1210 cells which had been treated with radiolabeled AHPG (tritium in the guanine base). HPLC analysis indicated that native AHPG was not present in the nucleic acids and phosphorylated AHPG was not found in cytosolic fractions. Since all the data suggested that the primary effect of AHPG might be directed at the level of translation, ribosomes and polysomes were isolated in the presence and absence of drug. After sixty minutes of exposure to AHPG there was a significant decrease in the levels of these complexes, suggesting that AHPG invokes its initial cytotoxic action directly at the level of protein synthesis. In summary, AHPG produces toxicity in L1210 cells by altering protein metabolism

  3. Binding of nucleotides to nucleoside diphosphate kinase: a calorimetric study. (United States)

    Cervoni, L; Lascu, I; Xu, Y; Gonin, P; Morr, M; Merouani, M; Janin, J; Giartosio, A


    The source of affinity for substrates of human nucleoside diphosphate (NDP) kinases is particularly important in that its knowledge could be used to design more effective antiviral nucleoside drugs (e.g., AZT). We carried out a microcalorimetric study of the binding of enzymes from two organisms to various nucleotides. Isothermal titration calorimetry has been used to characterize the binding in terms of Delta G degrees, Delta H degrees and Delta S degrees. Thermodynamic parameters of the interaction of ADP with the hexameric NDP kinase from Dictyostelium discoideum and with the tetrameric enzyme from Myxococcus xanthus, at 20 degrees C, were similar and, in both cases, binding was enthalpy-driven. The interactions of ADP, 2'deoxyADP, GDP, and IDP with the eukaryotic enzyme differed in enthalpic and entropic terms, whereas the Delta G degrees values obtained were similar due to enthalpy--entropy compensation. The binding of the enzyme to nonphysiological nucleotides, such as AMP--PNP, 3'deoxyADP, and 3'-deoxy-3'-amino-ADP, appears to differ in several respects. Crystallography of the protein bound to 3'-deoxy-3'-amino-ADP showed that the drug was in a distorted position, and was unable to interact correctly with active site side chains. The interaction of pyrimidine nucleoside diphosphates with the hexameric enzyme is characterized by a lower affinity than that with purine nucleotides. Titration showed the stoichiometry of the interaction to be abnormal, with 9--12 binding sites/hexamer. The presence of supplementary binding sites might have physiological implications. PMID:11294625

  4. Study of sperm cell phosphorylating systems using nucleotide photoaffinity probes

    International Nuclear Information System (INIS)

    The major thrust of the research presented in this thesis was to identify specific nucleotide binding proteins and phosphoproteins of rat caput and cauda sperm. Also, the differences in these proteins between caput and cauda sperm were investigated as well as determination of the membrane sidedness of the proteins and their location in either the head or tail/mid-piece region. In addition, the effects of small molecular weight modifers such as cGMP, cAMP and Ca2+ on the detection of binding proteins and phosphorylated proteins was studied. The technique used to identify and locate nucleotide binding proteins was photoaffinity labeling using the proven 8-azidopurine nucleotide analogs of cAMP, ATP and GTP in radioactive form. The first study presented involved the use of [32P]8-N 3cAMP which showed that both caput and cauda sperm contained both type I and type II regulatory subunits (R/sub I/ and R/sub II/, respectively) of the cAMP dependent kinases and that the great majority of the regulatory subunits were located in the tail/mid-piece section and not in the sperm head. The second phase of this study involved the use of [γ32P]8-azidoadensosine triphosphate ([γ32P]8-N3ATP) and (γ32P)8-azidoguanosine triphosphate ([γ32P]8-N3GTP) to photolable specific ATP and GTP binding proteins and to phosphorylate specific phosphoproteins. Again, this was done on caput versus cauda sperm and the location of the majority of the photolabeled or phosphorylated proteins was shown to be in the tail/mid-piece fraction. In addition, considerable differences were found in both the phosphorylated and photolabeled proteins of caput versus cauda sperm

  5. Comparative nucleotide diversity across North American and European populus species. (United States)

    Ismail, Mohamed; Soolanayakanahally, Raju Y; Ingvarsson, Pär K; Guy, Robert D; Jansson, Stefan; Silim, Salim N; El-Kassaby, Yousry A


    Nucleotide polymorphisms in two North American balsam poplars (Populus trichocarpa Torr. & Gray and P. balsamifera L.; section Tacamahaca), and one Eurasian aspen (P. tremula L.; section Populus) were compared using nine loci involved in defense, stress response, photoperiodism, freezing tolerance, and housekeeping. Nucleotide diversity varied among species and was highest for P. tremula (θ(w) = 0.005, π(T) = 0.007) as compared to P. balsamifera (θ(w) = 0.004, π(T) = 0.005) or P. trichocarpa (θ(w) = 0.002, π(T) = 0.003). Across species, the defense and the stress response loci accounted for the majority of the observed level of nucleotide diversity. In general, the studied loci did not deviate from neutral expectation either at the individual locus (non-significant normalized Fay and Wu's H) or at the multi-locus level (non-significant HKA test). Using molecular clock analysis, section Tacamahaca probably shared a common ancestor with section Populus approximately 4.5 million year ago. Divergence between the two closely related balsam poplars was about 0.8 million years ago, a pattern consistent with an isolation-with-migration (IM) model. As expected, P. tremula showed a five-fold higher substitution rate (2 × 10(-8) substitution/site/year) compared to the North American species (0.4 × 10(-8) substitution/site/year), probably reflecting its complex demographic history. Linkage disequilibrium (LD) varied among species with a more rapid decay in the North American species (balsam poplar species likely reflects the recent time of their divergence. PMID:22562720

  6. Bioinformatics comparison of sulfate-reducing metabolism nucleotide sequences (United States)

    Tremberger, G.; Dehipawala, Sunil; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.


    The sulfate-reducing bacteria can be traced back to 3.5 billion years ago. The thermodynamics details of the sulfur cycle have been well documented. A recent sulfate-reducing bacteria report (Robator, Jungbluth, et al , 2015 Jan, Front. Microbiol) with Genbank nucleotide data has been analyzed in terms of the sulfite reductase (dsrAB) via fractal dimension and entropy values. Comparison to oil field sulfate-reducing sequences was included. The AUCG translational mass fractal dimension versus ATCG transcriptional mass fractal dimension for the low temperature dsrB and dsrA sequences reported in Reference Thirteen shows correlation R-sq ~ 0.79 , with a probably of about 3% in simulation. A recent report of using Cystathionine gamma-lyase sequence to produce CdS quantum dot in a biological method, where the sulfur is reduced just like in the H2S production process, was included for comparison. The AUCG mass fractal dimension versus ATCG mass fractal dimension for the Cystathionine gamma-lyase sequences was found to have R-sq of 0.72, similar to the low temperature dissimilatory sulfite reductase dsr group with 3% probability, in contrary to the oil field group having R-sq ~ 0.94, a high probable outcome in the simulation. The other two simulation histograms, namely, fractal dimension versus entropy R-sq outcome values, and di-nucleotide entropy versus mono-nucleotide entropy R-sq outcome values are also discussed in the data analysis focusing on low probability outcomes.

  7. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))


    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  8. Usefulness of single nucleotide polymorphism data for estimating population parameters.


    Kuhner, M K; Beerli, P; Yamato, J; Felsenstein, J


    Single nucleotide polymorphism (SNP) data can be used for parameter estimation via maximum likelihood methods as long as the way in which the SNPs were determined is known, so that an appropriate likelihood formula can be constructed. We present such likelihoods for several sampling methods. As a test of these approaches, we consider use of SNPs to estimate the parameter Theta = 4N(e)micro (the scaled product of effective population size and per-site mutation rate), which is related to the br...

  9. Metal-based chemosensors for amino acids, peptides, and nucleotides


    Buryak, Andrey


    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  10. Metal-based chemosensors for amino acids, peptides, and nucleotides


    Buryak, Andrey; Severin, Kay


    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  11. Purine nucleotide synthesis in cultured rat embryos undergoing organogenesis

    International Nuclear Information System (INIS)

    The authors show that de n ovo synthesis is the sole source of the purine nucleotides required for in vitro rat embryonic growth during organogenesis. The presence of high levels of activity of purine catabolic enzymes in the homologous serum essential for culture prohibits the salvage of purine. While the 3-carbon atom of serine is the major source of one carbon units for purine ring synthesis there is a significant contribution from the 2-ring carbon atom of tryptophan. The paper describes in detail the incorporation of (1-14C)glycine into the acid soluble phase and other processes connected with de novo purine synthesis

  12. Nucleotide sequence of a spinach chloroplast valine tRNA.


    Sprouse, H M; Kashdan, M; Otis, L; Dudock, B


    The nucleotide sequence of a spinach chloroplast valine tRNA (sp. chl. tRNA Val) has been determined. This tRNA shows essentially equal homology to prokaryotic valine tRNAs (58-65% homology) and to the mitochondrial valine tRNAs of lower eukaryotes (yeast and N. crassa, 61-62% homology). Sp. chl. tRNA Val shows distinctly lower homology to mouse mitochondrial valine tRNA (53% homology) and to eukaryotic cytoplasmic valine tRNAs (47-53% homology). Sp. chl. tRNA Val, like all other chloroplast ...

  13. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian


    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  14. Single nucleotide polymorphism analysis of European archaeological M. leprae DNA.

    Directory of Open Access Journals (Sweden)

    Claire L Watson

    Full Text Available BACKGROUND: Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA from medieval bones and single nucleotide polymorphism (SNP typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. METHODS AND FINDINGS: Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia and are dated around the medieval period (476 to 1350 A.D.. we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3. CONCLUSIONS: These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide.

  15. Nucleotide variation in the Toxoplasma gondii micronemal protein 8 gene. (United States)

    Li, Z Y; Song, H Q; Wang, C R; Zhu, X Q


    Toxoplasma gondii is a successful opportunistic protozoan distributed worldwide, which can infect all vertebrates, leading to serious infection, blindness, and abortion. Micronemal (MIC) proteins are critically important for T. gondii infection, as they participate in various stages of the Toxoplasma life cycle, including invasion and attachment to host cells. MIC8 secretion relies on the concentration of intracellular calcium, and can mediate the invasion of T. gondii by interacting with soluble MIC3. To investigate genetic diversity of the MIC8 gene, 16 T. gondii strains from different hosts and geographical locations, and two reference isolates (ToxoDB: TGME49_245490 and TGVEG_245490) were examined in this study. The results showed that all the examined MIC8 genes are 2055 bp, with an A+T content ranging from 50.2 to 50.6%. Conversely, lower levels of variation were detected within their nucleotide and amino acid sequences. Phylogenetic analyses indicated that three classical genotypes of T. gondii and the ToxoDB#9 genotype did not group exclusively via Bayesian inference, maximum parsimony, neighbor joining, and/or maximum likelihood assays based on the nucleotide and amino acid sequences of the MIC8 gene. In summary, the T. gondii MIC8 gene is not a suitable marker for population genetic studies of this parasite. PMID:27173337

  16. Structure and function of nucleotide sugar transporters: Current progress

    Directory of Open Access Journals (Sweden)

    Barbara Hadley


    Full Text Available The proteomes of eukaryotes, bacteria and archaea are highly diverse due, in part, to the complex post-translational modification of protein glycosylation. The diversity of glycosylation in eukaryotes is reliant on nucleotide sugar transporters to translocate specific nucleotide sugars that are synthesised in the cytosol and nucleus, into the endoplasmic reticulum and Golgi apparatus where glycosylation reactions occur. Thirty years of research utilising multidisciplinary approaches has contributed to our current understanding of NST function and structure. In this review, the structure and function, with reference to various disease states, of several NSTs including the UDP-galactose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, GDP-fucose, UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose and CMP-sialic acid transporters will be described. Little is known regarding the exact structure of NSTs due to difficulties associated with crystallising membrane proteins. To date, no three-dimensional structure of any NST has been elucidated. What is known is based on computer predictions, mutagenesis experiments, epitope-tagging studies, in-vitro assays and phylogenetic analysis. In this regard the best-characterised NST to date is the CMP-sialic acid transporter (CST. Therefore in this review we will provide the current state-of-play with respect to the structure–function relationship of the (CST. In particular we have summarised work performed by a number groups detailing the affect of various mutations on CST transport activity, efficiency, and substrate specificity.

  17. Evaluation of published single nucleotide polymorphisms associated with acute GVHD. (United States)

    Chien, Jason W; Zhang, Xinyi Cindy; Fan, Wenhong; Wang, Hongwei; Zhao, Lue Ping; Martin, Paul J; Storer, Barry E; Boeckh, Michael; Warren, Edus H; Hansen, John A


    Candidate genetic associations with acute GVHD (aGVHD) were evaluated with the use of genotyped and imputed single-nucleotide polymorphism data from genome-wide scans of 1298 allogeneic hematopoietic cell transplantation (HCT) donors and recipients. Of 40 previously reported candidate SNPs, 6 were successfully genotyped, and 10 were imputed and passed criteria for analysis. Patient and donor genotypes were assessed for association with grades IIb-IV and III-IV aGVHD, stratified by donor type, in univariate and multivariate allelic, recessive and dominant models. Use of imputed genotypes to replicate previous IL10 associations was validated. Similar to previous publications, the IL6 donor genotype for rs1800795 was associated with a 20%-50% increased risk for grade IIb-IV aGVHD after unrelated HCT in the allelic (adjusted P = .011) and recessive (adjusted P = .0013) models. The donor genotype was associated with a 60% increase in risk for grade III-IV aGVHD after related HCT (adjusted P = .028). Other associations were found for IL2, CTLA4, HPSE, and MTHFR but were inconsistent with original publications. These results illustrate the advantages of using imputed single-nucleotide polymorphism data in genetic analyses and demonstrate the importance of validation in genetic association studies. PMID:22282500

  18. Action of ''Bipenst'' preparation and dimethylsulfoxide on the adenyl nucleotide content in liver of irradiated animals

    International Nuclear Information System (INIS)

    Action of parenteral administration of a biostimulator ''Bipenst'' and a 10; dimethylsulfoxide solution on the level of adenyl nucleotides in the liver of rats subjected to a single whole-body irradiation (243 R) has been studied. It has been found that the level of adenyl nucleotides in the liver of irradiated animals decreases, and adenyl nucleotide content normalizes under the action of the preparations under study

  19. The complete nucleotide sequence of the RNA coding for the primary translation product of foot and mouth disease virus.



    The complete nucleotide sequence of the coding region of foot and mouth disease virus RNA (strain A1061) is presented. The sequence extends from the primary initiation site, approximately 1200 nucleotide from the 5' end of the genome, in an open translational reading frame of 6,999 nucleotides to a termination codon 93 nucleotides from the 3' terminal poly (A). Available amino acid sequence data correlates with that predicted from the nucleotide sequence. The amino acid sequence around cleava...

  20. Enzymatic polymerisation involving 2'-amino-LNA nucleotides. (United States)

    Johannsen, Marie W; Veedu, Rakesh N; Madsen, Andreas Stahl; Wengel, Jesper


    The triphosphate of the thymine derivative of 2'-amino-LNA (2'-amino-LNA-TTP) was synthesised and found to be a good substrate for Phusion® HF DNA polymerase, allowing enzymatic synthesis of modified DNA encoded by an unmodified template. To complement this, 2'-amino-LNA-T phosphoramidites were incorporated into DNA oligonucleotides which were used as templates for enzymatic synthesis of unmodified DNA using either KOD, KOD XL or Phusion polymerases. 2'-Amino-LNA-T in the template and 2'-amino-LNA-TTP as a substrate both decreased reaction rate and yield compared to unmodified DNA, especially for sequences with multiple 2'-amino-LNA-T nucleotides. PMID:22503454

  1. Pinched flow fractionation devices for detection of single nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Larsen, A.V.; Poulsen, L.; Birgens, H.;


    We demonstrate a new and flexible micro fluidic based method for genotyping single nucleotide polymorphisms ( SNPs). The method relies on size separation of selectively hybridized polystyrene microspheres in a micro fluidic pinched flow fractionation (PFF) device. The micro fluidic PFF devices with......, synthesized using human DNA samples from individuals with point mutations in the HBB gene. Following a stringent wash, the beads were separated in a PFF device and the fluorescent signal from the beads was analyzed. Patients being wildtypes, heterozygotes or mutated respectively for the investigated mutation...... could reliably be diagnosed in the PFF device. This indicates that the PFF technique can be used for accurate and fast genotyping of SNPs Udgivelsesdato: 2008...

  2. Single nucleotide variations: biological impact and theoretical interpretation. (United States)

    Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier


    Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433

  3. The adsorption and reaction of adenine nucleotides on montmorillonite (United States)

    Ferris, James P.; Hagan, William J., Jr.


    The binding of AMP to Zn(2+)-montmorillonite is investigated in the presence of salts and Good's zwitterion buffers, PIPES and MES. The initial concentrations of nucleotide and the percent adsorbtion are used to calculate the adsorption isotherms, and the Langmuir adsorption equation is used for the analysis of data. The adsorption coefficient was found to be three times greater in the presence of 0.2 M PIPES than in its absence. In addition, basal spacings measured by X-ray diffraction were increased by the buffer. These results are interpreted in terms of a model in which the adsorption of AMP is mediated by a Zn(2+) complex of PIPES in different orientations in the interlamellar region of the montmorillonite. Mixed ligand complexes of this type are reminiscent of the complexes observed between metal ions and biological molecules in living systems.

  4. Efficient fidelity control by stepwise nucleotide selection in polymerase elongation

    CERN Document Server

    Yu, Jin


    Polymerases select nucleotides before incorporating them for chemical synthesis during gene replication or transcription. How the selection proceeds stepwise efficiently to achieve sufficiently high fidelity and speed is essential for polymerase function. We examined step-by-step selections that have conformational transition rates tuned one at time in the polymerase elongation cycle, with a controlled differentiation free energy at each checkpoint. The elongation is sustained at non-equilibrium steady state with constant free energy input and heat dissipation. It is found that error reduction capability does not improve for selection checkpoints down the reaction path. Hence, it is essential to select early to achieve an efficient fidelity control. In particular, for two consecutive selections that reject the wrong substrate back and inhibit it forward from a same kinetic state, the same error rates are obtained at the same free energy differentiation. The initial screening is indispensible for maintaining t...

  5. The nucleotide sequence of the bacteriophage T5 ltf gene. (United States)

    Kaliman, A V; Kulshin, V E; Shlyapnikov, M G; Ksenzenko, V N; Kryukov, V M


    The nucleotide sequence of the bacteriophage T5 Bg/II-BamHI fragment (4,835 bp in length) known to carry a gene encoding the LTF protein which forms the phage L-shaped tail fibers was determined. It was shown to contain an open reading frame for 1,396 amino acid residues that corresponds to a protein of 147.8 kDa. The coding region of ltf gene is preceded by a typical Shine-Dalgarno sequence. Downstream from the ltf gene there is a strong transcription terminator. Data bank analysis of the LTF protein sequence reveals 55.1% identity to the hypothetical protein ORF 401 of bacteriophage lambda in a segment of 118 amino acids overlap. PMID:7789514

  6. Fluorogenic Labeling of 5-Formylpyrimidine Nucleotides in DNA and RNA. (United States)

    Samanta, Biswajit; Seikowski, Jan; Höbartner, Claudia


    5-Formylcytosine (5fC) and 5-formyluracil (5fU) are natural nucleobase modifications that are generated by oxidative modification of 5-methylcytosine and thymine (or 5-methyluracil). Herein, we describe chemoselective labeling of 5-formylpyrimidine nucleotides in DNA and RNA by fluorogenic aldol-type condensation reactions with 2,3,3-trimethylindole derivatives. Mild and specific reaction conditions were developed for 5fU and 5fC to produce hemicyanine-like chromophores with distinct photophysical properties. Residue-specific detection was established by fluorescence readout as well as primer-extension assays. The reactions were optimized on DNA oligonucleotides and were equally suitable for the modification of 5fU- and 5fC-modified RNA. This direct labeling approach of 5-formylpyrimidines is expected to help in elucidating the occurrence, enzymatic transformations, and functional roles of these epigenetic/epitranscriptomic nucleobase modifications in DNA and RNA. PMID:26679556

  7. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun


    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  8. A nucleotide-level coarse-grained model of RNA

    CERN Document Server

    Šulc, Petr; Ouldridge, Thomas E; Doye, Jonathan P K; Louis, Ard A


    We present a new, nucleotide-level model for RNA, oxRNA, based on the coarse-graining methodology recently developed for the oxDNA model of DNA. The model is designed to reproduce structural, mechanical and thermodynamic properties of RNA, and the coarse-graining level aims to retain the relevant physics for RNA hybridization and the structure of single- and double-stranded RNA. In order to explore its strengths and weaknesses, we test the model in a range of nanotechnological and biological settings. Applications explored include the folding thermodynamics of a pseudoknot, the formation of a kissing loop complex, the structure of a hexagonal RNA nanoring, and the unzipping of a hairpin motif. We argue that the model can be used for efficient simulations of the structure of systems with thousands of base pairs, and for the assembly of systems of up to hundreds of base pairs. The source code implementing the model is released for public use.

  9. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze


    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  10. Nucleotide sequence of Streptomyces griseus initiator tRNA.


    Kuchino, Y; Yamamoto, I.; Nishimura, S.


    The primary structure of initiator tRNA from Streptomyces griseus was determined by post-labeling procedures. The nucleotide sequence is pC-G-C-G-G-G-G-U-G-G-A-G-C-A-G-C-U-C-G-G-D-A-G-C-U-C-G-C-U-G-G-G-C-U-C-A-U-A-A-C-C- C-A-G-A-G-G-U-C-G-C-A-G-G-U-psi-C-A-m1A-A-U-C-C-U-G-U-C-C-C-C-G-C-U-A-C-C-A0H. The unique feature of the sequence of this tRNA is that residue 54 is occupied by unmodified U, while ribothymidine is located in that position in most initiator tRNAs from eubacteria.

  11. Current research status, databases and application of single nucleotide polymorphism. (United States)

    Javed, R; Mukesh


    Single Nucleotide Polymorphisms (SNPs) are the most frequent form of DNA variation in the genome. SNPs are genetic markers which are bi-allelic in nature and grow at a very fast rate. Current genomic databases contain information on several million SNPs. More than 6 million SNPs have been identified and the information is publicly available through the efforts of the SNP Consortium and others data bases. The NCBI plays a major role in facillating the identification and cataloging of SNPs through creation and maintenance of the public SNP database (dbSNP) by the biomedical community worldwide and stimulate many areas of biological research including the identification of the genetic components of disease. In this review article, we are compiling the existing SNP databases, research status and their application. PMID:21717869

  12. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry;


    glycogen, CP, ATP and IMP levels were similar across trials. In conclusion, altered levels of "classical peripheral fatiguing agents" does apparently not explain the reduced capacity for performing repeated sprints following intermittent exercise in the heat, whereas the augmented systemic NH3 response may......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling......) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following...

  13. Morphine enhances purine nucleotide catabolism in rive and in vitro

    Institute of Scientific and Technical Information of China (English)

    Chang LIU; Jian-kai LIU; Mu-jie KAN; Lin GAO; Hai-ying FU; Hang ZHOU; Min HONG


    Aim: To investigate the effect and mechanism of morphine on purine nucleotide catabolism. Methods: The rat model of morphine dependence and withdrawal and rat C6 glioma cells in culture were used. Concentrations of uric acid in the plasma were measured by the uricase-rap method, adenosine deaminase (ADA) and xan- thine oxidase (XO) in the plasma and tissues were measured by the ADA and XO test kit. RT-PCR and RT-PCR-Southern blotting were used to examine the relative amount of ADA and XO gene transcripts in tissues and C6 cells. Results: (i) the concentration of plasma uric acid in the morphine-administered group was signifi-cantly higher (P<0.05) than the control group; (ii) during morphine administration and withdrawal periods, the ADA and XO concentrations in the plasma increased significantly (P<0.05); (iii) the amount of ADA and XO in the parietal lobe, liver, small intestine, and skeletal muscles of the morphine-administered groups increased, while the level of ADA and XO in those tissues of the withdrawal groups decreased; (iv) the transcripts of the ADA and XO genes in the parietal lobe, liver, small intestine, and skeletal muscles were higher in the morphine-administered group. The expression of the ADA and XO genes in those tissues returned to the control level during morphine withdrawal, with the exception of the skeletal muscles; and (v) the upregulation of the expression of the ADA and XO genes induced by morphine treatment could be reversed by naloxone. Conclusion: The effects of morphine on purine nucleotide metabolism might be an important, new biochemical pharmacological mechanism of morphine action.

  14. Structural basis for a six nucleotide genetic alphabet. (United States)

    Georgiadis, Millie M; Singh, Isha; Kellett, Whitney F; Hoshika, Shuichi; Benner, Steven A; Richards, Nigel G J


    Expanded genetic systems are most likely to work with natural enzymes if the added nucleotides pair with geometries that are similar to those displayed by standard duplex DNA. Here, we present crystal structures of 16-mer duplexes showing this to be the case with two nonstandard nucleobases (Z, 6-amino-5-nitro-2(1H)-pyridone and P, 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)one) that were designed to form a Z:P pair with a standard "edge on" Watson-Crick geometry, but joined by rearranged hydrogen bond donor and acceptor groups. One duplex, with four Z:P pairs, was crystallized with a reverse transcriptase host and adopts primarily a B-form. Another contained six consecutive Z:P pairs; it crystallized without a host in an A-form. In both structures, Z:P pairs fit canonical nucleobase hydrogen-bonding parameters and known DNA helical forms. Unique features include stacking of the nitro group on Z with the adjacent nucleobase ring in the A-form duplex. In both B- and A-duplexes, major groove widths for the Z:P pairs are approximately 1 Å wider than those of comparable G:C pairs, perhaps to accommodate the large nitro group on Z. Otherwise, ZP-rich DNA had many of the same properties as CG-rich DNA, a conclusion supported by circular dichroism studies in solution. The ability of standard duplexes to accommodate multiple and consecutive Z:P pairs is consistent with the ability of natural polymerases to biosynthesize those pairs. This, in turn, implies that the GACTZP synthetic genetic system can explore the entire expanded sequence space that additional nucleotides create, a major step forward in this area of synthetic biology. PMID:25961938

  15. Synthesis and preliminary evaluation of 9-(4-[18F]fluoro-3-hydroxymethylbutyl) guanine ([18F]FHBG) in HSV1-tk gene transduced hepatoma cell

    International Nuclear Information System (INIS)

    The HSV1-tk reporter gene system is the most widely used system because of its advantage that direct monitoring is possible without the introduction of a separate reporter gene in case of HSV1-tk suicide gene therapy. In this study, we investigate the usefulness of the reporter probe (substrate), 9-(4-[18F]fluoro-3-hydroxymethylbutyl) guanine ([18F]FHBG) for non-invasive reporter gene imaging using PET in HSV1-tk expressing hepatoma model. Radiolabeled FHBG was prepared in 8 steps from a commercially available triester. The labeling reaction was carried out by NCA nucleophilic substitution with K[18F]/K2.2.2. in acetonitrile using N2-monomethoxytrityl-9-[4-(tosly)-3-monomethoxytritylmethylbutl] guanine as a precursor, followed by deprotection with 1 N HCI. Preliminary biological properties of the probe were evaluated with MCA cells and MCA-tk cells transduced with HSV1-tk reporter gene. In vitro uptake and release-out studies of [18F]FHBG were performed, and was analyzed correlation between [18F]FHBG uptake ratio according to increasing numeric count of MCA-tk cells and degree of gene expression. MicroPET scan image was obtained with MCA and MCA-tk tumor beating Balb/c-nude mouse model. [18F]FHBG was purified by reverse phase semi-HPLC system and collected at around 16-18 min. Radiochemical yield was about 20-25% (corrected for decay), radiochemical purity was > 95% and specific activity was around > 55.5 GBq/ μ mol. Specific accumulation of [18F]FHBG was observed in HSV1-tk gene transduced MCA-tk cells but not MCA cells, and consecutive 1 hour release-out results showed more than 86% of uptaked [18F]FHBG was retained inside of cells. The uptake of [18F]FHBG was showed a highly significant linear correlation (R2 = 0.995) with increasing percentage of MCA-tk numeric cell count. In microPET scan images, remarkable difference of accumulation was observed for the two type of tumors. [18F]FHBG appears to be a useful as non-invasive PET imaging substrate in HSV1-tk

  16. New water-soluble ruthenium(II) terpyridine complexes for anticancer activity: synthesis, characterization, activation kinetics, and interaction with guanine derivatives. (United States)

    Rilak, Ana; Bratsos, Ioannis; Zangrando, Ennio; Kljun, Jakob; Turel, Iztok; Bugarčić, Živadin D; Alessio, Enzo


    With the aim of assessing whether ruthenium(II) compounds with meridional geometry might be utilized as potential antitumor agents, a series of new, water-soluble, monofunctional ruthenium(II) complexes of the general formula mer-[Ru(L3)(N-N)X][Y]n (where L3 = 2,2':6',2″-terpyridine (tpy) or 4'-chloro-2,2':6',2″-terpyridine (Cl-tpy), N-N = 1,2-diaminoethane (en), 1,2-diaminocyclohexane (dach), or 2,2'-bipyridine (bpy); X = Cl or dmso-S; Y = Cl, PF6, or CF3SO3; n = 1 or 2, depending on the nature of X) were synthesized. All complexes were fully characterized by elemental analysis and spectroscopic techniques (IR, UV/visible, and 1D and 2D NMR), and for three of them, i.e., [Ru(Cl-tpy)(bpy)Cl][Cl] (3Cl), [Ru(Cl-tpy)(en)(dmso-S)][Y]2 [Y = PF6 (6PF6), CF3SO3 (6OTf)] and [Ru(Cl-tpy)(bpy)(dmso-S)][CF3SO3]2 (8OTf), the X-ray structure was also determined. The new terpyridine complexes, with the exception of 8, are well soluble in water (>25 mg/mL). (1)H and (31)P NMR spectroscopy studies performed on the three selected complexes [Ru(Cl-tpy)(N-N)Cl](+) [N-N = en (1), dach (2), and bpy (3)] demonstrated that, after hydrolysis of the Cl ligand, they are capable of interacting with guanine derivatives [i.e., 9-methylguanine (9MeG) or guanosine-5'-monophosphate (5'-GMP)] through N7, forming monofunctional adducts with rates and extents that depend strongly on the nature of N-N: 1 ≈ 2 ≫ 3. In addition, compound 1 shows high selectivity toward 5'-GMP compared to adenosine-5'-monophosphate (5'-AMP), in a competition experiment. Quantitative kinetic investigations on 1 and 2 were performed by means of UV/visible spectroscopy. Overall, the complexes with bidentate aliphatic diamines proved to be superior to those with bpy in terms of solubility and reactivity (i.e., release of Cl(-) and capability to bind guanine derivatives). Contrary to the chlorido compounds, the corresponding dmso derivatives proved to be inert (viz., they do not release the monodentate ligand) in

  17. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence... (United States)


    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  18. Enzymatic synthesis of radioisotope-labeled nucleotides from the corresponding labeled nitrogen bases

    International Nuclear Information System (INIS)

    The authors have developed a procedure that permits the production of nucleotides multiply labeled with various radioisotopes, with a molar radioactivity equal to the molar radioactivity of the original nitrogen bases. The methods of isolation and purification of the enzyme preparations were studied on the enzyme systems converting nitrogen bases to nucleoside triphosphates in the presence of phosphoribosyl pyrophosphate or ribose-5-phosphate. The presence of nucleotide impurities in the enzyme preparation was determined spectrophotometrically. The authors were able to practically avoid nucleotide impurities by salting out the protein fraction of interest with ammonium sulfate. The authors succeeded in reducing the content of nucleotides in the enzyme preparation by a factor of 40

  19. Gene : CBRC-CJAC-01-1151 [SEVENS

    Lifescience Database Archive (English)


  20. Electrochemically-tuned luminescence of a [Ru(bpy) 2(tatp)] 2+-sensitized TiO 2 anode and its applications to photo-stimulated guanine/H 2O 2 fuel cells (United States)

    Shao, Jiangyang; Sun, Ting; Ji, Shibo; Li, Hong; Lan, Sheng; Li, Weishan

    A phenazine-containing Ru(II) complex [Ru(bpy) 2(tatp)] 2+ (bpy = 2,2‧-bipyridine and tatp = 1,4,8,9-tetra-aza-triphenylene) is first applied to a modification of the nano-TiO 2/indium-tin oxide (ITO) electrode by the method of repetitive voltammetric sweeping. The resulting [Ru(bpy) 2(tatp)] 2+-modified TiO 2 electrode shows two pairs of well-defined redox waves and excellent electrocatalytic activity for the oxidation of guanine. [Ru(bpy) 2(tatp)] 2+ on TiO 2 surfaces exhibits intense absorbance and photoluminescence in visible region, revealed by absorption spectra, emission spectra and fluorescence microscope. While [Ru(bpy) 2(tatp)] 2+-sensitized TiO 2 is functionalized as an anode to combine with a continuous wave green laser via an optical microscope, the luminescence of Ru(II)-based excited states can be enhanced by the oxidation of guanine. Furthermore, the [Ru(bpy) 2(tatp)] 2+-sensitized TiO 2 electrode is used as photoanode and hemoglobin-modified single-walled carbon nanotubes (SWCNTs) as cathode for the elaboration of a photo-stimulated guanine/H 2O 2 fuel cell with a saturated KCl salt-bridge. It becomes evident that the photo-stimulated fuel cell performance depends strongly on the excited states of Ru(II) complex-sensitized anodes as well as the electrocatalytic oxidation of guanine. This study provides an electrochemically-tuned luminescence method for better evaluating contributions of the sensitizer excited states to photo-stimulated fuel cells.

  1. 2-Alkynyl-N-propargyl pyridinium salts: pyridinium-based heterocyclic skipped aza-enediynes that cleave DNA by deoxyribosyl hydrogen-atom abstraction and guanine oxidation. (United States)

    Tuesuwan, Bodin; Kerwin, Sean M


    Diradical-generating cyclizations such as the enediyne Bergman cyclization and the enyne allene Myers-Saito cyclization have been exploited by nature in the mechanism of DNA cleavage by a series of potent antitumor antibiotics. Alternative diradical-generating cyclizations have been proposed in the design of selective antitumor agents; however, little information is available concerning the utility of these alternative cyclizations in radical-based DNA cleavage chemistry. One such alternative diradical-generating cyclization, the aza-Myers-Saito cyclization of aza-enyne allenes that are derived from base-promoted isomerization of skipped aza-enediynes, has been recently reported. Here, we report the synthesis and DNA cleavage chemistry of a series of pyridinium skipped aza-enediynes (2-alkynyl-N-propargyl pyridinium salts). Efficient DNA cleavage requires the presence of the skipped aza-enediyne functionality, and optimal DNA cleavage occurs at basic pH. Within this series of compounds, the analogue bearing a p-methoxyphenyl group on the pyridinium 2-alkyne substituents was found to be the most effective DNA cleavage agent, displaying significant supercoiled DNA-nicking activity at concentrations as low as 1 microM. Detailed studies of this analogue show that DNA cleavage occurs through 4'-hydrogen-atom abstraction from the DNA backbone and oxidation of guanine bases. This is the first report of enediyne-like radical-based DNA cleavage by an agent designed to undergo an alternative diradical-generating cyclization. PMID:16752915

  2. Enhanced-oxidation and highly-sensitive detection of acetaminophen, guanine and adenine using NMP-exfoliated graphene nanosheets-modified electrode

    International Nuclear Information System (INIS)

    Graphical abstract: Display Omitted - Highlights: • Compared with RGO, NMP-exfoliated GS possessed lower electron transfer resistance. • Oxidation activity of AC, G and A on NMP-exfoliated GS surface increased greatly. • A highly-sensitive electrochemical sensing platform was constructed for AC, G and A. - Abstract: Graphene nanosheets (GS) were easily prepared by one-step ultrasonic exfoliation of graphite powder in N-methyl-2-pyrrolidone (NMP). Compared with the widely-used reduced graphene oxides that prepared via chemical methods, the NMP-exfoliated GS exhibited higher electron transfer ability. Moreover, the resulting GS displayed higher electrochemical reactivity toward the oxidation of acetaminophen (AC), guanine (G) and adenine (A). In pH 6.5 phosphate buffer, three well-defined oxidation waves at 0.41 V, 0.69 V and 0.96 V were observed, and the oxidation peak currents were greatly enhanced on the surface of GS. As a result, a highly-sensitive electrochemical sensing platform was developed for the simultaneous detection of AC, G and A. The detection limits of AC, G and A on GS-modified electrode were evaluated to be 2.5 nM, 10 nM and 10 nM, respectively. Besides, the proposed method was successfully applied in the detection of tablet and DNA samples

  3. Novel repair activities of AlkA (3-methyladenine DNA glycosylase II) and endonuclease VIII for xanthine and oxanine, guanine lesions induced by nitric oxide and nitrous acid (United States)

    Terato, Hiroaki; Masaoka, Aya; Asagoshi, Kenjiro; Honsho, Akiko; Ohyama, Yoshihiko; Suzuki, Toshinori; Yamada, Masaki; Makino, Keisuke; Yamamoto, Kazuo; Ide, Hiroshi


    Nitrosation of guanine in DNA by nitrogen oxides such as nitric oxide (NO) and nitrous acid leads to formation of xanthine (Xan) and oxanine (Oxa), potentially cytotoxic and mutagenic lesions. In the present study, we have examined the repair capacity of DNA N-glycosylases from Escherichia coli for Xan and Oxa. The nicking assay with the defined substrates containing Xan and Oxa revealed that AlkA [in combination with endonuclease (Endo) IV] and Endo VIII recognized Xan in the tested enzymes. The activity (Vmax/Km) of AlkA for Xan was 5-fold lower than that for 7-methylguanine, and that of Endo VIII was 50-fold lower than that for thymine glycol. The activity of AlkA and Endo VIII for Xan was further substantiated by the release of [3H]Xan from the substrate. The treatment of E.coli with N-methyl-N′-nitro-N-nitrosoguanidine increased the Xan-excising activity in the cell extract from alkA+ but not alkA– strains. The alkA and nei (the Endo VIII gene) double mutant, but not the single mutants, exhibited increased sensitivity to nitrous acid relative to the wild type strain. AlkA and Endo VIII also exhibited excision activity for Oxa, but the activity was much lower than that for Xan. PMID:12434002

  4. Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites. (United States)

    Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K


    Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn∆HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite. PMID:24923662

  5. Determination of guanine and adenine by high-performance liquid chromatography with a self-fabricated wall-jet/thin-layer electrochemical detector at a glassy carbon electrode. (United States)

    Zhou, Yaping; Yan, Hongling; Xie, Qingji; Yao, Shouzhuo


    A sensitive wall-jet/thin-layer amperometric electrochemical detector (ECD) coupled to high-performance liquid chromatography (HPLC) was developed for simultaneous determination of guanine (G) and adenine (A). The analytes were detected at a glassy carbon electrode (GCE) and the HPLC-ECD calibration curves showed good linearity (R(2)>0.997) under optimized conditions. Limits of detection for G and A are 0.6 nM and 1.4 nM (S/N=3), respectively, which are lower than those obtained with an UV-vis detector and a commercial electrochemical detector. We have successfully applied this HPLC-ECD to assess the contents of G and A in hydrochloric acid-digested calf thymus double-stranded DNA. In addition, we compared in detail the analysis of G and A by cyclic voltammetry (CV) and by the HPLC-ECD system on both bare GCE and electroreduced graphene oxide (ERGO) modified GCE. We found that the adsorption of G and A on the electrode surfaces can vary their anodic CV peaks and the competitive adsorption of G and A on the limited sites of the electrode surfaces can cause crosstalk effects on their anodic CV peak signals, but the HPLC-ECD system is insensitive to such electrode-adsorption and can give more reliable analytical results. PMID:25618679

  6. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.


    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H


    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  7. Energy efficiency trade-offs drive nucleotide usage in transcribed regions (United States)

    Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.


    Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

  8. Comparative Nucleotide Sequence Analysis of Polymorphic Variable-Number Tandem-Repeat Loci in Mycobacterium ulcerans


    Ablordey, A; Hilty, M.; Stragier, Pieter; Swings, Jean; Portaels, F.


    We analyzed a set of variable-number tandem-repeat (VNTR) loci to assess their nucleotide sequence diversity in isolates of three Mycobacterium ulcerans genotypes. Sequence variants in two loci resulted in intraspecies resolution of Southeast Asian and Asian genotypes in contrast to a homogenous sequence composition among African isolates. Nucleotide sequence polymorphism in repeat units can enhance discrimination of VNTR loci.

  9. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey; Rådstrøm, Peter; Malorny, Burkhard; Rudi, Knut


    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technology...

  10. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases (United States)

    Charlon, Thomas; Bossini-Castillo, Lara; Carmona, F. David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav


    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this “ancestry signal”, we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at PMID:27490238

  11. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases. (United States)

    Charlon, Thomas; Martínez-Bueno, Manuel; Bossini-Castillo, Lara; Carmona, F David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav; Martín, Javier; Alarcón-Riquelme, Marta E


    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this "ancestry signal", we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at PMID:27490238

  12. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts. (United States)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo


    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X3, an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp. PMID:27006518

  13. Single nucleotide polymorphisms in clinics: Fantasy or reality for cancer? (United States)

    Srinivasan, Srilakshmi; Clements, Judith A; Batra, Jyotsna


    Single nucleotide polymorphisms (SNPs) have been classically used for dissecting various human complex disorders using candidate gene studies. During the last decade, large scale SNP analysis, i.e. genome-wide association studies (GWAS) have provided an agnostic approach to identify possible genetic loci associated with heterogeneous disease such as cancer susceptibility, prognosis of survival or drug response. Further, the advent of new technologies, including microarray-based genotyping as well as high throughput next generation sequencing has opened new avenues for SNPs to be used in clinical practice. It is speculated that the utility of SNPs to understand the mechanisms, biology of variable drug response and ultimately treatment individualization based on the individual's genome composition will be indispensable in the near future. In the current review, we discuss the advantages and disadvantages of the clinical utility of genetic variants in disease risk-prediction, prognosis, clinical outcome and pharmacogenomics. The lessons and challenges for the utility of SNP-based biomarkers are also discussed, including the need for additional functional validation studies. PMID:26398894

  14. Single nucleotide polymorphisms of Kit gene in Chinese indigenous horses. (United States)

    Han, Haoyuan; Mao, Chunchun; Chen, Ningbo; Lan, Xianyong; Chen, Hong; Lei, Chuzhao; Dang, Ruihua


    Kit gene is a genetic determinant of horse white coat color which has been a highly valued trait in horses for at least 2,000 years. Single nucleotide polymorphisms (SNPs) in Kit are of importance due to their strong associations with melanoblast survival during embryonic development. In this study, a mutation analysis of all 21 Kit exons in 14 Chinese domestic horse breeds revealed six SNPs (g.91214T>G, g.143245T>G, g.164297C>T, g.170189C>T, g.171356C>G, and g.171471G>A), which located in 5'-UTR region, intron 6, exon 15, exon 20, intron 20, and exon 21 of the equine Kit gene, respectively. Subsequently, these six SNPs loci were genotyped in 632 Chinese horses by PCR-RFLP or direct sequencing. The six SNPs together defined 18 haplotypes, demonstrating abundant haplotype diversities in Chinese horses. All the mutant alleles and haplotypes were shared among different breeds. But fewer mutations were detected in horses from China than that from abroad, indicating that Chinese horses belong to a more ancient genetic pool. This study will provide fundamental genetic information for evaluating the genetic diversity of Kit gene in Chinese indigenous horse breeds. PMID:27348891

  15. MGMT expression: insights into its regulation. 2. Single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Iatsyshyna A. P.


    Full Text Available High intra- and interindividual variations in the expression levels of the human O6-methylguanine-DNA methyltransferase (MGMT gene have been observed. This DNA repair enzyme can be a cause of resistance of cancer cells to alkylating chemotherapy. It has been studied the association of single nucleotide polymorphisms (SNPs of MGMT with the risk for different types of cancer, progression-free survival in patients with cancer treated with alkylating chemotherapy, as well as an effect of SNPs on the MGMT gene expression and activity of the enzyme. SNPs have been suggested to be the factors which influence the levels of interindividual variability of the MGMT expression. Therefore, the aim of this paper was to review the experimental data on SNPs of the human MGMT gene, which are associated with cancer, as well as on location of MGMT-SNPs in regulatory and protein-coding regions of the gene in relation to its regulation. Lots of MGMT SNPs, which could affect the gene expression and result in interindividual MGMT variability or the enzyme resistance to pseudosubstrate inhibitors, have been re- vealed within the promoter and enhancer regions, the 5'- and 3'-UTRs and introns of the MGMT gene, as well as within the protein-coding region. Many of them may have regulatory effect.

  16. Magnetic Iron Oxide Nanoparticle Seeded Growth of Nucleotide Coordinated Polymers. (United States)

    Liang, Hao; Liu, Biwu; Yuan, Qipeng; Liu, Juewen


    The introduction of functional molecules to the surface of magnetic iron oxide nanoparticles (NPs) is of critical importance. Most previously reported methods were focused on surface ligand attachment either by physisorption or covalent conjugation, resulting in limited ligand loading capacity. In this work, we report the seeded growth of a nucleotide coordinated polymer shell, which can be considered as a special form of adsorption by forming a complete shell. Among all of the tested metal ions, Fe(3+) is the most efficient for this seeded growth. A diverse range of guest molecules, including small organic dyes, proteins, DNA, and gold NPs, can be encapsulated in the shell. All of these molecules were loaded at a much higher capacity compared to that on the naked iron oxide NP core, confirming the advantage of the coordination polymer (CP) shell. In addition, the CP shell provides better guest protein stability compared to that of simple physisorption while retaining guest activity as confirmed by the entrapped glucose oxidase assay. Use of this system as a peroxidase nanozyme and glucose biosensor was demonstrated, detecting glucose as low as 1.4 μM with excellent stability. This work describes a new way to functionalize inorganic materials with a biocompatible shell. PMID:27248668

  17. Unique nucleotide polymorphism of ankyrin gene cluster in Arabidopsis

    Indian Academy of Sciences (India)

    Jianchang Du; Xingna Wang; Mingsheng Zhang; Dacheng Tian; Yong-Hua Yang


    The ankyrin (ANK) gene cluster is a part of a multigene family encoding ANK transmembrane proteins in Arabidopsis thaliana, and plays an important role in protein–protein interactions and in signal pathways. In contrast to other regions of a genome, the ANK gene cluster exhibits an extremely high level of DNA polymorphism in an ∼5-kb region, without apparent decay. Phylogenetic analysis detects two clear, deeply differentiated haplotypes (dimorphism). The divergence between haplotypes of accession Col-0 and Ler-0 (Hap-C and Hap-L) is estimated to be 10.7%, approximately equal to the 10.5% average divergence between A. thaliana and A. lyrata. Sequence comparisons for the ANK gene cluster homologues in Col-0 indicate that the members evolve independently, and that the similarity among paralogues is lower than between alleles. Very little intralocus recombination or gene conversion is detected in ANK regions. All these characteristics of the ANK gene cluster are consistent with a tandem gene duplication and birth-and-death process. The possible mechanisms for and implications of this elevated nucleotide variation are also discussed, including the suggestion of balancing selection.

  18. Effects of hypobaric hypoxia on adenine nucleotide pools, adenine nucleotide transporter activity and protein expression in rat liver

    Institute of Scientific and Technical Information of China (English)

    Cong-Yang Li; Jun-Ze Liu; Li-Ping Wu; Bing Li; Li-Fen Chen


    AIM: To explore the effect of hypobaric hypoxia on mitochondrial energy metabolism in rat liver.METHODS: Adult male Wistar rats were exposed to a hypobaric chamber simulating 5000 m high altitude for 23 h every day for 0 (HO), 1 (H1), 5 (HS), 15 (H15) and 30 d (H30) respectively. Rats were sacrificed by decapitation and liver was removed. Liver mitochondria were isolated by differential centrifugation program. The size of adenine nucleotide pool (ATP, ADP, and AMP) in tissue and mitochondria was separated and measured by high performance liquid chromatography (HPLC). The adenine nucleotide transporter (ANT) activity was determined by isotopic technique. The ANT total protein level was determined by Western blot. RESULTS: Compared with HO group, intra-mitochondrial ATP content decreased in all hypoxia groups. However,the H5 group reached the lowest point (70.6%) (P< 0.01)when compared to the control group. Intra-mitochondrial ADP and AMP level showed similar change in all hypoxia groups and were significantly lower than that in HO group. In addition, extra-mitochondrial ATP and ADP content decreased significantly in all hypoxia groups.Furthermore, extra-mitochondrial AMP in groups H5, H15and H30 was significantly lower than that in HO group,whereas H1 group had no marked change compared to the control situation. The activity of ANT in hypoxia groups decreased significantly, which was the lowest in H5 group (55.7%) (P<0.01) when compared to HO group. ANT activity in H30 group was higher than in H15 group, but still lower than that in HO group. ANT protein level in H5, H15, H30 groups, compared with HO group decreased significantly, which in H5 group was the lowest, being 27.1% of that in HO group (P<0.01). ANT protein level in H30 group was higher than in H15 group,but still lower than in HO group.CONCLUSION: Hypobaric hypoxia decreases the mitochondrial ATP content in rat liver, while mitochondrial ATP level recovers during long-term hypoxia exposure.The lower

  19. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    Directory of Open Access Journals (Sweden)

    Diwesh Kumar Niraj


    Full Text Available Aim: An attempt has been made to study the Myxovirus resistant (Mx1 gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region, Fragment II of 148 bp (Exon 5 region, Fragment III of 161 bp (Exon 7 region, and Fragment IV of 176 bp (Exon 13 region of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  20. Hypoxanthine-guanine phosphoribosyltransferase and inosine 5’-monophosphate dehydrogenase activities in three mammalian species: aquatic (Mirounga angustirostris, semiaquatic (Lontra longicaudis annectens and terrestrial (Sus scrofa

    Directory of Open Access Journals (Sweden)

    Myrna eBarjau Perez-Milicua


    Full Text Available Aquatic and semiaquatic mammals have the capacity of breath hold (apnea diving. Northern elephant seals (Mirounga angustirostris have the ability to perform deep and long duration dives; during a routine dive, adults can hold their breath for 25 min. Neotropical river otters (Lontra longicaudis annectens can hold their breath for about 30 sec. Such periods of apnea may result in reduced oxygen concentration (hypoxia and reduced blood supply (ischemia to tissues. Production of adenosine 5’-triphosphate (ATP requires oxygen, and most mammalian species, like the domestic pig (Sus scrofa, are not adapted to tolerate hypoxia and ischemia, conditions that result in ATP degradation. The objective of this study was to explore the differences in purine synthesis and recycling in erythrocytes and plasma of three mammalian species adapted to different environments: aquatic (northern elephant seal (n=11, semiaquatic (neotropical river otter (n=4 and terrestrial (domestic pig (n=11. Enzymatic activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT was determined by spectrophotometry, and activity of inosine 5’-monophosphate dehydrogenase (IMPDH and the concentration of hypoxanthine (HX, inosine 5’-monophosphate (IMP, adenosine 5’-monophosphate (AMP, adenosine 5’-diphosphate (ADP, ATP, guanosine 5’-diphosphate (GDP, guanosine 5’-triphosphate (GTP, and xanthosine 5’-monophosphate (XMP were determined by high-performance liquid chromatography (HPLC. The activities of HGPRT and IMPDH and the concentration of HX, IMP, AMP, ADP, ATP, GTP and XMP in erythrocytes of domestic pigs were higher than in erythrocytes of northern elephant seals and river otters. These results suggest that under basal conditions (no diving, sleep apnea or exercise, aquatic and semiaquatic mammals have less purine mobilization than their terrestrial counterparts.

  1. Electronic absorption, vibrational spectra, non-linear optical properties, NBO analysis and thermodynamic properties of 9-[(2-hydroxyethoxy) methyl] guanine molecule by density functional method (United States)

    Rajamani, T.; Muthu, S.


    The Fourier transform infrared (FT-IR) and FT-Raman of 9-[(2-hydroxyethoxy) methyl] guanine (9-2HEMG) have been recorded in the regions 4000-100 and 4000-400 cm-1, respectively. A complete assignment and analysis of the fundamental vibrational modes of the molecule were carried out. The observed fundamental modes have been compared with the harmonic vibrational frequencies computed using DFT (B3LYP) method by employing 6-31G(d,p) and 3-21G basis sets. The vibrational studies were interpreted in terms of potential energy distribution. The first order hyperpolarizability (β0) and related properties (α, μ and Δα) of this molecular system are calculated using B3LYP/6-31G(d,p) method based on the finite-field approach. Stability of the molecule arising from hyperconjugative interactions and charge delocalization has been analyzed using natural bond orbital (NBO) analysis. The results show that electron density (ED) in the σ* and π* antibonding orbitals and second-order delocalization energies (E(2)) confirm the occurrence of intramolecular charge transfer (ICT) within the molecule. UV-vis spectrum of the compound has been recorded and electronic properties such as excitation energies, oscillator strength and wavelength are calculated by TD-DFT and CIS methods using B3LYP/6-31G (d,p) basis set. Molecular electrostatic potential (MEP) and HOMO-LUMO energy levels are also constructed. The thermodynamic properties of the title compound have been calculated at different temperatures and the results reveal that the standard heat capacities (Cp,m), standard entropies (Sm) and standard enthalpy changes (Hm) increase with rise in temperature.

  2. Prodrugs of the selective antiherpesvirus agent 9-[4-hydroxy-3-(hydroxymethyl)but-1-yl]guanine (BRL 39123) with improved gastrointestinal absorption properties. (United States)

    Harnden, M R; Jarvest, R L; Boyd, M R; Sutton, D; Vere Hodge, R A


    Potential oral prodrugs of the antiherpesvirus acyclonucleoside 9-[4-hydroxy-3-(hydroxymethyl)but-1-yl]guanine (1, BRL 39123) have been synthesized and evaluated for bioavailability of 1 in the blood of mice. Reduction of 9-[4-acetoxy-3-(acetoxymethyl)but-1-yl]-2-amino-6-chloropurine (13) using ammonium formate and 10% palladium on carbon afforded the 2-aminopurine 14, which was hydrolyzed to the monoacetate 15 and to 2-amino-9-[4-hydroxy-3-(hydroxymethyl)but-1-yl]purine (5). The 2-aminopurine 5 was subsequently converted to additional monoester (17, 21-23) and diester (16, 24) derivatives and to its di-O-isopropylidene derivative 18. Both 5 and its esters (14-17, 21, 22) and also 18 were well absorbed after oral administration and converted efficiently to 1, the diacetyl (14) and dipropionyl (16) esters providing concentrations of 1 in the blood that were more than 15-fold higher than those observed after dosing either 1 or its esters (25-27). Some 6-alkoxy-9-[4-hydroxy-3-(hydroxymethyl)but-1-yl]purines (8-10), the preparation of which has been reported previously, also showed improved absorption properties, but their conversion to 1 was less efficient than for the 2-aminopurine derivatives. On the basis of these results and subsequent experiments involving determinations of rates of conversion to 1 in the presence of rat and human tissue preparations, 9-[4-acetoxy-3-(acetoxymethyl)but-1-yl]-2-aminopurine (14, BRL 42810) was identified as the preferred prodrug of 1. Oral bioavailability studies in healthy human subjects confirmed 14 as an effective prodrug, and this compound is now being evaluated in clinical trials. PMID:2754699

  3. Hypoxanthine-guanine phosphoribosyltransferase and inosine 5'-monophosphate dehydrogenase activities in three mammalian species: aquatic (Mirounga angustirostris), semi-aquatic (Lontra longicaudis annectens) and terrestrial (Sus scrofa). (United States)

    Barjau Pérez-Milicua, Myrna; Zenteno-Savín, Tania; Crocker, Daniel E; Gallo-Reynoso, Juan P


    Aquatic and semiaquatic mammals have the capacity of breath hold (apnea) diving. Northern elephant seals (Mirounga angustirostris) have the ability to perform deep and long duration dives; during a routine dive, adults can hold their breath for 25 min. Neotropical river otters (Lontra longicaudis annectens) can hold their breath for about 30 s. Such periods of apnea may result in reduced oxygen concentration (hypoxia) and reduced blood supply (ischemia) to tissues. Production of adenosine 5'-triphosphate (ATP) requires oxygen, and most mammalian species, like the domestic pig (Sus scrofa), are not adapted to tolerate hypoxia and ischemia, conditions that result in ATP degradation. The objective of this study was to explore the differences in purine synthesis and recycling in erythrocytes and plasma of three mammalian species adapted to different environments: aquatic (northern elephant seal) (n = 11), semiaquatic (neotropical river otter) (n = 4), and terrestrial (domestic pig) (n = 11). Enzymatic activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) was determined by spectrophotometry, and activity of inosine 5'-monophosphate dehydrogenase (IMPDH) and the concentration of hypoxanthine (HX), inosine 5'-monophosphate (IMP), adenosine 5'-monophosphate (AMP), adenosine 5'-diphosphate (ADP), ATP, guanosine 5'-diphosphate (GDP), guanosine 5'-triphosphate (GTP), and xanthosine 5'-monophosphate (XMP) were determined by high-performance liquid chromatography (HPLC). The activities of HGPRT and IMPDH and the concentration of HX, IMP, AMP, ADP, ATP, GTP, and XMP in erythrocytes of domestic pigs were higher than in erythrocytes of northern elephant seals and river otters. These results suggest that under basal conditions (no diving, sleep apnea or exercise), aquatic, and semiaquatic mammals have less purine mobilization than their terrestrial counterparts. PMID:26283971

  4. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  5. Eukaryotic nucleotide excision repair: from understanding mechanisms to influencing biology

    Institute of Scientific and Technical Information of China (English)

    Sarah C Shuck; Emily A Short; John J Turchi


    Repair of bulky DNA adducts by the nucleotide excision repair (NER) pathway is one of the more versatile DNA repair pathways for the removal of DNA lesions. There are two subsets of the NER pathway, global genomic-NER (GG-NER) and transcription-coupled NER (TC-NER), which differ only in the step involving recognition of the DNA lesion. Following recognition of the damage, the sub-pathways then converge for the incision/excision steps and subsequent gap filling and ligation steps. This review will focus on the GGR sub-pathway of NER while the TCR sub-pathway will be covered in another article in this issue. The ability of the NER pathway to repair a wide array of adducts stems, in part, from the mechanisms involved in the initial recognition step of the damaged DNA and results in NER impacting an equally wide array of human physiological responses and events. In this review, the impact of NER on carcinogenesis, neurological function, sensitivity to environmental factors and sensitivity to cancer therapeutics will be discussed. The knowledge generated in our understanding of the NER pathway over the past 40 years has resulted from advances in the fields of animal model systems, mammalian genetics and in vitro biochemistry, as well as from reconstitution studies and structural analyses of the proteins and enzymes that participate in this pathway. Each of these avenues of research has contributed significantly to our understanding of how the NER pathway works and how alterations in NER activity, both positive and negative, influence human biology.

  6. Analysis of codon usage and nucleotide composition bias in polioviruses

    Directory of Open Access Journals (Sweden)

    Gu Yuan-xing


    Full Text Available Abstract Background Poliovirus, the causative agent of poliomyelitis, is a human enterovirus and a member of the family of Picornaviridae and among the most rapidly evolving viruses known. Analysis of codon usage can reveal much about the molecular evolution of the viruses. However, little information about synonymous codon usage pattern of polioviruses genome has been acquired to date. Methods The relative synonymous codon usage (RSCU values, effective number of codon (ENC values, nucleotide contents and dinucleotides were investigated and a comparative analysis of codon usage pattern for open reading frames (ORFs among 48 polioviruses isolates including 31 of genotype 1, 13 of genotype 2 and 4 of genotype 3. Results The result shows that the overall extent of codon usage bias in poliovirus samples is low (mean ENC = 53.754 > 40. The general correlation between base composition and codon usage bias suggests that mutational pressure rather than natural selection is the main factor that determines the codon usage bias in those polioviruses. Depending on the RSCU data, it was found that there was a significant variation in bias of codon usage among three genotypes. Geographic factor also has some effect on the codon usage pattern (exists in the genotype-1 of polioviruses. No significant effect in gene length or vaccine derived polioviruses (DVPVs, wild viruses and live attenuated virus was observed on the variations of synonymous codon usage in the virus genes. The relative abundance of dinucleotide (CpG in the ORFs of polioviruses are far below expected values especially in DVPVs and attenuated virus of polioviruses genotype 1. Conclusion The information from this study may not only have theoretical value in understanding poliovirus evolution, especially for DVPVs genotype 1, but also have potential value for the development of poliovirus vaccines.

  7. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi


    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  8. Cortisol promotes endoplasmic glucose production via pyridine nucleotide redox. (United States)

    Wang, Zengmin; Mick, Gail J; Xie, Rongrong; Wang, Xudong; Xie, Xuemei; Li, Guimei; McCormick, Kenneth L


    Both increased adrenal and peripheral cortisol production, the latter governed by 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1), contribute to the maintenance of fasting blood glucose. In the endoplasmic reticulum (ER), the pyridine nucleotide redox state (NADP/NADPH) is dictated by the concentration of glucose-6-phosphate (G6P) and the coordinated activities of two enzymes, hexose-6-phosphate dehydrogenase (H6PDH) and 11β-HSD1. However, luminal G6P may similarly serve as a substrate for hepatic glucose-6-phophatase (G6Pase). A tacit belief is that the G6P pool in the ER is equally accessible to both H6PDH and G6Pase. Based on our inhibition studies and kinetic analysis in isolated rat liver microsomes, these two aforesaid luminal enzymes do share the G6P pool in the ER, but not equally. Based on the kinetic modeling of G6P flux, the ER transporter for G6P (T1) preferentially delivers this substrate to G6Pase; hence, the luminal enzymes do not share G6P equally. Moreover, cortisol, acting through 11β-HSD1, begets a more reduced pyridine redox ratio. By altering this luminal redox ratio, G6P flux through H6PDH is restrained, allowing more G6P for the competing enzyme G6Pase. And, at low G6P concentrations in the ER lumen, which occur during fasting, this acute cortisol-induced redox adjustment promotes glucose production. This reproducible cortisol-driven mechanism has been heretofore unrecognized. PMID:26860459

  9. Resistance issues with new nucleoside/nucleotide backbone options. (United States)

    Wainberg, Mark A; Turner, Dan


    The nucleoside and nucleotide reverse transcriptase inhibitors (NRTIs/NtRTIs) remain an enduring feature of combination therapy. As NRTI/NtRTI options continue to expand, questions arise about how best to combine these agents to create effective dual NRTI/NtRTI backbones in antiretroviral regimens while avoiding treatment-emergent drug resistance. Clinicians must consider how NRTIs/NtRTIs such as tenofovir DF (TDF), abacavir (ABC), and emtricitabine (FTC), as well as new once-daily and coformulated NRTIs/NtRTIs, interact with older agents when combined in novel regimens and how sequencing the new NRTIs can preserve future treatment options. Resistance data from clinical trials have revealed important information on the patterns, prevalence, and effects of resistance seen among patients experiencing virologic failure. In recent years, the prevalence of some mutations such as M184V and Q151M has remained relatively constant, while the L74V mutation, the 69 insertions, and thymidine analogue mutations have decreased in prevalence. Other mutations such as K65R and Y115F, while still relatively uncommon, are increasing in prevalence. This increase may be due to the use of new treatment combinations that select for these mutations at a higher rate. Clinical trials suggest that new regimens containing TDF or ABC select for K65R and that this mutation is observed more frequently with TDF; in contrast, L74V is observed more frequently in ABC-containing regimens but is not commonly selected by TDF-containing regimens. Several lines of evidence are converging to suggest that the presence of zidovudine may decrease the risk of L74V and K65R in ABC- or TDF-containing regimens. This review summarizes the clinical implications of resistance profiles associated with new NRTI/NtRTI regimens in current use and in advanced clinical studies. PMID:15319668

  10. Antithrombotic activities of ferulic acid via intracellular cyclic nucleotide signaling. (United States)

    Hong, Qian; Ma, Zeng-Chun; Huang, Hao; Wang, Yu-Guang; Tan, Hong-Ling; Xiao, Cheng-Rong; Liang, Qian-De; Zhang, Han-Ting; Gao, Yue


    Ferulic acid (FA) produces protective effects against cardiovascular dysfunctions. However, the mechanisms of FA is still not known. Here we examined the antithrombotic effects of FA and its potential mechanisms. Anticoagulation assays and platelet aggregation was evaluated in vitro and in vivo. Thromboxane B2 (TXB2), cyclic adenosine monophosphate(cAMP), and cyclic guanosine monophosphate (cGMP) was determined using enzyme immunoassay kits. Nitric oxide (NO) production was measured using the Griess reaction. Protein expression was detected by Western blotting analysis. Oral administration of FA prevented death caused by pulmonary thrombosis and prolonged the tail bleeding and clotting time in mice,while, it did not alter the coagulation parameters, including the activated partial thromboplastin time (APTT), prothrombin time (PT), and thrombin time (TT). In addition, FA (50-200µM) dose-dependently inhibited platelet aggregation induced by various platelet agonists, including adenosine diphosphate (ADP), thrombin, collagen, arachidonic acid (AA), and U46619. Further, FA attenuated intracellular Ca(2)(+) mobilization and TXB2 production induced by the platelet agonists. FA increased the levels of cAMP and cGMP and phosphorylated vasodilator-stimulated phosphoprotein (VASP) while decreased phospho-MAPK (mitogen-activated protein kinase) and phosphodiesterase (PDE) in washed rat platelets, VASP is a substrate of cyclic nucleotide and PDE is an enzyme family responsible for hydrolysis of cAMP/cGMP. These results suggest that antithrombotic activities of FA may be regulated by inhibition of platelet aggregation, rather than through inhibiting the release of thromboplastin or formation of thrombin. The mechanism of this action may involve activation of cAMP and cGMP signaling. PMID:26948317

  11. Dietary Nucleotides Supplementation and Liver Injury in Alcohol-Treated Rats: A Metabolomics Investigation

    Directory of Open Access Journals (Sweden)

    Xiaxia Cai


    Full Text Available Background: Previous studies suggested that nucleotides were beneficial for liver function, lipid metabolism and so on. The present study aimed to investigate the metabolic response of dietary nucleotides supplementation in alcohol-induced liver injury rats. Methods: Five groups of male Wistar rats were used: normal control group (basal diet, equivalent distilled water, alcohol control group (basal diet, 50% alcohol (v/v, dextrose control group (basal diet, isocaloric amount of dextrose, and 0.04% and 0.16% nucleotides groups (basal diet supplemented with 0.4 g and 1.6 g nucleotides kg−1 respectively, 50% alcohol (v/v. The liver injury was measured through traditional liver enzymes, expression of oxidative stress markers and histopathological examination. Ultra-performance liquid chromatography quadrupole-time-flight mass spectrometry (UPLC-Q-TOF-MS was applied to identify liver metabolite profiles. Results: Nucleotides supplementation prevented the progression of hepatocyte steatosis. The levels of total proteins, globulin, alanine aminotransferase, aspartate aminotransferase, total cholesterol triglyceride, as well as the oxidative stress markers altered by alcohol, were improved by nucleotides supplementation. Elevated levels of liver bile acids (glycocholic acid, chenodeoxyglycocholic acid, and taurodeoxycholic acid, as well as lipids (stearic acid, palmitic acid, oleic acid, phosphatidylcholine, and lysophosphatidylethanolamine in alcohol-treated rats were reversed by nucleotides supplementation. In addition, supplementation with nucleotides could increase the levels of amino acids, including valyl-Leucine, l-leucine, alanyl-leucine and l-phenylalanine. Conclusion: These data indicate potential biomarkers and confirm the benefit of dietary nucleotides on alcoholic liver injury.

  12. Completion of the nucleotide sequence of sunn-hemp mosaic virus: a tobamovirus pathogenic to legumes. (United States)

    Silver, S; Quan, S; Deom, C M


    Sunn-hemp mosaic virus (SHMV) is a member of the tobamovirus group of plant viruses. The nucleotide sequence of the 5'-untranslated region, the 129 kD protein gene, and a portion of the 186 kD protein gene of SHMV was determined. The 4,683 nucleotides (nts) reported here completes the sequence of the SHMV genome and complements previous work (Meshi, Ohno, and Okada, Nucleic Acids Res. 10, 6111-6117 [1982]; Mol. Gen. Genet. 184, 20-25 [1981]) to provide the first complete nucleotide sequence for a tobamovirus that is pathogenic to leguminous plants. PMID:8938983

  13. Complete nucleotide sequence of the genomic RNA of tobacco mosaic virus strain Cg. (United States)

    Yamanaka, T; Komatani, H; Meshi, T; Naito, S; Ishikawa, M; Ohno, T


    Tobacco mosaic virus (TMV)-Cg is a crucifer-infecting tobamovirus that was isolated from field-grown garlic. We determined the complete nucleotide sequence of the genomic RNA of TMV-Cg. The genomic RNA of TMV-Cg consists of 6303 nucleotides and encodes four large open reading frames, organized basically in the same way as that of other tobamoviruses. The nucleotide and deduced amino acid sequences are very similar to those of the other crucifer-infecting tobamoviruses that have been sequenced so far. PMID:9608662

  14. The nucleotide sequence of the uvrD gene of E. coli.


    Finch, P W; Emmerson, P T


    The nucleotide sequence of a cloned section of the E. coli chromosome containing the uvrD gene has been determined. The coding region for the UvrD protein consists of 2,160 nucleotides which would direct the synthesis of a polypeptide 720 amino acids long with a calculated molecular weight of 82 kd. The predicted amino acid sequence of the UvrD protein has been compared with the amino acid sequences of other known adenine nucleotide binding proteins and a common sequence has been identified, ...

  15. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data. (United States)


    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data...

  16. Myosin individualized: single nucleotide polymorphisms in energy transduction

    Directory of Open Access Journals (Sweden)

    Wieben Eric D


    Full Text Available Abstract Background Myosin performs ATP free energy transduction into mechanical work in the motor domain of the myosin heavy chain (MHC. Energy transduction is the definitive systemic feature of the myosin motor performed by coordinating in a time ordered sequence: ATP hydrolysis at the active site, actin affinity modulation at the actin binding site, and the lever-arm rotation of the power stroke. These functions are carried out by several conserved sub-domains within the motor domain. Single nucleotide polymorphisms (SNPs affect the MHC sequence of many isoforms expressed in striated muscle, smooth muscle, and non-muscle tissue. The purpose of this work is to provide a rationale for using SNPs as a functional genomics tool to investigate structurefunction relationships in myosin. In particular, to discover SNP distribution over the conserved sub-domains and surmise what it implies about sub-domain stability and criticality in the energy transduction mechanism. Results An automated routine identifying human nonsynonymous SNP amino acid missense substitutions for any MHC gene mined the NCBI SNP data base. The routine tested 22 MHC genes coding muscle and non-muscle isoforms and identified 89 missense mutation positions in the motor domain with 10 already implicated in heart disease and another 8 lacking sequence homology with a skeletal MHC isoform for which a crystallographic model is available. The remaining 71 SNP substitutions were found to be distributed over MHC with 22 falling outside identified functional sub-domains and 49 in or very near to myosin sub-domains assigned specific crucial functions in energy transduction. The latter includes the active site, the actin binding site, the rigid lever-arm, and regions facilitating their communication. Most MHC isoforms contained SNPs somewhere in the motor domain. Conclusions Several functional-crucial sub-domains are infiltrated by a large number of SNP substitution sites suggesting these

  17. Database of amino acid-nucleotide contacts in the DNA complexes with homeodomain family proteins

    International Nuclear Information System (INIS)

    The analysis of amino acid-nucleotide contacts in interfaces of the protein-DNA complexes, intended to find consistencies in the protein-DNA recognition, is a complex problem that requires analysis of the physicochemical characteristics of these contacts, of the positions of the participating amino acids and nucleotides in the chains of the protein and the DNA, respectively, as well as conservatism of these contacts. Thus, those heterogeneous data should be systematized. For this purpose we have developed a database of amino acid-nucleotide contacts ANTPC (Amino acid Nucleotide Type Position Conservation) following the archetypal example of the proteins in the homeodomain family. We show that it can be used for comparison and classification of interfaces of the protein-DNA complexes

  18. A novel Access to Nucleotide-activated Oligosaccharides by Enzymatic Synthesis

    Czech Academy of Sciences Publication Activity Database

    Nieder, V.; Gallego, R.; Kutzer, M.; Kamerling, J.; Vliegenthart, J.; Marx, S.; Křen, Vladimír; Elling, L.

    Hamburg, 2000. s. 152. [International Carbohydrate Symposium /20./. 27.08.2000-01.09.2000, Hamburg] Institutional research plan: CEZ:AV0Z5020903 Keywords : nucleotide * activated * enzymatic Subject RIV: EE - Microbiology, Virology

  19. Changing the acceptor identity of a transfer RNA by altering nucleotides in a "variable pocket". (United States)

    McClain, W H; Foss, K


    The specificity of tRNA(Arg) (arginine transfer RNA) for aminoacylation (its acceptor identity) were first identified by computer analysis and then examined with amber suppressor tRNAs in Escherichia coli. On replacing two nucleotides in tRNA(Phe) (phenylalanine transfer RNA) with the corresponding nucleotides from tRNA(Arg), the acceptor identity of the resulting tRNA was changed to that of tRNA(Arg). The nucleotides used in the identity transformation occupy a "variable pocket" structure on the surface of the tRNA molecule where two single-stranded loop segments interact. The middle nucleotide in the anticodon also probably contributes to the interaction, since an amber suppressor of tRNA(Arg) had an acceptor identity for lysine as well as arginine. PMID:2459773

  20. Activity of different classes of nucleoside and nucleotide analogues against adenovirus in cell culture

    Czech Academy of Sciences Publication Activity Database

    Naesens, L.; Lenaerts, L.; Holý, Antonín; Balzarini, J.; De Clercq, E.

    Elsevier. Roč. 62, č. 2 (2004), s. A74. ISSN 0166-3542. [International Conference on Antiviral Research /17./. 02.05.2004-06.05.2004, Tucson] Keywords : nucleosides * nucleotides Subject RIV: CC - Organic Chemistry