WorldWideScience

Sample records for camp-regulated guanine nucleotide

  1. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  2. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  3. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  4. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)

    2017-01-15

    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  5. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.

    1989-01-01

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  6. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

    1986-01-01

    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  7. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    International Nuclear Information System (INIS)

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

    1988-01-01

    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

  8. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

    1987-01-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  9. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    Science.gov (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  10. Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

    International Nuclear Information System (INIS)

    Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.

    1986-01-01

    The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/

  11. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    International Nuclear Information System (INIS)

    Edenbrandt, C.M.; Murphy, S.

    1990-01-01

    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation

  12. Guanine nucleotide regulatory protein co-purifies with the D2-dopamine receptor

    International Nuclear Information System (INIS)

    Senogles, S.E.; Caron, M.G.

    1986-01-01

    The D 2 -dopamine receptor from bovine anterior pituitary was purified ∼1000 fold by affinity chromatography on CMOS-Sepharose. Reconstitution of the affinity-purified receptor into phospholipid vesicles revealed the presence of high and low affinity agonist sites as detected by N-n-propylnorapomorphine (NPA) competition experiments with 3 H-spiperone. High affinity agonist binding could be converted to the low affinity form by guanine nucleotides, indicating the presence of an endogenous guanine nucleotide binding protein (N protein) in the affinity-purified D 2 receptor preparations. Furthermore, this preparation contained an agonist-sensitive GTPase activity which was stimulated 2-3 fold over basal by 10 μM NPA. 35 S-GTPγS binding to these preparations revealed a stoichiometry of 0.4-0.7 mole N protein/mole receptor, suggesting the N protein may be specifically coupled with the purified D 2 -dopamine receptor and not present as a contaminant. Pertussis toxin treatment of the affinity purified receptor preparations prevented high affinity agonist binding, as well as agonist stimulation of the GTPase activity, presumably by inactivating the associated N protein. Pertussis toxin lead to the ADP-ribosylation of a protein of 39-40K on SDS-PAGE. These findings indicate that an endogenous N protein, N/sub i/ or N/sub o/, co-purifies with the D 2 -dopamine receptor which may reflect a precoupling of this receptor with an N protein within the membranes

  13. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

    Science.gov (United States)

    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

    2016-05-01

    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  14. WBSCR16 Is a Guanine Nucleotide Exchange Factor Important for Mitochondrial Fusion

    Directory of Open Access Journals (Sweden)

    Guorui Huang

    2017-07-01

    Full Text Available Regulated inter-mitochondrial fusion/fission is essential for maintaining optimal mitochondrial respiration and control of apoptosis and autophagy. In mammals, mitochondrial fusion is controlled by outer membrane GTPases MFN1 and MFN2 and by inner membrane (IM GTPase OPA1. Disordered mitochondrial fusion/fission contributes to various pathologies, and MFN2 or OPA1 mutations underlie neurodegenerative diseases. Here, we show that the WBSCR16 protein is primarily associated with the outer face of the inner mitochondrial membrane and is important for mitochondrial fusion. We provide evidence of a WBSCR16/OPA1 physical interaction in the intact cell and of a WBSCR16 function as an OPA1-specific guanine nucleotide exchange factor (GEF. Homozygosity for a Wbscr16 mutation causes early embryonic lethality, whereas neurons of mice heterozygous for the mutation have mitochondria with reduced membrane potential and increased susceptibility to fragmentation upon exposure to stress, suggesting roles for WBSCR16 deficits in neuronal pathologies.

  15. Proteomic analysis of Rac1 signaling regulation by guanine nucleotide exchange factors.

    Science.gov (United States)

    Marei, Hadir; Carpy, Alejandro; Macek, Boris; Malliri, Angeliki

    2016-08-02

    The small GTPase Rac1 is implicated in various cellular processes that are essential for normal cell function. Deregulation of Rac1 signaling has also been linked to a number of diseases, including cancer. The diversity of Rac1 functioning in cells is mainly attributed to its ability to bind to a multitude of downstream effectors following activation by Guanine nucleotide Exchange Factors (GEFs). Despite the identification of a large number of Rac1 binding partners, factors influencing downstream specificity are poorly defined, thus hindering the detailed understanding of both Rac1's normal and pathological functions. In a recent study, we demonstrated a role for 2 Rac-specific GEFs, Tiam1 and P-Rex1, in mediating Rac1 anti- versus pro-migratory effects, respectively. Importantly, via conducting a quantitative proteomic screen, we identified distinct changes in the Rac1 interactome following activation by either GEF, indicating that these opposing effects are mediated through GEF modulation of the Rac1 interactome. Here, we present the full list of identified Rac1 interactors together with functional annotation of the differentially regulated Rac1 binding partners. In light of this data, we also provide additional insights into known and novel signaling cascades that might account for the GEF-mediated Rac1-driven cellular effects.

  16. The selective phosphorylation of a guanine nucleotide-binding regulatory protein

    International Nuclear Information System (INIS)

    Carlson, K.E.

    1989-01-01

    Receptor-activated signal transduction pathways regulate the responsiveness of cells to external stimuli. These transduction pathways themselves are subject to regulation, most commonly by phosphorylation. Guanine nucleotide-binding regulatory proteins (G Proteins), as requisite signal transducing elements for many plasma membrane receptors, are considered likely targets for regulation by phosphorylation. Protein kinase C (PKC) has been shown to phosphorylate the α subunit of G i and other G proteins in solution. However, the occurrence of the phosphorylation of G 1 within intact cells in response to activation of PKC has not been rigorously demonstrated. In this thesis, the extent to which the α subunits of G i undergo phosphorylation within human platelets in response to activation of PKC was examined by means of radiolabeling and immunoprecipitation. Incubation of platelets with phorbol-12-myristate-13-acetate (PMA), a potent activator of PKC, promoted the phosphorylation of several proteins within saponin-permeabilized and intact platelets incubated with [γ 32 P]ATP and [ 32 P]H 3 PO 4 , respectively. None of the phosphoproteins, however, were precipitated by either of two antisera containing antibodies differing in specificities for epitopes within G iα -despite precipitation of a substantial fraction of the subunit itself. In contrast, other antisera, containing antibodies specific for the recently describe G zα , or antibodies for both G zα and G iα , precipitated a 40-kDa phosphoprotein

  17. In vitro guanine nucleotide exchange activity of DHR-2/DOCKER/CZH2 domains.

    Science.gov (United States)

    Côté, Jean-François; Vuori, Kristiina

    2006-01-01

    Rho family GTPases regulate a large variety of biological processes, including the reorganization of the actin cytoskeleton. Like other members of the Ras superfamily of small GTP-binding proteins, Rho GTPases cycle between a GDP-bound (inactive) and a GTP-bound (active) state, and, when active, the GTPases relay extracellular signals to a large number of downstream effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP on Rho GTPases, thereby activating them. Most Rho-GEFs mediate their effects through their signature domain known as the Dbl Homology-Pleckstrin Homology (DH-PH) module. Recently, we and others identified a family of evolutionarily conserved, DOCK180-related proteins that also display GEF activity toward Rho GTPases. The DOCK180-family of proteins lacks the canonical DH-PH module. Instead, they rely on a novel domain, termed DHR-2, DOCKER, or CZH2, to exchange GDP for GTP on Rho targets. In this chapter, the experimental approach that we used to uncover the exchange activity of the DHR-2 domain of DOCK180-related proteins will be described.

  18. Guanine nucleotide binding protein-like 3 is a potential prognosis indicator of gastric cancer.

    Science.gov (United States)

    Chen, Jing; Dong, Shuang; Hu, Jiangfeng; Duan, Bensong; Yao, Jian; Zhang, Ruiyun; Zhou, Hongmei; Sheng, Haihui; Gao, Hengjun; Li, Shunlong; Zhang, Xianwen

    2015-01-01

    Guanine nucleotide binding protein-like 3 (GNL3) is a GIP-binding nuclear protein that has been reported to be involved in various biological processes, including cell proliferation, cellular senescence and tumorigenesis. This study aimed to investigate the expression level of GNL3 in gastric cancer and to evaluate the relationship between its expression and clinical variables and overall survival of gastric cancer patients. The expression level of GNL3 was examined in 89 human gastric cancer samples using immunohistochemistry (IHC) staining. GNL3 in gastric cancer tissues was significantly upregulated compared with paracancerous tissues. GNL3 expression in adjacent non-cancerous tissues was associated with sex and tumor size. Survival analyses showed that GNL3 expression in both gastric cancer and adjacent non-cancerous tissues were not related to overall survival. However, in the subgroup of patients with larger tumor size (≥ 6 cm), a close association was found between GNL3 expression in gastric cancer tissues and overall survival. GNL3-positive patients had a shorter survival than GNL3-negative patients. Our study suggests that GNL3 might play an important role in the progression of gastric cancer and serve as a biomarker for poor prognosis in gastric cancer patients.

  19. Expression of a Rho guanine nucleotide exchange factor, Ect2, in the developing mouse pituitary.

    Science.gov (United States)

    Islam, M S; Tsuji, T; Higashida, C; Takahashi, M; Higashida, H; Koizumi, K

    2010-05-01

    The pituitary gland is a highly mitotically active tissue after birth. Various cell types are known to undergo proliferation in the anterior pituitary. However, little is known about the mechanisms regulating mitotic activity in this tissue. When searching for genes specifically expressed in the pituitary gland among those that we previously screened in Drosophila, we found epithelial cell-transforming gene 2 (Ect2). Ect2 is a guanine nucleotide exchange factor for Rho GTPases, which is known to play an essential role in cytokinesis. Although there have been many cellular studies regarding the function of Ect2, the temporal and spatial expression patterns of Ect2 in vivo have not been determined. In the present study, we examined the postnatal developmental expression of Ect2 in the mouse pituitary. Enhanced Ect2 expression was detected in the mouse pituitary gland during the first 3 weeks after birth, which coincided well with the period of rapid pituitary expansion associated with increased growth rate. Immunostaining analysis showed that Ect2-expressing cells were distributed in the anterior and intermediate lobes, but not the posterior lobe, of the pituitary. These Ect2-expressing cells frequently incorporated the thymidine analogue, EdU (5-ethynyl-2'-deoxyuridine), indicating that these cells were mitotically active. Taken together, the results demonstrate the functional role of Ect2 in postnatal proliferating cells in the two lobes of the pituitary, thereby suggesting roles in developmental growth of the mammalian pituitary.

  20. Ric-8A, a Gα protein guanine nucleotide exchange factor potentiates taste receptor signaling

    Directory of Open Access Journals (Sweden)

    Claire J Fenech

    2009-10-01

    Full Text Available Taste receptors for sweet, bitter and umami tastants are G-protein coupled receptors (GPCRs. While much effort has been devoted to understanding G-protein-receptor interactions and identifying the components of the signalling cascade downstream of these receptors, at the level of the G-protein the modulation of receptor signal transduction remains relatively unexplored. In this regard a taste-specific regulator of G-protein signaling (RGS, RGS21, has recently been identified. To study whether guanine nucleotide exchange factors (GEFs are involved in the transduction of the signal downstream of the taste GPCRs we investigated the expression of Ric-8A and Ric-8B in mouse taste cells and their interaction with G-protein subunits found in taste buds. Mammalian Ric-8 proteins were initially identified as potent GEFs for a range of Gα subunits and Ric-8B has recently been shown to amplify olfactory signal transduction. We find that both Ric-8A and Ric-8B are expressed in a large portion of taste bud cells and that most of these cells contain IP3R-3 a marker for sweet, umami and bitter taste receptor cells. Ric-8A interacts with Gα-gustducin and Gαi2 through which it amplifies the signal transduction of hTas2R16, a receptor for bitter compounds. Overall, these findings are consistent with a role for Ric-8 in mammalian taste signal transduction.

  1. Direct demonstration of guanine nucleotide sensitive receptors for vasoactive intestinal peptide in the anterior lobe of the rat pituitary gland

    International Nuclear Information System (INIS)

    Agui, T.; Matsumoto, K.

    1990-01-01

    The vasoactive intestinal peptide (VIP) receptors were identified on the membranes from the rat anterior pituitary gland with [ 125 I]VIP. The dissociation constant (Kd) and the maximal binding capacity (Bmax) values were estimated from the competitive inhibition data. The Kd and Bmax values were 1.05 +/- 0.75 nM and 103 +/- 11 fmol/mg protein, respectively. The order of molar potency of related peptides to inhibit [ 125 I]VIP binding was VIP greater than peptide histidine isoleucine (PHI) greater than secretin greater than glucagon. Glucagon was not effective to inhibit the binding. [ 125 I]VIP binding was effectively inhibited by the addition of guanine nucleotides. The order of molar potency to inhibit the binding was Gpp(NH)p greater than GTP greater than GDP greater than GMP greater than ATP. These results directly suggest the coupling of VIP receptors with guanine nucleotide binding proteins in the anterior pituitary gland

  2. Kinetics of the interactions between yeast elongation factors 1A and 1Balpha, guanine nucleotides, and aminoacyl-tRNA

    DEFF Research Database (Denmark)

    Gromadski, Kirill B; Schümmer, Tobias; Strømgaard, Anne

    2007-01-01

    of guanine nucleotides. At the concentrations of nucleotides and factors prevailing in the cell, the overall exchange rate is expected to be in the range of 6 s(-1), which is compatible with the rate of protein synthesis in the cell. eEF1A.GTP binds Phe-tRNA(Phe) with a K(d) of 3 nm, whereas eEF1A.GDP shows...... no significant binding, indicating that eEF1A has similar tRNA binding properties as its prokaryotic homolog, EF-Tu. Udgivelsesdato: 2007-Dec-7...

  3. Transduction proteins of olfactory receptor cells: identification of guanine nucleotide binding proteins and protein kinase C

    International Nuclear Information System (INIS)

    Anholt, R.R.H.; Mumby, S.M.; Stoffers, D.A.; Girard, P.R.; Kuo, J.F.; Snyder, S.H.

    1987-01-01

    The authors have analyzed guanine nucleotide binding proteins (G-proteins) in the olfactory epithelium of Rana catesbeiana using subunit-specific antisera. The olfactory epithelium contained the α subunits of three G-proteins, migrating on polyacrylamide gels in SDS with apparent molecular weights of 45,000, 42,000, and 40,000, corresponding to G/sub s/, G/sub i/, and G/sub o/, respectively. A single β subunit with an apparent molecular weight of 36,000 was detected. An antiserum against the α subunit of retinal transducin failed to detect immunoreactive proteins in olfactory cilia detached from the epithelium. The olfactory cilia appeared to be enriched in immunoreactive G/sub sα/ relative to G/sub ichemical bond/ and G/sub ochemical bond/ when compared to membranes prepared from the olfactory epithelium after detachment of the cilia. Bound antibody was detected by autoradiography after incubation with [ 125 I]protein. Immunohistochemical studies using an antiserum against the β subunit of G-proteins revealed intense staining of the ciliary surface of the olfactory epithelium and of the axon bundles in the lamina propria. In contrast, an antiserum against a common sequence of the α subunits preferentially stained the cell membranes of the olfactory receptor cells and the acinar cells of Bowman's glands and the deep submucosal glands. In addition to G-proteins, they have identified protein kinase C in olfactory cilia via a protein kinase C specific antiserum and via phorbol ester binding. However, in contrast to the G-proteins, protein kinase C occurred also in cilia isolated from respiratory epithelium

  4. Guanine nucleotide-binding protein regulation of melatonin receptors in lizard brain

    International Nuclear Information System (INIS)

    Rivkees, S.A.; Carlson, L.L.; Reppert, S.M.

    1989-01-01

    Melatonin receptors were identified and characterized in crude membrane preparations from lizard brain by using 125 I-labeled melatonin ( 125 I-Mel), a potent melatonin agonist. 125 I-Mel binding sites were saturable; Scatchard analysis revealed high-affinity and lower affinity binding sites, with apparent K d of 2.3 ± 1.0 x 10 -11 M and 2.06 ± 0.43 x 10 -10 M, respectively. Binding was reversible and inhibited by melatonin and closely related analogs but not by serotonin or norepinephrine. Treatment of crude membranes with the nonhydrolyzable GTP analog guanosine 5'-[γ-thio]triphosphate (GTP[γS]), significantly reduced the number of high-affinity receptors and increased the dissociation rate of 125 I-Mel from its receptor. Furthermore, GTP[γS] treatment of ligand-receptor complexes solubilized by Triton X-100 also led to a rapid dissociation of 125 I-Mel from solubilized ligand-receptor complexes. Gel filtration chromatography of solubilized ligand-receptor complexes revealed two major peaks of radioactivity corresponding to M r > 400,000 and M r ca. 110,000. This elution profile was markedly altered by pretreatment with GTP[γS] before solubilization; only the M r 110,000 peak was present in GTP[γS]-pretreated membranes. The results strongly suggest that 125 I-mel binding sites in lizard brain are melatonin receptors, with agonist-promoted guanine nucleotide-binding protein (G protein) coupling and that the apparent molecular size of receptors uncoupled from G proteins is about 110,000

  5. Haploinsufficiency of the Sec7 guanine nucleotide exchange factor gea1 impairs septation in fission yeast.

    Directory of Open Access Journals (Sweden)

    Alan M Eckler

    Full Text Available Membrane trafficking is essential to eukaryotic life and is controlled by a complex network of proteins that regulate movement of proteins and lipids between organelles. The GBF1/GEA family of Guanine nucleotide Exchange Factors (GEFs regulates trafficking between the endoplasmic reticulum and Golgi by catalyzing the exchange of GDP for GTP on ADP Ribosylation Factors (Arfs. Activated Arfs recruit coat protein complex 1 (COP-I to form vesicles that ferry cargo between these organelles. To further explore the function of the GBF1/GEA family, we have characterized a fission yeast mutant lacking one copy of the essential gene gea1 (gea1+/-, the Schizosaccharomyces pombe ortholog of GBF1. The haploinsufficient gea1+/- strain was shown to be sensitive to the GBF1 inhibitor brefeldin A (BFA and was rescued from BFA sensitivity by gea1p overexpression. No overt defects in localization of arf1p or arf6p were observed in gea1+/- cells, but the fission yeast homolog of the COP-I cargo sac1 was mislocalized, consistent with impaired COP-I trafficking. Although Golgi morphology appeared normal, a slight increase in vacuolar size was observed in the gea1+/- mutant strain. Importantly, gea1+/- cells exhibited dramatic cytokinesis-related defects, including disorganized contractile rings, an increased septation index, and alterations in septum morphology. Septation defects appear to result from altered secretion of enzymes required for septum dynamics, as decreased secretion of eng1p, a β-glucanase required for septum breakdown, was observed in gea1+/- cells, and overexpression of eng1p suppressed the increased septation phenotype. These observations implicate gea1 in regulation of septum breakdown and establish S. pombe as a model system to explore GBF1/GEA function in cytokinesis.

  6. Expression Pattern and Localization Dynamics of Guanine Nucleotide Exchange Factor RIC8 during Mouse Oogenesis.

    Directory of Open Access Journals (Sweden)

    Merly Saare

    Full Text Available Targeting of G proteins to the cell cortex and their activation is one of the triggers of both asymmetric and symmetric cell division. Resistance to inhibitors of cholinesterase 8 (RIC8, a guanine nucleotide exchange factor, activates a certain subgroup of G protein α-subunits in a receptor independent manner. RIC8 controls the asymmetric cell division in Caenorhabditis elegans and Drosophila melanogaster, and symmetric cell division in cultured mammalian cells, where it regulates the mitotic spindle orientation. Although intensely studied in mitosis, the function of RIC8 in mammalian meiosis has remained unknown. Here we demonstrate that the expression and subcellular localization of RIC8 changes profoundly during mouse oogenesis. Immunofluorescence studies revealed that RIC8 expression is dependent on oocyte growth and cell cycle phase. During oocyte growth, RIC8 is abundantly present in cytoplasm of oocytes at primordial, primary and secondary preantral follicle stages. Later, upon oocyte maturation RIC8 also populates the germinal vesicle, its localization becomes cell cycle dependent, and it associates with chromatin and the meiotic spindle. After fertilization, RIC8 protein converges to the pronuclei and is also detectable at high levels in the nucleolus precursor bodies of both maternal and paternal pronucleus. During first cleavage of zygote RIC8 localizes in the mitotic spindle and cell cortex of forming blastomeres. In addition, we demonstrate that RIC8 co-localizes with its interaction partners Gαi1/2:GDP and LGN in meiotic/mitotic spindle, cell cortex and polar bodies of maturing oocytes and zygotes. Downregulation of Ric8 by siRNA leads to interferred translocation of Gαi1/2 to cortical region of maturing oocytes and reduction of its levels. RIC8 is also expressed at high level in female reproductive organs e.g. oviduct. Therefore we suggest a regulatory function for RIC8 in mammalian gametogenesis and fertility.

  7. The guanine nucleotide exchange factor RIC8 regulates conidial germination through Gα proteins in Neurospora crassa.

    Directory of Open Access Journals (Sweden)

    Carla J Eaton

    Full Text Available Heterotrimeric G protein signaling is essential for normal hyphal growth in the filamentous fungus Neurospora crassa. We have previously demonstrated that the non-receptor guanine nucleotide exchange factor RIC8 acts upstream of the Gα proteins GNA-1 and GNA-3 to regulate hyphal extension. Here we demonstrate that regulation of hyphal extension results at least in part, from an important role in control of asexual spore (conidia germination. Loss of GNA-3 leads to a drastic reduction in conidial germination, which is exacerbated in the absence of GNA-1. Mutation of RIC8 leads to a reduction in germination similar to that in the Δgna-1, Δgna-3 double mutant, suggesting that RIC8 regulates conidial germination through both GNA-1 and GNA-3. Support for a more significant role for GNA-3 is indicated by the observation that expression of a GTPase-deficient, constitutively active gna-3 allele in the Δric8 mutant leads to a significant increase in conidial germination. Localization of the three Gα proteins during conidial germination was probed through analysis of cells expressing fluorescently tagged proteins. Functional TagRFP fusions of each of the three Gα subunits were constructed through insertion of TagRFP in a conserved loop region of the Gα subunits. The results demonstrated that GNA-1 localizes to the plasma membrane and vacuoles, and also to septa throughout conidial germination. GNA-2 and GNA-3 localize to both the plasma membrane and vacuoles during early germination, but are then found in intracellular vacuoles later during hyphal outgrowth.

  8. Regulation of mitotic spindle formation by the RhoA guanine nucleotide exchange factor ARHGEF10

    Directory of Open Access Journals (Sweden)

    Satoh Takaya

    2009-07-01

    Full Text Available Abstract Background The Dbl family guanine nucleotide exchange factor ARHGEF10 was originally identified as the product of the gene associated with slowed nerve-conduction velocities of peripheral nerves. However, the function of ARHGEF10 in mammalian cells is totally unknown at a molecular level. ARHGEF10 contains no distinctive functional domains except for tandem Dbl homology-pleckstrin homology and putative transmembrane domains. Results Here we show that RhoA is a substrate for ARHGEF10. In both G1/S and M phases, ARHGEF10 was localized in the centrosome in adenocarcinoma HeLa cells. Furthermore, RNA interference-based knockdown of ARHGEF10 resulted in multipolar spindle formation in M phase. Each spindle pole seems to contain a centrosome consisting of two centrioles and the pericentriolar material. Downregulation of RhoA elicited similar phenotypes, and aberrant mitotic spindle formation following ARHGEF10 knockdown was rescued by ectopic expression of constitutively activated RhoA. Multinucleated cells were not increased upon ARHGEF10 knockdown in contrast to treatment with Y-27632, a specific pharmacological inhibitor for the RhoA effector kinase ROCK, which induced not only multipolar spindle formation, but also multinucleation. Therefore, unregulated centrosome duplication rather than aberration in cytokinesis may be responsible for ARHGEF10 knockdown-dependent multipolar spindle formation. We further isolated the kinesin-like motor protein KIF3B as a binding partner of ARHGEF10. Knockdown of KIF3B again caused multipolar spindle phenotypes. The supernumerary centrosome phenotype was also observed in S phase-arrested osteosarcoma U2OS cells when the expression of ARHGEF10, RhoA or KIF3B was abrogated by RNA interference. Conclusion Collectively, our results suggest that a novel RhoA-dependent signaling pathway under the control of ARHGEF10 has a pivotal role in the regulation of the cell division cycle. This pathway is not involved in

  9. ARHGEF7 (Beta-PIX acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.

    Directory of Open Access Journals (Sweden)

    Karina Haebig

    Full Text Available BACKGROUND: Mutations within the leucine-rich repeat kinase 2 (LRRK2 gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. METHODOLOGY/PRINCIPAL FINDINGS: Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. CONCLUSIONS/SIGNIFICANCE: Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i a feedback control mechanism for LRRK2 activity as well as (ii an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.

  10. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    International Nuclear Information System (INIS)

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.; Price, S.R.; Moss, J.; Vaughan, M.

    1989-01-01

    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A) + RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A) + RNA are consistent with the presence of at least two, and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs

  11. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  12. Differential Rac1 signalling by guanine nucleotide exchange factors implicates FLII in regulating Rac1-driven cell migration

    Science.gov (United States)

    Marei, Hadir; Carpy, Alejandro; Woroniuk, Anna; Vennin, Claire; White, Gavin; Timpson, Paul; Macek, Boris; Malliri, Angeliki

    2016-01-01

    The small GTPase Rac1 has been implicated in the formation and dissemination of tumours. Upon activation by guanine nucleotide exchange factors (GEFs), Rac1 associates with a variety of proteins in the cell thereby regulating various functions, including cell migration. However, activation of Rac1 can lead to opposing migratory phenotypes raising the possibility of exacerbating tumour progression when targeting Rac1 in a clinical setting. This calls for the identification of factors that influence Rac1-driven cell motility. Here we show that Tiam1 and P-Rex1, two Rac GEFs, promote Rac1 anti- and pro-migratory signalling cascades, respectively, through regulating the Rac1 interactome. In particular, we demonstrate that P-Rex1 stimulates migration through enhancing the interaction between Rac1 and the actin-remodelling protein flightless-1 homologue, to modulate cell contraction in a RhoA-ROCK-independent manner. PMID:26887924

  13. The PDZ domain of the guanine nucleotide exchange factor PDZGEF directs binding to phosphatidic acid during brush border formation.

    Directory of Open Access Journals (Sweden)

    Sarah V Consonni

    Full Text Available PDZGEF is a guanine nucleotide exchange factor for the small G protein Rap. It was recently found that PDZGEF contributes to establishment of intestinal epithelial polarity downstream of the kinase Lkb1. By binding to phosphatidic acid enriched at the apical membrane, PDZGEF locally activates Rap2a resulting in induction of brush border formation via a pathway that includes the polarity players TNIK, Mst4 and Ezrin. Here we show that the PDZ domain of PDZGEF is essential and sufficient for targeting PDZGEF to the apical membrane of polarized intestinal epithelial cells. Inhibition of PLD and consequently production of phosphatidic acid inhibitis targeting of PDZGEF to the plasma membrane. Furthermore, localization requires specific positively charged residues within the PDZ domain. We conclude that local accumulation of PDZGEF at the apical membrane during establishment of epithelial polarity is mediated by electrostatic interactions between positively charged side chains in the PDZ domain and negatively charged phosphatidic acid.

  14. Protein Kinase A (PKA) Type I Interacts with P-Rex1, a Rac Guanine Nucleotide Exchange Factor

    Science.gov (United States)

    Chávez-Vargas, Lydia; Adame-García, Sendi Rafael; Cervantes-Villagrana, Rodolfo Daniel; Castillo-Kauil, Alejandro; Bruystens, Jessica G. H.; Fukuhara, Shigetomo; Taylor, Susan S.; Mochizuki, Naoki; Reyes-Cruz, Guadalupe; Vázquez-Prado, José

    2016-01-01

    Morphology of migrating cells is regulated by Rho GTPases and fine-tuned by protein interactions and phosphorylation. PKA affects cell migration potentially through spatiotemporal interactions with regulators of Rho GTPases. Here we show that the endogenous regulatory (R) subunit of type I PKA interacts with P-Rex1, a Rac guanine nucleotide exchange factor that integrates chemotactic signals. Type I PKA holoenzyme interacts with P-Rex1 PDZ domains via the CNB B domain of RIα, which when expressed by itself facilitates endothelial cell migration. P-Rex1 activation localizes PKA to the cell periphery, whereas stimulation of PKA phosphorylates P-Rex1 and prevents its activation in cells responding to SDF-1 (stromal cell-derived factor 1). The P-Rex1 DEP1 domain is phosphorylated at Ser-436, which inhibits the DH-PH catalytic cassette by direct interaction. In addition, the P-Rex1 C terminus is indirectly targeted by PKA, promoting inhibitory interactions independently of the DEP1-PDZ2 region. A P-Rex1 S436A mutant construct shows increased RacGEF activity and prevents the inhibitory effect of forskolin on sphingosine 1-phosphate-dependent endothelial cell migration. Altogether, these results support the idea that P-Rex1 contributes to the spatiotemporal localization of type I PKA, which tightly regulates this guanine exchange factor by a multistep mechanism, initiated by interaction with the PDZ domains of P-Rex1 followed by direct phosphorylation at the first DEP domain and putatively indirect regulation of the C terminus, thus promoting inhibitory intramolecular interactions. This reciprocal regulation between PKA and P-Rex1 might represent a key node of integration by which chemotactic signaling is fine-tuned by PKA. PMID:26797121

  15. The domain architecture of large guanine nucleotide exchange factors for the small GTP-binding protein Arf

    Directory of Open Access Journals (Sweden)

    Geldner Niko

    2005-02-01

    Full Text Available Abstract Background Small G proteins, which are essential regulators of multiple cellular functions, are activated by guanine nucleotide exchange factors (GEFs that stimulate the exchange of the tightly bound GDP nucleotide by GTP. The catalytic domain responsible for nucleotide exchange is in general associated with non-catalytic domains that define the spatio-temporal conditions of activation. In the case of small G proteins of the Arf subfamily, which are major regulators of membrane trafficking, GEFs form a heterogeneous family whose only common characteristic is the well-characterized Sec7 catalytic domain. In contrast, the function of non-catalytic domains and how they regulate/cooperate with the catalytic domain is essentially unknown. Results Based on Sec7-containing sequences from fully-annotated eukaryotic genomes, including our annotation of these sequences from Paramecium, we have investigated the domain architecture of large ArfGEFs of the BIG and GBF subfamilies, which are involved in Golgi traffic. Multiple sequence alignments combined with the analysis of predicted secondary structures, non-structured regions and splicing patterns, identifies five novel non-catalytic structural domains which are common to both subfamilies, revealing that they share a conserved modular organization. We also report a novel ArfGEF subfamily with a domain organization so far unique to alveolates, which we name TBS (TBC-Sec7. Conclusion Our analysis unifies the BIG and GBF subfamilies into a higher order subfamily, which, together with their being the only subfamilies common to all eukaryotes, suggests that they descend from a common ancestor from which species-specific ArfGEFs have subsequently evolved. Our identification of a conserved modular architecture provides a background for future functional investigation of non-catalytic domains.

  16. Different effects of guanine nucleotides (GDP and GTP) on protein-mediated mitochondrial proton leak.

    Science.gov (United States)

    Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa

    2014-01-01

    In this study, we compared the influence of GDP and GTP on isolated mitochondria respiring under conditions favoring oxidative phosphorylation (OXPHOS) and under conditions excluding this process, i.e., in the presence of carboxyatractyloside, an adenine nucleotide translocase inhibitor, and/or oligomycin, an FOF1-ATP synthase inhibitor. Using mitochondria isolated from rat kidney and human endothelial cells, we found that the action of GDP and GTP can differ diametrically depending on the conditions. Namely, under conditions favoring OXPHOS, both in the absence and presence of linoleic acid, an activator of uncoupling proteins (UCPs), the addition of 1 mM GDP resulted in the state 4 (non-phosphorylating respiration)-state 3 (phosphorylating respiration) transition, which is characteristic of ADP oxidative phosphorylation. In contrast, the addition of 1 mM GTP resulted in a decrease in the respiratory rate and an increase in the membrane potential, which is characteristic of UCP inhibition. The stimulatory effect of GDP, but not GTP, was also observed in inside-out submitochondrial particles prepared from rat kidney mitochondria. However, the effects of GDP and GTP were more similar in the presence of OXPHOS inhibitors. The importance of these observations in connection with the action of UCPs, adenine nucleotide translocase (or other carboxyatractyloside-sensitive carriers), carboxyatractyloside- and purine nucleotide-insensitive carriers, as well as nucleoside-diphosphate kinase (NDPK) are considered. Because the measurements favoring oxidative phosphorylation better reflect in vivo conditions, our study strongly supports the idea that GDP cannot be considered a significant physiological inhibitor of UCP. Moreover, it appears that, under native conditions, GTP functions as a more efficient UCP inhibitor than GDP and ATP.

  17. BLOC-3 mutated in Hermansky-Pudlak syndrome is a Rab32/38 guanine nucleotide exchange factor.

    Science.gov (United States)

    Gerondopoulos, Andreas; Langemeyer, Lars; Liang, Jin-Rui; Linford, Andrea; Barr, Francis A

    2012-11-20

    Hermansky-Pudlak syndrome (HPS) is a human disease characterized by partial loss of pigmentation and impaired blood clotting. These symptoms are caused by defects in the biogenesis of melanosomes and platelet dense granules, often referred to as lysosome-related organelles. Genes mutated in HPS encode subunits of the biogenesis of lysosome-related organelles complexes (BLOCs). BLOC-1 and BLOC-2, together with the AP-3 clathrin adaptor complex, act at early endosomes to sort components required for melanin formation and melanosome biogenesis away from the degradative lysosomal pathway toward early stage melanosomes. However the molecular functions of the Hps1-Hps4 complex BLOC-3 remain mysterious. Like other trafficking pathways, melanosome biogenesis and transport of enzymes involved in pigmentation involves specific Rab GTPases, in this instance Rab32 and Rab38. We now demonstrate that BLOC-3 is a Rab32 and Rab38 guanine nucleotide exchange factor (GEF). Silencing of the BLOC-3 subunits Hps1 and Hps4 results in the mislocalization of Rab32 and Rab38 and reduction in pigmentation. In addition, we show that BLOC-3 can promote specific membrane recruitment of Rab32/38. BLOC-3 therefore defines a novel Rab GEF family with a specific function in the biogenesis of lysosome-related organelles. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. A High-Throughput Assay for Rho Guanine Nucleotide Exchange Factors Based on the Transcreener GDP Assay.

    Science.gov (United States)

    Reichman, Melvin; Schabdach, Amanda; Kumar, Meera; Zielinski, Tom; Donover, Preston S; Laury-Kleintop, Lisa D; Lowery, Robert G

    2015-12-01

    Ras homologous (Rho) family GTPases act as molecular switches controlling cell growth, movement, and gene expression by cycling between inactive guanosine diphosphate (GDP)- and active guanosine triphosphate (GTP)-bound conformations. Guanine nucleotide exchange factors (GEFs) positively regulate Rho GTPases by accelerating GDP dissociation to allow formation of the active, GTP-bound complex. Rho proteins are directly involved in cancer pathways, especially cell migration and invasion, and inhibiting GEFs holds potential as a therapeutic strategy to diminish Rho-dependent oncogenesis. Methods for measuring GEF activity suitable for high-throughput screening (HTS) are limited. We developed a simple, generic biochemical assay method for measuring GEF activity based on the fact that GDP dissociation is generally the rate-limiting step in the Rho GTPase catalytic cycle, and thus addition of a GEF causes an increase in steady-state GTPase activity. We used the Transcreener GDP Assay, which relies on selective immunodetection of GDP, to measure the GEF-dependent stimulation of steady-state GTP hydrolysis by small GTPases using Dbs (Dbl's big sister) as a GEF for Cdc42, RhoA, and RhoB. The assay is well suited for HTS, with a homogenous format and far red fluorescence polarization (FP) readout, and it should be broadly applicable to diverse Rho GEF/GTPase pairs. © 2015 Society for Laboratory Automation and Screening.

  19. RINL, guanine nucleotide exchange factor Rab5-subfamily, is involved in the EphA8-degradation pathway with odin.

    Directory of Open Access Journals (Sweden)

    Hiroaki Kajiho

    Full Text Available The Rab family of small guanosine triphosphatases (GTPases plays a vital role in membrane trafficking. Its active GTP-bound state is driven by guanine nucleotide-exchange factors (GEFs. Ras and Rab interactor (or Ras interaction/interference-like (RINL, which contains a conserved VPS9 domain critical for GEF action, was recently identified as a new Rab5 subfamily GEF in vitro. However, its detailed function and interacting molecules have not yet been fully elucidated. Here we found that RINL has GEF activity for the Rab5 subfamily proteins by measuring their GTP-bound forms in cultured cells. We also found that RINL interacts with odin, a member of the ankyrin-repeat and sterile-alpha motif (SAM domain-containing (Anks protein family. In addition, the Eph tyrosine kinase receptor EphA8 formed a ternary complex with both RINL and odin. Interestingly, RINL expression in cultured cells reduced EphA8 levels in a manner dependent on both its GEF activity and interaction with odin. In addition, knockdown of RINL increased EphA8 level in HeLa cells. Our findings suggest that RINL, as a GEF for Rab5 subfamily, is implicated in the EphA8-degradation pathway via its interaction with odin.

  20. The Cdc42 guanine nucleotide exchange factor FGD6 coordinates cell polarity and endosomal membrane recycling in osteoclasts.

    Science.gov (United States)

    Steenblock, Charlotte; Heckel, Tobias; Czupalla, Cornelia; Espírito Santo, Ana Isabel; Niehage, Christian; Sztacho, Martin; Hoflack, Bernard

    2014-06-27

    The initial step of bone digestion is the adhesion of osteoclasts onto bone surfaces and the assembly of podosomal belts that segregate the bone-facing ruffled membrane from other membrane domains. During bone digestion, membrane components of the ruffled border also need to be recycled after macropinocytosis of digested bone materials. How osteoclast polarity and membrane recycling are coordinated remains unknown. Here, we show that the Cdc42-guanine nucleotide exchange factor FGD6 coordinates these events through its Src-dependent interaction with different actin-based protein networks. At the plasma membrane, FGD6 couples cell adhesion and actin dynamics by regulating podosome formation through the assembly of complexes comprising the Cdc42-interactor IQGAP1, the Rho GTPase-activating protein ARHGAP10, and the integrin interactors Talin-1/2 or Filamin A. On endosomes and transcytotic vesicles, FGD6 regulates retromer-dependent membrane recycling through its interaction with the actin nucleation-promoting factor WASH. These results provide a mechanism by which a single Cdc42-exchange factor controlling different actin-based processes coordinates cell adhesion, cell polarity, and membrane recycling during bone degradation. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Role of a guanine nucleotide-binding protein in α1-adrenergic receptor-mediated Ca2+ mobilization in DDT1 MF-2 cells

    International Nuclear Information System (INIS)

    Cornett, L.E.; Norris, J.S.

    1987-01-01

    In this study the mechanisms involved in α 1 -adrenergic receptor-mediated Ca 2+ mobilization at the level of the plasma membrane were investigated. Stimulation of 45 Ca 2+ efflux from saponin-permeabilized DDT 1 MF-2 cells was observed with the addition of either the α 1 -adrenergic agonist phenylephrine and guanosine-5'-triphosphate or the nonhydrolyzable guanine nucleotide guanylyl-imidodiphosphate. In the presence of [ 32 P] NAD, pertussis toxin was found to catalyze ADP-ribosylation of a M/sub r/ = 40,500 (n = 8) peptide in membranes prepared from DDT 1 , MF-2 cells, possibly the α-subunit of N/sub i/. However, stimulation of unidirectional 45 Ca 2+ efflux by phenylephrine was not affected by previous treatment of cells with 100 ng/ml pertussis toxin. These data suggest that the putative guanine nucleotide-binding protein which couples the α 1 -adrenergic receptor to Ca 2+ mobilization in DDT 1 MF-2 cells is not a pertussis toxin substrate and may possibly be an additional member of guanine nucleotide binding protein family

  2. Guanine nucleotide regulation of muscarinic receptor-mediated inositol phosphate formation in permeabilized 1321N1 cells

    International Nuclear Information System (INIS)

    Orellana, S.A.; Trilivas, I.; Brown, J.H.

    1986-01-01

    Carbachol and guanine nucleotides stimulate formation of the ( 3 H)inositol phosphates IP, IP2, and IP3 in saponin-permeabilized monolayers labelled with ( 3 H) inositol. Carbachol alone has little effect on formation of the ( 3 H) inositol phosphates (IPs), but GTPγS causes synergistic accumulation of ( 3 H)IPs to levels similar to those seen in intact cells. GTP, GppNHp, and GTPγS all support formation of the ( 3 H)IPs, with or without hormone, but GTPγS is the most effective. In the presence of GTPγS, the effect of carbachol is dose-dependent. Half-maximal and maximal accumulation of the ( 3 H)IPs occur at ∼ 5 μM and ∼ 100 μM carbachol, respectively; values close to those seen in intact cells. GTPγS alone stimulates formation of the ( 3 H)IPs after a brief lag time. The combination of GTPγS and carbachol both increases the rate of, and decreases the lag in, formation of the ( 3 H)IPs. LiCl increases ( 3 H)IP and IP2, but not IP3, accumulation; while 2,3-diphosphoglycerate substantially increases that of ( 3 H)IP3. GTPγS and carbachol cause formation of ( 3 H)IPs in the absence of Ca ++ , but formation induced by GTPγS with or without carbachol is Ca ++ -sensitive over a range of physiological concentrations. Although carbachol, Ca ++ , and GTPγS all have effects on formation of ( 3 H)IPs, GTPγS appears to be a primary and obligatory regulator of phosphoinositide hydrolysis in the permeabilized 1321N1 astrocytoma cell

  3. Overexpression of GEFT, a Rho family guanine nucleotide exchange factor, predicts poor prognosis in patients with rhabdomyosarcoma.

    Science.gov (United States)

    Sun, Chao; Liu, Chunxia; Li, Shugang; Li, Hongan; Wang, Yuanyuan; Xie, Yuwen; Li, Bingcheng; Cui, Xiaobin; Chen, Yunzhao; Zhang, Wenjie; Li, Feng

    2014-01-01

    Rhabdomyosarcoma (RMS) is one of the most common soft-tissue sarcomas in children and adolescents with poor prognosis. Yet, there is lack of effective prognostic biomarkers for RMS. The present study, therefore, aimed to explore potential biomarkers for RMS based on our previous findings using array comparative genomic hybridization. We investigated guanine nucleotide exchange factor, GEFT, at expression level in 45 RMS patients and 36 normal striated muscle controls using immunohistochemistry using tissue microarrays. The expression rate of GEFT in RMS samples (42/45, 93.33%) was significantly higher (Prate of GEFT in RMS (31/45, 68.89%) was also significantly higher (P<0.05) than that in normal controls (0/36, 0.00%). Increased expression of GEFT correlated significantly with advanced disease stages (stages III/IV) (P=0.001), lymph node metastasis (P=0.019), and distant metastasis (P=0.004), respectively, in RMS patients. In addition, RMS patients having overexpressed GEFT experienced worse overall survival (OS) than those having low levels of GEFT (P=0.001). GEFT overexpression was determined to be an independent prognostic factor for poor OS in RMS patients (hazard ratio: 3.491, 95% confidence interval: 1.121-10.871, P=0.004). In conclusion, these observations provide the first evidence of GEFT overexpression in RMS and its correlations with disease aggressiveness and metastasis. These findings suggest that GEFT may serve as a promising biomarker predicting poor prognosis in RMS patients, thus implying its potential as a therapeutic target.

  4. Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.

    Science.gov (United States)

    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli

    2014-01-01

    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

  5. Guanine nucleotide-binding protein subunit beta-2-like 1, a new Annexin A7 interacting protein

    International Nuclear Information System (INIS)

    Du, Yue; Meng, Jinyi; Huang, Yuhong; Wu, Jun; Wang, Bo; Ibrahim, Mohammed M.; Tang, Jianwu

    2014-01-01

    Highlights: • RACK1 formed a complex with Annexin A7. • Depletion of RACK1 inhibited the proliferation, migration and invasion. • RACK1 RNAi abolished RACK1-Annexin A7 interaction. • RACK1-Annexin A7 may play a role in regulating the metastatic potentials. - Abstract: We report for the first time that Guanine nucleotide-binding protein subunit beta-2-like 1 (RACK1) formed a complex with Annexin A7. Hca-F and Hca-P are a pair of syngeneic mouse hepatocarcinoma cell lines established and maintained in our laboratory. Our previous study showed that both Annexin A7 and RACK1 were expressed higher in Hca-F (lymph node metastasis >70%) than Hca-P (lymph node metastasis <30%). Suppression of Annexin A7 expression in Hca-F cells induced decreased migration and invasion ability. In this study, knockdown of RACK1 by RNA interference (RNAi) had the same impact on metastasis potential of Hca-F cells as Annexin A7 down-regulation. Furthermore, by co-immunoprecipitation and double immunofluorescence confocal imaging, we found that RACK1 was in complex with Annexin A7 in control cells, but not in the RACK1-down-regulated cells, indicating the abolishment of RACK1-Annexin A7 interaction in Hca-F cells by RACK1 RNAi. Taken together, these results suggest that RACK1-Annexin A7 interaction may be one of the means by which RACK1 and Annexin A7 influence the metastasis potential of mouse hepatocarcinoma cells in vitro

  6. Regulation of formyl peptide receptor binding to rabbit neutrophil plasma membranes. Use of monovalent cations, guanine nucleotides, and bacterial toxins to discriminate among different states of the receptor

    International Nuclear Information System (INIS)

    Feltner, D.E.; Marasco, W.A.

    1989-01-01

    The regulation by monovalent cations, guanine nucleotides, and bacterial toxins of [3H]FMLP binding to rabbit neutrophil plasma membranes was studied by using dissociation techniques to identify regulatory effects on separate receptor states. Under conditions of low receptor occupancy (1 nM [3H]FMLP) and in both Na+ and K+ buffers, dissociation is heterogenous, displaying two distinct, statistically significant off rates. [3H]FMLP binding was enhanced by substituting other monovalent cations for Na+. In particular, enhanced binding in the presence of K+ relative to Na+ was caused by additional binding to both rapidly and slowly dissociating receptors. Three receptor dissociation rates, two of which appear to correspond to the two affinity states detected in equilibrium binding studies, were defined by specific GTP and pertussis toxin (PT) treatments. Neither GTP, nor PT or cholera toxins (CT) had an effect on the rate of dissociation of [3H]FMLP from the rapidly dissociating form of the receptor. Both 100 microM GTP and PT treatments increased the percentage of rapidly dissociating receptors, correspondingly decreasing the percentage of slowly dissociating receptors. The observed changes in the rapidly and slowly dissociating receptors after GTP, PT, and CT treatments were caused by an absolute decrease in the amount of binding to the slowly dissociating receptors. However, complete inhibition of slowly dissociating receptor binding by GTP, PT, or both was never observed. Both GTP and PT treatments, but not CT treatment, increased by two-fold the rate of dissociation of 1 nM [3H]FMLP from the slowly dissociating form of the receptor, resulting in a third dissociation rate. Thus, slowly dissociating receptors comprise two different receptor states, a G protein-associated guanine nucleotide and PT-sensitive state and a guanine nucleotide-insensitive state

  7. Guanine nucleotide-dependent, pertussis toxin-insensitive, stimulation of inositol phosphate formation by carbachol in a membrane preparation from astrocytoma cells

    International Nuclear Information System (INIS)

    Hepler, J.R.; Harden, T.K.

    1986-01-01

    Formation of the inositol phosphates (InsP), InsP 3 , InsP 2 , and InsP 1 was increased in a concentration dependent manner (K/sub 0.5/ ∼ 5 μM) by GTPΣS in washed membranes prepared from 3 H-inositol-prelabelled 1321N1 human astrocytoma cells. Both GTPγS and GppNHp stimulated InsP formation by 2-3 fold over control; GTP and GDP were much less efficacious and GMP had no effect. Although the muscarinic cholinergic receptor agonist carbachol had no effect in the absence of guanine nucleotide, in the presence of 10 μM GTPγS, carbachol stimulated (K/sub 0.5/ ∼ 10 μ M) the formation of InsP above the level achieved with GTPγS alone. The effect of carbachol was completely blocked by atropine. The order of potency for a series of nucleotides for stimulation of InsP formation in the presence of 500 μM carbachol was GTPγS > GppNHp > GTP = GDP. Pertussis toxin, at concentrations that fully ADP-ribosylate and functionally inactivate G/sub i/, had no effect on InsP formation in the presence of GTPγS or GTPγS plus carbachol. Histamine and bradykinin also stimulated InsP formation in the presence of GTPγS in washed membranes from 1321N1 cells. These data are consistent with the idea that a guanine nucleotide regulatory protein that is not G/sub i/ is involved in receptor-mediated stimulation of InsP formation in 1321N1 human astrocytoma cells

  8. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E. (Fitzsimons Army Medical Center, Aurora, CO (USA))

    1990-06-01

    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.

  9. Guanine nucleotide exchange factor αPIX leads to activation of the Rac 1 GTPase/glycogen phosphorylase pathway in interleukin (IL)-2-stimulated T cells

    DEFF Research Database (Denmark)

    Llavero, Francisco; Urzelai, Bakarne; Osinalde, Nerea

    2015-01-01

    Recently, we have reported that the active form of Rac 1 GTPase binds to the glycogen phosphorylase muscle isoform (PYGM) and modulates its enzymatic activity leading to T cell proliferation. In the lymphoid system, Rac 1 and in general other small GTPases of the Rho family participate...... in the signaling cascades that are activated after engagement of the T cell antigen receptor. However, little is known about the IL-2-dependent Rac 1 activator molecules. For the first time, a signaling pathway leading to the activation of Rac 1/PYGM in response to IL-2-stimulated T cell proliferation is described....... More specifically, αPIX, a known guanine nucleotide exchange factor for the small GTPases of the Rho family, preferentially Rac 1, mediates PYGM activation in Kit 225 T cells stimulated with IL-2. Using directed mutagenesis, phosphorylation of αPIX Rho-GEF serines 225 and 488 is required for activation...

  10. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    International Nuclear Information System (INIS)

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E.

    1990-01-01

    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of [G- 3 H] hypoxanthine (Hy) into [ 3 H] labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate [ 3 H] ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation

  11. BIG1, a brefeldin A-inhibited guanine nucleotide-exchange protein regulates neurite development via PI3K-AKT and ERK signaling pathways.

    Science.gov (United States)

    Zhou, C; Li, C; Li, D; Wang, Y; Shao, W; You, Y; Peng, J; Zhang, X; Lu, L; Shen, X

    2013-12-19

    The elongation of neuron is highly dependent on membrane trafficking. Brefeldin A (BFA)-inhibited guanine nucleotide-exchange protein 1 (BIG1) functions in the membrane trafficking between the Golgi apparatus and the plasma membrane. BFA, an uncompetitive inhibitor of BIG1 can inhibit neurite outgrowth and polarity development. In this study, we aimed to define the possible role of BIG1 in neurite development and to further investigate the potential mechanism. By immunostaining, we found that BIG1 was extensively colocalized with synaptophysin, a marker for synaptic vesicles in soma and partly in neurites. The amount of both protein and mRNA of BIG1 were up-regulated during rat brain development. BIG1 depletion significantly decreased the neurite length and inhibited the phosphorylation of phosphatidylinositide 3-kinase (PI3K) and protein kinase B (AKT). Inhibition of BIG1 guanine nucleotide-exchange factor (GEF) activity by BFA or overexpression of the dominant-negative BIG1 reduced PI3K and AKT phosphorylation, indicating regulatory effects of BIG1 on PI3K-AKT signaling pathway is dependent on its GEF activity. BIG1 siRNA or BFA treatment also significantly reduced extracellular signal-regulated kinase (ERK) phosphorylation. Overexpression of wild-type BIG1 significantly increased ERK phosphorylation, but the dominant-negative BIG1 had no effect on ERK phosphorylation, indicating the involvement of BIG1 in ERK signaling regulation may not be dependent on its GEF activity. Our result identified a novel function of BIG1 in neurite development. The newly recognized function integrates the function of BIG1 in membrane trafficking with the activation of PI3K-AKT and ERK signaling pathways which are critical in neurite development. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  12. Protein Kinase A (PKA) Type I Interacts with P-Rex1, a Rac Guanine Nucleotide Exchange Factor: EFFECT ON PKA LOCALIZATION AND P-Rex1 SIGNALING.

    Science.gov (United States)

    Chávez-Vargas, Lydia; Adame-García, Sendi Rafael; Cervantes-Villagrana, Rodolfo Daniel; Castillo-Kauil, Alejandro; Bruystens, Jessica G H; Fukuhara, Shigetomo; Taylor, Susan S; Mochizuki, Naoki; Reyes-Cruz, Guadalupe; Vázquez-Prado, José

    2016-03-18

    Morphology of migrating cells is regulated by Rho GTPases and fine-tuned by protein interactions and phosphorylation. PKA affects cell migration potentially through spatiotemporal interactions with regulators of Rho GTPases. Here we show that the endogenous regulatory (R) subunit of type I PKA interacts with P-Rex1, a Rac guanine nucleotide exchange factor that integrates chemotactic signals. Type I PKA holoenzyme interacts with P-Rex1 PDZ domains via the CNB B domain of RIα, which when expressed by itself facilitates endothelial cell migration. P-Rex1 activation localizes PKA to the cell periphery, whereas stimulation of PKA phosphorylates P-Rex1 and prevents its activation in cells responding to SDF-1 (stromal cell-derived factor 1). The P-Rex1 DEP1 domain is phosphorylated at Ser-436, which inhibits the DH-PH catalytic cassette by direct interaction. In addition, the P-Rex1 C terminus is indirectly targeted by PKA, promoting inhibitory interactions independently of the DEP1-PDZ2 region. A P-Rex1 S436A mutant construct shows increased RacGEF activity and prevents the inhibitory effect of forskolin on sphingosine 1-phosphate-dependent endothelial cell migration. Altogether, these results support the idea that P-Rex1 contributes to the spatiotemporal localization of type I PKA, which tightly regulates this guanine exchange factor by a multistep mechanism, initiated by interaction with the PDZ domains of P-Rex1 followed by direct phosphorylation at the first DEP domain and putatively indirect regulation of the C terminus, thus promoting inhibitory intramolecular interactions. This reciprocal regulation between PKA and P-Rex1 might represent a key node of integration by which chemotactic signaling is fine-tuned by PKA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. A Histidine pH sensor regulates activation of the Ras-specific guanine nucleotide exchange factor RasGRP1.

    Science.gov (United States)

    Vercoulen, Yvonne; Kondo, Yasushi; Iwig, Jeffrey S; Janssen, Axel B; White, Katharine A; Amini, Mojtaba; Barber, Diane L; Kuriyan, John; Roose, Jeroen P

    2017-09-27

    RasGRPs are guanine nucleotide exchange factors that are specific for Ras or Rap, and are important regulators of cellular signaling. Aberrant expression or mutation of RasGRPs results in disease. An analysis of RasGRP1 SNP variants led to the conclusion that the charge of His 212 in RasGRP1 alters signaling activity and plasma membrane recruitment, indicating that His 212 is a pH sensor that alters the balance between the inactive and active forms of RasGRP1. To understand the structural basis for this effect we compared the structure of autoinhibited RasGRP1, determined previously, to those of active RasGRP4:H-Ras and RasGRP2:Rap1b complexes. The transition from the autoinhibited to the active form of RasGRP1 involves the rearrangement of an inter-domain linker that displaces inhibitory inter-domain interactions. His 212 is located at the fulcrum of these conformational changes, and structural features in its vicinity are consistent with its function as a pH-dependent switch.

  14. Identification of a negative regulatory region for the exchange activity and characterization of T332I mutant of Rho guanine nucleotide exchange factor 10 (ARHGEF10).

    Science.gov (United States)

    Chaya, Taro; Shibata, Satoshi; Tokuhara, Yasunori; Yamaguchi, Wataru; Matsumoto, Hiroshi; Kawahara, Ichiro; Kogo, Mikihiko; Ohoka, Yoshiharu; Inagaki, Shinobu

    2011-08-26

    The T332I mutation in Rho guanine nucleotide exchange factor 10 (ARHGEF10) was previously found in persons with slowed nerve conduction velocities and thin myelination of peripheral nerves. However, the molecular and cellular basis of the T332I mutant is not understood. Here, we show that ARHGEF10 has a negative regulatory region in the N terminus, in which residue 332 is located, and the T332I mutant is constitutively active. An N-terminal truncated ARHGEF10 mutant, ARHGEF10 ΔN (lacking amino acids 1-332), induced cell contraction that was inhibited by a Rho kinase inhibitor Y27632 and had higher GEF activity for RhoA than the wild type. The T332I mutant also showed the phenotype similar to the N-terminal truncated mutant. These data suggest that the ARHGEF10 T332I mutation-associated phenotype observed in the peripheral nerves is due to activated GEF activity of the ARHGEF10 T332I mutant.

  15. Identification of a Negative Regulatory Region for the Exchange Activity and Characterization of T332I Mutant of Rho Guanine Nucleotide Exchange Factor 10 (ARHGEF10)*

    Science.gov (United States)

    Chaya, Taro; Shibata, Satoshi; Tokuhara, Yasunori; Yamaguchi, Wataru; Matsumoto, Hiroshi; Kawahara, Ichiro; Kogo, Mikihiko; Ohoka, Yoshiharu; Inagaki, Shinobu

    2011-01-01

    The T332I mutation in Rho guanine nucleotide exchange factor 10 (ARHGEF10) was previously found in persons with slowed nerve conduction velocities and thin myelination of peripheral nerves. However, the molecular and cellular basis of the T332I mutant is not understood. Here, we show that ARHGEF10 has a negative regulatory region in the N terminus, in which residue 332 is located, and the T332I mutant is constitutively active. An N-terminal truncated ARHGEF10 mutant, ARHGEF10 ΔN (lacking amino acids 1–332), induced cell contraction that was inhibited by a Rho kinase inhibitor Y27632 and had higher GEF activity for RhoA than the wild type. The T332I mutant also showed the phenotype similar to the N-terminal truncated mutant. These data suggest that the ARHGEF10 T332I mutation-associated phenotype observed in the peripheral nerves is due to activated GEF activity of the ARHGEF10 T332I mutant. PMID:21719701

  16. Regulation of follitropin-sensitive adenylate cyclase by stimulatory and inhibitory forms of the guanine nucleotide regulatory protein in immature rat Sertoli cells

    International Nuclear Information System (INIS)

    Johnson, G.P.

    1987-01-01

    Studies have been designed to examine the role of guanine nucleotides in mediating FSH-sensitive adenylate cyclase activity in Sertoli cell plasma membranes. Analysis of [ 3 H]GDP binding to plasma membranes suggested a single high affinity site with a K d = 0.24 uM. Competition studies indicated that GTP γ S was 7-fold more potent than GDP β S. Bound GDP could be released by FSH in the presence of GTP γ S, but not by FSH alone. Adenylate cyclase activity was enhanced 5-fold by FSH in the presence of GTP. Addition of GDP β S to the activated enzyme (FSH plus GTP) resulted in a time-dependent decay to basal activity within 20 sec. GDP β S competitively inhibited GTP γ S-stimulated adenylate cyclase activity with a K i = 0.18 uM. Adenylate cyclase activity was also demonstrated to be sensitive to the nucleotide bound state. In the presence of FSH, only the GTP γ S-bound form persisted even if GDP β S previously occupied all available binding sites. Two membrane proteins, M r = 43,000 and 48,000, were ADP·ribosylated using cholera toxin and labeling was enhanced 2 to 4-fold by GTP γ S but not by GDP β S. The M r = 43,000 and 48,000 proteins represented variant forms of G S . A single protein of M r = 40,000 (G i ) was ADP-ribosylated by pertussis toxin in vitro. GTP inhibited forskolin-stimulated adenylate cyclase activity with an IC 50 = 0.1 uM. The adenosine analog, N 6 ·phenylisopropyl adenosine enhanced GTP inhibition of forskolin-stimulated adenylate cyclase activity by an additional 15%. GTP-dependent inhibition of forskolin-sensitive adenylate cyclase activity was abolished in membranes prepared from Sertoli cells treated in culture with pertussis toxin

  17. Solo, a RhoA-targeting guanine nucleotide exchange factor, is critical for hemidesmosome formation and acinar development in epithelial cells.

    Science.gov (United States)

    Fujiwara, Sachiko; Matsui, Tsubasa S; Ohashi, Kazumasa; Deguchi, Shinji; Mizuno, Kensaku

    2018-01-01

    Cell-substrate adhesions are essential for various physiological processes, including embryonic development and maintenance of organ functions. Hemidesmosomes (HDs) are multiprotein complexes that attach epithelial cells to the basement membrane. Formation and remodeling of HDs are dependent on the surrounding mechanical environment; however, the upstream signaling mechanisms are not well understood. We recently reported that Solo (also known as ARHGEF40), a guanine nucleotide exchange factor targeting RhoA, binds to keratin8/18 (K8/K18) intermediate filaments, and that their interaction is important for force-induced actin and keratin cytoskeletal reorganization. In this study, we show that Solo co-precipitates with an HD protein, β4-integrin. Co-precipitation assays revealed that the central region (amino acids 330-1057) of Solo binds to the C-terminal region (1451-1752) of β4-integrin. Knockdown of Solo significantly suppressed HD formation in MCF10A mammary epithelial cells. Similarly, knockdown of K18 or treatment with Y-27632, a specific inhibitor of Rho-associated kinase (ROCK), suppressed HD formation. As Solo knockdown or Y-27632 treatment is known to disorganize K8/K18 filaments, these results suggest that Solo is involved in HD formation by regulating K8/K18 filament organization via the RhoA-ROCK signaling pathway. We also showed that knockdown of Solo impairs acinar formation in MCF10A cells cultured in 3D Matrigel. In addition, Solo accumulated at the site of traction force generation in 2D-cultured MCF10A cells. Taken together, these results suggest that Solo plays a crucial role in HD formation and acinar development in epithelial cells by regulating mechanical force-induced RhoA activation and keratin filament organization.

  18. Rac1 Activation Caused by Membrane Translocation of a Guanine Nucleotide Exchange Factor in Akt2-Mediated Insulin Signaling in Mouse Skeletal Muscle.

    Directory of Open Access Journals (Sweden)

    Nobuyuki Takenaka

    Full Text Available Insulin-stimulated glucose uptake in skeletal muscle is mediated by the glucose transporter GLUT4, which is translocated to the plasma membrane following insulin stimulation. Several lines of evidence suggested that the protein kinase Akt2 plays a key role in this insulin action. The small GTPase Rac1 has also been implicated as a regulator of insulin-stimulated GLUT4 translocation, acting downstream of Akt2. However, the mechanisms whereby Akt2 regulates Rac1 activity remain obscure. The guanine nucleotide exchange factor FLJ00068 has been identified as a direct regulator of Rac1 in Akt2-mediated signaling, but its characterization was performed mostly in cultured myoblasts. Here, we provide in vivo evidence that FLJ00068 indeed acts downstream of Akt2 as a Rac1 regulator by using mouse skeletal muscle. Small interfering RNA knockdown of FLJ00068 markedly diminished GLUT4 translocation to the sarcolemma following insulin administration or ectopic expression of a constitutively activated mutant of either phosphoinositide 3-kinase or Akt2. Additionally, insulin and these constitutively activated mutants caused the activation of Rac1 as shown by immunofluorescent microscopy using a polypeptide probe specific to activated Rac1 in isolated gastrocnemius muscle fibers and frozen sections of gastrocnemius muscle. This Rac1 activation was also abrogated by FLJ00068 knockdown. Furthermore, we observed translocation of FLJ00068 to the cell periphery following insulin stimulation in cultured myoblasts. Localization of FLJ00068 in the plasma membrane in insulin-stimulated, but not unstimulated, myoblasts and mouse gastrocnemius muscle was further affirmed by subcellular fractionation and subsequent immunoblotting. Collectively, these results strongly support a critical role of FLJ00068 in Akt2-mediated Rac1 activation in mouse skeletal muscle insulin signaling.

  19. Coordinated regulation by two VPS9 domain-containing guanine nucleotide exchange factors in small GTPase Rab5 signaling pathways in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Kagiwada, Satoshi; Shimazu, Sayuri; Takegawa, Kaoru; Noguchi, Tetsuko; Miyamoto, Masaaki

    2015-01-01

    The small GTPase Rab5 is reported to regulate various cellular functions, such as vesicular transport and endocytosis. VPS9 domain-containing proteins are thought to activate Rab5(s) by their guanine-nucleotide exchange activities. Numerous VPS9 proteins have been identified and are structurally conserved from yeast to mammalian cells. However, the functional relationships among VPS9 proteins in cells remain unclear. Only one Rab5 and two VPS9 proteins were identified in the Schizosaccharomyces pombe genome. Here, we examined the cellular function of two VPS9 proteins and the relationship between these proteins in cellular functions. Vps901-GFP and Vps902-GFP exhibited dotted signals in vegetative and differentiated cells. vps901 deletion mutant (Δvps901) cells exhibited a phenotype deficient in the mating process and responses to high concentrations of ions, such as calcium and metals, and Δvps901Δvps902 double mutant cells exhibited round cell shapes similar to ypt5-909 (Rab5 mutant allele) cells. Deletion of both vps901 and vps902 genes completely abolished the mating process and responses to various stresses. A lack of vacuole formation and aberrant inner cell membrane structures were also observed in Δvps901Δvps902 cells by electron microscopy. These data strongly suggest that Vps901 and Vps902 are cooperatively involved in the regulation of cellular functions, such as cell morphology, sexual development, response to ion stresses, and vacuole formation, via Rab5 signaling pathways in fission yeast cells. - Highlights: • Roles of Rab5 activator VPS9 proteins in cellular functions. • Cooperation between VPS9 proteins in Rab5 signaling pathway. • Roles of each VPS9 protein in Rab5 signaling pathway are discussed

  20. Coordinated regulation by two VPS9 domain-containing guanine nucleotide exchange factors in small GTPase Rab5 signaling pathways in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta [Department of Biology, Graduate School of Science, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan); Kagiwada, Satoshi [Department of Biological Sciences, Faculty of Science, Nara Women' s University, Kitauoyanishi-machi, Nara 630-8506 (Japan); Shimazu, Sayuri [Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan); Takegawa, Kaoru [Department of Bioscience and Biotechnology, Graduate School of Bioresource and Bioenvironmental Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Noguchi, Tetsuko [Department of Biological Sciences, Faculty of Science, Nara Women' s University, Kitauoyanishi-machi, Nara 630-8506 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Department of Biology, Graduate School of Science, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho, Nada, Kobe 657-8501 (Japan)

    2015-03-20

    The small GTPase Rab5 is reported to regulate various cellular functions, such as vesicular transport and endocytosis. VPS9 domain-containing proteins are thought to activate Rab5(s) by their guanine-nucleotide exchange activities. Numerous VPS9 proteins have been identified and are structurally conserved from yeast to mammalian cells. However, the functional relationships among VPS9 proteins in cells remain unclear. Only one Rab5 and two VPS9 proteins were identified in the Schizosaccharomyces pombe genome. Here, we examined the cellular function of two VPS9 proteins and the relationship between these proteins in cellular functions. Vps901-GFP and Vps902-GFP exhibited dotted signals in vegetative and differentiated cells. vps901 deletion mutant (Δvps901) cells exhibited a phenotype deficient in the mating process and responses to high concentrations of ions, such as calcium and metals, and Δvps901Δvps902 double mutant cells exhibited round cell shapes similar to ypt5-909 (Rab5 mutant allele) cells. Deletion of both vps901 and vps902 genes completely abolished the mating process and responses to various stresses. A lack of vacuole formation and aberrant inner cell membrane structures were also observed in Δvps901Δvps902 cells by electron microscopy. These data strongly suggest that Vps901 and Vps902 are cooperatively involved in the regulation of cellular functions, such as cell morphology, sexual development, response to ion stresses, and vacuole formation, via Rab5 signaling pathways in fission yeast cells. - Highlights: • Roles of Rab5 activator VPS9 proteins in cellular functions. • Cooperation between VPS9 proteins in Rab5 signaling pathway. • Roles of each VPS9 protein in Rab5 signaling pathway are discussed.

  1. [3H]WB4101 labels the 5-HT1A serotonin receptor subtype in rat brain. Guanine nucleotide and divalent cation sensitivity

    International Nuclear Information System (INIS)

    Norman, A.B.; Battaglia, G.; Creese, I.

    1985-01-01

    In the presence of a 30 nM prazosin mask, [ 3 H]-2-(2,6-dimethoxyphenoxyethyl) aminomethyl-1,4-benzodioxane ([ 3 H]WB4101) can selectively label 5-HT1 serotonin receptors. Serotonin exhibits high affinity (Ki = 2.5 nM) and monophasic competition for [ 3 H] WB4101 binding in cerebral cortex. We have found a significant correlation (r = 0.96) between the affinities of a number of serotonergic and nonserotonergic compounds at [ 3 H]WB4101-binding sites in the presence of 30 nM prazosin and [ 3 H] lysergic acid diethylamide ([ 3 H]LSD)-labeled 5-HT1 serotonin receptors in homogenates of rat cerebral cortex. Despite similar pharmacological profiles, distribution studies indicate that, in the presence of 5 mM MgSO4, the Bmax of [ 3 H]WB4101 is significantly lower than the Bmax of [ 3 H]LSD in various brain regions. WB4101 competition for [ 3 H] LSD-labeled 5-HT1 receptors fits best to a computer-derived model assuming two binding sites, with the KH for WB4101 being similar to the KD of [ 3 H]WB4101 binding derived from saturation experiments. This suggests that [ 3 H]WB4101 labels only one of the subtypes of the 5-HT1 serotonin receptors labeled by [ 3 H]LSD. The selective 5-HT1A serotonin receptor antagonist, spiperone, and the selective 5-HT1A agonist, 8-hydroxy-2-(di-n-propylamino) tetraline, exhibit high affinity and monophasic competition for [ 3 H]WB4101 but compete for multiple [ 3 H]LSD 5-HT1 binding sites. These data indicate that [ 3 H]WB4101 selectively labels the 5-HT1A serotonin receptor, whereas [ 3 H] LSD appears to label both the 5-HT1A and the 5-HT1B serotonin receptor subtypes. The divalent cations, Mn2+, Mg2+, and Ca2+ were found to markedly increase the affinity and Bmax of [ 3 H]WB4101 binding in cerebral cortex. Conversely, the guanine nucleotides guanylylimidodiphosphate and GTP, but not the adenosine nucleotide ATP, markedly reduce the Bmax of [ 3 H]WB4101 binding

  2. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  3. Platelet cytosolic 44-kDa protein is a substrate of cholera toxin-induced ADP-ribosylation and is not recognized by antisera against the α subunit of the stimulatory guanine nucleotide-binding regulatory protein

    International Nuclear Information System (INIS)

    Molina Y Vedia, L.M.; Reep, B.R.; Lapetina, E.G.

    1988-01-01

    ADP-ribosylation induced by cholera toxin and pertussis toxin was studied in particulate and cytosolic fractions of human platelets. Platelets were disrupted by a cycle of freezing and thawing in the presence of a hyposmotic buffer containing protease inhibitors. In both fractions, the A subunit of cholera toxin ADP-ribosylates two proteins with molecular masses of 42 and 44 kDa, whereas pertussis toxin ADP-ribosylates a 41-kDa polypeptide. Two antisera against the α subunit of the stimulatory guanine nucleotide-binding regulatory protein recognize only the 42-kDa polypeptide. Cholera toxin-induced ADP-ribosylation of the 42- and 44-kDa proteins is reduced by pretreatment of platelets with iloprost, a prostacyclin analog. The 44-kDa protein, which is substrate of cholera toxin, could be extracted completely from the membrane and recovered in the cytosolic fraction when the cells were disrupted by Dounce homogenization and the pellet was extensively washed. A 44-kDa protein can also be labeled with 8-azidoguanosine 5'-[α- 32 P]triphosphate in the cytosol and membranes. These finding indicate that cholera and pertussis toxins produced covalent modifications of proteins present in particulate and cytosolic platelet fractions. Moreover, the 44-kDa protein might be an α subunit of a guanine nucleotide-binding regulatory protein that is not recognized by available antisera

  4. Specificities and pH profiles of adenine and hypoxanthine-guanine-xanthine phosphoribosyltransferases (nucleotide synthases) of the thermoacidophile archaeon Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Jensen, Kristine Steen; Rasmussen, Mads Skytte

    2014-01-01

    Two open reading frames in the genome of Sulfolobus solfataricus (SSO2341 and SSO2424) were cloned and expressed in E. coli. The protein products were purified and their enzymatic activity characterized. Although SSO2341 was annotated as a gene (gpT-1) encoding a 6-oxopurine...... phosphoribosyltransferase (PRTase), the protein product turned out to be a PRTase highly specific for adenine and we suggest that the reading frame should be renamed apT. The other reading frame SSO2424 (gpT-2) proved to be a true 6-oxopurine PRTase active with hypoxanthine, xanthine and guanine as substrates, and we.......5, while maximal activity with xanthine was observed at pH 7.5. We discuss likely reasons why SSO2341 in S. solfataricus and similar open reading frames in other Crenarchaeota could not be identified as genes encoding APRTase....

  5. An adenine-to-guanine nucleotide change in the IRES SL-IV domain of picornavirus/hepatitis C chimeric viruses leads to a nonviable phenotype

    International Nuclear Information System (INIS)

    McKnight, Kevin L.; Sandefur, Stephanie; Phipps, Krista M.; Heinz, Beverly A.

    2003-01-01

    The inability for the internal ribosomal entry site (IRES) of hepatitis C virus (HCV) to be readily studied in the context of viral replication has been circumvented by constructing chimeras such as with poliovirus (PV), in which translation of the genome polyprotein is under control of the HCV IRES. During our attempts to configure the PV/HCV chimera for our drug discovery efforts, we discovered that an adenine- (A) to-guanine (G) change at nt 350 in domain IV of the HCV IRES resulted in a nonviable phenotype. Similarly, a mengovirus (MV)/HCV chimera using the same configuration with a G at nt 350 (G-350) was found to be nonviable. In contrast, a bovine viral diarrhea virus (BVDV)/HCV chimera remained viable with G-350 in the HCV IRES insert. Second-site, resuscitating mutations were identified from the G-350 PV/HCV and MV/HCV viruses after blind passaging. For both viruses, the resuscitating mutations involved destabilization of domain IV in the HCV IRES. The nonviability of G-350 in the picornavirus/HCV chimeric background might be linked to translation efficiency as indicated by analyses with dual reporter and PV/HCV replicon constructs

  6. A novel missense variant (Gln220Arg) of GNB4 encoding guanine nucleotide-binding protein, subunit beta-4 in a Japanese family with autosomal dominant motor and sensory neuropathy.

    Science.gov (United States)

    Miura, Shiroh; Morikawa, Takuya; Fujioka, Ryuta; Noda, Kazuhito; Kosaka, Kengo; Taniwaki, Takayuki; Shibata, Hiroki

    2017-09-01

    Dominant intermediate Charcot-Marie-Tooth disease F (CMTDIF) is an autosomal dominant hereditary form of Charcot-Marie-Tooth disease (CMT) caused by variations in the guanine nucleotide-binding protein, subunit beta-4 gene (GNB4). We examined two Japanese familial cases with CMT. Case 1 was a 49-year-old male whose chief complaint was slowly progressive gait disturbance and limb dysesthesia that appeared at the age of 47. On neurological examination, he showed hyporeflexia or areflexia, distal limb muscle weakness, and distal sensory impairment with lower dominancy. Nerve conduction studies demonstrated demyelinating sensorimotor neuropathy with reduced action potentials in the lower limbs. Case 2 was an 80-year-old man, Case 1's father, who reported difficulty in riding a bicycle at the age of 76. On neurological examination, he showed areflexia in the upper and lower limbs. Distal sensory impairment in the lower limbs was also observed. Nerve conduction studies revealed mainly axonal involvement. Exome sequencing identified a novel heterozygous nonsynonymous variant (NM_021629.3:c.659T > C [p.Gln220Arg]) in GNB4 exon 8, which is known to be responsible for CMT. Sanger sequencing confirmed that both patients are heterozygous for the variation, which causes an amino acid substitution, Gln220Arg, in the highly conserved region of the WD40 domain of GNB4. The frequency of this variant in the Exome Aggregation Consortium Database was 0.000008247, and we confirmed its absence in 502 Japanese control subjects. We conclude that this novel GNB4 variant is causative for CMTDIF in these patients, who represent the first record of the disease in the Japanese population. Copyright © 2017. Published by Elsevier Masson SAS.

  7. Comprehensive behavioral analysis of mice deficient in Rapgef2 and Rapgef6, a subfamily of guanine nucleotide exchange factors for Rap small GTPases possessing the Ras/Rap-associating domain.

    Science.gov (United States)

    Maeta, Kazuhiro; Hattori, Satoko; Ikutomo, Junji; Edamatsu, Hironori; Bilasy, Shymaa E; Miyakawa, Tsuyoshi; Kataoka, Tohru

    2018-05-10

    Rapgef2 and Rapgef6 define a subfamily of guanine nucleotide exchange factors for Rap small GTPases, characterized by the possession of the Ras/Rap-associating domain. Previous genomic analyses suggested their possible involvement in the etiology of schizophrenia. We recently demonstrated the development of an ectopic cortical mass (ECM), which resembles the human subcortical band heterotopia, in the dorsal telencephalon-specific Rapgef2 conditional knockout (Rapgef2-cKO) brains. Additional knockout of Rapgef6 in Rapgef2-cKO mice resulted in gross enlargement of the ECM whereas knockout of Rapgef6 alone (Rapgef6-KO) had no discernible effect on the brain morphology. Here, we performed a battery of behavioral tests to examine the effects of Rapgef2 or Rapgef6 deficiency on higher brain functions. Rapgef2-cKO mice exhibited hyperlocomotion phenotypes. They showed decreased anxiety-like behavior in the elevated plus maze and the open-field tests as well as increased depression-like behavior in the Porsolt forced swim and tail suspension tests. They also exhibited increased sociability especially in novel environments. They showed defects in cognitive function as evidenced by reduced learning ability in the Barnes circular maze test and by impaired working memory in the T maze tests. In contrast, although Rapgef6 and Rapgef2 share similarities in biochemical roles, Rapgef6-KO mice exhibited mild behavioral abnormalities detected with a number of behavioral tests, such as hyperlocomotion phenotype in the open-field test and the social interaction test with a novel environment and working-memory defects in the T-maze test. In conclusion, although there were differences in their brain morphology and the magnitude of the behavioral abnormalities, Rapgef2-cKO mice and Rapgef6-KO mice exhibited hyperlocomotion phenotype and working-memory defect, both of which could be recognized as schizophrenia-like behavior.

  8. Follicle-stimulating hormone receptor-mediated uptake of 45Ca2+ by cultured rat Sertoli cells does not require activation of cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding proteins or adenylate cyclase

    International Nuclear Information System (INIS)

    Grasso, P.; Reichert, L.E. Jr.

    1990-01-01

    We have previously reported that FSH stimulates flux of 45Ca2+ into cultured Sertoli cells from immature rats via voltage-sensitive and voltage-independent calcium channels. In the present study, we show that this effect of FSH does not require cholera toxin (CT)- or pertussis toxin (PT)-sensitive guanine nucleotide binding (G) protein or activation of adenylate cyclase (AC). Significant stimulation of 45Ca2+ influx was observed within 1 min, and maximal response (3.2-fold over basal levels) was achieved within 2 min after exposure to FSH. FSH-stimulated elevations in cellular cAMP paralleled increases in 45Ca2+ uptake, suggesting a possible coupling of AC activation to 45Ca2+ influx. (Bu)2cAMP, however, was not able to enhance 45Ca2+ uptake over basal levels at a final concentration of 1000 microM, although a concentration-related increase in androstenedione conversion to estradiol was evident. Exposure of Sertoli cells to CT (10 ng/ml) consistently stimulated basal levels of androstenedione conversion to estradiol but had no effect on basal levels of 45Ca2+ uptake. Similarly, CT had no effect on FSH-induced 45Ca2+ uptake, but potentiated FSH-stimulated estradiol synthesis. PT (10 ng/ml) augmented basal and FSH-stimulated estradiol secretion without affecting 45Ca2+ influx. The adenosine analog N6-phenylisopropyladenosine, which binds to Gi-coupled adenosine receptors on Sertoli cells, inhibited FSH-stimulated androgen conversion to estradiol in a dose-related (1-1000 nM) manner, but FSH-stimulated 45Ca2+ influx remained unchanged. Our results show that in contrast to FSH-stimulated estradiol synthesis, the flux of 45Ca2+ into Sertoli cells in response to FSH is not mediated either directly or indirectly by CT- or PT-sensitive G protein, nor does it require activation of AC. Our data further suggest that the FSH receptor itself may function as a calcium channel

  9. Follicle-stimulating hormone receptor-mediated uptake of sup 45 Ca sup 2+ by cultured rat Sertoli cells does not require activation of cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding proteins or adenylate cyclase

    Energy Technology Data Exchange (ETDEWEB)

    Grasso, P.; Reichert, L.E. Jr. (Albany Medical College, NY (USA))

    1990-08-01

    We have previously reported that FSH stimulates flux of 45Ca2+ into cultured Sertoli cells from immature rats via voltage-sensitive and voltage-independent calcium channels. In the present study, we show that this effect of FSH does not require cholera toxin (CT)- or pertussis toxin (PT)-sensitive guanine nucleotide binding (G) protein or activation of adenylate cyclase (AC). Significant stimulation of 45Ca2+ influx was observed within 1 min, and maximal response (3.2-fold over basal levels) was achieved within 2 min after exposure to FSH. FSH-stimulated elevations in cellular cAMP paralleled increases in 45Ca2+ uptake, suggesting a possible coupling of AC activation to 45Ca2+ influx. (Bu)2cAMP, however, was not able to enhance 45Ca2+ uptake over basal levels at a final concentration of 1000 microM, although a concentration-related increase in androstenedione conversion to estradiol was evident. Exposure of Sertoli cells to CT (10 ng/ml) consistently stimulated basal levels of androstenedione conversion to estradiol but had no effect on basal levels of 45Ca2+ uptake. Similarly, CT had no effect on FSH-induced 45Ca2+ uptake, but potentiated FSH-stimulated estradiol synthesis. PT (10 ng/ml) augmented basal and FSH-stimulated estradiol secretion without affecting 45Ca2+ influx. The adenosine analog N6-phenylisopropyladenosine, which binds to Gi-coupled adenosine receptors on Sertoli cells, inhibited FSH-stimulated androgen conversion to estradiol in a dose-related (1-1000 nM) manner, but FSH-stimulated 45Ca2+ influx remained unchanged. Our results show that in contrast to FSH-stimulated estradiol synthesis, the flux of 45Ca2+ into Sertoli cells in response to FSH is not mediated either directly or indirectly by CT- or PT-sensitive G protein, nor does it require activation of AC. Our data further suggest that the FSH receptor itself may function as a calcium channel.

  10. Mutagenic and Cytotoxic Properties of 6-Thioguanine, S6-Methylthioguanine, and Guanine-S6-sulfonic Acid*S⃞

    OpenAIRE

    Yuan, Bifeng; Wang, Yinsheng

    2008-01-01

    Thiopurine drugs, including 6-thioguanine (SG), 6-mercaptopurine, and azathioprine, are widely employed anticancer agents and immunosuppressants. The formation of SG nucleotides from the thiopurine prodrugs and their subsequent incorporation into nucleic acids are important for the drugs to exert their cytotoxic effects. SG in DNA can be methylated by S-adenosyl-l-methionine to give S6-methylthioguanine (S6mG) and oxidized by UVA light to render guanine-S6-sulfonic acid ...

  11. Application of Ammonium Persulfate for Selective Oxidation of Guanines for Nucleic Acid Sequencing

    Directory of Open Access Journals (Sweden)

    Yafen Wang

    2017-07-01

    Full Text Available Nucleic acids can be sequenced by a chemical procedure that partially damages the nucleotide positions at their base repetition. Many methods have been reported for the selective recognition of guanine. The accurate identification of guanine in both single and double regions of DNA and RNA remains a challenging task. Herein, we present a new, non-toxic and simple method for the selective recognition of guanine in both DNA and RNA sequences via ammonium persulfate modification. This strategy can be further successfully applied to the detection of 5-methylcytosine by using PCR.

  12. Endogenous melatonin and oxidatively damaged guanine in DNA

    Directory of Open Access Journals (Sweden)

    Poulsen Henrik E

    2009-10-01

    Full Text Available Abstract Background A significant body of literature indicates that melatonin, a hormone primarily produced nocturnally by the pineal gland, is an important scavenger of hydroxyl radicals and other reactive oxygen species. Melatonin may also lower the rate of DNA base damage resulting from hydroxyl radical attack and increase the rate of repair of that damage. This paper reports the results of a study relating the level of overnight melatonin production to the overnight excretion of the two primary urinary metabolites of the repair of oxidatively damaged guanine in DNA. Methods Mother-father-daughter(s families (n = 55 were recruited and provided complete overnight urine samples. Total overnight creatinine-adjusted 6-sulphatoxymelatonin (aMT6s/Cr has been shown to be highly correlated with total overnight melatonin production. Urinary 8-oxo-7,8-dihydro-guanine (8-oxoGua results from the repair of DNA or RNA guanine via the nucleobase excision repair pathway, while urinary 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG may possibly result from the repair of DNA guanine via the nucleotide excision repair pathway. Total overnight urinary levels of 8-oxodG and 8-oxoGua are therefore a measure of total overnight guanine DNA damage. 8-oxodG and 8-oxoGua were measured using a high-performance liquid chromatography-electrospray ionization tandem mass spectrometry assay. The mother, father, and oldest sampled daughter were used for these analyses. Comparisons between the mothers, fathers, and daughters were calculated for aMT6s/Cr, 8-oxodG, and 8-oxoGua. Regression analyses of 8-oxodG and 8-oxoGua on aMT6s/Cr were conducted for mothers, fathers, and daughters separately, adjusting for age and BMI (or weight. Results Among the mothers, age range 42-80, lower melatonin production (as measured by aMT6s/CR was associated with significantly higher levels of 8-oxodG (p Conclusion Low levels of endogenous melatonin production among older individuals may lead to

  13. 21 CFR 73.1329 - Guanine.

    Science.gov (United States)

    2010-04-01

    ... in this subpart as safe and suitable for use in color additive mixtures for coloring externally... ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is the crystalline material obtained from fish scales and consists principally of the two purines...

  14. Synthesis of Lipophilic Guanine N-9 Derivatives

    DEFF Research Database (Denmark)

    Wamberg, Michael C; Pedersen, Pernille L; Löffler, Philipp M G

    2017-01-01

    the synthesis of five new guanine-N9 derivatives bearing alkyl chains with different attachment chemistries, exploiting a synthesis pathway that allows a flexible choice of hydrophobic anchor moiety. In this study, these guanine derivatives were functionalized with C10 chains for insertion into decanoic acid...... bilayer structures, in which both alkyl chain length and attachment chemistry determined their interaction with the membrane. Incubation of these guanine conjugates, as solids, with a decanoic acid vesicle suspension, showed that ether- and triazole-linked C10 anchors yielded an increased partitioning...... of the guanine derivative into the membranous phase compared to directly N-9-linked saturated alkyl anchors. Decanoic acid vesicle membranes could be loaded with up to 5.5 mol % guanine derivative, a 6-fold increase over previous limits. Thus, anchor chemistries exhibiting favorable interactions with a bilayer...

  15. Preparation and bioevaluation of 99mTc-carbonyl complex of guanine

    International Nuclear Information System (INIS)

    Cigdem Ichedef; Serap Teksoez; Kamile Senocak; Eser Ucar; Ayfer Yurt Kilcar

    2011-01-01

    The aim of this study is to prepare radiolabeled guanine with 99m Tc(CO) 3 + core. For this purpose, guanine has been radiolabeled with 99m Tc(CO) 3 + core. Quality control study of radiolabeled guanine molecule with 99m Tc(CO) 3 + core was performed by thin layer radio chromatography (TLRC) and high performance liquid radio chromatography (HPLRC). The results showed that the radiolabeling yield was quite high (94 ± 3%). Beside that 99m Tc(CO) 3 -Gua complex has showed good in vitro stability during the 24 h period. Radiopharmaceutical potential of this complex was evaluated in Wistar Albino Rats. It was concluded that 99m Tc(CO) 3 -Gua could be used as a nucleotide radiopharmaceutical for in vivo applications. (author)

  16. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  17. Extent of intramolecular pi stacks in aqueous solution in mixed-ligand copper(II) complexes formed by heteroaromatic amines and the anticancer and antivirally active 9[2-(phosphonomethoxy)ethyl]guanine (PMEG). A comparison with related acyclic nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Blindauer, C. A.; Sigel, A.; Operschall, B. P.; Griesser, R.; Holý, Antonín; Sigel, H.

    2016-01-01

    Roč. 103, Jan 8 (2016), s. 248-260 ISSN 0277-5387 Institutional support: RVO:61388963 Keywords : anticancer activity * antivirals * aromatic-ring stacking * isomeric equilibria * nucleotide analogues Subject RIV: CC - Organic Chemistry Impact factor: 1.926, year: 2016

  18. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  19. Mutagenic and cytotoxic properties of 6-thioguanine, S6-methylthioguanine, and guanine-S6-sulfonic acid.

    Science.gov (United States)

    Yuan, Bifeng; Wang, Yinsheng

    2008-08-29

    Thiopurine drugs, including 6-thioguanine ((S)G), 6-mercaptopurine, and azathioprine, are widely employed anticancer agents and immunosuppressants. The formation of (S)G nucleotides from the thiopurine prodrugs and their subsequent incorporation into nucleic acids are important for the drugs to exert their cytotoxic effects. (S)G in DNA can be methylated by S-adenosyl-l-methionine to give S(6)-methylthioguanine (S(6)mG) and oxidized by UVA light to render guanine-S(6)-sulfonic acid ((SO3H)G). Here, we constructed single-stranded M13 shuttle vectors carrying a (S)G, S(6)mG, or (SO3H)G at a unique site and allowed the vectors to propagate in wild-type and bypass polymerase-deficient Escherichia coli cells. Analysis of the replication products by using the competitive replication and adduct bypass and a slightly modified restriction enzyme digestion and post-labeling assays revealed that, although none of the three thionucleosides considerably blocked DNA replication in all transfected E. coli cells, both S(6)mG and (SO3H)G were highly mutagenic, which resulted in G-->A mutation at frequencies of 94 and 77%, respectively, in wild-type E. coli cells. Deficiency in bypass polymerases does not result in alteration of mutation frequencies of these two lesions. In contrast to what was found from previous steady-state kinetic analysis, our data demonstrated that 6-thioguanine is mutagenic, with G-->A transition occurring at a frequency of approximately 10%. The mutagenic properties of 6-thioguanine and its derivatives revealed in the present study offered important knowledge about the biological implications of these thionucleosides.

  20. Fluorescence enhancement of DNA-silver nanoclusters from guanine proximity

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, Hsin-chih [Los Alamos National Laboratory; Sharma, Jaswinder [Los Alamos National Laboratory; Yoo, Hyojong [Los Alamos National Laboratory; Martinez, Jennifer S [Los Alamos National Laboratory

    2010-01-01

    Oligonucleotide-templated, silver nanoclusters (DNA/Ag NCs) are a versatile set of fluorophores and have already been used for live cell imaging, detection of specific metal ions, and single-nucleotide variation identification. Compared to commonly used organic dyes, these fluorescent nanoclusters have much better photostability and are often a few times brighter. Owing to their small size, simple preparation, and biocompatibility (i.e. made of nontoxic metals), DNA/Ag NCs should find more applications in biological imaging and chemical detection in the years to come. While clearly promising as new fluorophores, DNA/Ag NCs possess a unique and poorly understood dynamic process not shared by organic dyes or photoluminescent nanocrystals - the conversion among different NC species due to silver oxidation/reduction or NC regrouping. While this environmental sensitivity can be viewed as a drawback, in the appropriate context, it can be used as a sensor or reporter. Often reversible, conversions among different NC species have been found to depend upon a number of factors, including time, temperature, oxygen and salt content. In this communication, we report significant fluorescence enhancement of DNA/Ag NCs via interactions with guanine-rich DNA sequences. Moreover, we demonstrated this property can be used for sensitive detection of specific target DNA from a human oncogene (i.e. Braf gene).

  1. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  2. The Emerging Role of Guanine Exchange Factors in ALS and other neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Cristian eDroppelmann

    2014-09-01

    Full Text Available Small GTPases participate in a broad range of cellular processes such as proliferation, differentiation and migration. The exchange of GDP for GTP resulting in the activation of these GTPases is catalyzed by a group of enzymes called guanine nucleotide exchange factors (GEFs, of which two classes: Dbl-related exchange factors and the more recently described Dock family exchange factors. Increasingly, deregulation of normal GEF activity or function has been associated with a broad range of disease states, including neurodegeneration and neurodevelopmental disorders. In this review, we examine this evidence with special emphasis on the novel role of Rho guanine nucleotide exchange factor (RGNEF/p190RhoGEF in the pathogenesis of amyotrophic lateral sclerosis (ALS. RGNEF is the first neurodegeneration-linked GEF that regulates not only RhoA GTPase activation but also functions as an RNA binding protein that directly acts with low molecular weight neurofilament (NEFL mRNA 3’UTR to regulate its stability. This dual role for RGNEF, coupled with the increasing understanding of the key role for GEFs in modulating the GTPase function in cell survival suggests a prominent role for GEFs in mediating a critical balance between cytotoxicity and neuroprotection which, when disturbed, contributes to neuronal loss.

  3. HIV1 V3 loop hypermutability is enhanced by the guanine usage bias in the part of env gene coding for it.

    Science.gov (United States)

    Khrustalev, Vladislav Victorovich

    2009-01-01

    Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).

  4. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  5. Reactivity of chitosan derivatives and their interaction with guanine ...

    Indian Academy of Sciences (India)

    Density functional theory; hydrogen bonding; chitosan derivative; guanine; solvent effect. 1. Introduction .... Out of different models for accounting the solva- tion energies ..... Authors thank DST, New Delhi for financial support. (Grant No.

  6. [Triplet expansion cytosine-guanine-guanine: Three cases of OMIM syndrome in the same family].

    Science.gov (United States)

    González-Pérez, Jesús; Izquierdo-Álvarez, Silvia; Fuertes-Rodrigo, Cristina; Monge-Galindo, Lorena; Peña-Segura, José Luis; López-Pisón, Francisco Javier

    2016-04-01

    The dynamic increase in the number of triplet repeats of cytosine-guanine-guanine (CGG) in the FMR1 gene mutation is responsible for three OMIM syndromes with a distinct clinical phenotype: Fragile X syndrome (FXS) and two pathologies in adult carriers of the premutation (55-200 CGG repeats): Primary ovarian insufficiency (FXPOI) and tremor-ataxia syndrome (FXTAS) associated with FXS. CGG mutation dynamics of the FMR1 gene were studied in DNA samples from peripheral blood from the index case and other relatives of first, second and third degree by TP-PCR, and the percentage methylation. Diagnosis of FXS was confirmed in three patients (21.4%), eight patients (57.1%) were confirmed in the premutation range transmitters, one male patient with full mutation/permutation mosaicism (7.1%) and two patients (14.3%) with normal study. Of the eight permutated patients, three had FXPOI and one male patient had FXTAS. Our study suggests the importance of making an early diagnosis of SXF in order to carry out a family study and genetic counselling, which allow the identification of new cases or premutated patients with FMR1 gene- associated syndromes (FXTAS, FXPOI). Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  7. Guanine nucleotide binding proteins in zucchini seedlings: Characterization and interactions with the NPA receptor

    International Nuclear Information System (INIS)

    Lindeberg, M.; Jacobs, M.

    1989-01-01

    A microsomal membrane preparation from hypocotyls of dark-grown Cucurbita pepo L. seedlings contains specific high-affinity binding sites for the non-hydrolyzable GTP analog guanosine 5'-[γ-thio] triphosphate (GTP-γ-S). Both the binding affinity and the pattern of binding specificity for GTP and GTP analogs are similar to animal G-proteins, and two zucchini membrane proteins are recognized in western blots by antiserum specific for the σ subunit of platelet G s protein. GTP-γ-S can increase specific naphthylphthalamic acid (NPA) binding in zucchini microsomal membrane preparations, with its stimulation increasing with large tissue age. Al +3 and F - agents known to activate G-proteins - decreased NPA specific binding by ca. 15%. In tests of in vitro auxin transport employing zucchini plasma membrane vesicles, AlF - 4 strongly inhibited 3 H-indoleacetic acid nor accumulation; GTP-γ-S effects on this system will be discussed

  8. Guanine nucleotide regulation of dopamine receptor agonist affinity states in rat estradiol-induced pituitary tumors

    Energy Technology Data Exchange (ETDEWEB)

    Di Paolo, T.; Falardeau, P.

    1987-08-31

    The authors have investigated dopamine (DA) receptor agonist high- and low-affinity states in female rate estradiol-induced prolactin (PRL)-secreting pituitary tumors and intact pituitary tissue. Estradiol treatment increased the anterior pituitary weight 9-fold and plasma prolactin levels 74-fold and these measures are correlated (R = 0.745, n = 73, p < 0.001). Competition for (/sup 3/H)-spiperone binding to the DA receptor by apomorphine was compared in normal and adenomatous pituitary tissue. The inhibition constants (Ki) and the proportions of the two apomorphine sites are unchanged in tumors compared to intact pituitary tissue. Guanosine 5'-(..beta..-..gamma..-imino)triphosphate (Gpp(NH)p) causes complete conversion of the high into low affinity dopaminergic agonist site in normal pituitary and in tumors. These results suggest that rats with primary estradiol-induced pituitary tumors have normal and functional DA receptors. 9 references, 2 tables.

  9. Guanine nucleotide regulation of dopamine receptor agonist affinity states in rat estradiol-induced pituitary tumors

    International Nuclear Information System (INIS)

    Di Paolo, T.; Falardeau, P.

    1987-01-01

    The authors have investigated dopamine (DA) receptor agonist high- and low-affinity states in female rate estradiol-induced prolactin (PRL)-secreting pituitary tumors and intact pituitary tissue. Estradiol treatment increased the anterior pituitary weight 9-fold and plasma prolactin levels 74-fold and these measures are correlated (R = 0.745, n = 73, p 3 H]-spiperone binding to the DA receptor by apomorphine was compared in normal and adenomatous pituitary tissue. The inhibition constants (Ki) and the proportions of the two apomorphine sites are unchanged in tumors compared to intact pituitary tissue. Guanosine 5'-[β-γ-imino]triphosphate (Gpp(NH)p) causes complete conversion of the high into low affinity dopaminergic agonist site in normal pituitary and in tumors. These results suggest that rats with primary estradiol-induced pituitary tumors have normal and functional DA receptors. 9 references, 2 tables

  10. Functional reconstitution of prostaglandin E receptor from bovine adrenal medulla with guanine nucleotide binding proteins

    International Nuclear Information System (INIS)

    Negishi, M.; Ito, S.; Yokohama, H.; Hayashi, H.; Katada, T.; Ui, M.; Hayaishi, O.

    1988-01-01

    Prostaglandin E 2 (PEG 2 ) was found to bind specifically to a 100,000 x g pellet prepared from bovine adrenal medulla. The PGE receptor was associated with a GTP-binding protein (G-protein) and could be covalently cross-linked with this G-protein by dithiobis(succinimidyl propionate) in the 100,000 x g pellet. In order to characterize the G-protein associated with the PGE receptor and reconstitute these proteins in phospholipid vesicles, the authors purified the G-protein to apparent homogeneity from the 100,000 x g pellet. The G-protein served as a substrate of pertussis toxin but differed in its α subunit from two known pertussis toxin substrate G-proteins (G/sub i/ and G 0 ) purified from bovine brain. The molecular weight of the α subunit was 40,000, which is between those of G/sub i/ and G 0 . The purified protein was also distinguished immunologically from G/sub i/ and G 0 and was referred to as G/sub am/. Reconstitution of the PGE receptor with pure C/sub am/, G/sub i/, or G 0 in phospholipid vesicles resulted in a remarkable restoration of [ 3 H]PGE 2 binding activity in a GTP-dependent manner. The efficiency of these three G-proteins in this capacity was roughly equal. When pertussis toxin- or N-ethylmaleimide-treated G-proteins, instead of the native ones, were reconstituted into vesicles, the restoration of binding activity was no longer observed. These results indicate that the PGE receptor can couple functionally with G/sub am/, G/sub i/, or G 0 in phospholipid vesicles and suggest that G/sub am/ may be involved in signal transduction of the PGE receptor in bovine adrenal medulla

  11. Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells.

    OpenAIRE

    Jiang, M; Pandey, S; Tran, V T; Fong, H K

    1991-01-01

    The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein alpha subunits (G alpha) including Gs alpha, Gi-1 alpha, Gi-2 alpha, Gi-3 alpha, and Gz alpha (or Gx alpha), where Gs and Gi are proteins that stimulate or inhibit adenylyl cyclase, respectively, and Gz is a protein that may mediate pertussis toxin-insensi...

  12. Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Meisheng; Tran, V.T.; Fong, H.K.W. (Univ. of Southern California, Los Angeles (United States)); Pandey, S. (Doheny Eye Inst., Los Angeles, CA (United States))

    1991-05-01

    The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha} protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.

  13. Characterization of oxidative guanine damage and repair in mammalian telomeres.

    Directory of Open Access Journals (Sweden)

    Zhilong Wang

    2010-05-01

    Full Text Available 8-oxo-7,8-dihydroguanine (8-oxoG and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG are among the most common oxidative DNA lesions and are substrates for 8-oxoguanine DNA glycosylase (OGG1-initiated DNA base excision repair (BER. Mammalian telomeres consist of triple guanine repeats and are subject to oxidative guanine damage. Here, we investigated the impact of oxidative guanine damage and its repair by OGG1 on telomere integrity in mice. The mouse cells were analyzed for telomere integrity by telomere quantitative fluorescence in situ hybridization (telomere-FISH, by chromosome orientation-FISH (CO-FISH, and by indirect immunofluorescence in combination with telomere-FISH and for oxidative base lesions by Fpg-incision/Southern blot assay. In comparison to the wild type, telomere lengthening was observed in Ogg1 null (Ogg1(-/- mouse tissues and primary embryonic fibroblasts (MEFs cultivated in hypoxia condition (3% oxygen, whereas telomere shortening was detected in Ogg1(-/- mouse hematopoietic cells and primary MEFs cultivated in normoxia condition (20% oxygen or in the presence of an oxidant. In addition, telomere length abnormalities were accompanied by altered telomere sister chromatid exchanges, increased telomere single- and double-strand breaks, and preferential telomere lagging- or G-strand losses in Ogg1(-/- mouse cells. Oxidative guanine lesions were increased in telomeres in Ogg1(-/- mice with aging and primary MEFs cultivated in 20% oxygen. Furthermore, oxidative guanine lesions persisted at high level in Ogg1(-/- MEFs after acute exposure to hydrogen peroxide, while they rapidly returned to basal level in wild-type MEFs. These findings indicate that oxidative guanine damage can arise in telomeres where it affects length homeostasis, recombination, DNA replication, and DNA breakage repair. Our studies demonstrate that BER pathway is required in repairing oxidative guanine damage in telomeres and maintaining telomere integrity

  14. Guanine holes are prominent targets for mutation in cancer and inherited disease.

    Directory of Open Access Journals (Sweden)

    Albino Bacolla

    Full Text Available Single base substitutions constitute the most frequent type of human gene mutation and are a leading cause of cancer and inherited disease. These alterations occur non-randomly in DNA, being strongly influenced by the local nucleotide sequence context. However, the molecular mechanisms underlying such sequence context-dependent mutagenesis are not fully understood. Using bioinformatics, computational and molecular modeling analyses, we have determined the frequencies of mutation at G • C bp in the context of all 64 5'-NGNN-3' motifs that contain the mutation at the second position. Twenty-four datasets were employed, comprising >530,000 somatic single base substitutions from 21 cancer genomes, >77,000 germline single-base substitutions causing or associated with human inherited disease and 16.7 million benign germline single-nucleotide variants. In several cancer types, the number of mutated motifs correlated both with the free energies of base stacking and the energies required for abstracting an electron from the target guanines (ionization potentials. Similar correlations were also evident for the pathological missense and nonsense germline mutations, but only when the target guanines were located on the non-transcribed DNA strand. Likewise, pathogenic splicing mutations predominantly affected positions in which a purine was located on the non-transcribed DNA strand. Novel candidate driver mutations and tissue-specific mutational patterns were also identified in the cancer datasets. We conclude that electron transfer reactions within the DNA molecule contribute to sequence context-dependent mutagenesis, involving both somatic driver and passenger mutations in cancer, as well as germline alterations causing or associated with inherited disease.

  15. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  16. Guanine limitation results in CodY-dependent and -independent alteration of Staphylococcus aureus physiology and gene expression.

    Science.gov (United States)

    King, Alyssa N; Borkar, Samiksha; Samuels, David J; Batz, Zachary; Bulock, Logan; Sadykov, Marat R; Bayles, Kenneth W; Brinsmade, Shaun R

    2018-04-30

    In Staphylococcus aureus , the global transcriptional regulator CodY modulates the expression of hundreds of genes in response to the availability of GTP and the branched-chain amino acids isoleucine, leucine, and valine (ILV). CodY DNA-binding activity is high when GTP and ILV are abundant. When GTP and ILV are limited, CodY's affinity for DNA drops, altering expression of CodY regulated targets. In this work, we investigated the impact of guanine nucleotides on S. aureus physiology and CodY activity by constructing a guaA null mutant (Δ guaA ). De novo biosynthesis of guanine monophosphate is abolished due to the guaA mutation; thus, the mutant cells require exogenous guanosine for growth. We also found that CodY activity was reduced when we knocked out guaA , activating the Agr two-component system and increasing secreted protease activity. Notably, in a rich, complex medium, we detected an increase in alternative sigma factor B activity in the Δ guaA mutant, which results in a 5-fold increase in production of the antioxidant pigment staphyloxanthin. Under biologically relevant flow conditions, Δ guaA cells failed to form robust biofilms when limited for guanine or guanosine. RNA-seq analysis of S. aureus transcriptome during growth in guanosine-limited chemostats revealed substantial CodY-dependent and -independent alteration of gene expression profiles. Importantly, these changes increase production of proteases and δ-toxin, suggesting that S. aureus exhibits a more invasive lifestyle when limited for guanosine. Further, gene-products upregulated under GN limitation, including those necessary for lipoic acid biosynthesis and sugar transport, may prove to be useful drug targets for treating Gram-positive infections. Importance Staphylococcus aureus infections impose a serious economic burden on healthcare facilities and patients because of the emergence of strains resistant to last-line antibiotics. Understanding the physiological processes governing

  17. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.

    Science.gov (United States)

    Lech, Christopher Jacques; Phan, Anh Tuân

    2017-06-20

    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Endogenous melatonin and oxidatively damaged guanine in DNA

    DEFF Research Database (Denmark)

    Davanipour, Zoreh; Poulsen, Henrik E; Weimann, Allan

    2009-01-01

    overnight guanine DNA damage. 8-oxodG and 8-oxoGua were measured using a high-performance liquid chromatography-electrospray ionization tandem mass spectrometry assay. The mother, father, and oldest sampled daughter were used for these analyses. Comparisons between the mothers, fathers, and daughters were...... attack and increase the rate of repair of that damage. This paper reports the results of a study relating the level of overnight melatonin production to the overnight excretion of the two primary urinary metabolites of the repair of oxidatively damaged guanine in DNA. METHODS: Mother...

  19. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  20. Guanine base stacking in G-quadruplex nucleic acids

    Science.gov (United States)

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  1. Electron detachment of the hydrogen-bonded amino acid side-chain guanine complexes

    Science.gov (United States)

    Wang, Jing; Gu, Jiande; Leszczynski, Jerzy

    2007-07-01

    The photoelectron spectra of the hydrogen-bonded amino acid side-chain-guanine complexes has been studied at the partial third order (P3) self-energy approximation of the electron propagator theory. The correlation between the vertical electron detachment energy and the charge distributions on the guanine moiety reveals that the vertical electron detachment energy (VDE) increases as the positive charge distribution on the guanine increases. The low VDE values determined for the negatively charged complexes of the guanine-side-chain-group of Asp/Glu suggest that the influence of the H-bonded anionic groups on the VDE of guanine could be more important than that of the anionic backbone structure. The even lower vertical electron detachment energy for guanine is thus can be expected in the H-bonded protein-DNA systems.

  2. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    Science.gov (United States)

    Dhapola, Parashar; Chowdhury, Shantanu

    2016-01-01

    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  3. Quantum molecular modeling of the interaction between guanine and alkylating agents--2--nitrogen mustard.

    Science.gov (United States)

    Hamza, A; Broch, H; Vasilescu, D

    1996-06-01

    The alkylation mechanism of guanine by nitrogen mustard (HN2) was studied by using a supermolecular modeling at the ab initio 6-31G level. Our computations show that interaction of guanine with the aziridinium form of HN2 necessitates a transition state for the N7 alkylation route. The pathway of N7-guanine alkylation by nitrogen and sulfur mustards is discussed on the basis of the Molecular Electrostatic Potential and HOMO-LUMO properties of these molecules.

  4. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  5. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  6. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  7. A non-catalytic N-terminal domain negatively influences the nucleotide exchange activity of translation elongation factor 1Bα.

    Science.gov (United States)

    Trosiuk, Tetiana V; Shalak, Vyacheslav F; Szczepanowski, Roman H; Negrutskii, Boris S; El'skaya, Anna V

    2016-02-01

    Eukaryotic translation elongation factor 1Bα (eEF1Bα) is a functional homolog of the bacterial factor EF-Ts, and is a component of the macromolecular eEF1B complex. eEF1Bα functions as a catalyst of guanine nucleotide exchange on translation elongation factor 1A (eEF1A). The C-terminal domain of eEF1Bα is necessary and sufficient for its catalytic activity, whereas the N-terminal domain interacts with eukaryotic translation elongation factor 1Bγ (eEF1Bγ) to form a tight complex. However, eEF1Bγ has been shown to enhance the catalytic activity of eEF1Bα attributed to the C-terminal domain of eEF1Bα. This suggests that the N-terminal domain of eEF1Bα may in some way influence the guanine nucleotide exchange process. We have shown that full-length recombinant eEF1Bα and its truncated forms are non-globular proteins with elongated shapes. Truncation of the N-terminal domain of eEF1Bα, which is dispensable for catalytic activity, resulted in acceleration of the rate of guanine nucleotide exchange on eEF1A compared to full-length eEF1Bα. A similar effect on the catalytic activity of eEF1Bα was observed after its interaction with eEF1Bγ. We suggest that the non-catalytic N-terminal domain of eEF1Bα may interfere with eEF1A binding to the C-terminal catalytic domain, resulting in a decrease in the overall rate of the guanine nucleotide exchange reaction. Formation of a tight complex between the eEF1Bγ and eEF1Bα N-terminal domains abolishes this inhibitory effect. © 2015 FEBS.

  8. Structural and Functional Studies on Nucleotide Excision Repair From Recognition to Incision.

    Energy Technology Data Exchange (ETDEWEB)

    Caroline Kisker

    2001-01-01

    Maintenance of the correct genetic information is crucial for all living organisms because mutations are the primary cause of hereditary diseases, as well as cancer and may also be involved in aging. The importance of genomic integrity is underscored by the fact that 80 to 90% of all human cancers are ultimately due to DNA damage. Among the different repair mechanisms that have evolved to protect the genome, nucleotide excision repair (NER) is a universal pathway found in all organisms. NER removes a wide variety of bulky DNA adducts including the carcinogenic cyclobutane pyrimidine dimers induced by UV radiation, benzo(a)pyrene-guanine adducts caused by smoking and the guanine-cisplatin adducts induced by chemotherapy. The importance of this repair mechanism is reflected by three severe inherited diseases in humans, which are due to defects in NER: xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy.

  9. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  10. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.

    2004-01-01

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  11. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  12. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  13. Quantum molecular modeling of the interaction between guanine and alkylating agents--1--sulfur mustard.

    Science.gov (United States)

    Broch, H; Hamza, A; Vasilescu, D

    1996-06-01

    Interaction between Guanine and the episulfonium form of Sulfur mustard (HD) was studied using the ab initio LCAO-MO method at the HF/6-31G level. The alkylation mechanism on guanine-N7 was analyzed by using a supermolecular modeling. Our stereostructural results associated with the molecular electrostatic potentials and HOMO-LUMO properties, show that in vacuum the alkylation of the N7 of guanine by HD in the aggressive episulfonium form is a direct process without transition state and of which the pathway is determined.

  14. VEGF-induced Rac1 activation in endothelial cells is regulated by the guanine nucleotide exchange factor Vav2

    NARCIS (Netherlands)

    Garrett, Tiana A.; van Buul, Jaap D.; Burridge, Keith

    2007-01-01

    Vascular endothelial growth factor (VEGF) signaling is critical for both normal and disease-associated vascular development. Dysregulated VEGF signaling has been implicated in ischemic stroke, tumor angiogenesis, and many other vascular diseases. VEGF signals through several effectors, including the

  15. Tyrosine Phosphorylation of the Guanine Nucleotide Exchange Factor GIV Promotes Activation of PI3K During Cell Migration

    Science.gov (United States)

    Lin, Changsheng; Ear, Jason; Pavlova, Yelena; Mittal, Yash; Kufareva, Irina; Ghassemian, Majid; Abagyan, Ruben; Garcia-Marcos, Mikel; Ghosh, Pradipta

    2014-01-01

    GIV (Gα-interacting vesicle-associated protein; also known as Girdin), enhances Akt activation downstream of multiple growth factor– and G-protein–coupled receptors to trigger cell migration and cancer invasion. Here we demonstrate that GIV is a tyrosine phosphoprotein that directly binds to and activates phosphoinositide 3-kinase (PI3K). Upon ligand stimulation of various receptors, GIV was phosphorylated at Tyr1764 and Tyr1798 by both receptor and non-receptor tyrosine kinases. These phosphorylation events enabled direct binding of GIV to the N- and C-terminal SH2 domains of p85α, a regulatory subunit of PI3K, stabilized receptor association with PI3K, and enhanced PI3K activity at the plasma membrane to trigger cell migration. Tyrosine phosphorylation of GIV and its association with p85α increased during metastatic progression of a breast carcinoma. These results suggest a mechanism by which multiple receptors activate PI3K through tyrosine phosphorylation of GIV, thereby making the GIVPI3K interaction a potential therapeutic target within the PI3K-Akt pathway. PMID:21954290

  16. Charge splitters and charge transport junctions based on guanine quadruplexes

    Science.gov (United States)

    Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

    2018-04-01

    Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

  17. Active site labeling of the guanine-7-methyltransferase

    International Nuclear Information System (INIS)

    Streaker, E.; Sitz, T.O.

    1992-01-01

    Studies on the guanine-7-methyltransferase have defined three domains in the active site: the S-adenosylmethionine (SAM) region, the cap region (GpppG), and the RNA binding domain (--NpNpNpNpNp---). The authors attempted to label the SAM binding domain by a photoaffinity label using 8-azido-SAM and another method using 3 H-SAM and long exposures to uv-light. Neither method was successful. The next approach was to attempt to label the cap-RNA binding domain (GpppGpNpNpNpNpN) by synthesizing RNA containing 8-azido-Ap using an in vitro transcription system and T7 RNA polymerase. The 8-azido-ATP inhibited the T7 RNA polymerase preventing the synthesis of RNA. As they were unable to synthesize the photoaffinity label, they next tried to synthesize an end labeled RNA and directly label by long exposures to uv-light. When the enzyme was incubated with 32 P-labeled RNA for 15 min at 37 degrees and then exposed to a germicidal lamp for various times at O degrees, optimal labeling occurred after 45 min. Various enzyme preparations were labeled by this method and two polypeptides were found to specifically bind the non-methylated mRNA analog. This labeling method should allow characterization of the subunit structure and generate information about the nature of the RNA binding domain

  18. Guanine is indispensable for immunoglobulin switch region RNA-DNA hybrid formation

    International Nuclear Information System (INIS)

    Mizuta, Ryushin; Mizuta, Midori; Kitamura, Daisuke

    2005-01-01

    It is suggested that the formation of the switch (S) region RNA-DNA hybrid and the subsequent generation of higher-order chromatin structures including R-loop initiate a class switch recombination of the immunoglobulin gene. The primary factor of this recombination is the S-region derived noncoding RNA. However, the biochemical character of this guanine-rich (G-rich) transcript is poorly understood. The present study was performed to analyze the structure of this G-rich RNA using atomic force microscope (AFM). The in vitro transcribed S-region RNA was spread on a mica plate, air-dried and observed by non-contact mode AFM in air. The G-rich transcripts tend to aggregate on the template DNA and to generate a higher-order RNA-DNA complex. However, the transcripts that incorporated guanine analogues as substitutes for guanine neither aggregated nor generated higher-order structures. Incorporation of guanine analogues in transcribes RNA partially disrupts hydrogen bonds related to guanine, such as Watson-Crick GC-base pair and Hoogsteen bond GG-base pair. Thus, aggregation of S-region RNA and generation of the higher-order RNA-DNA complex are attributed to hydrogen bonds of guanine. (author)

  19. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  20. Influence of GDP on interaction of transducin with cyclic nucleotide phosphodiesterase and rhodopsin from bovine retinal rods

    International Nuclear Information System (INIS)

    Rybin, V.O.

    1986-01-01

    In the presence of guanine nucleotides and rhodopsin-containing membranes from bovine retinal rod outer segments transducin stimulates light-sensitive cyclic nucleotide phosphodiesterase 5.5- to 7-fold. The activation constant (K/sub act/) for GTP and Gpp(NH)p is equal to 0.25 μM, while that for GDP and GDPβS is 14 and 110 μM, respectively. GDP free of admixtures of other nucleotides does not activate phosphodiesterase at concentrations up to 1 mM, but is bound to transducin and inhibits the Gpp(NH)p-dependent activation of phosphodiesterase. The nature of the interaction of transducin with depolarized rhodopsin also depends on the type of guanine nucleotide bound: in the presence of GDP rhodopsin-containing membranes bind 70-100% of the transducin, whereas in the presence of Gpp(NH)p only 13% of the protein is bound. The data obtained indicate that GDP and GTP convert transducin to two different functional states: the transducin-GTP complex is bound to phosphodiesterase and activates it, while the transducin-GDP complex is bound primarily to rhodopsin

  1. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  2. Behavior of the guanine base in G-quadruplexes probed by the fluorescent guanine analog, 6-methyl isozanthopterin

    Energy Technology Data Exchange (ETDEWEB)

    Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)

    2017-02-15

    In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.

  3. Highly sensitive and selective fluorescent assay for guanine based on the Cu(2+)/eosin Y system.

    Science.gov (United States)

    Shi, Huimin; Cui, Yi; Gong, Yijun; Feng, Suling

    2016-05-15

    A fluorescent probe has been developed for the determination of guanine based on the quenched fluorescence signal of Cu(2+)/eosin Y. Cu(2+) interacted with eosin Y, resulting in fluorescence quenching. Subsequently, with the addition of guanine to the Cu(2+)/eosin Y system, guanine reacted with Cu(2+) to form 1:1 chelate cation, which further combined with eosin Y to form a 1:1 ternary ion-association complex by electrostatic attraction and hydrophobic interaction, resulting in significant decrease of the fluorescence. Hence, a fluorescent system was constructed for rapid, sensitive and selective detection of guanine with a detection limit as low as 1.5 nmol L(-1) and a linear range of 3.3-116 nmol L(-1). The method has been applied satisfactorily to the determination of guanine in DNA and urine samples with the recoveries from 98.7% to 105%. This study significantly expands the realm of application of ternary ion-association complex in fluorescence probe. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Highly sensitive and selective fluorescent assay for guanine based on the Cu2 +/eosin Y system

    Science.gov (United States)

    Shi, Huimin; Cui, Yi; Gong, Yijun; Feng, Suling

    2016-05-01

    A fluorescent probe has been developed for the determination of guanine based on the quenched fluorescence signal of Cu2 +/eosin Y. Cu2 + interacted with eosin Y, resulting in fluorescence quenching. Subsequently, with the addition of guanine to the Cu2 +/eosin Y system, guanine reacted with Cu2 + to form 1:1 chelate cation, which further combined with eosin Y to form a 1:1 ternary ion-association complex by electrostatic attraction and hydrophobic interaction, resulting in significant decrease of the fluorescence. Hence, a fluorescent system was constructed for rapid, sensitive and selective detection of guanine with a detection limit as low as 1.5 nmol L- 1 and a linear range of 3.3-116 nmol L- 1. The method has been applied satisfactorily to the determination of guanine in DNA and urine samples with the recoveries from 98.7% to 105%. This study significantly expands the realm of application of ternary ion-association complex in fluorescence probe.

  5. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  6. Synthesis of a Pseudodisaccharide α-C-Glycosidically Linked to an 8-Alkylated Guanine

    Directory of Open Access Journals (Sweden)

    Jan Duchek

    2013-04-01

    Full Text Available The synthesis of stable guanofosfocin analogues has attracted considerable attention in the past 15 years. Several guanofosfocin analogues mimicking the three constitutional elements of mannose, ribose, and guanine were designed and synthesized. Interest in ether-linked pseudodisaccharides and 8-alkylated guanines is increasing, due to their potential applications in life science. In this article, a novel guanofosfocin analogue 6, an ether-linked pseudodisaccharide connected α-C-glycosidically to an 8-alkylated guanine, was synthesized in a 10-longest linear step sequence from known diol 13, resulting in an overall yield of 26%. The key steps involve the ring-opening of cyclic sulfate 8 by alkoxide generated from 7 and a reductive cyclization of 4-N-acyl-2,4-diamino-5-nitrosopyrimidine 19 to form compound 6.

  7. A DFT investigation on interactions between asymmetric derivatives of cisplatin and nucleobase guanine

    Science.gov (United States)

    Tai, Truong Ba; Nhat, Pham Vu

    2017-07-01

    The interactions of hydrolysis products of cisplatin and its asymmetric derivatives cis- and trans-[PtCl2(iPram)(Mepz)] with guanine were studied using DFT methods. These interactions are dominated by electrostatic effects, namely hydrogen bond contributions and there exists a charge flow from H-atoms of ligands to the O-atoms of guanine. The replacement of NH3 moieties by larger functional groups accompanies with a moderate reaction between PtII and guanine molecule, diminishing the cytotoxicity of the drug. The asymmetric and symmetric NH2 stretching modes of complexes having strong hydrogen bond interactions are red shifted importantly as compared to complexes without presence of hydrogen bond interactions.

  8. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  9. Guanine as a hygienic index for allergological relevant mite infestation in mattress dust

    NARCIS (Netherlands)

    Bronswijk, van J.E.M.H.

    1986-01-01

    Since guanine is not only an essential constituent of vital nucleic acids, but also the main end product of nitrogenous waste excretion in arachnids, it is a potential candidate for a hygienic index for mite activity in house dust. The public health significance of these mites is based on their

  10. Circular dichroism spectroscopy of conformers of (guanine + adenine) repeat strands of DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela

    2003-01-01

    Roč. 15, č. 7 (2003), s. 584-592 ISSN 0899-0042 R&D Projects: GA AV ČR IAA4004201; GA ČR GA204/01/0561 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA conformation * (guanine + adenine) repeats * homoduplexes Subject RIV: BO - Biophysics Impact factor: 1.793, year: 2003

  11. Primary overproduction of urate caused by a partial deficiency of hypoxanthine-guanine phosphoribosyl transferase

    International Nuclear Information System (INIS)

    Cassidy, M.; Gregory, M.C.; Harley, E.H.

    1980-01-01

    Inherited enzyme deficiencies are found in a small proportion of patients with gout who produce an excess of uric acid. The clinical, biochemical and therapeutic aspects of a case of hyperuricaemia caused by an atypical mutant hypoxanthine-guanine phophoribosyl transferase are presented. Urate overproduction was moderate and controlled by allopurinol therapy

  12. The Study of Adsorption of Patulin by Nanocellulose Conjugated with Poly Guanine in Contaminated Apple juice

    Directory of Open Access Journals (Sweden)

    M Ghafori Bidakhavidi

    2016-07-01

    Full Text Available Abstract Introdction: Patulin is a dangerous toxin produced by various fungi. Hence, the current study aimed to evaluate adsorption of Patulin by nanocellulose conjugated with Poly-guanine in contaminated apple juice. Methods: Firstly, nanocellulose was synthesized, and then it was bonded to poly-guanine by a cross-linker. Then, concentration serial of Patulin was prepared in the apple juice, conjugated nanoparticles were added to them, and all were incubated at 37 ºC. After incubation, the Patulin concentration was measured by HPLC, and finally the adsorption percentage was calculated for each tube. Regarding molecular simulation, the initial structures of Patulin and nanocellulose conjugated with Poly-guanine were inserted into Hyperchem software, and their intermolecular energy was calculated during 50 picoseconds. Results: The results of the present study demonstrated that there was a significant direct correlation between the initial concentration of Patulin and the adsorption percentage of toxin. In addition, the adsorption maximum was reported 70±5 %, and the intermolecular energy between two structures was -20.3 Kcal/mol based on the computational simulation. Conclusions: It can be concluded that nanocellulose conjugated with Poly-guanine seems to be a good adsorbent for Patulin, which is demanded to be used in the future studies in regard with its application.

  13. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  14. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  15. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  16. Scaffold-hopping from xanthines to tricyclic guanines: A case study of dipeptidyl peptidase 4 (DPP4) inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Pissarnitski, Dmitri A.; Zhao, Zhiqiang; Cole, David; Wu, Wen-Lian; Domalski, Martin; Clader, John W.; Scapin, Giovanna; Voigt, Johannes; Soriano, Aileen; Kelly, Theresa; Powles, Mary Ann; Yao, Zuliang; Burnett, Duane A. (Merck)

    2016-11-01

    Molecular modeling of unbound tricyclic guanine scaffolds indicated that they can serve as effective bioisosteric replacements of xanthines. This notion was further confirmed by a combination of X-ray crystallography and SAR studies, indicating that tricyclic guanine DPP4 inhibitors mimic the binding mode of xanthine inhibitors, exemplified by linagliptin. Realization of the bioisosteric relationship between these scaffolds potentially will lead to a wider application of cyclic guanines as xanthine replacements in drug discovery programs for a variety of biological targets. Newly designed DPP4 inhibitors achieved sub-nanomolar potency range and demonstrated oral activity in vivo in mouse glucose tolerance test.

  17. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  18. Absence of hypoxanthine:guanine phosphoribosyltransferase activity in murine Dunn osteosarcoma

    International Nuclear Information System (INIS)

    Abelson, H.T.; Gorka, C.

    1983-01-01

    The transplantable murine Dunn osteosarcoma has no detectable hypoxanthine:guanine phosphoribosyltransferase (EC 2.4.2.8) activity. This was established from the tumors directly and from tissue culture cell lines derived from the tumor using a variety of assays: e.g., no [3H]hypoxanthine uptake into tumor or tissue culture cells, no conversion of [3H]hypoxanthine to [3H]IMP by cell extracts from tumors or tissue culture cells, no growth of tissue culture cells in hypoxanthine:aminopterin:thymidine medium, and normal growth of these cells in 10 microM 6-mercaptopurine. Ten human osteosarcomas have been assayed, and two have no apparent hypoxanthine:guanine phosphoribosyltransferase enzyme activity. After high-dose methotrexate treatment in vivo, murine tumors could be selectively killed and normal tissues could be spared by using a rescue regimen of hypoxanthine-thymidine-allopurinol

  19. Structure-wise discrimination of adenine and guanine by proteins on the basis of their nonbonded interactions.

    Science.gov (United States)

    Usha, S; Selvaraj, S

    2015-01-01

    We have analyzed the nonbonded interactions of the structurally similar moieties, adenine and guanine forming complexes with proteins. The results comprise (a) the amino acid-ligand atom preferences, (b) solvent accessibility of ligand atoms before and after complex formation with proteins, and (c) preferred amino acid residue atoms involved in the interactions. We have observed that the amino acid preferences involved in the hydrogen bonding interactions vary for adenine and guanine. The structural variation between the purine atoms is clearly reflected by their burial tendency in the solvent environment. Correlation of the mean amino acid preference values show the variation that exists between adenine and guanine preferences of all the amino acid residues. All our observations provide evidence for the discriminating nature of the proteins in recognizing adenine and guanine.

  20. Benchmark Theoretical and Experimental Study on N-15 NMR Shifts of Oxidatively Damaged Guanine

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Šála, Michal; Klepetářová, Blanka; Šebera, Jakub; Fukal, Jiří; Holečková, Veronika; Tanaka, Y.; Nencka, Radim; Sychrovský, Vladimír

    2016-01-01

    Roč. 120, č. 5 (2016), s. 915-925 ISSN 1520-6106 R&D Projects: GA ČR GA13-27676S; GA ČR GA15-11223S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * DFT calculations * oxidatively damaged guanine * hOGG1 Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.177, year: 2016

  1. Voltammetric Determination of Guanine on the Electrode Modified by Gold Deposit and Nafion Film

    Directory of Open Access Journals (Sweden)

    L.G. Shaidarova

    2016-09-01

    Full Text Available Electrodeposited gold and Nafion-gold composite on the surface of glassy carbon electrodes (GCE have shown electrocatalytic activity during guanine oxidation. In comparison with the unmodified electrode, decreasing of the oxidation potential by 100 mV and increasing of the current of organic compound oxidation have been observed. When the Nafion (NF film is applied to the surface of the glassy carbon electrode with electrodeposited gold, a five-fold increase of guanine oxidation current has been achieved compared to its oxidation on the modified electrode without the NF film. Conditions have been found for electrodeposition of gold on the surface of the glassy carbon electrode, including that one covered with the NF film, as well as for registration of the maximum catalytic current on these electrodes. Linear dependence of the electrocatalytic response of the modified electrode from the guanine concentration has been observed in the range from 5·10–6 to 5·10–3 mol·L–1 (for Au GCE and from 5·10–7 to 5·10–3 mol·L–1 (for NF-Au GCE.

  2. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Science.gov (United States)

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  3. Function of the Nucleotide Exchange Activity of Vav1 in T cell Development and Activation*

    Science.gov (United States)

    Saveliev, Alexander; Vanes, Lesley; Ksionda, Olga; Rapley, Jonathan; Smerdon, Stephen J.; Rittinger, Katrin; Tybulewicz, Victor L. J.

    2012-01-01

    The guanine nucleotide exchange factor (GEF) Vav1 is essential for transducing T cell antigen receptor (TCR) signals and therefore plays a critical role in the development and activation of T cells. It has been presumed that the GEF activity of Vav1 is important for its function; however, there has been no direct demonstration of this. Here, we generated mice expressing enzymatically inactive, but normally folded, Vav1 protein. Analysis of these mice showed that the GEF activity of Vav1 was necessary for the selection of thymocytes and for the optimal activation of T cells, including signal transduction to Rac1, Akt, and integrins. In contrast, the GEF activity of Vav1 was not required for TCR-induced calcium flux, activation of extracellular signal–regulated kinase (ERK) and protein kinase D1 (PKD1), and cell polarization. Thus, in T cells, the GEF activity of Vav1 is essential for some, but not all, of its functions. PMID:20009105

  4. Function of the nucleotide exchange activity of vav1 in T cell development and activation.

    Science.gov (United States)

    Saveliev, Alexander; Vanes, Lesley; Ksionda, Olga; Rapley, Jonathan; Smerdon, Stephen J; Rittinger, Katrin; Tybulewicz, Victor L J

    2009-12-15

    The guanine nucleotide exchange factor (GEF) Vav1 is essential for transducing T cell antigen receptor (TCR) signals and therefore plays a critical role in the development and activation of T cells. It has been presumed that the GEF activity of Vav1 is important for its function; however, there has been no direct demonstration of this. Here, we generated mice expressing enzymatically inactive, but normally folded, Vav1 protein. Analysis of these mice showed that the GEF activity of Vav1 was necessary for the selection of thymocytes and for the optimal activation of T cells, including signal transduction to Rac1, Akt, and integrins. In contrast, the GEF activity of Vav1 was not required for TCR-induced calcium flux, activation of extracellular signal-regulated kinase and protein kinase D1, and cell polarization. Thus, in T cells, the GEF activity of Vav1 is essential for some, but not all, of its functions.

  5. Photoluminescence properties of a novel conjugate of water-soluble CdTe quantum dots to guanine

    Energy Technology Data Exchange (ETDEWEB)

    Feng Xuejiao [North-East Normal University, Changchun 130024 (China); Shang, Qingkun, E-mail: shangqk995@nenu.edu.c [North-East Normal University, Changchun 130024 (China); Liu Hongjian [Relia Diagnostic Systems, Burlingame, CA 94010 (United States); Wang Wenlan; Wang Zhidan; Liu Junyu [North-East Normal University, Changchun 130024 (China)

    2010-04-15

    A novel conjugate of water-soluble CdTe quantum dots to a small biomolecule guanine has been obtained in aqueous phase. The photoluminescence property and the stability of the conjugate increased comparing to CdTe QDs. The interaction between CdTe QDs and guanine was studied by TEM, fluorescence microscope and photoluminescence (PL), IR, UV-Vis spectra. The effects of reflux time, pH value, ionic strength, and the ratio of CdTe QDs to guanine on the photoluminescence properties of conjugate were investigated in detail. The results show that guanine has a great influence on both the photoluminescence property and stability of thioglycolic acid-stabilized CdTe QDs. The formation of coordination and hydrogen bond between guanine molecules and CdTe including thioglycolic acid on its surface may effectively enhance the PL intensity and stability of CdTe QDs. The maximum PL intensity of the conjugate was obtained on the condition with lower ionic strength, less than 30 min reflux time, neutral pH value and 6/1 as molar ratio of guanine to CdTe.

  6. Formation of diastereomeric benzo[a]pyrene diol epoxide-guanine adducts in p53 gene-derived DNA sequences.

    Science.gov (United States)

    Matter, Brock; Wang, Gang; Jones, Roger; Tretyakova, Natalia

    2004-06-01

    G --> T transversion mutations in the p53 tumor suppressor gene are characteristic of smoking-related lung tumors, suggesting that these genetic changes may result from exposure to tobacco carcinogens. It has been previously demonstrated that the diol epoxide metabolites of bay region polycyclic aromatic hydrocarbons present in tobacco smoke, e.g., benzo[a]pyrene diol epoxide (BPDE), preferentially bind to the most frequently mutated guanine nucleotides within p53 codons 157, 158, 248, and 273 [Denissenko, M. F., Pao, A., Tang, M., and Pfeifer, G. P. (1996) Science 274, 430-432]. However, the methodology used in that work (ligation-mediated polymerase chain reaction in combination with the UvrABC endonuclease incision assay) cannot establish the chemical structures and stereochemical identities of BPDE-guanine lesions. In the present study, we employ a stable isotope-labeling HPLC-MS/MS approach [Tretyakova, N., Matter, B., Jones, R., and Shallop, A. (2002) Biochemistry 41, 9535-9544] to analyze the formation of diastereomeric N(2)-BPDE-dG lesions within double-stranded oligodeoxynucleotides representing p53 lung cancer mutational hotspots and their surrounding DNA sequences. (15)N-labeled dG was placed at defined positions within DNA duplexes containing 5-methylcytosine at all physiologically methylated sites, followed by (+/-)-anti-BPDE treatment and enzymatic hydrolysis of the adducted DNA to 2'-deoxynucleosides. Capillary HPLC-ESI(+)-MS/MS was used to establish the amounts of (-)-trans-N(2)-BPDE-dG, (+)-cis-N(2)-BPDE-dG, (-)-cis-N(2)-BPDE-dG, and (+)-trans-N(2)-BPDE-dG originating from the (15)N-labeled bases. We found that all four N(2)-BPDE-dG diastereomers were formed preferentially at the methylated CG dinucleotides, including the frequently mutated p53 codons 157, 158, 245, 248, and 273. The contributions of individual diastereomers to the total adducts number at a given site varied between 70.8 and 92.9% for (+)-trans-N(2)-BPDE-dG, 5.6 and 16.7% for

  7. Increased mobility and on/off ratio in organic field-effect transistors using low-cost guanine-pentacene multilayers

    Science.gov (United States)

    Shi, Wei; Zheng, Yifan; Taylor, André D.; Yu, Junsheng; Katz, Howard E.

    2017-07-01

    Layer-by-layer deposited guanine and pentacene in organic field-effect transistors (OFETs) is introduced. Through adjusting the layer thickness ratio of guanine and pentacene, the tradeoff of two electronic parameters in OFETs, charge carrier mobility and current on/off ratio, was controlled. The charge mobility was enhanced by depositing pentacene over and between guanine layers and by increasing the proportion of pentacene in the layer-by-layer system, while the current on/off ratio was increased via the decreased off current induced by the guanine layers. The tunable device performance was mainly ascribed to the trap and dopant neutralizing properties of the guanine layers, which would decrease the density of free hydroxyl groups in the OFETs. Furthermore, the cost of the devices could be reduced remarkably via the adoption of low-cost guanine.

  8. High-performance liquid chromatography/electrospray mass spectrometry for the analysis of modified bases in DNA: 7-(2-hydroxyethyl)guanine, the major ethylene oxide-DNA adduct.

    Science.gov (United States)

    Leclercq, L; Laurent, C; De Pauw, E

    1997-05-15

    A method was developed for the analysis of 7-(2-hydroxyethyl)guanine (7HEG), the major DNA adduct formed after exposure to ethylene oxide (EO). The method is based on DNA neutral thermal hydrolysis, adduct micro-concentration, and final characterization and quantification by HPLC coupled to single-ion monitoring electrospray mass spectrometry (HPLC/SIR-ESMS). The method was found to be selective, sensitive, and easy to handle with no need for enzymatic digestion or previous sample derivatization. Detection limit was found to be close to 1 fmol of adduct injected (10(-10) M), thus allowing the detection of approximately three modified bases on 10(8) intact nucleotides in blood sample analysis. Quantification results are shown for 7HEG after calf thymus DNA and blood exposure to various doses of EO, in both cases obtaining clear dose-response relationships.

  9. The G-BHQ synergistic effect: Improved double quenching molecular beacons based on guanine and Black Hole Quencher for sensitive simultaneous detection of two DNAs.

    Science.gov (United States)

    Xiang, Dongshan; Li, Fengquan; Wu, Chenyi; Shi, Boan; Zhai, Kun

    2017-11-01

    We designed two double quenching molecular beacons (MBs) with simple structure based on guanine (G base) and Black Hole Quencher (BHQ), and developed a new analytical method for sensitive simultaneous detection of two DNAs by synchronous fluorescence analysis. In this analytical method, carboxyl fluorescein (FAM) and tetramethyl-6-carboxyrhodamine (TAMRA) were respectively selected as fluorophore of two MBs, Black Hole Quencher 1 (BHQ-1) and Black Hole Quencher 2 (BHQ-2) were respectively selected as organic quencher, and three continuous nucleotides with G base were connected to organic quencher (BHQ-1 and BHQ-2). In the presence of target DNAs, the two MBs hybridize with the corresponding target DNAs, the fluorophores are separated from organic quenchers and G bases, leading to recovery of fluorescence of FAM and TAMRA. Under a certain conditions, the fluorescence intensities of FAM and TAMRA all exhibited good linear dependence on their concentration of target DNAs (T1 and T2) in the range from 4 × 10 -10 to 4 × 10 -8 molL -1 (M). The detection limit (3σ, n = 13) of T1 was 3 × 10 -10 M and that of T2 was 2×10 -10 M, respectively. Compared with the existing analysis methods for multiplex DNA with MBs, this proposed method based on double quenching MBs is not only low fluorescence background, short analytical time and low detection cost, but also easy synthesis and good stability of MB probes. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Effect of Six Sessions of High Intensity Interval Training on Levels of Hypoxanthine, Xanthine, Hypoxanthine-Guanine phosphoribosyltransferase (HGPRT and Serum Uric Acid in active young men

    Directory of Open Access Journals (Sweden)

    ROHOULLAH HAGHSHENAS GATABI

    2017-01-01

    Full Text Available Abstract Introduction and objectives: long-term sport and physical activity results in compatibility in maintaining purine derivatives but the compatibility achieved within a few sessions is not well investigated. This study aimed to investigate the effect of a 30-seconds high intensity interval training on Hypoxanthine, xanthine, hypoxanthine-guanine phosphoribosyltransferase (HGPRT and serum uric acid in young college men. Methods: In this study, 18 untrained healthy men were divided into two control and training groups after homogenization based on their personal characteristics. Training included six sessions (every other day for two weeks with different intervals (4, 7, 6, 6, 5 & 4, respectively with a fixed four-minute rest between each interval, and with a constant load of .6 on the cycle-ergometer. Blood samples were taken before and 48 hours after the last training session, and were used to analyze hypoxanthine, xanthine, uric acid, and serum HGPRT. Statistical analysis was performed using analysis of covariance (ANCOVA. Results: The results showed that high-intensity interval training for two weeks did not cause significant changes in serum HGPRT (P = .73; likewise, the increase in serum hypoxanthine (P = .170 and serum xanthine (P = .170 was not statistically significant but significant reduction was observed in serum uric acid (P = .025. Discussion and conclusion: The results of this study indicated that two-week HIIT training is likely to enhance athletic performance and recovery of purine nucleotide cycle.

  11. Effect O6-guanine alkylation on DNA flexibility studied by comparative molecular dynamics simulations.

    Science.gov (United States)

    Kara, Mahmut; Drsata, Tomas; Lankas, Filip; Zacharias, Martin

    2015-01-01

    Alkylation of guanine at the O6 atom is a highly mutagenic DNA lesion because it alters the coding specificity of the base causing G:C to A:T transversion mutations. Specific DNA repair enzymes, e.g. O(6)-alkylguanin-DNA-Transferases (AGT), recognize and repair such damage after looping out the damaged base to transfer it into the enzyme active site. The exact mechanism how the repair enzyme identifies a damaged site within a large surplus of undamaged DNA is not fully understood. The O(6)-alkylation of guanine may change the deformability of DNA which may facilitate the initial binding of a repair enzyme at the damaged site. In order to characterize the effect of O(6)-methyl-guanine (O(6)-MeG) containing base pairs on the DNA deformability extensive comparative molecular dynamics (MD) simulations on duplex DNA with central G:C, O(6)-MeG:C or O(6)-MeG:T base pairs were performed. The simulations indicate significant differences in the helical deformability due to the presence of O(6)-MeG compared to regular undamaged DNA. This includes enhanced base pair opening, shear and stagger motions and alterations in the backbone fine structure caused in part by transient rupture of the base pairing at the damaged site and transient insertion of water molecules. It is likely that the increased opening motions of O(6)-MeG:C or O(6)-MeG:T base pairs play a decisive role for the induced fit recognition or for the looping out of the damaged base by repair enzymes. © 2014 Wiley Periodicals, Inc.

  12. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  13. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  14. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  15. CeO{sub 2} nanoparticles decorated multi-walled carbon nanotubes for electrochemical determination of guanine and adenine

    Energy Technology Data Exchange (ETDEWEB)

    Wei Yan [College of Chemistry and Materials Sciences, Anhui Normal University, Wuhu 241000 (China); Department of Chemistry, Wannan Medical College, Wuhu 241002 (China); Huang Qinan [Department of Chemistry, Wannan Medical College, Wuhu 241002 (China); Li Maoguo [College of Chemistry and Materials Sciences, Anhui Normal University, Wuhu 241000 (China); Huang Xingjiu [Institute of Intelligent Machines, Chinese Academy of Sciences, Hefei 230031 (China); Fang Bin, E-mail: binfang_47@yahoo.com.cn [College of Chemistry and Materials Sciences, Anhui Normal University, Wuhu 241000 (China); Wang Lun, E-mail: wanglun@mail.ahnu.edu.cn [College of Chemistry and Materials Sciences, Anhui Normal University, Wuhu 241000 (China)

    2011-10-01

    Sub-10 nm CeO{sub 2} nanoparticles decorated multi-walled carbon nanotubes has been constructed for electrochemial determination of guanine and adenine. Transmission electron microscopy (TEM) and X-ray diffraction (XRD) were used to characterize the nanoparticles CeO{sub 2}/MWCNTs. Electrochemical impedance spectroscopy (EIS) was used to characterize the electrode modifying process. Cyclic voltammetry (CV) and differential pulse voltammetry (DPV) were used to study the electrocatalytic activity toward the electrochemical oxidation of guanine and adenine. The detection limit (S/N = 3) for adenine and guanine was found to be 20 and 10 nM, respectively. The obtained sensitivity toward guanine and adenine was 1.26 and 1.13 {mu}A/{mu}M in the linear concentration range 5-50 {mu}M and 5-35 {mu}M, respectively. These results demonstrate that the carbon nanotubes could provide huge locations and facilitate the adsorptive accumulation of the guanine and adenine, and the CeO{sub 2} nanoparticles are promising substrates for the development of high-performance electrocatalysts for biosensing.

  16. First-Principles Vibrational Electron Energy Loss Spectroscopy of β -Guanine

    Science.gov (United States)

    Radtke, G.; Taverna, D.; Lazzeri, M.; Balan, E.

    2017-07-01

    A general approach to model vibrational electron energy loss spectra obtained using an electron beam positioned away from the specimen is presented. The energy-loss probability of the fast electron is evaluated using first-principles quantum mechanical calculations (density functional theory) of the dielectric response of the specimen. The validity of the method is assessed using recently measured anhydrous β -guanine, an important molecular solid used by animals to produce structural colors. The good agreement between theory and experiments lays the basis for a quantitative interpretation of this spectroscopy in complex systems.

  17. The cAMP-activated GTP exchange factor, Epac1 Upregulates Plasma Membrane and Nuclear Akt Kinase Activities in 8-CPT-2-O-Me-cAMP-Stimulated Macrophages: Gene silencing of the cAMP-activated GTP exchange Epac1 prevents 8-CPT-2-O-Me-cAMP activation of Akt activity in macrophages*

    OpenAIRE

    Misra, Uma K.; Kaczowka, Steven; Pizzo, Salvatore V.

    2008-01-01

    cAMP regulates a wide range of processes through its downstream effectors including PKA, and the family of guanine nucleotide exchange factors. Depending on the cell type, cAMP inhibits or stimulates growth and proliferation in a PKA-dependent or independent manner. PKA-independent effects are mediated by PI 3-kinases-Akt signaling and EPAC1 (exchange protein directly activated by cAMP) activation. Recently, we reported PKA-independent activation of the protein kinase Akt as well co-immunopre...

  18. New investigations of the guanine trichloro cuprate(II) complex crystal

    Science.gov (United States)

    Fabijanić, Ivana; Matković-Čalogović, Dubravka; Pilepić, Viktor; Ivanišević, Irena; Mohaček-Grošev, Vlasta; Sanković, Krešimir

    2017-01-01

    Crystals of the guanine trichloro cuprate(II) complex, (HGua)2[Cu2Cl6]·2H2O (HGua = protonated guanine), were prepared and analysed by spectroscopic (IR, Raman) and computational methods. A new single-crystal X-ray diffraction analysis was conducted to obtain data with lower standard uncertainties than those in the previously published structure. Raman and IR spectroscopy and quantum-mechanical analysis gave us new insight into the vibrational states of the (HGua)2[Cu2Cl6]·2H2O crystal. The vibrational spectra of the crystal were assigned by performing a normal coordinate analysis for a free dimer with a centre of inversion as the only symmetry element. The stretching vibration observed at 279 cm-1 in the infrared spectrum corresponds to the N-Cu bond. The noncovalent interaction (NCI) plots and quantum theory of atoms in molecules (QTAIM) analysis of the electron density obtained from periodic DFT calculations elucidated the interactions that exist within the crystal structure. Closed-shell ionic attractions, as well as weak and medium strength hydrogen bonds, prevailed in the crystal packing.

  19. A multi-functional guanine derivative for studying the DNA G-quadruplex structure.

    Science.gov (United States)

    Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan

    2017-10-23

    In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.

  20. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    Science.gov (United States)

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Somatotropin has no effect on the quantity of guanine nucleotide binding proteins Gq alpha/G11 alpha in goat adipose tissue in vivo

    Czech Academy of Sciences Publication Activity Database

    Krbeček, Vlastimil; Kovářů, H.; Škarda, Josef; Barth, Tomislav; Velek, Jiří; Žižkovský, V.

    2000-01-01

    Roč. 49, - (2000), s. 673-678 ISSN 0862-8408 R&D Projects: GA ČR GA523/99/0843; GA AV ČR IAA7045608; GA AV ČR KSK2020602 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.366, year: 2000

  2. Genetic deficiency of the α subunit of the guanine nucleotide-binding protein G/sub s/ as the molecular basis for Albright hereditary osteodystrophy

    International Nuclear Information System (INIS)

    Levine, M.A.; Ahn, T.G.; Klupt, S.F.; Kaufman, K.D.; Smallwood, P.M.; Bourne, H.R.; Sullivan, K.A.; Van Dop, C.

    1988-01-01

    Patients who have pseudohypoparathyroidism type I associated with Albright hereditary osteodystrophy commonly have a genetic deficiency of the α subunit of the G protein that stimulated adenylyl cyclase αG/sub s/. To discover the molecular mechanism that causes αG/sub s/ deficiency in these patients, the authors examined eight kindreds with one or more members affected with Albright hereditary osteodystrophy or pseudohypoparathyroidism and αG/sub s/ deficiency. In these families, αG/sub s/, deficiency and the Albright hereditary osteodystrophy phenotype were transmitted together in a dominant inheritance pattern. Using a cDNA hybridization probe for αG/sub s/, restriction analysis with several analysis with several endonucleases showed no abnormalities of restriction fragments or gene dosage. RNA blot and dot blot analysis of total RNA from cultured fibroblasts obtained from the patients revealed ∼ 50% reduced mRNA levels for αG/sub s/ in affected members of six of the pedigrees but normal levels in affected members of the two other pedigrees, compared to mRNA levels in fibroblasts from unaffected individuals. By contrast, mRNA levels encoding the α subunit of the G protein that inhibits adenylyl cyclase were not altered. These findings suggest that several molecular mechanisms produce αG/sub s/ deficiency in patients with pseudohypoparathyroidism type Ia and that major gene rearrangements or deletions are not a common cause for αG/sub s/ deficiency in pseudohypoparathyroidism type I

  3. ARF6 Activated by the LHCG Receptor through the Cytohesin Family of Guanine Nucleotide Exchange Factors Mediates the Receptor Internalization and Signaling*

    Science.gov (United States)

    Kanamarlapudi, Venkateswarlu; Thompson, Aiysha; Kelly, Eamonn; López Bernal, Andrés

    2012-01-01

    The luteinizing hormone chorionic gonadotropin receptor (LHCGR) is a Gs-coupled GPCR that is essential for the maturation and function of the ovary and testis. LHCGR is internalized following its activation, which regulates the biological responsiveness of the receptor. Previous studies indicated that ADP-ribosylation factor (ARF)6 and its GTP-exchange factor (GEF) cytohesin 2 regulate LHCGR internalization in follicular membranes. However, the mechanisms by which ARF6 and cytohesin 2 regulate LHCGR internalization remain incompletely understood. Here we investigated the role of the ARF6 signaling pathway in the internalization of heterologously expressed human LHCGR (HLHCGR) in intact cells using a combination of pharmacological inhibitors, siRNA and the expression of mutant proteins. We found that human CG (HCG)-induced HLHCGR internalization, cAMP accumulation and ARF6 activation were inhibited by Gallein (βγ inhibitor), Wortmannin (PI 3-kinase inhibitor), SecinH3 (cytohesin ARF GEF inhibitor), QS11 (an ARF GAP inhibitor), an ARF6 inhibitory peptide and ARF6 siRNA. However, Dynasore (dynamin inhibitor), the dominant negative mutants of NM23-H1 (dynamin activator) and clathrin, and PBP10 (PtdIns 4,5-P2-binding peptide) inhibited agonist-induced HLHCGR and cAMP accumulation but not ARF6 activation. These results indicate that heterotrimeric G-protein, phosphatidylinositol (PI) 3-kinase (PI3K), cytohesin ARF GEF and ARF GAP function upstream of ARF6 whereas dynamin and clathrin act downstream of ARF6 in the regulation of HCG-induced HLHCGR internalization and signaling. In conclusion, we have identified the components and molecular details of the ARF6 signaling pathway required for agonist-induced HLHCGR internalization. PMID:22523074

  4. Developmental changes in the role of a pertussis toxin sensitive guanine nucleotide binding protein in the rat cardiac alpha1-adrenergic system

    International Nuclear Information System (INIS)

    Han, H.M.

    1989-01-01

    During development, the cardiac alpha 1 -adrenergic chronotropic response changes from positive in the neonate to negative in the adult. This thesis examined the possibility of a developmental change in coupling of a PT-sensitive G-protein to the alpha 1 -adrenergic receptor. Radioligand binding experiments performed with the iodinated alpha 1 -selective radioligand [ 125 I]-I-2-[β-(4-hydroxphenyl)ethylaminomethyl]tetralone ([ 125 I]-IBE 2254) demonstrated that the alpha 1 -adrenergic receptor is coupled to a G-protein in both neonatal and adult rat hearts. However, in the neonate the alpha 1 -adrenergic receptor is coupled to a PT-insensitive G-protein, whereas in the adult the alpha 1 -adrenergic receptor is coupled to both a PT-insensitive and a PT-sensitive G-protein. Consistent with the results from binding experiments, PT did not have any effect on the alpha 1 -mediated positive chronotropic response in the neonate, whereas in the adult the alpha 1 -mediated negative chronotropic response was completely converted to a positive one after PT-treatment. This thesis also examined the possibility of an alteration in coupling of the alpha 1 -adrenergic receptor to its effector under certain circumstances such as high potassium (K + ) depolarization in nerve-muscle (NM) co-cultures, a system which has been previously shown to be a convenient in vitro model to study the mature inhibitory alpha 1 -response

  5. Stimulation through the T cell receptor induces Cbl association with Crk proteins and the guanine nucleotide exchange protein C3G

    NARCIS (Netherlands)

    Reedquist, K. A.; Fukazawa, T.; Panchamoorthy, G.; Langdon, W. Y.; Shoelson, S. E.; Druker, B. J.; Band, H.

    1996-01-01

    We and others have recently identified Cbl, the protein product of the c-cbl protooncogene, as an early tyrosine kinase substrate upon T cell activation and have shown that Cbl forms in vivo complexes with Src family tyrosine kinases, Grb2 adaptor protein, and the p85 subunit of PI-3 kinase. Here we

  6. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  8. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  9. Electrochemical behaviors and simultaneous determination of guanine and adenine based on graphene–ionic liquid–chitosan composite film modified glassy carbon electrode

    International Nuclear Information System (INIS)

    Niu Xiuli; Yang Wu; Ren Jie; Guo Hao; Long Shijia; Chen Jiaojiao; Gao Jinzhang

    2012-01-01

    Highlights: ► This work developed a novel electrochemical biosensors for guanine and adenine detection simultaneously. ► A disposable electrode based on graphene sheets, ionic liquid and chitosan was proposed. ► The presented method was also applied to simultaneous determination of guanine and adenine in denatured DNA samples with satisfying results. ► Easy fabrication, high sensitivity, excellent reproducibility and long-term stability. - Abstract: A graphene sheets (GS), ionic liquid (IL) and chitosan (CS) modified electrode was fabricated and the modified electrode displayed excellent electrochemical catalytic activities toward guanine and adenine. The transfer electron number (n) and the charge transfer coefficient (α) were calculated with the result as n = 2, α = 0.58 for guanine, and n = 2, α = 0.51 for adenine, which indicated the electrochemical oxidation of guanine and adenine on GS/IL/CS modified electrode was a two-electron and two-proton process. The oxidation overpotentials of guanine and adenine were decreased significantly compared with those obtained at the bare glassy carbon electrode and multi-walled carbon nanotubes modified electrode. The modified electrode exhibited good analytical performance and was successfully applied for individual and simultaneous determination of guanine and adenine. Low detection limits of 0.75 μM for guanine and 0.45 μM for adenine were obtained, with the linear calibration curves over the concentration range 2.5–150 μM and 1.5–350 μM, respectively. At the same time, the proposed method was successfully applied for the determination of guanine and adenine in denatured DNA samples with satisfying results. Moreover, the GS/IL/CS modified electrode exhibited good sensitivity, long-term stability and reproducibility for the determination of guanine and adenine.

  10. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  11. Synthesis and Evaluation of Asymmetric Acyclic Nucleoside Bisphosphonates as Inhibitors of Plasmodium falciparum and Human Hypoxanthine-Guanine-(Xanthine) Phosphoribosyltransferase

    Czech Academy of Sciences Publication Activity Database

    Špaček, Petr; Keough, D. T.; Chavchich, M.; Dračínský, Martin; Janeba, Zlatko; Naesens, L.; Edstein, M. D.; Guddat, L. W.; Hocková, Dana

    2017-01-01

    Roč. 60, č. 17 (2017), s. 7539-7554 ISSN 0022-2623 R&D Projects: GA ČR(CZ) GA16-06049S Institutional support: RVO:61388963 Keywords : hypoxanthine-guanine phosphoribosyltransferase * 2nd phosphonate group * 6-oxopurine phosphoribosyltransferases Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 6.259, year: 2016

  12. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  13. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  14. Examination of the effect of the annealing cation on higher order structures containing guanine or isoguanine repeats

    Science.gov (United States)

    Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.

    2010-01-01

    Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. The guanine-containing strand (G9) consistently formed quadruplexes upon annealing, whereas the isoguanine strand (Ig9) formed both pentaplexes and quadruplexes depending on the annealing cation. Quadruplex formation with G9 showed some dependence on the identity of the cation present during annealing with high relative quadruplex formation detected with six of ten cations. Analogous annealing experiments with Ig9 resulted in complex formation with all ten cations, and the majority of the resulting complexes were pentaplexes. CD results indicated most of the original complexes survived the desalting process necessary for ESI-MS analysis. In addition, several complexes, especially the pentaplexes, were found to be capable of cation exchange with ammonium ions. Ab initio calculations were conducted for isoguanine tetrads and pentads coordinated with all ten cations to predict the most energetically stable structures of the complexes in the gas phase. The observed preference of forming quadruplexes versus pentaplexes as a function of the coordinated cation can be interpreted by the calculated reaction energies of both the tetrads and pentads in combination with the distortion energies of tetrads. PMID:19746468

  15. The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.

    Science.gov (United States)

    Zaccaria, F; Paragi, G; Fonseca Guerra, C

    2016-08-21

    The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.

  16. Structural study and investigation of NMR tensors in interaction of dopamine with Adenine and guanine

    Directory of Open Access Journals (Sweden)

    Lingjia Xu

    2007-04-01

    Full Text Available The interaction of dopamine with adenine and guanine were studied at the Hartree-Fock level theory. The structural and vibrational properties of dopamine-4-N7GUA and dopamine-4-N3ADE were studied at level of HF/6-31G*. Interaction energies (ΔE were calculated to be -11.49 and -11.92 kcal/mol, respectively. Some of bond lengths, angels and tortions are compared. NBO studies were performed to the second-order and perturbative estimates of donor-acceptor interaction have been done. The procedures of gauge-invariant atomic orbital (GIAO and continuous-set-of-gauge-transformation (CSGT were employed to calculate isotropic shielding, chemical shifts anisotropy and chemical shifts anisotropy asymmetry and effective anisotropy using 6-31G* basis set. These calculations yielded molecular geometries in good agreement with available experimental data.

  17. INTRACELLULAR Leishmania amazonensis KILLING INDUCED BY THE GUANINE NUCLEOSIDE 8-BROMOGUANOSINE

    Directory of Open Access Journals (Sweden)

    GIORGIO Selma

    1998-01-01

    Full Text Available In this study we investigated the effect of 8-Bromoguanosine, an immunostimulatory compound, on the cytotoxicity of macrophages against Leishmania amazonensis in an in vitro system. The results showed that macrophages treated with 8-Bromoguanosine before or after infection are capable to reduce parasite load, as monitored by the number of amastigotes per macrophage and the percentage of infected cells (i.e. phagocytic index. Since 8-Bromoguanosine was not directly toxic to the promastigotes, it was concluded that the ribonucleoside induced macrophage activation. Presumably, 8-Bromoguanosine primed macrophages by inducing interferon alpha and beta which ultimately led to L. amazonensis amastigote killing. The results suggest that guanine ribonucleosides may be useful to treat infections with intracellular pathogens.

  18. Modified gold electrodes based on thiocytosine/guanine-gold nanoparticles for uric and ascorbic acid determination

    International Nuclear Information System (INIS)

    Vulcu, Adriana; Grosan, Camelia; Muresan, Liana Maria; Pruneanu, Stela; Olenic, Liliana

    2013-01-01

    The present paper describes the preparation of new modified surfaces for electrodes based on guanine/thiocytosine and gold nanoparticles. The gold nanoparticles were analyzed by UV–vis spectroscopy and transmission electron microscopy (TEM) and it was found that they have diameters between 30 and 40 nm. The layers were characterized by specular reflectance infrared spectroscopy (FTIR-RAS) and by atomic force microscopy (AFM). The thickness of layers was found to be approximately 30 nm for TC layers and 300 nm for GU layers. Every layer was characterized as electrochemical sensor (by cyclic voltammetry) both for uric acid and ascorbic acid determinations, separately and in their mixture. The modified sensors have good calibration functions with good sensitivity (between 1.145 and 1.406 mA cm −2 /decade), reproducibility ( t hiocytosine (Au T C) and gold g uanine (Au G U) layers

  19. Research Update: Density functional theory investigation of the interactions of silver nanoclusters with guanine

    Directory of Open Access Journals (Sweden)

    Brandon B. Dale

    2017-05-01

    Full Text Available Bare and guanine-complexed silver clusters Ag n z (n = 2-6; z = 0-2 are examined using density functional theory to elucidate the geometries and binding motifs that are present experimentally. Whereas the neutral systems remain planar in this size range, a 2D-3D transition occurs at Ag 5 + for the cationic system and at Ag 4 2 + for the dicationic system. Neutral silver clusters can bind with nitrogen 3 or with the pi system of the base. However, positively charged clusters interact with nitrogen 7 and the neighboring carbonyl group. Thus, the cationic silver-DNA clusters present experimentally may preferentially interact at these sites.

  20. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  1. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  2. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  3. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  4. Automated quantum chemistry based molecular dynamics simulations of electron ionization induced fragmentations of the nucleobases Uracil, Thymine, Cytosine, and Guanine.

    Science.gov (United States)

    Grimme, Stefan; Bauer, Christopher Alexander

    2015-01-01

    The gas-phase decomposition pathways of electron ionization (EI)-induced radical cations of the nucleobases uracil, thymine, cytosine, and guanine are investigated by means of mixed quantum-classical molecular dynamics. No preconceived fragmentation channels are used in the calculations. The results compare well to a plethora of experimental and theoretical data for these important biomolecules. With our combined stochastic and dynamic approach, one can access in an unbiased way the energetically available decomposition mechanisms. Additionally, we are able to separate the EI mass spectra of different tautomers of cytosine and guanine. Our method (previously termed quantum chemistry electron ionization mass spectra) reproduces free nucleobase experimental mass spectra well and provides detailed mechanistic in-sight into high-energy unimolecular decomposition processes.

  5. Structure of Radicals from X-irradiated Guanine Derivatives: An Experimental and Computational Study of Sodium Guanosine Dihydrate Single Crystals

    Science.gov (United States)

    Jayatilaka, Nayana; Nelson, William H.

    2008-01-01

    In sodium guanosine dihydrate single crystals, the guanine moiety is deprotonated at N1 due to growth from high-pH (>12) solutions. EPR and ENDOR study of crystals x-irradiated at 10 K detected evidence for three radical forms. Radical R1,characterized by two proton and two nitrogen hyperfine interactions, was identified as the product of net hydrogenation at N7 of the N1-deprotonated guanine unit. R1 exhibited an unusually distorted structure leading to net positive isotropic components of the hydrogen couplings. Radical R2, characterized by one proton and one nitrogen hyperfine coupling was identified as the primary electron loss product. This product is equivalent to that of deprotonation at N1 by the guanine cation and represents the first ENDOR characterization of that product. Radical R3, characterized by a single hydrogen hyperfine coupling, was identified as the product of net dehydrogenation at C1 of the ribose moiety. The identification of radicals R1-R3 was supported by DFT calculations on several possible structures using the B3LYP/6-311G(2df,p)//6-31G(d,p) approach. Radical R4, detected after warming the crystals to room temperature, was identified as the well-known product of net hydrogenation of C8 of the (N1-deprotonated) guanine component. Radical R1, evidently formed by protonation of the primary electron addition product, was present as roughly 60% of the total radicals detected at 10 K. Radical R2 was present as roughly 27% of the total yield, and the concentration of R3 contributed the remaining 13%. R3 is evidently the product of oneelectron oxidation followed by deprotonation; thus, the balance of oxidation and reduction products is approximately equal within experimental uncertainty. PMID:17249824

  6. Quenching of light flickering in synthetic guanine crystals in aqueous solutions under strong static magnetic fields

    Science.gov (United States)

    Mootha, A.; Takanezawa, Y.; Iwasaka, M.

    2018-05-01

    The present study focused on the vibration of micro crystal particles of guanine due to Brownian motion. The organic particle has a refractive index of 1.83 and caused a flickering of light. To test the possibility of using magnetic properties under wet conditions, changes in the frequency of particle vibration by applying magnetic fields were investigated. At first, we found that the exposure at 5 T inhibited the flickering light intensities and the particle vibration slightly decreased. Next, we carried out a high speed camera measurement of the Brownian motion of the particle with a time resolution of 100 flame per second (fps) with and without magnetic field exposures. It was revealed that the vibrational speed of synthetic particles was enhanced at 500 mT. Detailed analyses of the particle vibration by changing the direction of magnetic fields versus the light source revealed that the Brownian motion's vibrational frequency was entrained under magnetic fields at 500 mT, and an increase in vibration speed to 20Hz was observed. Additional measurements of light scattering fluctuation using photo-detector and analyses on auto-correlation also confirmed this speculation. The studied Brownian vibration may be influenced by the change in mechanical interactions between the vibration particles and surrounding medium. The discovered phenomena can be applied for molecular and biological interactions in future studies.

  7. Characterization of a mimivirus RNA cap guanine-N2 methyltransferase.

    Science.gov (United States)

    Benarroch, Delphine; Qiu, Zhicheng R; Schwer, Beate; Shuman, Stewart

    2009-04-01

    A 2,2,7-trimethylguanosine (TMG) cap is a signature feature of eukaryal snRNAs, telomerase RNAs, and trans-spliced nematode mRNAs. TMG and 2,7-dimethylguanosine (DMG) caps are also present on mRNAs of two species of alphaviruses (positive strand RNA viruses of the Togaviridae family). It is presently not known how viral mRNAs might acquire a hypermethylated cap. Mimivirus, a giant DNA virus that infects amoeba, encodes many putative enzymes and proteins implicated in RNA transactions, including the synthesis and capping of viral mRNAs and the promotion of cap-dependent translation. Here we report the identification, purification, and characterization of a mimivirus cap-specific guanine-N2 methyltransferase (MimiTgs), a monomeric enzyme that catalyzes a single round of methyl transfer from AdoMet to an m(7)G cap substrate to form a DMG cap product. MimiTgs, is apparently unable to convert a DMG cap to a TMG cap, and is thereby distinguished from the structurally homologous yeast and human Tgs1 enzymes. Nonetheless, we show genetically that MimiTgs is a true ortholog of Saccharomyces cerevisiae Tgs1. Our results hint that DMG caps can satisfy many of the functions of TMG caps in vivo. We speculate that DMG capping of mimivirus mRNAs might favor viral protein synthesis in the infected host.

  8. Structural landscape of the proline-rich domain of Sos1 nucleotide exchange factor.

    Science.gov (United States)

    McDonald, Caleb B; Bhat, Vikas; Kurouski, Dmitry; Mikles, David C; Deegan, Brian J; Seldeen, Kenneth L; Lednev, Igor K; Farooq, Amjad

    2013-01-01

    Despite its key role in mediating a plethora of cellular signaling cascades pertinent to health and disease, little is known about the structural landscape of the proline-rich (PR) domain of Sos1 guanine nucleotide exchange factor. Herein, using a battery of biophysical tools, we provide evidence that the PR domain of Sos1 is structurally disordered and adopts an extended random coil-like conformation in solution. Of particular interest is the observation that while chemical denaturation of PR domain results in the formation of a significant amount of polyproline II (PPII) helices, it has little or negligible effect on its overall size as measured by its hydrodynamic radius. Our data also show that the PR domain displays a highly dynamic conformational basin in agreement with the knowledge that the intrinsically unstructured proteins rapidly interconvert between an ensemble of conformations. Collectively, our study provides new insights into the conformational equilibrium of a key signaling molecule with important consequences on its physiological function. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  10. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  11. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    International Nuclear Information System (INIS)

    Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.

    2017-01-01

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  12. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    Energy Technology Data Exchange (ETDEWEB)

    Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  13. Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

    Directory of Open Access Journals (Sweden)

    Manjula Pandey

    2014-03-01

    Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

  14. Design of Plasmodium vivax Hypoxanthine-Guanine Phosphoribosyltransferase Inhibitors as Potential Antimalarial Therapeutics

    Czech Academy of Sciences Publication Activity Database

    Keough, D. T.; Rejman, Dominik; Pohl, Radek; Zborníková, Eva; Hocková, Dana; Croll, T.; Edstein, M. D.; Birrell, G. W.; Chavchich, M.; Naesens, L. M. J.; Pierens, G. K.; Brereton, I. M.; Guddat, L. W.

    2018-01-01

    Roč. 13, č. 1 (2018), s. 82-90 ISSN 1554-8929 R&D Projects: GA ČR(CZ) GA16-06049S; GA ČR GA15-11711S Institutional support: RVO:61388963 Keywords : plasmodium vivax * inhibitor * pyrrolidine nucleotide bisphosphonate * HXGPRT Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 4.995, year: 2016

  15. Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.

    Directory of Open Access Journals (Sweden)

    Ezekiel Crenshaw

    Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

  16. Pre-thymic somatic mutation leads to high mutant frequency at hypoxanthine-guanine phosphoribosyltransferase gene

    Energy Technology Data Exchange (ETDEWEB)

    Jett, J. [Lawrence Livermore National Lab., CA (United States)

    1994-12-01

    While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.

  17. Pan-pathway based interaction profiling of FDA-approved nucleoside and nucleobase analogs with enzymes of the human nucleotide metabolism.

    Science.gov (United States)

    Egeblad, Louise; Welin, Martin; Flodin, Susanne; Gräslund, Susanne; Wang, Liya; Balzarini, Jan; Eriksson, Staffan; Nordlund, Pär

    2012-01-01

    To identify interactions a nucleoside analog library (NAL) consisting of 45 FDA-approved nucleoside analogs was screened against 23 enzymes of the human nucleotide metabolism using a thermal shift assay. The method was validated with deoxycytidine kinase; eight interactions known from the literature were detected and five additional interactions were revealed after the addition of ATP, the second substrate. The NAL screening gave relatively few significant hits, supporting a low rate of "off target effects." However, unexpected ligands were identified for two catabolic enzymes guanine deaminase (GDA) and uridine phosphorylase 1 (UPP1). An acyclic guanosine prodrug analog, valaciclovir, was shown to stabilize GDA to the same degree as the natural substrate, guanine, with a ΔT(agg) around 7°C. Aciclovir, penciclovir, ganciclovir, thioguanine and mercaptopurine were also identified as ligands for GDA. The crystal structure of GDA with valaciclovir bound in the active site was determined, revealing the binding of the long unbranched chain of valaciclovir in the active site of the enzyme. Several ligands were identified for UPP1: vidarabine, an antiviral nucleoside analog, as well as trifluridine, idoxuridine, floxuridine, zidovudine, telbivudine, fluorouracil and thioguanine caused concentration-dependent stabilization of UPP1. A kinetic study of UPP1 with vidarabine revealed that vidarabine was a mixed-type competitive inhibitor with the natural substrate uridine. The unexpected ligands identified for UPP1 and GDA imply further metabolic consequences for these nucleoside analogs, which could also serve as a starting point for future drug design.

  18. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  19. Exploring the correlation between the sequence composition of the nucleotide binding G5 loop of the FeoB GTPase domain (NFeoB) and intrinsic rate of GDP release.

    Science.gov (United States)

    Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika

    2014-12-12

    GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.

  20. Electron attachment to the guanine-cytosine nucleic acid base pair and the effects of monohydration and proton transfer.

    Science.gov (United States)

    Gupta, Ashutosh; Jaeger, Heather M; Compaan, Katherine R; Schaefer, Henry F

    2012-05-17

    The guanine-cytosine (GC) radical anion and its interaction with a single water molecule is studied using ab initio and density functional methods. Z-averaged second-order perturbation theory (ZAPT2) was applied to GC radical anion for the first time. Predicted spin densities show that the radical character is localized on cytosine. The Watson-Crick monohydrated GC anion is compared to neutral GC·H2O, as well as to the proton-transferred analogue on the basis of structural and energetic properties. In all three systems, local minima are identified that correspond to water positioned in the major and minor grooves of macromolecular DNA. On the anionic surface, two novel structures have water positioned above or below the GC plane. On the neutral and anionic surfaces, the global minimum can be described as water interacting with the minor groove. These structures are predicted to have hydration energies of 9.7 and 11.8 kcal mol(-1), respectively. Upon interbase proton-transfer (PT), the anionic global minimum has water positioned in the major groove, and the hydration energy increases to 13.4 kcal mol(-1). PT GC·H2O(•-) has distonic character; the radical character resides on cytosine, while the negative charge is localized on guanine. The effects of proton transfer are further investigated through the computed adiabatic electron affinities (AEA) of GC and monohydrated GC, and the vertical detachment energies (VDE) of the corresponding anions. Monohydration increases the AEAs and VDEs by only 0.1 eV, while proton-transfer increases the VDEs substantially (0.8 eV). The molecular charge distribution of monohydrated guanine-cytosine radical anion depends heavily on interbase proton transfer.

  1. The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.

    2011-05-13

    Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.

  2. Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence*

    Science.gov (United States)

    Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L.; Embrey, Kevin J.; Golovanov, Alexander P.

    2016-01-01

    The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly 15N-labeled Ras as well as [13C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. PMID:26565026

  3. Nitrogen K-edge X-ray absorption near edge structure (XANES) spectra of purine-containing nucleotides in aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Shimada, Hiroyuki; Fukao, Taishi; Minami, Hirotake; Ukai, Masatoshi [Department of Applied Physics, Tokyo University of Agriculture and Technology, Koganei-shi, Tokyo 184-8588 (Japan); Fujii, Kentaro; Yokoya, Akinari [Advanced Science Research Center, Japan Atomic Energy Agency, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Fukuda, Yoshihiro; Saitoh, Yuji [Synchrotron Radiation Research Center, Japan Atomic Energy Agency, Sayo-gun, Hyougo 679-5148 (Japan)

    2014-08-07

    The N K-edge X-ray absorption near edge structure (XANES) spectra of the purine-containing nucleotide, guanosine 5{sup ′}-monophosphate (GMP), in aqueous solution are measured under various pH conditions. The spectra show characteristic peaks, which originate from resonant excitations of N 1s electrons to π* orbitals inside the guanine moiety of GMP. The relative intensities of these peaks depend on the pH values of the solution. The pH dependence is explained by the core-level shift of N atoms at specific sites caused by protonation and deprotonation. The experimental spectra are compared with theoretical spectra calculated by using density functional theory for GMP and the other purine-containing nucleotides, adenosine 5{sup ′}-monophosphate, and adenosine 5{sup ′}-triphosphate. The N K-edge XANES spectra for all of these nucleotides are classified by the numbers of N atoms with particular chemical bonding characteristics in the purine moiety.

  4. The electrochemical reduction of the purines guanine and adenine at platinum electrodes in several room temperature ionic liquids

    International Nuclear Information System (INIS)

    Zanoni, Maria Valnice Boldrin; Rogers, Emma I.; Hardacre, Christopher; Compton, Richard G.

    2010-01-01

    The reduction of guanine was studied by microelectrode voltammetry in the room temperature ionic liquids (RTILs) N-hexyltriethylammonium bis (trifluoromethanesulfonyl) imide [N 6,2,2,2 ][N(Tf) 2 ], 1-butyl-3-methylimidazolium hexafluorosphosphate [C 4 mim][PF 6 ], N-butyl-N-methyl-pyrrolidinium bis(trifluoromethanesulfonyl)imide [C 4 mpyrr][N(Tf) 2 ], 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide [C 4 mim][N(Tf) 2 ], N-butyl-N-methyl-pyrrolidinium dicyanamide [C 4 mpyrr][N(NC) 2 ] and tris(P-hexyl)-tetradecylphosphonium trifluorotris(pentafluoroethyl)phosphate [P 14,6,6,6 ][FAP] on a platinum microelectrode. In [N 6,2,2,2 ][NTf 2 ] and [P 14,6,6,6 ][FAP], but not in the other ionic liquids studied, guanine reduction involves a one-electron, diffusion-controlled process at very negative potential to produce an unstable radical anion, which is thought to undergo a dimerization reaction, probably after proton abstraction from the cation of the ionic liquid. The rate of this subsequent reaction depends on the nature of the ionic liquid, and it is faster in the ionic liquid [P 14,6,6,6 ][FAP], in which the formation of the resulting dimer can be voltammetrically monitored at less negative potentials than required for the reduction of the parent molecule. Adenine showed similar behaviour to guanine but the pyrimidines thymine and cytosine did not; thymine was not reduced at potentials less negative than required for solvent (RTIL) decomposition while only a poorly defined wave was seen for cytosine. The possibility for proton abstraction from the cation in [N 6,2,2,2 ][NTf 2 ] and [P 14,6,6,6 ][FAP] is noted and this is thought to aid the electrochemical dimerization process. The resulting rapid reaction is thought to shift the reduction potentials for guanine and adenine to lower values than observed in RTILs where the scope for proton abstraction is not present. Such shifts are characteristic of so-called EC processes where reversible electron transfer

  5. Reactions of guanine with methyl chloride and methyl bromide: O6-methylation versus charge transfer complex formation

    Science.gov (United States)

    Shukla, P. K.; Mishra, P. C.; Suhai, S.

    Density functional theory (DFT) at the B3LYP/6-31+G* and B3LYP/AUG-cc-pVDZ levels was employed to study O6-methylation of guanine due to its reactions with methyl chloride and methyl bromide and to obtain explanation as to why the methyl halides cause genotoxicity and possess mutagenic and carcinogenic properties. Geometries of the various isolated species involved in the reactions, reactant complexes (RCs), and product complexes (PCs) were optimized in gas phase. Transition states connecting the reactant complexes with the product complexes were also optimized in gas phase at the same levels of theory. The reactant complexes, product complexes, and transition states were solvated in aqueous media using the polarizable continuum model (PCM) of the self-consistent reaction field theory. Zero-point energy (ZPE) correction to total energy and the corresponding thermal energy correction to enthalpy were made in each case. The reactant complexes of the keto form of guanine with methyl chloride and methyl bromide in water are appreciably more stable than the corresponding complexes involving the enol form of guanine. The nature of binding in the product complexes was found to be of the charge transfer type (O6mG+ · X-, X dbond Cl, Br). Binding of HCl, HBr, and H2O molecules to the PCs obtained with the keto form of guanine did not alter the positions of the halide anions in the PCs, and the charge transfer character of the PCs was also not modified due to this binding. Further, the complexes obtained due to the binding of HCl, HBr, and H2O molecules to the PCs had greater stability than the isolated PCs. The reaction barriers involved in the formation of PCs were found to be quite high (?50 kcal/mol). Mechanisms of genotoxicity, mutagenesis and carcinogenesis caused by the methyl halides appear to involve charge transfer-type complex formation. Thus the mechanisms of these processes involving the methyl halides appear to be quite different from those that involve the

  6. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  7. Bacterial nucleotide-based second messengers.

    Science.gov (United States)

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  8. Simultaneous protection of organic p- and n-channels in complementary inverter from aging and bias-stress by DNA-base guanine/Al2O3 double layer.

    Science.gov (United States)

    Lee, Junyeong; Hwang, Hyuncheol; Min, Sung-Wook; Shin, Jae Min; Kim, Jin Sung; Jeon, Pyo Jin; Lee, Hee Sung; Im, Seongil

    2015-01-28

    Although organic field-effect transistors (OFETs) have various advantages of lightweight, low-cost, mechanical flexibility, and nowadays even higher mobility than amorphous Si-based FET, stability issue under bias and ambient condition critically hinder its practical application. One of the most detrimental effects on organic layer comes from penetrated atmospheric species such as oxygen and water. To solve such degradation problems, several molecular engineering tactics are introduced: forming a kinetic barrier, lowering the level of molecule orbitals, and increasing the band gap. However, direct passivation of organic channels, the most promising strategy, has not been reported as often as other methods. Here, we resolved the ambient stability issues of p-type (heptazole)/or n-type (PTCDI-C13) OFETs and their bias-stability issues at once, using DNA-base small molecule guanine (C5H5N5O)/Al2O3 bilayer. The guanine protects the organic channels as buffer/and H getter layer between the channels and capping Al2O3, whereas the oxide capping resists ambient molecules. As a result, both p-type and n-type OFETs are simultaneously protected from gate-bias stress and 30 days-long ambient aging, finally demonstrating a highly stable, high-gain complementary-type logic inverter.

  9. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  10. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  11. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  12. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  13. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  14. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  15. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  16. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  17. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  18. Multiscale QM/MM molecular dynamics study on the first steps of guanine damage by free hydroxyl radicals in solution.

    Science.gov (United States)

    Abolfath, Ramin M; Biswas, P K; Rajnarayanam, R; Brabec, Thomas; Kodym, Reinhard; Papiez, Lech

    2012-04-19

    Understanding the damage of DNA bases from hydrogen abstraction by free OH radicals is of particular importance to understanding the indirect effect of ionizing radiation. Previous studies address the problem with truncated DNA bases as ab initio quantum simulations required to study such electronic-spin-dependent processes are computationally expensive. Here, for the first time, we employ a multiscale and hybrid quantum mechanical-molecular mechanical simulation to study the interaction of OH radicals with a guanine-deoxyribose-phosphate DNA molecular unit in the presence of water, where all of the water molecules and the deoxyribose-phosphate fragment are treated with the simplistic classical molecular mechanical scheme. Our result illustrates that the presence of water strongly alters the hydrogen-abstraction reaction as the hydrogen bonding of OH radicals with water restricts the relative orientation of the OH radicals with respect to the DNA base (here, guanine). This results in an angular anisotropy in the chemical pathway and a lower efficiency in the hydrogen-abstraction mechanisms than previously anticipated for identical systems in vacuum. The method can easily be extended to single- and double-stranded DNA without any appreciable computational cost as these molecular units can be treated in the classical subsystem, as has been demonstrated here. © 2012 American Chemical Society

  19. Free terminal amines in DNA-binding peptides alter the product distribution from guanine radicals produced by single electron oxidation.

    Science.gov (United States)

    Konigsfeld, Katie M; Lee, Melissa; Urata, Sarah M; Aguilera, Joe A; Milligan, Jamie R

    2012-03-01

    Electron deficient guanine radical species are major intermediates produced in DNA by the direct effect of ionizing irradiation. There is evidence that they react with amine groups in closely bound ligands to form covalent crosslinks. Crosslink formation is very poorly characterized in terms of quantitative rate and yield data. We sought to address this issue by using oligo-arginine ligands to model the close association of DNA and its binding proteins in chromatin. Guanine radicals were prepared in plasmid DNA by single electron oxidation. The product distribution derived from them was assayed by strand break formation after four different post-irradiation incubations. We compared the yields of DNA damage produced in the presence of four ligands in which neither, one, or both of the amino and carboxylate termini were blocked with amides. Free carboxylate groups were unreactive. Significantly higher yields of heat labile sites were observed when the amino terminus was unblocked. The rate of the reaction was characterized by diluting the unblocked amino group with its amide blocked derivative. These observations provide a means to develop quantitative estimates for the yields in which these labile sites are formed in chromatin by exposure to ionizing irradiation.

  20. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization.

    Science.gov (United States)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E; Ding, Zhong-Tao

    2015-02-25

    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  2. Echinacoside induces apoptotic cancer cell death by inhibiting the nucleotide pool sanitizing enzyme MTH1

    Directory of Open Access Journals (Sweden)

    Dong L

    2015-12-01

    Full Text Available Liwei Dong,1 Hongge Wang,1 Jiajing Niu,1 Mingwei Zou,2 Nuoting Wu,1 Debin Yu,1 Ye Wang,1 Zhihua Zou11Key Laboratory for Molecular Enzymology and Engineering of the Ministry of Education, National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, Jilin Province, People’s Republic of China; 2Department of Psychology, College of Liberal Arts and Social Sciences, University of Houston, Houston, TX, USA Abstract: Inhibition of the nucleotide pool sanitizing enzyme MTH1 causes extensive oxidative DNA damages and apoptosis in cancer cells and hence may be used as an anticancer strategy. As natural products have been a rich source of medicinal chemicals, in the present study, we used the MTH1-catalyzed enzymatic reaction as a high-throughput in vitro screening assay to search for natural compounds capable of inhibiting MTH1. Echinacoside, a compound derived from the medicinal plants Cistanche and Echinacea, effectively inhibited the catalytic activity of MTH1 in an in vitro assay. Treatment of various human cancer cell lines with Echinacoside resulted in a significant increase in the cellular level of oxidized guanine (8-oxoguanine, while cellular reactive oxygen species level remained unchanged, indicating that Echinacoside also inhibited the activity of cellular MTH1. Consequently, Echinacoside treatment induced an immediate and dramatic increase in DNA damage markers and upregulation of the G1/S-CDK inhibitor p21, which were followed by marked apoptotic cell death and cell cycle arrest in cancer but not in noncancer cells. Taken together, these studies identified a natural compound as an MTH1 inhibitor and suggest that natural products can be an important source of anticancer agents. Keywords: Echinacoside, MTH1, 8-oxoG, DNA damage, apoptosis, cell cycle arrest

  3. Formation of amino acids and nucleotide bases in a Titan atmosphere simulation experiment.

    Science.gov (United States)

    Hörst, S M; Yelle, R V; Buch, A; Carrasco, N; Cernogora, G; Dutuit, O; Quirico, E; Sciamma-O'Brien, E; Smith, M A; Somogyi, A; Szopa, C; Thissen, R; Vuitton, V

    2012-09-01

    The discovery of large (>100 u) molecules in Titan's upper atmosphere has heightened astrobiological interest in this unique satellite. In particular, complex organic aerosols produced in atmospheres containing C, N, O, and H, like that of Titan, could be a source of prebiotic molecules. In this work, aerosols produced in a Titan atmosphere simulation experiment with enhanced CO (N(2)/CH(4)/CO gas mixtures of 96.2%/2.0%/1.8% and 93.2%/5.0%/1.8%) were found to contain 18 molecules with molecular formulae that correspond to biological amino acids and nucleotide bases. Very high-resolution mass spectrometry of isotopically labeled samples confirmed that C(4)H(5)N(3)O, C(4)H(4)N(2)O(2), C(5)H(6)N(2)O(2), C(5)H(5)N(5), and C(6)H(9)N(3)O(2) are produced by chemistry in the simulation chamber. Gas chromatography-mass spectrometry (GC-MS) analyses of the non-isotopic samples confirmed the presence of cytosine (C(4)H(5)N(3)O), uracil (C(5)H(4)N(2)O(2)), thymine (C(5)H(6)N(2)O(2)), guanine (C(5)H(5)N(5)O), glycine (C(2)H(5)NO(2)), and alanine (C(3)H(7)NO(2)). Adenine (C(5)H(5)N(5)) was detected by GC-MS in isotopically labeled samples. The remaining prebiotic molecules were detected in unlabeled samples only and may have been affected by contamination in the chamber. These results demonstrate that prebiotic molecules can be formed by the high-energy chemistry similar to that which occurs in planetary upper atmospheres and therefore identifies a new source of prebiotic material, potentially increasing the range of planets where life could begin.

  4. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  5. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  7. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

    Science.gov (United States)

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

    2016-01-01

    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

  8. Spectroscopic (UV/VIS, Raman and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

    Directory of Open Access Journals (Sweden)

    Seyedeh Maryam Banihashemian

    Full Text Available Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100, is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT. As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

  9. Electron transfer from nucleobase electron adducts to 5-bromouracil. Is guanine an ultimate sink for the electron in irradiated DNA?

    International Nuclear Information System (INIS)

    Nese, C.; Yuan, Z.; Schuchmann, M.N.; Sonntag, C. von

    1992-01-01

    Electron transfer to 5-bromouracil (5-BrU) from nucleobase (N) electron adducts (and their protonated forms) has been studied by product analysis and pulse radiolysis. When an electron is transferred to 5-BrU, the ensuing 5-BrU radical anion rapidly loses a bromide ion; the uracilyl radical thus formed reacts with added t-butanol, yielding uracil. From the uracil yields measured as the function of [N]/[5-BrU] after γ-radiolysis of Ar-saturated solutions it is concluded that thymine and adenine electron adducts and their heteroatom-protonated forms transfer electrons quantitatively to 5-BrU. The data raise the question whether in DNA the guanine moiety may act as the ultimate sink of the electron in competition with other processes such as protonation at C(6) of the thymine electron adduct. (Author)

  10. Estrogen Repression of MicroRNAs Is Associated with High Guanine Content in the Terminal Loop Sequences of Their Precursors

    Directory of Open Access Journals (Sweden)

    Amit Cohen

    2017-08-01

    Full Text Available Widespread microRNA (miRNA repression is a phenomenon observed in mammals after exposure to cigarette smoke and in many types of cancer. A comprehensive reduction in miRNA expression after treatment with the hormone estrogen has also previously been described. Here, we reveal a conserved association of miRNA downregulation after estrogen exposure in zebrafish, mouse, and human breast cancer cell line, with a high guanine content in the terminal loop sequences of their precursors, and offer a possible link between estrogen-related miRNA-adducts formation and carcinogenesis. We also show common gene expression patterns shared by breast cancer tumors and estrogen-treated zebrafish, suggesting that this organism can be used as a powerful model system for the study of human breast cancer.

  11. Magnetically-assembled micro/mesopixels exhibiting light intensity enhancement in the (012) planes of fish guanine crystals

    Science.gov (United States)

    Chikashige, T.; Iwasaka, M.

    2018-05-01

    In this study, a new method was investigated to form light-reflecting dots at the micrometer scale using the magnetic orientations of biogenic guanine crystals obtained from fish skin and scales. The crystal platelets, possessing average dimensions of 5 μm×20 μm×100 nm, were dispersed in water and observed during exposure to vertical magnetic fields up to 5 T. The magnetic field direction was parallel to Earth's gravity, and allowed the narrowest edges of the crystals to be observed at the micrometer scale for the first time. The magnetic orientation process was initiated under conditions where the crystal platelets in water were laid on a glass substrate or where the platelets had random orientations. In the former case, the crystal platelets followed a two-stage magnetic orientation process where, in the first step, the platelet widths were aligned in the magnetic field direction. The second step required rotation of the ˜20-μm-long plates with respect to the Earth's gravity, where application of a 5 T magnetic field enabled their orientation. Real-time images of the magnetically aligning platelets provided new evidence that the crystal platelets also emitted reflected light from a very narrow window at two crystal planes (i.e., (0 1 ¯ 2 ¯ ) and (0 1 ¯ 2 )). In the latter case with random platelet orientation, spatially-condensed light-reflecting dots appeared while the guanine crystal platelets were floating and maintaining their orientation. The technique developed for controlling light-reflecting microscale objects in an aqueous medium can be applied to produce a type of microfluidic optical tool.

  12. Magnetically-assembled micro/mesopixels exhibiting light intensity enhancement in the (012 planes of fish guanine crystals

    Directory of Open Access Journals (Sweden)

    T. Chikashige

    2018-05-01

    Full Text Available In this study, a new method was investigated to form light-reflecting dots at the micrometer scale using the magnetic orientations of biogenic guanine crystals obtained from fish skin and scales. The crystal platelets, possessing average dimensions of 5 μm×20 μm×100 nm, were dispersed in water and observed during exposure to vertical magnetic fields up to 5 T. The magnetic field direction was parallel to Earth’s gravity, and allowed the narrowest edges of the crystals to be observed at the micrometer scale for the first time. The magnetic orientation process was initiated under conditions where the crystal platelets in water were laid on a glass substrate or where the platelets had random orientations. In the former case, the crystal platelets followed a two-stage magnetic orientation process where, in the first step, the platelet widths were aligned in the magnetic field direction. The second step required rotation of the ∼20-μm-long plates with respect to the Earth’s gravity, where application of a 5 T magnetic field enabled their orientation. Real-time images of the magnetically aligning platelets provided new evidence that the crystal platelets also emitted reflected light from a very narrow window at two crystal planes (i.e., (01¯2¯ and (01¯2. In the latter case with random platelet orientation, spatially-condensed light-reflecting dots appeared while the guanine crystal platelets were floating and maintaining their orientation. The technique developed for controlling light-reflecting microscale objects in an aqueous medium can be applied to produce a type of microfluidic optical tool.

  13. A Steric-inhibition model for regulation of nucleotide exchange via the Dock180 family of GEFs.

    Science.gov (United States)

    Lu, Mingjian; Kinchen, Jason M; Rossman, Kent L; Grimsley, Cynthia; Hall, Matthew; Sondek, John; Hengartner, Michael O; Yajnik, Vijay; Ravichandran, Kodi S

    2005-02-22

    CDM (CED-5, Dock180, Myoblast city) family members have been recently identified as novel, evolutionarily conserved guanine nucleotide exchange factors (GEFs) for Rho-family GTPases . They regulate multiple processes, including embryonic development, cell migration, apoptotic-cell engulfment, tumor invasion, and HIV-1 infection, in diverse model systems . However, the mechanism(s) of regulation of CDM proteins has not been well understood. Here, our studies on the prototype member Dock180 reveal a steric-inhibition model for regulating the Dock180 family of GEFs. At basal state, the N-terminal SH3 domain of Dock180 binds to the distant catalytic Docker domain and negatively regulates the function of Dock180. Further studies revealed that the SH3:Docker interaction sterically blocks Rac access to the Docker domain. Interestingly, ELMO binding to the SH3 domain of Dock180 disrupted the SH3:Docker interaction, facilitated Rac access to the Docker domain, and contributed to the GEF activity of the Dock180/ELMO complex. Additional genetic rescue studies in C. elegans suggested that the regulation of the Docker-domain-mediated GEF activity by the SH3 domain and its adjoining region is evolutionarily conserved. This steric-inhibition model may be a general mechanism for regulating multiple SH3-domain-containing Dock180 family members and may have implications for a variety of biological processes.

  14. Structure of the nucleotide exchange factor eIF2B reveals mechanism of memory-enhancing molecule.

    Science.gov (United States)

    Tsai, Jordan C; Miller-Vedam, Lakshmi E; Anand, Aditya A; Jaishankar, Priyadarshini; Nguyen, Henry C; Renslo, Adam R; Frost, Adam; Walter, Peter

    2018-03-30

    Regulation by the integrated stress response (ISR) converges on the phosphorylation of translation initiation factor eIF2 in response to a variety of stresses. Phosphorylation converts eIF2 from a substrate to a competitive inhibitor of its dedicated guanine nucleotide exchange factor, eIF2B, thereby inhibiting translation. ISRIB, a drug-like eIF2B activator, reverses the effects of eIF2 phosphorylation, and in rodents it enhances cognition and corrects cognitive deficits after brain injury. To determine its mechanism of action, we solved an atomic-resolution structure of ISRIB bound in a deep cleft within decameric human eIF2B by cryo-electron microscopy. Formation of fully active, decameric eIF2B holoenzyme depended on the assembly of two identical tetrameric subcomplexes, and ISRIB promoted this step by cross-bridging a central symmetry interface. Thus, regulation of eIF2B assembly emerges as a rheostat for eIF2B activity that tunes translation during the ISR and that can be further modulated by ISRIB. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  15. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  16. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  17. The N54-αs Mutant Has Decreased Affinity for βγ and Suggests a Mechanism for Coupling Heterotrimeric G Protein Nucleotide Exchange with Subunit Dissociation.

    Science.gov (United States)

    Cleator, John H; Wells, Christopher A; Dingus, Jane; Kurtz, David T; Hildebrandt, John D

    2018-05-01

    Ser54 of G s α binds guanine nucleotide and Mg 2+ as part of a conserved sequence motif in GTP binding proteins. Mutating the homologous residue in small and heterotrimeric G proteins generates dominant-negative proteins, but by protein-specific mechanisms. For α i/o , this results from persistent binding of α to βγ , whereas for small GTP binding proteins and α s this results from persistent binding to guanine nucleotide exchange factor or receptor. This work examined the role of βγ interactions in mediating the properties of the Ser54-like mutants of G α subunits. Unexpectedly, WT- α s or N54- α s coexpressed with α 1B -adrenergic receptor in human embryonic kidney 293 cells decreased receptor stimulation of IP3 production by a cAMP-independent mechanism, but WT- α s was more effective than the mutant. One explanation for this result would be that α s , like Ser47 α i/o , blocks receptor activation by sequestering βγ ; implying that N54- α S has reduced affinity for βγ since it was less effective at blocking IP3 production. This possibility was more directly supported by the observation that WT- α s was more effective than the mutant in inhibiting βγ activation of phospholipase C β 2. Further, in vitro synthesized N54- α s bound biotinylated- βγ with lower apparent affinity than did WT- α s The Cys54 mutation also decreased βγ binding but less effectively than N54- α s Substitution of the conserved Ser in α o with Cys or Asn increased βγ binding, with the Cys mutant being more effective. This suggests that Ser54 of α s is involved in coupling changes in nucleotide binding with altered subunit interactions, and has important implications for how receptors activate G proteins. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

  18. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  19. Removal of oxygen free-radical-induced 5′,8-purine cyclodeoxynucleosides from DNA by the nucleotide excision-repair pathway in human cells

    Science.gov (United States)

    Kuraoka, Isao; Bender, Christina; Romieu, Anthony; Cadet, Jean; Wood, Richard D.; Lindahl, Tomas

    2000-01-01

    Exposure of cellular DNA to reactive oxygen species generates several classes of base lesions, many of which are removed by the base excision-repair pathway. However, the lesions include purine cyclodeoxynucleoside formation by intramolecular crosslinking between the C-8 position of adenine or guanine and the 5′ position of 2-deoxyribose. This distorting form of DNA damage, in which the purine is attached by two covalent bonds to the sugar-phosphate backbone, occurs as distinct diastereoisomers. It was observed here that both diastereoisomers block primer extension by mammalian and microbial replicative DNA polymerases, using DNA with a site-specific purine cyclodeoxynucleoside residue as template, and consequently appear to be cytotoxic lesions. Plasmid DNA containing either the 5′R or 5′S form of 5′,8-cyclo-2-deoxyadenosine was a substrate for the human nucleotide excision-repair enzyme complex. The R diastereoisomer was more efficiently repaired than the S isomer. No correction of the lesion by direct damage reversal or base excision repair was detected. Dual incision around the lesion depended on the core nucleotide excision-repair protein XPA. In contrast to several other types of oxidative DNA damage, purine cyclodeoxynucleosides are chemically stable and would be expected to accumulate at a slow rate over many years in the DNA of nonregenerating cells from xeroderma pigmentosum patients. High levels of this form of DNA damage might explain the progressive neurodegeneration seen in XPA individuals. PMID:10759556

  20. A computational study of a recreated G protein-GEF reaction intermediate competent for nucleotide exchange: fate of the Mg ion.

    Directory of Open Access Journals (Sweden)

    Mériam Ben Hamida-Rebaï

    Full Text Available Small G-proteins of the superfamily Ras function as molecular switches, interacting with different cellular partners according to their activation state. G-protein activation involves the dissociation of bound GDP and its replacement by GTP, in an exchange reaction that is accelerated and regulated in the cell by guanine-nucleotide exchange factors (GEFs. Large conformational changes accompany the exchange reaction, and our understanding of the mechanism is correspondingly incomplete. However, much knowledge has been derived from structural studies of blocked or inactive mutant GEFs, which presumably closely represent intermediates in the exchange reaction and yet which are by design incompetent for carrying out the nucleotide exchange reaction. In this study we have used comparative modelling to recreate an exchange-competent form of a late, pre-GDP-ejection intermediate species in Arf1, a well-characterized small G-protein. We extensively characterized three distinct models of this intermediate using molecular dynamics simulations, allowing us to address ambiguities related to the mutant structural studies. We observed in particular the unfavorable nature of Mg2+ associated forms of the complex and the establishment of closer Arf1-GEF contacts in its absence. The results of this study shed light on GEF-mediated activation of this small G protein and on predicting the fate of the Mg ion at a critical point in the exchange reaction. The structural models themselves furnish additional targets for interfacial inhibitor design, a promising direction for exploring potentially druggable targets with high biological specificity.

  1. Stable isotope labeling-mass spectrometry analysis of methyl- and pyridyloxobutyl-guanine adducts of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone in p53-derived DNA sequences.

    Science.gov (United States)

    Rajesh, Mathur; Wang, Gang; Jones, Roger; Tretyakova, Natalia

    2005-02-15

    The p53 tumor suppressor gene is a primary target in smoking-induced lung cancer. Interestingly, p53 mutations observed in lung tumors of smokers are concentrated at guanine bases within endogenously methylated (Me)CG dinucleotides, e.g., codons 157, 158, 245, 248, and 273 ((Me)C = 5-methylcytosine). One possible mechanism for the increased mutagenesis at these sites involves targeted binding of metabolically activated tobacco carcinogens to (Me)CG sequences. In the present work, a stable isotope labeling HPLC-ESI(+)-MS/MS approach was employed to analyze the formation of guanine lesions induced by the tobacco-specific lung carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) within DNA duplexes representing p53 mutational "hot spots" and surrounding sequences. Synthetic DNA duplexes containing p53 codons 153-159, 243-250, and 269-275 were prepared, where (Me)C was incorporated at all physiologically methylated CG sites. In each duplex, one of the guanine bases was replaced with [1,7,NH(2)-(15)N(3)-2-(13)C]-guanine, which served as an isotope "tag" to enable specific quantification of guanine lesions originating from that position. After incubation with NNK diazohydroxides, HPLC-ESI(+)-MS/MS analysis was used to determine the yields of NNK adducts at the isotopically labeled guanine and at unlabeled guanine bases elsewhere in the sequence. We found that N7-methyl-2'-deoxyguanosine and N7-[4-oxo-4-(3-pyridyl)but-1-yl]guanine lesions were overproduced at the 3'-guanine bases within polypurine runs, while the formation of O(6)-methyl-2'-deoxyguanosine and O(6)-[4-oxo-4-(3-pyridyl)but-1-yl]-2'-deoxyguanosine adducts was specifically preferred at the 3'-guanine base of 5'-GG and 5'-GGG sequences. In contrast, the presence of 5'-neighboring (Me)C inhibited O(6)-guanine adduct formation. These results indicate that the N7- and O(6)-guanine adducts of NNK are not overproduced at the endogenously methylated CG dinucleotides within the p53 tumor suppressor gene

  2. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  3. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  4. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  5. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  6. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  7. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.

    1990-01-01

    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  8. Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence.

    Science.gov (United States)

    Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L; Embrey, Kevin J; Golovanov, Alexander P

    2016-01-22

    The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly (15)N-labeled Ras as well as [(13)C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  10. Human T cell recognition of the blood stage antigen Plasmodium hypoxanthine guanine xanthine phosphoribosyl transferase (HGXPRT in acute malaria

    Directory of Open Access Journals (Sweden)

    Woodberry Tonia

    2009-06-01

    Full Text Available Abstract Background The Plasmodium purine salvage enzyme, hypoxanthine guanine xanthine phosphoribosyl transferase (HGXPRT can protect mice against Plasmodium yoelii pRBC challenge in a T cell-dependent manner and has, therefore, been proposed as a novel vaccine candidate. It is not known whether natural exposure to Plasmodium falciparum stimulates HGXPRT T cell reactivity in humans. Methods PBMC and plasma collected from malaria-exposed Indonesians during infection and 7–28 days after anti-malarial therapy, were assessed for HGXPRT recognition using CFSE proliferation, IFNγ ELISPOT assay and ELISA. Results HGXPRT-specific T cell proliferation was found in 44% of patients during acute infection; in 80% of responders both CD4+ and CD8+ T cell subsets proliferated. Antigen-specific T cell proliferation was largely lost within 28 days of parasite clearance. HGXPRT-specific IFN-γ production was more frequent 28 days after treatment than during acute infection. HGXPRT-specific plasma IgG was undetectable even in individuals exposed to malaria for at least two years. Conclusion The prevalence of acute proliferative and convalescent IFNγ responses to HGXPRT demonstrates cellular immunogenicity in humans. Further studies to determine minimal HGXPRT epitopes, the specificity of responses for Plasmodia and associations with protection are required. Frequent and robust T cell proliferation, high sequence conservation among Plasmodium species and absent IgG responses distinguish HGXPRT from other malaria antigens.

  11. Effect of ionic strength and cationic DNA affinity binders on the DNA sequence selective alkylation of guanine N7-positions by nitrogen mustards

    International Nuclear Information System (INIS)

    Hartley, J.A.; Forrow, S.M.; Souhami, R.L.

    1990-01-01

    Large variations in alkylation intensities exist among guanines in a DNA sequence following treatment with chemotherapeutic alkylating agents such as nitrogen mustards, and the substituent attached to the reactive group can impose a distinct sequence preference for reaction. In order to understand further the structural and electrostatic factors which determine the sequence selectivity of alkylation reactions, the effect of increase ionic strength, the intercalator ethidium bromide, AT-specific minor groove binders distamycin A and netropsin, and the polyamine spermine on guanine N7-alkylation by L-phenylalanine mustard (L-Pam), uracil mustard (UM), and quinacrine mustard (QM) was investigated with a modification of the guanine-specific chemical cleavage technique for DNA sequencing. The result differed with both the nitrogen mustard and the cationic agent used. The effect, which resulted in both enhancement and suppression of alkylation sites, was most striking in the case of netropsin and distamycin A, which differed from each other. DNA footprinting indicated that selective binding to AT sequences in the minor groove of DNA can have long-range effects on the alkylation pattern of DNA in the major groove

  12. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  13. The possible role of human milk nucleotides as sleep inducers.

    Science.gov (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  14. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  15. Oxidative generation of guanine radicals by carbonate radicals and their reactions with nitrogen dioxide to form site specific 5-guanidino-4-nitroimidazole lesions in oligodeoxynucleotides.

    Science.gov (United States)

    Joffe, Avrum; Mock, Steven; Yun, Byeong Hwa; Kolbanovskiy, Alexander; Geacintov, Nicholas E; Shafirovich, Vladimir

    2003-08-01

    A simple photochemical approach is described for synthesizing site specific, stable 5-guanidino-4-nitroimidazole (NIm) adducts in single- and double-stranded oligodeoxynucleotides containing single and multiple guanine residues. The DNA sequences employed, 5'-d(ACC CG(1)C G(2)TC CG(3)C G(4)CC) and 5'-d(ACC CG(1)C G(2)TC C), were a portion of exon 5 of the p53 tumor suppressor gene, including the codons 157 (G(2)) and 158 (G(3)) mutation hot spots in the former sequence with four Gs and the codon 157 (G(2)) mutation hot spot in the latter sequence with two Gs. The nitration of oligodeoxynucleotides was initiated by the selective photodissociation of persulfate anions to sulfate radicals induced by UV laser pulses (308 nm). In aqueous solutions, of bicarbonate and nitrite anions, the sulfate radicals generate carbonate anion radicals and nitrogen dioxide radicals by one electron oxidation of the respective anions. The guanine residue in the oligodeoxynucleotide is oxidized by the carbonate anion radical to form the neutral guanine radical. While the nitrogen dioxide radicals do not react with any of the intact DNA bases, they readily combine with the guanine radicals at either the C8 or the C5 positions. The C8 addition generates the well-known 8-nitroguanine (8-nitro-G) lesions, whereas the C5 attack produces unstable adducts, which rapidly decompose to NIm lesions. The maximum yields of the nitro products (NIm + 8-nitro-G) were typically in the range of 20-40%, depending on the number of guanine residues in the sequence. The ratio of the NIm to 8-nitro-G lesions gradually decreases from 3.4 in the model compound, 2',3',5'-tri-O-acetylguanosine, to 2.1-2.6 in the single-stranded oligodeoxynucleotides and to 0.8-1.1 in the duplexes. The adduct of the 5'-d(ACC CG(1)C G(2)TC C) oligodeoxynucleotide containing the NIm lesion in codon 157 (G(2)) was isolated in HPLC-pure form. The integrity of this adduct was established by a detailed analysis of exonuclease digestion

  16. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  17. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  18. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  19. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  20. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

    2011-07-01

    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  2. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  3. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    Science.gov (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Receptor binding of somatostatin-14 and somatostatin-28 in rat brain: differential modulation by nucleotides and ions.

    Science.gov (United States)

    Srikant, C B; Dahan, A; Craig, C

    1990-02-04

    The tissue-selective binding of the two principal bioactive forms of somatostatin, somatostatin-14 (SS-14) and somatostatin-28 (SS-28), their ability to modulate cAMP-dependent and -independent regulation of post-receptor events to different degrees and the documentation of specific labelling of SS receptor subtypes with SS-28 but not SS-14 in discrete regions of rat brain suggest the existence of distinct SS-14 and SS-28 binding sites. Receptor binding of SS-14 ligands has been shown to be modulated by nucleotides and ions, but the effect of these agents on SS-28 binding has not been studied. In the present study we investigated the effects of adenine and guanine nucleotides as well as monovalent and divalent cations on rat brain SS receptors quantitated with radioiodinated analogs of SS-14 ([125I-Tyr11]SS14, referred to in this paper as SS-14) and SS-28 ([Leu8, D-Trp22, 125I-Tyr25] SS-28, referred to as LTT* SS-28) in order to determine if distinct receptor sites for SS-14 and SS-28 could be distinguished on the basis of their modulation by nucleotides and ions. GTP as well as ATP exerted a dose-dependent inhibition (over a concentration range of 10(-7)-10(-3) M) of the binding of the two radioligands. The nucleotide inhibition of binding resulted in a decrease the Bmax of the SS receptors, the binding affinity remaining unaltered. GTP (10(-4) M) decreased the Bmax of LTT* SS-28 binding sites to a greater extent than ATP (145 +/- 10 and 228 +/- 16 respectively, compared to control value of 320 +/- 20 pmol mg-1). Under identical conditions GTP was less effective than ATP in reducing the number of T* SS-14 binding sites (Bmax = 227 +/- 8 and 182 +/- 15, respectively, compared to 340 +/- 15 pmol mg-1 in the absence of nucleotides). Monovalent cations inhibited the binding of both radioligands, Li+ and Na+ inhibited the binding of T* SS-14 to a greater extent than K+. The effect of divalent cations on the other hand was varied. At low concentration (2 mM) Mg2+, Ba2

  5. Modulation of B-cell receptor and microenvironment signaling by a guanine exchange factor in B-cell malignancies

    International Nuclear Information System (INIS)

    Liao, Wei; Sharma, Sanjai

    2016-01-01

    Objective: Chronic lymphocytic leukemia (CLL) and mantle cell lymphoma (MCL) cells over-express a guanine exchange factor (GEF), Rasgrf-1. This GEF increases active Ras as it catalyzes the removal of GDP from Ras so that GTP can bind and activate Ras. This study aims to study the mechanism of action of Rasgrf-1 in B-cell malignancies. Methods: N-terminus truncated Rasgrf-1 variants have a higher GEF activity as compared to the full-length transcript therefore a MCL cell line with stable over-expression of truncated Rasgrf-1 was established. The B-cell receptor (BCR) and chemokine signaling pathways were compared in the Rasgrf-1 over-expressing and a control transfected cell line. Results: Cells over-expressing truncated form of Rasgrf-1 have a higher proliferative rate as compared to control transfected cells. BCR was activated by lower concentrations of anti-IgM antibody in Rasgrf-1 over-expressing cells as compared to control cells indicating that these cells are more sensitive to BCR signaling. BCR signaling also phosphorylates Rasgrf-1 that further increases its GEF function and amplifies BCR signaling. This activation of Rasgrf-1 in over-expressing cells resulted in a higher expression of phospho-ERK, AKT, BTK and PKC-alpha as compared to control cells. Besides BCR, Rasgrf-1 over-expressing cells were also more sensitive to microenvironment stimuli as determined by resistance to apoptosis, chemotaxis and ERK pathway activation. Conclusions: This GEF protein sensitizes B-cells to BCR and chemokine mediated signaling and also upregulates a number of other signaling pathways which promotes growth and survival of these cells

  6. Localization of the 5-phospho-alpha-D-ribosyl-1-pyrophosphate binding site of human hypoxanthine-guanine phosphoribosyltransferase.

    Science.gov (United States)

    Keough, D T; Emmerson, B T; de Jersey, J

    1991-02-22

    Human erythrocyte hypoxanthine-guanine phosphoribosyltransferase (HPRT) is inactivated by iodoacetate in the absence, but not in the presence, of the substrate, 5-phospho-alpha-D-ribosyl-1-pyrophosphate (PRib-PP). Treatment of HPRT with [14C]iodoacetate followed by tryptic digestion, peptide separation and sequencing has shown that Cys-22 reacts with iodoacetate only in the absence of PRib-PP; this strongly suggests that Cys-22 is in or near the PRib-PP binding site. In contrast, Cys-105 reacts with [14C]iodoacetate both in the presence and absence of PRib-PP. Carboxymethylation of Cys-22 resulted in an increase in the Km for PRib-PP, but no change in Vmax. Storage of HPRT also resulted in an increase in the Km for PRib-PP and a decrease in its susceptibility to inactivation by iodoacetate. Dialysis of stored enzyme against 1 mM dithiothreitol resulted in a marked decrease in Km for PRib-PP. The stoichiometry of the reaction of [14C]iodoacetate with Cys-22 in HPRT leading to inactivation (approx. 1 residue modified per tetramer) showed that, in this preparation of HPRT purified from erythrocytes, only about 25% of the Cys-22 side chains were present as free and accessible thiols. Titration of thiol groups [with 5,5'-dithiobis(2-nitrobenzoic acid)] and the effect of dithiothreitol on Km for PRib-PP indicate that oxidation of thiol groups occurs on storage of HPRT, even in the presence of 1 mM beta-mercaptoethanol.

  7. Increased PRPP synthetase activity in cultured rat hepatoma cells containing mutations in the hypoxanthine-guanine phosphoribosyltransferase gene.

    Science.gov (United States)

    Graf, L H; McRoberts, J A; Harrison, T M; Martin, D W

    1976-07-01

    Nine independently derived clones of mutagenized rat hepatoma cells selected for resistance to 6-mercaptopurine (6-MP) or 6-thioguanine (6-ThioG) have been isolated. Each has severely reduced catalytic activity of hypoxanthine-guanine phosphoribosyltransferase (HPRT) and seven of them possess significantly increased activities of phosphoribosylpyrophosphate (PRPP) synthetase. The degrees of elevations of PRPP synthetase activities do not correlate with the degrees of deficiencies of HPRT activities. The cells from one of these clones, 1020/12, posses 40% of the normal HPRT catalytic activity and overproduce purines. We have extensively examined the cells from this clone. Immunotration studies of 1020/12 cells indicate that there is a mutation in the structural gene for HPRT. Although they possess increased specific catalytic activities of the enzyme. PRPP synthetase, the catalytic parameters, heat stability, and isoelectric pH of PRPP synthetase from 1020/12 cells are indistinguishable from those of the enzyme from wild-type cells. The cause of purine overproduction by 1020/12 cells appears to be the elevated PRPP synthetase activity, rather than a PRPP "sparing" effect stemming from reduced HPRT activity. Support for this idea is provided by the observation that the complete loss of HPRT activity in a clone derived from 1020/12 cells does not further enhance the levels of PRPP synthetase or purine overproduction. We propose that the elevated levels of PRPP synthetase activity in these HPRT deficient cells result from a mutational event in the structural gene for HPRT, and that this causes the disruption of a previously undescribed regulatory function of this gene on the expression of the PRPP synthetase gene.

  8. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  9. Investigation of specificity determinants in bacterial tRNA-guanine transglycosylase reveals queuine, the substrate of its eucaryotic counterpart, as inhibitor.

    Directory of Open Access Journals (Sweden)

    Inna Biela

    Full Text Available Bacterial tRNA-guanine transglycosylase (Tgt catalyses the exchange of the genetically encoded guanine at the wobble position of tRNAs(His,Tyr,Asp,Asn by the premodified base preQ1, which is further converted to queuine at the tRNA level. As eucaryotes are not able to synthesise queuine de novo but acquire it through their diet, eucaryotic Tgt directly inserts the hypermodified base into the wobble position of the tRNAs mentioned above. Bacterial Tgt is required for the efficient pathogenicity of Shigella sp, the causative agent of bacillary dysentery and, hence, it constitutes a putative target for the rational design of anti-Shigellosis compounds. Since mammalian Tgt is known to be indirectly essential to the conversion of phenylalanine to tyrosine, it is necessary to create substances which only inhibit bacterial but not eucaryotic Tgt. Therefore, it seems of utmost importance to study selectivity-determining features within both types of proteins. Homology models of Caenorhabditis elegans Tgt and human Tgt suggest that the replacement of Cys158 and Val233 in bacterial Tgt (Zymomonas mobilis Tgt numbering by valine and accordingly glycine in eucaryotic Tgt largely accounts for the different substrate specificities. In the present study we have created mutated variants of Z. mobilis Tgt in order to investigate the impact of a Cys158Val and a Val233Gly exchange on catalytic activity and substrate specificity. Using enzyme kinetics and X-ray crystallography, we gained evidence that the Cys158Val mutation reduces the affinity to preQ1 while leaving the affinity to guanine unaffected. The Val233Gly exchange leads to an enlarged substrate binding pocket, that is necessary to accommodate queuine in a conformation compatible with the intermediately covalently bound tRNA molecule. Contrary to our expectations, we found that a priori queuine is recognised by the binding pocket of bacterial Tgt without, however, being used as a substrate.

  10. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  11. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  12. The effect of S-substitution at the O6-guanine site on the structure and dynamics of a DNA oligomer containing a G:T mismatch.

    Directory of Open Access Journals (Sweden)

    Elaine Ann Moore

    Full Text Available The effect of S-substitution on the O6 guanine site of a 13-mer DNA duplex containing a G:T mismatch is studied using molecular dynamics. The structure, dynamic evolution and hydration of the S-substituted duplex are compared with those of a normal duplex, a duplex with S-substitution on guanine, but no mismatch and a duplex with just a G:T mismatch. The S-substituted mismatch leads to cell death rather than repair. One suggestion is that the G:T mismatch recognition protein recognises the S-substituted mismatch (GS:T as G:T. This leads to a cycle of futile repair ending in DNA breakage and cell death. We find that some structural features of the helix are similar for the duplex with the G:T mismatch and that with the S-substituted mismatch, but differ from the normal duplex, notably the helical twist. These differences arise from the change in the hydrogen-bonding pattern of the base pair. However a marked feature of the S-substituted G:T mismatch duplex is a very large opening. This showed considerable variability. It is suggested that this enlarged opening would lend support to an alternative model of cell death in which the mismatch protein attaches to thioguanine and activates downstream damage-response pathways. Attack on the sulphur by reactive oxygen species, also leading to cell death, would also be aided by the large, variable opening.

  13. Decrease in Survival Rate of Colorectal Cancer Patients Due to Insertion of a Single Guanine Base in Promoter Sequences of Matrix Metalloproteinase-1 Gene (in Tehran Population

    Directory of Open Access Journals (Sweden)

    Z Hojati

    2009-01-01

    Full Text Available Introduction: Insertion or deletion of a guanine in -1607 at promoter region of matrix metalloproteinase-1 enzyme creates two allelic types for this gene in the population: 2G and 1G, respectively. 2G allele contains an extra binding site for ETS transcription factors that this may increase the level of gene expression. Therefore, aim of this study was investigation of the single Guanine insertion in the promoter gene and its association with colorectal cancer patient survival rate and tumor progression. Methods: Blood samples from 150 colorectal patients and 100 cases were extracted. The mean follow-up was 25 months (12-36 months. Cases and patients were genotyped using genomic DNA extraction and PCR-RFLP. Results: Colorectal cancer patients were divided in two groups; with activity of metastasis (M+ and without activity of metastasis (M-. 2G allele in metastasis group (55% showed more frequency rather than controls (23%. Survival analyses showed that 3 years survival patients rate in the patients without metastasis activity carrying 1G allele (homo and heterozygote was 81% and for 2G homozygote is 66% (p=0.04. The survival rate dependent to cancer was 90% and 71%, respectively (P=0.01. Conclusion: According to the results, it seems that patients carrying 1G allele show a better survival rate dependent on cancer as compared to patients who do not carry this allele.

  14. Causes and consequences of plant radio-resistance. Formation of DNA basis lesions and self-repairing activity of one of them, the 8-oxo-7,8-dihydro-guanine in Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Dany, A.L.

    2001-01-01

    In this research thesis, the author first explains how and why DNA is injured when it is submitted to an oxidizing stress, and describes precisely the formation and the biological consequences of lesions of DNA bases, the 8-oxo-7,8-dihydro-guanine (8-oxoGua). She describes the repairing activities of the oxidized DNA, and more particularly the repairing of 8-oxoGua, in prokaryotes as well as in yeast, mammals and plants. Methodologies used are described, together with the repair activities of the 8-oxo-7,8-dihydro-guanine following a biochemical type approach and a molecular biology approach

  15. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  16. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  17. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  18. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.

    1980-01-01

    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  19. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  20. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

    1997-01-01

    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  1. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  2. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  3. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  4. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  5. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  6. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  7. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  8. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  9. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  10. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  11. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  12. Identification of the Structural Features of Guanine Derivatives as MGMT Inhibitors Using 3D-QSAR Modeling Combined with Molecular Docking

    Directory of Open Access Journals (Sweden)

    Guohui Sun

    2016-06-01

    Full Text Available DNA repair enzyme O6-methylguanine-DNA methyltransferase (MGMT, which plays an important role in inducing drug resistance against alkylating agents that modify the O6 position of guanine in DNA, is an attractive target for anti-tumor chemotherapy. A series of MGMT inhibitors have been synthesized over the past decades to improve the chemotherapeutic effects of O6-alkylating agents. In the present study, we performed a three-dimensional quantitative structure activity relationship (3D-QSAR study on 97 guanine derivatives as MGMT inhibitors using comparative molecular field analysis (CoMFA and comparative molecular similarity indices analysis (CoMSIA methods. Three different alignment methods (ligand-based, DFT optimization-based and docking-based alignment were employed to develop reliable 3D-QSAR models. Statistical parameters derived from the models using the above three alignment methods showed that the ligand-based CoMFA (Qcv2 = 0.672 and Rncv2 = 0.997 and CoMSIA (Qcv2 = 0.703 and Rncv2 = 0.946 models were better than the other two alignment methods-based CoMFA and CoMSIA models. The two ligand-based models were further confirmed by an external test-set validation and a Y-randomization examination. The ligand-based CoMFA model (Qext2 = 0.691, Rpred2 = 0.738 and slope k = 0.91 was observed with acceptable external test-set validation values rather than the CoMSIA model (Qext2 = 0.307, Rpred2 = 0.4 and slope k = 0.719. Docking studies were carried out to predict the binding modes of the inhibitors with MGMT. The results indicated that the obtained binding interactions were consistent with the 3D contour maps. Overall, the combined results of the 3D-QSAR and the docking obtained in this study provide an insight into the understanding of the interactions between guanine derivatives and MGMT protein, which will assist in designing novel MGMT inhibitors with desired activity.

  13. From lin-Benzoguanines to lin-Benzohypoxanthines as Ligands for Zymomonas mobilis tRNA-Guanine Transglycosylase: Replacement of Protein-Ligand Hydrogen Bonding by Importing Water Clusters.

    NARCIS (Netherlands)

    Barandun, L.J.; Immekus, F.; Kohler, P.C.; Tonazzi, S.; Wagner, B.; Wendelspiess, S.; Ritschel, T.; Heine, A.; Kansy, M.; Klebe, G.; Diederich, F.

    2012-01-01

    The foodborne illness shigellosis is caused by Shigella bacteria that secrete the highly cytotoxic Shiga toxin, which is also formed by the closely related enterohemorrhagic Escherichia coli (EHEC). It has been shown that tRNA-guanine transglycosylase (TGT) is essential for the pathogenicity of

  14. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  15. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  16. Relative Stability of the La and Lb Excited States in Adenine and Guanine: Direct Evidence from TD-DFT Calculations of MCD Spectra.

    Science.gov (United States)

    Santoro, Fabrizio; Improta, Roberto; Fahleson, Tobias; Kauczor, Joanna; Norman, Patrick; Coriani, Sonia

    2014-06-05

    The relative position of La and Lb ππ* electronic states in purine nucleobases is a much debated topic, since it can strongly affect our understanding of their photoexcited dynamics. To assess this point, we calculated the absorption and magnetic circular dichroism (MCD) spectra of adenine, guanine, and their nucleosides in gas-phase and aqueous solution, exploiting recent developments in MCD computational technology within time-dependent density functional theory. MCD spectroscopy allows us to resolve the intense S0→ La transition from the weak S0→ Lb transition. The spectra obtained in water solution, by using B3LYP and CAM-B3LYP functionals and describing solvent effect by cluster models and by the polarizable continuum model (PCM), are in very good agreement with the experimental counterparts, thus providing direct and unambiguous evidence that the energy ordering predicted by TD-DFT, La < Lb, is the correct one.

  17. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  18. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  19. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  20. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  1. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  3. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  4. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.

    1990-01-01

    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  5. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

    2009-01-01

    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  6. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  7. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  9. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  10. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  11. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  12. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  13. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  14. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  15. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  16. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  17. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

    2013-01-01

    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  18. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2018-02-21

    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  19. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  20. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  1. A simplified one-pot synthesis of 9-[(3-[{sup 18}F]Fluoro-1-hydroxy-2-propoxy)methyl]guanine([{sup 18}F]FHPG) and 9-(4-[{sup 18}F]Fluoro-3-hydroxymethylbutyl)guanine ([{sup 18}F]FHBG) for gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Shiue, Grace G.; Shiue, Chyng-Yann E-mail: Shiue@rad.upenn.edu; Lee, Roland L.; MacDonald, Douglas; Hustinx, Roland; Eck, Stephen L.; Alavi, Abass A

    2001-10-01

    9-[(3-[{sup 18}F]Fluoro-1-hydroxy-2-propoxy)methyl]guanine ([{sup 18}F]FHPG, 2) has been synthesized by nucleophilic substitution of N{sup 2}-(p-anisyldiphenylmethyl)-9-{l_brace}[1-(p-anisyldiphenylmethoxy)-3 -toluenesulfonyloxy-2-propoxy]methyl{r_brace}guanine (1) with potassium [{sup 18}F]fluoride/Kryptofix 2.2.2 followed by deprotection with 1 N HCl and purification with different methods in variable yields. When both the nucleophilic substitution and deprotection were carried out at 90 deg. C and the product was purified by HPLC (method A), the yield of compound 2 was 5-10% and the synthesis time was 90 min from EOB. However, if both the nucleophilic substitution and deprotection were carried out at 120 deg. C and the product was purified by HPLC, the yield of compound 2 decreased to 2%. When compound 2 was synthesized at 90 deg. C and purified by Silica Sep-Pak (method B), the yield increased to 10-15% and the synthesis time was 60 min from EOB. Similarly, 9-(4-[{sup 18}F]fluoro-3-hydroxymethylbutyl)guanine ([{sup 18}F]FHBG, 4) was synthesized with method A and method B in 9% and 10-15% yield, respectively, in a synthesis time of 90 and 60 min, respectively, from EOB. Compound 2 was relatively unstable in acidic medium at 120 deg. C while compound 4 was stable under the same condition. Both compound 2 and compound 4 had low lipid/water partition coefficient (0.126{+-}0.022, n=5 and 0.165{+-}0.023, n=5, respectively). Although it contains non-radioactive ganciclovir ({approx}5-30 {mu}g) as a chemical by-product, compound 2 synthesized by method B has a similar uptake in 9L glioma cells as that synthesized by method A, and is a potential tracer for imaging herpes simplex virus thymidine kinase gene expression in tumors using PET. Similarly, compound 4 synthesized by method B contains {approx}10-25 {mu}g of penciclovir as a chemical by-product. Thus, the simplified one pot synthesis (method B) is a useful method for synthesizing both compound 2 and compound 4 in

  2. A simplified one-pot synthesis of 9-[(3-[18F]Fluoro-1-hydroxy-2-propoxy)methyl]guanine([18F]FHPG) and 9-(4-[18F]Fluoro-3-hydroxymethylbutyl)guanine ([18F]FHBG) for gene therapy

    International Nuclear Information System (INIS)

    Shiue, Grace G.; Shiue, Chyng-Yann; Lee, Roland L.; MacDonald, Douglas; Hustinx, Roland; Eck, Stephen L.; Alavi, Abass A.

    2001-01-01

    9-[(3-[ 18 F]Fluoro-1-hydroxy-2-propoxy)methyl]guanine ([ 18 F]FHPG, 2) has been synthesized by nucleophilic substitution of N 2 -(p-anisyldiphenylmethyl)-9-{[1-(p-anisyldiphenylmethoxy)-3 -toluenesulfonyloxy-2-propoxy]methyl}guanine (1) with potassium [ 18 F]fluoride/Kryptofix 2.2.2 followed by deprotection with 1 N HCl and purification with different methods in variable yields. When both the nucleophilic substitution and deprotection were carried out at 90 deg. C and the product was purified by HPLC (method A), the yield of compound 2 was 5-10% and the synthesis time was 90 min from EOB. However, if both the nucleophilic substitution and deprotection were carried out at 120 deg. C and the product was purified by HPLC, the yield of compound 2 decreased to 2%. When compound 2 was synthesized at 90 deg. C and purified by Silica Sep-Pak (method B), the yield increased to 10-15% and the synthesis time was 60 min from EOB. Similarly, 9-(4-[ 18 F]fluoro-3-hydroxymethylbutyl)guanine ([ 18 F]FHBG, 4) was synthesized with method A and method B in 9% and 10-15% yield, respectively, in a synthesis time of 90 and 60 min, respectively, from EOB. Compound 2 was relatively unstable in acidic medium at 120 deg. C while compound 4 was stable under the same condition. Both compound 2 and compound 4 had low lipid/water partition coefficient (0.126±0.022, n=5 and 0.165±0.023, n=5, respectively). Although it contains non-radioactive ganciclovir (∼5-30 μg) as a chemical by-product, compound 2 synthesized by method B has a similar uptake in 9L glioma cells as that synthesized by method A, and is a potential tracer for imaging herpes simplex virus thymidine kinase gene expression in tumors using PET. Similarly, compound 4 synthesized by method B contains ∼10-25 μg of penciclovir as a chemical by-product. Thus, the simplified one pot synthesis (method B) is a useful method for synthesizing both compound 2 and compound 4 in good yield for routine clinical use, and the method is

  3. Multi-level Quantum Mechanics and Molecular Mechanics Study of Ring Opening Process of Guanine Damage by Hydroxyl Radical in Aqueous Solution.

    Science.gov (United States)

    Liu, Peng; Wang, Qiong; Niu, Meixing; Wang, Dunyou

    2017-08-10

    Combining multi-level quantum mechanics theories and molecular mechanics with an explicit water model, we investigated the ring opening process of guanine damage by hydroxyl radical in aqueous solution. The detailed, atomic-level ring-opening mechanism along the reaction pathway was revealed in aqueous solution at the CCSD(T)/MM levels of theory. The potentials of mean force in aqueous solution were calculated at both the DFT/MM and CCSD(T)/MM levels of the theory. Our study found that the aqueous solution has a significant effect on this reaction in solution. In particular, by comparing the geometries of the stationary points between in gas phase and in aqueous solution, we found that the aqueous solution has a tremendous impact on the torsion angles much more than on the bond lengths and bending angles. Our calculated free-energy barrier height 31.6 kcal/mol at the CCSD(T)/MM level of theory agrees well with the one obtained based on gas-phase reaction profile and free energies of solvation. In addition, the reaction path in gas phase was also mapped using multi-level quantum mechanics theories, which shows a reaction barrier at 19.2 kcal/mol at the CCSD(T) level of theory, agreeing very well with a recent ab initio calculation result at 20.8 kcal/mol.

  4. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  5. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  6. Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites.

    Science.gov (United States)

    Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K

    2014-09-01

    Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn∆HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite.

  7. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  8. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  9. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  10. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  11. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  12. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  13. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  14. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  15. Endogenous 5-methylcytosine protects neighboring guanines from N7 and O6-methylation and O6-pyridyloxobutylation by the tobacco carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone.

    Science.gov (United States)

    Ziegel, Rebecca; Shallop, Anthony; Upadhyaya, Pramod; Jones, Roger; Tretyakova, Natalia

    2004-01-20

    All CG dinucleotides along exons 5-8 of the p53 tumor suppressor gene contain endogenous 5-methylcytosine (MeC). These same sites (e.g., codons 157, 158, 245, 248, and 273) are mutational hot spots in smoking-induced lung cancer. Several groups used the UvrABC endonuclease incision assay to demonstrate that methylated CG dinucleotides of the p53 gene are the preferred binding sites for the diol epoxides of bay region polycyclic aromatic hydrocarbons (PAH). In contrast, effects of endogenous cytosine methylation on the distribution of DNA lesions induced by tobacco-specific nitrosamines, e.g., 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), have not been elucidated. In the work presented here, a stable isotope labeling HPLC-ESI-MS/MS approach was employed to analyze the reactivity of the N7 and O6 positions of guanines within hemimethylated and fully methylated CG dinucleotides toward NNK-derived methylating and pyridyloxobutylating species. 15N3-labeled guanine bases were placed within synthetic DNA sequences representing endogenously methylated p53 codons 154, 157, and 248, followed by treatment with acetylated precursors to NNK diazohydroxides. HPLC-ESI-MS/MS analysis was used to determine the relative yields of N7- and O6-guanine adducts at the 15N3-labeled position. In all cases, the presence of MeC inhibited the formation of N7-methylguanine, O6-methylguanine, and O6-pyridyloxobutylguanine at a neighboring G, with the greatest decrease observed in fully methylated dinucleotides and at guanines preceded by MeC. Furthermore, the O6-Me-dG/N7-Me-G molar ratios were decreased in the presence of the 5'-neighboring MeC, suggesting that the observed decline in O6-alkylguanine adduct yields is, at least partially, a result of an altered reactivity pattern in methylated CG dinucleotides. These results indicate that, unlike N2-guanine adducts of PAH diol epoxides, NNK-induced N7- and O6-alkylguanine adducts are not preferentially formed at the endogenously

  16. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  17. Immunostimulation by cytosine-phosphate-guanine oligodeoxynucleotides in combination with IL-2 can improve the success rate of karyotype analysis in chronic lymphocytic leukaemia.

    Science.gov (United States)

    Lin, Xiaolan; Chen, Jiadi; Huang, Huifang

    2016-07-01

    To assess whether immunostimulatory cytosine-phosphate-guanine oligodeoxynucleotides (CpG-ODN) combined with interleukin-2 (IL-2) improves the number of mitotic metaphases and the detection rate of chromosomal abnormalities in chronic lymphocytic leukaemia (CLL). Bone marrow specimens were collected from 36 patients with CLL. CLL cells were cultured with CpG-ODN type DSP30 plus IL-2 for 72 h, following which R-banding analysis was conducted. Conventional culture without the immunostimulant served as the control group. The incidence of genetic abnormalities was measured by fluorescence in situ hybridisation (FISH) using a panel of five specific probes: D13S25 (13q14.3), RB1 (13q14), P53 (17p13), ATM (11q22.3) and CSP12 (trisomy 12, +12). In the control group, chromosome analysis achieved a success rate of only 22.2, and 11.1% of abnormal karyotypes were detected. After immunostimulation with DSP30 plus IL-2, chromosome analysis achieved a success rate of up to 91.6, and 41.6% of abnormal karyotypes were detected. FISH analysis detected 77.7% of abnormalities. FISH combined with CpG-ODN DSP30 plus IL-2 improved the detection rate of chromosomal abnormalities in CLL to 83.3%. CpG-ODN DSP30 combined with IL-2 is effective in improving the detection rate of chromosomal abnormalities in CLL cells. This combination with FISH analysis is conducive to increasing the detection rate of genetic abnormalities in CLL.

  18. The radioprotector WR-2721 reduces neutron-induced mutations at the hypoxanthine-guanine phosphoribosyl transferase locus in mouse splenocytes when administered prior to or following irradiation

    International Nuclear Information System (INIS)

    Grdina, D.J.; Basic, I.

    1992-01-01

    An in vitro T-lymphocyte cloning technique has been applied to study the effects of JANUS fission-spectrum neutron irradiation and the radioprotector S-2-(3-aminopropylamino) ethylphosphorothioic acid (WR-2721) on the subsequent development of somatic mutations at the hypoxanthine-guanine phosphoribosyl transferase (hprt) locus in hybrid B6CF1 male mice. In control studies performed to establish an in vitro cloning technique, the mutant frequencies of splenic T-lymphocytes, as a result of exposure to a 100 cGy dose of neutrons, increased with time from a control level of 9 x 10 -7 to a maximum value of 1.7 x 10 -5 at 56 days following irradiation. Between 56 and 150 days after irradiation, mutant frequencies were observed to plateau and remain stable. All subsequent determinations were performed at 56 days following the experimental treatment of animals. WR-2721 at a dose of 400 mg/kg was effective in protecting against the induction of hprt mutants (i.e. a mutant frequency reduction factor, MFRF) following the largest dose of neutrons used (i.e. 150 cGy). The antimutagenic effectiveness of WR-2721 administered 30 min prior to irradiation was unaffected, even when the dose was reduced to 200 mg/kg. These findings confirm our earlier report using the radioprotector N-(2-mercaptoethyl)-1,2-diaminopropane (WR-1065) under in vitro conditions, and demonstrate that these agents can be used as effective antimutagens even when they are administered up to 3 h following radiation exposure. (Author)

  19. Hypoxanthine-guanine phosphoribosyltransferase and inosine 5’-monophosphate dehydrogenase activities in three mammalian species: aquatic (Mirounga angustirostris, semiaquatic (Lontra longicaudis annectens and terrestrial (Sus scrofa

    Directory of Open Access Journals (Sweden)

    Myrna eBarjau Perez-Milicua

    2015-07-01

    Full Text Available Aquatic and semiaquatic mammals have the capacity of breath hold (apnea diving. Northern elephant seals (Mirounga angustirostris have the ability to perform deep and long duration dives; during a routine dive, adults can hold their breath for 25 min. Neotropical river otters (Lontra longicaudis annectens can hold their breath for about 30 sec. Such periods of apnea may result in reduced oxygen concentration (hypoxia and reduced blood supply (ischemia to tissues. Production of adenosine 5’-triphosphate (ATP requires oxygen, and most mammalian species, like the domestic pig (Sus scrofa, are not adapted to tolerate hypoxia and ischemia, conditions that result in ATP degradation. The objective of this study was to explore the differences in purine synthesis and recycling in erythrocytes and plasma of three mammalian species adapted to different environments: aquatic (northern elephant seal (n=11, semiaquatic (neotropical river otter (n=4 and terrestrial (domestic pig (n=11. Enzymatic activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT was determined by spectrophotometry, and activity of inosine 5’-monophosphate dehydrogenase (IMPDH and the concentration of hypoxanthine (HX, inosine 5’-monophosphate (IMP, adenosine 5’-monophosphate (AMP, adenosine 5’-diphosphate (ADP, ATP, guanosine 5’-diphosphate (GDP, guanosine 5’-triphosphate (GTP, and xanthosine 5’-monophosphate (XMP were determined by high-performance liquid chromatography (HPLC. The activities of HGPRT and IMPDH and the concentration of HX, IMP, AMP, ADP, ATP, GTP and XMP in erythrocytes of domestic pigs were higher than in erythrocytes of northern elephant seals and river otters. These results suggest that under basal conditions (no diving, sleep apnea or exercise, aquatic and semiaquatic mammals have less purine mobilization than their terrestrial counterparts.

  20. Simultaneous determination of adenine guanine and thymine at multi-walled carbon nanotubes incorporated with poly(new fuchsin) composite film

    Energy Technology Data Exchange (ETDEWEB)

    Tang Ching; Yogeswaran, Umasankar [Department of Chemical Engineering and Biotechnology, National Taipei University of Technology, No.1, Section 3, Chung-Hsiao East Road, Taipei 106, Taiwan (China); Chen, S.-M. [Department of Chemical Engineering and Biotechnology, National Taipei University of Technology, No.1, Section 3, Chung-Hsiao East Road, Taipei 106, Taiwan (China)], E-mail: smchen78@ms15.hinet.net

    2009-03-16

    A composite film (MWCNTs-PNF) which contains multi-walled carbon nanotubes (MWCNTs) along with the incorporation of poly(new fuchsin) (PNF) has been synthesized on glassy carbon electrode (GCE), gold (Au) and indium tin oxide (ITO) by potentiostatic methods. The presence of MWCNTs in the composite film enhances surface coverage concentration ({gamma}) of PNF to {approx}176.5%, and increases the electron transfer rate constant (k{sub s}) to {approx}346%. The composite film also exhibits promising enhanced electrocatalytic activity towards the mixture of biochemical compounds such as adenine (AD), guanine (GU) and thymine (THY). The surface morphology of the composite film deposited on ITO has been studied using scanning electron microscopy and atomic force microscopy. These two techniques reveal that the PNF incorporated on MWCNTs. Electrochemical quartz crystal microbalance study reveals the enhancement in the functional properties of MWCNTs and PNF. The electrocatalytic responses of analytes at MWCNTs and MWCNTs-PNF films were measured using both cyclic voltammetry (CV) and differential pulse voltammetry (DPV). From electrocatalysis studies, well separated voltammetric peaks have been obtained at the composite film for AD, GU and THY, with the peak separation of 320.3 and 132.7 mV between GU-AD and AD-THY respectively. The sensitivity of the composite film towards AD, GU and THY in DPV technique is 218.18, 12.62 and 78.22 mA M{sup -1} cm{sup -2} respectively, which are higher than MWCNTs film. Further, electroanalytical studies of AD, GU and THY present in single-strand deoxyribonucleic acid (ssDNA) have been carried out using semi-derivative CV and DPV.

  1. Modeling of Toxicity-Relevant Electrophilic Reactivity for Guanine with Epoxides: Estimating the Hard and Soft Acids and Bases (HSAB) Parameter as a Predictor.

    Science.gov (United States)

    Zhang, Jing; Wang, Chenchen; Ji, Li; Liu, Weiping

    2016-05-16

    According to the electrophilic theory in toxicology, many chemical carcinogens in the environment and/or their active metabolites are electrophiles that exert their effects by forming covalent bonds with nucleophilic DNA centers. The theory of hard and soft acids and bases (HSAB), which states that a toxic electrophile reacts preferentially with a biological macromolecule that has a similar hardness or softness, clarifies the underlying chemistry involved in this critical event. Epoxides are hard electrophiles that are produced endogenously by the enzymatic oxidation of parent chemicals (e.g., alkenes and PAHs). Epoxide ring opening proceeds through a SN2-type mechanism with hard nucleophile DNA sites as the major facilitators of toxic effects. Thus, the quantitative prediction of chemical reactivity would enable a predictive assessment of the molecular potential to exert electrophile-mediated toxicity. In this study, we calculated the activation energies for reactions between epoxides and the guanine N7 site for a diverse set of epoxides, including aliphatic epoxides, substituted styrene oxides, and PAH epoxides, using a state-of-the-art density functional theory (DFT) method. It is worth noting that these activation energies for diverse epoxides can be further predicted by quantum chemically calculated nucleophilic indices from HSAB theory, which is a less computationally demanding method than the exacting procedure for locating the transition state. More importantly, the good qualitative/quantitative correlations between the chemical reactivity of epoxides and their bioactivity suggest that the developed model based on HSAB theory may aid in the predictive hazard evaluation of epoxides, enabling the early identification of mutagenicity/carcinogenicity-relevant SN2 reactivity.

  2. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  3. Implication of SUMO E3 ligases in nucleotide excision repair.

    Science.gov (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji

    2015-08-01

    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  4. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  5. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  6. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  7. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma

    2008-08-01

    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  8. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  9. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  10. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben

    2010-01-01

    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  11. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  12. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  13. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  14. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  15. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  16. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  17. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  18. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  19. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  20. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy.

    Science.gov (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G

    2017-02-01

    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  1. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme

    2018-02-01

    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  2. The signaling pathway of Campylobacter jejuni-induced Cdc42 activation: Role of fibronectin, integrin beta1, tyrosine kinases and guanine exchange factor Vav2

    LENUS (Irish Health Repository)

    Krause-Gruszczynska, Malgorzata

    2011-12-28

    Abstract Background Host cell invasion by the foodborne pathogen Campylobacter jejuni is considered as one of the primary reasons of gut tissue damage, however, mechanisms and key factors involved in this process are widely unclear. It was reported that small Rho GTPases, including Cdc42, are activated and play a role during invasion, but the involved signaling cascades remained unknown. Here we utilised knockout cell lines derived from fibronectin-\\/-, integrin-beta1-\\/-, focal adhesion kinase (FAK)-\\/- and Src\\/Yes\\/Fyn-\\/- deficient mice, and wild-type control cells, to investigate C. jejuni-induced mechanisms leading to Cdc42 activation and bacterial uptake. Results Using high-resolution scanning electron microscopy, GTPase pulldowns, G-Lisa and gentamicin protection assays we found that each studied host factor is necessary for induction of Cdc42-GTP and efficient invasion. Interestingly, filopodia formation and associated membrane dynamics linked to invasion were only seen during infection of wild-type but not in knockout cells. Infection of cells stably expressing integrin-beta1 variants with well-known defects in fibronectin fibril formation or FAK signaling also exhibited severe deficiencies in Cdc42 activation and bacterial invasion. We further demonstrated that infection of wild-type cells induces increasing amounts of phosphorylated FAK and growth factor receptors (EGFR and PDGFR) during the course of infection, correlating with accumulating Cdc42-GTP levels and C. jejuni invasion over time. In studies using pharmacological inhibitors, silencing RNA (siRNA) and dominant-negative expression constructs, EGFR, PDGFR and PI3-kinase appeared to represent other crucial components upstream of Cdc42 and invasion. siRNA and the use of Vav1\\/2-\\/- knockout cells further showed that the guanine exchange factor Vav2 is required for Cdc42 activation and maximal bacterial invasion. Overexpression of certain mutant constructs indicated that Vav2 is a linker

  3. The signaling pathway of Campylobacter jejuni-induced Cdc42 activation: Role of fibronectin, integrin beta1, tyrosine kinases and guanine exchange factor Vav2

    Directory of Open Access Journals (Sweden)

    Krause-Gruszczynska Malgorzata

    2011-12-01

    Full Text Available Abstract Background Host cell invasion by the foodborne pathogen Campylobacter jejuni is considered as one of the primary reasons of gut tissue damage, however, mechanisms and key factors involved in this process are widely unclear. It was reported that small Rho GTPases, including Cdc42, are activated and play a role during invasion, but the involved signaling cascades remained unknown. Here we utilised knockout cell lines derived from fibronectin-/-, integrin-beta1-/-, focal adhesion kinase (FAK-/- and Src/Yes/Fyn-/- deficient mice, and wild-type control cells, to investigate C. jejuni-induced mechanisms leading to Cdc42 activation and bacterial uptake. Results Using high-resolution scanning electron microscopy, GTPase pulldowns, G-Lisa and gentamicin protection assays we found that each studied host factor is necessary for induction of Cdc42-GTP and efficient invasion. Interestingly, filopodia formation and associated membrane dynamics linked to invasion were only seen during infection of wild-type but not in knockout cells. Infection of cells stably expressing integrin-beta1 variants with well-known defects in fibronectin fibril formation or FAK signaling also exhibited severe deficiencies in Cdc42 activation and bacterial invasion. We further demonstrated that infection of wild-type cells induces increasing amounts of phosphorylated FAK and growth factor receptors (EGFR and PDGFR during the course of infection, correlating with accumulating Cdc42-GTP levels and C. jejuni invasion over time. In studies using pharmacological inhibitors, silencing RNA (siRNA and dominant-negative expression constructs, EGFR, PDGFR and PI3-kinase appeared to represent other crucial components upstream of Cdc42 and invasion. siRNA and the use of Vav1/2-/- knockout cells further showed that the guanine exchange factor Vav2 is required for Cdc42 activation and maximal bacterial invasion. Overexpression of certain mutant constructs indicated that Vav2 is a linker

  4. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  5. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

    1991-01-01

    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  6. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  7. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  8. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  9. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  10. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  11. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  12. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  13. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

    OpenAIRE

    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

    2008-01-01

    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  14. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  15. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

    1987-10-01

    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  16. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  17. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  18. Glucose-nucleobase pairs within DNA: impact of hydrophobicity, alternative linking unit and DNA polymerase nucleotide insertion studies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc04850e

    Science.gov (United States)

    Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos

    2018-01-01

    Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486

  19. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  20. The effects of 6-mercaptopurine nucleotide derivatives on the growth and survival of 6-mercaptopurine-sensitive and -resistant cell culture lines.

    Science.gov (United States)

    Johnston, H P; Hawley, P; White, S E; Gibson, I; Tidd, D M

    1985-04-01

    6-Mercaptopurine (MP)-sensitive and -resistant cell culture lines were used to further characterize the apparent ability of MP nucleotide derivatives to overcome resistance to the parent drug. 6-Mercaptopurine-9-beta-D-ribofuranoside 5'-monophosphate [MPRP], bis(6-mercaptopurine-9-beta-D-ribofuranoside)-5', 5"'-monophosphate [bis(MPR)P], bis(O2',O3'-dibutyryl-6-mercaptopurine-9-beta-D-ribofuranoside)-5', 5"'-monophosphate [bis(dibut.MPR)P], and O2',O3'-dibutyryl-6-mercaptopurine-9-beta-D-ribofuranoside 5'-monophosphate [dibut.MPRP] were tested for cytotoxic and/or growth inhibitory effects against MP-resistant sublines of V79 Chinese hamster lung fibroblasts (CH/TG) and L1210 mouse leukaemia cells (L1210/MPR) in which deficiencies of hypoxanthine-guanine phosphoribosyltransferase, and hence drug nucleotide forming capacity were the basis of resistance. L1210/MPR cells were totally resistant to 1 mM 6-mercaptopurine-9-beta-D-ribofuranoside [MPR] and 2 mM MPRP, but were inhibited by high concentrations (greater than 0.25 mM) of bis(MPR)P. These results suggested that bis(MPR)P was taken up by cells as the intact molecule since MPR and MPRP were its extracellular breakdown products. L1210/MPR cells were much more sensitive to the lipophilic bis(dibut.MPR)P derivative which had a predominantly cytotoxic action as judged by trypan blue staining and the ability of treated cells to produce macroscopic colonies in soft agar medium. However, cells killed by bis(dibut.MPR)P did not disintegrate appreciably over periods of up to 10 days. The effects of bis(dibut.MPR)P were probably the result of cellular uptake of the intact molecule. Dibut.MPRP showed minimal ability to inhibit L1210/MPR cells although this compound was a possible breakdown product of bis(dibut.MPR)P and a source of the same extracellular degradation products. The median cell size decreased in L1210/MPR cultures during exposure to both bis(MPR)P and bis(dibut.MPR)P. This effect was elicited more rapidly and

  1. The effects of 6-mercaptopurine nucleotide derivatives on the growth and survival of 6-mercaptopurine-sensitive and -resistant cell culture lines.

    Science.gov (United States)

    Johnston, H. P.; Hawley, P.; White, S. E.; Gibson, I.; Tidd, D. M.

    1985-01-01

    6-Mercaptopurine (MP)-sensitive and -resistant cell culture lines were used to further characterize the apparent ability of MP nucleotide derivatives to overcome resistance to the parent drug. 6-Mercaptopurine-9-beta-D-ribofuranoside 5'-monophosphate [MPRP], bis(6-mercaptopurine-9-beta-D-ribofuranoside)-5', 5"'-monophosphate [bis(MPR)P], bis(O2',O3'-dibutyryl-6-mercaptopurine-9-beta-D-ribofuranoside)-5', 5"'-monophosphate [bis(dibut.MPR)P], and O2',O3'-dibutyryl-6-mercaptopurine-9-beta-D-ribofuranoside 5'-monophosphate [dibut.MPRP] were tested for cytotoxic and/or growth inhibitory effects against MP-resistant sublines of V79 Chinese hamster lung fibroblasts (CH/TG) and L1210 mouse leukaemia cells (L1210/MPR) in which deficiencies of hypoxanthine-guanine phosphoribosyltransferase, and hence drug nucleotide forming capacity were the basis of resistance. L1210/MPR cells were totally resistant to 1 mM 6-mercaptopurine-9-beta-D-ribofuranoside [MPR] and 2 mM MPRP, but were inhibited by high concentrations (greater than 0.25 mM) of bis(MPR)P. These results suggested that bis(MPR)P was taken up by cells as the intact molecule since MPR and MPRP were its extracellular breakdown products. L1210/MPR cells were much more sensitive to the lipophilic bis(dibut.MPR)P derivative which had a predominantly cytotoxic action as judged by trypan blue staining and the ability of treated cells to produce macroscopic colonies in soft agar medium. However, cells killed by bis(dibut.MPR)P did not disintegrate appreciably over periods of up to 10 days. The effects of bis(dibut.MPR)P were probably the result of cellular uptake of the intact molecule. Dibut.MPRP showed minimal ability to inhibit L1210/MPR cells although this compound was a possible breakdown product of bis(dibut.MPR)P and a source of the same extracellular degradation products. The median cell size decreased in L1210/MPR cultures during exposure to both bis(MPR)P and bis(dibut.MPR)P. This effect was elicited more rapidly and

  2. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  3. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

    Science.gov (United States)

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

    2017-12-01

    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  4. On the Formation and Properties of Interstrand DNA-DNA Cross-links Forged by Reaction of an Abasic Site With the Opposing Guanine Residue of 5′-CAp Sequences in Duplex DNA

    Science.gov (United States)

    Johnson, Kevin M.; Price, Nathan E.; Wang, Jin; Fekry, Mostafa I.; Dutta, Sanjay; Seiner, Derrick R.; Wang, Yinsheng; Gates, Kent S.

    2014-01-01

    We recently reported that the aldehyde residue of an abasic (Ap) site in duplex DNA can generate an interstrand cross-link via reaction with a guanine residue on the opposing strand. This finding is intriguing because the highly deleterious nature of interstrand cross-links suggests that even small amounts of Ap-derived cross-links could make a significant contribution to the biological consequences stemming from the generation of Ap sites in cellular DNA. Incubation of 21-bp duplexes containing a central 5′-CAp sequence under conditions of reductive amination (NaCNBH3, pH 5.2) generated much higher yields of cross-linked DNA than reported previously. At pH 7, in the absence of reducing agents, these Ap-containing duplexes also produced cross-linked duplexes that were readily detected on denaturing polyacrylamide gels. Cross-link formation was not highly sensitive to reaction conditions and, once formed, the cross-link was stable to a variety of work-up conditions. Results of multiple experiments including MALDI-TOF mass spectrometry, gel mobility, methoxyamine capping of the Ap aldehyde, inosine-for-guanine replacement, hydroxyl radical footprinting, and LCMS/MS were consistent with a cross-linking mechanism involving reversible reaction of the Ap aldehyde residue with the N2-amino group of the opposing guanine residue in 5′-CAp sequences to generate hemiaminal, imine, or cyclic hemiaminal cross-links (7-10) that were irreversibly converted under conditions of reductive amination (NaCNBH3/pH 5.2) to a stable amine linkage. Further support for the importance of the exocyclic N2-amino group in this reaction was provided by an experiment showing that installation of a 2-aminopurine-thymine base pair at the cross-linking site produced high yields (15-30%) of a cross-linked duplex at neutral pH, in the absence of NaCNBH3. PMID:23215239

  5. Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Abhasnee Sobhonslidsuk

    2017-01-01

    Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

  6. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  7. Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

    International Nuclear Information System (INIS)

    Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

    2013-01-01

    Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  8. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  9. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  10. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.

    1986-01-01

    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  11. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  12. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  13. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  14. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  15. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  16. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

    1988-01-01

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  17. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  18. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  19. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  1. Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions

    OpenAIRE

    M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska

    2006-01-01

    The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...

  2. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  3. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

    Science.gov (United States)

    Tomaszewski, M; Buchowicz, J

    1971-08-01

    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  4. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    Science.gov (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  5. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  6. Synthesis and spectroscopy of clay intercalated Cu(II) bio-monomer complexes: coordination of Cu(II) with purines and nucleotides

    NARCIS (Netherlands)

    Weckhuysen, B.M.; Leeman, H.; Schoonheydt, R.A.

    1999-01-01

    The spectroscopic properties of Cu(bio-monomer)nm+ complexes [BM=bio-monomer (purine, adenine, guanine, hypoxanthine, 5-ADP and 5-GMP)] in saponite clays have been investigated by diffuse reflectance spectroscopy (DRS) in the UV-Vis-NIR region and electron paramagnetic resonance (EPR) at X-band.

  7. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben

    2016-01-01

    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  8. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  9. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz

    2015-09-01

    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  10. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    International Nuclear Information System (INIS)

    Welin, Martin; Nordlund, Paer

    2010-01-01

    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  11. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  12. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  13. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.

    2012-01-01

    , including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

  14. 2′-O-methyl nucleotide modified DNA substrates influence the ...

    Indian Academy of Sciences (India)

    2014-07-18

    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  15. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  16. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene

    2017-01-01

    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  17. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  18. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    Science.gov (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  19. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  20. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  1. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

    Science.gov (United States)

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

    2014-01-01

    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  2. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

    2015-01-01

    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  3. Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

    DEFF Research Database (Denmark)

    Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine

    2007-01-01

    Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

  4. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

    Science.gov (United States)

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

    2014-11-24

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  6. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  7. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  8. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  9. Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

    DEFF Research Database (Denmark)

    Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup

    2008-01-01

    Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

  10. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

    2013-12-01

    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  11. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  12. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  13. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  14. Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

    Czech Academy of Sciences Publication Activity Database

    Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal

    2015-01-01

    Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

  15. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  16. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

    Science.gov (United States)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

    2013-11-01

    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  17. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  18. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

    2017-01-01

    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  20. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

    Science.gov (United States)

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

    1999-03-01

    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  1. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal

    2012-01-01

    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  2. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  3. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn

    2015-01-01

    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  4. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

    Science.gov (United States)

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

    2001-05-01

    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  5. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2006-01-01

    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  6. Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

    African Journals Online (AJOL)

    The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

  7. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

    Science.gov (United States)

    Woolfitt, A R; Kellett, G L; Hoggett, J G

    1988-01-29

    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  8. Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Barry J Grant

    2009-03-01

    Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

  9. DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob

    2010-01-01

    To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

  10. Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

    DEFF Research Database (Denmark)

    Sonne, Jacob; Kandt, C.; Peters, Günther H.j.

    2007-01-01

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

  11. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  12. Mixed adenine/guanine quartets with three trans-a2 Pt(II) (a=NH(3) or MeNH(2)) cross-links: linkage and rotational isomerism, base pairing, and loss of NH(3).

    Science.gov (United States)

    Albertí, Francisca M; Rodríguez-Santiago, Luis; Sodupe, Mariona; Mirats, Andrea; Kaitsiotou, Helena; Sanz Miguel, Pablo J; Lippert, Bernhard

    2014-03-17

    Of the numerous ways in which two adenine and two guanines (N9 positions blocked in each) can be cross-linked by three linear metal moieties such as trans-a2 Pt(II) (with a=NH3 or MeNH2 ) to produce open metalated purine quartets with exclusive metal coordination through N1 and N7 sites, one linkage isomer was studied in detail. The isomer trans,trans,trans-[{Pt(NH3 )2 (N7-9-EtA-N1)2 }{Pt(MeNH2 )2 (N7-9-MeGH)}2 ][(ClO4 )6 ]⋅3H2 O (1) (with 9-EtA=9-ethyladenine and 9-MeGH=9-methylguanine) was crystallized from water and found to adopt a flat Z-shape in the solid state as far as the trinuclear cation is concerned. In the presence of excess 9-MeGH, a meander-like construct, trans,trans,trans-[{Pt(NH3 )2 (N7-9-EtA-N1)2 }{Pt(MeNH2 )2 (N7-9-MeGH)2 }][(ClO4 )6 ]⋅[(9-MeGH)2 ]⋅7 H2 O (2) is formed, in which the two extra 9-MeGH nucleobases are hydrogen bonded to the two terminal platinated guanine ligands of 1. Compound 1, and likewise the analogous complex 1 a (with NH3 ligands only), undergo loss of an ammonia ligand and formation of NH4 (+) when dissolved in [D6 ]DMSO. From the analogy between the behavior of 1 and 1 a it is concluded that a NH3 ligand from the central Pt atom is lost. Addition of 1-methylcytosine (1-MeC) to such a DMSO solution reveals coordination of 1-MeC to the central Pt. In an analogous manner, 9-MeGH can coordinate to the central Pt in [D6 ]DMSO. It is proposed that the proton responsible for formation of NH4 (+) is from one of the exocyclic amino groups of the two adenine bases, and furthermore, that this process is accompanied by a conformational change of the cation from Z-form to U-form. DFT calculations confirm the proposed mechanism and shed light on possible pathways of this process. Calculations show that rotational isomerism is not kinetically hindered and that it would preferably occur previous to the displacement of NH3 by DMSO. This displacement is the most energetically costly step, but it is compensated by the proton

  13. Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

    Directory of Open Access Journals (Sweden)

    Yang Ming

    2012-07-01

    Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

  14. Enzymatic production of dietary nucleotides from low-soluble purine bases by an efficient, thermostable and alkali-tolerant biocatalyst.

    Science.gov (United States)

    Del Arco, J; Cejudo-Sanches, J; Esteban, I; Clemente-Suárez, V J; Hormigo, D; Perona, A; Fernández-Lucas, J

    2017-12-15

    Traditionally, enzymatic synthesis of nucleoside-5'-monophosphates (5'-NMPs) using low water-soluble purine bases has been described as less efficient due to their low solubility in aqueous media. The use of enzymes from extremophiles, such as thermophiles or alkaliphiles, offers the potential to increase solubilisation of these bases by employing high temperatures or alkaline pH. This study describes the cloning, expression and purification of hypoxanthine-guanine-xanthine phosphoribosyltransferase from Thermus thermophilus (TtHGXPRT). Biochemical characterization indicates TtHGXPRT as a homotetramer with excellent activity and stability across a broad range of temperatures (50-90°C) and ionic strengths (0-500mMNaCl), but it also reveals an unusually high activity and stability under alkaline conditions (pH range 8-11). In order to explore the potential of TtHGXPRT as an industrial biocatalyst, enzymatic production of several dietary 5'-NMPs, such as 5'-GMP and 5'-IMP, was carried out at high concentrations of guanine and hypoxanthine. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Isotope Dilution nanoLC/ESI+-HRMS3 Quantitation of Urinary N7-(1-Hydroxy-3-buten-2-yl) Guanine Adducts in Humans and Their Use as Biomarkers of Exposure to 1,3-Butadiene.

    Science.gov (United States)

    Sangaraju, Dewakar; Boldry, Emily J; Patel, Yesha M; Walker, Vernon; Stepanov, Irina; Stram, Daniel; Hatsukami, Dorothy; Tretyakova, Natalia

    2017-02-20

    1,3-Butadiene (BD) is an important industrial and environmental chemical classified as a known human carcinogen. Occupational exposure to BD in the polymer and monomer industries is associated with an increased incidence of lymphoma. BD is present in automobile exhaust, cigarette smoke, and forest fires, raising concern about potential exposure of the general population to this carcinogen. Following inhalation exposure, BD is bioactivated to 3,4-epoxy-1-butene (EB). If not detoxified, EB is capable of modifying guanine and adenine bases of DNA to form nucleobase adducts, which interfere with accurate DNA replication and cause cancer-initiating mutations. We have developed a nanoLC/ESI + -HRMS 3 methodology for N7-(1-hydroxy-3-buten-2-yl) guanine (EB-GII) adducts in human urine (limit of detection: 0.25 fmol/mL urine; limit of quantitation: 1.0 fmol/mL urine). This new method was successfully used to quantify EB-GII in urine of F344 rats treated with 0-200 ppm of BD, occupationally exposed workers, and smokers belonging to two different ethnic groups. EB-GII amounts increased in a dose-dependent manner in urine of laboratory rats exposed to 0, 62.5, or 200 ppm of BD. Urinary EB-GII levels were significantly increased in workers occupationally exposed to 0.1-2.2 ppm of BD (1.25 ± 0.51 pg/mg of creatinine) as compared to administrative controls exposed to <0.01 ppm of BD (0.22 ± 0.08 and pg/mg of creatinine) (p = 0.0024), validating the use of EB-GII as a biomarker of human exposure to BD. EB-GII was also detected in smokers' urine with European American smokers excreting significantly higher amounts of EB-GII than African American smokers (0.48 ± 0.09 vs 0.12 ± 0.02 pg/mg of creatinine, p = 3.1 × 10 -7 ). Interestingly, small amounts of EB-GII were observed in animals and humans with no known exposure to BD, providing preliminary evidence for its endogenous formation. Urinary EB-GII adduct levels and urinary mercapturic acids of BD (MHBMA, DHBMA) were compared

  16. Synthesis and preliminary evaluation of 9-(4-[{sup 18}F]fluoro-3-hydroxymethylbutyl) guanine ([{sup 18}F]FHBG) in HSV1-tk gene transduced hepatoma cell

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Byung Seok; Lee, Tae Sup [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of); Lee, Myoung Keun [Yonsei University, Wonju (Korea, Republic of)] (and others)

    2006-08-15

    The HSV1-tk reporter gene system is the most widely used system because of its advantage that direct monitoring is possible without the introduction of a separate reporter gene in case of HSV1-tk suicide gene therapy. In this study, we investigate the usefulness of the reporter probe (substrate), 9-(4-[{sup 18}F]fluoro-3-hydroxymethylbutyl) guanine ([{sup 18}F]FHBG) for non-invasive reporter gene imaging using PET in HSV1-tk expressing hepatoma model. Radiolabeled FHBG was prepared in 8 steps from a commercially available triester. The labeling reaction was carried out by NCA nucleophilic substitution with K[{sup 18}F]/K2.2.2. in acetonitrile using N2-monomethoxytrityl-9-[4-(tosly)-3-monomethoxytritylmethylbutl] guanine as a precursor, followed by deprotection with 1 N HCI. Preliminary biological properties of the probe were evaluated with MCA cells and MCA-tk cells transduced with HSV1-tk reporter gene. In vitro uptake and release-out studies of [{sup 18}F]FHBG were performed, and was analyzed correlation between [{sup 18}F]FHBG uptake ratio according to increasing numeric count of MCA-tk cells and degree of gene expression. MicroPET scan image was obtained with MCA and MCA-tk tumor beating Balb/c-nude mouse model. [{sup 18}F]FHBG was purified by reverse phase semi-HPLC system and collected at around 16-18 min. Radiochemical yield was about 20-25% (corrected for decay), radiochemical purity was > 95% and specific activity was around > 55.5 GBq/ {mu} mol. Specific accumulation of [{sup 18}F]FHBG was observed in HSV1-tk gene transduced MCA-tk cells but not MCA cells, and consecutive 1 hour release-out results showed more than 86% of uptaked [{sup 18}F]FHBG was retained inside of cells. The uptake of [{sup 18}F]FHBG was showed a highly significant linear correlation (R{sup 2} = 0.995) with increasing percentage of MCA-tk numeric cell count. In microPET scan images, remarkable difference of accumulation was observed for the two type of tumors. [{sup 18}F]FHBG appears

  17. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  18. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  19. Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.

    Science.gov (United States)

    Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen

    2014-04-15

    In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P

    2017-06-01

    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  1. Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

    International Nuclear Information System (INIS)

    Efimova, N.I.; Libenson, S.V.

    1982-01-01

    Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals

  2. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  3. Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina

    Science.gov (United States)

    Arora, Avnish Kumar; Kamaluddin

    2009-03-01

    Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

  4. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  5. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  6. Lack of nucleotide variability in a beetle pest with extreme inbreeding

    OpenAIRE

    Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.

    1998-01-01

    The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...

  7. Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation

    Directory of Open Access Journals (Sweden)

    Francesco Di Virgilio

    2018-02-01

    Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.

  8. Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

    Energy Technology Data Exchange (ETDEWEB)

    Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

    2016-12-21

    Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

  9. Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.

    OpenAIRE

    Shemesh, M; Hansel, W; Strauss, J F

    1984-01-01

    Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...

  10. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  11. Prolinol-based nucleoside phosphonic acids: new isosteric conformationally flexible nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Vaněk, Václav; Buděšínský, Miloš; Rinnová, Markéta; Rosenberg, Ivan

    2009-01-01

    Roč. 65, č. 4 (2009), s. 862-876 ISSN 0040-4020 R&D Projects: GA ČR GA203/05/0827; GA MŠk(CZ) LC06077; GA MŠk LC512; GA MŠk(CZ) LC06061 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotide analogues * phosphonates * prolinol derivatives * N- alkylation Subject RIV: CC - Organic Chemistry Impact factor: 3.219, year: 2009

  12. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  13. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    OpenAIRE

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  14. Mesenchymal stem cells from different murine tissues have differential capacity to metabolize extracellular nucleotides.

    Science.gov (United States)

    Iser, Isabele C; Bracco, Paula A; Gonçalves, Carlos E I; Zanin, Rafael F; Nardi, Nance B; Lenz, Guido; Battastini, Ana Maria O; Wink, Márcia R

    2014-10-01

    Mesenchymal stem cells (MSCs) have shown a great potential for cell-based therapy and many different therapeutic purposes. Despite the recent advances in the knowledge of MSCs biology, their biochemical and molecular properties are still poorly defined. Ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) and ecto-5'-nucleotidase (eNT/CD73) are widely expressed enzymes that hydrolyze extracellular nucleotides, generating an important cellular signaling cascade. Currently, studies have evidenced the relationship between the purinergic system and the development, maintenance, and differentiation of stem cells. The objective of this study is to identify the NTPDases and eNT/CD73 and compare the levels of nucleotide hydrolysis on MSCs isolated from different murine tissues (bone marrow, lung, vena cava, kidney, pancreas, spleen, skin, and adipose tissue). MSCs from all tissues investigated expressed the ectoenzymes at different levels. In MSCs from pancreas and adipose tissue, the hydrolysis of triphosphonucleosides was significantly higher when compared to the other cells. The diphosphonucleosides were hydrolyzed at a higher rate by MSC from pancreas when compared to MSC from other tissues. The differential nucleotide hydrolysis activity and enzyme expression in these cells suggests that MSCs play different roles in regulating the purinergic system in these tissues. Overall MSCs are an attractive adult-derived cell population for therapies, however, the fact that ecto-nucleotide metabolism can affect the microenvironment, modulating important events, such as immune response, makes the assessment of this metabolism an important part of the characterization of MSCs to be applied therapeutically. © 2014 Wiley Periodicals, Inc.

  15. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  16. Roles of phosphorylation and nucleotide binding domains in calcium transport by sarcoplasmic reticulum adenosinetriphosphatase

    International Nuclear Information System (INIS)

    Teruel, J.A.; Inesi, G.

    1988-01-01

    The roles of the phosphorylation (phosphorylated enzyme intermediate) and nucleotide binding domains in calcium transport were studied by comparing acetyl phosphate and ATP as substrates for the Ca 2+ -ATPase of sarcoplasmic reticulum vesicles. The authors found that the maximal level of phosphoenzyme obtained with either substrate is approximately 4 nmol/mg of protein, corresponding to the stoichiometry of catalytic sites in their preparation. The initial burst of phosphoenzyme formation observed in the transient state, following addition of either substrate, is accompanied by internalization of 2 mol of calcium per mole of phosphoenzyme. The internalized calcium is then translocated with a sequential pattern, independent of the substrate used. Following a rate-limiting step, the phosphoenzyme undergoes hydrolytic cleavage and proceeds to the steady-state activity which is soon back inhibited by the rise of Ca 2+ concentration in the lumen of the vesicles. When the back inhibition is released by the addition of oxalate, substrate utilization and calcium transport occur with a ratio of 1:2, independent of the substrate and its concentration. When the nucleotide binding site is derivatized with FITP, the enzyme can still utilize acetyl phosphate (but not ATP) for calcium transport. These observations demonstrate that the basic coupling mechanism of catalysis and calcium transport involves the phosphorylation and calcium binding domains, and not the nucleotide binding domain. On the other hand, occupancy of the FITC-sensitive nucleotide site is involved in kinetic regulation not only with respect to utilization of substrate for the phosphoryl transfer reaction but also for subsequent steps related to calcium translocation and phosphoenzyme turnover

  17. A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.

    Directory of Open Access Journals (Sweden)

    Beth M Carpenter

    Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.

  18. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    Science.gov (United States)

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  19. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene

    Directory of Open Access Journals (Sweden)

    Othman E. Othman

    2014-12-01

    It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.

  1. Nucleotide homeostasis and purinergic nociceptive signaling in rat meninges in migraine-like conditions.

    Science.gov (United States)

    Yegutkin, Gennady G; Guerrero-Toro, Cindy; Kilinc, Erkan; Koroleva, Kseniya; Ishchenko, Yevheniia; Abushik, Polina; Giniatullina, Raisa; Fayuk, Dmitriy; Giniatullin, Rashid

    2016-09-01

    Extracellular ATP is suspected to contribute to migraine pain but regulatory mechanisms controlling pro-nociceptive purinergic mechanisms in the meninges remain unknown. We studied the peculiarities of metabolic and signaling pathways of ATP and its downstream metabolites in rat meninges and in cultured trigeminal cells exposed to the migraine mediator calcitonin gene-related peptide (CGRP). Under resting conditions, meningeal ATP and ADP remained at low nanomolar levels, whereas extracellular AMP and adenosine concentrations were one-two orders higher. CGRP increased ATP and ADP levels in meninges and trigeminal cultures and reduced adenosine concentration in trigeminal cells. Degradation rates for exogenous nucleotides remained similar in control and CGRP-treated meninges, indicating that CGRP triggers nucleotide release without affecting nucleotide-inactivating pathways. Lead nitrate-based enzyme histochemistry of whole mount meninges revealed the presence of high ATPase, ADPase, and AMPase activities, primarily localized in the medial meningeal artery. ATP and ADP induced large intracellular Ca(2+) transients both in neurons and in glial cells whereas AMP and adenosine were ineffective. In trigeminal glia, ATP partially operated via P2X7 receptors. ATP, but not other nucleotides, activated nociceptive spikes in meningeal trigeminal nerve fibers providing a rationale for high degradation rate of pro-nociceptive ATP. Pro-nociceptive effect of ATP in meningeal nerves was reproduced by α,β-meATP operating via P2X3 receptors. Collectively, extracellular ATP, which level is controlled by CGRP, can persistently activate trigeminal nerves in meninges which considered as the origin site of migraine headache. These data are consistent with the purinergic hypothesis of migraine pain and suggest new targets against trigeminal pain.

  2. Fluorinated Nucleotide Modifications Modulate Allele Selectivity of SNP-Targeting Antisense Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Michael E. Østergaard

    2017-06-01

    Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.

  3. Porous silicon surfaces for metabonomics: Detection and identification of nucleotides without matrix interference

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, D.; Azcarate, Sabino [Dpto. de Micro y Nanotecnologias, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain); Fernandez, Jose A.; Astigarraga, Egoitz [Dpto. de Quimica Fisica, Universidad del Pais Vasco, Campus de Lejona, Lejona (Spain); Marcaide, Arrate [Dpto. de Procesos de Fabricacion, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain)

    2007-07-01

    In present work, porous silicon surfaces (PSS) have been developed for time of flight mass spectrometric experiments (TOF-MS) in the monitoring of nucleotides, commonly found as metabolites in the cell. The mass range of the studied molecules ({proportional_to} 400 amu) is common to several important messengers and other metabolites. Different porosified surfaces have been developed by means of electrochemical etching and different degree of porosity and pore size achieved as function of silicon dopant concentration, silicon resistivity, current density and the presence or absence of illumination along the process. As main conclusion, it can be said that an interesting commercial nucleotide (Cyclic adenosine monophosphate, c-AMP) has been detected on low concentrations ({proportional_to}hundreds of femtomols) for some of the fabricated porous surfaces. Taking into account that these concentrations are similar to the ones found in real samples, this result opens the possibility to the fabrication of DIOS (Desorption Ionization On Silicon) chips for the detection of nucleotides in biological fluids. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  4. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  5. Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.

    Directory of Open Access Journals (Sweden)

    Enying Zhang

    Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.

  6. Junctional transfer in cultured vascular endothelium: II. Dye and nucleotide transfer

    International Nuclear Information System (INIS)

    Larson, D.M.; Sheridan, J.D.

    1985-01-01

    Vascular endothelial cultures, derived from large vessels, retain many of the characteristics of their in vivo counterparts. However, the observed reduction in size and complexity of intercellular gap and tight junctions in these cultured cells suggests that important functions, thought to be mediated by these structures, may be altered in vitro. In continuing studies on intercellular communication in vessel wall cells, the authors have quantitated the extent of junctional transfer of small molecular tracers (the fluorescent dye Lucifer Yellow CH and tritiated uridine nucleotides) in confluent cultures of calf aortic (BAEC) and umbilical vein (BVEC) endothelium. Both BAEC and BVEC show extensive (and quantitatively equivalent) dye and nucleotide transfer. As an analogue of intimal endothelium, the authors have also tested dye transfer in freshly isolated sheets of endothelium. Transfer in BAEC and BVEC sheets was more rapid, extensive and homogeneous than in the cultured cells, implying a reduction in molecular coupling as endothelium adapts to culture conditions. In addition, they have documented heterocellular nucleotide transfer between cultured endothelium and vascular smooth muscle cells, of particular interest considering the prevalence of ''myo-endothelial'' junctions in vivo. These data yield further information on junctional transfer in cultured vascular endothelium and have broad implications for the functional integration of the vessel wall in the physiology and pathophysiology of the vasculature

  7. The low-dose combination preparation Vertigoheel activates cyclic nucleotide pathways and stimulates vasorelaxation.

    Science.gov (United States)

    Heinle, H; Tober, C; Zhang, D; Jäggi, R; Kuebler, W M

    2010-01-01

    Vertigo of various and often unknown aetiologies has been associated with and attributed to impaired microvascular perfusion in the inner ear or the vertebrobasilar system. Vertigoheel is a low-dose combination preparation of proven value in the symptomatic treatment of vertigo. In the present study we tested the hypothesis that Vertigoheel's anti-vertiginous properties may in part be due to a vasodilatory effect exerted via stimulation of the adenylate and/or guanylate cyclase pathways. Thus, the influence of Vertigoheel or its single constituents on synthesis and degradation of cyclic nucleotides was measured. Furthermore, vessel myography was used to observe the effect of Vertigoheel on the vasoreactivity of rat carotid arteries. Vertigoheel and one of its constituents, Anamirta cocculus, stimulated adenylate cyclase activity, while another constituent, Conium maculatum, inhibited phosphodiesterase 5, suggesting that the individual constituents of Vertigoheel contribute differentially to a synergistic stimulation of cyclic nucleotide signalling pathways. In rat carotid artery rings, Vertigoheel counteracted phenylephrine-induced tonic vasoconstriction. The present data demonstrate a vasorelaxant effect of Vertigoheel that goes along with a synergistic stimulation of cyclic nucleotide pathways and may provide a mechanistic basis for the documented anti-vertiginous effects of this combination preparation.

  8. Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate

    International Nuclear Information System (INIS)

    Puig, J.G.; Fox, I.H.

    1984-01-01

    Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake

  9. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    Science.gov (United States)

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  10. OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

    Science.gov (United States)

    Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

    2016-02-01

    Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

  11. Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism.

    Science.gov (United States)

    Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P

    2004-12-15

    Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.

  12. A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

    Science.gov (United States)

    Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

    2016-01-01

    We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

  13. Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

    Science.gov (United States)

    Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

    2015-10-01

    Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

  14. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

    2003-01-01

    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  15. Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

    Directory of Open Access Journals (Sweden)

    Waikhom Bimolata

    Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

  16. Synthesis and degradation of cyclic nucleotides in brain after a high dose of ionizing radiation

    International Nuclear Information System (INIS)

    Hunt, W.A.; Dalton, T.K.

    1981-01-01

    Previous data from our laboratory have indicated that a high dose of ionizing radiation can deplete the cyclic nucleotides guanosine 3',5'-cyclic monophosphate (cGMP) and adenosine 3',5'-cyclic monophosphate (cAMP) on several areas of the rat brain. cGMP is more sensitive to radiation than cAMP and does not recover for at least 24 h after irradiation. The response of cAMP is transient and recovery occurs within 4 h. The purpose of the present paper is to determine whether alternations in the activity of the synthetic and degradative enzymes that regulate cyclic nucleotide levels could account for the observed effects. Guanylate and adenylate cyclase and cGMP and cAMP phosphodiesterase activities were determined 10 min after irradiation with 10,000 rad of high-energy electrons. No alteration was detected under these experimental conditions. The data suggest that the reduction in cyclic nucleotides is not a direct effect on their metabolic enzymes and is probably secondary to some as yet-undefined action of radiation on the brain

  17. The nucleotide-binding domain of NLRC5 is critical for nuclear import and transactivation activity

    International Nuclear Information System (INIS)

    Meissner, Torsten B.; Li, Amy; Liu, Yuen-Joyce; Gagnon, Etienne; Kobayashi, Koichi S.

    2012-01-01

    Highlights: ► NLRC5 requires an intact NLS for its function as MHC class I transactivator. ► Nuclear presence of NLRC5 is required for MHC class I induction. ► Nucleotide-binding controls nuclear import and transactivation activity of NLRC5. -- Abstract: Major histocompatibility complex (MHC) class I and class II are crucial for the function of the human adaptive immune system. A member of the NLR (nucleotide-binding domain, leucine-rich repeat) protein family, NLRC5, has recently been identified as a transcriptional regulator of MHC class I and related genes. While a ‘master regulator’ of MHC class II genes, CIITA, has long been known, NLRC5 specifically associates with and transactivates the proximal promoters of MHC class I genes. In this study, we analyzed the molecular requirements of NLRC5 nuclear import and transactivation activity. We show that NLRC5-mediated MHC class I gene induction requires an intact nuclear localization signal and nuclear distribution of NLRC5. In addition, we find that the nucleotide-binding domain (NBD) of NLRC5 is critical not only for nuclear translocation but also for the transactivation of MHC class I genes. Changing the cellular localization of NLRC5 is likely to immediately impact MHC class I expression as well as MHC class I-mediated antigen presentation. NLRC5 may thus provide a promising target for the modulation of MHC class I antigen presentation, especially in the setting of transplant medicine.

  18. The first 3':5'-cyclic nucleotide-amino acid complex: L-His-cIMP.

    Science.gov (United States)

    Slepokura, Katarzyna

    2012-08-01

    In the crystal structure of the L-His-cIMP complex, i.e. L-histidinium inosine 3':5'-cyclic phosphate [systematic name: 5-(2-amino-2-carboxyethyl)-1H-imidazol-3-ium 7-hydroxy-2-oxo-6-(6-oxo-6,9-dihydro-1H-purin-9-yl)-4a,6,7,7a-tetrahydro-4H-1,3,5,2λ(5)-furo[3,2-d][1,3,2λ(5)]dioxaphosphinin-2-olate], C(6)H(10)N(3)O(2)(+)·C(10)H(10)N(4)O(7)P(-), the Hoogsteen edge of the hypoxanthine (Hyp) base of cIMP and the Hyp face are engaged in specific amino acid-nucleotide (His···cIMP) recognition, i.e. by abutting edge-to-edge and by π-π stacking, respectively. The Watson-Crick edge of Hyp and the cIMP phosphate group play a role in nonspecific His···cIMP contacts. The interactions between the cIMP anions (anti/C3'-endo/trans-gauche/chair conformers) are realized mainly between riboses and phosphate groups. The results for this L-His-cIMP complex, compared with those for the previously reported solvated L-His-IMP crystal structure, indicate a different nature of amino acid-nucleotide recognition and interactions upon the 3':5'-cyclization of the nucleotide phosphate group.

  19. Pulmonary preservation studies: effects on endothelial function and pulmonary adenine nucleotides.

    Science.gov (United States)

    Paik, Hyo Chae; Hoffmann, Steven C; Egan, Thomas M

    2003-02-27

    Lung transplantation is an effective therapy plagued by a high incidence of early graft dysfunction, in part because of reperfusion injury. The optimal preservation solution for lung transplantation is unknown. We performed experiments using an isolated perfused rat lung model to test the effect of lung preservation with three solutions commonly used in clinical practice. Lungs were retrieved from Sprague-Dawley rats and flushed with one of three solutions: modified Euro-Collins (MEC), University of Wisconsin (UW), or low potassium dextran and glucose (LPDG), then stored cold for varying periods before reperfusion with Earle's balanced salt solution using the isolated perfused rat lung model. Outcome measures were capillary filtration coefficient (Kfc), wet-to-dry weight ratio, and lung tissue levels of adenine nucleotides and cyclic AMP. All lungs functioned well after 4 hr of storage. By 6 hr, UW-flushed lungs had a lower Kfc than LPDG-flushed lungs. After 8 hr of storage, only UW-flushed lungs had a measurable Kfc. Adenine nucleotide levels were higher in UW-flushed lungs after prolonged storage. Cyclic AMP levels correlated with Kfc in all groups. Early changes in endothelial permeability seemed to be better attenuated in lungs flushed with UW compared with LPDG or MEC; this was associated with higher amounts of adenine nucleotides. MEC-flushed lungs failed earlier than LPDG-flushed or UW-flushed lungs. The content of the solution may be more important for lung preservation than whether the ionic composition is intracellular or extracellular.

  20. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.