Blum, Walter; Pecze, László; Rodriguez, Janine Wörthmüller; Steinauer, Martine; Schwaller, Beat
2018-04-27
The calcium-binding protein calretinin (gene name: CALB2) is currently considered as the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). MM is a very aggressive tumor strongly linked to asbestos exposure and with no existing cure so far. The mechanisms of calretinin regulation, as well as its distinct function in MM are still poorly understood. We searched for transcription factors binding to the CALB2 promoter and modulating calretinin expression. For this, DNA-binding assays followed by peptide shotgun-mass spectroscopy analyses were used. CALB2 promoter activity was assessed by dual-luciferase reporter assays. Furthermore, we analyzed the effects of CALB2 promoter-binding proteins by lentiviral-mediated overexpression or down-regulation of identified proteins in MM cells. The modulation of expression of such proteins by butyrate was determined by subsequent Western blot analysis. Immunohistochemical analysis of embryonic mouse lung tissue served to verify the simultaneous co-expression of calretinin and proteins interacting with the CALB2 promoter during early development. Finally, direct interactions of calretinin with target proteins were evidenced by co-immunoprecipitation experiments. Septin 7 was identified as a butyrate-dependent transcription factor binding to a CALB2 promoter region containing butyrate-responsive elements (BRE) resulting in decreased calretinin expression. Accordingly, septin 7 overexpression decreased calretinin expression levels in MM cells. The regulation was found to operate bi-directionally, i.e. calretinin overexpression also decreased septin 7 levels. During murine embryonic development calretinin and septin 7 were found to be co-expressed in embryonic mesenchyme and undifferentiated mesothelial cells. In MM cells, calretinin and septin 7 colocalized during cytokinesis in distinct regions of the cleavage furrow and in the midbody region of mitotic cells. Co-immunoprecipitation experiments
Geometric Simulation Approach for Grading and Assessing the Thermostability of CALBs
Directory of Open Access Journals (Sweden)
B. Senthilkumar
2016-01-01
Full Text Available Candida antarctica lipase B (CALB is a known stable and highly active enzyme used widely in biodiesel synthesis. In this work, the stability of native (4K6G and mutant (4K5Q CALB was studied through various structural parameters using conformational sampling approach. The contours of polar surface area and surface area of mutant CALB were 11357.67 Å2 and 30007.4 Å2, respectively, showing an enhanced stability compared to native CALB with a statistically significant P value of < 0.0001. Moreover, simulated thermal denaturation of CALB, a process involving dilution of hydrogen bond, significantly shielded against different intervals of energy application in mutant CALB revealing its augmentation of structural rigidity against native CALB. Finally, computational docking analysis showed an increase in the binding affinity of CALB and its substrate (triglyceride in mutant CALB with Atomic Contact Energy (ACE of −91.23 kcal/mol compared to native CALB (ACE of −70.3 kcal/mol. The computational observations proposed that the use of mutant CALB (4K5Q could serve as a best template for production of biodiesel in the future. Additionally, it can also be used as a template to identify efficient thermostable lipases through further mutations.
Resolving the fast kinetics of cooperative binding: Ca2+ buffering by calretinin.
Directory of Open Access Journals (Sweden)
Guido C Faas
2007-11-01
Full Text Available Cooperativity is one of the most important properties of molecular interactions in biological systems. It is the ability to influence ligand binding at one site of a macromolecule by previous ligand binding at another site of the same molecule. As a consequence, the affinity of the macromolecule for the ligand is either decreased (negative cooperativity or increased (positive cooperativity. Over the last 100 years, O2 binding to hemoglobin has served as the paradigm for cooperative ligand binding and allosteric modulation, and four practical models were developed to quantitatively describe the mechanism: the Hill, the Adair-Klotz, the Monod-Wyman-Changeux, and the Koshland-Némethy-Filmer models. The predictions of these models apply under static conditions when the binding reactions are at equilibrium. However, in a physiological setting, e.g., inside a cell, the timing and dynamics of the binding events are essential. Hence, it is necessary to determine the dynamic properties of cooperative binding to fully understand the physiological implications of cooperativity. To date, the Monod-Wyman-Changeux model was applied to determine the kinetics of cooperative binding to biologically active molecules. In this model, cooperativity is established by postulating two allosteric isoforms with different binding properties. However, these studies were limited to special cases, where transition rates between allosteric isoforms are much slower than the binding rates or where binding and unbinding rates could be measured independently. For all other cases, the complex mathematical description precludes straightforward interpretations. Here, we report on calculating for the first time the fast dynamics of a cooperative binding process, the binding of Ca2+ to calretinin. Calretinin is a Ca2+-binding protein with four cooperative binding sites and one independent binding site. The Ca2+ binding to calretinin was assessed by measuring the decay of free Ca2
Calcium-binding Protein Calretinin Immunoreactivity in the Dog Superior Colliculus
International Nuclear Information System (INIS)
Lee, Jea-Young; Choi, Jae-Sik; Ahn, Chang-Hyun; Kim, In-Suk; Ha, Ji-Hong; Jeon, Chang-Jin
2006-01-01
We studied calretinin-immunoreactive (IR) fibers and cells in the canine superior colliculus (SC) and studied the distribution and effect of enucleation on the distribution of this protein. Localization of calretinin was immunocytochemically observed. A dense plexus of anti-calretinin-IR fibers was found within the upper part of the superficial gray layer (SGL). Almost all of the labeled fibers were small in diameter with few varicosities. The intermediate and deep layers contained many calretinin-IR neurons. Labeled neurons within the intermediate gray layer (IGL) formed clusters in many sections. By contrast, labeled neurons in the deep gray layer (DGL) did not form clusters. Calretinin-IR neurons in the IGL and DGL varied in morphology and included round/oval, vertical fusiform, stellate, and horizontal neurons. Neurons with varicose dendrites were also labeled in the IGL. Most of the labeled neurons were small to medium in size. Monocular enucleation produced an almost complete reduction of calretinin-IR fibers in the SC contralateral to the enucleation. However, many calretinin-IR cells appeared in the contralateral superficial SC. Enucleation appeared to have no effect on the distribution of calretinin-IR neurons in the contralateral intermediate and deep layers of the SC. The calretinin-IR neurons in the superficial dog SC were heterogeneous small- to medium-sized neurons including round/oval, vertical fusiform, stellate, pyriform, and horizontal in shape. Two-color immunofluorescence revealed that no cells in the dog SC expressed both calretinin and GABA. Many horseradish peroxidase (HRP)-labeled retinal ganglion cells were seen after injections into the superficial layers. The vast majority of the double-labeled cells (HRP and calretinin) were small cells. The present results indicate that antibody to calretinin labels subpopulations of neurons in the dog SC, which do not express GABA. The results also suggest that the calretinin-IR afferents in the
Shu, Zunpeng; Yang, Yanni; Xing, Na; Wang, Yi; Wang, Qiuhong; Kuang, Haixue
2018-02-01
A purified polysaccharide, designated CALB-4, was acquired from Fructus aurantii that is the traditional edible/medicina plant in China. The present study was performed to characterize the CALB-4 and to evaluate its immunomodulatory activities on human peripheral blood mononuclear cells (PBMCs). The structure of CALB-4 was characterized by partial acid hydrolysis, periodate oxidation, Smith degradation, and methylation analysis combined with gas chromatography-mass spectrometry (GC-MS), Infrared Spectroscopy (IR) and scanning electron microscopy (SEM). The results indicated that CALB-4 was elucidated as a pectic polysaccharide and its main chain is composed of Man, Gal UA and Gal, interspersed with Ara, Rha, Man and Gal. Furthermore, immunological tests showed that CALB-4 exhibits the immunoenhancement effects. The mechanism for this action might be attributed to the increase of the cytoplasmic concentration of pro-IL-1 via the up-regulation of several mitogen-activated protein kinases (MAPKs) and the nuclear translocation of p65. This study clarified that CALB-4 could be as an efficacious biological response modifier in immunotherapy. Copyright © 2018. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Joana S. Alves
2014-07-01
Full Text Available It is well established that the performance of lipase B from Candida antarctica (CALB as catalyst for esterification reactions may be improved by the use of ultrasound technology or by its immobilization on styrene-divinylbenzene beads (MCI-CALB. The present research evaluated the synthesis of butyl acetate using MCI-CALB under ultrasonic energy, comparing the results against those obtained using the commercial preparation, Novozym 435. The optimal conditions were determined using response surface methodology (RSM evaluating the following parameters: reaction temperature, substrate molar ratio, amount of biocatalyst, and added water. The optimal conditions for butyl acetate synthesis catalyzed by MCI-CALB were: temperature, 48.8 °C; substrate molar ratio, 3.46:1 alcohol:acid; amount of biocatalyst, 7.5%; and added water 0.28%, both as substrate mass. Under these conditions, 90% of conversion was reached in 1.5 h. In terms of operational stability, MCI-CALB was reused in seven cycles while keeping 70% of its initial activity under ultrasonic energy. The support pore size and resistance are key points for the enzyme activity and stability under mechanical stirring. The use of ultrasound improved both activity and stability because of better homogeneity and reduced mechanical stress to the immobilized system.
Foda, Abd AlRahman Mohammad; El-Hawary, Amira Kamal; Hamed, Hazem
2016-10-01
CRC is a heterogeneous disease in terms of morphology, invasive behavior, metastatic capacity, and clinical outcome. Recently, many so-called mesothelial markers, including calretinin, D2-40, WT1, thrombomodulin, mesothelin, and others, have been certified. The aim of this study was to assess the immunohistochemical expression of calretinin and other mesothelial markers (D2-40 and mesothelin) in colorectal mucinous adenocarcinoma (MA) and non mucinous adenocarcinoma (NMA) specimens and relation to clinicopathological features and prognosis using manual tissue microarray technique. We studied tumor tissue specimens from 150 patients with colorectal MA and NMA who underwent radical surgery from January 2007 to January 2012. High-density manual tissue microarrays were constructed using a modified mechanical pencil tip technique, and paraffin sections were submitted for immunohistochemistry using Calretinin, D2-40 and mesothelin expressions. We found that NMA showed significantly more calretinin and D2-40 expression than MA In contrast, no statistically significant difference between NMA and MA was detected in mesothelin expression. There were no statistically significant relations between any of the clinicopathological or histological parameters and any of the three markers. In a univariate analysis, neither calretinin nor D2-40 expressions showed any significant relations to DFS or OS. However, mesothelin luminal expression was significantly associated with worse DFS. Multivariate Cox regression analysis proved that luminal mesothelin expression was an independent negative prognostic factor in NMA. In conclusion, Calretinin, D2-40 and mesothelin are aberrantly expressed in a proportion of CRC cases with more expression in NMA than MA. Aberrant expression of these mesothelial markers was not associated with clinicopathological or histological features of CRCs. Only mesothelin expression appears to be a strong predictor of adverse prognosis.
Directory of Open Access Journals (Sweden)
Lokendra Yadav
2014-01-01
Full Text Available Background: Acetylcholinesterase (AChE histochemistry on rectal mucosal biopsies accurately diagnoses Hirschsprung disease (HD, but is not widely employed as it requires special tissue handling and pathologist expertise. Calretinin immunohistochemistry (IHC has been reported to be comparable to AChE staining with the loss of expression correlating with aganglionosis. Aim: The aim was to evaluate calretinin IHC as a primary diagnostic tool in comparison to the improvised rapid AChE technique in the diagnosis of HD. Materials and Methods: A total of 74 rectal biopsies (18 fresh frozen - 18 cases, 56 formalin fixed - 33 cases from 51 cases of suspect HD were evaluated with hematoxylin and eosin/AChE/Calretinin. Ten biopsies each from ganglionated and aganglionated segments served as positive and negative controls. Ileal (3, appendiceal (3 and ring bowel (2 biopsies were also included. Two pathologists blinded to the clinical details evaluated the histomorphology with AChE and calretinin. Observations were statistically analyzed and Cohen′s k coefficient employed to assess agreement between two pathologists and calretinin and the AChE. Results: The study confirmed HD in 26 and non-HD in 25 cases. There were 7 neonates, 5 low level biopsies and 14 "inadequate" biopsies. The results of calretinin were comparable with AChE with a statistically significant measure of agreement of k = 0.973 between the two. One false-positive case of HD was noted with calretinin. The advantages and disadvantages of calretinin versus AChE are discussed. Conclusion: Calretinin is a reliable single immune marker for ruling out HD by its specific positive mucosal staining of formalin fixed rectal biopsy. The improvised AChE staining remains indispensable to confirm HD on fresh biopsies and thus, along with calretinin IHC maximizes the diagnostic accuracy of HD in difficult cases.
D'Silva, Shaloom; Sumathi, M K; Balaji, N; Shetty, Nisha K N; Pramod, K M; Cheeramelil, Jacob
2013-12-01
Calretinin a 29-kDa calcium binding protein is expressed widely in normal human tissue and tumours including amelobastoma. The objective of this study was to determine calretinin expression in heamatoxylin and eosin diagnosed cases of ameloblastoma and non-neoplastic odontogenic cysts. The lining epithelium in 3 cases of radicular cysts, 5 cases of odontogenic keratocysts, 5 cases of dentigerous cysts and 11 cases of ameloblastomas were examined for expression of calretinin. No positive epithelial staining was observed in radicular and dentigerous cysts. In comparison, however 100% of cases of ameloblastomas and 40% of cases of odontogenic karatocysts showed positive calretinin expression. Calretinin may be a specific immunohistochemical marker for ameloblastoma. If there is any possible relation between calretinin expression and neural origin of the odontogenic epithelium and its neoplastic transformation and if calretinin could be used as an early marker to predict the tendency of neoplastic change of odontogenic epithelium could be answered through further researches. How to cite this article: D'Silva S, Sumathi MK, Balaji N, Shetty NK, Pramod KM, Cheeramelil J. Evaluation of Calretinin expression in Ameloblastoma and Non-Neoplastic Odontogenic Cysts - An immunohistochemical study. J Int Oral Health 2013; 5(6):42-8 .
Nicolás, Paula; Lassalle, Verónica L; Ferreira, María L
2017-02-01
The aim of this manuscript was to study the application of a new method of protein quantification in Candida antarctica lipase B commercial solutions. Error sources associated to the traditional Bradford technique were demonstrated. Eight biocatalysts based on C. antarctica lipase B (CALB) immobilized onto magnetite nanoparticles were used. Magnetite nanoparticles were coated with chitosan (CHIT) and modified with glutaraldehyde (GLUT) and aminopropyltriethoxysilane (APTS). Later, CALB was adsorbed on the modified support. The proposed novel protein quantification method included the determination of sulfur (from protein in CALB solution) by means of Atomic Emission by Inductive Coupling Plasma (AE-ICP). Four different protocols were applied combining AE-ICP and classical Bradford assays, besides Carbon, Hydrogen and Nitrogen (CHN) analysis. The calculated error in protein content using the "classic" Bradford method with bovine serum albumin as standard ranged from 400 to 1200% when protein in CALB solution was quantified. These errors were calculated considering as "true protein content values" the results of the amount of immobilized protein obtained with the improved method. The optimum quantification procedure involved the combination of Bradford method, ICP and CHN analysis. Copyright © 2016 Elsevier Inc. All rights reserved.
Calretinin as a marker for premotor neurons involved in upgaze in human brainstem
Directory of Open Access Journals (Sweden)
Christopher eAdamczyk
2015-12-01
Full Text Available Eye movements are generated by different premotor pathways. Damage to them can cause specific deficits of eye movements, such as saccades. For correlative clinico-anatomical post-mortem studies of cases with eye movement disorders it is essential to identify the functional cell groups of the oculomotor system in the human brain by marker proteins. Based on monkey studies, the premotor neurons of the saccadic system can be identified by the histochemical markers parvalbumin and perineuronal nets in humans. These areas involve the interstitial nucleus of Cajal (INC and the rostral interstitial nucleus of the medial longitudinal fascicle (RIMLF, which both contain premotor neurons for upgaze and downgaze. Recent monkey and human studies revealed a selective excitatory calretinin-positive input to the motoneurons mediating upgaze, but not to those for downgaze. Three premotor regions were identified as sources of calretinin input in monkey: y-group, INC and RIMLF. These findings suggest that the expression pattern of parvalbumin and calretinin may help to identify premotor neurons involved in up- or downgaze. In a post-mortem study of five human cases without neurological diseases we investigated the y-group, INC and RIMLF for the presence of parvalbumin and calretinin positive neurons including their co-expression. Adjacent thin paraffin sections were stained for the aggrecan component of perineuronal nets, parvalbumin or calretinin and glutamate decarboxylase. The comparative analysis of scanned thin sections of INC and RIMLF revealed medium-sized parvalbumin positive neurons with and without calretinin coexpression, which were intermingled. The parvalbumin/calretinin positive neurons in both nuclei are considered as excitatory premotor upgaze neurons. Accordingly, the parvalbumin-positive neurons lacking calretinin are considered as premotor downgaze neurons in RIMLF, but may in addition include inhibitory premotor upgaze neurons in the INC as
International Nuclear Information System (INIS)
Kalsoom, F.; Atique, M.; Ahmed, S.
2015-01-01
To determine calretinin expression by immunohistochemistry in ameloblastoma and keratocystic odontogenic tumors (KCOT) and to document the use of calretinin as a differentiating marker between the two lesions. Study Design: A cross sectional study conducted on previously diagnosed cases of ameloblastoma and Keratocystic odontogenic tumour. Place and Duration of Study: Armed forces Institute of Pathology, Rawalpindi Pakistan and duration was one year. (Sep 2009- Aug 2010). Materials and Methods: Twenty cases each of Ameloblastoma and KCOT were retrieved from the record files along with their paraffin embedded blocks. Histological features of all the cases were reviewed on freshly prepared slides and a fresh diagnosis made regardless of the previous diagnosis. The immunohistochemical marker, Calretinin, was applied on both types of cases using the avidin-biotinylated peroxidase complex method. The results were interpreted. Results: In the cases of Ameloblastoma the epithelial tumour nests showed positivity for Calretinin expression. In 85% cases; intense and diffuse staining was observed in more than 80% of the stellate reticulum like cells while 15% cases showed focal and moderate staining patterns. On the other hand KCOT showed contrary results as none of epithelial lining expressed positive staining for Calretinin, (p<0.001). Conclusion: Calretinin can be used as a useful marker for Ameloblastoma and can be used to differentiate KCOT from Ameloblastoma. (author)
Finno, C J; Valberg, S J; Shivers, J; D'Almeida, E; Armién, A G
2016-01-01
Equine degenerative myeloencephalopathy (EDM) is characterized by a symmetric general proprioceptive ataxia in young horses, and is likely underdiagnosed for 2 reasons: first, clinical signs overlap those of cervical vertebral compressive myelopathy; second, histologic lesions--including axonal spheroids in specific tracts of the somatosensory and motor systems--may be subtle. The purpose of this study was (1) to utilize immunohistochemical (IHC) markers to trace axons in the spinocuneocerebellar, dorsal column-medial lemniscal, and dorsospinocerebellar tracts in healthy horses and (2) to determine the IHC staining characteristics of the neurons and degenerated axons along the somatosensory tracts in EDM-affected horses. Examination of brain, spinal cord, and nerves was performed on 2 age-matched control horses, 3 EDM-affected horses, and 2 age-matched disease-control horses via IHC for calbindin, vesicular glutamate transporter 2, parvalbumin, calretinin, glutamic acid decarboxylase, and glial fibrillary acidic protein. Primary afferent axons of the spinocuneocerebellar, dorsal column-medial lemniscal, and dorsospinocerebellar tracts were successfully traced with calretinin. Calretinin-positive cell bodies were identified in a subset of neurons in the dorsal root ganglia, suggesting that calretinin IHC could be used to trace axonal projections from these cell bodies. Calretinin-immunoreactive spheroids were present in EDM-affected horses within the nuclei cuneatus medialis, cuneatus lateralis, and thoracicus. Neurons within those nuclei were calretinin negative. Cell bodies of degenerated axons in EDM-affected horses are likely located in the dorsal root ganglia. These findings support the role of sensory axonal degeneration in the pathogenesis of EDM and provide a method to highlight tracts with axonal spheroids to aid in the diagnosis of this neurodegenerative disease. © The Author(s) 2015.
Directory of Open Access Journals (Sweden)
Daniela eCamillo
2014-09-01
Full Text Available Calretinin is a calcium-binding protein often used as a marker for a subset of inhibitory interneurons in the mammalian neocortex. We studied the labeled cells in offspring from a cross of a Cre-dependent reporter line with the CR-ires-Cre mice, which express Cre-recombinase in the same pattern as calretinin. We found that in the mature visual cortex, only a minority of the cells that have expressed calretinin and Cre-recombinase during their lifetime is GABAergic and only about 20% are immunoreactive for calretinin. The reason behind this is that calretinin is transiently expressed in many cortical pyramidal neurons during development. To determine whether neurons that express or have expressed calretinin share any distinct functional characteristics, we recorded their visual response properties using GCaMP6s calcium imaging. The average orientation selectivity, size tuning, and temporal and spatial frequency tuning of this group of cells, however, match the response profile of the general neuronal population, revealing the lack of functional specialization for the features studied.
Calretinin immunoreactivity in the claustrum of the rat
Czech Academy of Sciences Publication Activity Database
Druga, Rastislav; Salaj, M.; Barinka, F.; Edelstein, L.; Kubová, Hana
2015-01-01
Roč. 8, Jan 20 (2015), s. 160 ISSN 1662-5129 R&D Projects: GA ČR(CZ) GA304/07/1137; GA ČR(CZ) GAP302/10/0971; GA ČR(CZ) GBP304/12/G069 Institutional support: RVO:67985823 Keywords : calcium-binding proteins * calretinin * claustrum * endopiriform nucleus Subject RIV: FH - Neurology Impact factor: 3.260, year: 2015
Directory of Open Access Journals (Sweden)
Sara Peirce
2016-06-01
Full Text Available Lipase B from Candida antarctica (CALB was immobilized on octyl agarose (OC and physically modified with polyethyleneimine (PEI in order to confer a strong ion exchange character to the enzyme and thus enable the immobilization of other enzymes on its surface. The enzyme activity was fully maintained during the coating and the thermal stability was marginally improved. The enzyme release from the support by incubation in the non-ionic detergent Triton X-100 was more difficult after the PEI-coating, suggesting that some intermolecular physical crosslinking had occurred, making this desorption more difficult. Thermal stability was marginally improved, but the stability of the OCCALB-PEI was significantly better than that of OCCALB during inactivation in mixtures of aqueous buffer and organic cosolvents. SDS-PAGE analysis of the inactivated biocatalyst showed the OCCALB released some enzyme to the medium during inactivation, and this was partially prevented by coating with PEI. This effect was obtained without preventing the possibility of reuse of the support by incubation in 2% ionic detergents. That way, this modified CALB not only has a strong anion exchange nature, while maintaining the activity, but it also shows improved stability under diverse reaction conditions without affecting the reversibility of the immobilization.
Czech Academy of Sciences Publication Activity Database
Salaj, M.; Druga, Rastislav; Cerman, J.; Kubová, Hana; Barinka, F.
2015-01-01
Roč. 1627, Nov 19 (2015), s. 201-215 ISSN 0006-8993 R&D Projects: GA ČR(CZ) GBP304/12/G069 Institutional support: RVO:67985823 Keywords : retrosplenial cortex * calretinin * parvalbumin * interneurons * calcium-binding proteins * perirhinal cortex Subject RIV: FH - Neurology Impact factor: 2.561, year: 2015
Rivera, Patricia; Arrabal, Sergio; Vargas, Antonio; Blanco, Eduardo; Serrano, Antonia; Pavón, Francisco J.; Rodríguez de Fonseca, Fernando; Suárez, Juan
2014-01-01
The N-acylethanolamines (NAEs), oleoylethanolamide (OEA) and palmithylethanolamide (PEA) are known to be endogenous ligands of PPARα receptors, and their presence requires the activation of a specific phospholipase D (NAPE-PLD) associated with intracellular Ca2+ fluxes. Thus, the identification of a specific population of NAPE-PLD/PPARα-containing neurons that express selective Ca2+-binding proteins (CaBPs) may provide a neuroanatomical basis to better understand the PPARα system in the brain. For this purpose, we used double-label immunofluorescence and confocal laser scanning microscopy for the characterization of the co-existence of NAPE-PLD/PPARα and the CaBPs calbindin D28k, calretinin and parvalbumin in the rat hippocampus. PPARα expression was specifically localized in the cell nucleus and, occasionally, in the cytoplasm of the principal cells (dentate granular and CA pyramidal cells) and some non-principal cells of the hippocampus. PPARα was expressed in the calbindin-containing cells of the granular cell layer of the dentate gyrus (DG) and the SP of CA1. These principal PPARα+/calbindin+ cells were closely surrounded by NAPE-PLD+ fiber varicosities. No pyramidal PPARα+/calbindin+ cells were detected in CA3. Most cells containing parvalbumin expressed both NAPE-PLD and PPARα in the principal layers of the DG and CA1/3. A small number of cells containing PPARα and calretinin was found along the hippocampus. Scattered NAPE-PLD+/calretinin+ cells were specifically detected in CA3. NAPE-PLD+ puncta surrounded the calretinin+ cells localized in the principal cells of the DG and CA1. The identification of the hippocampal subpopulations of NAPE-PLD/PPARα-containing neurons that express selective CaBPs should be considered when analyzing the role of NAEs/PPARα-signaling system in the regulation of hippocampal functions. PMID:24672435
Directory of Open Access Journals (Sweden)
Khusna Widhyahrini
2017-10-01
How to Cite: Widhyahrini, K., Handayani, N., Wahyuningrum, D., Nurbaiti, S., Radiman, C.L. (2017. The Microwave-assisted Synthesis of Polyethersulfone (PES as A Matrix in Immobilization of Candida antarctica Lipase B (Cal-B. Bulletin of Chemical Reaction Engineering & Catalysis, 12(3: 343-350 (doi:10.9767/bcrec.12.3.774.343-350
Fosser, Nicolás Sebastián; Ronco, Laura; Bejarano, Alejandro; Paganelli, Alejandra R; Ríos, Hugo
2013-07-01
Members of the family of calcium binding proteins (CBPs) are involved in the buffering of calcium (Ca2+) by regulating how Ca2+ can operate within synapses or more globally in the entire cytoplasm and they are present in a particular arrangement in all types of retinal neurons. Calbindin D28k and calretinin belong to the family of CBPs and they are mainly co-expressed with other CBPs. Calbindin D28k is expressed in doubles cones, bipolar cells and in a subpopulation of amacrine and ganglion neurons. Calretinin is present in horizontal cells as well as in a subpopulation of amacrine and ganglion neurons. Both proteins fill the soma at the inner nuclear layer and the neuronal projections at the inner plexiform layer. Moreover, calbindin D28k and calretinin have been associated with neuronal plasticity in the central nervous system. During pre and early postnatal visual development, the visual system shows high responsiveness to environmental influences. In this work we observed modifications in the pattern of stratification of calbindin immunoreactive neurons, as well as in the total amount of calbindin through the early postnatal development. In order to test whether or not calbindin is involved in retinal plasticity we analyzed phosphorylated p38 MAPK expression, which showed a decrease in p-p38 MAPK, concomitant to the observed decrease of calbindin D28k. Results showed in this study suggest that calbindin is a molecule related with neuroplasticity, and we suggest that calbindin D28k has significant roles in neuroplastic changes in the retina, when retinas are stimulated with different light conditions. Copyright © 2013 Wiley Periodicals, Inc.
In silico screening of 393 mutants facilitates enzyme engineering of amidase activity in CalB
DEFF Research Database (Denmark)
Hediger, Martin Robert; De Vico, Luca; Rannes, Julie Bille
2013-01-01
Our previously presented method for high throughput computational screening of mutant activity (Hediger et al., 2012) is benchmarked against experimentally measured amidase activity for 22 mutants of Candida antarctica lipase B (CalB). Using an appropriate cutoff criterion for the computed barriers......, the qualitative activity of 15 out of 22 mutants is correctly predicted. The method identifies four of the six most active mutants with ≥3-fold wild type activity and seven out of the eight least active mutants with ≤0.5-fold wild type activity. The method is further used to screen all sterically possible (386......) double-, triple- and quadruple-mutants constructed from the most active single mutants. Based on the benchmark test at least 20 new promising mutants are identified....
Directory of Open Access Journals (Sweden)
Han Mingbo
2006-08-01
Full Text Available Abstract Background Cognitive performance declines with increasing age. Possible cellular mechanisms underlying this age-related functional decline remain incompletely understood. Early studies attributed this functional decline to age-related neuronal loss. Subsequent studies using unbiased stereological techniques found little or no neuronal loss during aging. However, studies using specific cellular markers found age-related loss of specific neuronal types. To test whether there is age-related loss of specific neuronal populations in the hippocampus, and subsequently, whether over-expression of the B-cell lymphoma protein-2 (Bcl-2 in these neurons could delay possible age-related neuronal loss, we examined calretinin (CR positive neurons in the mouse dentate gyrus during aging. Result In normal mice, there was an age-related loss of CR positive cells in the dentate gyrus. At the same region, there was no significant decrease of total numbers of neurons, which suggested that age-related loss of CR positive cells was due to the decrease of CR expression in these cells instead of cell death. In the transgenic mouse line over-expressing Bcl-2 in neurons, there was an age-related loss of CR positive cells. Interestingly, there was also an age-related neuronal loss in this transgenic mouse line. Conclusion These data suggest an age-related loss of CR positive neurons but not total neuronal loss in normal mice and this age-related neuronal change is not prevented by Bcl-2 over-expression.
Bioreduction of substituted α-tetralones promoted by Daucus carota root
International Nuclear Information System (INIS)
Ferraz, Helena M.C.; Bianco, Graziela G.; Bombonato, Fernanda I.; Andrade, Leandro H.; Porto, Andre L.M.
2008-01-01
The bioreduction of a series of substituted α-tetralones, carried out using Daucus carota root (carrot), afforded the corresponding homochiral α-tetralols in variable conversions (9 to 90%) and excellent enantiomeric excesses. Two of the assayed α-tetralones were resistant to the bioreduction conditions. The absolute configurations of four α-tetralols were assigned as being (S), by comparison to the (S)-enantiomers obtained by kinetic resolution promoted by CALB-catalysed acetylation. Additionally, the new 5-methoxy-6-methyl-1-tetralone was synthesized in seven steps from 3-methylsalicylic acid. (author)
Barreiro-Iglesias, Antón; Villar-Cerviño, Verona; Villar-Cheda, Begoña; Anadón, Ramón; Rodicio, María Celina
2008-12-01
Neuroactive substances such as serotonin and other monoamines have been suggested to be involved in the transmission of gustatory signals from taste bud cells to afferent fibers. Lampreys are the earliest vertebrates that possess taste buds, although these differ in structure from taste buds in jawed vertebrates, and their neurochemistry remains unknown. We used immunofluorescence methods with antibodies raised against serotonin, tyrosine hydroxylase (TH), gamma-aminobutyric acid (GABA), glutamate, calcitonin gene-related peptide (CGRP), neuropeptide Y (NPY), calretinin, and acetylated alpha-tubulin to characterize the neurochemistry and innervation of taste buds in the sea lamprey, Petromyzon marinus L. For localization of proliferative cells in taste buds we used bromodeoxyuridine labeling and proliferating cell nuclear antigen immunohistochemistry. Results with both markers indicate that proliferating cells are restricted to a few basal cells and that almost all cells in taste buds are nonproliferating. A large number of serotonin-, calretinin-, and CGRP-immunoreactive bi-ciliated cells were revealed in lamprey taste buds. This suggests that serotonin participates in the transmission of gustatory signals and indicates that this substance appeared early on in vertebrate evolution. The basal surface of the bi-ciliated taste bud cells was contacted by tubulin-immunoreactive fibers. Some of the fibers surrounding the taste bud were calretinin immunoreactive. Lamprey taste bud cells or afferent fibers did not exhibit TH, GABA, glutamate, or NPY immunoreactivity, which suggests that expression of these substances evolved in taste buds of some gnathostomes lines after the separation of gnathostomes and lampreys. (c) 2008 Wiley-Liss, Inc.
Fgf signaling controls pharyngeal taste bud formation through miR-200 and Delta-Notch activity.
Kapsimali, Marika; Kaushik, Anna-Lila; Gibon, Guillaume; Dirian, Lara; Ernest, Sylvain; Rosa, Frederic M
2011-08-01
Taste buds, the taste sensory organs, are conserved in vertebrates and composed of distinct cell types, including taste receptor, basal/presynaptic and support cells. Here, we characterize zebrafish taste bud development and show that compromised Fgf signaling in the larva results in taste bud reduction and disorganization. We determine that Fgf activity is required within pharyngeal endoderm for formation of Calb2b(+) cells and reveal miR-200 and Delta-Notch signaling as key factors in this process. miR-200 knock down shows that miR-200 activity is required for taste bud formation and in particular for Calb2b(+) cell formation. Compromised delta activity in mib(-/-) dramatically reduces the number of Calb2b(+) cells and increases the number of 5HT(+) cells. Conversely, larvae with increased Notch activity and ascl1a(-/-) mutants are devoid of 5HT(+) cells, but have maintained and increased Calb2b(+) cells, respectively. These results show that Delta-Notch signaling is required for intact taste bud organ formation. Consistent with this, Notch activity restores Calb2b(+) cell formation in pharyngeal endoderm with compromised Fgf signaling, but fails to restore the formation of these cells after miR-200 knock down. Altogether, this study provides genetic evidence that supports a novel model where Fgf regulates Delta-Notch signaling, and subsequently miR-200 activity, in order to promote taste bud cell type differentiation.
The complexity of the calretinin-expressing progenitors in the human cerebral cortex
Directory of Open Access Journals (Sweden)
Nevena V Radonjic
2014-08-01
Full Text Available The complex structure and function of the cerebral cortex critically depend on the balance of excitation and inhibition provided by the pyramidal projection neurons and GABAergic interneurons, respectively. The calretinin-expressing (CalR+ cell is a subtype of GABAergic cortical interneurons that is more prevalent in humans than in rodents. In rodents, CalR+ interneurons originate in the caudal ganglionic eminence (CGE from Gsx2+ progenitors, but in humans it has been suggested that a subpopulation of CalR+ cells can also be generated in the cortical ventricular/subventricular zone (VZ/SVZ. The progenitors for cortically generated CalR+ subpopulation in primates are not yet characterized. Hence, the aim of this study was to identify patterns of expression of the transcription factors (TFs that commit cortical stem cells to the CalR fate, with a focus on Gsx2. First, we studied the expression of Gsx2 and its downstream effectors, Ascl1 and Sp8 in the cortical regions of the fetal human forebrain at midgestation. Next, we established that a subpopulation of cells expressing these TFs are proliferating in the cortical SVZ, and can be co-labeled with CalR. The presence and proliferation of Gsx2+ cells, not only in the ventral telencephalon (GE as previously reported, but also in the cerebral cortex suggests cortical origin of a subpopulation of CalR+ neurons in humans. In vitro treatment of human cortical progenitors with Sonic hedgehog (Shh, an important morphogen in the specification of interneurons, decreased levels of Ascl1 and Sp8 proteins, but did not affect Gsx2 levels. Taken together, our ex-vivo and in vitro results on human fetal brain suggest complex endogenous and exogenous regulation of TFs implied in the specification of different subtypes of CalR+ cortical interneurons.
Global Proteomic Analysis of Brain Tissues in Transient Ischemia Brain Damage in Rats
Directory of Open Access Journals (Sweden)
Jiann-Hwa Chen
2015-05-01
Full Text Available Ischemia-reperfusion injury resulting from arterial occlusion or hypotension in patients leads to tissue hypoxia with glucose deprivation, which causes endoplasmic reticulum (ER stress and neuronal death. A proteomic approach was used to identify the differentially expressed proteins in the brain of rats following a global ischemic stroke. The mechanisms involved the action in apoptotic and ER stress pathways. Rats were treated with ischemia-reperfusion brain injuries by the bilateral occlusion of the common carotid artery. The cortical neuron proteins from the stroke animal model (SAM and the control rats were separated using two-dimensional gel electrophoresis (2-DE to purify and identify the protein profiles. Our results demonstrated that the SAM rats experienced brain cell death in the ischemic core. Fifteen proteins were expressed differentially between the SAM rats and control rats, which were assayed and validated in vivo and in vitro. Interestingly, the set of differentially expressed, down-regulated proteins included catechol O-methyltransferase (COMT and cathepsin D (CATD, which are implicated in oxidative stress, inflammatory response and apoptosis. After an ischemic stroke, one protein spot, namely the calretinin (CALB2 protein, showed increased expression. It mediated the effects of SAM administration on the apoptotic and ER stress pathways. Our results demonstrate that the ischemic injury of neuronal cells increased cell cytoxicity and apoptosis, which were accompanied by sustained activation of the IRE1-alpha/TRAF2, JNK1/2, and p38 MAPK pathways. Proteomic analysis suggested that the differential expression of CALB2 during a global ischemic stroke could be involved in the mechanisms of ER stress-induced neuronal cell apoptosis, which occurred via IRE1-alpha/TRAF2 complex formation, with activation of JNK1/2 and p38 MAPK. Based on these results, we also provide the molecular evidence supporting the ischemia
Vugler, Anthony A; Coffey, Peter J
2003-11-01
The retinae of dystrophic Royal College of Surgeons (RCS) rats exhibit progressive photoreceptor degeneration accompanied by pathology of ganglion cells. To date, little work has examined the consequences of retinal degeneration for central visual structures in dystrophic rats. Here, we use immunohistochemistry for calretinin (CR) to label retinal afferents in the superior colliculus (SC), lateral geniculate nucleus, and olivary pretectal nucleus of RCS rats aged between 2 and 26 months of age. Early indications of fiber loss in the medial dystrophic SC were apparent between 9 and 13 months. Quantitative methods reveal a significant reduction in the level of CR immunoreactivity in visual layers of the medial dystrophic SC at 13 months (P animals aged 19-26 months the loss of CR fibers in SC was dramatic, with well-defined patches of fiber degeneration predominating in medial aspects of the structure. This fiber degeneration in SC was accompanied by increased detection of cells immunoreactive for CR. In several animals, regions of fiber loss were also found to contain strongly parvalbumin-immunoreactive cells. Loss of CR fibers was also observed in the lateral geniculate nucleus and olivary pretectal nucleus. Patterns of fiber loss in the dystrophic SC compliment reports of ganglion cell degeneration in these animals and the response of collicular neurons to degeneration is discussed in terms of plasticity of the dystrophic visual system and properties of calcium binding proteins.
Increased anxiety and fear memory in adult mice lacking type 2 deiodinase.
Bárez-López, Soledad; Montero-Pedrazuela, Ana; Bosch-García, Daniel; Venero, César; Guadaño-Ferraz, Ana
2017-10-01
A euthyroid state in the brain is crucial for its adequate development and function. Impairments in thyroid hormones (THs; T3 or 3,5,3'-triiodothyronine and T4 or thyroxine) levels and availability in brain can lead to neurological alterations and to psychiatric disorders, particularly mood disorders. The thyroid gland synthetizes mainly T4, which is secreted to circulating blood, however, most actions of THs are mediated by T3, the transcriptionally active form. In the brain, intracellular concentrations of T3 are modulated by the activity of type 2 (D2) and type 3 (D3) deiodinases. In the present work, we evaluated learning and memory capabilities and anxiety-like behavior at adult stages in mice lacking D2 (D2KO) and we analyzed the impact of D2-deficiency on TH content and on the expression of T3-dependent genes in the amygdala and the hippocampus. We found that D2KO mice do not present impairments in spatial learning and memory, but they display emotional alterations with increased anxiety-like behavior as well as enhanced auditory-cued fear memory and spontaneous recovery of fear memory following extinction. D2KO mice also presented reduced T3 content in the hippocampus and decreased expression of the T3-dependent gene Dio3 in the amygdala suggesting a hypothyroid status in this structure. We propose that the emotional dysfunctions found in D2KO mice can arise from the reduced T3 content in their brain, which consequently leads to alterations in gene expression with functional consequences. We found a downregulation in the gene encoding for the calcium-binding protein calretinin (Calb2) in the amygdala of D2KO mice that could affect the GABAergic transmission. The current findings in D2KO mice can provide insight into emotional disorders present in humans with DIO2 polymorphisms. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Alvaro eGarcía-Aviles
2015-03-01
Full Text Available Methylphenidate (MPD is a commonly administered drug to treat children suffering from attention deficit hyperactivity disorder (ADHD. Alterations in septal driven hippocampal theta rhythm may underlie attention deficits observed in these patients. Amongst others, the septo-hippocampal connections have long been acknowledged to be important in preserving hippocampal function. Thus, we wanted to ascertain if methylphenidate administration, which improves attention in patients, could affect septal areas connecting with hippocampus. We used low and orally administered methylphenidate doses (1.3; 2.7 and 5mg/Kg to rats what mimics the dosage range in humans. In our model, we observed no effect when using 1.3mg/Kg methylphenidate; whereas 2.7 and 5 mg/Kg induced a significant increase in c-fos expression specifically in the medial septum, an area intimately connected to the hippocampus. We analyzed dopaminergic areas such as nucleus accumbens and striatum, and found that only 5mg/Kg induced c-fos levels increase. In these areas tyrosine hydroxylase correlated well with c-fos staining, whereas in the medial septum the sparse tyrosine hydroxylase fibres did not overlap with c-fos positive neurons. Double immunofluorescence of c-fos with neuronal markers in the septal area revealed that co-localization with choline acethyl transferase, parvalbumin, and calbindin with c-fos did not change with MPD treatment; whereas, calretinin and c-fos double labeled neurons increased after MPD administration. Altogether, these results suggest that low and acute doses of methylphenidate primary target specific populations of caltretinin medial septal neurons.
Salaj, Martin; Druga, Rastislav; Cerman, Jiří; Kubová, Hana; Barinka, Filip
2015-11-19
The retrosplenial cortex (RSC) is a mesocortical region broadly involved with memory and navigation. It shares many characteristics with the perirhinal cortex (PRC), both of which appear to be significantly involved in the spreading of epileptic activity. We hypothesized that RSC possesses an interneuronal composition similar to that of PRC. To prove the hypothesis we studied the general pattern of calretinin (CR) and parvalbumin (PV) immunoreactivity in the RSC of the rat brain, its optical density as well as the morphological features and density of CR- and PV-immunoreactive (CR+ and PV+) interneurons. We also analyzed the overall neuronal density on Nissl-stained sections in RSC. Finally, we compared our results with our earlier analysis of PRC (Barinka et al., 2012). Compared to PRC, RSC was observed to have a higher intensity of PV staining and lower intensity of CR staining of neuropil. Vertically-oriented bipolar neurons were the most common morphological type among CR+ neurons. The staining pattern did not allow for a similarly detailed analysis of somatodendritic morphology of PV+ neurons. RSC possessed lower absolute (i.e., neurons/mm(3)) and relative (i.e., percentage of the overall neuronal population) densities of CR+ neurons and similar absolute and lower relative densities of PV+ neurons relative to PRC. CR: PV neuronal ratio in RSC (1:2 in area 29 and 1:2.2 in area 30) differed from PRC (1:1.2 in area 35 and 1:1.7 in area 36). In conclusion, RSC, although similar in many aspects to PRC, differs strikingly in the interneuronal composition relative to PRC. Copyright © 2015 Elsevier B.V. All rights reserved.
Immobilization of Candida antarctica Lipase B by Covalent Attachment to Green Coconut Fiber
Brígida, Ana I. S.; Pinheiro, Álvaro D. T.; Ferreira, Andrea L. O.; Pinto, Gustavo A. S.; Gonçalves, Luciana R. B.
The objective of this study was to covalently immobilize Candida antarctica type B lipase (CALB) onto silanized green coconut fibers. Variables known to control the number of bonds between enzyme and support were evaluated including contact time, pH, and final reduction with sodium borohydride. Optimal conditions for lipase immobilization were found to be 2h incubation at both pH 7.0 and 10.0. Thermal stability studies at 60°C showed that the immobilized lipase prepared at pH 10.0 (CALB-10) was 363-fold more stable than the soluble enzyme and 5.4-fold more stable than the biocatalyst prepared at pH 7.0 (CALB-7). CALB-7 was found to have higher specific activity and better stability when stored at 5°C. When sodium borohydride was used as reducing agent on CALB-10 there were no improvement in storage stability and at 60°C stability was reduced for both CALB-7 and CALB-10.
Immobilization of Candida antarctica Lipase B by Adsorption to Green Coconut Fiber
Brígida, Ana I. S.; Pinheiro, Álvaro D. T.; Ferreira, Andrea L. O.; Gonçalves, Luciana R. B.
An agroindustrial residue, green coconut fiber, was evaluated as support for immobilization of Candida antarctica type B (CALB) lipase by physical adsorption. The influence of several parameters, such as contact time, amount of enzyme offered to immobilization, and pH of lipase solution was analyzed to select a suitable immobilization protocol. Kinetic constants of soluble and immobilized lipases were assayed. Thermal and operational stability of the immobilized enzyme, obtained after 2 h of contact between coconut fiber and enzyme solution, containing 40 U/ml in 25 mM sodium phosphate buffer pH 7, were determined. CALB immobilization by adsorption on coconut fiber promoted an increase in thermal stability at 50 and 60 °C, as half-lives (t 1/2) of the immobilized enzyme were, respectively, 2- and 92-fold higher than the ones for soluble enzyme. Furthermore, operational stabilities of methyl butyrate hydrolysis and butyl butyrate synthesis were evaluated. After the third cycle of methyl butyrate hydrolysis, it retained less than 50% of the initial activity, while Novozyme 435 retained more than 70% after the tenth cycle. However, in the synthesis of butyl butyrate, CALB immobilized on coconut fiber showed a good operational stability when compared to Novozyme 435, retaining 80% of its initial activity after the sixth cycle of reaction.
Shang, Chuan-Yang; Li, Wei-Xun; Zhang, Rui-Feng
2014-01-01
ZnO nanowires were successfully introduced into a macroporous SiO2 by in situ hydrothermal growth in 3D pores. The obtained composites were characterized by SEM and XRD, and used as supports to immobilize Candida antarctica lipase B (CALB) through adsorption. The high specific surface area (233 m(2)/g) and strong electrostatic interaction resulted that the average loading amount of the composite supports (196.8 mg/g) was 3-4 times of that of macroporous SiO2 and approximate to that of a silica-based mesoporous material. Both adsorption capacity and the activity of the CALB immobilized on the composite supports almost kept unchanged as the samples were soaked in buffer solution for 48 h. The chiral resolution of 2-octanol was catalyzed by immobilized CALB. A maximum molar conversion of 49.1% was achieved with 99% enantiomeric excess of (R)-2-octanol acetate under the optimal condition: a reaction using 1.0 mol/L (R,S)-2-octanol, 2.0 mol/L vinyl acetate and 4.0 wt.% water content at 60°C for 8h. After fifteen recycles the immobilized lipase could retain 96.9% of relative activity and 93.8% of relative enantioselectivity. Copyright © 2014 Elsevier Inc. All rights reserved.
Mizuno, Márcia Sanae; Crisma, Amanda Rabello; Borelli, Primavera; Schäfer, Bárbara Tavares; Silveira, Mariana Póvoa; Castelucci, Patricia
2014-01-01
AIM: To investigate the colocalization, density and profile of neuronal areas of enteric neurons in the ileum of male obese mice. METHODS: The small intestinal samples of male mice in an obese group (OG) (C57BL/6J ob/ob) and a control group (CG) (+/+) were used. The tissues were analyzed using a double immunostaining technique for immunoreactivity (ir) of the P2X2 receptor, nitric oxide synthase (NOS), choline acetyl transferase (ChAT) and calretinin (Calr). Also, we investigated the density and profile of neuronal areas of the NOS-, ChAT- and Calr-ir neurons in the myenteric plexus. Myenteric neurons were labeled using an NADH-diaphorase histochemical staining method. RESULTS: The analysis demonstrated that the P2X2 receptor was expressed in the cytoplasm and in the nuclear and cytoplasmic membranes only in the CG. Neuronal density values (neuron/cm2) decreased 31% (CG: 6579 ± 837; OG: 4556 ± 407) and 16.5% (CG: 7796 ± 528; OG: 6513 ± 610) in the NOS-ir and calretinin-ir neurons in the OG, respectively (P < 0.05). Density of ChAT-ir (CG: 6200 ± 310; OG: 8125 ± 749) neurons significantly increased 31% in the OG (P < 0.05). Neuron size studies demonstrated that NOS, ChAT, and Calr-ir neurons did not differ significantly between the CG and OG groups. The examination of NADH-diaphorase-positive myenteric neurons revealed an overall similarity between the OG and CG. CONCLUSION: Obesity may exert its effects by promoting a decrease in P2X2 receptor expression and modifications in the density of the NOS-ir, ChAT-ir and CalR-ir myenteric neurons. PMID:25320527
INSPIRE-00258707; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Di Ruscio, F; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Holtrop, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; Mc Skelly, B; McCarthy, J; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polyakov, I; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skwarnicki, T; Smith, N A; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Van Dijk, M; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A
2013-01-01
The first observation of the decay $B^0_s\\rightarrow\\chi_{c1}\\phi$ and a study of $B^0\\rightarrow\\chi_{c1,2}K^{*0}$ decays are presented. The analysis is performed using a dataset, corresponding to an integrated luminosity of 1.0 fb$^{-1}$, collected by the LHCb experiment in pp collisions at a centre-of-mass energy of 7 TeV. The following ratios of branching fractions are measured: \\begin{equation*} \\begin{array}{lll} \\dfrac{\\cal{B}(B^0_s\\rightarrow\\chi_{c1}\\phi)}{\\cal{B}(B^0_s\\rightarrow J/\\psi\\phi)} &=& (18.9 \\pm1.8\\,(stat)\\pm1.3\\,(syst)\\pm0.8\\,(\\cal{B})) \\times 10^{-2}, \\\\ \\dfrac{\\cal{B}(B^0\\rightarrow\\chi_{c1}K^{*0})}{\\cal{B}(B^0\\rightarrow J/\\psi K^{*0})} &=& (19.8 \\pm1.1\\,(stat)\\pm1.2\\,(syst)\\pm0.9\\,(\\cal{B})) \\times 10^{-2}, \\\\ \\dfrac{\\cal{B}(B^0\\rightarrow\\chi_{c2}K^{*0})}{\\cal{B}(B^0\\rightarrow\\chi_{c 1}K^{*0})} &=& (17.1 \\pm5.0\\,(stat)\\pm1.7\\,(syst)\\pm1.1\\,(\\cal{B})) \\times 10^{-2}, \\\\ \\end{array} \\end{equation*} where the third uncertainty is due to the limited knowledge o...
Dynamic expression of calretinin in embryonic and early fetal human cortex
Directory of Open Access Journals (Sweden)
Miriam eGonzalez-Gomez
2014-06-01
Full Text Available Calretinin (CR is one of the earliest neurochemical markers in human corticogenesis. In embryos from Carnegie stages (CS 17 to 23, calbindin (CB and CR stain opposite poles of the incipient cortex suggesting early regionalization: CB marks the neuroepithelium of the medial boundary of the cortex with the choroid plexus (cortical hem. By contrast, CR is confined to the subventricular zone (SVZ of the lateral and caudal ganglionic eminences at the pallial-subpallial boundary (PSB, or antihem, from where CR+/Tbr1- neurons migrate toward piriform cortex and amygdala as a component of the lateral cortical stream. At CS 19, columns of CR+ cells arise in the rostral cortex, and contribute at CS 20 to the monolayer of horizontal Tbr1+/CR+ and GAD+ cells in the preplate. At CS 21, the pioneer cortical plate appears as a radial aggregation of CR+/Tbr1+ neurons, which cover the entire future neocortex and extend the first corticofugal axons. CR expression in early human corticogenesis is thus not restricted to interneurons, but is also present in the first excitatory projection neurons of the cortex. At CS 21/22, the cortical plate is established following a lateral to medial gradient, when Tbr1+/CR- neurons settle within the pioneer cortical plate, and thus separate superficial and deep pioneer neurons. CR+ pioneer neurons disappear shortly after the formation of the cortical plate. Reelin+ Cajal-Retzius cells begin to express CR around CS21 (7/8 PCW. At CS 21-23, the CR+ SVZ at the PSB is the source of CR+ interneurons migrating into the cortical SVZ. In turn, CB+ interneurons migrate from the subpallium into the intermediate zone following the fibers of the internal capsule. Early CR+ and CB+ interneurons thus have different origins and migratory routes. CR+ cell populations in the embryonic telencephalon take part in a complex sequence of events not analyzed so far in other mammalian species, which may represent a distinctive trait of the initial steps
International Nuclear Information System (INIS)
Jeong, Se-Jin; Kim, Hyun-Ho; Lee, Won-Sig; Jeon, Chang-Jin
2014-01-01
The purpose of this study was to investigate the localization of cells containing the calcium-binding proteins (CBPs) calbindin D28K (CB), calretinin (CR), and parvalbumin (PV) in the superior colliculus (SC) of the bat using immunocytochemistry. CB-immunoreactive (IR) cells formed a laminar tier within the upper superficial gray layer (SGL), while CR-IR cells were widely distributed within the optic layer (OL). Scattered CR-IR cells were also found within the intermediate gray, white, and deep gray layers. By contrast, PV-IR cells formed a laminar tier within the lower SGL and upper OL. Scattered PV-IR cells were also found throughout the intermediate layers, but without a specific laminar pattern. The CBP-IR cells varied in size and morphology: While most of the CB-IR cells in the superficial layers were small round or oval cells, most CR-IR cells in the intermediate and deep layers were large stellate cells. By contrast, PV-IR cells were small to large in size and included round or oval, stellate, vertical fusiform, and horizontal cells. The average diameters of the CB-, CR-, and PV-IR cells were 11.59, 17.17, and 12.60 μm, respectively. Double-immunofluorescence revealed that the percentage of co-localization with GABA-IR cells was 0.0, 0.0, and 10.27% of CB-, CR-, and PV-IR cells, respectively. These results indicate that CBP distribution patterns in the bat SC are unique compared with other mammalian SCs, which suggest functional diversity of these proteins in visually guided behaviors
Yan, Jinyong; Li, Aitao; Xu, Yi; Ngo, Thao P N; Phua, Szechao; Li, Zhi
2012-11-01
A novel concept and efficient method for producing biodiesel (FAME) from grease (15-40wt% free fatty acid, FFA) were developed by using tandem lipases for one-pot esterification of FFA and transesterification of triglyceride with methanol in a solvent-free system. Combining immobilized Candida antarctica lipase B (CALB) (Novozyme 435) favoring the esterification and immobilized Thermomyces lanuginosus lipase (TLL) (Lipozyme TLIM) preferring the transesterification at 2:8 (wt/wt) gave FAME in 80% yield, being better than that with Novozyme 435 or Lipozyme TLIM. Recombinant Escherichia coli (Calb/Tll) co-expressing CALB and TLL was engineered as a more efficient tandem-lipases system. Using wet or dry cells (4wt%) gave FAME in 87% or 95% yield, which is much better than that with E. coli cells expressing either CALB or TLL alone. Cells of E. coli (Calb/Tll) were recycled for five times and retained 75% productivity, thus being practical for producing biodiesel from grease. Copyright © 2012 Elsevier Ltd. All rights reserved.
Pombal, M A; Puelles, L
1999-11-22
The structural organization of the lamprey extratelencephalic forebrain is re-examined from the perspective of the prosomeric segmental paradigm. The question asked was whether the prosomeric forebrain model used for gnathostomes is of material advantage for interpreting subdivisions in the lamprey forebrain. To this aim, the main longitudinal and transverse landmarks recognized by the prosomeric model in other vertebrates were identified in Nissl-stained lamprey material. Lines of cytoarchitectural discontinuity and contours of migrated neuronal groups were mapped in a two-dimensional sagittal representation and were also classified according to their radial position. Immunocytochemical mapping of calretinin expression in adjacent sections served to define particular structural units better, in particular, the dorsal thalamus. These data were complemented by numerous other chemoarchitectonic observations obtained with ancillary markers, which identified additional specific formations, subdivisions, or boundaries. Emphasis was placed on studying whether such chemically defined neuronal groups showed boundaries aligned with the postulated inter- or intraprosomeric boundaries. The course of diverse axonal tracts was studied also with regard to their prosomeric topography. This analysis showed that the full prosomeric model applies straightforwardly to the lamprey forebrain. This finding implies that a common segmental and longitudinal organization of the neural tube may be primitive for all vertebrates. Interesting novel aspects appear in the interpretation of the lamprey pretectum, the dorsal and ventral thalami, and the hypothalamus. The topologic continuity of the prosomeric forebrain regions with evaginated or non-evaginated portions of the telencephalon was also examined. Copyright 1999 Wiley-Liss, Inc.
Chen, Bo; Pernodet, Nadine; Rafailovich, Miriam H; Bakhtina, Asya; Gross, Richard A
2008-12-02
A series of epoxy-activated polymer films composed of poly(glycidyl methacrylate/butyl methacrylate/hydroxyethyl methacrylate) were prepared. Variation in comonomer composition allowed exploration of relationships between surface wettability and Candida antartica lipase B (CALB) binding to surfaces. By changing solvents and polymer concentrations, suitable conditions were developed for preparation by spin-coating of uniform thin films. Film roughness determined by AFM after incubation in PBS buffer for 2 days was less than 1 nm. The occurrence of single CALB molecules and CALB aggregates at surfaces was determined by AFM imaging and measurements of volume. Absolute numbers of protein monomers and multimers at surfaces were used to determine values of CALB specific activity. Increased film wettability, as the water contact angle of films increased from 420 to 550, resulted in a decreased total number of immobilized CALB molecules. With further increases in the water contact angle of films from 55 degrees to 63 degrees, there was an increased tendency of CALB molecules to form aggregates on surfaces. On all flat surfaces, two height populations, differing by more than 30%, were observed from height distribution curves. They are attributed to changes in protein conformation and/or orientation caused by protein-surface and protein-protein interactions. The fraction of molecules in these populations changed as a function of film water contact angle. The enzyme activity of immobilized films was determined by measuring CALB-catalyzed hydrolysis of p-nitrophenyl butyrate. Total enzyme specific activity decreased by decreasing film hydrophobicity.
Promoter2.0: for the recognition of PolII promoter sequences
DEFF Research Database (Denmark)
Knudsen, Steen; Knudsen, Steen
1999-01-01
transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...
Lyu, M; Cha, N; Zou, Y F; Leng, J H; Xu, L; Sun, Y; Hao, Y Y
2018-03-08
Objective: To investigate the diagnostic value of some antibodies in peritoneal fluid of patients with gastric cancer and malignant epithelioid mesothelioma in serous effusion. Methods: One hundred and eighty-two cases of serous effusion were collected at Jilin Cancer Hospital, from July 2012 to July 2016. The expression of GLUT1, CDX2, Villin, calretinin and WT1 was evaluated using SP immunocytochemical technique in peritoneal fluid samples collected from 98 patients with gastric cancer and 74 patients with reactive mesothelial cells. The expression of GLUT1, calretinin and WT1 was also evaluated in serous effusion from 10 patients with mesothelioma. Results: The sensitivity of GLUT1, CDX2 and Villin in adenocarcinoma cells was 91.8%(90/98), 68.4% (67/98) and 88.8%(87/98), respectively. The specificity was 95.9% (71/74), 100.0%(74/74) and 100.0% (74/74), respectively. The sensitivity of calretinin and WT1 for reactive mesothelium was 93.2% (69/74) and 79.7% (59/74), respectively. The specificity was 96.9% (95/98) and 100.0% (98/98), respectively. The sensitivity of GLUT1, calretinin and WT1 for mesothelioma was 9/10, 9/10 and 7/10. The reactivity of GLUT1, CDX2, Villin, calretinin and WT1 showed a significant difference ( P <0.01) between adenocarcinoma cells and reactive mesothelium. The reactivity of GLUT1 showed a significant difference ( P <0.01) between mesothelioma and reactive mesothelium. Conclusions: The optimal combination is a panel of GLUT1, CDX2, Villin, calretinin and WT1 for differential diagnosis between adenocarcinoma cells and reactive mesothelium in peritoneal fluid of patients with gastric cancer. Whereas GLUT1, calretinin and WT1 is the best for differential diagnosis between reactive mesothelium and mesothelioma in serous effusions.
Directory of Open Access Journals (Sweden)
Hale Öztürk
2016-12-01
Full Text Available The immobilization of Candida antarctica lipase B (CALB was performed by physical adsorption on both neat and organo-modified forms of sepiolite and montmorillonite. The influence of different parameters, e.g., solvent, enzyme loading, cross-linking, and type of clay support, on immobilization efficiency and catalyst hydrolytic activity has been investigated. The highest hydrolytic activities were obtained for CALB immobilized on organo-modified clay minerals, highlighting the beneficial effect of organo-modification. The esterification activity of these CALB/organoclay catalysts was also tested in the ring-opening polymerization of ε-caprolactone. The polymerization kinetics observed for clay-immobilized catalysts confirmed that CALB adsorbed on organo-modified montmorillonite (CALB/MMTMOD was the highest-performing catalytic system.
Enzyme-Catalyzed Regioselective Modification of Starch Nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Soma [Polytechnic Univ., Brooklyn, NY (United States). National Science Foundation (NSF) Center for Biocatalysis and Bioprocessing of Macromolecules, Othmer Dept. of Chemical and Biological Science and Engineering; Sahoo, Bishwabhusan [Polytechnic Univ., Brooklyn, NY (United States). National Science Foundation (NSF) Center for Biocatalysis and Bioprocessing of Macromolecules, Othmer Dept. of Chemical and Biological Science and Engineering; Teraoka, Iwao [Polytechnic Univ., Brooklyn, NY (United States). National Science Foundation (NSF) Center for Biocatalysis and Bioprocessing of Macromolecules, Othmer Dept. of Chemical and Biological Science and Engineering; Miller, Lisa M. [Brookhaven National Lab. (BNL), Upton, NY (United States). National Synchrotron Light Source (NSLS); Gross, Richard A. [Polytechnic Univ., Brooklyn, NY (United States). National Science Foundation (NSF) Center for Biocatalysis and Bioprocessing of Macromolecules, Othmer Dept. of Chemical and Biological Science and Engineering
2004-12-13
The selective esterification of starch nanoparticles was performed using as catalyst Candida antartica Lipase B (CAL-B) in its immobilized (Novozym 435) and free (SP-525) forms. The starch nanoparticles were made accessible for acylation reactions by formation of Aerosol-OT (AOT, bis(2-ethylhexyl)sodium sulfosuccinate) stabilized microemulsions. Starch nanoparticles in microemulsions were reacted with vinyl stearate, ε-caprolactone, and maleic anhydride at 40 °C for 48 h to give starch esters with degrees of substitution (DS) of 0.8, 0.6, and 0.4, respectively. Substitution occurred regioselectively at the C-6 position of the glucose repeat units. Infrared microspectroscopy (IRMS) revealed that AOT-coated starch nanoparticles diffuse into the outer 50 μm shell of catalyst beads. Thus, even though CAL-B is immobilized within a macroporous resin, CAL-B is sufficiently accessible to the starch nanoparticles. When free CAL-B was incorporated along with starch within AOT-coated reversed micelles, CAL-B was also active and catalyzed the acylation with vinyl stearate (24 h, 40 °C) to give DS = 0.5. After removal of surfactant from the modified starch nanoparticles, they were dispersed in DMSO or water and were shown to retain their nanodimensions.
Directory of Open Access Journals (Sweden)
Kiran eTodkar
2012-04-01
Full Text Available Calretinin (CR and calbindin D-28k (CB are cytosolic EF-hand Ca2+-binding proteins and function as Ca2+ buffers affecting the spatiotemporal aspects of Ca2+ transients and possibly also as Ca2+ sensors modulating signaling cascades. In the adult hippocampal circuitry, CR and CB are expressed in specific principal neurons and subsets of interneurons. In addition, CR is transiently expressed within the neurogenic dentate gyrus (DG niche. CR and CB expression during adult neurogenesis mark critical transition stages, onset of differentiation for CR and the switch to adult-like connectivity for CB. Absence of either protein during these stages in null-mutant mice may have functional consequences and contribute to some aspects of the identified phenotypes. We report the impact of CR- and CB-deficiency on the proliferation and differentiation of progenitor cells within the subgranular zone (SGZ neurogenic niche of the DG. Effects were evaluated I 2 and 4 weeks postnatally, during the transition period of the proliferative matrix to the adult state, and II in adult animals (3 months to trace possible permanent changes in adult neurogenesis. The absence of CB from differentiated DG granule cells has no retrograde effect on the proliferative activity of progenitor cells, nor affects survival or migration/differentiation of newborn neurons in the adult DG including the SGZ. On the contrary, lack of CR from immature early postmitotic granule cells causes an early loss in proliferative capacity of the SGZ that is maintained into adult age, when it has a further impact on the migration/survival of newborn granule cells. The transient CR expression at the onset of adult neurogenesis differentiation may thus have two functions: I to serve as a self-maintenance signal for the pool of cells at the same stage of neurogenesis contributing to their survival/differentiation, and II it may contribute to retrograde signaling required for maintenance of the progenitor
Lienbacher, Karoline; Ono, Seiji; Fleuriet, Jérome; Mustari, Michael; Horn, Anja K. E.
2018-01-01
Purpose To further chemically characterize palisade endings in extraocular muscles in rhesus monkeys. Methods Extraocular muscles of three rhesus monkeys were studied for expression of the calcium-binding protein calretinin (CR) in palisade endings and multiple endings. The complete innervation was visualized with antibodies against the synaptosomal-associated protein of 25 kDa and combined with immunofluorescence for CR. Six rhesus monkeys received tracer injections of choleratoxin subunit B or wheat germ agglutinin into either the belly or distal myotendinous junction of the medial or inferior rectus muscle to allow retrograde tracing in the C-group of the oculomotor nucleus. Double-immunofluorescence methods were used to study the CR content in retrogradely labeled neurons in the C-group. Results A subgroup of palisade and multiple endings was found to express CR, only in the medial and inferior rectus muscle. In contrast, the en plaque endings lacked CR. Accordingly, within the tracer-labeled neurons of the C-group, a subgroup expressed CR. Conclusions The study indicates that two different neuron populations targeting nontwitch muscle fibers are present within the C-group for inferior rectus and medial rectus, respectively, one expressing CR, one lacking CR. It is possible that the CR-negative neurons represent the basic population for all extraocular muscles, whereas the CR-positive neurons giving rise to CR-positive palisade endings represent a specialized, perhaps more excitable type of nerve ending in the medial and inferior rectus muscles, being more active in vergence. The malfunction of this CR-positive population of neurons that target nontwitch muscle fibers could play a significant role in strabismus.
Effect of Water Clustering on the Activity of Candida antarctica Lipase B in Organic Medium
DEFF Research Database (Denmark)
Banik, Sindrila Dutta; Nordblad, Mathias; Woodley, John M.
2017-01-01
The effect of initial water activity of MTBE (methyl tert-butyl ether) medium on CALB (Candida antarctica lipase B) catalyzed esterification reaction is investigated using experimental methods and classical molecular dynamics (MD) simulations. The experimental kinetic studies show that the initial...... reaction rate of CALB-catalyzed esterification reaction between butyric acid and ethanol decreases with increasing initial water activity of the medium. The highest rate of esterification is observed at the lowest water activity studied. MD simulations were performed to gain a molecular insight...... on the effect of initial water activity on the rate of CALB-catalyzed reaction. Our results show that hydration has an insignificant effect on the structure and flexibility of CALB. Rather, it appears that water molecules bind to certain regions ("hot spots") on the CALB surface and form clusters. The size...
An, Liupan
2016-01-01
Using the $pp$ collision data collected by LHCb at center-of-mass energies $\\sqrt{s} \\, = 7 \\, {\\rm TeV} \\,$ and $8 \\, {\\rm TeV} \\,$, corresponding to an integrated luminosity of $3 \\, \\mathrm{fb}^{-1} \\,$, the ratio of the branching fraction of the $B_{c}^{+} \\to \\psi(2S)\\pi^+$ decay relative to that of the $B_{c}^{+} \\to J/\\psi\\pi^+$ decay is measured to be ${0.268 \\pm 0.032\\mathrm{\\,(stat)} \\pm 0.007\\mathrm{\\,(syst)} \\pm 0.006\\,(\\mathrm{BF}) }$. The first uncertainty is statistical, the second is systematic, and the third is due to the uncertainties on the branching fractions of the $J/\\psi \\to \\mu^{+}\\mu^{-}$ and $\\psi(2S) \\to \\mu^{+}\\mu^{-}$ decays. To enhance the signal significance with limited $B_{c}^{+}$ statistics, the boosted decision tree selection is used to separate the signal and background effectively. The systematic uncertainties are discussed extensively. This measurement is consistent with the previous LHCb result, and the statistical uncertainty is halved.
International Nuclear Information System (INIS)
Tzialla, Aikaterini A.; Kalogeris, Emmanuel; Enotiadis, Apostolos; Taha, Ali A.; Gournis, Dimitrios; Stamatis, Haralambos
2009-01-01
The use of three smectite nanoclays (Laponite, SWy-2 and Kunipia) organic-modified with octadecyl-trimethyl-ammonium surfactant, as suitable host matrices for the immobilization of lipase B from Candida antarctica (CaLB) was demonstrated. The resulting hybrid biocatalysts were characterized by a combination of powder X-ray diffraction, thermogravimetric analysis, differential thermal analysis, scanning electron microscopy and infrared spectroscopy. The experimental results confirmed the remarkable binding capacity of the three organoclays for CaLB. Activity and operational stability of immobilized CaLB were determined for the chemo-enzymatic epoxidation of terpenes (α-pinene and d-limonene) in organic media using various oxidizing agents. The immobilized enzyme retains a significant part of its activity after repeated use under drastic reaction conditions originating from the use of oxidants.
Hermanowicz-Sobieraj, Beata; Robak, Anna
2017-01-01
The study describes the immunoreactivity of calbindin (CB), calretinin (CR) and parvalbumin (PV), their distribution pattern and the co-distribution of CB and CR as well as CB and PV in the septum of the guinea pig during development. Immunohistochemistry was conducted on embryonic (E40, E50, E60), newborn (P0) and postnatal (P5, P10, P20, P40, P100) guinea pig brains. The presence of both CB and CR was detected at E40, while PV began to be observed at E60. Immunoreactivity for CB was constant throughout ontogeny. In contrast to CR immunoreactivity, PV immunoreactivity was higher in the postnatal stages than in the prenatal and newborn stages. Double immunostaining showed that CB co-localized with CR from E40 onwards, while with PV from P5 onwards, suggesting that CB co-operates with these proteins in the guinea pig septum during different periods of ontogeny. Our results also indicate that among the studied CaBPs, CB exhibited the highest immunoreactivity during both embryonic and postnatal development. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
V. M. Costa
Full Text Available Abstract Superparamagnetic nanomaterials have attracted interest in many areas due to the high saturation magnetization and surface area. For enzyme immobilization, these properties favor the enzyme-support contact during the immobilization reaction and easy separation from the reaction mixture by use of low-cost magnetic processes. Iron oxide magnetic nanoparticles (Fe3O4, MNPs, produced by the co-precipitation method, functionalized with 3-aminopropyltriethoxysilane (APTES and glutaraldehyde (GLU, were evaluated as a solid support for Candida antarctica lipase B (CALB immobilization. The nanomagnetic derivative (11nm obtained after CALB immobilization (MNPs/APTES/GLU/CALB was evaluated as biocatalyst in isoniazide (INH synthesis using ethyl isonicotinate (INE and hydrazine hydrate (HID as substrates, in 1,4-dioxane. The results showed that MNPs/APTES/CALB had a similar performance when compared to a commercial enzyme Novozym 435, showing significant advantages over other biocatalysts, such as Rhizhomucor miehei lipase (RML and CALB immobilized on non-conventional, low-cost, chitosan-based supports.
22 CFR 101.2 - Promotion of American interests.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Promotion of American interests. 101.2 Section... FUNCTIONS § 101.2 Promotion of American interests. Officers of the Foreign Service shall further the.... (g) By taking appropriate steps to facilitate the promotion of such import trade into the United...
Sasahara, Tais Harumi de Castro; Leal, Leonardo Martins; Spillantini, Maria Grazia; Machado, Márcia Rita Fernandes
2015-04-01
The majority of neuroanatomical and chemical studies of the olfactory bulb have been performed in small rodents, such as rats and mice. Thus, this study aimed to describe the organisation and the chemical neuroanatomy of the main olfactory bulb (MOB) in paca, a large rodent belonging to the Hystricomorpha suborder and Caviomorpha infraorder. For this purpose, histological and immunohistochemical procedures were used to characterise the tyrosine hydroxylase (TH) and calretinin (CR) neuronal populations and their distribution. The paca MOB has eight layers: the olfactory nerve layer (ONL), the glomerular layer (GL), the external plexiform layer (EPL; subdivided into the inner and outer sublayers), the mitral cell layer (MCL), the internal plexiform layer (IPL), the granule cell layer (GCL), the periventricular layer and the ependymal layer. TH-ir neurons were found mostly in the GL, and moderate numbers of TH-ir neurons were scattered in the EPL. Numerous varicose fibres were distributed in the IPL and in the GCL. CR-ir neurons concentrated in the GL, around the base of the olfactory glomeruli. Most of the CR-ir neurons were located in the MCL, IPL and GCL. Some of the granule cells had an apical dendrite with a growth cone. The CR immunoreactivity was also observed in the ONL with olfactory nerves strongly immunostained. This study has shown that the MOB organisation in paca is consistent with the description in other mammals. The characterisation and distribution of the population of TH and CR in the MOB is not exclusively to this species. This large rodent shares common patterns to other caviomorph rodent, as guinea pig, and to the myomorph rodents, as mice, rats and hamsters.
Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter
International Nuclear Information System (INIS)
Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.
2004-01-01
The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder
AAHD's Health Promotion and Wellness, Part 2: Health Promotion Programs
Exceptional Parent, 2011
2011-01-01
This article is part 2 of a 4-part series on "Health Promotion and Wellness" from the American Association on Health and Disability (AAHD). According to the U.S. Census Bureau, more than 54 million people--one in five Americans--have a disability, and these Americans are more likely to report: (1) Being in poorer overall health; (2) Having less…
Effect of Water Clustering on the Activity of Candida antarctica Lipase B in Organic Medium
Directory of Open Access Journals (Sweden)
Sindrila Dutta Banik
2017-07-01
Full Text Available The effect of initial water activity of MTBE (methyl tert-butyl ether medium on CALB (Candida antarctica lipase B catalyzed esterification reaction is investigated using experimental methods and classical molecular dynamics (MD simulations. The experimental kinetic studies show that the initial reaction rate of CALB-catalyzed esterification reaction between butyric acid and ethanol decreases with increasing initial water activity of the medium. The highest rate of esterification is observed at the lowest water activity studied. MD simulations were performed to gain a molecular insight on the effect of initial water activity on the rate of CALB-catalyzed reaction. Our results show that hydration has an insignificant effect on the structure and flexibility of CALB. Rather, it appears that water molecules bind to certain regions (“hot spots” on the CALB surface and form clusters. The size of the water clusters at these hot spot regions gradually increase and expand with increasing water activity. Consequently, the surface area of CALB covered by the water molecules also increases. Specifically, our results indicate that a particular water cluster located close to the active site partially cover the binding pocket of substrate at high water activity. As a consequence, the effective concentration of substrate at the catalytic site decreases. Therefore, the reaction rate slows down with increasing water activity, which correlates well with the observed decrease in the experimentally determined initial reaction rate.
International Nuclear Information System (INIS)
Augood, S.J.; Waldvogel, H.J.; Muenkle, M.C.; Faull, R.L.M.; Emson, P.C.
1999-01-01
-positive neurons revealed them all to be in the range of 300 μm 2 . The unique patterns of calcium-binding protein gene expression were similarly reflected at the protein level; an abundance of parvalbumin- and calretinin-immunopositive neurons were observed whereas only occasional intensely-labelled calbindin-immunopositive fibres were seen, no calbindin-immunopositive cells were detected. Single and double labelling studies show that parvalbumin-immunopositive neurons were mainly localized in the dorsal region of the nucleus, and calretinin-immunopositive neurons were mainly localized in the ventral region although there was overlap with double-labelled neurons located in the middle and dorsal regions.The significance of these findings, in particular the expression of GAT-1, a high-affinity GABA uptake protein, for basal ganglia signalling is discussed. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress
Directory of Open Access Journals (Sweden)
Ou Shulin
2017-01-01
Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.
mTORC2 Promotes Tumorigenesis via Lipid Synthesis.
Guri, Yakir; Colombi, Marco; Dazert, Eva; Hindupur, Sravanth K; Roszik, Jason; Moes, Suzette; Jenoe, Paul; Heim, Markus H; Riezman, Isabelle; Riezman, Howard; Hall, Michael N
2017-12-11
Dysregulated mammalian target of rapamycin (mTOR) promotes cancer, but underlying mechanisms are poorly understood. We describe an mTOR-driven mouse model that displays hepatosteatosis progressing to hepatocellular carcinoma (HCC). Longitudinal proteomic, lipidomics, and metabolomic analyses revealed that hepatic mTORC2 promotes de novo fatty acid and lipid synthesis, leading to steatosis and tumor development. In particular, mTORC2 stimulated sphingolipid (glucosylceramide) and glycerophospholipid (cardiolipin) synthesis. Inhibition of fatty acid or sphingolipid synthesis prevented tumor development, indicating a causal effect in tumorigenesis. Increased levels of cardiolipin were associated with tubular mitochondria and enhanced oxidative phosphorylation. Furthermore, increased lipogenesis correlated with elevated mTORC2 activity and HCC in human patients. Thus, mTORC2 promotes cancer via formation of lipids essential for growth and energy production. Copyright © 2017 Elsevier Inc. All rights reserved.
Decreased Expression of DREAM Promotes the Degeneration of Retinal Neurons
Chintala, Shravan; Cheng, Mei; Zhang, Xiao
2015-01-01
The intrinsic mechanisms that promote the degeneration of retinal ganglion cells (RGCs) following the activation of N-Methyl-D-aspartic acid-type glutamate receptors (NMDARs) are unclear. In this study, we have investigated the role of downstream regulatory element antagonist modulator (DREAM) in NMDA-mediated degeneration of the retina. NMDA, phosphate-buffered saline (PBS), and MK801 were injected into the vitreous humor of C57BL/6 mice. At 12, 24, and 48 hours after injection, expression of DREAM in the retina was determined by immunohistochemistry, western blot analysis, and electrophoretic mobility-shift assay (EMSA). Apoptotic death of cells in the retina was determined by terminal deoxynucleotidyl transferace dUTP nick end labeling (TUNEL) assays. Degeneration of RGCs in cross sections and in whole mount retinas was determined by using antibodies against Tuj1 and Brn3a respectively. Degeneration of amacrine cells and bipolar cells was determined by using antibodies against calretinin and protein kinase C (PKC)-alpha respectively. DREAM was expressed constitutively in RGCs, amacrine cells, bipolar cells, as well as in the inner plexiform layer (IPL). NMDA promoted a progressive decrease in DREAM levels in all three cell types over time, and at 48 h after NMDA-treatment very low DREAM levels were evident in the IPL only. DREAM expression in retinal nuclear proteins was decreased progressively after NMDA-treatment, and correlated with its decreased binding to the c-fos-DRE oligonucleotides. A decrease in DREAM expression correlated significantly with apoptotic death of RGCs, amacrine cells and bipolar cells. Treatment of eyes with NMDA antagonist MK801, restored DREAM expression to almost normal levels in the retina, and significantly decreased NMDA-mediated apoptotic death of RGCs, amacrine cells, and bipolar cells. Results presented in this study show for the first time that down-regulation of DREAM promotes the degeneration of RGCs, amacrine cells, and
GSTT2 promoter polymorphisms and colorectal cancer risk
Directory of Open Access Journals (Sweden)
Ahn Sun-A
2007-01-01
Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.
Eom, Gyeong Tae; Lee, Seung Hwan; Song, Bong Keun; Chung, Keun-Wo; Kim, Young-Wun; Song, Jae Kwang
2013-08-01
The gene encoding lipase B from Candida antarctica (CalB) was expressed in Pichia pastoris after it was synthesized by the recursive PCR and cloned into the Pichia expression plasmid, pPICZαA. The CalB was successfully secreted in the recombinant P. pastoris strain X-33 with an apparent molecular weight of 34 kDa. For 140 h flask culture, the dry cell weight and the extracellular lipase activity reached at 5.4 g/l and 57.9 U/l toward p-nitrophenyl palmitate, respectively. When we performed the fed-batch fermentation using a methanol feeding strategy for 110 h, the dry cell weight and the extracellular lipase activity were increased to 135.7 g/l and 11,900 U/l; the CalB protein concentration was 1.18 g/l of culture supernatant. The characteristics of CalB recovered from the P. pastoris culture were compared with the commercial form of CalB produced in Aspergillus oryzae. The kinetic constants and specific activity, the effects of activity and stability on temperature and pH, the glycosylation extent, the degree of immobilization on macroporous resin and the yield of esterification reaction between oleic acid and n-butanol were almost identical to each other. Therefore, we successfully proved that the Pichia-based expression system for CalB in this study was industrially promising compared with one of the most efficient production systems. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Submucosal neurons and enteric glial cells expressing the P2X7 receptor in rat experimental colitis.
da Silva, Marcos Vinícius; Marosti, Aline Rosa; Mendes, Cristina Eusébio; Palombit, Kelly; Castelucci, Patricia
2017-06-01
The aim of this study was to evaluate the effect of ulcerative colitis on the submucosal neurons and glial cells of the submucosal ganglia of rats. 2,4,6-Trinitrobenzene sulfonic acid (TNBS; colitis group) was administered in the colon to induce ulcerative colitis, and distal colons were collected after 24h. The colitis rats were compared with those in the sham and control groups. Double labelling of the P2X7 receptor with calbindin (marker for intrinsic primary afferent neurons, IPANs, submucosal plexus), calretinin (marker for secretory and vasodilator neurons of the submucosal plexus), HuC/D and S100β was performed in the submucosal plexus. The density (neurons per area) of submucosal neurons positive for the P2X7 receptor, calbindin, calretinin and HuC/D decreased by 21%, 34%, 8.2% and 28%, respectively, in the treated group. In addition, the density of enteric glial cells in the submucosal plexus decreased by 33%. The profile areas of calbindin-immunoreactive neurons decreased by 25%. Histological analysis revealed increased lamina propria and decreased collagen in the colitis group. This study demonstrated that ulcerative colitis affected secretory and vasodilatory neurons, IPANs and enteric glia of the submucosal plexus expressing the P2X7 receptor. Copyright © 2017 Elsevier GmbH. All rights reserved.
DEFF Research Database (Denmark)
Banik, Sindrila Dutta; Nordblad, Mathias; Woodley, John
2016-01-01
in an inhibitory effect which is also confirmed by the binding free energies for the solvent and substrate molecules estimated from the simulations. Consequently, the catalytic activity of CALB decreases in polar solvents. This effect is significant, and CALB is over 10 orders of magnitude more active in nonpolar...... of the enzyme may be ascribed to binding of solvent molecules to the enzyme active site region and the solvation energy of substrate molecules in the different solvents. Polar solvent molecules interact strongly with CALB and compete with the substrate to bind to the active site region, resulting...
Structural Evolution and Stability of Sol-Gel Biocatalysts
International Nuclear Information System (INIS)
Rodgers, L.E.; Foster, L.J.R.; Holden, P.J.; Knott, R.B.; Bartlett, J.B.
2005-01-01
Full text: Immobilisation strategies for catalytic enzymes are important as they allow reuse of the biocatalysts. Sol-gel materials have been used to immobilise Candida antarctica lipase B (CALB), a commonly used industrial enzyme with a known crystal structure. The sol-gel bioencapsulate is produced through the condensation of suitable metal alkoxides in the presence of CALB, yielding materials with controlled pore sizes, volume and surface chemistry. Sol-gel matrices have been shown to prolong the catalytic life and enhance the activity of CALB, although the molecular basis for this effect has yet to be elucidated due to the limitations of analysis techniques applied to date. Small angle neutron scattering (SANS) allows such multicomponent systems to be characterised through contrast matching. In the sol-gel bioencapsulate system, at the contrast match point for silica, residual scattering intensity is due to the CALB and density fluctuations in the matrix. A SANS contrast variation series found the match point for the silica matrix, both with and without enzyme present, to be around 35 percent. The model presented here proposes a mechanism for the interaction between CALB and the surrounding sol-gel matrix, and the observed improvement in enzyme activity and matrix strength. The SANS protocol developed here may be applied more generally to bioencapsulates. (authors)
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
Directory of Open Access Journals (Sweden)
Richele P. Severino
2012-07-01
Full Text Available The lipase B from Candida antarctica (Novozym 435®, CALB efficiently catalyzed the kinetic resolution of some aliphatic secondary alcohols: (±-4-methylpentan-2-ol (1, (±-5-methylhexan-2-ol (3, (±-octan-2-ol (4, (±-heptan-3-ol (5 and (±-oct-1-en-3-ol (6. The lipase showed excellent enantioselectivities in the transesterifications of racemic aliphatic secondary alcohols producing the enantiopure alcohols (>99% ee and acetates (>99% ee with good yields. Kinetic resolution of rac-alcohols was successfully achieved with CALB lipase using simple conditions, vinyl acetate as acylating agent, and hexane as non-polar solvent.
DEFF Research Database (Denmark)
Møller, A M; Jensen, N M; Pildal, J
2001-01-01
This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single-s......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single...
García, Javier; Fernández, Susana; Ferrero, Miguel; Sanghvi, Yogesh S; Gotor, Vicente
2002-06-28
A short and convenient synthesis of 3'- and 5'-O-levulinyl-2'-deoxynucleosides has been developed from the corresponding 3',5'-di-O-levulinyl derivatives by regioselective enzymatic hydrolysis, avoiding several tedious chemical protection/deprotection steps. Thus, Candida antartica lipase B (CAL-B) was found to selectively hydrolyze the 5'-levulinate esters, furnishing 3'-O-levulinyl-2'-deoxynucleosides 3 in >80% isolated yields. On the other hand, immobilized Pseudomonas cepacia lipase (PSL-C) and Candida antarctica lipase A (CAL-A) exhibit the opposite selectivity toward the hydrolysis at the 3'-position, affording 5'-O-levulinyl derivatives 4 in >70% yields. A similar hydrolysis procedure was successfully extended to the synthesis of 3'- and 5'-O-levulinyl-protected 2'-O-alkylribonucleosides 7 and 8. This work demonstrates for the first time application of commercial CAL-B and PSL-C toward regioselective hydrolysis of levulinyl esters with excellent selectivity and yields. It is noteworthy that protected cytidine and adenosine base derivatives were not adequate substrates for the enzymatic hydrolysis with CAL-B, whereas PSL-C was able to accommodate protected bases during selective hydrolysis. In addition, we report an improved synthesis of dilevulinyl esters using a polymer-bound carbodiimide as a replacement for dicyclohexylcarbodiimide (DCC), thus considerably simplifying the workup for esterification reactions.
Cyclooxygenase 2 Promotes Parathyroid Hyperplasia in ESRD
Zhang, Qian; Qiu, Junsi; Li, Haiming; Lu, Yanwen; Wang, Xiaoyun; Yang, Junwei; Wang, Shaoqing; Zhang, Liyin; Gu, Yong; Hao, Chuan-Ming
2011-01-01
Hyperplasia of the PTG underlies the secondary hyperparathyroidism (SHPT) observed in CKD, but the mechanism underlying this hyperplasia is incompletely understood. Because aberrant cyclooxygenase 2 (COX2) expression promotes epithelial cell proliferation, we examined the effects of COX2 on the parathyroid gland in uremia. In patients with ESRD who underwent parathyroidectomy, clusters of cells within the parathyroid glands had increased COX2 expression. Some COX2-positive cells exhibited two nuclei, consistent with proliferation. Furthermore, nearly 78% of COX2-positive cells expressed proliferating cell nuclear antigen (PCNA). In the 5/6-nephrectomy rat model, rats fed a high-phosphate diet had significantly higher serum PTH levels and larger parathyroid glands than sham-operated rats. Compared with controls, the parathyroid glands of uremic rats exhibited more PCNA-positive cells and greater COX2 expression in the chief cells. Treatment with COX2 inhibitor celecoxib significantly reduced PCNA expression, attenuated serum PTH levels, and reduced the size of the glands. In conclusion, COX2 promotes the pathogenesis of hyperparathyroidism in ESRD, suggesting that inhibiting the COX2 pathway could be a potential therapeutic target. PMID:21335517
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
Characterization of the promoter of human CRTh2, a prostaglandin D{sub 2} receptor
Energy Technology Data Exchange (ETDEWEB)
Quapp, Russell; Madsen, Norman [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada); Cameron, Lisa [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada)
2007-11-30
Chemoattractant-receptor homologous molecule expressed on Th2 cells (CRTh2) is a receptor for prostaglandin (PG)D{sub 2}, a lipid mediator involved in allergic inflammation. CRTh2 is expressed by Th2 cells, eosinophils and basophils and PDG{sub 2}-CRTh2 signaling induces calcium mobilization, cell migration and expression of the Th2 cytokines IL-4, IL-5, and IL-13. Despite the role of CRTh2 in allergic inflammation, transcriptional regulation of this gene has not been studied. Here, we demonstrated that a reporter construct of the CRTh2 promoter was induced following T cell stimulation. This activity could be further enhanced by over-expression of GATA-3, but not NFAT2 or STAT6. Electromobility shift assay demonstrated GATA-3 binding to a probe from the CRTh2 promoter. This study provides the first detailed analysis of transcriptional regulation of the human CRTh2 promoter. These findings may help identify strategies to attenuate expression of this gene and influence the maintenance and proliferation of Th2 cells in allergic inflammation.
Comparison of two polymer-based immunohistochemical detection systems: ENVISION+ and ImmPRESS.
Ramos-Vara, José A; Miller, Margaret A
2006-11-01
The non-specific background reaction produced in avidin-biotin-based immunohistochemistry, particularly after harsh antigen retrieval procedures, has promoted the use of non-avidin-biotin systems, yet there are few reports comparing the performance of non-avidin-biotin, polymer-based methods. In this study we compare two of these methods, ENVISION+trade mark and ImmPRESS, in animal tissues. We examined the immunoreactivity of 18 antigens in formalin-fixed, paraffin-embedded tissues. Antigens were located in the cytoplasmic membrane (CD11d, CD18 and CD79a), cytoplasm (calretinin, COX-1, COX-2, Glut-1, HepPar 1, KIT, Melan A, tryptase and uroplakin III) or nucleus (MUM-1, PGP 9.5 and thyroid transcription factor 1). We also evaluated three infectious agents (Aspergillus, calicivirus and West Nile virus). The staining with ENVISION+ or ImmPRESS was performed simultaneously for each antigen. The intensity of the reaction and background staining were scored. ImmPRESS yielded similar or higher reaction intensity than ENVISION+trade mark in 16/18 antigens. ImmPRESS produced abundant background with the other two antigens (calretinin and COX-2), which hindered interpretation of the specific reaction. The cost of ImmPRESS was 25% lower than for ENVISION+trade mark. Based on these results, ImmPRESS is a good polymer-based detection system for routine immunohistochemistry.
H2A/K pseudogene mutation may promote cell proliferation
Energy Technology Data Exchange (ETDEWEB)
Guo, Jisheng; Jing, Ruirui; Lv, Xin; Wang, Xiaoyue; Li, Junqiang; Li, Lin; Li, Cuiling; Wang, Daoguang; Bi, Baibing; Chen, Xinjun [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Yang, Jing-Hua, E-mail: sdu_crc_group1@126.com [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Department of Surgery, VA Boston Healthcare System, Boston University School of Medicine, Boston 510660, MA (United States)
2016-05-15
Highlights: • The mutant H2A/K pseudogene is active. • The mutant H2A/K pseudogene can promote cell proliferation. - Abstract: Little attention has been paid to the histone H2A/K pseudogene. Results from our laboratory showed that 7 of 10 kidney cancer patients carried a mutant H2A/K pseudogene; therefore, we were interested in determining the relationship between mutant H2A/K and cell proliferation. We used shotgun and label-free proteomics methods to study whether mutant H2A/K lncRNAs affected cell proliferation. Quantitative proteomic analysis indicated that the expression of mutant H2A/K lncRNAs resulted in the upregulation of many oncogenes, which promoted cell proliferation. Further interaction analyses revealed that a proliferating cell nuclear antigen (PCNA)-protein interaction network, with PCNA in the center, contributes to cell proliferation in cells expressing the mutant H2A/K lncRNAs. Western blotting confirmed the critical upregulation of PCNA by mutant H2A/K lncRNA expression. Finally, the promotion of cell proliferation by mutant H2A/K lncRNAs (C290T, C228A and A45G) was confirmed using cell proliferation assays. Although we did not determine the exact mechanism by which the oncogenes were upregulated by the mutant H2A/K lncRNAs, we confirmed that the mutant H2A/K lncRNAs promoted cell proliferation by upregulating PCNA and other oncogenes. The hypothesis that cell proliferation is promoted by the mutant H2A/K lncRNAs was supported by the protein expression and cell proliferation assay results. Therefore, mutant H2A/K lncRNAs may be a new factor in renal carcinogenesis.
Characterization and sequence analysis of the F2 promoter from corynephage BFK20
International Nuclear Information System (INIS)
Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.
1994-01-01
F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)
Trottier, Caitlin; Perl, Jeffrey; Freeman, Megan; Thadhani, Ravi; Berg, Anders; Kalim, Sahir
2018-01-01
Protein carbamylation is a post-translational urea-driven protein modification associated with mortality. Free amino acids (AAs) competitively inhibit protein carbamylation and parenteral AA therapy reduces carbamylation in hemodialysis (HD) patients. Peritoneal dialysis (PD) yields differences in urea clearance and AA balance compared with HD, but the influence of PD and intraperitoneal AA solutions on carbamylation is unclear. Thus, we first measured carbamylated albumin (C-Alb; a marker of carbamylation load) in 100 diabetic HD patients frequency-matched by age, sex, and race to 98 diabetic PD subjects from the IMPENDIA trial, which originally compared the metabolic effects of low-glucose PD solutions (incorporating icodextrin and AAs) to a control group (dextrose-only solutions). We then determined the effects of the AA-enriched PD solutions by measuring the 6-month change in C-Alb within the IMPENDIA cohort by treatment allocation (48 treated vs 50 controls). Peritoneal dialysis patients, when compared with HD patients, had higher baseline urea and higher C-Alb. Among IMPENDIA participants, there was no difference in C-Alb change in either arm, but treated subjects showed a trend towards increased carbamylation. Treated subjects also demonstrated an increase in urea, possibly explaining the carbamylation trend. In summary, carbamylation levels in PD patients appeared higher than in matched HD patients. A regimen of AA and low-glucose PD solutions did not reduce C-Alb in IMPENDIA subjects. Copyright © 2018 International Society for Peritoneal Dialysis.
CO2 methanation on the catalyst of Ni/MCM-41 promoted with CeO2.
Wang, Xiaoliu; Zhu, Lingjun; Liu, Yincong; Wang, Shurong
2018-06-01
CO 2 as a raw feed combined with renewable hydrogen for the production of useful chemicals and alternative energy products is one of the solutions to environmental and energy problems. In this study, a series of Ni-xCeO 2 /MCM-41 catalysts with a nickel content of 20wt% were prepared through deposition precipitation method for CO 2 methanation. Different characterization methods, including BET, XRD, TEM, SEM, H 2 -TPR and H 2 -TPD were applied to help explore the influence mechanism of CeO 2 on Ni/MCM-41 in CO 2 methanation. It was found that all CeO 2 -promoted catalysts exhibited enhanced catalytic activity when compared to Ni/MCM-41. The catalyst modified with 20wt% CeO 2 showed the best catalytic performance, with CO 2 conversion and CH 4 selectivity of 85.6% and 99.8%, respectively, at the temperature of 380°C under atmospheric pressure. The synergetic effects among Ni 0 active sites, the promoter and the support, including nickel dispersion improvement and increased CO 2 adsorption sites due to the addition of CeO 2 , were considered as important factors for high reactivity of the promoted catalysts. The stability test showed that the promoted catalyst maintained its high reactivity after 30h. Copyright © 2017 Elsevier B.V. All rights reserved.
Promoter2.0: for the recognition of PolII promoter sequences
DEFF Research Database (Denmark)
Knudsen, Steen; Knudsen, Steen
1999-01-01
Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...
TiO2 promoted by two different non-noble metal cocatalysts for enhanced photocatalytic H2 evolution
International Nuclear Information System (INIS)
Lin, Jing-Dong; Yan, Shi; Huang, Qin-Dong; Fan, Mei-Ting; Yuan, You-Zhu; Tan, Timothy Thatt-Yang; Liao, Dai-Wei
2014-01-01
TiO 2 photocatalysts modified by cobalt and nickel cocatalysts were prepared via polymerized complex method (PCM) and evaluated by photocatalytic hydrogen evolution. Hydrogen generation in 6 h for the TiO 2 promoted by cobalt and nickel (0.1%Co + 0.2%Ni/TiO 2 ) is about two times (2456 μmol H 2 ) compared to that of TiO 2 promoted only by cobalt (1180 μmol H 2 for 0.1%Co/TiO 2 ) or nickel (1127 μmol H 2 for 0.2%Ni/TiO 2 ), and mechanically mixed TiO 2 promoted by cobalt and TiO 2 promoted by nickel (0.1%Co/TiO 2 :0.2%Ni/TiO 2 = 1:1 (m/m), 1282 μmol H 2 ). The high photocatalytic H 2 evolution activity over TiO 2 promoted by cobalt and nickel is ascribed to enhanced photo response due to the presence of cobalt and nickel impurity level, and effective separation of photogenerated electrons and holes due to the synergistic effect of cobalt and nickel, which serve as active sites for H 2 evolution reaction (HER) and oxidation reaction (OR) respectively. This study demonstrates a viable strategy to design more active photocatalysts for photocatalytic H 2 evolution by substituting noble metals with more abundant elements using as HER and OR cocatalysts, respectively.
Induction of NFATc2 expression by interleukin 6 promotes T helper type 2 differentiation.
Diehl, Sean; Chow, Chi-Wing; Weiss, Linda; Palmetshofer, Alois; Twardzik, Thomas; Rounds, Laura; Serfling, Edgar; Davis, Roger J; Anguita, Juan; Rincón, Mercedes
2002-07-01
Interleukin (IL)-6 is produced by professional antigen-presenting cells (APCs) such as B cells, macrophages, and dendritic cells. It has been previously shown that APC-derived IL-6 promotes the differentiation of naive CD4+ T cells into effector T helper type 2 (Th2) cells. Here, we have studied the molecular mechanism for IL-6-mediated Th2 differentiation. During the activation of CD4+ T cells, IL-6 induces the production of IL-4, which promotes the differentiation of these cells into effector Th2 cells. Regulation of IL-4 gene expression by IL-6 is mediated by nuclear factor of activated T cells (NFAT), as inhibition of NFAT prevents IL-6-driven IL-4 production and Th2 differentiation. IL-6 upregulates NFAT transcriptional activity by increasing the levels of NFATc2. The ability of IL-6 to promote Th2 differentiation is impaired in CD4+ T cells that lack NFATc2, demonstrating that NFATc2 is required for regulation of IL-4 gene expression by IL-6. Regulation of NFATc2 expression and NFAT transcriptional activity represents a novel pathway by which IL-6 can modulate gene expression.
Aquaporin 2 promotes cell migration and epithelial morphogenesis.
Chen, Ying; Rice, William; Gu, Zhizhan; Li, Jian; Huang, Jianmin; Brenner, Michael B; Van Hoek, Alfred; Xiong, Jianping; Gundersen, Gregg G; Norman, Jim C; Hsu, Victor W; Fenton, Robert A; Brown, Dennis; Lu, Hua A Jenny
2012-09-01
The aquaporin 2 (AQP2) water channel, expressed in kidney collecting ducts, contributes critically to water homeostasis in mammals. Animals lacking or having significantly reduced levels of AQP2, however, have not only urinary concentrating abnormalities but also renal tubular defects that lead to neonatal mortality from renal failure. Here, we show that AQP2 is not only a water channel but also an integrin-binding membrane protein that promotes cell migration and epithelial morphogenesis. AQP2 expression modulates the trafficking and internalization of integrin β1, facilitating its turnover at focal adhesions. In vitro, disturbing the interaction between AQP2 and integrin β1 by mutating the RGD motif led to reduced endocytosis, retention of integrin β1 at the cell surface, and defective cell migration and tubulogenesis. Similarly, in vivo, AQP2-null mice exhibited significant retention of integrin β1 at the basolateral membrane and had tubular abnormalities. In summary, these data suggest that the water channel AQP2 interacts with integrins to promote renal epithelial cell migration, contributing to the structural and functional integrity of the mammalian kidney.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
Energy Technology Data Exchange (ETDEWEB)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)
2016-04-15
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
International Nuclear Information System (INIS)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi
2016-01-01
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
International Nuclear Information System (INIS)
Gabrielides, C.; Christakos, S.; McCormack, A.L.; Hunt, D.F.
1991-01-01
A calcium binding protein of M r 29,000 which cross-reacts with antibodies raised against chick calbindin-D 28k was previously reported to be present in rat cerebellum. It was suggested that the M r 29,000 protein represents another form of calbindin-D 28k . In the authors laboratory they were able to identify M r 28,000 and 29,000 proteins in rat, human, and chick cerebellum by their ability to bind 45 Ca in a 45 Ca blot assay. Two calcium binding proteins of M r 27,680 and 29,450 were isolated from rat cerebelli by the use of gel permeation chromatography and preparative gel electrophoresis. After reverse-phase high-performance liquid chromatography (HPLC) the proteins were sequenced. Sequence analysis by tandem mass spectrometry indicated only 52% identity between the rat cerebellar M r 28,000 and 29,000 proteins. Thus they are not different forms of the same protein, as previously suggested. Eighty-nine percent identity was observed between the rate cerebellar M r 29,000 protein and chick calretinin. The difference in identity between the rat cerebellar M r 29,000 protein and chick calretinin may be due to species differences, and thus this protein is most likely rat calretinin. These results suggest either posttranscriptional regulation of calretinin in cerebellum or species differences. The study also suggests that previous immunocytochemical mapping for calbindin using antisera which cross-reacted with both proteins detected brain regions that expressed not only calbindin but also calretinin or a calretinin-like protein
The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries
Directory of Open Access Journals (Sweden)
Nove E. Variant Anna
2015-04-01
Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university libraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flicker to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.
The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries
Directory of Open Access Journals (Sweden)
Nove E. Variant Anna
2018-01-01
Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university librraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flikr to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.
Joven, Alberto; Morona, Ruth; Moreno, Nerea; González, Agustín
2013-07-01
The sequence of appearance of calretinin and calbindin-D28k immunoreactive (CRir and CBir, respectively) cells and fibers has been studied in the brain of the urodele amphibian Pleurodeles waltl. Embryonic, larval and juvenile stages were studied. The early expression and the dynamics of the distribution of CBir and CRir structures have been used as markers for developmental aspects of distinct neuronal populations, highlighting the accurate extent of many regions in the developing brain, not observed on the basis of cytoarchitecture alone. CR and, to a lesser extent, CB are expressed early in the central nervous system and show a progressively increasing expression from the embryonic stages throughout the larval life and, in general, the labeled structures in the developing brain retain their ability to express these proteins in the adult brain. The onset of CRir cells primarily served to follow the development of the olfactory bulbs, subpallium, thalamus, alar hypothalamus, mesencephalic tegmentum, and distinct cell populations in the rhombencephalic reticular formation. CBir cells highlighted the development of, among others, the pallidum, hypothalamus, dorsal habenula, midbrain tegmentum, cerebellum, and central gray of the rostral rhombencephalon. However, it was the relative and mostly segregated distribution of both proteins in distinct cell populations which evidenced the developing regionalization of the brain. The results have shown the usefulness in neuroanatomy of the analysis during development of the onset of CBir and CRir structures, but the comparison with previous data has shown extensive variability across vertebrate classes. Therefore, one should be cautious when comparing possible homologue structures across species only on the basis of the expression of these proteins, due to the variation of the content of calcium-binding proteins observed in well-established homologous regions in the brain of different vertebrates.
MECP2 promoter methylation and X chromosome inactivation in autism.
Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M
2008-06-01
Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.
Development of dynamic kinetic resolution on large scale for (±-1-phenylethylamine
Directory of Open Access Journals (Sweden)
Lisa K. Thalén
2010-09-01
Full Text Available Candida antarctica lipase B (CALB and racemization catalyst 4 were combined in the dynamic kinetic resolution (DKR of (±-1-phenylethylamine (1. Several reaction parameters have been investigated to modify the method for application on multigram scale. A comparison of isopropyl acetate and alkyl methoxyacetates as acyl donors was carried out. It was found that lower catalyst loadings could be used to obtain (R-2-methoxy-N-(1-phenylethylacetamide (3 in good yield and high ee when alkyl methoxyacetates were used as acyl donors compared to when isopropyl acetate was used as the acyl donor. The catalyst loading could be decreased to 1.25 mol % Ru-catalyst 4 and 10 mg CALB per mmol 1 when alkyl methoxyacetates were used as the acyl donor.
Development of dynamic kinetic resolution on large scale for (±)-1-phenylethylamine.
Thalén, Lisa K; Bäckvall, Jan-E
2010-09-13
Candida antarctica lipase B (CALB) and racemization catalyst 4 were combined in the dynamic kinetic resolution (DKR) of (±)-1-phenylethylamine (1). Several reaction parameters have been investigated to modify the method for application on multigram scale. A comparison of isopropyl acetate and alkyl methoxyacetates as acyl donors was carried out. It was found that lower catalyst loadings could be used to obtain (R)-2-methoxy-N-(1-phenylethyl)acetamide (3) in good yield and high ee when alkyl methoxyacetates were used as acyl donors compared to when isopropyl acetate was used as the acyl donor. The catalyst loading could be decreased to 1.25 mol % Ru-catalyst 4 and 10 mg CALB per mmol 1 when alkyl methoxyacetates were used as the acyl donor.
International Nuclear Information System (INIS)
Hurst, Helen C
2001-01-01
Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells. Consequently, strategies have been devised to target promoter activity, either through the DNA binding sites for these factors, or through another promoter sequence, a polypurine-polypyrimidine repeat structure. The promoter has also been exploited for its tumour-specific activity to direct the accumulation of cytotoxic compounds selectively within cancer cells. Our current understanding of the ERBB2 promoter is reviewed and the status of these therapeutic avenues is discussed
Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2 ...
Indian Academy of Sciences (India)
First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from ... to promote chemical reactions is called sonochemistry .... −1): 1615, 2845, 2980, 3036, 3067; 1H NMR (500MHz,. CDCl3):δ 5.38 (s, 2H, CH2), 6.65 (d, J = 8.0 ...
DEFF Research Database (Denmark)
Møller, A M; Jensen, N M; Pildal, J
2001-01-01
This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......-strand conformational polymorphism and heteroduplex analysis followed by direct sequencing of identified variants on genomic DNA from 96 randomly recruited Danish type 2 diabetic patients. We identified 4 nucleotide variants, -447g-->a, -149c-->a, -122t-->c, and -44g-->a. None of the variants were positioned in known...
Simulation and modeling CO2 absorption in biogas with DEA promoted K2CO3 solution in packed column
Nurkhamidah, Siti; Altway, Ali; Airlangga, Bramantyo; Emilia, Dwi Putri
2017-05-01
Absorption of carbon dioxide (CO2) using potassium carbonate (K2CO3) is one of biogas purification method. However, K2CO3 have slow mass transfer in liquid phase. So it is necessary to eliminate the disadvantage of CO2 absorption using K2CO3 by adding promotor (activator). Diethanol amine (DEA) is one of promotor which can increase its reaction rate. Simulation and modeling research of the CO2 absorption from biogas with DEA promoted K2CO3 solution has not been conducted. Thus, the main goal of this research is create model and simulation for the CO2 absorption from biogas with DEA promoted K2CO3 solution, then observe the influence of promoter concentration. DEA concentration varies between 1-5 %wt. From the simulation, we concluded that the CO2 removal rise with the increasing of promoter concentration. The highest CO2 removal is 54.5318 % at 5 % wt DEA concentration.
Common variants in the TPH2 promoter confer susceptibility to paranoid schizophrenia.
Yi, Zhenghui; Zhang, Chen; Lu, Weihong; Song, Lisheng; Liu, Dentang; Xu, Yifeng; Fang, Yiru
2012-07-01
Serotonergic system-related genes may be good candidates in investigating the genetic basis of schizophrenia. Our previous study suggested that promoter region of tryptophan hydroxylase 2 gene (TPH2) may confer the susceptibility to paranoid schizophrenia. In this study, we investigated whether common variants within TPH2 promoter may predispose to paranoid schizophrenia in Han Chinese. A total of 509 patients who met DSM-IV criteria for paranoid schizophrenia and 510 matched healthy controls were recruited for this study. Five polymorphisms within TPH2 promoter region were tested. No statistically significant differences were found in allele or genotype frequencies between schizophrenic patients and healthy controls. The frequency of the rs4448731T-rs6582071A-rs7963803A-rs4570625T-rs11178997A haplotype was significantly higher in cases compared to the controls (P = 0.003; OR = 1.49; 95% CI, 1.15-1.95). Our results suggest that the common variants within TPH2 promoter are associated with paranoid schizophrenia in Han Chinese. Further studies in larger samples are warranted to elucidate the role of TPH2 in the etiology of paranoid schizophrenia.
MRG15 activates the cdc2 promoter via histone acetylation in human cells
International Nuclear Information System (INIS)
Pena, AndreAna N.; Tominaga, Kaoru; Pereira-Smith, Olivia M.
2011-01-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
MRG15 activates the cdc2 promoter via histone acetylation in human cells
Energy Technology Data Exchange (ETDEWEB)
Pena, AndreAna N., E-mail: andreana.pena@gmail.com [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Tominaga, Kaoru; Pereira-Smith, Olivia M. [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States)
2011-07-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
Liang, Xing-xiang; Wang, Bei-bei; Sun, Yu-fei; Lin, Ying; Han, Shuang-yan; Zheng, Sui-ping; Cui, Tang-bing
2013-03-01
A new approach is described to quantify the number of enzyme molecules, such as Candia antarctica lipase B, that are displayed on the cell surface of Pichia pastoris. Enhanced green fluorescent protein (EGFP) and Candida antarctica lipase B (CALB) were fused and displayed on the surface of P. pastoris by linking to the anchor flocculation functional domain of FLO1p from Saccharomyces cerevisiae. Confocal laser scanning microscopy, flow cytometry, and fluorescence spectrophotometry were used to monitor the fluorescence intensity of fused EGFP. Combined with the corresponding protein concentration detected in the medium, a standard curve describing the relationship between the fusion protein concentration and fluorescence intensity were obtained and could be used to number CALB displayed on the cell surface. The results showed that approx. 10(4) molecules of CALB molecules were immobilized on the single P. pastoris cell wall based on FS anchor system.
Pokemon and MEF2D co-operationally promote invasion of hepatocellular carcinoma.
Hong, Xin; Hong, Xing-Yu; Li, Tao; He, Cheng-Yan
2015-12-01
Hepatocellular carcinoma (HCC) is one of the most deadly human malignancy, and frequent invasion and metastasis is closely associated with its poor prognosis. However, the molecular mechanism underlying HCC invasion is still not completely elucidated. Pokemon is a well-established oncogene for HCC growth, but its contribution to HCC invasion has not been studied yet. In this paper, Pokemon was found to be overexpressed in MHCC-97H HCC cell line, which possesses higher invasiveness. Downregulation of Pokemon abolished the invasion of MHCC-97H HCC cell lines. Pokemon overexpression was able to enhance the invasion of MHCC-97L cells with lower invasiveness. MEF2D, an oncogene promoting the invasion of HCC cells, was further detected to be upregulated and downregulated when Pokemon was overexpressed and silenced, respectively. Online database analysis indicated that one Pokemon recognition site was located within the promoter of MEF2D. Chromatin co-precipitation, luciferase, and qPCR assays all proved that Pokemon can promote the expression of MEF2D in HCC cells. Restoration of MEF2D expression can prevent the impaired invasion of HCC cells with Pokemon silencing, while suppression of MEF2D abolished the effect of Pokemon overexpression on HCC invasion. More interestingly, MEF2D was also found to increase the transcription of Pokemon by binding myocyte enhancer factor 2 (MEF2) sites within its promoter region, implying an auto-regulatory circuit consisting of these two oncogenes that can promote HCC invasion. Our findings can contribute to the understanding of molecular mechanism underlying HCC invasion, and provided evidence that targeting this molecular loop may be a promising strategy for anti-invasion therapy.
RLIM interacts with Smurf2 and promotes TGF-β induced U2OS cell migration
International Nuclear Information System (INIS)
Huang, Yongsheng; Yang, Yang; Gao, Rui; Yang, Xianmei; Yan, Xiaohua; Wang, Chenji; Jiang, Sirui; Yu, Long
2011-01-01
Highlights: → RLIM directly binds to Smurf2. → RLIM enhances TGF-β responsiveness in U2OS cells. → RLIM promotes TGF-β driven migration of osteosarcoma U2OS cells. -- Abstract: TGF-β (transforming growth factor-β), a pleiotropic cytokine that regulates diverse cellular processes, has been suggested to play critical roles in cell proliferation, migration, and carcinogenesis. Here we found a novel E3 ubiquitin ligase RLIM which can directly bind to Smurf2, enhancing TGF-β responsiveness in osteosarcoma U2OS cells. We constructed a U2OS cell line stably over-expressing RLIM and demonstrated that RLIM promoted TGF-β-driven migration of U2OS cells as tested by wound healing assay. Our results indicated that RLIM is an important positive regulator in TGF-β signaling pathway and cell migration.
[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].
Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W
2016-11-23
Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.
Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells
Directory of Open Access Journals (Sweden)
Hsu Anna
2011-10-01
Full Text Available Abstract Sulforaphane (SFN, an isothiocyanate derived from cruciferous vegetables, induces potent anti-proliferative effects in prostate cancer cells. One mechanism that may contribute to the anti-proliferative effects of SFN is the modulation of epigenetic marks, such as inhibition of histone deacetylase (HDAC enzymes. However, the effects of SFN on other common epigenetic marks such as DNA methylation are understudied. Promoter hyper-methylation of cyclin D2, a major regulator of cell cycle, is correlated with prostate cancer progression, and restoration of cyclin D2 expression exerts anti-proliferative effects on LnCap prostate cancer cells. Our study aimed to investigate the effects of SFN on DNA methylation status of cyclin D2 promoter, and how alteration in promoter methylation impacts cyclin D2 gene expression in LnCap cells. We found that SFN significantly decreased the expression of DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3b. Furthermore, SFN significantly decreased methylation in cyclin D2 promoter regions containing c-Myc and multiple Sp1 binding sites. Reduced methlyation of cyclin D2 promoter corresponded to an increase in cyclin D2 transcript levels, suggesting that SFN may de-repress methylation-silenced cyclin D2 by impacting epigenetic pathways. Our results demonstrated the ability of SFN to epigenetically modulate cyclin D2 expression, and provide novel insights into the mechanisms by which SFN may regulate gene expression as a prostate cancer chemopreventive agent.
Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene
International Nuclear Information System (INIS)
Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo
2006-01-01
In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains
Collaborative interplay between FGF-2 and VEGF-C promotes lymphangiogenesis and metastasis
DEFF Research Database (Denmark)
Cao, Renhai; Ji, Hong; Feng, Ninghan
2012-01-01
Interplay between various lymphangiogenic factors in promoting lymphangiogenesis and lymphatic metastasis remains poorly understood. Here we show that FGF-2 and VEGF-C, two lymphangiogenic factors, collaboratively promote angiogenesis and lymphangiogenesis in the tumor microenvironment, leading...... endothelial cell tip cell formation is a prerequisite for FGF-2-stimulated lymphangiogenesis. In the tumor microenvironment, the reciprocal interplay between FGF-2 and VEGF-C collaboratively stimulated tumor growth, angiogenesis, intratumoral lymphangiogenesis, and metastasis. Thus, intervention and targeting...
Promoter characterization and genomic organization of the human X11β gene APBA2.
LENUS (Irish Health Repository)
Hao, Yan
2012-02-15
Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.
Mutational analysis of the UCP2 core promoter and relationships of variants with obesity
DEFF Research Database (Denmark)
Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H
2003-01-01
To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....
Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.
Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile
2017-01-01
Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.
Directory of Open Access Journals (Sweden)
Walter Blum
2017-04-01
Full Text Available Summary: Malignant mesothelioma (MM is an aggressive neoplasm characterized by a poor patient survival rate, because of rapid tumor recurrence following first-line therapy. Cancer stem cells (CSCs are assumed to be responsible for initiating tumorigenesis and driving relapse after therapeutic interventions. CSC-enriched MM cell subpopulations were identified by an OCT4/SOX2 reporter approach and were characterized by (1 increased resistance to cisplatin, (2 increased sensitivity toward the FAK inhibitor VS-6063 in vitro, and (3 a higher tumor-initiating capacity in vivo in orthotopic xenograft and allograft mouse models. Overexpression of NF2 (neurofibromatosis 2, merlin, a tumor suppressor often mutated or lost in MM, did not affect proliferation and viability of CSC-enriched MM populations but robustly decreased the viability of reporter-negative cells. In contrast, downregulation of calretinin strongly decreased proliferation and viability of both populations. In summary, we have enriched and characterized a small MM cell subpopulation that bears the expected CSC characteristics. : A cancer stem cell (CSC-enriched malignant mesothelioma (MM cell subpopulation was identified by an OCT4/SOX2 reporter approach. These EGFP-expressing cells showed an altered sensitivity toward chemotherapeutic drugs and a higher tumor-initiating capacity in vivo in orthotopic xenograft and allograft mouse models. While NF2 overexpression had no effect on proliferation/viability of CSC-enriched MM populations, they were susceptible to downregulation of calretinin. Keywords: mesothelioma, cancer stem cells, SOX2, OCT4, NF2, merlin, calretinin, defactinib
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
International Nuclear Information System (INIS)
Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter
2004-01-01
Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M
2006-01-01
Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.
Understanding structure-stability relationships of Candida antartica lipase B in ionic liquids.
De Diego, Teresa; Lozano, Pedro; Gmouh, Said; Vaultier, Michel; Iborra, José L
2005-01-01
Two different water-immiscible ionic liquids (ILs), 1-ethyl-3-methylimidizolium bis(trifluoromethylsulfonyl)imide and butyltrimethylammonium bis(trifluoromethylsulfonyl)imide, were used for butyl butyrate synthesis from vinyl butyrate catalyzed by Candida antarctica lipase B (CALB) at 2% (v/v) water content and 50 degrees C. Both the synthetic activity and stability of the enzyme in these ILs were enhanced as compared to those in hexane. Circular dichroism and intrinsic fluorescence spectroscopic techniques have been used over a period of 4 days to determine structural changes in the enzyme associated with differences in its stability for each assayed medium. CALB showed a loss in residual activity higher than 75% after 4 days of incubation in both water and hexane media at 50 degrees C, being related to great changes in both alpha-helix and beta-strand secondary structures. The stabilization of CALB, which was observed in the two ILs studied, was associated with both the maintenance of the 50% of initial alpha-helix content and the enhancement of beta-strands. Furthermore, intrinsic fluorescence studies clearly showed how a classical enzyme unfolding was occurring with time in both water and hexane media. However, the structural changes associated with the incubation of the enzyme in both ILs might be attributed to a compact and active enzyme conformation, resulting in an enhancement of the stability in these nonaqueous environments.
CO_2 capture from flue gas using clathrate formation in the presence of thermodynamic promoters
International Nuclear Information System (INIS)
Kim, Soyoung; Choi, Sung-Deuk; Seo, Yongwon
2017-01-01
Tetrahydrofuran (THF) as a water-soluble sII clathrate former, cyclopentane (CP) as a water-insoluble sII clathrate former, and tetra n-butyl ammonium chloride (TBAC) as a water-soluble semiclathrate former were used to investigate their thermodynamic promotion effects on clathrate-based CO_2 capture from simulated flue gas. The phase equilibria of CO_2 (20%) + N_2 (80%) + promoter clathrates at different promoter concentrations revealed that the presence of THF, CP, and TBAC could significantly reduce the clathrate formation pressure. THF solutions provided the highest gas uptake and steepest CO_2 concentration changes in the vapor phase, whereas TBAC solutions showed the highest CO_2 selectivity (∼61%) in the clathrate phase. CP solutions exhibited a slower formation rate, but their final gas uptake and CO_2 selectivity in the clathrate phase were comparable to the THF solutions. Raman spectroscopy confirmed the enclathration of both CO_2 and N_2 in the clathrate cages and a structural transition due to the inclusion of promoters in the clathrate phase. The overall experimental results indicate that TBAC is a viable thermodynamic promoter for clathrate-based CO_2 capture from simulated flue gas, considering the lower pressure requirement for clathrate formation, higher CO_2 enrichment in the clathrate phase, non-toxicity, and non-volatility. - Highlights: • Clathrate-based CO_2 capture was investigated in the presence of thermodynamic promoters. • THF, CP, and TBAC demonstrated a significant thermodynamic promotion for CO_2 (20%) + N_2 (80%) clathrates. • The highest gas uptake was observed for the THF (5.6 mol%) solution. • TBAC solutions showed the highest CO_2 selectivity in the clathrate phase (∼61%). • Raman spectroscopy confirmed the guest gas enclathration and clathrate structure.
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
DEFF Research Database (Denmark)
Putluru, Siva Sankar Reddy; Jensen, Anker Degn; Riisager, Anders
2011-01-01
V2O5/TiO2 and heteropoly acid promoted V2O5/TiO2 catalysts were prepared and characterized by N2 physisorption, XRPD and NH3-TPD. The influence of the calcination temperature from 400 to 700 1C on crystallinity and acidic properties was studied and compared with the activity for the selective...... catalytic reduction (SCR) of NO with ammonia. The SCR activity of heteropoly acid promoted catalysts was found to be much higher than for unpromoted catalysts. The stability of heteropoly acid promoted catalysts is dependent on calcination temperature and there is a gradual decrease in SCR activity...... and acidity with increase in calcination temperatures. Furthermore, the heteropoly acid promoted V2O5/TiO2 catalysts showed excellent alkali deactivation resistance and might therefore be alternative deNOx catalysts in biomass fired power plants....
RBP2 Promotes Adult Acute Lymphoblastic Leukemia by Upregulating BCL2.
Directory of Open Access Journals (Sweden)
Xiaoming Wang
Full Text Available Despite recent increases in the cure rate of acute lymphoblastic leukemia (ALL, adult ALL remains a high-risk disease that exhibits a high relapse rate. In this study, we found that the histone demethylase retinoblastoma binding protein-2 (RBP2 was overexpressed in both on-going and relapse cases of adult ALL, which revealed that RBP2 overexpression was not only involved in the pathogenesis of ALL but that its overexpression might also be related to relapse of the disease. RBP2 knockdown induced apoptosis and attenuated leukemic cell viability. Our results demonstrated that BCL2 is a novel target of RBP2 and supported the notion of RBP2 being a regulator of BCL2 expression via directly binding to its promoter. As the role of RBP2 in regulating apoptosis was confirmed, RBP2 overexpression and activation of BCL2 might play important roles in ALL development and progression.
The promotive effect of N 2 fixers, Bacillus circulans and ...
African Journals Online (AJOL)
The promotive effect of N 2 fixers, Bacillus circulans and Saccharomyces cerevisiae on the viability of native arbuscular mycorrhizal fungi and the impact on the productivity of alfalfa ( Medicago sativa l.)
Understanding promotion of photocatalytic activity of TiO2 by Au nanoparticles
Amrollahi Buky, Rezvaneh; Hamdy, Mohamed S.; Mul, Guido
2014-01-01
Au nanoparticles prepared by deposition–precipitation were evaluated in promoting photocatalytic activity of TiO2 (P25) in the oxidation of methylcyclohexane. At 375 nm and in particular at 425 nm, Au was found to significantly enhance the rate induced by P25. Illumination of Au-promoted P25 at 525
Characterization of Cross-Linked Lipase Aggregates
DEFF Research Database (Denmark)
Prabhavathi Devi, Bethala Lakshmi Anu; Guo, Zheng; Xu, Xuebing
2009-01-01
. Precipitants were found to have a profound influence on both specific activities and total activity recovery of CLEAs, as exemplified by Candida antarctica lipase B (CALB). Among the CLEAs of CALB studied, those obtained using PEG600, ammonium sulfate, PEG200 and acetone as precipitants were observed to attain...... over 200% total activity recovery in comparison with acetone powder directly precipitated from the liquid solution by acetone. PEG200 precipitated CLEA gave the best specific activity (139% relative to acetone powder). The results of kinetic studies showed that V (max)/K (m) does not significantly...
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Hinrichsen, Inga; Kemp, Matthias; Peveling-Oberhag, Jan; Passmann, Sandra; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela
2014-01-01
Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC) specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV). However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR) genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16) in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Directory of Open Access Journals (Sweden)
Inga Hinrichsen
Full Text Available Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV. However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16 in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
The flavonoid fisetin promotes osteoblasts differentiation through Runx2 transcriptional activity.
Léotoing, Laurent; Davicco, Marie-Jeanne; Lebecque, Patrice; Wittrant, Yohann; Coxam, Véronique
2014-06-01
Flavonoids represent a group of polyphenolic compounds commonly found in daily nutrition with proven health benefits. Among this group, the flavonol fisetin has been previously shown to protect bone by repressing osteoclast differentiation. In the present study, we investigated the role of fisetin in regulating osteoblasts physiology. In vivo mice treated with LPSs exhibited osteoporosis features associated with a dramatic repression of osteoblast marker expression. In this model, inhibition of osteocalcin and type I collagen alpha 1 transcription was partially countered by a daily consumption of fisetin. Interestingly, in vitro, fisetin promoted both osteoblast alkaline phosphatase activity and mineralization process. To decipher how fisetin may exert its positive effect on osteoblastogenesis, we analyzed its ability to control the runt-related transcription factor 2 (Runx2), a key organizer in developing and maturing osteoblasts. While fisetin did not impact Runx2 mRNA and protein levels, it upregulated its transcriptional activity. Actually, fisetin stimulated the luciferase activity of a reporter plasmid driven by the osteocalcin gene promoter that contains Runx2 binding sites and promoted the mRNA expression of osteocalcin and type I collagen alpha 1 targets. Bone sparing properties of fisetin also rely on its positive influence on osteoblast differentiation and activity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Divya Shet
2018-03-01
Full Text Available This study was conducted to evaluate the effects of different levels of dietary phytase supplementation in the layer feed on egg production performance, egg shell quality and expression of osteopontin (OPN and calbindin (CALB1 genes. Seventy-five White Leghorn layers at 23 weeks of age were randomly divided into 5 groups consisting of a control diet with 0.33% non-phytate phosphorus (NPP and 4 low phosphorus (P diets: 2 diets (T1 and T2 with 0.24% NPP + 250 FTU/kg laboratory produced phytase or commercial phytase and another 2 diets (T3 and T4 with 0.16% NPP + 500 FTU/kg laboratory produced phytase or commercial phytase with complete replacement of inorganic P. The results indicated that there were no significant differences (P > 0.05 in egg production performance and quality of egg during the first 2 months of trial. However, in next 2 months, a significant drop in egg production and feed intake was observed in birds fed diets with low P and 500 FTU/kg supplementation of laboratory produced phytase. Osteopontin gene was up-regulated whereas the CALB1 gene was down regulated in all phytase treatment groups irrespective of the source of phytase. The current data demonstrated that 250 FTU/kg supplementation of laboratory produced phytase with 50% less NPP supplementation and 500 FTU/kg supplementation of commercial phytase even without NPP in diet can maintain the egg production. The up-regulation of OPN and down regulation of CALB1 in egg shell gland in the entire phytase treated group birds irrespective of the source of enzymes is indicative of the changes in P bio-availability at this site. Keywords: Phytase, Layer, Egg production, Gene expression, Egg shell
Promoted V2O5/TiO2 catalysts for selective catalytic reduction of NO with NH3 at low temperatures
DEFF Research Database (Denmark)
Putluru, Siva Sankar Reddy; Schill, Leonhard; Godiksen, Anita
2016-01-01
characterized by N2 physisorption, XRPD, NH3-TPD, H2-TPR, Raman, FTIR and EPR spectroscopy to investigate the properties of the catalysts. XRPD, Raman and FTIR showed that promotion with 15 wt.% HPA does not cause V2O5 to be present in crystalline form, also at a loading of 5 wt.% V2O5. Hence, use of HPAs does......The influence of varying the V2O5 content (3–6 wt.%) was studied for the selective catalytic reduction (SCR) of nitrogen oxides by ammonia on heteropoly acid (HPA)- and tungsten oxide (WO3)-promoted V2O5/TiO2 catalysts. The SCR activity and alkali deactivation resistance of HPA-promoted V2O5/TiO2...... catalysts was found to be much higher than for WO3-promoted catalysts. By increasing the vanadium content from 3 to 5 wt.% the catalysts displayed a two fold increase in activity at 225 °C and retained their initial activity after alkali doping at a molar K/V ratio of 0.181. Furthermore, the catalysts were...
Wang, Qi; Li, Juanjuan; Wu, Wei; Shen, Ruizhe; Jiang, He; Qian, Yuting; Tang, Yanping; Bai, Tingting; Wu, Sheng; Wei, Lumin; Zang, Yi; Zhang, Ji; Wang, Lifu
2016-03-08
The importance of Pituitary homeobox 2 (Pitx2) in malignancy remains enigmatic, and Pitx2 has not been previously implicated in pancreatic ductal adenocarcinoma (PDAC). In this study, we performed gene expression profiling of human PDAC tissues and identified Pitx2 as a promising candidate. Pitx2 expression was decreased from 2.6- to 19-fold in human PDAC tissues from microarray units. Immunochemistry staining showed that Pitx2 expression was moderate to intense in normal pancreatic and pancreatic intraepithelial neoplastic lesions, whereas low in human PDAC tissues. The Pitx2 levels correlated with overall patient survival post-operatively in PDAC. Induction of Pitx2 expression partly inhibited the malignant phenotype of PDAC cells. Interestingly, low Pitx2 expression was correlated with Smad4 mutant inactivation, but not with Pitx2 DNA-methylation. Furthermore, Smad4 protein bound to Pitx2 promoter and stimulated Pitx2 expression in PDAC. In addition, Pitx2 protein bound to the promoter of the protein phosphatase 2A regulatory subunit B55α (PPP2R2A) and upregulated PPP2R2A expression, which may activate dephosphorylation of Akt in PDAC. These findings provide new mechanistic insights into Pitx2 as a tumor suppressor in the downstream of Smad4. And Pitx2 protein promotes PPP2R2A expression which may inhibit Akt pathway. Therefore, we propose that the Smad4-Pitx2-PPP2R2A axis, a new signaling pathway, suppresses the pancreatic carcinogenesis.
Tang, Juan; Guo, Yun-Shan; Yu, Xiao-Ling; Huang, Wan; Zheng, Ming; Zhou, Ying-Hui; Nan, Gang; Wang, Jian-Chao; Yang, Hai-Jiao; Yu, Jing-Min; Jiang, Jian-Li; Chen, Zhi-Nan
2015-10-27
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC) metastasis and proliferation by enhancing the amplitude and frequency of [Ca2+]i oscillations in HCC cells. CD147 activates two distinct signaling pathways to regulate [Ca2+]i oscillations. By activating FAK-Src-IP3R1 signaling pathway, CD147 promotes Ca2+ release from endoplasmic reticulum (ER) and enhances the amplitude of [Ca2+]i oscillations. Furthermore, CD147 accelerates ER Ca2+refilling and enhances the frequency of [Ca2+]i oscillations through activating CaMKP-PAK1-PP2A-PLB-SERCA signaling pathway. Besides, CD147-promoted ER Ca2+ release and refilling are tightly regulated by changing [Ca2+]i. CD147 may activate IP3R1 channel under low [Ca2+]i conditions and CD147 may activate SERCA pump under high [Ca2+]i conditions. CD147 deletion suppresses HCC tumorigenesis and increases the survival rate of liver-specific CD147 knockout mice by regulating [Ca2+]i oscillations in vivo. Together, these results reveal that CD147 functions as a critical regulator of ER-dependent [Ca2+]i oscillations to promote oncogenic progression in HCC.
Energy Technology Data Exchange (ETDEWEB)
Kunz, S.; Schmitz, H.J.; Schrenk, D. [Kaiserslautern Univ. (Germany). Dept. of Food Chemistry and Environmental Toxicology; Buchmann, A.; Schwarz, M. [Tuebingen Univ. (Germany). Inst. of Toxicology; Schilling, B.; Paepke, O. [ERGO Research, Hamburg (Germany); Robertson, L.W.; Lehmler, H.J. [Iowa Univ, Iowa City, IA (United States). Dept. of Occupational and Environmental Health
2004-09-15
Polychlorinated biphenyls (PCBs) are potent persistent environmental pollutants exhibiting neurotoxic, teratogenic and tumor-promoting effects in experimental animal models. PCB congeners can be divided into 'dioxin-like' and 'non-dioxin-like' congeners on the basis of their ability to act as aryl hydrocarbon receptor (AhR) agonists. Like the most toxic dioxin congener 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) 'dioxin-like' PCBs bind to the AhR and show characteristic effects on the expression of AhR-regulated genes including the induction of cytochrome P450 (CYP) 1A1. On the other hand, 'non-dioxin-like' PCB congeners have a lower or no binding affinity to the AhR, but exhibit a 'phenobarbital-type' induction of CYP 2B1/2 activity. The tumor-promoting potency of several PCBs has been demonstrated in two-stage initiation-promotion experiments in rat liver. Preneoplastic cell clones, targets for tumor promotion, can be identified as phenotypically altered foci showing characteristic enzyme patterns including the decreased activity of adenosine triphosphatase (ATPase) or the increased expression of the placental form of gluthatione S-transferase (GSTP). In the present study, the effect of the 'non-dioxin-like' 2,4,4'-trichlorobiphenyl (PCB 28) and 2,2',4,5,5'-pentachlorobiphenyl (PCB 101) on the promotion of enzyme-altered hepatic foci was investigated in female Wistar rats after initiation with diethylnitrosamine (DEN).
In vitro and in vivo characterization of highly purified Human Mesothelioma derived cells
International Nuclear Information System (INIS)
Melotti, Alice; Daga, Antonio; Marubbi, Daniela; Zunino, Annalisa; Mutti, Luciano; Corte, Giorgio
2010-01-01
Malignant pleural mesothelioma is a rare disease known to be resistant to conventional therapies. A better understanding of mesothelioma biology may provide the rationale for new therapeutic strategies. In this regard, tumor cell lines development has been an important tool to study the biological properties of many tumors. However all the cell lines established so far were grown in medium containing at least 10% serum, and it has been shown that primary cell lines cultured under these conditions lose their ability to differentiate, acquire gene expression profiles that differ from that of tissue specific stem cells or the primary tumor they derive from, and in some cases are neither clonogenic nor tumorigenic. Our work was aimed to establish from fresh human pleural mesothelioma samples cell cultures maintaining tumorigenic properties. The primary cell cultures, obtained from four human pleural mesotheliomas, were expanded in vitro in a low serum proliferation-permissive medium and the expression of different markers as well as the tumorigenicity in immunodeficient mice was evaluated. The established mesothelioma cell cultures are able to engraft, after pseudo orthotopic intraperitoneal transplantation, in immunodeficient mouse and maintain this ability to after serial transplantation. Our cell cultures were strongly positive for CD46, CD47, CD56 and CD63 and were also strongly positive for some markers never described before in mesothelioma cell lines, including CD55, CD90 and CD99. By real time PCR we found that our cell lines expressed high mRNA levels of typical mesothelioma markers as mesothelin (MSLN) and calretinin (CALB2), and of BMI-1, a stemness marker, and DKK1, a potent Wingless [WNT] inhibitor. These cell cultures may provide a valuable in vitro and in vivo model to investigate mesothelioma biology. The identification of new mesothelioma markers may be useful for diagnosis and/or prognosis of this neoplasia as well as for isolation of mesothelioma
CNPY2 promoted the proliferation of renal cell carcinoma cells and increased the expression of TP53
International Nuclear Information System (INIS)
Taniguchi, Hidefumi; Ito, Saya; Ueda, Takashi; Morioka, Yukako; Kayukawa, Naruhiro; Ueno, Akihisa; Nakagawa, Hideo; Fujihara, Atsuko; Ushijima, So; Kanazawa, Motohiro; Hongo, Fumiya; Ukimura, Osamu
2017-01-01
Renal cell carcinoma (RCC) is the most common type of kidney cancer. However, the mechanisms underlying the progression of the disease are not well understood. The data in this report suggest that canopy FGF signaling regulator 2 (CNPY2) is a promoter of RCC progression. We found that CNPY2 significantly promoted growth of RCC cells and upregulated TP53 gene expression. Although TP53 is widely known as a tumor suppressor, in RCC TP53 promoted tumor cell growth. A typical p53 target gene, CDKN1A, was upregulated by both p53 and CNPY2 in RCC cells, suggesting that CNPY2 increased the expression level of TP53. Consistent with these results, CNPY2 and TP53 expression levels were positively correlated in RCC patients. These findings suggested that CNPY2 promoted cancer cell growth in RCC through regulating TP53 gene expression. - Highlights: • CNPY2 promoted growth of renal cell carcinoma (RCC) cells. • TP53 expression levels were increased by CNPY2 in RCC cells. • Growth of RCC cells was promoted by TP53. • CNPY2 expression positively correlated with TP53 expression in RCC patients.
Dvorak, Kaitlyn M; Pettee, Krista M; Rubinic-Minotti, Kaitlin; Su, Robin; Nestor-Kalinoski, Andrea; Eisenmann, Kathryn M
2018-01-01
The tumor microenvironment (TME) promotes tumor cell invasion and metastasis. An important step in the shift to a pro-cancerous microenvironment is the transformation of normal stromal fibroblasts to carcinoma-associated fibroblasts (CAFs). CAFs are present in a majority of solid tumors and can directly promote tumor cell motility via cytokine, chemokine and growth factor secretion into the TME. The exact effects that the TME has upon cytoskeletal regulation in motile tumor cells remain enigmatic. The conserved formin family of cytoskeleton regulating proteins plays an essential role in the assembly and/or bundling of unbranched actin filaments. Mammalian Diaphanous-related formin 2 (mDia2/DIAPH3/Drf3/Dia) assembles a dynamic F-actin cytoskeleton that underlies tumor cell migration and invasion. We therefore sought to understand whether CAF-derived chemokines impact breast tumor cell motility through modification of the formin-assembled F-actin cytoskeleton. In MDA-MB-231 cells, conditioned media (CM) from WS19T CAFs, a human breast tumor-adjacent CAF line, significantly and robustly increased wound closure and invasion relative to normal human mammary fibroblast (HMF)-CM. WS19T-CM also promoted proteasome-mediated mDia2 degradation in MDA-MB-231 cells relative to control HMF-CM and WS21T CAF-CM, a breast CAF cell line that failed to promote robust MDA-MB-231 migration. Cytokine array analysis of CM identified up-regulated secreted factors in WS19T relative to control WS21T CM. We identified CXCL12 as a CM factor influencing loss of mDia2 protein while increasing MDA-MB-231 cell migration. Our data suggest a mechanism whereby CAFs promote tumor cell migration and invasion through CXCL12 secretion to regulate the mDia2-directed cytoskeleton in breast tumor cells.
The miR-599 promotes non-small cell lung cancer cell invasion via SATB2
International Nuclear Information System (INIS)
Tian, Wenjun; Wang, Guanghai; Liu, Yiqing; Huang, Zhenglan; Zhang, Caiqing; Ning, Kang; Yu, Cuixiang; Shen, Yajuan; Wang, Minghui; Li, Yuantang; Wang, Yong; Zhang, Bingchang; Zhao, Yaoran
2017-01-01
MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. Here, we identified that miR-599 is up-regulated in non-small cell lung cancer (NSCLC) patients. It promoted NSCLC cell proliferation by negatively regulating SATB2. In NSCLC cell lines, CCK-8 proliferation assay indicated that the cell proliferation is promoted by miR-599 mimics. Transwell assay showed that miR-599 mimics promoted the invasion and migration of NSCLC cells. Luciferase assays confirmed that miR-599 directly binds to the 3'untranslated region of SATB2, and western blotting showed that miR-599 suppresses the expression of SATB2 at the protein level. This study indicates that miR-599 promotes proliferation and invasion of NSCLC cell lines via SATB2. The miR-599 may represent a potential therapeutic target for NSCLC treatment. - Highlights: • miR-599 is up-regulated in NSCLC. • miR-599 promotes the proliferation and invasion of NSCLC cells. • miR-599 inhibitors inhibits the proliferation and invasion of NSCLC cells. • miR-599 targets 3′ UTR of SATB2 in NSCLC cells. • miR-599 inhibits SATB2 in NSCLC cells.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
Energy Technology Data Exchange (ETDEWEB)
Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)
2012-01-13
Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
International Nuclear Information System (INIS)
Yang, Zhihong; Zhang, Yuxia; Wang, Li
2012-01-01
Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
MODEL2TALK : An Intervention to Promote Productive Classroom Talk
van der Veen, Chiel; van der Wilt, Femke; van Kruistum, Claudia; van Oers, Bert; Michaels, Sarah
2017-01-01
This article describes the MODEL2TALK intervention, which aims to promote young children's oral communicative competence through productive classroom talk. Productive classroom talk provides children in early childhood education with many opportunities to talk and think together. Results from a
Energy Technology Data Exchange (ETDEWEB)
Fang, Zejun [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Gong, Chaoju [Department of Pathology and Pathophysiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 (China); Liu, Hong [Zhejiang Normal University – Jinhua People' s Hospital Joint Center for Biomedical Research, Jinhua, Zhejiang, 321004 (China); Zhang, Xiaomin; Mei, Lingming [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Song, Mintao [Department of Pathophysiology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (CAMS), School of Basic Medicine, Peking Union Medical College (PUMC), Beijing, 100005 (China); Qiu, Lanlan; Luo, Shuchai; Zhu, Zhihua; Zhang, Ronghui; Gu, Hongqian [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Chen, Xiang, E-mail: sychenxiang@126.com [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China)
2015-08-21
As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2 were closely related to the transcription factor E2F1. Mechanistic studies were conducted to determine the molecular basis. Ectopic overexpression of E2F1 promoted RRM2 transactivation while knockdown of E2F1 reduced the levels of RRM2 mRNA and protein. To further investigate the roles of RRM2 which was activated by E2F1 in CRC, CCK-8 assay and EdU incorporation assay were performed. Overexpression of E2F1 promoted cell proliferation in CRC cells, which was blocked by RRM2 knockdown attenuation. In the migration and invasion tests, overexpression of E2F1 enhanced the migration and invasion of CRC cells which was abrogated by silencing RRM2. Besides, overexpression of RRM2 reversed the effects of E2F1 knockdown partially in CRC cells. Examination of clinical CRC specimens demonstrated that both RRM2 and E2F1 were elevated in most cancer tissues compared to the paired normal tissues. Further analysis showed that the protein expression levels of E2F1 and RRM2 were parallel with each other and positively correlated with lymph node metastasis (LNM), TNM stage and distant metastasis. Consistently, the patients with low E2F1 and RRM2 levels have a better prognosis than those with high levels. Therefore, we suggest that E2F1 can promote CRC proliferation, migration, invasion and metastasis by regulating RRM2 transactivation. Understanding the role of E2F1 in activating RRM2 transcription will help to explain the relationship between E2F1 and RRM2 in CRC and provide a novel predictive marker for diagnosis and prognosis of the disease. - Highlights: • E2F1 promotes RRM2 transactivation in CRC cells. • E2F1 promotes the proliferation of CRC cells by activating RRM2. • E2F1 promotes the migration and
HNF1 alpha activates the aminopeptidase N promoter in intestinal (Caco-2) cells
DEFF Research Database (Denmark)
Olsen, Jørgen; Laustsen, Lotte; Troelsen, J
1994-01-01
The importance of HNF1 binding proteins for intestinal aminopeptidase N expression was investigated using the Caco-2 cell-line. Aminopeptidase N promoter activity in Caco-2 cells depends on the HNF1 element (positions -85 to -58) and co-transfection with an HNF1 alpha expression vector demonstrates...... a direct activation of the promoter by HNF1 alpha through this element. Electrophoretic mobility shift assays using nuclear extracts from Caco-2 cells show the presence of high amounts of HNF1 binding proteins irrespective of their state of differentiation....
SAV1 promotes Hippo kinase activation through antagonizing the PP2A phosphatase STRIPAK
Energy Technology Data Exchange (ETDEWEB)
Bae, Sung Jun [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Ni, Lisheng [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Osinski, Adam [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Tomchick, Diana R. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Brautigam, Chad A. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, United States; Luo, Xuelian [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States
2017-10-24
The Hippo pathway controls tissue growth and homeostasis through a central MST-LATS kinase cascade. The scaffold protein SAV1 promotes the activation of this kinase cascade, but the molecular mechanisms remain unknown. Here, we discover SAV1-mediated inhibition of the PP2A complex STRIPAKSLMAP as a key mechanism of MST1/2 activation. SLMAP binding to autophosphorylated MST2 linker recruits STRIPAK and promotes PP2A-mediated dephosphorylation of MST2 at the activation loop. Our structural and biochemical studies reveal that SAV1 and MST2 heterodimerize through their SARAH domains. Two SAV1–MST2 heterodimers further dimerize through SAV1 WW domains to form a heterotetramer, in which MST2 undergoes trans-autophosphorylation. SAV1 directly binds to STRIPAK and inhibits its phosphatase activity, protecting MST2 activation-loop phosphorylation. Genetic ablation of SLMAP in human cells leads to spontaneous activation of the Hippo pathway and alleviates the need for SAV1 in Hippo signaling. Thus, SAV1 promotes Hippo activation through counteracting the STRIPAKSLMAP PP2A phosphatase complex.
Alkali promotion of N-2 dissociation over Ru(0001)
DEFF Research Database (Denmark)
Mortensen, Jens Jørgen; Hammer, Bjørk; Nørskov, Jens Kehlet
1998-01-01
Using self-consistent density functional calculations, we show that adsorbed Na and Cs lower the barrier for dissociation of N2 on Ru(0001). Since N2 dissociation is a crucial step in the ammonia synthesis reaction, we explain in this way the experimental observation that alkali metals promote th...... the ammonia synthesis reaction over Ru catalysts. We also show that the origin of this effect is predominantly a direct electrostatic attraction between the adsorbed alkali atoms and the dissociating molecule....
A growth hormone receptor SNP promotes lung cancer by impairment of SOCS2-mediated degradation
DEFF Research Database (Denmark)
Chhabra, Y.; Wong, H. Y.; Nikolajsen, Louise Fletcher
2018-01-01
Both humans and mice lacking functional growth hormone (GH) receptors are known to be resistant to cancer. Further, autocrine GH has been reported to act as a cancer promoter. Here we present the first example of a variant of the GH receptor (GHR) associated with cancer promotion, in this case lu......-mesenchymal transition and metastases (TWIST1, SNAI2, EGFR, MYC and CCND1) at 2 h after a GH pulse. This is consistent with prolonged GH signalling acting to promote cancer progression in lung cancer.Oncogene advance online publication, 2 October 2017; doi:10.1038/onc.2017.352....
Enhancing promotional strategies within social marketing programs: use of Web 2.0 social media.
Thackeray, Rosemary; Neiger, Brad L; Hanson, Carl L; McKenzie, James F
2008-10-01
The second generation of Internet-based applications (i.e., Web 2.0), in which users control communication, holds promise to significantly enhance promotional efforts within social marketing campaigns. Web 2.0 applications can directly engage consumers in the creative process by both producing and distributing information through collaborative writing, content sharing, social networking, social bookmarking, and syndication. Web 2.0 can also enhance the power of viral marketing by increasing the speed at which consumers share experiences and opinions with progressively larger audiences. Because of the novelty and potential effectiveness of Web 2.0, social marketers may be enticed to prematurely incorporate related applications into promotional plans. However, as strategic issues such as priority audience preferences, selection of appropriate applications, tracking and evaluation, and related costs are carefully considered, Web 2.0 will expand to allow health promotion practitioners more direct access to consumers with less dependency on traditional communication channels.
The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.
Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta
2009-08-01
Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Role of CeO2 promoter in NiO/α-Al2O3 catalyst for dry reforming of methane
Loc, Luu Cam; Phuong, Phan Hong; Tri, Nguyen
2017-09-01
A series of Ni/α-Al2O3 (NiAl) catalysts promoted by CeO2 was prepared by co-impregnation methods with content of (NiO+CeO2) being in the range of 10-30 wt%. The NiO:CeO2 weight ratio was fluctuated at 1:1, 1:2 and 1:3. Several techniques, including X-ray powder diffraction (XRD), Hydrogen temperature-programmed reduction (H2-TPR), and transmission electron microscopy (TEM) were used to investigate catalysts' physico-chemical properties. The activity of these catalysts in dry reforming of CH4 was investigated at temperature range of 550-800 °C. The results revealed that the most suitable CeO2 promoted Ni catalyst contained 20 wt% of (NiO+CeO2) and NiO:CeO2 weight ratio of 1:2. The best catalytic performance of catalyst [20(1Ni2Ce)Al] due to a better reducibility resulted in a higher amount of free small particle NiO. At 700 °C and CH4:CO2 molar ratio of 1:1, the conversion of CH4 and CO2 on the most suitable CeO2 promoted Ni catalyst reached 86% and 67%, respectively; H2 and CO selectivity of 90% and H2:CO molar ratio of 1.15 were obtained. Being similar to MgO [1], promoter CeO2 could improve catalytic activity of Ni/α-Al2O3 catalyst at a lower range of temperature. Besides, both MgO and CeO2 had a great impact on improving coke resistance of Ni catalysts. At higher temperature, the role of CeO2 as well as MgO in preventing coke formation on catalyst was clarified by temperature-programmed oxidation (TPO) technique. Coke amount formed after 30-h TOS on 20(1Ni2Ce) catalyst was found to be 22.18 mgC/gcat, being less than on non-promoted catalyst (36.75 mgC/gcat), but more than on 20(1Ni2Mg)Al one (5.25 mgC/gcat).
Predictability of Joint Promotion Examinations in SS2 on Academic ...
African Journals Online (AJOL)
This research studied the predictability of joint SS2 promotion examinations of all the command secondary schools in Nigeria on academic performance of students in Senior School Certificate Examinations. The sample consists of 120 students selected at the Command Secondary School, Abakaliki and Command Day ...
DEFF Research Database (Denmark)
Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher
2014-01-01
The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator Actll orf4...... constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning......, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actll orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actll orf4. The resulting library was screened based...
Bahadoran, Shahab; Dehghani Samani, Amir; Hassanpour, Hossein
2018-01-01
Heat stress is a problem in laying hens as it decreases egg quality by decreasing eggshell mineralization. Heat stress alters gene expression, hence our aim was to investigate effects of heat stress on gene expression of ion transport elements involving in uterine mineralization (TRPV6, CALB1, ITPR3, SCNN1G, SLC4A4, KCNJ15, SLC4A9, and CLCN2) by real time quantitative PCR. Forty 23-week-old White Leghorn laying hens were housed in two rooms. The control group (n = 20) was maintained at 21-23 °C, and the heat stress group (n = 20) was exposed to 36-38 °C for 8 weeks. All parameters of egg quality including egg weight, surface area, volume, and eggshell weight, thickness, ash weight, and calcium content were decreased in the heat stress group compared to the control group (by 26.9%, 32.7%, 44.1%, 38.4%, 31.7%, 39.4%, and 11.1%, respectively). Total plasma calcium was decreased by 13.4%. Levels of ITPR3, SLC4A4, and SLC4A9 transcripts in the uterine lining were decreased in the heat stress group compared to the control group (by 61.4%, 66.1%, and 66.1%, respectively). CALB1 transcript level was increased (by 34.2 fold) in the heat stress group of hens compared to controls. TRPV6, SCNN1G, KCNJ15, and CLCN2 transcript levels did not significantly differ between control and heat stress groups of laying hens. It is concluded that the down-expression of ITPR3, SLC4A4, and SLC4A9 genes may impair transportation of Cl - , HCO 3 - , and Na + in eggshell mineralization during heat stress. Increased CALB1 gene expression may increase resistance of uterine cells to detrimental effects of heat stress.
Promotion of Nb2O5 on the wustite-based iron catalyst for ammonia synthesis
International Nuclear Information System (INIS)
Han, Wenfeng; Huang, Shiliang; Cheng, Tianhong; Tang, Haodong; Li, Ying; Liu, Huazhang
2015-01-01
Highlights: • Niobium enhances the reduction of wustite-based ammonia synthesis catalyst significantly. • Nb 2 O 5 inhibits the segregation or formation of solid solutions on the catalyst surface. • Nb 2 O 5 doping enhances the growth rates of [2 1 1] and [2 0 0] planes rather than their amounts. - Abstract: Niobium was selected and investigated as a potential promoter for wustite-based catalyst (WBC) for ammonia synthesis. Experiments on reduction performance, activity test and H 2 -TGA, in situ XRD as well as XPS were carried out to obtain the promotion effect and mechanism involved. Niobium as a promoter was confirmed to enhance the reduction of WBC significantly. This behavior is highly desired for industry in terms of catalyst regeneration and lesser pretreatment time for fabrication regardless the unimproved catalytic performance for Nb 2 O 5 -doped wustite-based catalyst (Nb-WBC). Possible reasons for these phenomena are discussed. It is suggested that Nb 2 O 5 is not favorable for the segregation or formation of solid solutions on the catalyst surface, which are difficult to be reduced. However, it seems that niobium does not promote the growth of [2 1 1] plane, which is active for ammonia synthesis.
Directory of Open Access Journals (Sweden)
Zahraa Mohammed Yahya
2013-11-01
Full Text Available Objective: To evaluate the sensitivity and specificity of Calretinin and Carcinoembryonic antigen as immunocytochemical markers in distinguishing mesothelial cells from metastatic adenocarcinoma cells in effusion cytology.Methods: This study included 50 patients who presented with effusions (26 pleural and 24 peritoneal, at Al-Kadhimya Teaching Hospital who were selected according to their preliminary diagnosis from 1st December 2010 to 30th June 2011. Effusion fluids were aspirated and processed for both conventional cytological methods using Papanicolaou-stain and immunocytochemical staining with anti Calretinin and Carcinoembryonic antigen.Results: The sensitivity of cytology for detection of malignant cells was 77%, with 100% specificity and 86% accuracy. Calretinin was observed to be a specific (100% and sensitive (90% marker for mesothelial cells (of benign etiology. Carcinoembryonic antigen exhibited 70% sensitivity and 100% specificity for adenocarcinoma cells. When the results of both cytology and immunocytochemistry were considered in conjunction, the sensitivity for the detection of malignancy increased to 97%, with 100% specificity and 98% accuracy.Conclusion: Calretinin and Carcinoembryonic antigen were found to be useful markers for differentiating reactive mesothelial cells from metastatic adenocarcinoma cells in smears prepared from body fluids. Also, the combination of both cytology and immunocytochemical studies using the two markers can greatly enhance the diagnostic accuracy, sensitivity and specificity in malignant effusions.
Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing
2017-01-03
Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Promoting Reflective Thinking Skills by Using Web 2.0 Application
Abdullah, Mohamed
2015-01-01
The study aims to investigate are using Web 2.0 applications promoting reflective thinking skills for higher education student in faculty for education. Although the literature reveals that technology integration is a trend in higher education and researchers and educators have increasingly shared their ideas and examples of implementations of Web…
Multicomponent Biginelli's synthesis of 3,4-dihydropyrimidin-2(1H-ones promoted by SnCl2.2H2O
Directory of Open Access Journals (Sweden)
Russowsky Dennis
2004-01-01
Full Text Available The ability of SnCl2.2H2O as catalyst to promote the Biginelli three-component condensation reaction from a diversity of aromatic aldehydes, ethyl acetoacetate and urea or thiourea is described. The reaction was carried out in acetonitrile or ethanol as solvents in neutral media and represents an improvement of the classical Biginelli protocol and an advantage in comparison with FeCl3.6H2O, NiCl2.6H2O and CoCl2.6H2O which were used with HCl as co-catalyst. The synthesis of 3,4-dihydropyrimidinones was achieved in good to excelent yields.
FGF‐2 promotes osteocyte differentiation through increased E11/podoplanin expression
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N.; Fleming, Robert; Vincent, Tonia L.; Buttle, David J.; Pitsillides, Andrew A.; Farquharson, Colin
2018-01-01
E11/podoplanin is critical in the early stages of osteoblast‐to‐osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF‐2 on E11‐mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast‐like cells and murine primary osteoblasts to FGF‐2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF‐2‐related changes in E11 expression and dendrite formation. FGF‐2 strongly activated the ERK signaling pathway in osteoblast‐like cells but inhibition of this pathway did not block the ability of FGF‐2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF‐2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF‐2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. PMID:29215722
Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.
Directory of Open Access Journals (Sweden)
Nobuko Matsushita
Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.
saRNA-guided Ago2 targets the RITA complex to promoters to stimulate transcription.
Portnoy, Victoria; Lin, Szu Hua Sharon; Li, Kathy H; Burlingame, Alma; Hu, Zheng-Hui; Li, Hao; Li, Long-Cheng
2016-03-01
Small activating RNAs (saRNAs) targeting specific promoter regions are able to stimulate gene expression at the transcriptional level, a phenomenon known as RNA activation (RNAa). It is known that RNAa depends on Ago2 and is associated with epigenetic changes at the target promoters. However, the precise molecular mechanism of RNAa remains elusive. Using human CDKN1A (p21) as a model gene, we characterized the molecular nature of RNAa. We show that saRNAs guide Ago2 to and associate with target promoters. saRNA-loaded Ago2 facilitates the assembly of an RNA-induced transcriptional activation (RITA) complex, which, in addition to saRNA-Ago2 complex, includes RHA and CTR9, the latter being a component of the PAF1 complex. RITA interacts with RNA polymerase II to stimulate transcription initiation and productive elongation, accompanied by monoubiquitination of histone 2B. Our results establish the existence of a cellular RNA-guided genome-targeting and transcriptional activation mechanism and provide important new mechanistic insights into the RNAa process.
Directory of Open Access Journals (Sweden)
Deepti Jain
Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.
Impact of Ni promotion on the hydrogenation pathways of phenanthrene on MoS 2 /γ-Al 2 O 3
Energy Technology Data Exchange (ETDEWEB)
Schachtl, Eva; Yoo, Jong Suk; Gutiérrez, Oliver Y.; Studt, Felix; Lercher, Johannes A.
2017-08-01
The reaction network and elementary steps of the hydrogenation of phenanthrene are explored on parent and Ni-promoted MoS2/c-Al2O3. Two pathways were identified, i.e., Path 1: Phenanthrene _ 9,10-dihydrophenanthrene (DiHPhe)?1,2,3,4,4a,9,10,10a-octahydro-phenanthrene (asymOHPhe), and Path 2: Phenanthrene ?1,2,3,4-tetrahydrophenanthrene (TetHPhe)?1,2,3,4,5,6,7,8-octahydrophenan threne. The steps TetHPhe?asymOHPhe (hydrogenation), and DiHPhe?TetHPhe (hydrogenationisomerization) become notable at phenanthrene conversions above 20%. The reaction preferentially proceeds via Path 1 (90% selectivity) on MoS2/Al2O3. Ni promotion (Ni/(Ni + Mo) molar ratio of 0.3 at the edges on MoS2) increases the hydrogenation activity per active edge twofold and leads to 50% selectivity to both pathways. The reaction orders in H2 vary from _0.8 on MoS2/Al2O3 to _1.2 on Ni-MoS2/Al2O3, whereas the reaction orders in phenanthrene (_0.6) hardly depend on Ni promotion. The reaction orders in H2S are zero on MoS2/Al2O3 and slightly negative on Ni-MoS2/Al2O3. DFT calculations indicate that phenanthrene is preferentially adsorbed parallel to the basal planes, while H is located at the edges perpendicular to the basal planes. Theory also suggests that Ni atoms, incorporated preferentially on the S-edges, increase the stability of hydrogenated intermediates. Hydrogenation of phenanthrene proceeds through quasi-equilibrated adsorption of the reactants followed by consecutive addition of hydrogen pairs to the adsorbed hydrocarbon. The rate determining steps for the formation of DiHPhe and TetHPhe are the addition of the first and second hydrogen pair, respectively. The concentration of SH groups (activated H at the edges) increases with Ni promotion linearly correlating the rates of Path 1 and Path 2, albeit with different functions. The enhancing effect of Ni on Path 2 is attributed to accelerated hydrogen addition to adsorbed hydrocarbons without important changes in their coverages.
Karume, Ibrahim
2016-10-04
The immobilization of Thermoanaerobacter ethanolicus secondary alcohol dehydrogenase (TeSADH) using sol–gel method enables its use to racemize enantiopure alcohols in organic media. Here, we report the racemization of enantiopure phenyl-ring-containing secondary alcohols using xerogel-immobilized W110A TeSADH in hexane rather than the aqueous medium required by the enzyme. We further showed that this racemization approach in organic solvent was compatible with Candida antarctica lipase B (CALB)-catalyzed kinetic resolution. This compatibility, therefore, allowed a dual enzymatic dynamic kinetic resolution of racemic alcohols using CALB-catalyzed kinetic resolution and W110A TeSADH-catalyzed racemization of phenyl-ring-containing alcohols.
P2Y2 Receptor and EGFR Cooperate to Promote Prostate Cancer Cell Invasion via ERK1/2 Pathway.
Li, Wei-Hua; Qiu, Ying; Zhang, Hong-Quan; Tian, Xin-Xia; Fang, Wei-Gang
2015-01-01
As one member of G protein-coupled P2Y receptors, P2Y2 receptor can be equally activated by extracellular ATP and UTP. Our previous studies have proved that activation of P2Y2 receptor by extracellular ATP could promote prostate cancer cell invasion and metastasis in vitro and in vivo via regulating the expressions of some epithelial-mesenchymal transition/invasion-related genes (including IL-8, E-cadherin, Snail and Claudin-1), and the most significant change in expression of IL-8 was observed after P2Y2 receptor activation. However, the signaling pathway downstream of P2Y2 receptor and the role of IL-8 in P2Y2-mediated prostate cancer cell invasion remain unclear. Here, we found that extracellular ATP/UTP induced activation of EGFR and ERK1/2. After knockdown of P2Y2 receptor, the ATP -stimulated phosphorylation of EGFR and ERK1/2 was significantly suppressed. Further experiments showed that inactivation of EGFR and ERK1/2 attenuated ATP-induced invasion and migration, and suppressed ATP-mediated IL-8 production. In addition, knockdown of IL-8 inhibited ATP-mediated invasion and migration of prostate cancer cells. These findings suggest that P2Y2 receptor and EGFR cooperate to upregulate IL-8 production via ERK1/2 pathway, thereby promoting prostate cancer cell invasion and migration. Thus blocking of the P2Y2-EGFR-ERK1/2 pathway may provide effective therapeutic interventions for prostate cancer.
Directory of Open Access Journals (Sweden)
Manuel Castellano-Muñoz
2010-10-01
Full Text Available Hair cells in the auditory, vestibular, and lateral-line systems respond to mechanical stimulation and transmit information to afferent nerve fibers. The sensitivity of mechanoelectrical transduction is modulated by the efferent pathway, whose activity usually reduces the responsiveness of hair cells. The basis of this effect remains unknown.We employed immunocytological, electrophysiological, and micromechanical approaches to characterize the anatomy of efferent innervation and the effect of efferent activity on the electrical and mechanical properties of hair cells in the bullfrog's sacculus. We found that efferent fibers form extensive synaptic terminals on all macular and extramacular hair cells. Macular hair cells expressing the Ca(2+-buffering protein calretinin contain half as many synaptic ribbons and are innervated by twice as many efferent terminals as calretinin-negative hair cells. Efferent activity elicits inhibitory postsynaptic potentials in hair cells and thus inhibits their electrical resonance. In hair cells that exhibit spiking activity, efferent stimulation suppresses the generation of action potentials. Finally, efferent activity triggers a displacement of the hair bundle's resting position.The hair cells of the bullfrog's sacculus receive a rich efferent innervation with the heaviest projection to calretinin-containing cells. Stimulation of efferent axons desensitizes the hair cells and suppresses their spiking activity. Although efferent activation influences mechanoelectrical transduction, the mechanical effects on hair bundles are inconsistent.
Solubility and viscosity for CO_2 capture process using MEA promoted DEAE aqueous solution
International Nuclear Information System (INIS)
Fu, Dong; Wang, LeMeng; Zhang, Pan; Mi, ChenLu
2016-01-01
Highlights: • Solubility of CO_2 in MEA promoted DEAE aqueous solution was measured. • Mass fraction and temperature dependences of solubility were illustrated. • Viscosities of carbonated MEA–DEAE solutions were measured and calculated. • Temperature, mass fraction and CO_2 loading dependences of viscosity were illustrated. - Abstract: The saturated solubility of CO_2 in monoethanolamine (MEA) promoted 2-diethylaminoethanol (DEAE) aqueous solution was investigated at temperatures ranging from (303.2 to 323.2) K. The mass fraction and temperature dependences of the saturated solubility and CO_2 loading are illustrated. The viscosities of both CO_2-unloaded and CO_2-loaded DEAE–MEA aqueous solutions were measured and then calculated by using the Weiland equation. The effects of temperature, mass fraction and CO_2 loading on viscosities are demonstrated.
Mao, Zhantong; Ganesh, Manoj; Bucaro, Michael; Smolianski, Igor; Gross, Richard A; Lyons, Alan M
2014-12-08
By bringing enzymes into contact with predefined regions of a surface, a polymer film can be selectively degraded to form desired patterns that find a variety of applications in biotechnology and electronics. This so-called "enzymatic lithography" is an environmentally friendly process as it does not require actinic radiation or synthetic chemicals to develop the patterns. A significant challenge to using enzymatic lithography has been the need to restrict the mobility of the enzyme in order to maintain control of feature sizes. Previous approaches have resulted in low throughput and were limited to polymer films only a few nanometers thick. In this paper, we demonstrate an enzymatic lithography system based on Candida antartica lipase B (CALB) and poly(ε-caprolactone) (PCL) that can resolve fine-scale features, (<1 μm across) in thick (0.1-2.0 μm) polymer films. A Polymer Pen Lithography (PPL) tool was developed to deposit an aqueous solution of CALB onto a spin-cast PCL film. Immobilization of the enzyme on the polymer surface was monitored using fluorescence microscopy by labeling CALB with FITC. The crystallite size in the PCL films was systematically varied; small crystallites resulted in significantly faster etch rates (20 nm/min) and the ability to resolve smaller features (as fine as 1 μm). The effect of printing conditions and relative humidity during incubation is also presented. Patterns formed in the PCL film were transferred to an underlying copper foil demonstrating a "Green" approach to the fabrication of printed circuit boards.
Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans
Directory of Open Access Journals (Sweden)
Wang Xiaoqin
2005-10-01
Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.
Ets2 in tumor fibroblasts promotes angiogenesis in breast cancer.
Directory of Open Access Journals (Sweden)
Julie A Wallace
Full Text Available Tumor fibroblasts are active partners in tumor progression, but the genes and pathways that mediate this collaboration are ill-defined. Previous work demonstrates that Ets2 function in stromal cells significantly contributes to breast tumor progression. Conditional mouse models were used to study the function of Ets2 in both mammary stromal fibroblasts and epithelial cells. Conditional inactivation of Ets2 in stromal fibroblasts in PyMT and ErbB2 driven tumors significantly reduced tumor growth, however deletion of Ets2 in epithelial cells in the PyMT model had no significant effect. Analysis of gene expression in fibroblasts revealed a tumor- and Ets2-dependent gene signature that was enriched in genes important for ECM remodeling, cell migration, and angiogenesis in both PyMT and ErbB2 driven-tumors. Consistent with these results, PyMT and ErbB2 tumors lacking Ets2 in fibroblasts had fewer functional blood vessels, and Ets2 in fibroblasts elicited changes in gene expression in tumor endothelial cells consistent with this phenotype. An in vivo angiogenesis assay revealed the ability of Ets2 in fibroblasts to promote blood vessel formation in the absence of tumor cells. Importantly, the Ets2-dependent gene expression signatures from both mouse models were able to distinguish human breast tumor stroma from normal stroma, and correlated with patient outcomes in two whole tumor breast cancer data sets. The data reveals a key function for Ets2 in tumor fibroblasts in signaling to endothelial cells to promote tumor angiogenesis. The results highlight the collaborative networks that orchestrate communication between stromal cells and tumor cells, and suggest that targeting tumor fibroblasts may be an effective strategy for developing novel anti-angiogenic therapies.
Electrochemical study on the cationic promotion of the catalytic SO2 oxidation in pyrosulfate melts
DEFF Research Database (Denmark)
Petrushina, Irina; Bjerrum, Niels; Cappeln, Frederik Vilhelm
1998-01-01
The electrochemical behavior of the molten V2O5-M2S2O7 (M = K, Cs, or Na) system was studied using a gold working electrode at 440 degrees C in argon and air atmosphere. The aim of the present investigation was to find a possible correlation between the promoting effect of Cs+ and Na+ ions...... on the catalytic oxidation of SO2 in the V2O5-M2S2O7 system and the effect of these alkali cations on the electrochemical behavior of V2O5 in the alkali pyrosulfate melts It has been shown that Na+ ions had a promoting effect on the V(V) reversible arrow V(IV) electrochemical reaction. Sodium ions accelerate both...... in the catalytic SO, oxidation most likely is the oxidation of V(IV) to V(V) and the Na+ and Cs+ promoting effect is based on the acceleration of this stage. It has also been proposed that voltammetric measurements can be used for fast optimization of the composition of the vanadium catalyst (which...
Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung
2014-09-01
BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Sox2 promotes survival of satellite glial cells in vitro
International Nuclear Information System (INIS)
Koike, Taro; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao
2015-01-01
Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling
Sox2 promotes survival of satellite glial cells in vitro
Energy Technology Data Exchange (ETDEWEB)
Koike, Taro, E-mail: koiket@hirakata.kmu.ac.jp; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao
2015-08-14
Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling.
FGF-2 promotes osteocyte differentiation through increased E11/podoplanin expression.
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N; Fleming, Robert; Vincent, Tonia L; Buttle, David J; Pitsillides, Andrew A; Staines, Katherine A; Farquharson, Colin
2018-07-01
E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast-like cells and murine primary osteoblasts to FGF-2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF-2-related changes in E11 expression and dendrite formation. FGF-2 strongly activated the ERK signaling pathway in osteoblast-like cells but inhibition of this pathway did not block the ability of FGF-2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF-2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF-2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. © 2017 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Ho-Chang Kuo
2015-01-01
Full Text Available Kawasaki disease (KD is characterized by pediatric systemic vasculitis of an unknown cause. The low affinity immunoglobulin gamma Fc region receptor II-a (FCGR2A gene was reported to be involved in the susceptibility of KD. DNA methylation is one of the epigenetic mechanisms that control gene expression; thus, we hypothesized that methylation status of CpG islands in FCGR2A promoter associates with the susceptibility and therapeutic outcomes of Kawasaki disease. In this study, 36 KD patients and 24 healthy subjects from out-patient clinic were recruited. Eleven potential methylation sites within the targeted promoter region of FCGR2A were selected for investigation. We marked the eleven methylation sites from A to K. Our results indicated that methylation at the CpG sites G, H, and J associated with the risk of KD. CpG sites B, C, E, F, H, J, and K were found to associate with the outcomes of IVIG treatment. In addition, CpG sites G, J, and K were predicted as transcription factors binding sites for NF-kB, Myc-Max, and SP2, respectively. Our study reported a significant association among the promoter methylation of FCGR2A, susceptibility of KD, and the therapeutic outcomes of IVIG treatment. The methylation levels of CpG sites of FCGR2A gene promoter should be an important marker for optimizing IVIG therapy.
E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor
International Nuclear Information System (INIS)
Hiebert, S.W.; Lipp, M.; Nevins, J.R.
1989-01-01
E2F is a cellular transcription factor that binds to two sites in the adenovirus E2 promoter. Previous experiments have implicated E2F in the E1A-dependent transactivation of the E2 gene since levels of active E2F increase markedly during adenovirus infection in parallel with the increase in E2 transcription, and an E2F binding site can confer E1A inducibility to a heterologous promoter. Here the authors show that E2F binds to two sequence elements within the P2 promoter of the human MYC gene which are within a region that is critical for promoter activity. The MYC promoter can be trans-activated in an E1A-dependent manner and site-directed mutagenesis demonstrates that these E2F elements are essential for trans-activation. Finally, they also find that adenovirus infection of quiescent cells results in a stimulation of the endogenous MYC gene. They conclude that the activation of the E2F factor, which is likely responsible for the activation of viral E2 transcription, is also responsible for the E1A-dependent induction of MYC transcription
Promoting lifestyle changes for Chinese Australians with Type 2 diabetes
SUET TING CHOI
2017-01-01
Providing translated diabetes education from English to Chinese is not enough to promote healthy lifestyle changes among Chinese Australians with type 2 diabetes. This thesis explored the behaviour patterns of Chinese patients during diabetes education and identified the most successful education approaches. The research involved a review of literature and an exploratory qualitative study across three countries. The findings suggest health professionals working with Chinese Australian patient...
Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C
2017-09-12
Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Chen-Chun Pai
2017-09-01
Full Text Available Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB binding factor (MBF-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR expression, reduced deoxyribonucleoside triphosphate (dNTP synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast.
Wolff, Dennis W; Xie, Yan; Deng, Caishu; Gatalica, Zoran; Yang, Mingjie; Wang, Bo; Wang, Jincheng; Lin, Ming-Fong; Abel, Peter W; Tu, Yaping
2012-04-01
G-protein-coupled receptor (GPCR)-stimulated androgen-independent activation of androgen receptor (AR) contributes to acquisition of a hormone-refractory phenotype by prostate cancer. We previously reported that regulator of G-protein signaling (RGS) 2, an inhibitor of GPCRs, inhibits androgen-independent AR activation (Cao et al., Oncogene 2006;25:3719-34). Here, we show reduced RGS2 protein expression in human prostate cancer specimens compared to adjacent normal or hyperplastic tissue. Methylation-specific PCR analysis and bisulfite sequencing indicated that methylation of the CpG island in the RGS2 gene promoter correlated with RGS2 downregulation in prostate cancer. In vitro methylation of this promoter suppressed reporter gene expression in transient transfection studies, whereas reversal of this promoter methylation with 5-aza-2'-deoxycytidine (5-Aza-dC) induced RGS2 reexpression in androgen-independent prostate cancer cells and inhibited their growth under androgen-deficient conditions. Interestingly, the inhibitory effect of 5-Aza-dC was significantly reduced by an RGS2-targeted short hairpin RNA, indicating that reexpressed RGS2 contributed to this growth inhibition. Restoration of RGS2 levels by ectopic expression in androgen-independent prostate cancer cells suppressed growth of xenografts in castrated mice. Thus, RGS2 promoter hypermethylation represses its expression and unmasks a latent pathway for AR transactivation in prostate cancer cells. Targeting this reversible process may provide a new strategy for suppressing prostate cancer progression by reestablishing its androgen sensitivity. Copyright © 2011 UICC.
DEFF Research Database (Denmark)
Boyd, Mette; Coskun, Mehmet; Lilje, Berit
2014-01-01
The Caco-2 cell line is one of the most important in vitro models for enterocytes, and is used to study drug absorption and disease, including inflammatory bowel disease and cancer. In order to use the model optimally, it is necessary to map its functional entities. In this study, we have generated...... genome-wide maps of active transcription start sites (TSSs), and active enhancers in Caco-2 cells with or without tumour necrosis factor (TNF)-α stimulation to mimic an inflammatory state. We found 520 promoters that significantly changed their usage level upon TNF-α stimulation; of these, 52...... promoters. As a case example, we characterize an enhancer regulating the laminin-5 γ2-chain (LAMC2) gene by nuclear factor (NF)-κB binding. This report is the first to present comprehensive TSS and enhancer maps over Caco-2 cells, and highlights many novel inflammation-specific promoters and enhancers....
Directory of Open Access Journals (Sweden)
Ryan F Overcash
Full Text Available The type I transmembrane protein with epidermal growth factor and two follistatin motifs 2 (TMEFF2, is expressed mainly in brain and prostate. Expression of TMEFF2 is deregulated in prostate cancer, suggesting a role in this disease, but the molecular mechanism(s involved in this effect are not clear. Although androgens promote tmeff2 transcription, androgen delivery to castrated animals carrying CWR22 xenografts increases TMEFF2 protein levels in the absence of mRNA changes, suggesting that TMEFF2 may also be post-transcriptionally regulated. Here we show that translation of TMEFF2 is regulated by androgens. Addition of physiological concentrations of dihydrotestosterone (DHT to prostate cancer cell lines increases translation of endogenous TMEFF2 or transfected TMEFF2-Luciferase fusions, and this effect requires the presence of upstream open reading frames (uORFs in the 5'-untranslated region (5'-UTR of TMEFF2. Using chemical and siRNA inhibition of the androgen receptor (AR, we show that the androgen effect on TMEFF2 translation is mediated by the AR. Importantly, DHT also promotes phosphorylation of the α subunit of the translation initiation factor 2 (eIF2α in an AR-dependent manner, paralleling the effect on TMEFF2 translation. Moreover, endoplasmic reticulum (ER stress conditions, which promote eIF2α phosphorylation, also stimulate TMEFF2 translation. These results indicate that androgen signaling promotes eIF2α phosphorylation and subsequent translation of TMEFF2 via a mechanism that requires uORFs in the 5'-UTR of TMEFF2.
TGF-β promotes glioma cell growth via activating Nodal expression through Smad and ERK1/2 pathways
International Nuclear Information System (INIS)
Sun, Jing; Liu, Su-zhi; Lin, Yan; Cao, Xiao-pan; Liu, Jia-ming
2014-01-01
Highlights: •TGF-β promoted Nodal expression in glioma cells. •TGF-β promoted Nodal expression via activating Smad and ERK1/2 pathways. •TGF-β promotes glioma cell growth via activating Nodal expression. -- Abstract: While there were certain studies focusing on the mechanism of TGF-β promoting the growth of glioma cells, the present work revealed another novel mechanism that TGF-β may promote glioma cell growth via enhancing Nodal expression. Our results showed that Nodal expression was significantly upregulated in glioma cells when TGF-β was added, whereas the TGF-β-induced Nodal expression was evidently inhibited by transfection Smad2 or Smad3 siRNAs, and the suppression was especially significant when the Smad3 was downregulated. Another, the attenuation of TGF-β-induced Nodal expression was observed with blockade of the ERK1/2 pathway also. Further detection of the proliferation, apoptosis, and invasion of glioma cells indicated that Nodal overexpression promoted the proliferation and invasion of tumor cells and inhibited their apoptosis, resembling the effect of TGF-β addition. Downregulation of Nodal expression via transfection Nodal-specific siRNA in the presence of TGF-β weakened the promoting effect of the latter on glioma cells growth, and transfecting Nodal siRNA alone in the absence of exogenous TGF-β more profoundly inhibited the growth of glioma cells. These results demonstrated that while both TGF-β and Nodal promoted glioma cells growth, the former might exert such effect by enhancing Nodal expression, which may form a new target for glioma therapy
Directory of Open Access Journals (Sweden)
Kosuke Fujita
2017-06-01
Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.
International Nuclear Information System (INIS)
Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran
2012-01-01
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC
SOX2 Reprograms Resident Astrocytes into Neural Progenitors in the Adult Brain
Directory of Open Access Journals (Sweden)
Wenze Niu
2015-05-01
Full Text Available Glial cells can be in vivo reprogrammed into functional neurons in the adult CNS; however, the process by which this reprogramming occurs is unclear. Here, we show that a distinct cellular sequence is involved in SOX2-driven in situ conversion of adult astrocytes to neurons. This includes ASCL1+ neural progenitors and DCX+ adult neuroblasts (iANBs as intermediates. Importantly, ASCL1 is required, but not sufficient, for the robust generation of iANBs in the adult striatum. These progenitor-derived iANBs predominantly give rise to calretinin+ interneurons when supplied with neurotrophic factors or the small-molecule valproic acid. Patch-clamp recordings from the induced neurons reveal subtype heterogeneity, though all are functionally mature, fire repetitive action potentials, and receive synaptic inputs. Together, these results show that SOX2-mediated in vivo reprogramming of astrocytes to neurons passes through proliferative intermediate progenitors, which may be exploited for regenerative medicine.
Efficient water removal in lipase-catalyzed esterifications using a low-boiling-point azeotrope.
Yan, Youchun; Bornscheuer, Uwe T; Schmid, Rolf D
2002-04-05
High conversions in lipase-catalyzed syntheses of esters from free acyl donors and an alcohol requires efficient removal of water preferentially at temperatures compatible to enzyme activity. Using a lipase B from Candida antarctica (CAL-B)-mediated synthesis of sugar fatty-acid esters, we show that a mixture of ethyl methylketone (EMK) and hexane (best ratio: 4:1, vo/vo) allows efficient removal of water generated during esterification. Azeotropic distillation of the solvent mixture (composition: 26% EMK, 55% hexane, 19% water) takes place at 59 degrees C, which closely matches the optimum temperature reported for CAL-B. Water is then removed from the azeotrope by membrane vapor permeation. In case of glucose stearate, 93% yield was achieved after 48 h using an equimolar ratio of glucose and stearic acid. CAL-B could be reused for seven reaction cycles, with 86% residual activity after 14 d total reaction time at 59 degrees C. A decrease in fatty-acid chain length as well as increasing temperatures (75 degrees C) resulted in lower conversions. In addition, immobilization of CAL-B on a magnetic polypropylene carrier (EP 100) facilitated separation of the biocatalyst. Copyright 2002 Wiley Periodicals, Inc. Biotechnol Bioeng 78: 31--34, 2002; DOI 10.1002/bit.10084
IL6 gene promoter polymorphisms and type 2 diabetes
DEFF Research Database (Denmark)
Huth, Cornelia; Heid, Iris M; Vollmert, Caren
2006-01-01
Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...
Comparison of the Kinetic Promoters Piperazine and Carbonic Anhydrase for CO2 Absorption
DEFF Research Database (Denmark)
Gladis, Arne; Gundersen, Maria T.; Thomsen, Kaj
2017-01-01
Kinetic promoter that enhance the reaction kinetics with CO2 are enabling the use of the low heat of reaction of slow absorbing solvents like MDEA. Mass transfer experiments with 30 wt% MDEA promoted by either by 1.7 and 8.5g/L enzyme carbonic anhydrase (CA) or 5 wt% piperazine (PZ) where conduct...
Directory of Open Access Journals (Sweden)
Ling Yang
2013-01-01
Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.
International Nuclear Information System (INIS)
Tong, Joanna H; Lo, Kwok W; To, Ka F; Ng, David C; Chau, Shuk L; So, Ken K; Leung, Patrick P; Lee, Tin L; Lung, Raymond W; Chan, Michael W; Chan, Anthony W
2010-01-01
Human Disabled-2 (DAB2), is a multi-function signalling molecule that it is frequently down-regulated in human cancers. We aimed to investigate the possible tumour suppressor effect of DAB2 in nasopharyngeal carcinoma (NPC). We studied the expression of DAB2 in NPC cell lines, xenografts and primary tumour samples. The status of promoter methylation was assessed by methylation specific PCR and bisulfite sequencing. The functional role of DAB2 in NPC was investigated by re-introducing DAB2 expression into NPC cell line C666-1. Decrease or absent of DAB2 transcript was observed in NPC cell lines and xenografts. Loss of DAB2 protein expression was seen in 72% (33/46) of primary NPC as demonstrated by immunohistochemistry. Aberrant DAB2 promoter methylation was detected in 65.2% (30/46) of primary NPC samples by methylation specific PCR. Treatment of the DAB2 negative NPC cell line C666-1 with 5-aza-2'-deoxycytidine resulted in restoration of DAB2 expression in a dose-dependent manner. Overexpression of DAB2 in NPC cell line C666-1 resulted in reduced growth rate and 35% reduction in anchorage-dependent colony formation, and inhibition of serum-induced c-Fos expression compared to vector-transfected controls. Over expression of DAB2 resulted in alterations of multiple pathways as demonstrated by expression profiling and functional network analysis, which confirmed the role of DAB2 as an adaptor molecule involved in multiple receptor-mediated signalling pathways. We report the frequent down regulation of DAB2 in NPC and the promoter hypermethylation contributes to the loss of expression of DAB2. This is the first study demonstrating frequent DAB2 promoter hypermethylation in human cancer. Our functional studies support the putative tumour suppressor effect of DAB2 in NPC cells
DEFF Research Database (Denmark)
Zhang, Ming Dong; Tortoriello, Giuseppe; Hsueh, Brian
2014-01-01
, and nerve injury-induced regulation of NECAB1/NECAB2 in mouse dorsal root ganglia (DRGs) and spinal cord. In DRGs, NECAB1/2 are expressed in around 70% of mainly small- and medium-sized neurons. Many colocalize with calcitonin gene-related peptide and isolectin B4, and thus represent nociceptors. NECAB1....../2 neurons are much more abundant in DRGs than the Ca2+-binding proteins (parvalbumin, calbindin, calretinin, and secretagogin) studied to date. In the spinal cord, the NECAB1/2 distribution is mainly complementary. NECAB1 labels interneurons and a plexus of processes in superficial layers of the dorsal horn....... In the dorsal horn, most NECAB1/2 neurons are glutamatergic. Both NECAB1/2 are transported into dorsal roots and peripheral nerves. Peripheral nerve injury reduces NECAB2, but not NECAB1, expression in DRG neurons. Our study identifies NECAB1/2 as abundant Ca2+-binding proteins in pain-related DRG neurons...
Transient HIF2A inhibition promotes satellite cell proliferation and muscle regeneration.
Xie, Liwei; Yin, Amelia; Nichenko, Anna S; Beedle, Aaron M; Call, Jarrod A; Yin, Hang
2018-03-13
The remarkable regeneration capability of skeletal muscle depends on coordinated proliferation and differentiation of satellite cells. The self-renewal of satellite cells is critical for long-term maintenance of muscle regeneration potential. Hypoxia profoundly affects the proliferation, differentiation, and self-renewal of cultured myoblasts. However, the physiological relevance of hypoxia and hypoxia signaling in satellite cells in vivo remains largely unknown. Here, we report that satellite cells are in an intrinsic hypoxic state in vivo and express hypoxia-inducible factor 2A (HIF2A). HIF2A promotes the stemness and long-term homeostatic maintenance of satellite cells by maintaining the quiescence, increasing the self-renewal and blocking the myogenic differentiation of satellite cells. HIF2A stabilization in satellite cells cultured under normoxia augmented their engraftment potential in regenerative muscle. Reversely, HIF2A ablation led to the depletion of satellite cells and the consequent regenerative failure in the long-term. In contrast, transient pharmacological inhibition of HIF2A accelerated muscle regeneration by increasing satellite cell proliferation and differentiation. Mechanistically, HIF2A induces the quiescence/self-renewal of satellite cells by binding the promoter of Spry1 gene and activating Spry1 expression. These findings suggest that HIF2A is a pivotal mediator of hypoxia signaling in satellite cells and may be therapeutically targeted to improve muscle regeneration.
International Nuclear Information System (INIS)
Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent
2011-01-01
Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue
Directory of Open Access Journals (Sweden)
Lagerstedt Kristina
2011-06-01
Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.
Steer, Andrew M; Bia, Nicolas; Smith, David K; Clarke, Paul A
2017-09-25
Understanding the prebiotic genesis of 2-deoxy-d-ribose, which forms the backbone of DNA, is of crucial importance to unravelling the origins of life, yet remains open to debate. Here we demonstrate that 20 mol% of proteinogenic amino esters promote the selective formation of 2-deoxy-d-ribose over 2-deoxy-d-threopentose in combined yields of ≥4%. We also demonstrate the first aldol reaction promoted by prebiotically-relevant proteinogenic amino nitriles (20 mol%) for the enantioselective synthesis of d-glyceraldehyde with 6% ee, and its subsequent conversion into 2-deoxy-d-ribose in yields of ≥ 5%. Finally, we explore the combination of these two steps in a one-pot process using 20 mol% of an amino ester or amino nitrile promoter. It is hence demonstrated that three interstellar starting materials, when mixed together with an appropriate promoter, can directly lead to the formation of a mixture of higher carbohydrates, including 2-deoxy-d-ribose.
Tu, Min; Lu, Cheng; Lv, Nan; Wei, Jishu; Lu, Zipeng; Xi, Chunhua; Chen, Jianmin; Guo, Feng; Jiang, Kuirong; Li, Qiang; Wu, Junli; Song, Guoxin; Wang, Shui; Gao, Wentao; Miao, Yi
2016-12-28
Vasohibin 2 (VASH2) is an angiogenic factor and cancer-related protein that acts via paracrine mechanisms. Here, we investigated the angiogenic function and mechanism of action of VASH2 in 200 human breast cancer tissues by performing immunohistochemical staining, western blot, indirect sandwich enzyme-linked immunosorbent assay (ELISA), and a semi-quantitative sandwich-based antibody array. Breast cancer cells stably overexpressing VASH2 or with knocked-down VASH2 were established and used for in vivo and in vitro models. In human luminal tissue, but not in HER2-positive or basal-like breast cancer tissues, VASH2 was positively correlated with CD31-positive microvascular density, induced angiogenesis in xenograft tumors, and promoted human umbilical vein endothelial cell tube formation in vitro. VASH2 expression was absent in the concentrated conditioned medium collected from knocked-down VASH2 and VASH2-overexpressing luminal breast cancer cells. Further, VASH2 regulated the expression of fibroblast growth factor 2 (FGF2) in human luminal breast cancer cells, and the pro-angiogenic effect induced by VASH2 overexpression was blocked by FGF2 neutralization in vitro. Additionally, dual luciferase reporter assay and Chromatin immunoprecipitation analysis results showed that FGF2 promoter was transcriptionally activated by VASH2 via histone modifications. In conclusion, VASH2 expression is positively correlated with FGF2 expression and promotes angiogenesis in human luminal breast cancer by transcriptional activation of fibroblast growth factor 2 through non-paracrine mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Baizer, Joan S; Baker, James F
2005-07-01
The vestibular nuclear complex (VNC) is classically divided into four nuclei on the basis of cytoarchitectonics. However, anatomical data on the distribution of afferents to the VNC and the distribution of cells of origin of different efferent pathways suggest a more complex internal organization. Immunoreactivity for calcium-binding proteins has proven useful in many areas of the brain for revealing structure not visible with cell, fiber or Golgi stains. We have looked at the VNC of the cat using immunoreactivity for the calcium-binding proteins calbindin, calretinin and parvalbumin. Immunoreactivity for calretinin revealed a small, intensely stained region of cell bodies and processes just beneath the fourth ventricle in the medial vestibular nucleus. A presumably homologous region has been described in rodents. The calretinin-immunoreactive cells in this region were also immunoreactive for choline acetyltransferase. Evidence from other studies suggests that the calretinin region contributes to pathways involved in eye movement modulation but not generation. There were focal dense regions of fibers immunoreactive to calbindin in the medial and inferior nuclei, with an especially dense region of label at the border of the medial nucleus and the nucleus prepositus hypoglossi. There is anatomical evidence that suggests that the likely source of these calbindin-immunoreactive fibers is the flocculus of the cerebellum. The distribution of calbindin-immunoreactive fibers in the lateral and superior nuclei was much more uniform. Immunoreactivity to parvalbumin was widespread in fibers distributed throughout the VNC. The results suggest that neurochemical techniques may help to reveal the internal complexity in VNC organization.
KRUYT, FAE; FOLKERS, GE; WALHOUT, AJM; VANDERLEEDE, BM; VANDERSAAG, PT; Kruyt, Frank
The retinoic acid (RA) receptor (RAR) beta2 promoter is strongly activated by RA in embryonal carcinoma (EC) cells. We examined this activation in the P19 EC-derived END-2 cell line and in E1A-expressing counterparts and found strong RA-dependent RARbeta2 promoter activation in the E1A-expressing
International Nuclear Information System (INIS)
Ruiz, E.; Cillero, D.; Martinez, P. J.; Morales, A.; San Vicente, G.; Diego, G. de; Sanchez, J. M.
2014-01-01
The ultimate goal of the project PROMOCAP was the development and study of electrochemical promotion systems for the capture and valorization of CO 2 in combustion flue gases. To achieve this objective, electrocatalysts consisting of tubes or monoliths of solid electrolyte (K-βAl 2 O 3 or YSZ), coated by the corresponding active metal (Pt, Pd, Ni, Cu, Fe-TiO 2 , Pt-Ru - C, Pt-C, etc.), were prepared using both conventional (painting) and improved (dip-coating, electroless or spray-coating) procedures. Both physico-chemical and volt amperometric characterization of the electrocatalysts was carried out both as prepared and after use in electro promoted CO 2 capture and valorization processes (study of chemisorption, reaction, inhibition, deactivation phenomena, etc.). Pilot plant studies were carried out under realistic conditions for identifying the best electro catalyst and the operating conditions more suitable for CO 2 electro promoted capture and valorization. Finally, the electrocatalysts identified as the most promising for electro promoted CO 2 capture (Pt/K-βAl 2 O 3 ) and valorization (Cu/K-βAl 2 O 3 ) were prepared using the developed optimized procedures and their behavior over multiple cycles of electro promoted CO 2 capture and in long term operation against electro promoted CO 2 hydrogenation, respectively, was studied under real or realistic conditions. (Author)
Li, Minghua; Li, Zhiqin; Morris, David L.; Rui, Liangyou
2007-01-01
The SH2B family has three members (SH2B1, SH2B2, and SH2B3) that contain conserved dimerization (DD), pleckstrin homology, and SH2 domains. The DD domain mediates the formation of homo- and heterodimers between members of the SH2B family. The SH2 domain of SH2B1 (previously named SH2-B) or SH2B2 (previously named APS) binds to phosphorylated tyrosines in a variety of tyrosine kinases, including Janus kinase-2 (JAK2) and the insulin receptor, thereby promoting the activation of JAK2 or the ins...
Felsberg, Jörg; Thon, Niklas; Eigenbrod, Sabina; Hentschel, Bettina; Sabel, Michael C; Westphal, Manfred; Schackert, Gabriele; Kreth, Friedrich Wilhelm; Pietsch, Torsten; Löffler, Markus; Weller, Michael; Reifenberger, Guido; Tonn, Jörg C
2011-08-01
Epigenetic silencing of the O(6) -methylguanine-DNA methyltransferase (MGMT) gene promoter is associated with prolonged survival in glioblastoma patients treated with temozolomide (TMZ). We investigated whether glioblastoma recurrence is associated with changes in the promoter methylation status and the expression of MGMT and the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 in pairs of primary and recurrent glioblastomas of 80 patients, including 64 patients treated with radiotherapy and TMZ after the first operation. Among the primary tumors, the MGMT promoter was methylated in 31 patients and unmethylated in 49 patients. In 71 patients (89%), the MGMT promoter methylation status of the primary tumor was retained at recurrence. MGMT promoter methylation, but not MGMT protein expression, was associated with longer progression-free survival, overall survival and postrecurrence survival (PRS). Moreover, PRS was increased under salvage chemotherapy. Investigation of primary and recurrent glioblastomas of 43 patients did not identify promoter methylation in any of the four MMR genes. However, recurrent glioblastomas demonstrated significantly lower MSH2, MSH6 and PMS2 protein expression as detected by immunohistochemistry. In conclusion, reduced expression of MMR proteins, but not changes in MGMT promoter methylation, is characteristic of glioblastomas recurring after the current standards of care. Copyright © 2011 UICC.
ATM-Dependent Phosphorylation of MEF2D Promotes Neuronal Survival after DNA Damage
Chan, Shing Fai; Sances, Sam; Brill, Laurence M.; Okamoto, Shu-ichi; Zaidi, Rameez; McKercher, Scott R.; Akhtar, Mohd W.; Nakanishi, Nobuki
2014-01-01
Mutations in the ataxia telangiectasia mutated (ATM) gene, which encodes a kinase critical for the normal DNA damage response, cause the neurodegenerative disorder ataxia-telangiectasia (AT). The substrates of ATM in the brain are poorly understood. Here we demonstrate that ATM phosphorylates and activates the transcription factor myocyte enhancer factor 2D (MEF2D), which plays a critical role in promoting survival of cerebellar granule cells. ATM associates with MEF2D after DNA damage and phosphorylates the transcription factor at four ATM consensus sites. Knockdown of endogenous MEF2D with a short-hairpin RNA (shRNA) increases sensitivity to etoposide-induced DNA damage and neuronal cell death. Interestingly, substitution of endogenous MEF2D with an shRNA-resistant phosphomimetic MEF2D mutant protects cerebellar granule cells from cell death after DNA damage, whereas an shRNA-resistant nonphosphorylatable MEF2D mutant does not. In vivo, cerebella in Mef2d knock-out mice manifest increased susceptibility to DNA damage. Together, our results show that MEF2D is a substrate for phosphorylation by ATM, thus promoting survival in response to DNA damage. Moreover, dysregulation of the ATM–MEF2D pathway may contribute to neurodegeneration in AT. PMID:24672010
LRRK2 mediated Rab8a phosphorylation promotes lipid storage.
Yu, Miao; Arshad, Muhammad; Wang, Wenmin; Zhao, Dongyu; Xu, Li; Zhou, Linkang
2018-02-27
Several mutations in leucine rich repeat kinase 2 (LRRK2) gene have been associated with pathogenesis of Parkinson's disease (PD), a neurodegenerative disorder marked by resting tremors, and rigidity, leading to Postural instability. It has been revealed that mutations that lead to an increase of kinase activity of LRRK2 protein are significantly associated with PD pathogenesis. Recent studies have shown that some Rab GTPases, especially Rab8, serve as substrates of LRRK2 and undergo phosphorylation in its switch II domain upon interaction. Current study was performed in order to find out the effects of the phosphorylation of Rab8 and its mutants on lipid metabolism and lipid droplets growth. The phosphorylation status of Rab8a was checked by phos-tag gel. Point mutant construct were generated to investigate the function of Rab8a. 3T3L1 cells were transfected with indicated plasmids and the lipid droplets were stained with Bodipy. Fluorescent microscopy experiments were performed to examine the sizes of lipid droplets. The interactions between Rab8a and Optineurin were determined by immunoprecipitation and western blot. Our assays demonstrated that Rab8a was phosphorylated by mutated LRRK2 that exhibits high kinase activity. Phosphorylation of Rab8a on amino acid residue T72 promoted the formation of large lipid droplets. T72D mutant of Rab8a had higher activity to promote the formation of large lipid droplets compared with wild type Rab8a, with increase in average diameter of lipid droplets from 2.10 μm to 2.46 μm. Moreover, phosphorylation of Rab8a weakened the interaction with its effector Optineurin. Y1699C mutated LRRK2 was able to phosphorylate Rab8a and phosphorylation of Rab8a on site 72 plays important role in the fusion and enlargement of lipid droplets. Taken together, our study suggests an indirect relationship between enhanced lipid storage capacity and PD pathogenesis.
Promotional programmes for energy conservation and CO2 avoidance. Efficiency and costs
International Nuclear Information System (INIS)
Lechtenboehmer, S.; Bach, W.
1994-01-01
Least-cost planning and demand-side management are attempts to bring into accord company policies of the energy utility with the targets of environmental and climate protection and resource savings. Since 1982 also the Stadtwerke Muenster have promotional programmes for heating system modernization. With the example of three current promotional programmes the article analysis the costs of such programmes, their impact with regard to energy conservation and CO 2 avoidance and their status within the scope of local climate protection. Moreover the volume of investment is assessed which is necessary in Muenster to reduce the heating energy consumption of existing residential buildings till 2005 by more than one third. (orig./UA) [de
Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra
2013-01-01
Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this
Directory of Open Access Journals (Sweden)
Kazi Md Kamrul Huda
Full Text Available Plasma membrane Ca(2+ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+ from the cell, hence regulating Ca(2+ level within cells. Though plant Ca(2+ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied.The 1478 bp promoter sequence of rice plasma membrane Ca(2+ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs.The rice plasma membrane Ca(2+ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible
Directory of Open Access Journals (Sweden)
Jose J. Virgen-Ortíz
2017-01-01
Full Text Available Lipases from Candida antarctica (isoform B and Rhizomucor miehei (CALB and RML have been immobilized on octyl-agarose (OC and further coated with polyethylenimine (PEI and dextran sulfate (DS. The enzymes just immobilized on OC supports could be easily released from the support using 2% SDS at pH 7, both intact or after thermal inactivation (in fact, after inactivation most enzyme molecules were already desorbed. The coating with PEI and DS greatly reduced the enzyme release during thermal inactivation and improved enzyme stability. However, using OC-CALB/RML-PEI-DS, the full release of the immobilized enzyme to reuse the support required more drastic conditions: a pH value of 3, a buffer concentration over 2 M, and temperatures above 45 °C. However, even these conditions were not able to fully release the thermally inactivated enzyme molecules from the support, being necessary to increase the buffer concentration to 4 M sodium phosphate and decrease the pH to 2.5. The formation of unfolded protein/polymers composites seems to be responsible for this strong interaction between the octyl and some anionic groups of OC supports. The support could be reused five cycles using these conditions with similar loading capacity of the support and stability of the immobilized enzyme.
DNA of HeLa cells during caffeine-promoted recovery from X-ray induced G2 arrest
International Nuclear Information System (INIS)
Bases, R.; Mendez, F.; Liebeskind, D.; Elequin, F.; Neubort, S.
1980-01-01
Progression of X-irradiated HeLa cells from G2 arrest through mitosis was promoted by 1mM caffeine. Caffeine promoted the return from abnormally high levels of radiation-induced immunoreactivity to antinucleoside antibodies, which indicates persistent DNA strand separation, to the low levels normally found in G2. With caffeine, the irradiated cells progressed through mitosis, producing daughter cells with the normal G1 content of DNA. Without caffeine, the DNA content of individual radiation-arrested cells retained G2 values and the abnormally high levels of immunoreactivity to antinucleoside antibodies. (author)
Directory of Open Access Journals (Sweden)
Surleen Kaur
2016-03-01
Full Text Available Insulin receptor substrate-2 (IRS-2 plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS, insulin resistance and cancer. To predict the transcription factors (TFs responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]. The ibid data is part of author׳s publication (Anjali et al., 2015 [2] that explains Follicle stimulating hormone (FSH mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. Keywords: IRS-2, TFBS, FSH, SP1, ChIP
Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction
Directory of Open Access Journals (Sweden)
Yun-Fang Jia
2017-07-01
Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.
DEFF Research Database (Denmark)
Knudsen, Jan Dines; Johanson, Ted; Eliasson Lantz, Anna
2015-01-01
A control point for keeping redox homeostasis in Saccharomyces cerevisiae during fermentative growth is the dynamic regulation of transcription for the glycerol-3-phosphate dehydrogenase 2 (GPD2) gene. In this study, the possibility to steer the activity of the GPD2 promoter was investigated by p...
An, Ming-Xin; Li, Si; Yao, Han-Bing; Li, Chao; Wang, Jia-Mei; Sun, Jia; Li, Xin-Yu; Meng, Xiao-Na; Wang, Hua-Qin
2017-12-04
Aerobic glycolysis, a phenomenon known historically as the Warburg effect, is one of the hallmarks of cancer cells. In this study, we characterized the role of BAG3 in aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) and its molecular mechanisms. Our data show that aberrant expression of BAG3 significantly contributes to the reprogramming of glucose metabolism in PDAC cells. Mechanistically, BAG3 increased Hexokinase 2 (HK2) expression, the first key enzyme involved in glycolysis, at the posttranscriptional level. BAG3 interacted with HK2 mRNA, and the degree of BAG3 expression altered recruitment of the RNA-binding proteins Roquin and IMP3 to the HK2 mRNA. BAG3 knockdown destabilized HK2 mRNA via promotion of Roquin recruitment, whereas BAG3 overexpression stabilized HK2 mRNA via promotion of IMP3 recruitment. Collectively, our results show that BAG3 promotes reprogramming of glucose metabolism via interaction with HK2 mRNA in PDAC cells, suggesting that BAG3 may be a potential target in the aerobic glycolysis pathway for developing novel anticancer agents. © 2017 An et al.
Urocortin 2 treatment is protective in excitotoxic retinal degeneration.
Szabadfi, K; Kiss, P; Reglodi, D; Fekete, E M; Tamas, A; Danyadi, B; Atlasz, T; Gabriel, R
2014-03-01
Urocortin 2 (Ucn 2) is a corticotrop releasing factor paralog peptide with many physiological functions and it has widespread distribution. There are some data on the cytoprotective effects of Ucn 2, but less is known about its neuro- and retinoprotective actions. We have previously shown that Ucn 2 is protective in ischemia-induced retinal degeneration. The aim of the present study was to examine the protective potential of Ucn 2 in monosodium-glutamate (MSG)-induced retinal degeneration by routine histology and to investigate cell-type specific effects by immunohistochemistry. Rat pups received MSG applied on postnatal days 1, 5 and 9 and Ucn 2 was injected intravitreally into one eye. Retinas were processed for histology and immunocytochemistry after 3 weeks. Immunolabeling was determined for glial fibrillary acidic protein, vesicular glutamate transporter 1, protein kinase Cα, calbindin, parvalbumin and calretinin. Retinal tissue from animals treated with MSG showed severe degeneration compared to normal retinas, but intravitreal Ucn 2 treatment resulted in a retained retinal structure both at histological and neurochemical levels: distinct inner retinal layers and rescued inner retinal cells (different types of amacrine and rod bipolar cells) could be observed. These findings support the neuroprotective function of Ucn 2 in MSG-induced retinal degeneration.
Glycine Receptor α2 Subunit Activation Promotes Cortical Interneuron Migration
Directory of Open Access Journals (Sweden)
Ariel Avila
2013-08-01
Full Text Available Glycine receptors (GlyRs are detected in the developing CNS before synaptogenesis, but their function remains elusive. This study demonstrates that functional GlyRs are expressed by embryonic cortical interneurons in vivo. Furthermore, genetic disruption of these receptors leads to interneuron migration defects. We discovered that extrasynaptic activation of GlyRs containing the α2 subunit in cortical interneurons by endogenous glycine activates voltage-gated calcium channels and promotes calcium influx, which further modulates actomyosin contractility to fine-tune nuclear translocation during migration. Taken together, our data highlight the molecular events triggered by GlyR α2 activation that control cortical tangential migration during embryogenesis.
β-elemene inhibits tumor-promoting effect of M2 macrophages in lung cancer.
Yu, Xiaomu; Xu, Maoyi; Li, Na; Li, Zongjuan; Li, Hongye; Shao, Shujuan; Zou, Kun; Zou, Lijuan
2017-08-19
Macrophages in tumor are mostly M2-polarized and have been reported to promote tumorigenesis, which are also defined as tumor-associated macrophages (TAMs). β-elemene has therapeutic effects against several cancers, however, it remains unknown whether β-elemene could inhibit cancer by targeting TAMs. Herein, we examined the effect of β-elemene on macrophages to elucidate a novel mechanism of β-elemene in tumor therapy. We showed that the conditioned medium of M2 macrophages promoted lung cancer cells to migration, invasion and epithelial mesenchymal transition, which could be inhibited by β-elemene. Moreover, β-elemene regulated the polarization of macrophages from M2 to M1. β-elemene also inhibited the proliferation, migration, invasion of lung cancer cells and enhanced its radiosensitivity. These results indicate β-elemene suppresses lung cancer by regulating both macrophages and lung cancer cells, it is a promising drug for combination with chemotherapy or radiotherapy. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Kristi M Porter
Full Text Available Pulmonary Hypertension (PH is a progressive disorder characterized by endothelial dysfunction and proliferation. Hypoxia induces PH by increasing vascular remodeling. A potential mediator in hypoxia-induced PH development is arachidonate 5-Lipoxygenase (ALOX5. While ALOX5 metabolites have been shown to promote pulmonary vasoconstriction and endothelial cell proliferation, the contribution of ALOX5 to hypoxia-induced proliferation remains unknown. We hypothesize that hypoxia exposure stimulates HPAEC proliferation by increasing ALOX5 expression and activity. To test this, human pulmonary artery endothelial cells (HPAEC were cultured under normoxic (21% O2 or hypoxic (1% O2 conditions for 24-, 48-, or 72 hours. In a subset of cells, the ALOX5 inhibitor, zileuton, or the 5-lipoxygenase activating protein inhibitor, MK-886, was administered during hypoxia exposure. ALOX5 expression was measured by qRT-PCR and western blot and HPAEC proliferation was assessed. Our results demonstrate that 24 and 48 hours of hypoxia exposure have no effect on HPAEC proliferation or ALOX5 expression. Seventy two hours of hypoxia significantly increases HPAEC ALOX5 expression, hydrogen peroxide (H2O2 release, and HPAEC proliferation. We also demonstrate that targeted ALOX5 gene silencing or inhibition of the ALOX5 pathway by pharmacological blockade attenuates hypoxia-induced HPAEC proliferation. Furthermore, our findings indicate that hypoxia-induced increases in cell proliferation and ALOX5 expression are dependent on H2O2 production, as administration of the antioxidant PEG-catalase blocks these effects and addition of H2O2 to HPAEC promotes proliferation. Overall, these studies indicate that hypoxia exposure induces HPAEC proliferation by activating the ALOX5 pathway via the generation of H2O2.
International Nuclear Information System (INIS)
Zaid, A.; Salem, Gh.
2012-01-01
The GC-box is an important transcriptional regulatory element present in the promoters of many mammalian genes, and is found in most, if not all, oxidative phosphorylation (OXPHOS) promoters. In the present study we examine the effects of three Spl family members (Sp2, Sp3, and Sp4) on the adenine nucleotide translocase 2, cytochrome cl, Fl-ATPase β-subunit, and the mitochondria transcription factor (mtTFA) promoters in Drosophila SL2 cell line. Sp3, like Spl, strongly activates transcription all four promoters. SP4 stimulates, moderately, but Sp2 had no effect. In addition, Sp3 can, like Spl, inhibit transcription from the proximal promoter of the ANT2 gene through binding to the Cbox GC element. By contrast, Sp4 and Sp2 do not repress promoter activity. Furthermore, since Sp4 and Sp2 bind to the Cbox repression element on the ANT2 promoter, but do not repress transcription, inhibition of transcription cannot be explained by steric hindrance of pre-initiation complex assembly. These data suggest that different Spl family members differentially affect transcription from the OXPHOS promoters.
Catalysis by Candida antarctica B (CALB) immobilized on natural ...
African Journals Online (AJOL)
Objective: In this work, a lipase B from Candida antarctica strain was immobilized onto natural silica carriers via adsorption to enhance its feasibility in practical applications. Methodology and results: The biocatalyst was prepared by simple adsorption on the support whose composition was beforehand characterized and the ...
Directory of Open Access Journals (Sweden)
So Masaki
Full Text Available Transforming growth factor beta (TGF-β has critical roles in regulating cell growth, differentiation, apoptosis, invasion and epithelial-mesenchymal transition (EMT of various cancer cells. TGF-β-induced EMT is an important step during carcinoma progression to invasion state. Thioredoxin binding protein-2 (TBP-2, also called Txnip or VDUP1 is downregulated in various types of human cancer, and its deficiency results in the earlier onset of cancer. However, it remains unclear how TBP-2 suppresses the invasion and metastasis of cancer.In this study, we demonstrated that TBP-2 deficiency increases the transcriptional activity in response to TGF-β and also enhances TGF-β-induced Smad2 phosphorylation levels. Knockdown of TBP-2 augmented the TGF-β-responsive expression of Snail and Slug, transcriptional factors related to TGF-β-mediated induction of EMT, and promoted TGF-β-induced spindle-like morphology consistent with the depletion of E-Cadherin in A549 cells.Our results indicate that TBP-2 deficiency enhances TGF-β signaling and promotes TGF-β-induced EMT. The control of TGF-β-induced EMT is critical for the inhibition of the invasion and metastasis. Thus TBP-2, as a novel regulatory molecule of TGF-β signaling, is likely to be a prognostic indicator or a potential therapeutic target for preventing tumor progression.
Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher T.; Mijakovic, Ivan; Lantz, Anna Eliasson
2014-01-01
The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator ActII orf4, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actII orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actII orf4. The resulting library was screened based on the yield of actinorhodin. Selected strains were further physiologically characterized. One of the strains from the library, ScoSPL20, showed considerably higher yield of actinorhodin and final actinorhodin titer, compared to S. coelicolor wild type and S. coelicolor with actII orf4 expressed from a strong constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning of gene expression in metabolic engineering. Transcriptome studies were performed in exponential and actinorhodin-producing phase of growth to compare gene expression between ScoSPL20 and the wild type. To our knowledge, this is the first successful application of the SPL technology for secondary metabolite production in filamentous bacteria. PMID:24963940
Varga, Csaba; Tamas, Gabor; Barzo, Pal; Olah, Szabolcs; Somogyi, Peter
2015-01-01
Transcription factors contribute to the differentiation of cortical neurons, orchestrate specific interneuronal circuits, and define synaptic relationships. We have investigated neurons expressing chicken ovalbumin upstream promoter transcription factor II (COUP-TFII), which plays a role in the migration of GABAergic neurons. Whole-cell, patch-clamp recording in vitro combined with colocalization of molecular cell markers in the adult cortex differentiates distinct interneurons. The majority of strongly COUP-TFII-expressing neurons were in layers I–III. Most calretinin (CR) and/or cholecystokinin- (CCK) and/or reelin-positive interneurons were also COUP-TFII-positive. CR-, CCK-, or reelin-positive neurons formed 80%, 20%, or 17% of COUP-TFII-positive interneurons, respectively. About half of COUP-TFII-/CCK-positive interneurons were CR-positive, a quarter of them reelin-positive, but none expressed both. Interneurons positive for COUP-TFII fired irregular, accommodating and adapting trains of action potentials (APs) and innervated mostly small dendritic shafts and rarely spines or somata. Paired recording showed that a calretinin-/COUP-TFII-positive interneuron elicited inhibitory postsynaptic potentials (IPSPs) in a reciprocally connected pyramidal cell. Calbindin, somatostatin, or parvalbumin-immunoreactive interneurons and most pyramidal cells express no immunohistochemically detectable COUP-TFII. In layers V and VI, some pyramidal cells expressed a low level of COUP-TFII in the nucleus. In conclusion, COUP-TFII is expressed in a diverse subset of GABAergic interneurons predominantly innervating small dendritic shafts originating from both interneurons and pyramidal cells. PMID:25787832
Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.
Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T
2017-08-01
X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.
Characteristics of NaNO3-Promoted CdO as a Midtemperature CO2 Absorbent.
Kim, Kang-Yeong; Kwak, Jin-Su; An, Young-In; Oh, Kyung-Ryul; Kwon, Young-Uk
2017-06-28
In this study, we explored the reaction system CdO(s) + CO 2 (g) ⇄ CdCO 3 (s) as a model system for CO 2 capture agent in the intermediate temperature range of 300-400 °C. While pure CdO does not react with CO 2 at all up to 500 °C, CdO mixed with an appropriate amount of NaNO 3 (optimal molar ratio NaNO 3 /CdO = 0.14) greatly enhances the conversion of CdO into CdCO 3 up to ∼80% (5.68 mmol/g). These NaNO 3 -promoted CdO absorbents can undergo many cycles of absorption and desorption by temperature swing between 300 and 370 °C under a 100% CO 2 condition. Details of how NaNO 3 promotes the CO 2 absorption of CdO have been delineated through various techniques using thermogravimetry, coupled with X-ray diffraction and electron microscopy. On the basis of the observed data, we propose a mechanism of CO 2 absorption and desorption of NaNO 3 -promoted CdO. The absorption proceeds through a sequence of events of CO 2 adsorption on the CdO surface covered by NaNO 3 , dissolution of so-formed CdCO 3 , and precipitation of CdCO 3 particles in the NaNO 3 medium. The desorption occurs through the decomposition of CdCO 3 in the dissolved state in the NaNO 3 medium where CdO nanoparticles are formed dispersed in the NaNO 3 medium. The CdO nanoparticles are aggregated into micrometer-large particles with smooth surfaces and regular shapes.
Loo, Tze Mun; Kamachi, Fumitaka; Watanabe, Yoshihiro; Yoshimoto, Shin; Kanda, Hiroaki; Arai, Yuriko; Nakajima-Takagi, Yaeko; Iwama, Atsushi; Koga, Tomoaki; Sugimoto, Yukihiko; Ozawa, Takayuki; Nakamura, Masaru; Kumagai, Miho; Watashi, Koichi; Taketo, Makoto M; Aoki, Tomohiro; Narumiya, Shuh; Oshima, Masanobu; Arita, Makoto; Hara, Eiji; Ohtani, Naoko
2017-05-01
Obesity increases the risk of cancers, including hepatocellular carcinomas (HCC). However, the precise molecular mechanisms through which obesity promotes HCC development are still unclear. Recent studies have shown that gut microbiota may influence liver diseases by transferring its metabolites and components. Here, we show that the hepatic translocation of obesity-induced lipoteichoic acid (LTA), a Gram-positive gut microbial component, promotes HCC development by creating a tumor-promoting microenvironment. LTA enhances the senescence-associated secretory phenotype (SASP) of hepatic stellate cells (HSC) collaboratively with an obesity-induced gut microbial metabolite, deoxycholic acid, to upregulate the expression of SASP factors and COX2 through Toll-like receptor 2. Interestingly, COX2-mediated prostaglandin E 2 (PGE 2 ) production suppresses the antitumor immunity through a PTGER4 receptor, thereby contributing to HCC progression. Moreover, COX2 overexpression and excess PGE 2 production were detected in HSCs in human HCCs with noncirrhotic, nonalcoholic steatohepatitis (NASH), indicating that a similar mechanism could function in humans. Significance: We showed the importance of the gut-liver axis in obesity-associated HCC. The gut microbiota-driven COX2 pathway produced the lipid mediator PGE 2 in senescent HSCs in the tumor microenvironment, which plays a pivotal role in suppressing antitumor immunity, suggesting that PGE 2 and its receptor may be novel therapeutic targets for noncirrhotic NASH-associated HCC. Cancer Discov; 7(5); 522-38. ©2017 AACR. This article is highlighted in the In This Issue feature, p. 443 . ©2017 American Association for Cancer Research.
Directory of Open Access Journals (Sweden)
Hongying Zhang
2017-07-01
Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.
Growth hormone-promoted tyrosyl phosphorylation of SHC proteins and SHC association with Grb2
DEFF Research Database (Denmark)
VanderKuur, J; Allevato, G; Billestrup, Nils
1995-01-01
. To gain insight into pathways coupling GH receptor (GHR) to MAP kinase activation and signaling molecules that might interact with GHR and its associated tyrosine kinase JAK2, we examined whether SHC and Grb2 proteins serve as signaling molecules for GH. Human GH was shown to promote the rapid tyrosyl...... phosphorylation of 66-, 52-, and 46-kDa SHC proteins in 3T3-F442A fibroblasts. GH also promoted binding of GHR and JAK2 to the SH2 domain of 46/52-kDa SHC protein fused to glutathione S-transferase (GST). Constitutively phosphorylated JAK2, from COS-7 cells transiently transfected with murine JAK2 cDNA, bound......-638 and GHR1-638(Y333,338F), GH stimulated phosphorylation of all 3 SHC proteins whereas GH stimulated phosphorylation of only the 66- and 52-kDa SHC proteins in cells expressing GHR1-454. GH had no effect on SHC phosphorylation in cells expressing GHR1-294 or GHR delta P, the latter lacking amino acids 297...
Statins Activate Human PPAR Promoter and Increase PPAR mRNA Expression and Activation in HepG2 Cells
Directory of Open Access Journals (Sweden)
Makoto Seo
2008-01-01
Full Text Available Statins increase peroxisome proliferator-activated receptor (PPAR mRNA expression, but the mechanism of this increased PPAR production remains elusive. To examine the regulation of PPAR production, we examined the effect of 7 statins (atorvastatin, cerivastatin, fluvastatin, pitavastatin, pravastatin, rosuvastatin, and simvastatin on human PPAR promoter activity, mRNA expression, nuclear protein levels, and transcriptional activity. The main results are as follows. (1 Majority of statins enhanced PPAR promoter activity in a dose-dependent manner in HepG2 cells transfected with the human PPAR promoter. This enhancement may be mediated by statin-induced HNF-4. (2 PPAR mRNA expression was increased by statin treatment. (3 The PPAR levels in nuclear fractions were increased by statin treatment. (4 Simvastatin, pravastatin, and cerivastatin markedly enhanced transcriptional activity in 293T cells cotransfected with acyl-coenzyme A oxidase promoter and PPAR/RXR expression vectors. In summary, these data demonstrate that PPAR production and activation are upregulated through the PPAR promoter activity by statin treatment.
Protein adsorption onto nanozeolite: effect of micropore openings.
Wu, Jiamin; Li, Xiang; Yan, Yueer; Hu, Yuanyuan; Zhang, Yahong; Tang, Yi
2013-09-15
A clear and deep understanding of protein adsorption on porous surfaces is desirable for the reasonable design and applications of porous materials. In this study, the effect of surface micropores on protein adsorption was systematically investigated by comparing adsorption behavior of cytochrome c (Cyto-c) and Candida antarctica Lipase B (CALB) on porous and non-porous nanozeolites silicalite-1 and Beta. It was found that micropore openings on the surface of nanozeolites played a key role in determining adsorption affinity, conformations, and activities of proteins. Both Cyto-c and CALB showed higher affinity to porous nanozeolites than to non-porous ones, resulting in greater conformational change of proteins on porous surfaces which in turn affected their bio-catalytic performance. The activity of Cyto-c improved while that of CALB decreased on porous nanozeolites. Recognition of certain amino acid residues or size-matching secondary structures by micropore openings on the surface of nanozeolites was proposed to be the reason. Moreover, the pore opening effect of porous nanozeolites on protein behavior could be altered by changing protein coverage on them. This study gives a novel insight into the interaction between proteins and microporous materials, which will help to guide the rational fabrication and bio-applications of porous materials in the future. Copyright © 2013 Elsevier Inc. All rights reserved.
Yildiz, Esra; Kavuran, Esin
2018-03-01
A healthy promotion is important for maintaining health and preventing complications in patients with type 2 diabetes. The aim of the present study was to examine the psychometrics of a recently developed tool that can be used to screen for a health-promoting lifestyle in patients with type 2 diabetes. Data were collected from outpatients attending diabetes clinics. The Type 2 Diabetes and Health Promotion Scale (T2DHPS) and a demographic questionnaire were administered to 295 participants. Forward-backward translation of the original English version was used to develop a Turkish version. Internal consistency of the scale was assessed by Cronbach's alpha. An explanatory factor analysis and confirmatory factor analysis used validity of the Type 2 Diabetes and Health Promotion Scale - Turkish version. Kaiser-Meyer-Olkin (KMO) and Bartlett's sphericity tests showed that the sample met the criteria required for factor analysis. The reliability coefficient for the total scale was 0.84, and alpha coefficients for the subscales ranged from 0.57 to 0.92. A six-factor solution was obtained that explained 59.3% of the total variance. The ratio of chi-square statistics to degrees of freedom (χ 2 /df) 3.30 (χ 2 = 1157.48/SD = 350); error of root mean square approximation (RMSEA) 0.061; GFI value of 0.91 and comparative fit index (CFI) value was obtained as 0.91. Turkish version of The T2DHPS is a valid and reliable tool that can be used to assess patients' health-promoting lifestyle behaviours. Validity and reliability studies in different cultures and regions are recommended. © 2017 Nordic College of Caring Science.
Calcium-binding protein expression in peritoneal endometriosis-associated nerve fibres.
Barcena de Arellano, M L; Münch, S; Arnold, J; Helbig, S; Schneider, A; Mechsner, S
2013-11-01
Recent studies demonstrated the potential involvement of nerve fibres in the chronic inflammatory process of endometriosis. We aimed to characterize nerve fibres in the proximal and distal areas of the peritoneal endometriotic lesions in order to understand the chronic inflammatory process in endometriosis. Peritoneal endometriotic lesions (proximal area) (n = 17), the matching unaffected peritoneum (distal area) and healthy peritoneum of patients without endometriosis (n = 15) were analysed with the neuronal markers PGP 9.5, calbindin, calretinin and parvalbumin. Peritoneal fluids of women with and without endometriosis were used for Western blot analysis and for the neuronal growth assay. The protein expression of neuronal PC-12 cells incubated with peritoneal fluids was analysed. The overall nerve fibre density was significantly reduced in the distal area of the lesion when compared with the proximal area or with healthy peritoneum. The density of calbindin-, calretinin- and parvalbumin-positive nerve fibres was significantly increased in the endometriosis group. Calretinin expression was elevated in the peritoneal fluid of women with symptomatic endometriosis when compared with women with asymptomatic endometriosis. Furthermore, PC-12 cells incubated with peritoneal fluid of women with endometriosis showed a higher proliferation rate and a stronger neurite outgrowth than the control group. PC-12 cells incubated in peritoneal fluids of women with endometriosis expressed less calretinin but more calbindin than the control group. Calcium-binding proteins seem to be increased in endometriosis-associated nerve fibres and might play an important role in the chronic inflammatory condition and the pain pathogenesis of endometriosis. © 2013 European Federation of International Association for the Study of Pain Chapters.
Directory of Open Access Journals (Sweden)
Hua Geng
Full Text Available BACKGROUND: The apolipoprotein E gene (APOE coding polymorphism modifies the risks of Alzheimer's disease, type 2 diabetes, and coronary heart disease. Aside from the coding variants, single nucleotide polymorphism (SNP of the APOE promoter has also been shown to modify the risk of Alzheimer's disease. METHODOLOGY/PRINCIPAL FINDINGS: In this study we investigate the genotype-function relationship of APOE promoter polymorphism at molecular level and at physiological level: i.e., in transcription control of the gene and in the risk of type 2 diabetes. In molecular studies, the effect of the APOE -491A/T (rs449647 polymorphism on gene transcription was accessed by dual-luciferase reporter gene assays. The -491 A to T substitution decreased the activity (p<0.05 of the cloned APOE promoter (-1017 to +406. Using the -501 to -481 nucleotide sequence of the APOE promoter as a 'bait' to screen the human brain cDNA library by yeast one-hybrid system yielded ATF4, an endoplasmic reticulum stress response gene, as one of the interacting factors. Electrophoretic-mobility-shift assays (EMSA and chromatin immuno-precipitation (ChIP analyses further substantiated the physical interaction between ATF4 and the APOE promoter. Over-expression of ATF4 stimulated APOE expression whereas siRNA against ATF4 suppressed the expression of the gene. However, interaction between APOE promoter and ATF4 was not -491A/T-specific. At physiological level, the genotype-function relationship of APOE promoter polymorphism was studied in type 2 diabetes. In 630 cases and 595 controls, three APOE promoter SNPs -491A/T, -219G/T (rs405509, and +113G/C (rs440446 were genotyped and tested for association with type 2 diabetes in Hong Kong Chinese. No SNP or haplotype association with type 2 diabetes was detected. CONCLUSIONS/SIGNIFICANCE: At molecular level, polymorphism -491A/T and ATF4 elicit independent control of APOE gene expression. At physiological level, no genotype
de Boer, Johannes W.; Alsters, Paul L.; Meetsma, Auke; Hage, Ronald; Browne, Wesley R.; Feringa, Ben L.
2008-01-01
The role played by the additives salicylic acid, L-ascorbic acid and oxalic acid in promoting the catalytic activity of [Mn(IV) (2)(O)(3)(tmtacn)(2)](PF(6))(2) {1(PF(6))(2), where tmtacn = N, N ', N ''-trimethyl-1,4,7-triazacyclononane} in the epoxidation and cis-dihydroxylation of alkenes with
MDM2 promoter SNP344T>A (rs1196333 status does not affect cancer risk.
Directory of Open Access Journals (Sweden)
Stian Knappskog
Full Text Available The MDM2 proto-oncogene plays a key role in central cellular processes like growth control and apoptosis, and the gene locus is frequently amplified in sarcomas. Two polymorphisms located in the MDM2 promoter P2 have been shown to affect cancer risk. One of these polymorphisms (SNP309T>G; rs2279744 facilitates Sp1 transcription factor binding to the promoter and is associated with increased cancer risk. In contrast, SNP285G>C (rs117039649, located 24 bp upstream of rs2279744, and in complete linkage disequilibrium with the SNP309G allele, reduces Sp1 recruitment and lowers cancer risk. Thus, fine tuning of MDM2 expression has proven to be of significant importance with respect to tumorigenesis. We assessed the potential functional effects of a third MDM2 promoter P2 polymorphism (SNP344T>A; rs1196333 located on the SNP309T allele. While in silico analyses indicated SNP344A to modulate TFAP2A, SPIB and AP1 transcription factor binding, we found no effect of SNP344 status on MDM2 expression levels. Assessing the frequency of SNP344A in healthy Caucasians (n = 2,954 and patients suffering from ovarian (n = 1,927, breast (n = 1,271, endometrial (n = 895 or prostatic cancer (n = 641, we detected no significant difference in the distribution of this polymorphism between any of these cancer forms and healthy controls (6.1% in healthy controls, and 4.9%, 5.0%, 5.4% and 7.2% in the cancer groups, respectively. In conclusion, our findings provide no evidence indicating that SNP344A may affect MDM2 transcription or cancer risk.
β-Hydroxy-β-Methylbutyrate (HMB) Promotes Neurite Outgrowth in Neuro2a Cells.
Salto, Rafael; Vílchez, Jose D; Girón, María D; Cabrera, Elena; Campos, Nefertiti; Manzano, Manuel; Rueda, Ricardo; López-Pedrosa, Jose M
2015-01-01
β-Hydroxy-β-methylbutyrate (HMB) has been shown to enhance cell survival, differentiation and protein turnover in muscle, mainly activating phosphoinositide-3-kinase/protein kinase B (PI3K/Akt) and mitogen-activated protein kinases/ extracellular-signal-regulated kinases (MAPK/ERK) signaling pathways. Since these two pathways are related to neuronal survival and differentiation, in this study, we have investigated the neurotrophic effects of HMB in mouse neuroblastoma Neuro2a cells. In Neuro2a cells, HMB promotes differentiation to neurites independent from any effects on proliferation. These effects are mediated by activation of both the PI3K/Akt and the extracellular-signal-regulated kinases (ERK1/2) signaling as demonstrated by the use of specific inhibitors of these two pathways. As myocyte-enhancer factor 2 (MEF2) family of transcription factors are involved in neuronal survival and plasticity, the transcriptional activity and protein levels of MEF2 were also evaluated. HMB promoted MEF2-dependent transcriptional activity mediated by the activation of Akt and ERK1/2 pathways. Furthermore, HMB increases the expression of brain glucose transporters 1 (GLUT1) and 3 (GLUT3), and mTOR phosphorylation, which translates in a higher protein synthesis in Neuro2a cells. Furthermore, Torin1 and rapamycin effects on MEF2 transcriptional activity and HMB-dependent neurite outgrowth support that HMB acts through mTORC2. Together, these findings provide clear evidence to support an important role of HMB in neurite outgrowth.
2-HG Inhibits Necroptosis by Stimulating DNMT1-Dependent Hypermethylation of the RIP3 Promoter
Directory of Open Access Journals (Sweden)
Zhentao Yang
2017-05-01
Full Text Available 2-hydroxyglutarate-(2-HG-mediated inhibition of TET2 activity influences DNA hypermethylation in cells harboring mutations of isocitrate dehydrogenases 1 and 2 (IDH1/2. Here, we show that 2-HG also regulates DNA methylation mediated by DNA methyltransferase 1 (DNMT1. DNMT1-dependent hypermethylation of the RIP3 promoter occurred in both IDH1 R132Q knockin mutant mouse embryonic fibroblast (MEFs and 2-HG-treated wild-type (WT MEFs. We found that 2-HG bound to DNMT1 and stimulated its association with the RIP3 promoter, inducing hypermethylation that reduces RIP3 protein and consequently impaired RIP3-dependent necroptosis. In human glioma samples, RIP3 protein levels correlated negatively with IDH1 R132H levels. Furthermore, ectopic expression of RIP3 in transformed IDH1-mutated MEFs inhibited the growth of tumors derived from these cells following transplantation into nude mice. Thus, our research sheds light on a mechanism of 2-HG-induced DNA hypermethylation and suggests that impaired necroptosis contributes to the tumorigenesis driven by IDH1/2 mutations.
Conversion of CO2 via Visible Light Promoted Homogeneous Redox Catalysis
Directory of Open Access Journals (Sweden)
Bernhard Rieger
2012-11-01
Full Text Available This review gives an overview on the principles of light-promoted homogeneous redox catalysis in terms of applications in CO2 conversion. Various chromophores and the advantages of different structures and metal centers as well as optimization strategies are discussed. All aspects of the reduction catalyst site are restricted to CO2 conversion. An important focus of this review is the question of a replacement of the sacrificial donor which is found in most of the current publications. Furthermore, electronic parameters of supramolecular systems are reviewed with reference to the requisite of chromophores, oxidation and reduction sites.
ΔNp63α induces the expression of FAT2 and Slug to promote tumor invasion
Dang, Tuyen T.; Westcott, Jill M.; Maine, Erin A.; Kanchwala, Mohammed; Xing, Chao; Pearson, Gray W.
2016-01-01
Tumor invasion can be induced by changes in gene expression that alter cell phenotype. The transcription factor ΔNp63α promotes basal-like breast cancer (BLBC) migration by inducing the expression of the mesenchymal genes Slug and Axl, which confers cells with a hybrid epithelial/mesenchymal state. However, the extent of the ΔNp63α regulated genes that support invasive behavior is not known. Here, using gene expression analysis, ChIP-seq, and functional testing, we find that ΔNp63α promotes BLBC motility by inducing the expression of the atypical cadherin FAT2, the vesicular binding protein SNCA, the carbonic anhydrase CA12, the lipid binding protein CPNE8 and the kinase NEK1, along with Slug and Axl. Notably, lung squamous cell carcinoma migration also required ΔNp63α dependent FAT2 and Slug expression, demonstrating that ΔNp63α promotes migration in multiple tumor types by inducing mesenchymal and non-mesenchymal genes. ΔNp63α activation of FAT2 and Slug influenced E-cadherin localization to cell-cell contacts, which can restrict spontaneous cell movement. Moreover, live-imaging of spheroids in organotypic culture demonstrated that ΔNp63α, FAT2 and Slug were essential for the extension of cellular protrusions that initiate collective invasion. Importantly, ΔNp63α is co-expressed with FAT2 and Slug in patient tumors and the elevated expression of ΔNp63α, FAT2 and Slug correlated with poor patient outcome. Together, these results reveal how ΔNp63α promotes cell migration by directly inducing the expression of a cohort of genes with distinct cellular functions and suggest that FAT2 is a new regulator of collective invasion that may influence patient outcome. PMID:27081041
Song, Xian-Rong; Qiu, Yi-Feng; Song, Bo; Hao, Xin-Hua; Han, Ya-Ping; Gao, Pin; Liu, Xue-Yuan; Liang, Yong-Min
2015-02-20
A novel BF3·Et2O-promoted tandem reaction of easily prepared 2-propynolphenols/anilines and trimethylsilyl azide is developed to give C2-alkenylated benzoxazoles and benzimidazoles in moderate to good yields. Most reactions could be accomplished in 30 min at room temperature. This tandem process involves a Csp-Csp2 bond cleavage and a C-N bond formation. Moreover, both tertiary and secondary propargylic alcohols with diverse functional groups were tolerated under the mild conditions.
Characterization of P1 promoter activity of the β-galactoside α2,6 ...
Indian Academy of Sciences (India)
2012-04-05
Apr 5, 2012 ... The level of β-galactoside α2,6-sialyltransferase I (ST6Gal I) mRNA, encoded by the gene siat1, is increased in malignant tissues. Expression is regulated by different promoters – P1, P2 and P3 – generating three mRNA isoforms. H, X and YZ. In cervical cancer tissue the mRNA isoform H, which results ...
Promoting effect of bile acids on neoplastic transformation of x-irradiated 10T1/2 cells
International Nuclear Information System (INIS)
Han, A.; Hill, C.K.
1984-01-01
Experimental studies have raised a concern about a role of bile acids in colo-rectal carcinogenesis. Studies in vivo suggest that bile acids may act as tumor promoters. Using 10T1/2 mouse cells as a model system, the authors explored the effects of cholic and cheno-deoxycholic acid on x-ray-induced neoplastic transformation in these cells. Addition of either cheno-deoxycholic acid or cholic acid to 10T1/2 cells, 24 hours after exposure to x-rays (50kv) increases significantly the frequencies of transformation. The compounds were present in the medium throughout the entire postirradiation refeeding period. At the concentrations used (0.5μg/ml), neither acid was cytotoxic and did not have any effect on cell survival. The enhancement of radiation-induced transformation seems to be greater in the presence of cholic acid, as compared to the effect of cheno-deoxycholic acid. Increase in transformation was relatively greater after low compared to high doses of radiation. The effect of bile acids on transformation of 10T1/2 cells is similar to that of a known tumor promoter TPA. The authors' observations support the conclusion that promotional effect of bile acids is not because of their specific effect on colonic epithelium, but rather due to their general properties as tumor promoters
Energy Technology Data Exchange (ETDEWEB)
Zheng, Xuqin [Department of Endocrinology, First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu Province 210029 (China); Sun, Tao [Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Nanjing, Jiangsu Province 210002 (China); Wang, Xiaodong, E-mail: xdwang666@hotmail.com [Department of Endocrinology, First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu Province 210029 (China)
2013-07-05
Highlights: •TC, a CB2R specific agonist, stimulates SIRT1 activity by PKA/CREB pathway. •TC promotes PGC-1α transcriptional activity by increasing its deacetylation. •TC increases the expression of genes linked to FAO and promotes the rate of FAO. •The effects of TC in FAO are dependent on CB2R. •Suggesting CB2R as a target to treat diseases with lipid dysregulation. -- Abstract: Abnormal fatty acid oxidation has been associated with obesity and type 2 diabetes. At the transcriptional level, peroxisome proliferator-activated receptor-gamma coactivator 1α (PGC-1α) has been reported to strongly increase the ability of hormone nuclear receptors PPARα and ERRα to drive transcription of fatty acid oxidation enzymes. In this study, we report that a specific agonist of the type 2 cannabinoid receptor (CB2R) can lead to fatty acid oxidation through the PGC-1α pathway. We have found that CB2R is expressed in differentiated C2C12 myotubes, and that use of the specific agonist trans-caryophyllene (TC) stimulates sirtuin 1 (SIRT1) deacetylase activity by increasing the phosphorylation of cAMP response element-binding protein (CREB), thus leading to increased levels of PGC-1α deacetylation. This use of TC treatment increases the expression of genes linked to the fatty acid oxidation pathway in a SIRT1/PGC-1α-dependent mechanism and also drastically accelerates the rate of complete fatty acid oxidation in C2C12 myotubes, neither of which occur when CB2R mRNA is knocked down using siRNA. These results reveal that activation of CB2R by a selective agonist promotes lipid oxidation through a signaling/transcriptional pathway. Our findings imply that pharmacological manipulation of CB2R may provide therapeutic possibilities to treat metabolic diseases associated with lipid dysregulation.
International Nuclear Information System (INIS)
Kangvansura, Praewpilin; Schulz, Hans; Suramitr, Anwaraporn; Poo-arporn, Yingyot; Viravathana, Pinsuda; Worayingyong, Attera
2014-01-01
Highlights: • Ru/ZrO 2 , ZrO 2 promoted Co/SiO 2 for FTS were reduced by time resolved XANES. • Reduced catalysts resulted from XANES reduction showed the mixed phases of Co, CoO. • The highest percentages of CoO resulted from the high ZrO 2 promoted Co/SiO 2 . • Product distributions of 1-alkenes, iso-alkanes indicated sites for FTS and the 2° reaction. • Alkene readsorption were high corresponding to the high CoO forming branched alkanes. - Abstract: Co/SiO 2 catalysts were promoted with 4% and 8% ZrO 2 . Small amounts (0.07%) of Ru were impregnated onto 4%ZrO 2 /Co/SiO 2 . Catalysts resulting from time-resolved XANES reduction showed mixed phases of Co and CoO, with the highest percentages of Co resulting from Ru/4%ZrO 2 /Co/SiO 2 and the highest percentages of CoO resulting from 8%ZrO 2 /Co/SiO 2 . Product distributions of n-alkanes, iso-alkanes and alkenes during Fischer–Tropsch Synthesis (FTS) were used to investigate the catalyst performance of 4%ZrO 2 /Co/SiO 2 8%ZrO 2 /Co/SiO 2 and Ru/4%ZrO 2 /Co/SiO 2 . FTS steady state was studied by growth probabilities of n-alkane products. No 1-alkene was produced from Ru/4%ZrO 2 /Co/SiO 2 , indicating high availability of Fischer–Tropsch sites for long chain hydrocarbon growth, despite high methanation. Branched alkanes produced from the secondary reaction were related to the high CoO percentages on 8%ZrO 2 /Co/SiO 2 . Alkene readsorption sites were high, corresponding to the high CoO percentages, causing a high probability of forming branched alkane products
MDM2 promoter SNP344T>A (rs1196333) status does not affect cancer risk
S. Knappskog (Stian); L.B. Gansmo (Liv); P. Romundstad (Pål); M. Bjørnslett (Merete); J. Trovik (Jone); J. Sommerfelt-Pettersen (Jan); E. Løkkevik (Erik); R.A.E.M. Tollenaar (Rob); C.M. Seynaeve (Caroline); P. Devilee (Peter); H.B. Salvesen (Helga); A. Dørum (Anne); K. Hveem (Kristian); L.J. Vatten (Lars); P.E. Lønning (Per )
2012-01-01
textabstractThe MDM2 proto-oncogene plays a key role in central cellular processes like growth control and apoptosis, and the gene locus is frequently amplified in sarcomas. Two polymorphisms located in the MDM2 promoter P2 have been shown to affect cancer risk. One of these polymorphisms
Effect of glycation of albumin on its renal clearance in normal and diabetic rats
International Nuclear Information System (INIS)
Layton, G.J.; Jerums, G.
1988-01-01
Two independent techniques have been used to study the renal clearances of nonenzymatically glycated albumin and nonglycated albumin in normal and streptozotocin-induced diabetic rats, 16 to 24 weeks after the onset of diabetes. In the first technique, serum and urinary endogenous glycated and nonglycated albumin were separated using m-aminophenylboronate affinity chromatography and subsequently quantified by radioimmunoassay. Endogenous glycated albumin was cleared approximately twofold faster than nonglycated albumin in normal and diabetic rats. However, no difference was observed in the glycated albumin/nonglycated albumin clearance ratios (Cga/Calb) in normal and diabetic rats, respectively (2.18 +/- 0.39 vs 1.83 +/- 0.22, P greater than 0.05). The second technique measured the renal clearance of injected 125I-labelled glycated albumin and 125I-labelled albumin. The endogenous results were supported by the finding that 125I-labelled glycated albumin was cleared more rapidly than 125I-labelled albumin in normal (P less than 0.01) and diabetic (P less than 0.05) rats. The Cga/Calb ratio calculated for the radiolabelled albumins was 1.4 and 2.0 in normal and diabetic rats, respectively. This evidence suggests that nonenzymatic glycation of albumin increases its renal clearance to a similar degree in normal and diabetic rats
Duan, Chaojun; Li, Minghua; Rui, Liangyou
2004-10-15
Leptin regulates energy homeostasis primarily by binding and activating its long form receptor (LRb). Deficiency of either leptin or LRb causes morbid obesity. Leptin stimulates LRb-associated JAK2, thus initiating multiple pathways including the Stat3 and phosphatidylinositol (PI) 3-kinase pathways that mediate leptin biological actions. Here we report that SH2-B, a JAK2-interacting protein, promotes activation of the PI 3-kinase pathway by recruiting insulin receptor substrate 1 (IRS1) and IRS2 in response to leptin. SH2-B directly bound, via its PH and SH2 domain, to both IRS1 and IRS2 both in vitro and in intact cells and mediated formation of a JAK2/SH2-B/IRS1 or IRS2 tertiary complex. Consequently, SH2-B dramatically enhanced leptin-stimulated tyrosine phosphorylation of IRS1 and IRS2 in HEK293 cells stably expressing LRb, thus promoting association of IRS1 and IRS2 with the p85 regulatory subunit of PI 3-kinase and phosphorylation and activation of Akt. SH2-B mutants with lower affinity for IRS1 and IRS2 exhibited reduced ability to promote association of JAK2 with IRS1, tyrosine phosphorylation of IRS1, and association of IRS1 with p85 in response to leptin. Moreover, deletion of the SH2-B gene impaired leptin-stimulated tyrosine phosphorylation of endogenous IRS1 in mouse embryonic fibroblasts (MEF), which was reversed by reintroduction of SH2-B. Similarly, SH2-B promoted growth hormone-stimulated tyrosine phosphorylation of IRS1 in both HEK293 and MEF cells. Our data suggest that SH2-B is a novel mediator of the PI 3-kinase pathway in response to leptin or other hormones and cytokines that activate JAK2.
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins
Hu, Yuhui; Willett, Kristine L.; Khan, Ikhlas A.; Scheffler, Brian E.; Dasmahapatra, Asok K.
2009-01-01
Medaka (Oryzias latipes) embryos at different developmental stages were exposed to ethanol for 48 h, then allowed to hatch. Teratogenic effects were evaluated in hatchlings after examining chondrocranial cartilage deformities. Ethanol disrupted cartilage development in medaka in a dose and developmental stage-specific manner. Compared to controls, the linear length of the neurocranium and other cartilages were reduced in ethanol-treated groups. Moreover, the chondrification in cartilages, specifically trabeculae and polar cartilages, were inhibited by ethanol. To understand the mechanism of ethanol teratogenesis, NAD+: NADH status during embryogenesis and the methylation pattern of Aldh1A2 promoter in whole embryos and adult tissues (brain, eye, heart and liver) were analyzed. Embryos 6 dpf had higher NAD+ than embryos 0 or 2 dpf. Ethanol (200 or 400 mM) was able to reduce NAD+ content in 2 and 6 dpf embryos. However, in both cases reductions were not significantly different from the controls. Moreover, no significant difference in either NADH content or in NAD+: NADH status of the ethanol-treated embryos, with regard to controls, was observed. The promoter of Aldh1A2 contains 31 CpG dinucleotides (-705 to +154, ATG = +1); none of which were methylated. Compared to controls, embryonic ethanol exposure (100 and 400 mM) was unable to alter Aldh1A2 promoter methylation in embryos or in the tissues of adults (breeding) developmentally exposed to ethanol (300 mM, 48 hpf). From these data we conclude that ethanol teratogenesis in medaka does not induce alteration in the methylation pattern of Aldh1A2 promoter, but does change cartilage development. PMID:19651241
Lithium niobate bulk crystallization promoted by CO2 laser radiation
Ferreira, N. M.; Costa, F. M.; Nogueira, R. N.; Graça, M. P. F.
2012-09-01
The crystallization induced by laser radiation is a very promising technique to promote glass/ceramic transformation, being already used to produce crystalline patterns on glass surfaces. In this work, a SiO2-Li2O-Nb2O5 glass, prepared by the sol-gel route, was submitted to CO2 laser radiation and conventional heat-treatments in order to induce the LiNbO3 crystallization. The structure and morphology of the samples prepared by both routes was analyzed as a function of exposure time, radiation power and heat-treatment temperatures by XRD, Raman spectroscopy and SEM. The results reveal a correlation between the crystallization degree of LiNbO3 particles and glass matrix with the heat treatment type and experimental parameters. An heat-treatment at 650 °C/4 h was necessary to induce crystallization in heat treatments samples while 4 W/500 s was enough for laser radiation ones, corresponding a reduction time processing of ˜14 000 s.
Directory of Open Access Journals (Sweden)
Andrew D Beggs
2013-05-01
Full Text Available Serrated adenomas form a distinct subtype of colorectal pre-malignant lesions that may progress to malignancy along a different molecular pathway than the conventional adenoma-carcinoma pathway. Previous studies have hypothesised that BRAF mutation and promoter hypermethylation plays a role, but the evidence for this is not robust. We aimed to carry out a whole-genome loss of heterozygosity analysis, followed by targeted promoter methylation and expression analysis to identify potential pathways in serrated adenomas. An initial panel of 9 sessile serrated adenomas (SSA and one TSA were analysed using Illumina Goldengate HumanLinkage panel arrays to ascertain regions of loss of heterozygosity. This was verified via molecular inversion probe analysis and microsatellite analysis of a further 32 samples. Methylation analysis of genes of interest was carried out using methylation specific PCR (verified by pyrosequencing and immunohistochemistry used to correlate loss of expression of genes of interest. All experiments used adenoma samples and normal tissue samples as control. SSA samples were found on whole-genome analysis to have consistent loss of heterozygosity at 4p15.1-4p15.31, which was not found in the sole TSA, adenomas, or normal tissues. Genes of interest in this region were PDCH7 and SLIT2, and combined MSP/IHC analysis of these genes revealed significant loss of SLIT2 expression associated with promoter methylation of SLIT2. Loss of expression of SLIT2 by promoter hypermethylation and loss of heterozygosity events is significantly associated with serrated adenoma development, and SLIT2 may represent a epimutated tumour suppressor gene according to the Knudson "two hit" hypothesis.
Eissa, Sanaa; Zohny, Samir F; Shehata, Hanan Hussien; Hegazy, Marwa G A; Salem, Ahmed M; Esmat, Mohamed
2012-04-01
We evaluated the significance of urinary retinoic acid receptor-β2 (RAR-β2) gene promoter methylation and hyaluronidase activity in comparison with voided urine cytology (VUC) in diagnosis of bladder cancer. This study included 100 patients diagnosed with bladder cancer, 65 patients with benign urological disorders and 51 healthy volunteers. Urine supernatant was used for determining hyaluronidase activity by zymography while urine sediment was used for cytology and detection of methylated RAR-β2 gene promoter by methylation specific nested PCR. The sensitivity and specificity were 53% and 90.5% for VUC, 65% and 89.7% for percent methylation fraction of RAR-β2 gene promoter, and 89% and 90.5% for hyaluronidase activity; combination of the three parameters increased sensitivity to 95%. A significant association was observed between investigated markers and advanced grade tumor. Combined use of RAR-β2 gene promoter methylation, hyaluronidase activity and VUC is promising non-invasive tool for bladder cancer detection. Copyright © 2012. Published by Elsevier Inc.
EZH2 regulates neuroblastoma cell differentiation via NTRK1 promoter epigenetic modifications.
Li, Zhenghao; Takenobu, Hisanori; Setyawati, Amallia Nuggetsiana; Akita, Nobuhiro; Haruta, Masayuki; Satoh, Shunpei; Shinno, Yoshitaka; Chikaraishi, Koji; Mukae, Kyosuke; Akter, Jesmin; Sugino, Ryuichi P; Nakazawa, Atsuko; Nakagawara, Akira; Aburatani, Hiroyuki; Ohira, Miki; Kamijo, Takehiko
2018-05-01
The polycomb repressor complex 2 molecule EZH2 is now known to play a role in essential cellular processes, namely, cell fate decisions, cell cycle regulation, senescence, cell differentiation, and cancer development/progression. EZH2 inhibitors have recently been developed; however, their effectiveness and underlying molecular mechanisms in many malignancies have not yet been elucidated in detail. Although the functional role of EZH2 in tumorigenesis in neuroblastoma (NB) has been investigated, mutations of EZH2 have not been reported. A Kaplan-Meier analysis on the event free survival and overall survival of NB patients indicated that the high expression of EZH2 correlated with an unfavorable prognosis. In order to elucidate the functional roles of EZH2 in NB tumorigenesis and its aggressiveness, we knocked down EZH2 in NB cell lines using lentivirus systems. The knockdown of EZH2 significantly induced NB cell differentiation, e.g., neurite extension, and the neuronal differentiation markers, NF68 and GAP43. EZH2 inhibitors also induced NB cell differentiation. We performed a comprehensive transcriptome analysis using Human Gene Expression Microarrays and found that NTRK1 (TrkA) is one of the EZH2-related suppression targets. The depletion of NTRK1 canceled EZH2 knockdown-induced NB cell differentiation. Our integrative methylome, transcriptome, and chromatin immunoprecipitation assays using NB cell lines and clinical samples clarified that the NTRK1 P1 and P2 promoter regions were regulated differently by DNA methylation and EZH2-related histone modifications. The NTRK1 transcript variants 1/2, which were regulated by EZH2-related H3K27me3 modifications at the P1 promoter region, were strongly expressed in favorable, but not unfavorable NB. The depletion and inhibition of EZH2 successfully induced NTRK1 transcripts and functional proteins. Collectively, these results indicate that EZH2 plays important roles in preventing the differentiation of NB cells and also
TRF2 Recruits RTEL1 to Telomeres in S Phase to Promote T-Loop Unwinding
Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John?H.J.; Boulton, Simon?J.
2015-01-01
Summary The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to?prevent catastrophic t-loop processing by structure-specific nucleases. We show that ...
Directory of Open Access Journals (Sweden)
In Sung Son
2013-03-01
Full Text Available The effects of the SnO2 pore size and metal oxide promoters on the sensing properties of SnO2-based thick film gas sensors were investigated to improve the detection of very low H2S concentrations (<1 ppm. SnO2 sensors and SnO2-based thick-film gas sensors promoted with NiO, ZnO, MoO3, CuO or Fe2O3 were prepared, and their sensing properties were examined in a flow system. The SnO2 materials were prepared by calcining SnO2 at 600, 800, 1,000 and 1,200 °C to give materials identified as SnO2(600, SnO2(800, SnO2(1000, and SnO2(1200, respectively. The Sn(12Mo5Ni3 sensor, which was prepared by physically mixing 5 wt% MoO3 (Mo5, 3 wt% NiO (Ni3 and SnO2(1200 with a large pore size of 312 nm, exhibited a high sensor response of approximately 75% for the detection of 1 ppm H2S at 350 °C with excellent recovery properties. Unlike the SnO2 sensors, its response was maintained during multiple cycles without deactivation. This was attributed to the promoter effect of MoO3. In particular, the Sn(12Mo5Ni3 sensor developed in this study showed twice the response of the Sn(6Mo5Ni3 sensor, which was prepared by SnO2(600 with the smaller pore size than SnO2(1200. The excellent sensor response and recovery properties of Sn(12Mo5Ni3 are believed to be due to the combined promoter effects of MoO3 and NiO and the diffusion effect of H2S as a result of the large pore size of SnO2.
SNAI2/Slug promotes growth and invasion in human gliomas
International Nuclear Information System (INIS)
Yang, Hong Wei; Menon, Lata G; Black, Peter M; Carroll, Rona S; Johnson, Mark D
2010-01-01
Numerous factors that contribute to malignant glioma invasion have been identified, but the upstream genes coordinating this process are poorly known. To identify genes controlling glioma invasion, we used genome-wide mRNA expression profiles of primary human glioblastomas to develop an expression-based rank ordering of 30 transcription factors that have previously been implicated in the regulation of invasion and metastasis in cancer. Using this approach, we identified the oncogenic transcriptional repressor, SNAI2/Slug, among the upper tenth percentile of invasion-related transcription factors overexpressed in glioblastomas. SNAI2 mRNA expression correlated with histologic grade and invasive phenotype in primary human glioma specimens, and was induced by EGF receptor activation in human glioblastoma cells. Overexpression of SNAI2/Slug increased glioblastoma cell proliferation and invasion in vitro and promoted angiogenesis and glioblastoma growth in vivo. Importantly, knockdown of endogenous SNAI2/Slug in glioblastoma cells decreased invasion and increased survival in a mouse intracranial human glioblastoma transplantation model. This genome-scale approach has thus identified SNAI2/Slug as a regulator of growth and invasion in human gliomas
Pokemon promotes the invasiveness of hepatocellular carcinoma by enhancing MEF2D transcription.
Kong, Jing; Liu, Xiaoping; Li, Xiangqian; Wu, Jinsheng; Wu, Ning; Chen, Jun; Fang, Fang
2016-05-01
Pokemon, a master oncogene crucial for the tumorigenicity and progression of a variety of cancers, has been demonstrated to enhance the proliferation and survival of hepatocellular carcinoma (HCC). However, the contribution of Pokemon to the invasiveness of HCC has not yet been studied. In this study, we employed HCC cells to investigate the role of Pokemon in the invasion of HCC with multidisciplinary approaches. Pokemon overexpression was found to be closely associated with invasion and intrahepatic metastasis of HCC in clinical specimens. Suppression of Pokemon attenuated the invasion of HCC cells by in vitro transwell and wound-healing assays. Myocyte enhancer factor 2D (MEF2D), an oncogene that can promote the invasiveness of HCC, was found to be underexpressed during Pokemon silencing in HCC cells. Restoration of MEF2D abolished the effect of Pokemon downregulation on the migration of HCC cells. Further experiments verified that Pokemon binds two putative recognition sites located within the upstream region of the MEF2D promoter and enhances its transcription. The association between Pokemon and MEF2D was further confirmed in HCC specimens. Animal experiments further confirmed that Pokemon downregulation attenuated the metastasis of HCC cells in mice. Collectively, Pokemon was found to enhance the migration and invasion of HCC by increasing MEF2D expression. Thus, targeting Pokemon and MEF2D may be an effective strategy to suppress the metastasis of HCC.
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...
Web 2.0 for health promotion: reviewing the current evidence.
Chou, Wen-ying Sylvia; Prestin, Abby; Lyons, Claire; Wen, Kuang-yi
2013-01-01
As Web 2.0 and social media make the communication landscape increasingly participatory, empirical evidence is needed regarding their impact on and utility for health promotion. Following Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines, we searched 4 medical and social science databases for literature (2004-present) on the intersection of Web 2.0 and health. A total of 514 unique publications matched our criteria. We classified references as commentaries and reviews (n = 267), descriptive studies (n = 213), and pilot intervention studies (n = 34). The scarcity of empirical evidence points to the need for more interventions with participatory and user-generated features. Innovative study designs and measurement methods are needed to understand the communication landscape and to critically assess intervention effectiveness. To address health disparities, interventions must consider accessibility for vulnerable populations.
NF45/ILF2 tissue expression, promoter analysis, and interleukin-2 transactivating function
International Nuclear Information System (INIS)
Zhao Guohua; Shi Lingfang; Qiu Daoming; Hu Hong; Kao, Peter N.
2005-01-01
NF45/ILF2 associates with NF90/ILF3 in the nucleus and regulates IL-2 gene transcription at the antigen receptor response element (ARRE)/NF-AT DNA target sequence (P.N. Kao, L. Chen, G. Brock, J. Ng, A.J. Smith, B. Corthesy, J. Biol. Chem. 269 (1994) 20691-20699). NF45 is widely expressed in normal tissues, especially testis, brain, and kidney, with a predominantly nuclear distribution. NF45 mRNA expression is increased in lymphoma and leukemia cell lines. The human and murine NF45 proteins differ only by substitution of valine by isoleucine at amino acid 142. Fluorescence in situ hybridization localized the human NF45 gene to chromosome 1q21.3, and mouse NF45 gene to chromosome 3F1. Promoter analysis of 2.5 kB of the murine NF45 gene reveals that significant activation is conferred by factors, possible including NF-Y, that bind to the CCAAT-box sequence. The function of human NF45 in regulating IL-2 gene expression was characterized in Jurkat T-cells stably transfected with plasmids directing expression of NF45 cDNA in sense or antisense orientations. NF45 sense expression increased IL-2 luciferase reporter gene activity 120-fold, and IL-2 protein expression 2-fold compared to control cells. NF45 is a highly conserved, regulated transcriptional activator, and one target gene is IL-2
PIF4 Promotes Expression of LNG1 and LNG2 to Induce Thermomorphogenic Growth in Arabidopsis
Directory of Open Access Journals (Sweden)
Geonhee Hwang
2017-07-01
Full Text Available Arabidopsis plants adapt to high ambient temperature by a suite of morphological changes including elongation of hypocotyls and petioles and leaf hyponastic growth. These morphological changes are collectively called thermomorphogenesis and are believed to increase leaf cooling capacity by enhancing transpiration efficiency, thereby increasing tolerance to heat stress. The bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4 has been identified as a major regulator of thermomorphogenic growth. Here, we show that PIF4 promotes the expression of two homologous genes LONGIFOLIA1 (LNG1 and LONGIFOLIA2 (LNG2 that have been reported to regulate leaf morphology. ChIP-Seq analyses and ChIP assays showed that PIF4 directly binds to the promoters of both LNG1 and LNG2. The expression of LNG1 and LNG2 is induced by high temperature in wild type plants. However, the high temperature activation of LNG1 and LNG2 is compromised in the pif4 mutant, indicating that PIF4 directly regulates LNG1 and LNG2 expression in response to high ambient temperatures. We further show that the activities of LNGs support thermomorphogenic growth. The expression of auxin biosynthetic and responsive genes is decreased in the lng quadruple mutant, implying that LNGs promote thermomorphogenic growth by activating the auxin pathway. Together, our results demonstrate that LNG1 and LNG2 are directly regulated by PIF4 and are new components for the regulation of thermomorphogenesis.
Chemoenzymatic approaches to obtain chiral-centered selenium compounds
Brondani, Patricia B.; Guilmoto, Nathalie M. A. F.; Dudek, Hanna M.; Fraaije, Marco W.; Andrade, Leandro H.
2012-01-01
The synthesis of chiral-centered selenium compounds is presented. Enantioselective oxidations of these organoselenium compounds were performed using a wide range of biocatalysts, including Baeyer-Villiger monooxygenases, oxidoreductases-containing Aspergillus terreus and lipase (Cal-B) in the
Jiang, Yi; Alberda van Ekenstein, Gerhard; Woortman, Albert J. J.; Loos, Katja
2014-01-01
Fully biobased saturated and unsaturated aliphatic polyesters and oligoesters are successfully prepared by Candida antarctica lipase B (CALB)-catalyzed polycondensations of succinate, itaconate, and 1,4-butanediol. The effects of monomer substrates and polymerization methods on enzymatic
Serafini, Suellen; Santos, Maria Mercês; Aoun Tannuri, Ana Cristina; Zerbini, Maria Claudia Nogueira; de Mendonça Coelho, Maria Cecília; de Oliveira Gonçalves, Josiane; Tannuri, Uenis
2017-12-06
Hematoxylin-eosin (HE) staining of a full-thickness rectal wall fragment is classically used for the diagnosis of Hirschsprung disease (HD). However, this technique requires large fragments for a better diagnosis. Additionally, the histochemical and immunohistochemical methods of staining small fragments of rectal mucosal and submucosal biopsies are not available in all centers. Therefore, the possibility of diagnosing HD through HE staining in these biopsies could be a valuable alternative for centers that do not have more specific techniques. The objectives of the current investigation were to evaluate the concordance of the results obtained by HE staining and the calretinin method with acetylcholinesterase (AChE) activity in fragments of mucosa and submucosa in the diagnosis of HD. For this study, 50 cases from our laboratory were selected. The tissue material was embedded in paraffin. Sixty levels of each fragment were utilized for HE, and the other 3 levels were used for calretinin. These slides were analyzed under the microscope, photographed and classified as either positive for HD when no ganglion cells were found with nerve trunks present or as negative when ganglion cells were found. The results from reading the slides were compared with those of AChE. Of the 50 cases evaluated by the HE technique, only 5 contradicted the diagnosis based on AChE, with a Kappa value of 0.800 and an accuracy of 90%. In the comparison between calretinin and AChE, 8 cases were discordant, with a Kappa value of 0.676 and an accuracy of 84%. The concordance of results from AChE and HE methods was satisfactory, allowing for the potential use of the HE method for fragments of mucosa and submucosa as a valid alternative in the diagnosis of HD. The immunohistochemical technique of calretinin did not show good agreement with the AChE activity in our study.
Sun, Jinghui; Luo, Qing; Liu, Lingling; Song, Guanbin
2018-07-28
Cancer stem cells (CSCs) are a small subpopulation of tumour cells that have been proposed to be responsible for cancer initiation, chemotherapy resistance and cancer recurrence. Shear stress activated cellular signalling is involved in cellular migration, proliferation and differentiation. However, little is known about the effects of shear stress on the migration of liver cancer stem cells (LCSCs). Here, we studied the effects of shear stress that are generated from a parallel plated flow chamber system, on LCSC migration and the activation of focal adhesion kinase (FAK) and extracellular signal regulated kinase1/2 (ERK1/2), using transwell assay and western blot, respectively. We found that 2 dyne/cm 2 shear stress loading for 6 h promotes LCSC migration and activation of the FAK and ERK1/2 signalling pathways, whereas treatment with the FAK phosphorylation inhibitor PF573228 or the ERK1/2 phosphorylation inhibitor PD98059 suppressed the shear stress-promoted migration, indicating the involvement of FAK and ERK1/2 activation in shear stress-induced LCSC migration. Additionally, atomic force microscopy (AFM) analysis showed that shear stress lowers LCSC stiffness via the FAK and ERK1/2 pathways, suggesting that the mechanism by which shear stress promotes LCSC migration might partially be responsible for the decrease in cell stiffness. Further experiments focused on the role of the actin cytoskeleton, demonstrating that the F-actin filaments in LCSCs are less well-defined after shear stress treatment, providing an explanation for the reduction in cell stiffness and the promotion of cell migration. Overall, our study demonstrates that shear stress promotes LCSC migration through the activation of the FAK-ERK1/2 signalling pathways, which further results in a reduction of organized actin and softer cell bodies. Copyright © 2018 Elsevier B.V. All rights reserved.
Alternative Splicing of CHEK2 and Codeletion with NF2 Promote Chromosomal Instability in Meningioma
Directory of Open Access Journals (Sweden)
Hong Wei Yang
2012-01-01
Full Text Available Mutations of the NF2 gene on chromosome 22q are thought to initiate tumorigenesis in nearly 50% of meningiomas, and 22q deletion is the earliest and most frequent large-scale chromosomal abnormality observed in these tumors. In aggressive meningiomas, 22q deletions are generally accompanied by the presence of large-scale segmental abnormalities involving other chromosomes, but the reasons for this association are unknown. We find that large-scale chromosomal alterations accumulate during meningioma progression primarily in tumors harboring 22q deletions, suggesting 22q-associated chromosomal instability. Here we show frequent codeletion of the DNA repair and tumor suppressor gene, CHEK2, in combination with NF2 on chromosome 22q in a majority of aggressive meningiomas. In addition, tumor-specific splicing of CHEK2 in meningioma leads to decreased functional Chk2 protein expression. We show that enforced Chk2 knockdown in meningioma cells decreases DNA repair. Furthermore, Chk2 depletion increases centrosome amplification, thereby promoting chromosomal instability. Taken together, these data indicate that alternative splicing and frequent codeletion of CHEK2 and NF2 contribute to the genomic instability and associated development of aggressive biologic behavior in meningiomas.
Energy Technology Data Exchange (ETDEWEB)
Elsasser, Brigitta M.; Schoenen, Iris; Fels, Gregor
2013-06-07
Candida antarctica lipase B (CALB) efficiently catalyzes the ring-opening polymerization of lactones to high molecular weight products in good yield. In contrast, an efficient enzymatic synthesis of polyamides has so far not been described in the literature. This obvious difference in enzyme catalysis is the subject of our comparative study of the initial steps of a CALB catalyzed ring-opening polymerization of ε- caprolactone and ε-caprolactam. We have applied docking tools to generate the reactant state complex and performed quantum mechanical/molecular mechanical (QM/MM) calculations at the density functional theory (DFT) PBE0 level of theory to simulate the acylation of Ser105 by the lactone and the lactam, respectively, via the corresponding first tetrahedral intermediates. We could identify a decisive difference in the accessibility of the two substrates in the ring-opening to the respective acyl enzyme complex as the attack of ε-caprolactam is hindered because of an energetically disfavored proton transfer during this part of the catalytic reaction while ε-caprolactone is perfectly processed along the widely accepted pathway using the catalytic triade of Ser105, His224, and Asp187. Since the generation of an acylated Ser105 species is the crucial step of the polymerization procedure, our results give an explanation for the unsatisfactory enzymatic polyamide formation and opens up new possibilities for targeted rational catalyst redesign in hope of an experimentally useful CALB catalyzed polyamide synthesis.
Dermatofibroma-like granular cell tumour: a potential diagnostic pitfall
Directory of Open Access Journals (Sweden)
Jiri Soukup
2016-11-01
Full Text Available Dermatofibroma-like granular cell tumour (GCT is a rare entity, with only two cases having been described so far. We report another case in a 62-year-old woman, discuss histopathological features, and review other tumours in which granular changes have been observed. Our tumour was composed predominantly of oval-to-spindle granular cells with prominent nucleoli, arranged in short fascicles and storiform pattern, infiltrating around collagen bundles. Immunohistochemical analysis with antibodies against CD31, CD56, CD68, CD117, S-100 protein, inhibin, calretinin, EMA, p53 and MIB-1 was performed, showing expression of CD56, CD68, S-100 protein, inhibin and calretinin. The diagnosis of atypical dermatofibroma-like GCT was made.
Wang, Hao; Nie, Lei; Wu, Lei; Liu, Qiufang; Guo, Xueyan
2017-03-25
Metastasis is one of the most decisive factors influencing CRC patient prognosis and current studies suggest that a molecular mechanism known as EMT broadly regulates cancer metastasis. NR2F2 is a key molecule in the development of CRC, but the roles and underlying mechanisms of NR2F2 in TGF-β induced EMT in CRC remain largely unknown. In the current study, we were interested to examine the role of NR2F2 in the TGF-β-induced EMT in CRC. Here, we found NR2F2 was upregulated in CRC cells and promotes TGF-β-induced EMT in CRC. Using comparative miRNA profiling TGF-β pre-treated CRC cells in which NR2F2 had been knocked down with that of control cells, we identified miR-21 as a commonly downregulated miRNA in HT29 cells treated with TGF-β and NR2F2 siRNA, and its downregulation inhibiting migration and invasion of CRC cells. Moreover, we found NR2F2 could transcriptional activated miR-21 expression by binding to miR-21 promoter in HT29 by ChIP and luciferase assay. In the last, our data demonstrated that Smad7 was the direct target of miR-21 in CRC cells. Thus, NR2F2 could promote TGF-β-induced EMT and inhibit Smad7 expression via transactivation of miR-21, and NR2F2 may be a new common therapeutic target for CRC. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Okamoto, Michio [Department of Orthopaedic Surgery, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Hiroyuki, E-mail: tanahiro-osk@umin.ac.jp [Department of Orthopaedic Surgery, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Okada, Kiyoshi [Department of Orthopaedic Surgery, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Kuroda, Yusuke [Department of Orthopaedic Surgery, Kansai Rosai Hospital, 3-1-69 Inabaso, Amagasaki, Hyogo 660-8511 (Japan); Nishimoto, Shunsuke; Murase, Tsuyoshi; Yoshikawa, Hideki [Department of Orthopaedic Surgery, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-01-17
Highlights: •Methylcobalamin activated the Erk1/2 signaling pathway in C2C12 cells. •Methylcobalamin promoted the proliferation and migration in C2C12 cells. •C2C12 cell apoptosis during differentiation was inhibited by methylcobalamin. -- Abstract: Methylcobalamin (MeCbl) is a vitamin B12 analog that has some positive effects on peripheral nervous disorders. Although some previous studies revealed the effects of MeCbl on neurons, its effect on the muscle, which is the final target of motoneuron axons, remains to be elucidated. This study aimed to determine the effect of MeCbl on the muscle. We found that MeCbl promoted the proliferation and migration of C2C12 myoblasts in vitro and that these effects are mediated by the Erk1/2 signaling pathway without affecting the activity of the Akt signaling pathway. We also demonstrated that MeCbl inhibits C2C12 cell apoptosis during differentiation. Our results suggest that MeCbl has beneficial effects on the muscle in vitro. MeCbl administration may provide a novel therapeutic approach for muscle injury or degenerating muscle after denervation.
Yan, Meiping; Zhang, Xinhua; Chen, Ao; Gu, Wei; Liu, Jie; Ren, Xiaojiao; Zhang, Jianping; Wu, Xiaoxiong; Place, Aaron T; Minshall, Richard D; Liu, Guoquan
2017-11-01
Intercellular adhesion molecule-1 (ICAM-1) mediates the firm adhesion of leukocytes to endothelial cells and initiates subsequent signaling that promotes their transendothelial migration (TEM). Vascular endothelial (VE)-cadherin plays a critical role in endothelial cell-cell adhesion, thereby controlling endothelial permeability and leukocyte transmigration. This study aimed to determine the molecular signaling events that originate from the ICAM-1-mediated firm adhesion of neutrophils that regulate VE-cadherin's role as a negative regulator of leukocyte transmigration. We observed that ICAM-1 interacts with Src homology domain 2-containing phosphatase-2 (SHP-2), and SHP-2 down-regulation via silencing of small interfering RNA in endothelial cells enhanced neutrophil adhesion to endothelial cells but inhibited neutrophil transmigration. We also found that VE-cadherin associated with the ICAM-1-SHP-2 complex. Moreover, whereas the activation of ICAM-1 leads to VE-cadherin dissociation from ICAM-1 and VE-cadherin association with actin, SHP-2 down-regulation prevented ICAM-1-VE-cadherin association and promoted VE-cadherin-actin association. Furthermore, SHP-2 down-regulation in vivo promoted LPS-induced neutrophil recruitment in mouse lung but delayed neutrophil extravasation. These results suggest that SHP-2- via association with ICAM-1-mediates ICAM-1-induced Src activation and modulates VE-cadherin switching association with ICAM-1 or actin, thereby negatively regulating neutrophil adhesion to endothelial cells and enhancing their TEM.-Yan, M., Zhang, X., Chen, A., Gu, W., Liu, J., Ren, X., Zhang, J., Wu, X., Place, A. T., Minshall, R. D., Liu, G. Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction. © FASEB.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Shuang; Shang, Wenting; Yang, Xiaoxi; Zhang, Shujuan; Zhang, Xiaogang; Chen, Jiawei [Renmin Univ. of China, Beijing (China)
2013-09-15
The immobilization of enzyme is one of the key issues both in the field of enzymatic research and industrialization. In this work, we reported a facile method to immobilize Candida Antarctica lipase B (CALB) in alginate carrier. In the presence of calcium cation, the enzyme-alginate suspension could be cross-linked to form beads with porous structure at room temperature, and the enzyme CALB was dispersed in the beads. Activity of the enzyme-alginate composite was verified by enzymatic hydrolysis reaction of p-nitrophenol butyrate in aqueous phase. The effects of reaction parameters such as temperature, pH, embedding and lyophilized time on the reactive behavior were discussed. Reuse cycle experiments for the hydrolysis of p-nitrophenol butyrate demonstrated that activity of the enzyme-alginate composite was maintained without marked deactivation up to 6 repeated cycles.
Mariana Provedel Martins
2012-01-01
Neste trabalho foram realizadas as resoluções cinéticas das haloidrinas racêmicas (RS)-1-benziloxi-3-cloropropan-2-ol (4a), (RS)-1-benziloxi-3-bromopropan-2-ol (4b), (RS)-1-cloro-3-(4-metoxifenoxi)propan-2-ol (5a), (RS)-1-bromo-3-(4-metoxifenoxi)propan-2-ol (5b), (RS)-1-aliloxi-3-cloro-propan-2-ol (6a) e (RS)-1-aliloxi-3-bromo-propan-2-ol (6b) empregando-se a lipase comercial de Candida antarctica CALB como catalisador e acetato de vinila como agente acilante. As razões enantioméricas das res...
International Nuclear Information System (INIS)
Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya
2006-01-01
The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2
Li, Xue-Dong; Song, Qing-Wen; Lang, Xian-Dong; Chang, Yao; He, Liang-Nian
2017-11-17
Chemical valorization of CO 2 to access various value-added compounds has been a long-term and challenging objective from the viewpoint of sustainable chemistry. Herein, a one-pot three-component reaction of terminal propargyl alcohols, CO 2 , and 2-aminoethanols was developed for the synthesis of 2-oxazolidinones and an equal amount of α-hydroxyl ketones promoted by Ag 2 O/TMG (1,1,3,3-tetramethylguanidine) with a TON (turnover number) of up to 1260. By addition of terminal propargyl alcohol, the thermodynamic disadvantage of the conventional 2-aminoethanol/CO 2 coupling was ameliorated. Mechanistic investigations including control experiments, DFT calculation, kinetic and NMR studies suggest that the reaction proceeds through a cascade pathway and TMG could activate propargyl alcohol and 2-aminoethanol through the formation of hydrogen bonds and also activate CO 2 . © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Surfactant-promoted reactions of Cl2 and Br2 with Br- in glycerol.
Faust, Jennifer A; Dempsey, Logan P; Nathanson, Gilbert M
2013-10-17
Gas-liquid scattering experiments are used to explore reactions of gaseous Cl2 and Br2 with a 0.03 M solution of the surfactant tetrahexylammonium bromide (THABr) dissolved in glycerol. At thermal collision energies, 79 ± 2% of incident Cl2 molecules react with Br(-) to form Cl2Br(-) in the interfacial region. This reaction probability is three times greater than the reactivity of Cl2 with 3 M NaBr-glycerol, even though the interfacial Br(-) concentrations are similar in each solution. We attribute the high 79% uptake to the presence of surface THA(+) ions that stabilize the Cl2Br(-) intermediate as it is formed in the charged, hydrophobic pocket created by the hexyl chains. Cl2Br(-) generates the single exchange product BrCl in a 1% yield close to the surface, while the remaining 99% desorbs as the double exchange product Br2 over >0.1 s after diffusing deeply into the bulk. When NaCl is added to the surfactant solution in a 20:1 Cl(-)/Br(-) ratio, the Cl2 reaction probability drops from 79% to 46 ± 1%, indicating that Cl(-) in the interfacial region only partially blocks reaction with Br(-). In parallel, we observe that gaseous Br2 molecules dissolve in 0.03 M THABr for 10(4) times longer than in 3 M NaBr. We attribute this change to formation of stabilizing interfacial and bulk-phase THA(+)Br3(-) ion pairs, in analogy with the capture of Cl2 and formation of THA(+)Cl2Br(-) pairs. The THA(+) ion appears to be a powerful interfacial catalyst for promoting reaction of Cl2 and Br2 with Br(-) and for ferrying the resultant ions into solution.
Directory of Open Access Journals (Sweden)
RODRIGO GONZÁLEZ
2007-01-01
Full Text Available Diabetic nephropathy (DN is one of the major complications of type 2 diabetes and is associated with coronary disease. Nephrin, a protein mainly expressed in glomeruli, is decreased in DN and other kidney diseases. Since insulin levels are misregulated in type 2 diabetes, a possible connection between DN and its decreased nephrin expression could be the presence of regulatory elements responsive to insulin in the nephrin gene (NPHS1 promoter region. In this work, using bioinformatic tools, we identified a purine-rich GAGA element in the nephrin gene promoter and conducted a genomic study in search of the presence of polymorphisms in this element and its possible association with DN in type 2 diabetic patients. We amplified and sequenced a 514 bp promoter region of 100 individuals and found no genetic variants in the purine-rich GAGA-box of the nephrin gene promoter between groups of patients with diabetes type 2 with and without renal and coronary complications, control patients without diabetes and healthy controls
Goethite promoted biodegradation of 2,4-dinitrophenol under nitrate reduction condition.
Tang, Ting; Yue, Zhengbo; Wang, Jin; Chen, Tianhu; Qing, Chengsong
2018-02-05
Iron oxide may interact with other pollutants in the aquatic environments and further influence their toxicity, transport and fate. The current study was conducted to investigate the biodegradation of 2,4-dinitrophenol (2,4-DNP) in the presence of iron oxide of goethite under anoxic condition using nitrate as the electron acceptor. Experiment results showed that the degradation rate of 2,4-DNP was improved by goethite. High performance liquid chromatography-mass spectra analysis results showed that goethite promoted degradation and transformation of 2,4-diaminophenol and 2-amino-4-nitrophenol (2-nitro-4-aminophenol). Microbial community analysis results showed that the abundance of Actinobacteria, which have the potential ability to degrade PAHs, was increased when goethite was available. This might partially explain the higher degradation of 2,4-DNP. Furthermore, another bacterium of Desulfotomaculum reducens which could reduce soluble Fe(III) and nitrate was also increased. Results further confirmed that nanomaterials in the aquatic environment will influence the microbial community and further change the transformation process of toxic pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.
PKCα promotes generation of reactive oxygen species via DUOX2 in hepatocellular carcinoma
International Nuclear Information System (INIS)
Wang, Jiajun; Shao, Miaomiao; Liu, Min; Peng, Peike; Li, Lili; Wu, Weicheng; Wang, Lan; Duan, Fangfang; Zhang, Mingming; Song, Shushu; Jia, Dongwei; Ruan, Yuanyuan; Gu, Jianxin
2015-01-01
Hepatocellular carcinoma (HCC) remains the second leading cause of cancer-related death worldwide, and elevated rates of reactive oxygen species (ROS) have long been considered as a hallmark of almost all types of cancer including HCC. Protein kinase C alpha (PKCα), a serine/threonine kinase among conventional PKC family, is recognized as a major player in signal transduction and tumor progression. Overexpression of PKCα is commonly observed in human HCC and associated with its poor prognosis. However, how PKCα is involved in hepatocellular carcinogenesis remains not fully understood. In this study, we found that among the members of conventional PKC family, PKCα, but not PKCβI or βII, promoted ROS production in HCC cells. PKCα stimulated generation of ROS by up-regulating DUOX2 at post-transcriptional level. Depletion of DUOX2 abrogated PKCα-induced activation of AKT/MAPK pathways as well as cell proliferation, migration and invasion in HCC cells. Moreover, the expression of DUOX2 and PKCα was well positively correlated in both HCC cell lines and patient samples. Collectively, our findings demonstrate that PKCα plays a critical role in HCC development by inducing DUOX2 expression and ROS generation, and propose a strategy to target PKCα/DUOX2 as a potential adjuvant therapy for HCC treatment. - Highlights: • PKCα promotes the generation of ROS in hepatocellular carcinoma. • PKCα induces ROS production by up-regulating DUOX2 at post-transcriptional level. • DUOX2 is required for PKCα-induced AKT/MAPK activation and tumor progression in HCC. • The expression of PKCα is positively correlated with DUOX2 in HCC
PKCα promotes generation of reactive oxygen species via DUOX2 in hepatocellular carcinoma
Energy Technology Data Exchange (ETDEWEB)
Wang, Jiajun; Shao, Miaomiao; Liu, Min; Peng, Peike; Li, Lili; Wu, Weicheng; Wang, Lan [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Duan, Fangfang [Institute of Biomedical Science, Fudan University, Shanghai (China); Zhang, Mingming; Song, Shushu [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Jia, Dongwei, E-mail: jiadongwei@fudan.edu.cn [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Ruan, Yuanyuan, E-mail: yuanyuanruan@fudan.edu.cn [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Gu, Jianxin [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Institute of Biomedical Science, Fudan University, Shanghai (China)
2015-08-07
Hepatocellular carcinoma (HCC) remains the second leading cause of cancer-related death worldwide, and elevated rates of reactive oxygen species (ROS) have long been considered as a hallmark of almost all types of cancer including HCC. Protein kinase C alpha (PKCα), a serine/threonine kinase among conventional PKC family, is recognized as a major player in signal transduction and tumor progression. Overexpression of PKCα is commonly observed in human HCC and associated with its poor prognosis. However, how PKCα is involved in hepatocellular carcinogenesis remains not fully understood. In this study, we found that among the members of conventional PKC family, PKCα, but not PKCβI or βII, promoted ROS production in HCC cells. PKCα stimulated generation of ROS by up-regulating DUOX2 at post-transcriptional level. Depletion of DUOX2 abrogated PKCα-induced activation of AKT/MAPK pathways as well as cell proliferation, migration and invasion in HCC cells. Moreover, the expression of DUOX2 and PKCα was well positively correlated in both HCC cell lines and patient samples. Collectively, our findings demonstrate that PKCα plays a critical role in HCC development by inducing DUOX2 expression and ROS generation, and propose a strategy to target PKCα/DUOX2 as a potential adjuvant therapy for HCC treatment. - Highlights: • PKCα promotes the generation of ROS in hepatocellular carcinoma. • PKCα induces ROS production by up-regulating DUOX2 at post-transcriptional level. • DUOX2 is required for PKCα-induced AKT/MAPK activation and tumor progression in HCC. • The expression of PKCα is positively correlated with DUOX2 in HCC.
Enzymatic catalysts, such as lipases, have advantages over chemical catalysts for transesterification of triglycerides to produce biodiesel. A gene encoding a synthetic truncated Candida antarctica lipase B (CALB) was generated via automated PCR and expressed in Saccharomyces cerevisiae. Western b...
A Menagerie of Promotional Characters: Promoting Food to Children through Food Packaging
Hebden, Lana; King, Lesley; Kelly, Bridget; Chapman, Kathy; Innes-Hughes, Christine
2011-01-01
Objective: To determine the extent to which (1) promotional characters are used on food packaging for healthful and less-healthful food and (2) different companies use this persuasive marketing strategy. Design: Cross-sectional supermarket audit of all food and beverages featuring promotional characters on the packaging. Setting: Three Australian…
Yin, Fengqiong; Xu, Zhenhua; Wang, Zifeng; Yao, Hong; Shen, Zan; Yu, Fang; Tang, Yiping; Fu, Dengli; Lin, Sheng; Lu, Gang; Kung, Hsiang-Fu; Poon, Wai Sang; Huang, Yunchao; Lin, Marie Chia-Mi
2012-12-14
Chemokine CC-motif receptor-like 2 (CCRL2) is a 7-transmembrane G protein-coupled receptor which plays a key role in lung dendritic cell trafficking to peripheral lymph nodes. The function and expression of CCRL2 in cancer is not understood at present. Here we report that CCRL2 expression level is elevated in human glioma patient samples and cell lines. The magnitude of increase is positively associated with increasing tumor grade, with the highest level observed in grade IV glioblastoma. By gain-of-function and loss-of-function studies, we further showed that CCRL2 did not regulate the growth of human glioblatoma U87 and U373 cells. Importantly, we demonstrated that over-expression of CCRL2 significantly enhanced the migration rate and invasiveness of the glioblastoma cells. Taken together, these results suggest for the first time that elevated CCRL2 in glioma promotes cell migration and invasion. The potential roles of CCRL2 as a novel therapeutic target and biomarker warrant further investigations. Copyright © 2012 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Walspurger, S.; Boels, L.; Cobden, P.D.; Elzinga, G.D.; Haije, W.G.; Van den Brink, R.W. [Energy Research Centre of the Netherlands ECN, Westerduinweg 3, 1755LE, Petten (Netherlands)
2008-09-15
CO2-free hydrogen can be produced from coal gasification power plants by pre-combustion decarbonisation and carbon dioxide capture. Potassium carbonate promoted hydrotalcite-based and alumina-based materials are cheap and excellent materials for high-temperature (300-500C) adsorption of CO2, and particularly promising in the sorption-enhanced water gas shift (SEWGS) reaction. Alkaline promotion significantly improves CO2 reversible sorption capacity at 300-500C for both materials. Hydrotalcites and promoted hydrotalcites, promoted magnesium oxide and promoted -alumina were investigated by in situ analytical methods (IR spectroscopy, sorption experiments, X-ray diffraction) to identify structural and surface rearrangements. All experimental results show that potassium ions actually strongly interact with aluminium oxide centres in the aluminium-containing materials. This study unambiguously shows that potassium promotion of aluminium oxide centres in hydrotalcite generates basic sites which reversibly adsorb CO2 at 400C.
Vitamin K2 promotes mesenchymal stem cell differentiation by inhibiting miR‑133a expression.
Zhang, Yuelei; Weng, Shiyang; Yin, Junhui; Ding, Hao; Zhang, Changqing; Gao, Youshui
2017-05-01
Vitamin K2 has been demonstrated to promote the osteogenic differentiation of mesenchymal stem cells; however, the mechanisms underlying this effect remain unclear. As microRNA (miR)‑133a has been identified as a negative regulator of osteogenic differentiation, the present study hypothesized that vitamin K2 promoted osteogenesis by inhibiting miR‑133a. Using human bone marrow stromal cells (hBMSCs) overexpressing miR‑133a, or a control, the expression levels of osteogenesis‑associated proteins, including runt‑related transcription factor 2, alkaline phosphatase and osteocalcin, were analyzed. miR‑133a significantly suppressed the osteogenic differentiation of hBMSCs. To determine the effect of vitamin K2 on miR‑133a expression and osteogenesis, hBMSCs were treated with vitamin K2. Vitamin K2 inhibited miR‑133a expression, which was accompanied by enhanced osteogenic differentiation. Furthermore, the expression levels of vitamin K epoxide reductase complex subunit 1, the key protein in γ‑carboxylation, were downregulated by miR‑133a overexpression and upregulated by vitamin K2 treatment, indicating a positive feedback on γ‑carboxylation. The results of the present study suggested that vitamin K2 targets miR‑133a to regulate osteogenesis.
Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D
2000-01-01
Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift
Cai, Wei; Jiang, Haitao; Yu, Yifan; Xu, Yong; Zuo, Wenshan; Wang, Shouguo; Su, Zhen
2017-11-01
Recently, miR-367 is reported to exert either oncogenic or tumor suppressive effects in human malignancies. Recent study reports that miR-367 is up-regulated in OS tissues and cell lines, and abrogates adriamycin-induced apoptosis. The clinical significance of miR-367 and its function in OS need further investigation. In our study, miR-367 expression in OS was markedly elevated compared with corresponding non-tumor tissues. High miR-367 expression was associated with malignant clinical features and poor prognosis of OS patients. In accordance, the levels of miR-367 were dramatically up-regulated in OS cells. Loss of miR-367 expression in Saos-2 cells obviously inhibited the proliferation, migration and invasion of cancer cells in vitro. Meanwhile, miR-367 restoration promoted these malignant behaviors of MG-63 cells. Mechanistically, miR-367 negatively regulated DOC-2/DAB2 interactive protein (DAB2IP) abundance in OS cells. Hereby, DAB2IP was recognized as a direct target gene of miR-367 in OS. DAB2IP mRNA level was down-regulated and inversely correlated with miR-367 expression in OS specimens. DAB2IP overexpression prohibited proliferation, migration and invasion in Saos-2 cells, while DAB2IP knockdown showed promoting effects on proliferation, migration and invasion of MG-63 cells. Furthermore, the role of miR-367 might be mediated by DAB2IP-regulated phosphorylation of ERK and AKT in OS cells. To conclude, miR-367 may function as a biomarker for prediction of prognosis and a target for OS therapy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Yuan, Xiao-Hua; Fan, Yang-Yang; Yang, Chun-Rong; Gao, Xiao-Rui; Zhang, Li-Li; Hu, Ying; Wang, Ya-Qin; Jun, Hu
2016-01-01
The role of progesterone on the cardiovascular system is controversial. Our present research is to specify the effect of progesterone on arterial endothelial cells in response to oxidative stress. Our result showed that H2O2 (150 μM and 300 μM) induced cellular antioxidant response. Glutathione (GSH) production and the activity of Glutathione peroxidase (GPx) were increased in H2O2-treated group. The expression of glutamate cysteine ligase catalytic subunit (GCLC) and modifier subunit (GCLM) was induced in response to H2O2. However, progesterone absolutely abolished the antioxidant response through increasing ROS level, inhibiting the activity of Glutathione peroxidase (GPx), decreasing GSH level and reducing expression of GClC and GCLM. In our study, H2O2 induced nitrogen monoxide (NO) production and endothelial nitric oxide synthase (eNOS) expression, and progesterone promoted H2O2-induced NO production. Progesterone increased H2O2-induced expression of hypoxia inducible factor-α (HIFα) which in turn regulated eNOS expression and NO synthesis. Further study demonstrated that progesterone increased H2O2 concentration of culture medium which may contribute to NO synthesis. Exogenous GSH decreased the content of H2O2 of culture medium pretreated by progesterone combined with H2O2 or progesterone alone. GSH also inhibited expression of HIFα and eNOS, and abolished NO synthesis. Collectively, our study demonstrated for the first time that progesterone inhibited cellular antioxidant effect and increased oxidative stress, promoted NO production of arterial endothelial cells, which may be due to the increasing H2O2 concentration and amplified oxidative stress signal. Copyright © 2015. Published by Elsevier Ltd.
Energy Technology Data Exchange (ETDEWEB)
Tahir, Muhammad, E-mail: mtahir@cheme.utm.my [Chemical Reaction Engineering Group (CREG), Faculty of Chemical and Energy Engineering, Universiti Teknologi Malaysia, 81310, UTM, Johor Bahru, Johor (Malaysia); Department of Chemical Engineering, COMSATS Institute of Information Technology, Lahore, Punjab (Pakistan); Tahir, Beenish; Saidina Amin, Nor Aishah; Alias, Hajar [Chemical Reaction Engineering Group (CREG), Faculty of Chemical and Energy Engineering, Universiti Teknologi Malaysia, 81310, UTM, Johor Bahru, Johor (Malaysia)
2016-12-15
Highlights: • Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} nanocatalysts tested for CO{sub 2} photoreduction with H{sub 2}O/H{sub 2}. • Production of CH{sub 4} and CH{sub 3}OH depends on reductants type and metal-loading to TiO{sub 2}. • CH{sub 4} production over Cu-In/TiO{sub 2} was 1.5 fold more than In/TiO{sub 2} and 5 times the TiO{sub 2}. • The Cu-promoted CH{sub 3}OH production while In gave more CH{sub 4} with water vapors. • The H{sub 2} reductant gave negative effect for CH{sub 4} but enhanced CH{sub 3}OH production. - Abstract: Photocatalytic CO{sub 2} reduction by H{sub 2}O and/or H{sub 2} reductant to selective fuels over Cu-promoted In{sub 2}O{sub 3}/TiO{sub 2} photocatalyst has been investigated. The samples, prepared via a simple and direct sol-gel method, were characterized by XRD, SEM, TEM, XPS, N{sub 2} adsorption-desorption, UV–vis diffuse reflectance, Raman and PL spectroscopy. Cu and In loaded into TiO{sub 2}, oxidized as Cu{sup 2+} and In{sup 3+}, promoted efficient separation of photo-generated electron/hole pairs (e{sup −}/h{sup +}). The results indicate that the reduction rate of CO{sub 2} by H{sub 2}O to CH{sub 4} approached to 181 μmol g{sup −1} h{sup −1} using 0.5% Cu-3% In{sub 2}O{sub 3}/TiO{sub 2} catalyst, a 1.53 fold higher than the production rate over the 3% In{sub 2}O{sub 3}/TiO{sub 2} and 5 times the amount produced over the pure TiO{sub 2}. In addition, Cu was found to promote efficient production of CH{sub 3}OH and yield rate reached to 68 μmol g{sup −1} h{sup −1} over 1% Cu-3% In{sub 2}O{sub 3}/TiO{sub 2} catalyst. This improvement was attributed to charge transfer property and suppressed recombination rate by Cu-metal. More importantly, H{sub 2} reductant was less favorable for CH{sub 4} production, yet a significant amount of CH{sub 4} and CH{sub 3}OH were obtained using a mixture of H{sub 2}O/H{sub 2} reductant. Therefore, Cu-loaded In{sub 2}O{sub 3}/TiO{sub 2} catalyst has shown to be capable for
Inflammation induced mTORC2-Akt-mTORC1 signaling promotes macrophage foam cell formation.
Banerjee, Dipanjan; Sinha, Archana; Saikia, Sudeshna; Gogoi, Bhaskarjyoti; Rathore, Arvind K; Das, Anindhya Sundar; Pal, Durba; Buragohain, Alak K; Dasgupta, Suman
2018-06-05
The transformation of macrophages into lipid loaded foam cells is a critical and early event in the pathogenesis of atherosclerosis. Several recent reports highlighted that induction of TLR4 signaling promotes macrophage foam cell formation; however, the underlying molecular mechanisms have not been clearly elucidated. Here, we found that the TLR4 mediated inflammatory signaling communicated with mTORC2-Akt-mTORC1 metabolic cascade in macrophage and thereby promoting lipid uptake and foam cell formation. Mechanistically, LPS treatment markedly upregulates TLR4 mediated inflammatory pathway which by activating mTORC2 induces Akt phosphorylation at serine 473 and that aggravate mTORC1 dependent scavenger receptors expression and consequent lipid accumulation in THP-1 macrophages. Inhibition of mTORC2 either by silencing Rictor expression or inhibiting its association with mTOR notably prevents LPS induced Akt activation, scavenger receptors expression and macrophage lipid accumulation. Although suppression of mTORC1 expression by genetic knockdown of Raptor did not produce any significant change in Akt S473 phosphorylation, however, incubation with Akt activator in Rictor silenced cells failed to promote scavenger receptors expression and macrophage foam cell formation. Thus, present research explored the signaling pathway involved in inflammation induced macrophage foam cells formation and therefore, targeting this pathway might be useful for preventing macrophage foam cell formation. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
TRF2 recruits RTEL1 to telomeres in S phase to promote t-loop unwinding.
Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John H J; Boulton, Simon J
2015-02-19
The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to prevent catastrophic t-loop processing by structure-specific nucleases. We show that the TRF2-RTEL1 interaction is mediated by a metal-coordinating C4C4 motif in RTEL1, which is compromised by the Hoyeraal-Hreidarsson syndrome (HHS) mutation, RTEL1(R1264H). Conversely, we define a TRF2(I124D) substitution mutation within the TRFH domain of TRF2, which eliminates RTEL1 binding and phenocopies the RTEL1(R1264H) mutation, giving rise to aberrant t-loop excision, telomere length heterogeneity, and loss of the telomere as a circle. These results implicate TRF2 in the recruitment of RTEL1 to facilitate t-loop disassembly at telomeres in S phase. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
MicroRNA-181b promotes ovarian cancer cell growth and invasion by targeting LATS2
Energy Technology Data Exchange (ETDEWEB)
Xia, Ying; Gao, Yan, E-mail: gaoyanhdhos@126.com
2014-05-09
Highlights: • miR-181b is upregulated in human ovarian cancer tissues. • miR-181b promotes ovarian cancer cell proliferation and invasion. • LATS2 is a direct target of miR-181b. • LATS2 is involved in miR-181b-induced ovarian cancer cell growth and invasion. - Abstract: MicroRNAs (miRNAs) are strongly implicated in tumorigenesis and metastasis. In this study, we showed significant upregulation of miR-181b in ovarian cancer tissues, compared with the normal ovarian counterparts. Forced expression of miR-181b led to remarkably enhanced proliferation and invasion of ovarian cancer cells while its knockdown induced significant suppression of these cellular events. The tumor suppressor gene, LATS2 (large tumor suppressor 2), was further identified as a novel direct target of miR-181b. Specifically, miR-181b bound directly to the 3′-untranslated region (UTR) of LATS2 and suppressed its expression. Restoration of LATS2 expression partially reversed the oncogenic effects of miR-181b. Our results indicate that miR-181b promotes proliferation and invasion by targeting LATS2 in ovarian cancer cells. These findings support the utility of miR-181b as a potential diagnostic and therapeutic target for ovarian cancer.
Jha, Chaitanya Kumar; Patel, Baldev; Saraf, Meenu
2012-03-01
A novel Enterobacter cancerogenus MSA2 is a plant growth promoting gamma-proteobacterium that was isolated from the rhizosphere of Jatropha cucas a potentially important biofuel feed stock plant. Based on phenotypic, physiological, biochemical and phylogenetic studies, strain MSA2 could be classified as a member of E. cancerogenus. However, comparisons of characteristics with other known species of the genus Enterobacter suggested that strain MSA2 could be a novel PGPB strain. In vitro studies were carried for the plant growth promoting attribute of this culture. It tested positive for ACC (1-aminocyclopropane-1-carboxylic acid) deaminase production, phytase, phosphate solubilization, IAA (Indole acetic acid) production, siderophore, and ammonia production. The isolate was then used as a inoculant for the vegetative study of Jatropha curcas plant. Enterobacter cancerogenus MSA2 supplemented with 1% carboxymethylcellulose showed overall plant growth promotion effect resulting in enhanced root length (124.14%), fresh root mass (81%), fresh shoot mass (120.02%), dry root mass (124%), dry shoot mass (105.54%), number of leaf (30.72%), chlorophyll content (50.41%), and biomass (87.20%) over control under the days of experimental observation. This study was designed for 120 days and was in triplicate and the data was collected at every 30 days.
Coxsackievirus B3 2A protease promotes encephalomyocarditis virus replication.
Song, Qin-Qin; Lu, Ming-Zhi; Song, Juan; Chi, Miao-Miao; Sheng, Lin-Jun; Yu, Jie; Luo, Xiao-Nuan; Zhang, Lu; Yao, Hai-Lan; Han, Jun
2015-10-02
To determine whether 2A protease of the enterovirus genus with type I internal ribosome entry site (IRES) effect on the viral replication of type II IRES, coxsackievirus B3(CVB3)-encoded protease 2A and encephalomyocarditis virus (EMCV) IRES (Type II)-dependent or cap-dependent report gene were transiently co-expressed in eukaryotic cells. We found that CVB3 2A protease not only inhibited translation of cap-dependent reporter genes through the cleavage of eIF4GI, but also conferred high EMCV IRES-dependent translation ability and promoted EMCV replication. Moreover, deletions of short motif (aa13-18 RVVNRH, aa65-70 KNKHYP, or aa88-93 PRRYQSH) resembling the nuclear localization signals (NLS) or COOH-terminal acidic amino acid motif (aa133-147 DIRDLLWLEDDAMEQ) of CVB3 2A protease decreased both its EMCV IRES-dependent translation efficiency and destroy its cleavage on eukaryotic initiation factor 4G (eIF4G) I. Our results may provide better understanding into more effective interventions and treatments for co-infection of viral diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Zhang Hua
2006-08-01
Full Text Available Abstract The detailed methylation status of CpG sites in the promoter region of hMSH2 gene has yet not to be reported. We have mapped the complete methylation status of the hMSH2 promoter, a region that contains 75 CpG sites, using bisulfite genomic sequencing in 60 primary colorectal cancers. And the expression of hMSH2 was detected by immunohistochemistry. The hypermethylation of hMSH2 was detected in 18.33% (11/60 of tumor tissues. The protein of hMSH2 was detected in 41.67% (25/60 of tumor tissues. No hypermethylation of hMSH2 was detected in normal tissues. The protein of hMSH2 was detected in all normal tissues. Our study demonstrated that hMSH2 hypermethylation and protein expression were associated with the development of colorectal cancer.
Bm-TFF2, a toad trefoil factor, promotes cell migration, survival and wound healing
International Nuclear Information System (INIS)
Zhang, Yong; Yu, Guoyu; Xiang, Yang; Wu, Jianbo; Jiang, Ping; Lee, Wenhui; Zhang, Yun
2010-01-01
Research highlights: → Bm-TFF2 binds to epithelial cells and induces cell migration and wound healing. → Bm-TFF2 suppresses cell apoptosis. → Bm-TFF2 has no effect on cell proliferation. -- Abstract: Toad skin is naked and continually confronted by various injurious factors. Constant skin renewal and repairs occur frequently. However, the mechanisms of the renewal and repair have not clearly elucidated. In our previous work, a trefoil factor (TFF), Bm-TFF2, has been purified from the Bombina maxima skin and characterized as a platelet agonist. The mRNA of TFFs in toad skin was up-regulated greatly during the metamorphosis, indicating a pivotal role of TFFs in amphibian skin. Here, we presented the effects of Bm-TFF2 on the cell migration, apoptosis and proliferation. Bm-TFF2 bound to epithelial cells and showed strong cell motility activity. At the concentrations of 1-100 nM, Bm-TFF2-induced migration of human epithelial AGS and HT-29 cells, and rat intestinal epithelial IEC-6 cell lines. The in vitro wound healing assay also verified the activity of Bm-TFF2. Bm-TFF2 could also inhibit cell apoptosis induced by ceramide and sodium butyrate. The cell migration-promoting activity was abolished by MEK1 inhibitors, U0126 and PD98059, suggesting that ERK1/2 activation is crucial for Bm-TFF2 to stimulate cell migration. Taken together, Bm-TFF2 promoted wound healing by stimulating cell migration via MAPK pathway and preventing cell apoptosis. The potent biological activity of Bm-TFF2 makes it a useful molecular tool for further studies of structure-function relationship of the related human TFFs.
Bm-TFF2, a toad trefoil factor, promotes cell migration, survival and wound healing
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yong [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Yu, Guoyu [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Department of Biochemistry, Kunming Medical College, Kunming, Yunnan 650032 (China); Xiang, Yang [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Wu, Jianbo [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Jiang, Ping [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Lee, Wenhui [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Zhang, Yun, E-mail: zhangy@mail.kiz.ac.cn [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China)
2010-07-30
Research highlights: {yields} Bm-TFF2 binds to epithelial cells and induces cell migration and wound healing. {yields} Bm-TFF2 suppresses cell apoptosis. {yields} Bm-TFF2 has no effect on cell proliferation. -- Abstract: Toad skin is naked and continually confronted by various injurious factors. Constant skin renewal and repairs occur frequently. However, the mechanisms of the renewal and repair have not clearly elucidated. In our previous work, a trefoil factor (TFF), Bm-TFF2, has been purified from the Bombina maxima skin and characterized as a platelet agonist. The mRNA of TFFs in toad skin was up-regulated greatly during the metamorphosis, indicating a pivotal role of TFFs in amphibian skin. Here, we presented the effects of Bm-TFF2 on the cell migration, apoptosis and proliferation. Bm-TFF2 bound to epithelial cells and showed strong cell motility activity. At the concentrations of 1-100 nM, Bm-TFF2-induced migration of human epithelial AGS and HT-29 cells, and rat intestinal epithelial IEC-6 cell lines. The in vitro wound healing assay also verified the activity of Bm-TFF2. Bm-TFF2 could also inhibit cell apoptosis induced by ceramide and sodium butyrate. The cell migration-promoting activity was abolished by MEK1 inhibitors, U0126 and PD98059, suggesting that ERK1/2 activation is crucial for Bm-TFF2 to stimulate cell migration. Taken together, Bm-TFF2 promoted wound healing by stimulating cell migration via MAPK pathway and preventing cell apoptosis. The potent biological activity of Bm-TFF2 makes it a useful molecular tool for further studies of structure-function relationship of the related human TFFs.
Li, Guoqiang; Feng, Ligang; Chang, Jinfa; Wickman, Björn; Grönbeck, Henrik; Liu, Changpeng; Xing, Wei
2014-12-01
Ethanol is an alternative fuel for direct alcohol fuel cells, in which the electrode materials are commonly based on Pt or Pd. Owing to the excellent promotion effect of Ni2 P that was found in methanol oxidation, we extended the catalyst system of Pt or Pd modified by Ni2 P in direct ethanol fuel cells. The Ni2 P-promoted catalysts were compared to commercial catalysts as well as to reference catalysts promoted with only Ni or only P. Among the studied catalysts, Pt/C and Pd/C modified by Ni2 P (30 wt %) showed both the highest activity and stability. Upon integration into the anode of a homemade direct ethanol fuel cell, the Pt-Ni2 P/C-30 % catalyst showed a maximum power density of 21 mW cm(-2) , which is approximately two times higher than that of a commercial Pt/C catalyst. The Pd-Ni2 P/C-30 % catalyst exhibited a maximum power density of 90 mW cm(-2) . This is approximately 1.5 times higher than that of a commercial Pd/C catalyst. The discharge stability on both two catalysts was also greatly improved over a 12 h discharge operation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dual reporter transgene driven by 2.3Col1a1 promoter is active in differentiated osteoblasts
Marijanovic, Inga; Jiang, Xi; Kronenberg, Mark S.; Stover, Mary Louise; Erceg, Ivana; Lichtler, Alexander C.; Rowe, David W.
2003-01-01
AIM: As quantitative and spatial analyses of promoter reporter constructs are not easily performed in intact bone, we designed a reporter gene specific to bone, which could be analyzed both visually and quantitatively by using chloramphenicol acetyltransferase (CAT) and a cyan version of green fluorescent protein (GFPcyan), driven by a 2.3-kb fragment of the rat collagen promoter (Col2.3). METHODS: The construct Col2.3CATiresGFPcyan was used for generating transgenic mice. Quantitative measurement of promoter activity was performed by CAT analysis of different tissues derived from transgenic animals; localization was performed by visualized GFP in frozen bone sections. To assess transgene expression during in vitro differentiation, marrow stromal cell and neonatal calvarial osteoblast cultures were analyzed for CAT and GFP activity. RESULTS: In mice, CAT activity was detected in the calvaria, long bone, teeth, and tendon, whereas histology showed that GFP expression was limited to osteoblasts and osteocytes. In cell culture, increased activity of CAT correlated with increased differentiation, and GFP activity was restricted to mineralized nodules. CONCLUSION: The concept of a dual reporter allows a simultaneous visual and quantitative analysis of transgene activity in bone.
Buttari, Brigitta; Profumo, Elisabetta; Domenici, Giacomo; Tagliani, Angela; Ippoliti, Flora; Bonini, Sergio; Businaro, Rita; Elenkov, Ilia; Riganò, Rachele
2014-07-01
Neuropeptide Y (NPY), a major autonomic nervous system and stress mediator, is emerging as an important regulator of inflammation, implicated in autoimmunity, asthma, atherosclerosis, and cancer. Yet the role of NPY in regulating phenotype and functions of dendritic cells (DCs), the professional antigen-presenting cells, remains undefined. Here we investigated whether NPY could induce DCs to migrate, mature, and polarize naive T lymphocytes. We found that NPY induced a dose-dependent migration of human monocyte-derived immature DCs through the engagement of NPY Y1 receptor and the activation of ERK and p38 mitogen-activated protein kinases. NPY promoted DC adhesion to endothelial cells and transendothelial migration. It failed to induce phenotypic DC maturation, whereas it conferred a T helper 2 (Th2) polarizing profile to DCs through the up-regulation of interleukin (IL)-6 and IL-10 production. Thus, during an immune/inflammatory response NPY may exert proinflammatory effects through the recruitment of immature DCs, but it may exert antiinflammatory effects by promoting a Th2 polarization. Locally, at inflammatory sites, cell recruitment could be amplified in conditions of intense acute, chronic, or cold stress. Thus, altered or amplified signaling through the NPY-NPY-Y1 receptor-DC axis may have implications for the development of inflammatory conditions.-Buttari, B., Profumo, E., Domenici, G., Tagliani, A., Ippoliti, F., Bonini, S., Businaro, R., Elenkov, I., Riganò, R. Neuropeptide Y induces potent migration of human immature dendritic cells and promotes a Th2 polarization. © FASEB.
Glycerol acyl-transfer kinetics of a circular permutated Candida antarctica Lipase B
Triacylglycerols containing a high abundance of unusual fatty acids, such as y-linolenic acid, or novel arylaliphatic acids, such as ferulic acid, are useful in pharmaceutical and cosmeceutical applications. Candida antarctica lipase B (CALB) is quite often used for non-aqueous synthesis, although ...
Dependency of water concentration on ethanolysis of trioleoylglycerol by lipases
DEFF Research Database (Denmark)
Piyatheerawong, W.; Iwasaki, Y; Xu, Xuebing
2004-01-01
tested (Rhizomucor miehei lipase, Burkholderia cepacia lipase and Thermomyces lanuginosus lipase) required larger amounts of free water (ca. 7-9 wt.%) for their best performance and exhibited no ethanolysis reaction at low free water concentrations. The CALB's anomalous behavior was also observed...
Molecular Modeling of Enzyme Dynamics Towards Understanding Solvent Effects
DEFF Research Database (Denmark)
Wedberg, Nils Hejle Rasmus Ingemar
This thesis describes the development of a molecular simulation methodology to study properties of enzymes in non-aqueous media at fixed thermodynamic water activities. The methodology is applied in a molecular dynamics study of the industrially important enzyme Candida antarctica lipase B (CALB...... of enzyme kinetics in non-aqueous media, it has been a fruitful approach to fix the enzyme hydration level by controlling the water activity of the medium. In this work, a protocol is therefore developed for determining the water activity in non-aqueous protein simulations. The method relies on determining...... integration, while for small systems, it seems to be even better. The method is applied to compute the excess Gibbs energy of the mixtures of water and organic solvents used in the simulations of CALB. This allows to determine the water activity of the simulated systems and thus to compare protein properties...
Directory of Open Access Journals (Sweden)
Rosenbaum Joel L
2011-01-01
Full Text Available Abstract Background Chlamydomonas reinhardtii is a model system for the biology of unicellular green algae. Chemically regulated promoters, such as the nickel-inducible CYC6 or the low CO2-inducible CAH1 promoter, may prove useful for expressing, at precise times during its cell cycle, proteins with relevant biological functions, or complementing mutants in genes encoding such proteins. To this date, this has not been reported for the above promoters. Results We fused the CYC6 and CAH1 promoters to an HA-tagged RSP3 gene, encoding a protein of the flagellar radial spoke complex. The constructs were used for chemically regulated complementation of the pf14 mutant, carrying an ochre mutation in the RSP3 gene. 7 to 8% of the transformants showed cells with restored motility after induction with nickel or transfer to low CO2 conditions, but not in non-inducing conditions. Maximum complementation (5% motile cells was reached with very different kinetics (5-6 hours for CAH1, 48 hours for CYC6. The two inducible promoters drive much lower levels of RSP3 protein expression than the constitutive PSAD promoter, which shows almost complete rescue of motility. Conclusions To our knowledge, this is the first example of the use of the CYC6 or CAH1 promoters to perform a chemically regulated complementation of a Chlamydomonas mutant. Based on our data, the CYC6 and CAH1 promoters should be capable of fully complementing mutants in genes whose products exert their biological activity at low concentrations.
DEFF Research Database (Denmark)
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice
2016-01-01
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...
Impaired PRC2 activity promotes transcriptional instability and favors breast tumorigenesis.
Wassef, Michel; Rodilla, Veronica; Teissandier, Aurélie; Zeitouni, Bruno; Gruel, Nadege; Sadacca, Benjamin; Irondelle, Marie; Charruel, Margaux; Ducos, Bertrand; Michaud, Audrey; Caron, Matthieu; Marangoni, Elisabetta; Chavrier, Philippe; Le Tourneau, Christophe; Kamal, Maud; Pasmant, Eric; Vidaud, Michel; Servant, Nicolas; Reyal, Fabien; Meseure, Dider; Vincent-Salomon, Anne; Fre, Silvia; Margueron, Raphaël
2015-12-15
Alterations of chromatin modifiers are frequent in cancer, but their functional consequences often remain unclear. Focusing on the Polycomb protein EZH2 that deposits the H3K27me3 (trimethylation of Lys27 of histone H3) mark, we showed that its high expression in solid tumors is a consequence, not a cause, of tumorigenesis. In mouse and human models, EZH2 is dispensable for prostate cancer development and restrains breast tumorigenesis. High EZH2 expression in tumors results from a tight coupling to proliferation to ensure H3K27me3 homeostasis. However, this process malfunctions in breast cancer. Low EZH2 expression relative to proliferation and mutations in Polycomb genes actually indicate poor prognosis and occur in metastases. We show that while altered EZH2 activity consistently modulates a subset of its target genes, it promotes a wider transcriptional instability. Importantly, transcriptional changes that are consequences of EZH2 loss are predominantly irreversible. Our study provides an unexpected understanding of EZH2's contribution to solid tumors with important therapeutic implications. © 2015 Wassef et al.; Published by Cold Spring Harbor Laboratory Press.
GTPase ROP2 binds and promotes activation of target of rapamycin, TOR, in response to auxin.
Schepetilnikov, Mikhail; Makarian, Joelle; Srour, Ola; Geldreich, Angèle; Yang, Zhenbiao; Chicher, Johana; Hammann, Philippe; Ryabova, Lyubov A
2017-04-03
Target of rapamycin (TOR) promotes reinitiation at upstream ORFs (uORFs) in genes that play important roles in stem cell regulation and organogenesis in plants. Here, we report that the small GTPase ROP2, if activated by the phytohormone auxin, promotes activation of TOR, and thus translation reinitiation of uORF-containing mRNAs. Plants with high levels of active ROP2, including those expressing constitutively active ROP2 (CA-ROP2), contain high levels of active TOR ROP2 physically interacts with and, when GTP-bound, activates TOR in vitro TOR activation in response to auxin is abolished in ROP-deficient rop2 rop6 ROP4 RNAi plants. GFP-TOR can associate with endosome-like structures in ROP2-overexpressing plants, indicating that endosomes mediate ROP2 effects on TOR activation. CA-ROP2 is efficient in loading uORF-containing mRNAs onto polysomes and stimulates translation in protoplasts, and both processes are sensitive to TOR inhibitor AZD-8055. TOR inactivation abolishes ROP2 regulation of translation reinitiation, but not its effects on cytoskeleton or intracellular trafficking. These findings imply a mode of translation control whereby, as an upstream effector of TOR, ROP2 coordinates TOR function in translation reinitiation pathways in response to auxin. © 2017 The Authors.
International Nuclear Information System (INIS)
Engdahl, Ryan; Monroy, M. Alexandra; Daly, John M.
2007-01-01
Prostaglandin metabolite 15-Deoxy-Δ 12,14 -prostaglandin J2 (15d-PGJ2) is known to inhibit a number of pro-inflammatory cytokines as well as being a ligand for nuclear receptor PPARγ. We investigated the ability of 15d-PGJ2 to inhibit TNF-α gene expression through mechanisms that involve histone modification. Pretreatment with 15d-PGJ2 (10 μM) inhibited LPS-stimulated TNF-α mRNA in THP-1 monocytes or PMA-differentiated cells to nearly basal levels. A specific PPARγ ligand, GW1929, failed to inhibit LPS-induced TNF-α mRNA expression nor did a PPARγ antagonist, GW9662, alter the repression of TNF-α mRNA in LPS-stimulated cells pretreated with 15d-PGJ2 suggesting a PPARγ-independent inhibition of TNF-α mRNA in THP-1 cells. Transfection studies with a reporter construct and subsequent treatment with 15d-PGJ2 demonstrated a dose-dependent inhibition of the TNF-α promoter. Additional studies demonstrated that inhibition of histone deacetylases with trichostatin A (TSA) or overexpression of histone acetyltransferase CBP could overcome 15d-PGJ2-mediated repression of the TNF-α promoter, suggesting that an important mechanism whereby 15d-PGJ2 suppresses a cytokine is through factors that regulate histone modifications. To examine the endogenous TNF-α promoter, chromatin immunoprecipitations (ChIP) were performed. ChIP assays demonstrated that LPS stimulation induced an increase in histone H3 and H4 acetylation at the TNF-α promoter, which was reduced in cells pretreated with 15d-PGJ2. These results highlight the ability of acetylation and deacetylation factors to affect the TNF-α promoter and demonstrate that an additional important mechanism whereby 15d-PGJ2 mediates TNF-α transcriptional repression by altering levels of acetylated histone H3 and H4 at its promoter
Swaminathan, Vinay; Fischer, R. S.; Waterman, Clare M.
2016-01-01
Cell migration is initiated in response to biochemical or physical cues in the environment that promote actin-mediated lamellipodial protrusion followed by the formation of nascent integrin adhesions (NAs) within the protrusion to drive leading edge advance. Although FAK is known to be required for cell migration through effects on focal adhesions, its role in NA formation and lamellipodial dynamics is unclear. Live-cell microscopy of FAK−/− cells with expression of phosphorylation deficient or a FERM-domain mutant deficient in Arp2/3 binding revealed a requirement for FAK in promoting the dense formation, transient stabilization, and timely turnover of NA within lamellipodia to couple actin-driven protrusion to adhesion and advance of the leading edge. Phosphorylation on Y397 of FAK promotes dense NA formation but is dispensable for transient NA stabilization and leading edge advance. In contrast, transient NA stabilization and advance of the cell edge requires FAK–Arp2/3 interaction, which promotes Arp2/3 localization to NA and reduces FAK activity. Haptosensing of extracellular matrix (ECM) concentration during migration requires the interaction between FAK and Arp2/3, whereas FAK phosphorylation modulates mechanosensing of ECM stiffness during spreading. Taken together, our results show that mechanistically separable functions of FAK in NA are required for cells to distinguish distinct properties of their environment during migration. PMID:26842895
Electrochemical promotion of sulfur dioxide catalytic oxidation
DEFF Research Database (Denmark)
Petrushina, Irina; Bandur, Viktor; Cappeln, Frederik Vilhelm
2000-01-01
investigation was to study a possible non-Faradaic electrochemical promotion of the liquid-phase catalytic reaction. It has been shown that there are two negative potential promotion areas with maximum effects at approximately -0.1 and -0.2 V, and one positive potential promotion area with the maximum effect...... between 0.1 and 0.3 V. There were no Faradaic reactions in the negative polarization region, and there was an anodic current which was less than 16% of the theoretical value for an exclusively Faradaic SO2 oxidation. Therefore the promotion effects at negative polarization are completely non-Faradaic. All...... the promotion effects have been explained as mainly due to charging of the electric double layer at the gold electrode. The effect at -0.2 V also depends on the V2O5 concentration and is more pronounced at higher V2O5 concentrations. This has been ascribed to a destruction of the vanadium polymeric chains...
Directory of Open Access Journals (Sweden)
Sazlina eShariff-Ghazali
2013-12-01
Full Text Available Introduction: Type 2 diabetes mellitus (T2DM among people aged 60 years and above is a growing public health problem. Regular physical activity is one of the key elements in the management of T2DM. Recommendations suggest that older people with T2DM will benefit from regular physical activity for better disease control and delaying complications. Despite the known benefits, many remain sedentary. Hence, this review assessed interventions for promoting physical activity in persons aged 65 years and older with type 2 diabetes mellitus. Methods: A literature search was conducted using OvidMEDLINE, PubMed, EMBASE, SPORTDiscus and CINAHL databases to retrieve articles published between January 2000 and December 2012. Randomised controlled trials and quasi-experimental designs comparing different strategies to increase physical activity level in persons aged 65 years and older with T2DM were included. The methodological quality of studies was assessed.Results: Twenty-one eligible studies were reviewed, only six studies were rated as good quality and only one study specifically targeted persons aged 65 years and older. Personalised coaching, goal setting, peer support groups, use of technology and physical activity monitors were proven to increase the level of physical activity. Incorporation of health behaviour theories and follow-up supports also were successful strategies. However, the methodological quality and type of interventions promoting physical activity of the included studies in this review varied widely across the eligible studies.Conclusion: Strategies that increased level of physical activity in persons with T2DM are evident but most studies focused on middle-aged persons and there was a lack of well-designed trials. Hence, more studies of satisfactory methodological quality with interventions promoting physical activity in older people are required.
Stanniocalcin 2 promotes cell proliferation and cisplatin resistance in cervical cancer
International Nuclear Information System (INIS)
Wang, Yuxia; Gao, Ying; Cheng, Hairong; Yang, Guichun; Tan, Wenhua
2015-01-01
Cervical cancer is one of the most common carcinomas in the female reproductive system. Treatment of cervical cancer involves surgical removal and chemotherapy. Resistance to platinum-based chemotherapy drugs including cisplatin has increasingly become an important problem in the treatment of cervical cancer patients. We found in this study that stanniocalcin 2 (STC2) expression was upregulated in both cervical cancer tissues and cell lines. The levels of STC2 expression in cervical cancer cell lines were positively correlated with the rate of cell proliferation. Furthermore, in cisplatin resistant cervical cancer cells, the levels of STC2 expression were significantly elevated. Modulation of STC2 expression by siRNA or overexpression in cisplatin resistant cells resulted in altered cell survival, apoptosis, and cisplatin resistance. Finally, we found that there was significant difference in the activity of the MAPK signaling pathway between cisplatin sensitive and resistant cervical cancer cells, and that STC2 could regulate the activity of the MAPK signaling pathway. - Highlights: • STC2 was upregulated in cervical cancer and promoted cervical cancer cell proliferation. • Cisplatin resistant cells had elevated STC2 levels and enhanced proliferation. • STC2 regulated cisplatin chemosensitivity in cervical cancer cells. • STC2 regulated the activity of the MAPK signaling pathway.
Energy Technology Data Exchange (ETDEWEB)
Zhu, Hong; Miao, Mei-hua; Ji, Xue-qiang; Xue, Jun; Shao, Xue-jun, E-mail: xuejunshao@hotmail.com
2015-04-03
MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. However, the role of microRNAs in leukaemia, particularly T-cell acute lymphoblastic leukaemia (T-ALL), has remained elusive. Here, we identified miR-664 and its predicted target gene PLP2 were differentially expressed in T-ALL using bioinformatics methods. In T-ALL cell lines, CCK-8 proliferation assay indicated that the cell proliferation was promoted by miR-664, while miR-664 inhibitor could significantly inhibited the proliferation. Moreover, migration and invasion assay showed that overexpression of miR-664 could significantly promoted the migration and invasion of T-ALL cells, whereas miR-664 inhibitor could reduce cell migration and invasion. luciferase assays confirmed that miR-664 directly bound to the 3'untranslated region of PLP2, and western blotting showed that miR-664 suppressed the expression of PLP2 at the protein levels. This study indicated that miR-664 negatively regulates PLP2 and promotes proliferation and invasion of T-ALL cell lines. Thus, miR-664 may represent a potential therapeutic target for T-ALL intervention. - Highlights: • miR-664 mimics promote the proliferation and invasion of T-ALL cells. • miR-664 inhibitors inhibit the proliferation and invasion of T-ALL cells. • miR-664 targets 3′ UTR of PLP2 in T-ALL cells. • miR-664 negatively regulates PLP2 in T-ALL cells.
Sox2 Is an Androgen Receptor-Repressed Gene That Promotes Castration-Resistant Prostate Cancer
Kregel, Steven; Kiriluk, Kyle J.; Rosen, Alex M.; Cai, Yi; Reyes, Edwin E.; Otto, Kristen B.; Tom, Westin; Paner, Gladell P.; Szmulewitz, Russell Z.; Vander Griend, Donald J.
2013-01-01
Despite advances in detection and therapy, castration-resistant prostate cancer continues to be a major clinical problem. The aberrant activity of stem cell pathways, and their regulation by the Androgen Receptor (AR), has the potential to provide insight into novel mechanisms and pathways to prevent and treat advanced, castrate-resistant prostate cancers. To this end, we investigated the role of the embryonic stem cell regulator Sox2 [SRY (sex determining region Y)-box 2] in normal and malignant prostate epithelial cells. In the normal prostate, Sox2 is expressed in a portion of basal epithelial cells. Prostate tumors were either Sox2-positive or Sox2-negative, with the percentage of Sox2-positive tumors increasing with Gleason Score and metastases. In the castration-resistant prostate cancer cell line CWR-R1, endogenous expression of Sox2 was repressed by AR signaling, and AR chromatin-IP shows that AR binds the enhancer element within the Sox2 promoter. Likewise, in normal prostate epithelial cells and human embryonic stem cells, increased AR signaling also decreases Sox2 expression. Resistance to the anti-androgen MDV3100 results in a marked increase in Sox2 expression within three prostate cancer cell lines, and in the castration-sensitive LAPC-4 prostate cancer cell line ectopic expression of Sox2 was sufficient to promote castration-resistant tumor formation. Loss of Sox2 expression in the castration-resistant CWR-R1 prostate cancer cell line inhibited cell growth. Up-regulation of Sox2 was not associated with increased CD133 expression but was associated with increased FGF5 (Fibroblast Growth Factor 5) expression. These data propose a model of elevated Sox2 expression due to loss of AR-mediated repression during castration, and consequent castration-resistance via mechanisms not involving induction of canonical embryonic stem cell pathways. PMID:23326489
Ionizing radiation in tumor promotion and progression
International Nuclear Information System (INIS)
Mitchel, R.E.J.
1990-08-01
Chronic exposure to beta radiation has been tested as a tumor promoting or progressing agent. The dorsal skins of groups of 25 female SENCAR mice were chemically initiated with a single exposure to DMBA, and chronic exposure to strontium-90/yttrium-90 beta radiation was tested as a stage 1, stage 2 or complete skin tumor promoter. Exposure of initiated mice to 0.5 gray twice a week for 13 weeks produced no papillomas, indicating no action as a complete promoter. Another similar group of animals was chemically promoted through stage 1 (with TPA) followed by 0.5 gray of beta radiation twice a week for 13 weeks. Again no papillomas developed indicating no action of chronic radiation as a stage 2 tumor promoter. The same radiation exposure protocol in another DMBA initiated group receiving both stage 1 and 2 chemical promotion resulted in a decrease in papilloma frequency, compared to the control group receiving no beta irradiation, indicating a tumor preventing effect of radiation at stage 2 promotion, probably by killing initiated cells. Chronic beta radiation was tested three different ways as a stage 1 tumor promoter. When compared to the appropriate control, beta radiation given after initiation as a stage 1 promoter (0.5 gray twice a week for 13 weeks), after initiation and along with a known stage 1 chemical promoter (1.0 gray twice a week for 2 weeks), or prior to initiation as a stage 1 promoter (0.5 gray twice a week for 4 weeks), each time showed a weak (∼ 15% stimulation) but statistically significant (p<0.01) ability to act as a stage 1 promoter. When tested as a tumor progressing agent delivered to pre-existing papillomas, beta radiation (0.5 gray twice a week for 13 weeks) increased carcinoma frequency from 0.52 to 0.68 carcinoma/animal, but this increase was not statistically significant at the 95% confidence level. We conclude that in the addition to the known initiating, progressing and complete carcinogenic action of acute exposures to ionizing
DEFF Research Database (Denmark)
Dai, Ning; Christiansen, Jan; Nielsen, Finn
2013-01-01
uncover a new mechanism by which mTOR regulates organismal growth by promoting IGF2 production in the mouse embryo through mTORC2-catalyzed cotranslational IMP1/IMP3 phosphorylation. Inasmuch as TORC2 is activated by association with ribosomes, the present results indicate that mTORC2-catalyzed...... production, and diminished proliferation. The proliferation of the IMP1-null fibroblasts can be restored to wild-type levels by IGF2 in vitro or by re-expression of IMP1, which corrects the defects in IGF2 RNA splicing and translation. The ability of IMP1 to correct these defects is dependent on IMP1...
Gotoh, Saki; Negishi, Masahiko
2015-09-22
Statin therapy is known to increase blood glucose levels in humans. Statins utilize pregnane X receptor (PXR) and serum/glucocorticoid regulated kinase 2 (SGK2) to activate phosphoenolpyruvate carboxykinase 1 (PEPCK1) and glucose-6-phosphatase (G6Pase) genes, thereby increasing glucose production in human liver cells. Here, the novel statin/PXR/SGK2-mediated signaling pathway has now been characterized for hepatic gluconeogenesis. Statin-activated PXR scaffolds the protein phosphatase 2C (PP2C) and SGK2 to stimulate PP2C to dephosphorylate SGK2 at threonine 193. Non-phosphorylated SGK2 co-activates PXR-mediated trans-activation of promoters of gluconeogenic genes in human liver cells, thereby enhancing gluconeogenesis. This gluconeogenic statin-PXR-SGK2 signal is not present in mice, in which statin treatment suppresses hepatic gluconeogenesis. These findings provide the basis for statin-associated side effects such as an increased risk for Type 2 diabetes.
TROP2 overexpression promotes proliferation and invasion of lung adenocarcinoma cells
Energy Technology Data Exchange (ETDEWEB)
Li, Zanhua [Medical School of Nanchang University (China); The Chest Hospital of Jiangxi Province Department of Respiration (China); Jiang, Xunsheng [Department of Respiration, Medical School of Nanchang University (China); Zhang, Wei, E-mail: weizhangncu@gmail.com [Department of Respiration, The First Affiliated Hospital of Nanchang University (China)
2016-01-29
Recent studies suggest that the human trophoblast cell-surface antigen TROP2 is highly expressed in a number of tumours and is correlated with poor prognosis. However, its role in non-small cell lung carcinoma (NSCLC) remains largely unknown. Here we examined TROP2 expression by immunohistochemistry in a series of 68 patients with adenocarcinoma (ADC). We found significantly elevated TROP2 expression in ADC tissues compared with normal lung tissues (P < 0.05), and TROP2 overexpression was significantly associated with TNM (tumour, node, metastasis) stage (P = 0.012), lymph node metastasis (P = 0.038), and histologic grade (P = 0.013). Kaplan–Meier survival analysis revealed that high TROP2 expression correlated with poor prognosis (P = 0.046). Multivariate analysis revealed that TROP2 expression was an independent prognostic marker for overall survival of ADC patients. Moreover, TROP2 overexpression enhanced cell proliferation, migration, and invasion in the NSCLC cell line A549, whereas knockdown of TROP2 induced apoptosis and impaired proliferation, migration, and invasion in the PC-9 cells. Altogether, our data suggest that TROP2 plays an important role in promoting ADC and may represent a novel prognostic biomarker and therapeutic target for the disease.
Health 2.0-Lessons Learned: Social Networking With Patients for Health Promotion.
Sharma, Suparna; Kilian, Reena; Leung, Fok-Han
2014-07-01
The advent of social networking as a major platform for human interaction has introduced a new dimension into the physician-patient relationship, known as Health 2.0. The concept of Health 2.0 is young and evolving; so far, it has meant the use of social media by health professionals and patients to personalize health care and promote health education. Social networking sites like Facebook and Twitter offer promising platforms for health care providers to engage patients. Despite the vast potential of Health 2.0, usage by health providers remains relatively low. Using a pilot study as an example, this commentary reviews the ways in which physicians can effectively harness the power of social networking to meaningfully engage their patients in primary prevention. © The Author(s) 2014.
Mechanism of Methane Chemical Looping Combustion with Hematite Promoted with CeO 2
Energy Technology Data Exchange (ETDEWEB)
Miller, Duane D.; Siriwardane, Ranjani
2013-08-15
Chemical looping combustion (CLC) is a promising technology for fossil fuel combustion that produces sequestration-ready CO{sub 2} stream, reducing the energy penalty of CO{sub 2} separation from flue gases. An effective oxygen carrier for CLC will readily react with the fuel gas and will be reoxidized upon contact with oxygen. This study investigated the development of a CeO{sub 2}-promoted Fe{sub 2}O{sub 3}-hematite oxygen carrier suitable for the methane CLC process. Composition of CeO{sub 2} is between 5 and 25 wt % and is lower than what is generally used for supports in Fe{sub 2}O{sub 3} carrier preparations. The incorporation of CeO{sub 2} to the natural ore hematite strongly modifies the reduction behavior in comparison to that of CeO{sub 2} and hematite alone. Temperature-programmed reaction studies revealed that the addition of even 5 wt % CeO{sub 2} enhances the reaction capacity of the Fe{sub 2}O{sub 3} oxygen carrier by promoting the decomposition and partial oxidation of methane. Fixed-bed reactor data showed that the 5 wt % cerium oxides with 95 wt % iron oxide produce 2 times as much carbon dioxide in comparison to the sum of carbon dioxide produced when the oxides were tested separately. This effect is likely due to the reaction of CeO{sub 2} with methane forming intermediates, which are reactive for extracting oxygen from Fe{sub 2}O{sub 3} at a considerably faster rate than the rate of the direct reaction of Fe{sub 2}O{sub 3} with methane. These studies reveal that 5 wt % CeO{sub 2}/Fe{sub 2}O{sub 3} gives stable conversions over 15 reduction/oxidation cycles. Lab-scale reactor studies (pulsed mode) suggest the methane reacts initially with CeO{sub 2} lattice oxygen to form partial oxidation products (CO + H{sub 2}), which continue to react with oxygen from neighboring Fe{sub 2}O{sub 3}, leading to its complete oxidation to form CO{sub 2}. The reduced cerium oxide promotes the methane decomposition reaction to form C + H{sub 2}, which continue to
DEFF Research Database (Denmark)
Herrmann, Susan; Seidelin, Michel; Bisgaard, Hanne Cathrine
2002-01-01
Indole-3-carbinol (I3C) is a naturally occurring substance that shows anti-carcinogenic properties in animal models. Besides its clear anti-carcinogenic effects, some studies indicate that I3C may sometimes act as a tumor promoter. Indolo[3,2-b]carbazole (ICZ), which is formed in the acidic...... environment of the stomach after intake of I3C, has a similar structure to, and shares biological effects with, the well-known tumor promoter 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD). Therefore, we hypothesized that ICZ could be responsible for the potential tumor-promoting activity of I3C. The aim...
Jiang, Yi; Woortman, Albert J J; van Ekenstein, Gert O R Alberda; Loos, Katja
2013-01-01
Bio-based commercially available succinate, itaconate and 1,4-butanediol are enzymatically co-polymerized in solution via a two-stage method, using Candida antarctica Lipase B (CALB, in immobilized form as Novozyme® 435) as the biocatalyst. The chemical structures of the obtained products,
Enzymatic polymerization of bio-based monomers for applications in hydrogels and coatings
DEFF Research Database (Denmark)
Hoffmann, Christian; Nguyen, Hiep Dinh; Storgaard, Thomas
of the enzymatic catalysts that can provide control over polymer structure in functional polymers. Lipase catalyzed polymerizations (specifically CALB) has been applied to prepare functional polyesters and to evaluate the possibilities of using less stable bio-based monomers such as itaconic acid or its...
Song, Hongwei; Yang, Minghui; Guo, Hua
2016-10-01
Vibrational excitations of reactants sometimes promote reactions more effectively than the same amount of translational energy. Such mode specificity provides insights into the transition-state modulation of reactivity and might be used to control chemical reactions. We report here a state-of-the-art full-dimensional quantum dynamical study of the hydrogen abstraction reaction H + NH3 → H2 + NH2 on an accurate ab initio based global potential energy surface. This reaction serves as an ideal candidate to study the relative efficacies of symmetric and degenerate antisymmetric stretching modes. Strong mode specificity, particularly for the NH3 stretching modes, is demonstrated. It is further shown that nearly identical efficacies of the symmetric and antisymmetric stretching modes of NH3 in promoting the reaction can be understood in terms of local-mode stretching vibrations of the reactant molecule.
Tropomyosin Promotes Lamellipodial Persistence by Collaborating with Arp2/3 at the Leading Edge.
Brayford, Simon; Bryce, Nicole S; Schevzov, Galina; Haynes, Elizabeth M; Bear, James E; Hardeman, Edna C; Gunning, Peter W
2016-05-23
At the leading edge of migrating cells, protrusion of the lamellipodium is driven by Arp2/3-mediated polymerization of actin filaments [1]. This dense, branched actin network is promoted and stabilized by cortactin [2, 3]. In order to drive filament turnover, Arp2/3 networks are remodeled by proteins such as GMF, which blocks the actin-Arp2/3 interaction [4, 5], and coronin 1B, which acts by directing SSH1L to the lamellipodium where it activates the actin-severing protein cofilin [6, 7]. It has been shown in vitro that cofilin-mediated severing of Arp2/3 actin networks results in the generation of new pointed ends to which the actin-stabilizing protein tropomyosin (Tpm) can bind [8]. The presence of Tpm in lamellipodia, however, is disputed in the literature [9-19]. Here, we report that the Tpm isoforms 1.8/9 are enriched in the lamellipodium of fibroblasts as detected with a novel isoform-specific monoclonal antibody. RNAi-mediated silencing of Tpm1.8/9 led to an increase of Arp2/3 accumulation at the cell periphery and a decrease in the persistence of lamellipodia and cell motility, a phenotype consistent with cortactin- and coronin 1B-deficient cells [2, 7]. In the absence of coronin 1B or cofilin, Tpm1.8/9 protein levels are reduced while, conversely, inhibition of Arp2/3 with CK666 leads to an increase in Tpm1.8/9 protein. These findings establish a novel regulatory mechanism within the lamellipodium whereby Tpm collaborates with Arp2/3 to promote lamellipodial-based cell migration. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ahn, Sungjin; Lee, Moonyoung; An, Seungchan; Hyun, Sooyeol; Hwang, Jiho; Lee, Jongkook; Noh, Minsoo
2018-03-01
Adiponectin is a major adipocytokine secreted from mammalian adipocytes. Relatively low expression of adiponectin is associated with various human metabolic diseases and some cancers. Adiponectin-secreting compounds have therapeutic potential for these diseases. Adipogenesis of human bone marrow-mesenchymal stem cells (hBM-MSCs) has been used as a phenotypic assay to find adiponectin secreting compounds. In a phytochemical library screen, 2-formyl-komarovicine, 1-(quinolin-8-yl)-1,3,4,9-tetrahydro-2H-pyrido[3,4-b]indole-2-carbaldehyde, isolated from Nitraria komarovii was identified as a potential adiponectin-secreting compound. To validate the results of the impure phytochemical, we synthesized 2-formyl-komarovicine. The synthetic 2-formyl-komarovicine significantly promoted adiponectin production during adipogenesis in hBM-MSCs. In a target identification experiment, 2-formyl-komarovicine bound to peroxisome proliferator-activated receptor γ (PPARγ) in a concentration-dependent manner. Notably, 2-formyl-komarovicine competitively inhibited the adiponectin-promoting activity of a full PPARγ agonist, troglitazone, in hBM-MSCs, which is a pharmacological feature of a partial agonist. The ligand-docking model showed that 2-formyl-komarovicine interacted with the hydrophobic pocket of the PPARγ ligand-binding domain, but lacked an interaction to stabilize helix H12, which is one of the major binding themes of PPARγ partial agonists. We concluded that 2-formyl-komarovicine provides a novel pharmacophore for PPARγ partial agonists to increase adiponectin production. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ping Peng
Full Text Available To investigate the association of ABCG1, GALNT2 and HMGCR genes promoter DNA methylation with coronary heart disease (CHD and explore the interaction between their methylation status and the CHD patients' clinical characteristics in Han Chinese population.Methylation-specific polymerase chain reaction (MSP technology was used to examine the role of the aberrant gene promoter methylation in CHD in Han Chinese population. A total of 85 CHD patients and 54 participants without CHD confirmed by angiography were recruited. 82.8% of the participants with ABCG1 gene promoter hypermethylation have CHD, while only 17.4% of the participants without hypermethylation have it. The average age of the participants with GALNT2 gene promoter hypermethylation is 62.10 ± 8.21, while that of the participants without hypermethylation is 57.28 ± 9.87; in the former group, 75.4% of the participants have CHD, compared to only 50% in the latter group. As for the HMGCR gene, the average age of the participants with promoter hypermethylation is 63.24 ± 8.10 and that of the participants without hypermethylation is 57.79 ± 9.55; its promoter hypermethylation is likely to be related to smoking. Our results indicated a significant statistical association of promoter methylation of the ABCG1 gene with increased risk of CHD (OR = 19.966; 95% CI, 7.319-54.468; P*<0.001; P*: adjusted for age, gender, smoking, lipid level, hypertension, and diabetes. Similar results were obtained for that of the GALNT2 gene (OR = 2.978; 95% CI, 1.335-6.646; P* = 0.008, but not of HMGCR gene (OR = 1.388; 95% CI, 0.572-3.371; P* = 0.469.The present work provides evidence to support the association of promoter DNA methylation status with the risk profile of CHD. Our data indicates that promoter DNA hypermethylation of the ABCG1 and GALNT2 genes, but not the HMGCR gene, is associated with an increased risk of CHD. CHD, smoking and aging are likely to be the important factors influencing DNA
Remote and web 2.0 interventions for promoting physical activity.
Foster, Charles; Richards, Justin; Thorogood, Margaret; Hillsdon, Melvyn
2013-09-30
Remote and web 2.0 interventions for promoting physical activity (PA) are becoming increasingly popular but their ability to achieve long term changes are unknown. To compare the effectiveness of remote and web 2.0 interventions for PA promotion in community dwelling adults (aged 16 years and above) with a control group exposed to placebo or no or minimal intervention. We searched CENTRAL, MEDLINE, EMBASE, CINAHL, and some other databases (from earliest dates available to October 2012). Reference lists of relevant articles were checked. No language restrictions were applied. Randomised controlled trials (RCTs) that compared remote and web 2.0 PA interventions for community dwelling adults with a placebo or no or minimal intervention control group. We included studies if the principal component of the intervention was delivered using remote or web 2.0 technologies (for example the internet, smart phones) or more traditional methods (for example telephone, mail-outs), or both. To assess behavioural change over time, the included studies had a minimum of 12 months follow-up from the start of the intervention to the final results. We excluded studies that had more than a 20% loss to follow-up if they did not apply an intention-to-treat analysis. At least two authors independently assessed the quality of each study and extracted the data. Non-English language papers were reviewed with the assistance of an interpreter who was an epidemiologist. Study authors were contacted for additional information where necessary. Standardised mean differences (SMDs) and 95% confidence intervals (CIs) were calculated for the continuous measures of self-reported PA and cardio-respiratory fitness. For studies with dichotomous outcomes, odds ratios and 95% CIs were calculated. A total of 11 studies recruiting 5862 apparently healthy adults met the inclusion criteria. All of the studies took place in high-income countries. The effect of the interventions on cardiovascular fitness at one
Directory of Open Access Journals (Sweden)
Soo-Kyung Park
2017-10-01
Full Text Available Background/Aims: Colorectal cancer (CRC screening using stool DNA was recently found to yield good detection rates. A multi-target stool DNA test (Cologuard®, Exact Sciences, including methylated genes has been recently approved by the U.S. Food and Drug Administration. The aim of this study was to validate these aberrantly methylated genes as stool-based DNA markers for detecting CRC and colorectal advanced adenoma (AA in the Korean population.Methods: A single-center study was conducted in 36 patients with AA; 35 patients with CRC; and 40 endoscopically diagnosed healthy controls using CRC screening colonoscopy. The methylation status of the SFRP2, TFPI2, NDRG4, and BMP3 promoters was investigated blindly using bisulfate-modified stool DNA obtained from 111 participants. Methylation status was investigated by methylation-specific polymerase chain reaction.Results: Methylated SFRP2, TFPI2, NDRG4, and BMP3 promoters were detected in 60.0%, 31.4%, 68.8%, and 40.0% of CRC samples and in 27.8%, 27.8%, 27.8%, and 33.3% of AA samples, respectively. The sensitivities obtained using 4 markers to detect CRC and AA were 94.3% and 72.2%, respectively. The specificity was 55.0%.Conclusions: Our results demonstrate that the SFRP2, TFPI2, NDRG4, and BMP3 promoter methylation analysis of stool sample DNA showed high sensitivity but low specificity for detecting CRC and AA. Because of the low specificity, 4 methylated markers might not be sufficient for CRC screening in the Korean population. Further large-scale studies are required to validate the methylation of these markers in the Asian population and to find new markers for the Asian population.
Directory of Open Access Journals (Sweden)
Shailendra eRaikwar
2015-12-01
Full Text Available Genetic material always remains at the risk of spontaneous or induced damage which challenges the normal functioning of DNA molecule, thus, DNA repair is vital to protect the organisms against genetic damage. DNA hHelicases, the unique molecular motors, are emerged as potentialprospective molecules to engineer stress tolerance in plants and are involved in a variety of DNA nucleic acid metabolismc processes including DNA repair. The DNA repair helicase, OsXPB2 is an evolutionary conserved protein present in different organisms, including plants. Availability of few efficient promoters for gene expression in plants provoked us to study the promoter of XPB for better understanding of gene regulation under stress The analysis of promoter sequence from plant genome is important in understanding the gene regulation. Hereconditions. Here, we report the in silico analysis of novel stress inducible promoter of rice Oryza sativa OsXPB2 (OsXPB2. gene is reported. The in vivo validation of functionality/activity of novel stress inducible promoter of rice OsXPB2 gene promoter under abiotic and hormonal stress conditions was performed by Agrobacterium-mediated transient assay in tobacco leaves using OsXPB2::GUS chimeric construct. Our resultsThe present research revealed that OsXPB2 promoter contains cis-elements accounting for various abiotic stresses (salt, dehydration or cold and hormone (Auxin, ABA or MeJA induced GUS expression/activity in the promoter-reporter assay. The promoter region of OsXPB2 contains CACG, GTAACG, CACGTG, CGTCA CCGCCGCGCT cis acting-elements which are reported to be salt, dehydration, cold, MeJA or ABA responsive, respectively. Functional analysis was done by Agrobacterium-transient assays using agroinfiltration in tobacco leaves, followed by GUS staining and fluorescence quantitative analyses. The results revealed high induction of GUS activity under multiple abiotic stresses as compared to mock treated control. The present
Shanks, Julia; Herring, Neil; Johnson, Errin; Liu, Kun; Li, Dan
2017-01-01
Reduced cardiomyocyte excitation–contraction coupling and downregulation of the SERCA2a (sarcoendoplasmic reticulum calcium ATPase 2a) is associated with heart failure. This has led to viral transgene upregulation of SERCA2a in cardiomyocytes as a treatment. We hypothesized that SERCA2a gene therapy expressed under a similar promiscuous cytomegalovirus promoter could also affect the cardiac sympathetic neural axis and promote sympathoexcitation. Stellate neurons were isolated from 90 to 120 g male, Sprague–Dawley, Wistar Kyoto, and spontaneously hypertensive rats. Neurons were infected with Ad-mCherry or Ad-mCherry-hATP2Aa (SERCA2a). Intracellular Ca2+ changes were measured using fura-2AM in response to KCl, caffeine, thapsigargin, and carbonylcyanide-p-trifluoromethoxyphenylhydrazine to mobilize intracellular Ca2+ stores. The effect of SERCA2a on neurotransmitter release was measured using [3H]-norepinephrine overflow from 340 to 360 g Sprague–Dawley rat atria in response to right stellate ganglia stimulation. Upregulation of SERCA2a resulted in greater neurotransmitter release in response to stellate stimulation compared with control (empty: 98.7±20.5 cpm, n=7; SERCA: 186.5±28.41 cpm, n=8; Pneurons, SERCA2a overexpression facilitated greater depolarization-induced Ca2+ transients (empty: 0.64±0.03 au, n=57; SERCA: 0.75±0.03 au, n=68; Pneurons resulted in increased neurotransmission and increased Ca2+ loading into intracellular stores. Whether the increased Ca2+ transient and neurotransmission after SERCA2A overexpression contributes to enhanced sympathoexcitation in heart failure patients remains to be determined. PMID:28223472
Directory of Open Access Journals (Sweden)
Pohida Thomas J
2006-03-01
Full Text Available Abstract Background A functional blood supply is essential for tumor growth and proliferation. However, the mechanism of blood vessel recruitment to the tumor is still poorly understood. Ideally, a thorough molecular assessment of blood vessel cells would be critical in our comprehension of this process. Yet, to date, there is little known about the molecular makeup of the endothelial cells of tumor-associated blood vessels, due in part to the difficulty of isolating a pure population of endothelial cells from the heterogeneous tissue environment. Methods Here we describe the use of a recently developed technique, Expression Microdissection, to isolate endothelial cells from the tumor microenvironment. The methylation status of the dissected samples was evaluated for GSTP1 and RARβ2 promoters via the QMS-PCR method. Results Comparing GSTP1 and RARβ2 promoter methylation data, we show that 100% and 88% methylation is detected, respectively, in the tumor areas, both in epithelium and endothelium. Little to no methylation is observed in non-tumor tissue areas. Conclusion We applied an accurate microdissection technique to isolate endothelial cells from tissues, enabling DNA analysis such as promoter methylation status. The observations suggest that epigenetic alterations may play a role in determining the phenotype of tumor-associated vasculature.
Czech Academy of Sciences Publication Activity Database
Krejčí, Alena; Bruce, A. W.; Doležal, Vladimír; Tuček, Stanislav; Buckley, N. J.
2004-01-01
Roč. 91, č. 1 (2004), s. 88-98 ISSN 0022-3042 R&D Projects: GA AV ČR IAA5011306 Institutional research plan: CEZ:AV0Z5011922 Keywords : M2 muscarinic receptor * neuron-restrictive silence factor * promoter Subject RIV: ED - Physiology Impact factor: 4.824, year: 2004
International Nuclear Information System (INIS)
Müller, Imke; Wischnewski, Frank; Pantel, Klaus; Schwarzenbach, Heidi
2010-01-01
The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs) and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR) caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3) at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. This study is one of the first to reveal the histone code and MBD profile
Cai, Shao-hang; Lu, Shi-xun; Liu, Li-li; Zhang, Chris Zhiyi; Yun, Jing-ping
2017-01-01
Background: Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. Methods: A total of 615 HCC specimens were obtained to construct tissue microarrays and pe...
Directory of Open Access Journals (Sweden)
Bertrand Gonthier
Full Text Available There is increasing evidence for a crucial role of proteases and metalloproteinases during axon growth and guidance. In this context, we recently described a functional link between the chemoattractive Sema3C and Matrix metalloproteinase 3 (MMP3. Here, we provide data demonstrating the involvement of MMP-2 to trigger the growth-promoting effect of Sema3A in cortical dendrites. The in situ analysis of MMP-2 expression and activity is consistent with a functional growth assay demonstrating in vitro that the pharmacological inhibition of MMP-2 reduces the growth of cortical dendrites in response to Sema3A. Hence, our results suggest that the selective recruitment and activation of MMP-2 in response to Sema3A requires a PKC alpha dependent mechanism. Altogether, we provide a second set of data supporting MMPs as effectors of the growth-promoting effects of semaphorins, and we identify the potential signalling pathway involved.
Directory of Open Access Journals (Sweden)
Berthold Frank
2009-04-01
Full Text Available Abstract Background HAND2, a key regulator for the development of the sympathetic nervous system, is located on chromosome 4q33 in a head-to-head orientation with DEIN, a recently identified novel gene with stage specific expression in primary neuroblastoma (NB. Both genes are expressed in primary NB as well as most NB cell lines and are separated by a genomic sequence of 228 bp. The similar expression profile of both genes suggests a common transcriptional regulation mediated by a bidirectional promoter. Results Northern Blot analysis of DEIN and HAND2 in 20 primary NBs indicated concurrent expression levels of the two genes, which was confirmed by microarray analysis of 236 primary NBs (Pearson's correlation coefficient r = 0.65. While DEIN expression in the latter cohort was associated with stage 4S (p = 0.02, HAND2 expression was not associated with tumor stage. In contrast, both HAND2 and DEIN transcript levels were highly associated with age at diagnosis DEIN orientation, an average 3.4 fold increase in activity was observed as compared to the promoterless vector, whereas an average 15.4 fold activation was detected in HAND2 orientation. The presence of two highly conserved putative regulatory elements, one of which was shown to enhance HAND2 expression in branchial arches previously, displayed weak repressor activity for both genes. Conclusion HAND2 and DEIN represent a gene pair that is tightly linked by a bidirectional promoter in an evolutionary highly conserved manner. Expression of both genes in NB is co-regulated by asymmetrical activity of this promoter and modulated by the activity of two cis-regulatory elements acting as weak repressors. The concurrent quantitative and tissue specific expression of HAND2 and DEIN suggests a functional link between both genes.
Effect of Promoters in Co-Mn-Al Mixed Oxide Catalyst on N2O Decomposition
Czech Academy of Sciences Publication Activity Database
Karásková, K.; Obalová, L.; Jirátová, Květa; Kovanda, F.
2010-01-01
Roč. 160, č. 2 (2010), s. 480-487 ISSN 1385-8947 R&D Projects: GA ČR GA106/09/1664 Institutional research plan: CEZ:AV0Z40720504 Keywords : nitrous oxide * catalytic decomposition * promoter effect Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 3.074, year: 2010
Energy Technology Data Exchange (ETDEWEB)
Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo; Miller Jenkins, Lisa M.; Wlodawer, Alexander; Chattoraj, Dhruba; Dunny, Gary M.
2017-04-18
Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations in
Ray, Amlan K.; DasMahapatra, Pramathes; Swarnakar, Snehasikta
2016-01-01
Endometriosis is characterized by the ectopic development of the endometrium which relies on angiogenesis. Although studies have identified the involvement of different matrix metalloproteinases (MMPs) in endometriosis, no study has yet investigated the role of MMP-2 in endometriosis-associated angiogenesis. The present study aims to understand the regulation of MMP-2 activity in endothelial cells and on angiogenesis during progression of ovarian endometriosis. Histological and biochemical data showed increased expressions of vascular endothelial growth factor (VEGF), VEGF receptor-2, cycloxygenase (COX)-2, von Willebrand factor along with angiogenesis during endometriosis progression. Women with endometriosis showed decreased MMP-2 activity in eutopic endometrium as compared to women without endometriosis. However, ectopic ovarian endometrioma showed significantly elevated MMP-2 activity with disease severity. In addition, increased MT1MMP and decreased tissue inhibitors of metalloproteinases (TIMP)-2 expressions were found in the late stages of endometriosis indicating more MMP-2 activation with disease progression. In vitro study using human endothelial cells showed that prostaglandin E2 (PGE2) significantly increased MMP-2 activity as well as tube formation. Inhibition of COX-2 and/or phosphorylated AKT suppressed MMP-2 activity and endothelial tube formation suggesting involvement of PGE2 in regulation of MMP-2 activity during angiogenesis. Moreover, specific inhibition of MMP-2 by chemical inhibitor significantly reduced cellular migration, invasion and tube formation. In ovo assay showed decreased angiogenic branching upon MMP-2 inhibition. Furthermore, a significant reduction of lesion numbers was observed upon inhibition of MMP-2 and COX-2 in mouse model of endometriosis. In conclusion, our study establishes the involvement of MMP-2 activity via COX-2-PGE2-pAKT axis in promoting angiogenesis during endometriosis progression. PMID:27695098
Heterogeneity of chromosome 22 breakpoint in Philadelphia-positive (Ph+) acute lymphocytic leukemia
International Nuclear Information System (INIS)
Erikson, J.; Griffin, C.A.; Ar-Rushdi, A.
1986-01-01
In chronic myelogenous leukemias (CML) with the t(9;22)(q34;q11) chromosome translocation the breakpoints on chromosome 22 occur within a 5.8-kilobase segment of DNA referred to as breakpoint cluster region (bcr). The same cytogenetically indinstinguishable translocation occurs in approximately 10% of patients with acute lymphocytic leukemias (ALL). In this study the authors have investigated the chromosome breakpoints in several cases of ALL carrying the t(9;22) translocation. In three of five cases of ALL they found that the bcr region was not involved in the chromosome rearrangement and that the 22q11 chromosome breakpoints were proximal (5') to the bcr region at band 22q11. In addition, they observed normal size bcr and c-alb transcripts in an ALL cell line carrying the t(9;22) translocation. They conclude, therefore, that if c-alb is inappropriately expressed in ALL cells without bcr rearrangements, the genetic mechanism of activation must be different from that reported for CML
Gas6 Promotes Inflammatory (CCR2hiCX3CR1lo) Monocyte Recruitment in Venous Thrombosis.
Laurance, Sandrine; Bertin, François-René; Ebrahimian, Talin; Kassim, Yusra; Rys, Ryan N; Lehoux, Stéphanie; Lemarié, Catherine A; Blostein, Mark D
2017-07-01
Coagulation and inflammation are inter-related. Gas6 (growth arrest-specific 6) promotes venous thrombosis and participates to inflammation through endothelial-innate immune cell interactions. Innate immune cells can provide the initiating stimulus for venous thrombus development. We hypothesize that Gas6 promotes monocyte recruitment during venous thrombosis. Deep venous thrombosis was induced in wild-type and Gas6-deficient (-/-) mice using 5% FeCl 3 and flow reduction in the inferior vena cava. Total monocyte depletion was achieved by injection of clodronate before deep venous thrombosis. Inflammatory monocytes were depleted using an anti-C-C chemokine receptor type 2 (CCR2) antibody. Similarly, injection of an anti-chemokine ligand 2 (CCL2) antibody induced CCL2 depletion. Flow cytometry and immunofluorescence were used to characterize the monocytes recruited to the thrombus. In vivo, absence of Gas6 was associated with a reduction of monocyte recruitment in both deep venous thrombosis models. Global monocyte depletion by clodronate leads to smaller thrombi in wild-type mice. Compared with wild type, the thrombi from Gas6 -/- mice contain less inflammatory (CCR2 hi CX 3 CR1 lo ) monocytes, consistent with a Gas6-dependent recruitment of this monocyte subset. Correspondingly, selective depletion of CCR2 hi CX 3 CR1 lo monocytes reduced the formation of venous thrombi in wild-type mice demonstrating a predominant role of the inflammatory monocytes in thrombosis. In vitro, the expression of both CCR2 and CCL2 were Gas6 dependent in monocytes and endothelial cells, respectively, impacting monocyte migration. Moreover, Gas6-dependent CCL2 expression and monocyte migration were mediated via JNK (c-Jun N-terminal kinase). This study demonstrates that Gas6 specifically promotes the recruitment of inflammatory CCR2 hi CX 3 CR1 lo monocytes through the regulation of both CCR2 and CCL2 during deep venous thrombosis. © 2017 American Heart Association, Inc.
Face-to-face versus remote and web 2.0 interventions for promoting physical activity.
Richards, Justin; Thorogood, Margaret; Hillsdon, Melvyn; Foster, Charles
2013-09-30
Face-to-face interventions for promoting physical activity (PA) are continuing to be popular as remote and web 2.0 approaches rapidly emerge, but we are unsure which approach is more effective at achieving long term sustained change. To compare the effectiveness of face-to-face versus remote and web 2.0 interventions for PA promotion in community dwelling adults (aged 16 years and above). We searched CENTRAL, MEDLINE, EMBASE, CINAHL, and some other databases (from earliest dates available to October 2012). Reference lists of relevant articles were checked. No language restrictions were applied. Randomised trials that compared face-to-face versus remote and web 2.0 PA interventions for community dwelling adults. We included studies if they compared an intervention that was principally delivered face-to-face to an intervention that had principally remote and web 2.0 methods. To assess behavioural change over time, the included studies had a minimum of 12 months follow-up from the start of the intervention to the final results. We excluded studies that had more than a 20% loss to follow-up if they did not apply an intention-to-treat analysis. At least two review authors independently assessed the quality of each study and extracted the data. Non-English language papers were reviewed with the assistance of an interpreter who was an epidemiologist. Study authors were contacted for additional information where necessary. Standardised mean differences (SMDs) and 95% confidence intervals (CIs) were calculated for continuous measures of cardio-respiratory fitness. One study recruiting 225 apparently healthy adults met the inclusion criteria. This study took place in a high-income country. From 27,299 hits, the full texts of 193 papers were retrieved for examination against the inclusion criteria. However, there was only one paper that met the inclusion criteria. This study reported the effect of a PA intervention on cardio-respiratory fitness. There were no reported data
SALES PROMOTION, A SUGGESTED ADULT DISTRIBUTIVE EDUCATION COURSE OUTLINE.
RUBIN, ALAN J.; AND OTHERS
THIS SUGGESTED OUTLINE FOR A BASIC COURSE IN SALES PROMOTION IS DESIGNED FOR NOT LESS THAN FIVE 2-HOUR SESSIONS ON (1) ASPECTS OF SALES PROMOTION, (2) SALES PROMOTION TECHNIQUES, (3) NEWSPAPER ADVERTISING, (4) WINDOW AND INTERIOR DISPLAY PRINCIPLES, AND (5) SELECTED PROMOTIONAL MEDIA AND DEVICES. POSSIBLE TEACHERS INCLUDE A SALES PROMOTION…
International Nuclear Information System (INIS)
Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert
2014-01-01
In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis
Synthesis of benzimidazoles by PIDA-promoted direct C(sp2)-H imidation of N-arylamidines.
Huang, Jinbo; He, Yimiao; Wang, Yong; Zhu, Qiang
2012-10-29
A metal-free synthesis of diversified benzimidazoles from N-arylamidines through a phenyliodine(III) diacetate (PIDA) promoted intramolecular direct C(sp(2))-H imidation has been developed. The reaction proceeds smoothly at 0 °C or ambient temperature to provide the desired products in good to excellent yields. The synthesis of 2-alkyl- or 2-alkyl-fused benzimidazoles, which are generally inaccessible by similar Pd- or Cu-catalyzed approaches, can also be achieved. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yan, Wei; Yun, Yang; Ku, Tingting; Li, Guangke; Sang, Nan
2016-03-01
Air pollution has been reported to be associated with increased risks of cognitive impairment and neurodegenerative diseases. Because NO2 is a typical primary air pollutant and an important contributor to secondary aerosols, NO2-induced neuronal functional abnormalities have attracted greater attention, but the available experimental evidence, modulating mechanisms, and targeting medications remain ambiguous. In this study, we exposed C57BL/6J and APP/PS1 mice to dynamic NO2 inhalation and found for the first time that NO2 inhalation caused deterioration of spatial learning and memory, aggravated amyloid β42 (Aβ42) accumulation, and promoted pathological abnormalities and cognitive defects related to Alzheimer’s disease (AD). The microarray and bioinformation data showed that the cyclooxygenase-2 (COX-2)-mediated arachidonic acid (AA) metabolism of prostaglandin E2 (PGE2) played a key role in modulating this aggravation. Furthermore, increasing endocannabinoid 2-arachidonoylglycerol (2-AG) by inhibiting monoacylglycerol lipase (MAGL) prevented PGE2 production, neuroinflammation-associated Aβ42 accumulation, and neurodegeneration, indicating a therapeutic target for relieving cognitive impairment caused by NO2 exposure.
Song, Shun; Xu, Yi; Huang, Dongmei; Miao, Hongxia; Liu, Juhua; Jia, Caihong; Hu, Wei; Valarezo, Ana Valeria; Xu, Biyu; Jin, Zhiqiang
2018-07-01
Drought and salt stresses often affect plant growth and crop yields. Identification of promoters involved in drought and salt stress responses is of great significance for genetic improvement of crop resistance. Our previous studies showed that aquaporin can respond to drought and salt stresses, but its promoter has not yet been reported in plants. In the present study, cis-acting elements of MaAQP family member promoters were systematically analyzed in banana. Expression of MaTIP1; 2 was induced by drought and salt stresses but not sensitive to cold stress, waterlogging stress, or mechanical damage, and its promoter contained five stress-related cis-acting elements. The MaTIP1; 2 promoter (841 bp upstream of translation initiation site) from banana (Musa acuminata L. AAA group cv. Brazilian) was isolated through genome walking polymerase chain reaction, and found to contain a TATA Box, CAAT box, ABRE element, CCGTCC box, CGTCA motif, and TCA element. Transformation of the MaTIP1; 2 promoter into Arabidopsis to assess its function indicated that it responds to both drought and salt stress treatments. These results suggest that MaTIP1; 2 utilization may improve drought and salt stresses resistance of the transgenic plants by promoting banana aquaporin expression. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Faten Bougatef
Full Text Available EMMPRIN's expression in melanoma tissue was reported to be predictive of poor prognosis. Here we demonstrate that EMMPRIN up-regulated VEGF receptor-2 (VEGFR-2 in two different primary melanoma cell lines and consequently increased migration and proliferation of these cells while inhibiting their apoptosis. SiRNA inhibition of VEGFR-2 expression abrogated these EMMPRIN effects. EMMPRIN regulation of VEGFR-2 was mediated through the over-expression of HIF-2alpha and its translocation to the nucleus where it forms heterodimers with HIF-1beta. These results were supported by an in vivo correlation between the expression of EMMPRIN with that of VEGFR-2 in human melanoma tissues as well as with the extent of HIF-2alpha localization in the nucleus. They demonstrate a novel mechanism by which EMMPRIN promotes tumor progression through HIF-2alpha/VEGFR-2 mediated mechanism, with an autocrine role in melanoma cell malignancy. The inhibition of EMMPRIN in cancer may thus simultaneously target both the VEGFR-2/VEGF system and the matrix degrading proteases to block tumor cell growth and invasion.
Energy Technology Data Exchange (ETDEWEB)
Naruse, Masae; Shibasaki, Koji; Ishizaki, Yasuki, E-mail: yasukiishizaki@gunma-u.ac.jp
2015-08-07
The origins and developmental regulation of cerebellar oligodendrocytes are largely unknown, although some hypotheses of embryonic origins have been suggested. Neural stem cells exist in the white matter of postnatal cerebellum, but it is unclear whether these neural stem cells generate oligodendrocytes at postnatal stages. We previously showed that cerebellar progenitor cells, including neural stem cells, widely express CD44 at around postnatal day 3. In the present study, we showed that CD44-positive cells prepared from the postnatal day 3 cerebellum gave rise to neurospheres, while CD44-negative cells prepared from the same cerebellum did not. These neurospheres differentiated mainly into oligodendrocytes and astrocytes, suggesting that CD44-positive neural stem/progenitor cells might generate oligodendrocytes in postnatal cerebellum. We cultured CD44-positive cells from the postnatal day 3 cerebellum in the presence of signaling molecules known as mitogens or inductive differentiation factors for oligodendrocyte progenitor cells. Of these, only FGF-2 promoted survival and proliferation of CD44-positive cells, and these cells differentiated into O4+ oligodendrocytes. Furthermore, we examined the effect of FGF-2 on cerebellar oligodendrocyte development ex vivo. FGF-2 enhanced proliferation of oligodendrocyte progenitor cells and increased the number of O4+ and CC1+ oligodendrocytes in slice cultures. These results suggest that CD44-positive cells might be a source of cerebellar oligodendrocytes and that FGF-2 plays important roles in their development at an early postnatal stage. - Highlights: • CD44 is expressed in cerebellar neural stem/progenitor cells at postnatal day 3 (P3). • FGF-2 promoted proliferation of CD44-positive progenitor cells from P3 cerebellum. • FGF-2 promoted oligodendrocytic differentiation of CD44-positive progenitor cells. • FGF-2 increased the number of oligodendrocytes in P3 cerebellar slice culture.
International Nuclear Information System (INIS)
Naruse, Masae; Shibasaki, Koji; Ishizaki, Yasuki
2015-01-01
The origins and developmental regulation of cerebellar oligodendrocytes are largely unknown, although some hypotheses of embryonic origins have been suggested. Neural stem cells exist in the white matter of postnatal cerebellum, but it is unclear whether these neural stem cells generate oligodendrocytes at postnatal stages. We previously showed that cerebellar progenitor cells, including neural stem cells, widely express CD44 at around postnatal day 3. In the present study, we showed that CD44-positive cells prepared from the postnatal day 3 cerebellum gave rise to neurospheres, while CD44-negative cells prepared from the same cerebellum did not. These neurospheres differentiated mainly into oligodendrocytes and astrocytes, suggesting that CD44-positive neural stem/progenitor cells might generate oligodendrocytes in postnatal cerebellum. We cultured CD44-positive cells from the postnatal day 3 cerebellum in the presence of signaling molecules known as mitogens or inductive differentiation factors for oligodendrocyte progenitor cells. Of these, only FGF-2 promoted survival and proliferation of CD44-positive cells, and these cells differentiated into O4+ oligodendrocytes. Furthermore, we examined the effect of FGF-2 on cerebellar oligodendrocyte development ex vivo. FGF-2 enhanced proliferation of oligodendrocyte progenitor cells and increased the number of O4+ and CC1+ oligodendrocytes in slice cultures. These results suggest that CD44-positive cells might be a source of cerebellar oligodendrocytes and that FGF-2 plays important roles in their development at an early postnatal stage. - Highlights: • CD44 is expressed in cerebellar neural stem/progenitor cells at postnatal day 3 (P3). • FGF-2 promoted proliferation of CD44-positive progenitor cells from P3 cerebellum. • FGF-2 promoted oligodendrocytic differentiation of CD44-positive progenitor cells. • FGF-2 increased the number of oligodendrocytes in P3 cerebellar slice culture
Raikwar, Shailendra; Srivastava, Vineet K; Gill, Sarvajeet S; Tuteja, Renu; Tuteja, Narendra
2015-01-01
Genetic material always remains at the risk of spontaneous or induced damage which challenges the normal functioning of DNA molecule, thus, DNA repair is vital to protect the organisms against genetic damage. Helicases, the unique molecular motors, are emerged as prospective molecules to engineer stress tolerance in plants and are involved in nucleic acid metabolism including DNA repair. The repair helicase, XPB is an evolutionary conserved protein present in different organisms, including plants. Availability of few efficient promoters for gene expression in plants provoked us to study the promoter of XPB for better understanding of gene regulation under stress conditions. Here, we report the in silico analysis of novel stress inducible promoter of Oryza sativa XPB2 (OsXPB2). The in vivo validation of functionality/activity of OsXPB2 promoter under abiotic and hormonal stress conditions was performed by Agrobacterium-mediated transient assay in tobacco leaves using OsXPB2::GUS chimeric construct. The present research revealed that OsXPB2 promoter contains cis-elements accounting for various abiotic stresses (salt, dehydration, or cold) and hormone (Auxin, ABA, or MeJA) induced GUS expression/activity in the promoter-reporter assay. The promoter region of OsXPB2 contains CACG, GTAACG, CACGTG, CGTCA CCGCCGCGCT cis acting-elements which are reported to be salt, dehydration, cold, MeJA, or ABA responsive, respectively. Functional analysis was done by Agrobacterium-mediated transient assay using agroinfiltration in tobacco leaves, followed by GUS staining and fluorescence quantitative analyses. The results revealed high induction of GUS activity under multiple abiotic stresses as compared to mock treated control. The present findings suggest that OsXPB2 promoter is a multi-stress inducible promoter and has potential applications in sustainable crop production under abiotic stresses by regulating desirable pattern of gene expression.
Sustained Elevated Adenosine via ADORA2B Promotes Chronic Pain through Neuro-immune Interaction
Directory of Open Access Journals (Sweden)
Xia Hu
2016-06-01
Full Text Available The molecular mechanisms of chronic pain are poorly understood and effective mechanism-based treatments are lacking. Here, we report that mice lacking adenosine deaminase (ADA, an enzyme necessary for the breakdown of adenosine, displayed unexpected chronic mechanical and thermal hypersensitivity due to sustained elevated circulating adenosine. Extending from Ada−/− mice, we further discovered that prolonged elevated adenosine contributed to chronic pain behaviors in two additional independent animal models: sickle cell disease mice, a model of severe pain with limited treatment, and complete Freund’s adjuvant paw-injected mice, a well-accepted inflammatory model of chronic pain. Mechanistically, we revealed that activation of adenosine A2B receptors on myeloid cells caused nociceptor hyperexcitability and promoted chronic pain via soluble IL-6 receptor trans-signaling, and our findings determined that prolonged accumulated circulating adenosine contributes to chronic pain by promoting immune-neuronal interaction and revealed multiple therapeutic targets.
Directory of Open Access Journals (Sweden)
Schwarzenbach Heidi
2010-06-01
Full Text Available Abstract Background The aim of the current study was to analyze the involvement of methyl-CpG binding proteins (MBDs and histone modifications on the regulation of CD44, Cyclin D2, GLIPR1 and PTEN in different cellular contexts such as the prostate cancer cells DU145 and LNCaP, and the breast cancer cells MCF-7. Since global chromatin changes have been shown to occur in tumours and regions of tumour-associated genes are affected by epigenetic modifications, these may constitute important regulatory mechanisms for the pathogenesis of malignant transformation. Methods In DU145, LNCaP and MCF-7 cells mRNA expression levels of CD44, Cyclin D2, GLIPR1 and PTEN were determined by quantitative RT-PCR at the basal status as well as after treatment with demethylating agent 5-aza-2'-deoxycytidine and/or histone deacetylase inhibitor Trichostatin A. Furthermore, genomic DNA was bisulfite-converted and sequenced. Chromatin immunoprecipitation was performed with the stimulated and unstimulated cells using antibodies for MBD1, MBD2 and MeCP2 as well as 17 different histone antibodies. Results Comparison of the different promoters showed that MeCP2 and MBD2a repressed promoter-specifically Cyclin D2 in all cell lines, whereas in MCF-7 cells MeCP2 repressed cell-specifically all methylated promoters. Chromatin immunoprecipitation showed that all methylated promoters associated with at least one MBD. Treatment of the cells by the demethylating agent 5-aza-2'-deoxycytidine (5-aza-CdR caused dissociation of the MBDs from the promoters. Only MBD1v1 bound and repressed methylation-independently all promoters. Real-time amplification of DNA immunoprecipitated by 17 different antibodies showed a preferential enrichment for methylated lysine of histone H3 (H3K4me1, H3K4me2 and H3K4me3 at the particular promoters. Notably, the silent promoters were associated with unmodified histones which were acetylated following treatment by 5-aza-CdR. Conclusions This study is one
NoRC Recruitment by H2A.X Deposition at rRNA Gene Promoter Limits Embryonic Stem Cell Proliferation
Directory of Open Access Journals (Sweden)
Boris Eleuteri
2018-05-01
Full Text Available Summary: Embryonic stem cells (ESCs display an abbreviated cell cycle, resulting in a short doubling time and rapid proliferation. The histone variant H2A.X is critical for proliferation of stem cells, although mechanistic insights have remained obscure. Here, we show that H2A.X defines the rate of mouse ESC proliferation independently of the DNA damage response pathway, and it associates with three major chromatin-modifying complexes. Our functional and biochemical analyses demonstrate that H2A.X-associated factors mediate the H2A.X-dependent effect on ESC proliferation and involve the nucleolar remodeling complex (NoRC. A specific H2A.X deposition at rDNA promoters determines the chromatin recruitment of the NoRC, histone modifications, the rRNA transcription, and the rate of proliferation. Collectively, our results suggest that NoRC assembly by H2A.X deposition at rRNA promoters silences transcription, and this represents an important regulatory component for ESC proliferation. : Histone variant H2A.X defines the rate of embryonic stem cell proliferation. Eleuteri et al. identify H2A.X-interacting proteins, and they show that H2A.X deposition at rDNA promoters assembles the NoRC, which represses rRNA transcription and determines the rate of self-renewal. Keywords: ribosomal biogenesis, rRNA, rDNA, stem cells, TIP5, SNF2H, SPT16, BRG1, H2A.X, G1, cell cycle, cell cycle arrest, proliferation
2011-05-01
transverse dispersivity [m] BTEX benzene, toluene, ethylbenzene, and xylene B lumped parameter defined as /cal calB J M β= CDM Camp Dresser ...Groundwater at Fort Lewis generally flows to northwest in the Vashon aquifer and west- southwest in the SLA aquifer. A simplified geologic cross section of the
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias
2016-01-07
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.
Wang, Songbo; Wang, Guoqing; Zhang, Mengyuan; Zhuang, Lu; Wan, Xiaojuan; Xu, Jingren; Wang, Lina; Zhu, Xiaotong; Gao, Ping; Xi, Qianyun; Zhang, Yongliang; Shu, Gang; Jiang, Qingyan
2016-11-15
It has been implicated that IGF-1 secretion can be regulated by dietary protein. However, whether the dipeptides, one of digested products of dietary protein, have influence on IGF-1 secretion remain largely unknown. Our study aimed to investigate the effects of the dipeptide Pro-Asp on IGF-1 secretion and expression in hepatocytes and to explore the possible underlying mechanisms. Our findings demonstrated that Pro-Asp promoted the secretion and gene expression of IGF-1 in HepG2 cells and primary porcine hepatocytes. Meanwhile, Pro-Asp activated the ERK and Akt signaling pathways, downstream of IGF-1. In addition, Pro-Asp enhanced GH-mediated JAK2/STAT5 signaling pathway, while inhibition of JAK2/STAT5 blocked the promotive effect of Pro-Asp on IGF-1 secretion and expression. Moreover, acute injection of Pro-Asp stimulated IGF-1 expression and activated JAK2/STAT5 signaling pathway in mice liver. Together, these results suggested that the dipeptide Pro-Asp promoted IGF-1 secretion and expression in hepatocytes by enhancing GH-mediated JAK2/STAT5 signaling pathway. Copyright © 2016. Published by Elsevier Ireland Ltd.
Bone marrow concentrate promotes bone regeneration with a suboptimal-dose of rhBMP-2.
Egashira, Kazuhiro; Sumita, Yoshinori; Zhong, Weijian; I, Takashi; Ohba, Seigo; Nagai, Kazuhiro; Asahina, Izumi
2018-01-01
Bone marrow concentrate (BMC), which is enriched in mononuclear cells (MNCs) and platelets, has recently attracted the attention of clinicians as a new optional means for bone engineering. We previously reported that the osteoinductive effect of bone morphogenetic protein-2 (BMP-2) could be enhanced synergistically by co-transplantation of peripheral blood (PB)-derived platelet-rich plasma (PRP). This study aims to investigate whether BMC can effectively promote bone formation induced by low-dose BMP-2, thereby reducing the undesirable side-effects of BMP-2, compared to PRP. Human BMC was obtained from bone marrow aspirates using an automated blood separator. The BMC was then seeded onto β-TCP granules pre-adsorbed with a suboptimal-dose (minimum concentration to induce bone formation at 2 weeks in mice) of recombinant human (rh) BMP-2. These specimens were transplanted subcutaneously to the dorsal skin of immunodeficient-mice and the induction of ectopic bone formation was assessed 2 and 4 weeks post-transplantation. Transplantations of five other groups [PB, PRP, platelet-poor plasma (PPP), bone marrow aspirate (BM), and BM-PPP] were employed as experimental controls. Then, to clarify the effects on vertical bone augmentation, specimens from the six groups were transplanted for on-lay placement on the craniums of mice. The results indicated that BMC, which contained an approximately 2.5-fold increase in the number of MNCs compared to PRP, could accelerate ectopic bone formation until 2 weeks post-transplantation. On the cranium, the BMC group promoted bone augmentation with a suboptimal-dose of rhBMP-2 compared to other groups. Particularly in the BMC specimens harvested at 4 weeks, we observed newly formed bone surrounding the TCP granules at sites far from the calvarial bone. In conclusion, the addition of BMC could reduce the amount of rhBMP-2 by one-half via its synergistic effect on early-phase osteoinduction. We propose here that BMC transplantation
Directory of Open Access Journals (Sweden)
Tursunov Obid
2017-11-01
Full Text Available The thermal behaviour of the Rosa mutiflora biomass by thermogravimetric analysis was studied at heating rate 3 K min−1 from ambient temperature to 950 °C. TGA tests were performed in high purity carbon dioxide (99 998% with a flow rate 200 ml/min and 100 mg of sample, milled and sieved to a particle size below 250 µm. Moreover, yields of gasification products such as hydrogen (H2, carbon monoxide (CO and methane (CH4 were determined based on the thermovolumetric measurements of catalytic (Ni/Al2O3-SiO2 and Ni/Al2O3-SiO2 with K2O promoter catalysts and non-catalytic gasification of the Rosa multiflora biomass. Additionally, carbon conversion degrees are presented. Calculations were made of the kinetic parameters of carbon monoxide and hydrogen formation reaction in the catalytic and non-catalytic CO2 gasification processes. A high temperature of 950 °C along with Ni/Al2O3-SiO2and Ni/Al2O3-SiO2 with K2O promoter catalysts resulted in a higher conversion of Rosa multiflora biomass into gaseous yield production with greatly increasing of H2 and CO contents. Consequently, H2 and CO are the key factors to produce renewable energy and bio-gases (synthesis gas. The parameters obtained during the experimental examinations enable a tentative assessment of plant biomasses for the process of large-scale gasification in industrial sectors.
MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2
International Nuclear Information System (INIS)
Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming
2016-01-01
MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.
MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2
Energy Technology Data Exchange (ETDEWEB)
Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming, E-mail: lizm_1001@sina.com
2016-02-26
MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.
The ubiquitin ligase ASB4 promotes trophoblast differentiation through the degradation of ID2.
Directory of Open Access Journals (Sweden)
W H Davin Townley-Tilson
Full Text Available Vascularization of the placenta is a critical developmental process that ensures fetal viability. Although the vascular health of the placenta affects both maternal and fetal well being, relatively little is known about the early stages of placental vascular development. The ubiquitin ligase Ankyrin repeat, SOCS box-containing 4 (ASB4 promotes embryonic stem cell differentiation to vascular lineages and is highly expressed early in placental development. The transcriptional regulator Inhibitor of DNA binding 2 (ID2 negatively regulates vascular differentiation during development and is a target of many ubiquitin ligases. Due to their overlapping spatiotemporal expression pattern in the placenta and contrasting effects on vascular differentiation, we investigated whether ASB4 regulates ID2 through its ligase activity in the placenta and whether this activity mediates vascular differentiation. In mouse placentas, ASB4 expression is restricted to a subset of cells that express both stem cell and endothelial markers. Placentas that lack Asb4 display immature vascular patterning and retain expression of placental progenitor markers, including ID2 expression. Using JAR placental cells, we determined that ASB4 ubiquitinates and represses ID2 expression in a proteasome-dependent fashion. Expression of ASB4 in JAR cells and primary isolated trophoblast stem cells promotes the expression of differentiation markers. In functional endothelial co-culture assays, JAR cells ectopically expressing ASB4 increased endothelial cell turnover and stabilized endothelial tube formation, both of which are hallmarks of vascular differentiation within the placenta. Co-transfection of a degradation-resistant Id2 mutant with Asb4 inhibits both differentiation and functional responses. Lastly, deletion of Asb4 in mice induces a pathology that phenocopies human pre-eclampsia, including hypertension and proteinuria in late-stage pregnant females. These results indicate that
Directory of Open Access Journals (Sweden)
Zeina Kais
2016-06-01
Full Text Available BRCA1/2 proteins function in homologous recombination (HR-mediated DNA repair and cooperate with Fanconi anemia (FA proteins to maintain genomic integrity through replication fork stabilization. Loss of BRCA1/2 proteins results in DNA repair deficiency and replicative stress, leading to genomic instability and enhanced sensitivity to DNA-damaging agents. Recent studies have shown that BRCA1/2-deficient tumors upregulate Polθ-mediated alternative end-joining (alt-EJ repair as a survival mechanism. Whether other mechanisms maintain genomic integrity upon loss of BRCA1/2 proteins is currently unknown. Here we show that BRCA1/2-deficient tumors also upregulate FANCD2 activity. FANCD2 is required for fork protection and fork restart in BRCA1/2-deficient tumors. Moreover, FANCD2 promotes Polθ recruitment at sites of damage and alt-EJ repair. Finally, loss of FANCD2 in BRCA1/2-deficient tumors enhances cell death. These results reveal a synthetic lethal relationship between FANCD2 and BRCA1/2, and they identify FANCD2 as a central player orchestrating DNA repair pathway choice at the replication fork.
Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter
Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.
2011-01-01
Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are
Soenens, Bart; Vansteenkiste, Maarten; Lens, Willy; Luyckx, Koen; Goossens, Luc; Beyers, Wim; Ryan, Richard M.
2007-01-01
In current research on parenting, 2 ways of conceptualizing perceived parental autonomy support can be distinguished. Parental autonomy support can be defined in terms of promotion of independence (PI) or in terms of promotion of volitional functioning (PVF). This study aimed to establish the empirical distinctiveness of both conceptualizations…
Properties of Immobilized Candida antarctica Lipase B on Highly Macroporous Copolymer
International Nuclear Information System (INIS)
Handayani, N.; Achmad, S.; Wahyuningrum, D.
2011-01-01
In spite of their excellent catalytic properties, enzymes should be improved before their implementation both in industrial and laboratorium scales. Immobilization of enzyme is one of the ways to improve their properties. Candida antarctica lipase B (Cal-B) has been reported in numerous publications to be a particularly useful enzyme catalizing in many type of reaction including regio- and enantio- synthesis. For this case, cross-linking of immobilized Cal-B with 1,2,7,8 diepoxy octane is one of methods that proved significantly more stable from denaturation by heat, organic solvents, and proteolysis than lyophilized powder or soluble enzymes. More over, the aim of this procedure is to improve the activity and reusability of lipase. Enzyme kinetics test was carried out by transesterification reaction between 4-nitrophenyl acetate (pNPA) and methanol by varying substrate concentrations, and the result is immobilized enzymes follows the Michaelis-Menten models and their activity is match with previous experiment. Based on the V max values, the immobilized enzymes showed higher activity than the free enzyme. Cross-linking of immobilized lipase indicate that cross-linking by lower concentration of cross-linker, FIC (immobilized lipase that was incubated for 24 h) gave the highest activity and cross-linking by higher concentration of cross-linker, PIC (immobilized lipase that was incubated for 2 h) gives the highest activity. However, pore size and saturation level influenced their activity. (author)
Shibahara, Fumitoshi; Kitagawa, Asumi; Yamaguchi, Eiji; Murai, Toshiaki
2006-11-23
Iodine-mediated, oxidative desulfurization promoted cyclization of N-2-pyridylmethyl thioamides serves as an efficient and versatile method for the preparation of 2-azaindolizines (imidazo[1,5-a]pyridines) and rare 2-azaindolizine sulfur-bridged dimers. The 2-azaindolizines prepared in this manner are readily converted to a variety of fluorescent compounds by using transition-metal-catalyzed cross-coupling reactions. [reaction: see text].
7 CFR 1160.301 - Promotion, consumer education and research.
2010-01-01
... (2) The evaluation of consumer education, promotion and research activities implemented under the... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion, consumer education and research. 1160.301... PROGRAM Fluid Milk Promotion Order Promotion, Consumer Education and Research § 1160.301 Promotion...
Directory of Open Access Journals (Sweden)
Luisina De Tullio
2017-10-01
Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.
Ozaki, Tomoka; Matsuoka, Junki; Tsubota, Maho; Tomita, Shiori; Sekiguchi, Fumiko; Minami, Takeshi; Kawabata, Atsufumi
2018-01-15
Ca v 3.2 T-type Ca 2+ channel activity is suppressed by zinc that binds to the extracellular histidine-191 of Ca v 3.2, and enhanced by H 2 S that interacts with zinc. Ca v 3.2 in nociceptors is upregulated in an activity-dependent manner. The enhanced Ca v 3.2 activity by H 2 S formed by the upregulated cystathionine-γ-lyase (CSE) is involved in the cyclophosphamide (CPA)-induced cystitis-related bladder pain in mice. We thus asked if zinc deficiency affects the cystitis-related bladder pain in mice by altering Ca v 3.2 function and/or expression. Dietary zinc deficiency for 2 weeks greatly decreased zinc concentrations in the plasma but not bladder tissue, and enhanced the bladder pain/referred hyperalgesia (BP/RH) following CPA at 200mg/kg, a subeffective dose, but not 400mg/kg, a maximal dose, an effect abolished by pharmacological blockade or gene silencing of Ca v 3.2. Acute zinc deficiency caused by systemic N,N,N',N'-tetrakis-(2-pyridylmethyl)-ethylendiamine (TPEN), a zinc chelator, mimicked the dietary zinc deficiency-induced Ca v 3.2-dependent promotion of BP/RH following CPA at 200mg/kg. CPA at 400mg/kg alone or TPEN plus CPA at 200mg/kg caused Ca v 3.2 overexpression accompanied by upregulation of Egr-1 and USP5, known to promote transcriptional expression and reduce proteasomal degradation of Ca v 3.2, respectively, in the dorsal root ganglia (DRG). The CSE inhibitor, β-cyano-l-alanine, prevented the BP/RH and upregulation of Ca v 3.2, Egr-1 and USP5 in DRG following TPEN plus CPA at 200mg/kg. Together, zinc deficiency promotes bladder pain accompanying CPA-induced cystitis by enhancing function and expression of Ca v 3.2 in nociceptors, suggesting a novel therapeutic avenue for treatment of bladder pain, such as zinc supplementation. Copyright © 2017 Elsevier B.V. All rights reserved.
Src-homology 2 domain-containing tyrosine phosphatase 2 promotes oral cancer invasion and metastasis
2014-01-01
Background Tumor invasion and metastasis represent a major unsolved problem in cancer pathogenesis. Recent studies have indicated the involvement of Src-homology 2 domain-containing tyrosine phosphatase 2 (SHP2) in multiple malignancies; however, the role of SHP2 in oral cancer progression has yet to be elucidated. We propose that SHP2 is involved in the progression of oral cancer toward metastasis. Methods SHP2 expression was evaluated in paired oral cancer tissues by using immunohistochemical staining and real-time reverse transcription polymerase chain reaction. Isogenic highly invasive oral cancer cell lines from their respective low invasive parental lines were established using a Boyden chamber assay, and changes in the hallmarks of the epithelial-mesenchymal transition (EMT) were assessed to evaluate SHP2 function. SHP2 activity in oral cancer cells was reduced using si-RNA knockdown or enforced expression of a catalytically deficient mutant to analyze migratory and invasive ability in vitro and metastasis toward the lung in mice in vivo. Results We observed the significant upregulation of SHP2 in oral cancer tissues and cell lines. Following SHP2 knockdown, the oral cancer cells markedly attenuated migratory and invasion ability. We observed similar results in phosphatase-dead SHP2 C459S mutant expressing cells. Enhanced invasiveness was associated with significant upregulation of E-cadherin, vimentin, Snail/Twist1, and matrix metalloproteinase-2 in the highly invasive clones. In addition, we determined that SHP2 activity is required for the downregulation of phosphorylated ERK1/2, which modulates the downstream effectors, Snail and Twist1 at a transcript level. In lung tissue sections of mice, we observed that HSC3 tumors with SHP2 deletion exhibited significantly reduced metastatic capacity, compared with tumors administered control si-RNA. Conclusions Our data suggest that SHP2 promotes the invasion and metastasis of oral cancer cells. These results
Wei, Tingyi; Chen, Wen; Wang, Xiukun; Zhang, Man; Chen, Jiayu; Zhu, Songcheng; Chen, Long; Yang, Dandan; Wang, Guiying; Jia, Wenwen; Yu, Yangyang; Duan, Tao; Wu, Minjuan; Liu, Houqi; Gao, Shaorong; Kang, Jiuhong
2015-01-01
The maturation of induced pluripotent stem cells (iPS) is one of the limiting steps of somatic cell reprogramming, but the underlying mechanism is largely unknown. Here, we reported that knockdown of histone deacetylase 2 (HDAC2) specifically promoted the maturation of iPS cells. Further studies showed that HDAC2 knockdown significantly increased histone acetylation, facilitated TET1 binding and DNA demethylation at the promoters of iPS cell maturation-related genes during the transition of pre-iPS cells to a fully reprogrammed state. We also found that HDAC2 competed with TET1 in the binding of the RbAp46 protein at the promoters of maturation genes and knockdown of TET1 markedly prevented the activation of these genes. Collectively, our data not only demonstrated a novel intrinsic mechanism that the HDAC2-TET1 switch critically regulates iPS cell maturation, but also revealed an underlying mechanism of the interplay between histone acetylation and DNA demethylation in gene regulation. PMID:25934799
DEFF Research Database (Denmark)
Nielsen, Anne Veller Friis; Andric, Pavle; Munk Nielsen, Per
2014-01-01
A systematic study of the influence of carrier particle size (500 − 850 μ m) and enzyme load (26 200 − 66 100 lipase activity units (LU)/g dry carrier) on the content and activity of Candida antarctica lipase B (CALB) immobilized by adsorption onto macroporous poly(methyl methacrylate) (PMM...
International Nuclear Information System (INIS)
Sato, Kazuhito; Yoshinari, Tomohiro; Kintaichi, Yoshiaki; Haneda, Masaaki; Hamada, Hideaki
2003-01-01
The addition of small amounts of rhodium enhanced the activity of Ag/Al 2 O 3 catalyst for the selective reduction of NO with decane at low temperatures. The Rh-promoted Ag/Al 2 O 3 showed its high performance even in the presence of low concentrations of SO 2 . Based on the catalytic activity for elementary reactions, it was suggested that the role of added rhodium is to enhance the reaction between NO x and decane-derived species, leading to NO reduction. Catalyst characterization by UV-Vis spectroscopy indicated that the major silver species on Rh-promoted Ag/Al 2 O 3 is Ag nn δ+ clusters, which would be responsible for the high activity. FT-IR measurements revealed that the formation rate of isocyanate species, which is a major reaction intermediate, is higher on Rh-promoted Ag/Al 2 O 3
Analysis of the promoters involved in enterocin AS-48 expression.
Cebrián, Rubén; Rodríguez-Ruano, Sonia; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes; Montalbán-López, Manuel
2014-01-01
The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene) and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2) and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2) promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2) promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.
Analysis of the promoters involved in enterocin AS-48 expression.
Directory of Open Access Journals (Sweden)
Rubén Cebrián
Full Text Available The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2 and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2 promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2 promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.
Asymmetric Arginine dimethylation of Epstein-Barr virus nuclear antigen 2 promotes DNA targeting
International Nuclear Information System (INIS)
Gross, Henrik; Barth, Stephanie; Palermo, Richard D.; Mamiani, Alfredo; Hennard, Christine; Zimber-Strobl, Ursula; West, Michelle J.; Kremmer, Elisabeth; Graesser, Friedrich A.
2010-01-01
The Epstein-Barr virus (EBV) growth-transforms B-lymphocytes. The virus-encoded nuclear antigen 2 (EBNA2) is essential for transformation and activates gene expression by association with DNA-bound transcription factors such as RBPJκ (CSL/CBF1). We have previously shown that EBNA2 contains symmetrically dimethylated Arginine (sDMA) residues. Deletion of the RG-repeat results in a reduced ability of the virus to immortalise B-cells. We now show that the RG repeat also contains asymmetrically dimethylated Arginines (aDMA) but neither non-methylated (NMA) Arginines nor citrulline residues. We demonstrate that only aDMA-containing EBNA2 is found in a complex with DNA-bound RBPJκ in vitro and preferentially associates with the EBNA2-responsive EBV C, LMP1 and LMP2A promoters in vivo. Inhibition of methylation in EBV-infected cells results in reduced expression of the EBNA2-regulated viral gene LMP1, providing additional evidence that methylation is a prerequisite for DNA-binding by EBNA2 via association with the transcription factor RBPJκ.
Guo, Si-Xuan; Li, Fengwang; Chen, Lu; MacFarlane, Douglas R; Zhang, Jie
2018-04-18
Electrochemical reduction of CO 2 is a promising method to convert CO 2 into fuels or useful chemicals, such as carbon monoxide (CO), hydrocarbons, and alcohols. In this study, nanostructured Ag was obtained by electrodeposition of Ag in the presence of a Keggin type polyoxometalate, [PMo 12 O 40 ] 3- (PMo). Metallic Ag is formed upon reduction of Ag + . Adsorption of PMo on the surface of the newly formed Ag lowers its surface energy thus stabilizes the nanostructure. The electrocatalytic performance of this Ag-PMo nanocomposite for CO 2 reduction was evaluated in a CO 2 saturated dimethylformamide medium containing 0.1 M [ n-Bu 4 N]PF 6 and 0.5% (v/v) added H 2 O. The results show that this Ag-PMo nanocomposite can catalyze the reduction of CO 2 to CO with an onset potential of -1.70 V versus Fc 0/+ , which is only 0.29 V more negative than the estimated reversible potential (-1.41 V) for this process and 0.70 V more positive than that on bulk Ag metal. High faradaic efficiencies of about 90% were obtained over a wide range of applied potentials. A Tafel slope of 60 mV dec -1 suggests that rapid formation of *CO 2 •- is followed by the rate-determining protonation step. This is consistent with the voltammetric data which suggest that the reduced PMo interacts strongly with CO 2 (and presumably CO 2 •- ) and hence promotes the formation of CO 2 •- .
RNA-binding proteins ZFP36L1 and ZFP36L2 promote cell quiescence.
Galloway, Alison; Saveliev, Alexander; Łukasiak, Sebastian; Hodson, Daniel J; Bolland, Daniel; Balmanno, Kathryn; Ahlfors, Helena; Monzón-Casanova, Elisa; Mannurita, Sara Ciullini; Bell, Lewis S; Andrews, Simon; Díaz-Muñoz, Manuel D; Cook, Simon J; Corcoran, Anne; Turner, Martin
2016-04-22
Progression through the stages of lymphocyte development requires coordination of the cell cycle. Such coordination ensures genomic integrity while cells somatically rearrange their antigen receptor genes [in a process called variable-diversity-joining (VDJ) recombination] and, upon successful rearrangement, expands the pools of progenitor lymphocytes. Here we show that in developing B lymphocytes, the RNA-binding proteins (RBPs) ZFP36L1 and ZFP36L2 are critical for maintaining quiescence before precursor B cell receptor (pre-BCR) expression and for reestablishing quiescence after pre-BCR-induced expansion. These RBPs suppress an evolutionarily conserved posttranscriptional regulon consisting of messenger RNAs whose protein products cooperatively promote transition into the S phase of the cell cycle. This mechanism promotes VDJ recombination and effective selection of cells expressing immunoglobulin-μ at the pre-BCR checkpoint. Copyright © 2016, American Association for the Advancement of Science.
BF3·Et2O promoted conjugate addition of ethanethiol to electron-deficient alkynes
Institute of Scientific and Technical Information of China (English)
Qing Fa Zhou; Xue Ping Chu; Shen Zhao; Tao Lu; Wei Fang Tang
2012-01-01
An effective method for the synthesis of vinyl thioethers through the conjugate addition of ethanethiol to electron-deficient alkynes promoted by BF3·Et2O has been developed.Electron-deficient internal alkynes react with ethanethiol in this system to yield mainly Z-isomer of vinyl thioether adducts,while electron-deficient terminal alkynes afford mainly E-isomer of vinyl thioether adducts.
Expanding the substantial interactome of NEMO using protein microarrays.
LENUS (Irish Health Repository)
Fenner, Beau J
2010-01-01
Signal transduction by the NF-kappaB pathway is a key regulator of a host of cellular responses to extracellular and intracellular messages. The NEMO adaptor protein lies at the top of this pathway and serves as a molecular conduit, connecting signals transmitted from upstream sensors to the downstream NF-kappaB transcription factor and subsequent gene activation. The position of NEMO within this pathway makes it an attractive target from which to search for new proteins that link NF-kappaB signaling to additional pathways and upstream effectors. In this work, we have used protein microarrays to identify novel NEMO interactors. A total of 112 protein interactors were identified, with the most statistically significant hit being the canonical NEMO interactor IKKbeta, with IKKalpha also being identified. Of the novel interactors, more than 30% were kinases, while at least 25% were involved in signal transduction. Binding of NEMO to several interactors, including CALB1, CDK2, SAG, SENP2 and SYT1, was confirmed using GST pulldown assays and coimmunoprecipitation, validating the initial screening approach. Overexpression of CALB1, CDK2 and SAG was found to stimulate transcriptional activation by NF-kappaB, while SYT1 overexpression repressed TNFalpha-dependent NF-kappaB transcriptional activation in human embryonic kidney cells. Corresponding with this finding, RNA silencing of CDK2, SAG and SENP2 reduced NF-kappaB transcriptional activation, supporting a positive role for these proteins in the NF-kappaB pathway. The identification of a host of new NEMO interactors opens up new research opportunities to improve understanding of this essential cell signaling pathway.
Salmon, J.; Jorna, M.; Hume, C.; Arundell, L.; Chahine, N.; Tienstra, M.L.; Crawford, D.
2011-01-01
Translational or implementation research that assesses the effectiveness of strategies to promote health behaviours among children that have been previously tested under 'ideal' conditions is rarely reported. Switch-2-Activity aimed to examine the effectiveness of an abbreviated programme delivered
McFie, Pamela J.; Banman, Shanna L.; Kary, Steven; Stone, Scot J.
2011-01-01
Triacylglycerol (TG) is the major form of stored energy in eukaryotic organisms and is synthesized by two distinct acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes, DGAT1 and DGAT2. Both DGAT enzymes reside in the endoplasmic reticulum (ER), but DGAT2 also co-localizes with mitochondria and lipid droplets. In this report, we demonstrate that murine DGAT2 is part of a multimeric complex consisting of several DGAT2 subunits. We also identified the region of DGAT2 responsible for its localization to the ER. A DGAT2 mutant lacking both its transmembrane domains, although still associated with membranes, was absent from the ER and instead localized to mitochondria. Unexpectedly, this mutant was still active and capable of interacting with lipid droplets to promote TG storage. Additional experiments indicated that the ER targeting signal was present in the first transmembrane domain (TMD1) of DGAT2. When fused to a fluorescent reporter, TMD1, but not TMD2, was sufficient to target mCherry to the ER. Finally, the interaction of DGAT2 with lipid droplets was dependent on the C terminus of DGAT2. DGAT2 mutants, in which regions of the C terminus were either truncated or specific regions were deleted, failed to co-localize with lipid droplets when cells were oleate loaded to stimulate TG synthesis. Our findings demonstrate that DGAT2 is capable of catalyzing TG synthesis and promote its storage in cytosolic lipid droplets independent of its localization in the ER. PMID:21680734
Zhang, Weibin; Miley, Natasha; Zastrow, Michael S; MacQueen, Amy J; Sato, Aya; Nabeshima, Kentaro; Martinez-Perez, Enrique; Mlynarczyk-Evans, Susanna; Carlton, Peter M; Villeneuve, Anne M
2012-01-01
During meiosis, chromosomes align with their homologous pairing partners and stabilize this alignment through assembly of the synaptonemal complex (SC). Since the SC assembles cooperatively yet is indifferent to homology, pairing and SC assembly must be tightly coordinated. We identify HAL-2 as a key mediator in this coordination, showing that HAL-2 promotes pairing largely by preventing detrimental effects of SC precursors (SYP proteins). hal-2 mutants fail to establish pairing and lack multiple markers of chromosome movement mediated by pairing centers (PCs), chromosome sites that link chromosomes to cytoplasmic microtubules through nuclear envelope-spanning complexes. Moreover, SYP proteins load inappropriately along individual unpaired chromosomes in hal-2 mutants, and markers of PC-dependent movement and function are restored in hal-2; syp double mutants. These and other data indicate that SYP proteins can impede pairing and that HAL-2 promotes pairing predominantly but not exclusively by counteracting this inhibition, thereby enabling activation and regulation of PC function. HAL-2 concentrates in the germ cell nucleoplasm and colocalizes with SYP proteins in nuclear aggregates when SC assembly is prevented. We propose that HAL-2 functions to shepherd SYP proteins prior to licensing of SC assembly, preventing untimely interactions between SC precursors and chromosomes and allowing sufficient accumulation of precursors for rapid cooperative assembly upon homology verification.
Energy Technology Data Exchange (ETDEWEB)
Li, Zhi [Department of Human Anatomy and Histoembryology, College of Basic Medical Sciences, Jilin University (China); Li, Youjun, E-mail: liyoujunn@126.com [Department of Human Anatomy and Histoembryology, College of Basic Medical Sciences, Jilin University (China); Wang, Nan; Yang, Lifeng; Zhao, Wei; Zeng, Xiandong [Central Hospital Affiliated to Shenyang Medical College (China)
2016-03-18
miR-130b was significantly up-regulated in osteosarcoma (OS) cells. Naked cuticle homolog 2 (NKD2) inhibited tumor growth and metastasis in OS by suppressing Wnt signaling. We used three miRNA target analysis tools to identify potential targets of miR-130b, and found that NKD2 is a potential target of miR-130b. Based on these findings, we hypothesize that miR-130b might target NKD2 and regulate the Wnt signaling to promote OS growth. We detected the expression of miR-130b and NKD2 mRNA and protein by quantitative Real-Time PCR (qRT-PCR) and western blot assays, respectively, and found up-regulation of miR-130b and down-regulation of NKD2 mRNA and protein exist in OS cell lines. MTT and flow cytometry assays showed that miR-130b inhibitors inhibit proliferation and promote apoptosis in OS cells. Furthermore, we showed that NKD2 is a direct target of miR-130b, and miR-130b regulated proliferation and apoptosis of OS cells by targeting NKD2. We further investigated whether miR-130b and NKD2 regulate OS cell proliferation and apoptosis by inhibiting Wnt signaling, and the results confirmed our speculation that miR-130b targets NKD2 and regulates the Wnt signaling to promote proliferation and inhibit apoptosis of OS cells. These findings will offer new clues for OS development and progression, and novel potential therapeutic targets for OS. - Highlights: • miR-130b is up-regulated and NKD2 is down-regulated in osteosarcoma cell lines. • Down-regulation of miR-130b inhibits proliferation of osteosarcoma cells. • Down-regulation of miR-130b promotes apoptosis of osteosarcoma cells. • miR-130b directly targets NKD2. • NKD2 regulates OS cell proliferation and apoptosis by inhibiting the Wnt signaling.
International Nuclear Information System (INIS)
Li, Zhi; Li, Youjun; Wang, Nan; Yang, Lifeng; Zhao, Wei; Zeng, Xiandong
2016-01-01
miR-130b was significantly up-regulated in osteosarcoma (OS) cells. Naked cuticle homolog 2 (NKD2) inhibited tumor growth and metastasis in OS by suppressing Wnt signaling. We used three miRNA target analysis tools to identify potential targets of miR-130b, and found that NKD2 is a potential target of miR-130b. Based on these findings, we hypothesize that miR-130b might target NKD2 and regulate the Wnt signaling to promote OS growth. We detected the expression of miR-130b and NKD2 mRNA and protein by quantitative Real-Time PCR (qRT-PCR) and western blot assays, respectively, and found up-regulation of miR-130b and down-regulation of NKD2 mRNA and protein exist in OS cell lines. MTT and flow cytometry assays showed that miR-130b inhibitors inhibit proliferation and promote apoptosis in OS cells. Furthermore, we showed that NKD2 is a direct target of miR-130b, and miR-130b regulated proliferation and apoptosis of OS cells by targeting NKD2. We further investigated whether miR-130b and NKD2 regulate OS cell proliferation and apoptosis by inhibiting Wnt signaling, and the results confirmed our speculation that miR-130b targets NKD2 and regulates the Wnt signaling to promote proliferation and inhibit apoptosis of OS cells. These findings will offer new clues for OS development and progression, and novel potential therapeutic targets for OS. - Highlights: • miR-130b is up-regulated and NKD2 is down-regulated in osteosarcoma cell lines. • Down-regulation of miR-130b inhibits proliferation of osteosarcoma cells. • Down-regulation of miR-130b promotes apoptosis of osteosarcoma cells. • miR-130b directly targets NKD2. • NKD2 regulates OS cell proliferation and apoptosis by inhibiting the Wnt signaling.
Lithium niobate bulk crystallization promoted by CO{sub 2} laser radiation
Energy Technology Data Exchange (ETDEWEB)
Ferreira, N.M., E-mail: nmferreira@ua.pt [i3N - Aveiro, Physics Department, Aveiro University, Campus Universitario de Santiago, 3810-193 Aveiro (Portugal); Costa, F.M. [i3N - Aveiro, Physics Department, Aveiro University, Campus Universitario de Santiago, 3810-193 Aveiro (Portugal); Nogueira, R.N. [Instituto de Telecomunicacoes, 3810-193 Aveiro (Portugal); Graca, M.P.F. [i3N - Aveiro, Physics Department, Aveiro University, Campus Universitario de Santiago, 3810-193 Aveiro (Portugal)
2012-09-15
Highlights: Black-Right-Pointing-Pointer Crystallization of LiNbO{sub 3} nanocrystals in a SiO{sub 2} matrix by CO{sub 2} laser irradiation process. Black-Right-Pointing-Pointer Samples heat-treated at 650 Degree-Sign C (4 h) and laser treated (4 W/500 s) show similar morphology. Black-Right-Pointing-Pointer Glass-ceramics produced by laser process requires a very low processing time. - Abstract: The crystallization induced by laser radiation is a very promising technique to promote glass/ceramic transformation, being already used to produce crystalline patterns on glass surfaces. In this work, a SiO{sub 2}-Li{sub 2}O-Nb{sub 2}O{sub 5} glass, prepared by the sol-gel route, was submitted to CO{sub 2} laser radiation and conventional heat-treatments in order to induce the LiNbO{sub 3} crystallization. The structure and morphology of the samples prepared by both routes was analyzed as a function of exposure time, radiation power and heat-treatment temperatures by XRD, Raman spectroscopy and SEM. The results reveal a correlation between the crystallization degree of LiNbO{sub 3} particles and glass matrix with the heat treatment type and experimental parameters. An heat-treatment at 650 Degree-Sign C/4 h was necessary to induce crystallization in heat treatments samples while 4 W/500 s was enough for laser radiation ones, corresponding a reduction time processing of {approx}14 000 s.
Mono-(2-Ethylhexyl Phthalate Promotes Pro-Labor Gene Expression in the Human Placenta.
Directory of Open Access Journals (Sweden)
Ximi K Wang
Full Text Available Women exposed to phthalates during pregnancy are at increased risk for delivering preterm, but the mechanism behind this relationship is unknown. Placental corticotropin-releasing hormone (CRH and cyclooxygenase-2 (COX-2 are key mediators of parturition and are regulated by the non-canonical NF-kB (RelB/p52 signaling pathway. In this study, we demonstrate that one of the major phthalate metabolites, mono-(2-ethylhexyl-phthalate (MEHP, increased CRH and COX-2 mRNA and protein abundance in a dose-dependent manner in primary cultures of cytotrophoblast. This was coupled with an increase in nuclear import of RelB/p52 and its association with the CRH and COX-2 promoters. Silencing of NF-kB inducing kinase, a central signaling component of the non-canonical NF-kB pathway, blocked MEHP-induced upregulation of CRH and COX-2. These results suggest a potential mechanism mediated by RelB/p52 by which phthalates could prematurely induce pro-labor gene activity and lead to preterm birth.
Directory of Open Access Journals (Sweden)
Gao Chen
2012-02-01
Full Text Available Abstract Background The human papillomavirus (HPV E2 protein is a multifunctional DNA-binding protein. The transcriptional activity of HPV E2 is mediated by binding to its specific binding sites in the upstream regulatory region of the HPV genomes. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. Under the control of HPV-2 LCR, co-expression of the mutated HPV E2 induced an increased activity on the viral early promoter. In the present study, a series of mammalian expression plasmids encoding E2 proteins with one to five amino acid (aa substitutions for these mutations were constructed and transfected into HeLa, C33A and SiHa cells. Results CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. To study the effect of E2 mutations on its DNA-binding activity, a serial of recombinant E2 proteins with various lengths were expressed and purified. Electrophoresis mobility shift assays (EMSA showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. Conclusions These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation.
Neiger, Brad L; Thackeray, Rosemary; Fagen, Michael C
2011-03-01
Priority setting is an important component of systematic planning in health promotion and also factors into the development of a comprehensive evaluation plan. The basic priority rating (BPR) model was introduced more than 50 years ago and includes criteria that should be considered in any priority setting approach (i.e., use of predetermined criteria, standardized comparisons, and a rubric that controls bias). Although the BPR model has provided basic direction in priority setting, it does not represent the broad array of data currently available to decision makers. Elements in the model also give more weight to the impact of communicable diseases compared with chronic diseases. For these reasons, several modifications are recommended to improve the BPR model and to better assist health promotion practitioners in the priority setting process. The authors also suggest a new name, BPR 2.0, to represent this revised model.
Energy Technology Data Exchange (ETDEWEB)
Liu, Lingling, E-mail: liulingling2012@163.com [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Luo, Qing, E-mail: qing.luo@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Sun, Jinghui, E-mail: sunjhemail@163.com [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Wang, Aoli, E-mail: leaf13332@163.com [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Shi, Yisong, E-mail: shiyis@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Ju, Yang, E-mail: ju@mech.nagoya-u.ac.jp [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Morita, Yasuyuki, E-mail: morita@mech.nagoya-u.ac.jp [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Song, Guanbin, E-mail: song@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China)
2017-06-15
Migration of bone marrow-derived mesenchymal stem cells (BMSCs) plays an important role in many physiological and pathological settings, including wound healing. During the migration of BMSCs through interstitial tissues, the movement of the nucleus must be coordinated with the cytoskeletal dynamics, which in turn affects the cell migration efficiency. Our previous study indicated that osteopontin (OPN) significantly promotes the migration of rat BMSCs. However, the nuclear behaviors and involved molecular mechanisms in OPN-mediated BMSC migration are largely unclear. In the present study, using an atomic force microscope (AFM), we found that OPN could decrease the nuclear stiffness of BMSCs and reduce the expression of lamin A/C, which is the main determinant of nuclear stiffness. Increased lamin A/C expression attenuates BMSC migration by increasing nuclear stiffness. Decreased lamin A/C expression promotes BMSC migration by decreasing nuclear stiffness. Furthermore, OPN promotes BMSC migration by diminishing lamin A/C expression and decreasing nuclear stiffness via the FAK-ERK1/2 signaling pathway. This study provides strong evidence for the role of nuclear mechanics in BMSC migration as well as new insight into the molecular mechanisms of OPN-promoted BMSC migration. - Highlights: • OPN promotes BMSC migration by decreasing nuclear stiffness. • Lamin A/C knockdown decreases, while its overexpression enhances, the nuclear stiffness of BMSCs. • Lamin A/C overexpression and downregulation affect the migration of BMSCs. • OPN diminishes lamin A/C expression and decreases nuclear stiffness through the activation of the FAK-ERK1/2 signaling pathway. • OPN promotes BMSC migration via the FAK-ERK1/2 signaling pathway.
International Nuclear Information System (INIS)
Liu, Lingling; Luo, Qing; Sun, Jinghui; Wang, Aoli; Shi, Yisong; Ju, Yang; Morita, Yasuyuki; Song, Guanbin
2017-01-01
Migration of bone marrow-derived mesenchymal stem cells (BMSCs) plays an important role in many physiological and pathological settings, including wound healing. During the migration of BMSCs through interstitial tissues, the movement of the nucleus must be coordinated with the cytoskeletal dynamics, which in turn affects the cell migration efficiency. Our previous study indicated that osteopontin (OPN) significantly promotes the migration of rat BMSCs. However, the nuclear behaviors and involved molecular mechanisms in OPN-mediated BMSC migration are largely unclear. In the present study, using an atomic force microscope (AFM), we found that OPN could decrease the nuclear stiffness of BMSCs and reduce the expression of lamin A/C, which is the main determinant of nuclear stiffness. Increased lamin A/C expression attenuates BMSC migration by increasing nuclear stiffness. Decreased lamin A/C expression promotes BMSC migration by decreasing nuclear stiffness. Furthermore, OPN promotes BMSC migration by diminishing lamin A/C expression and decreasing nuclear stiffness via the FAK-ERK1/2 signaling pathway. This study provides strong evidence for the role of nuclear mechanics in BMSC migration as well as new insight into the molecular mechanisms of OPN-promoted BMSC migration. - Highlights: • OPN promotes BMSC migration by decreasing nuclear stiffness. • Lamin A/C knockdown decreases, while its overexpression enhances, the nuclear stiffness of BMSCs. • Lamin A/C overexpression and downregulation affect the migration of BMSCs. • OPN diminishes lamin A/C expression and decreases nuclear stiffness through the activation of the FAK-ERK1/2 signaling pathway. • OPN promotes BMSC migration via the FAK-ERK1/2 signaling pathway.
De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C
2017-10-17
Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Rohimah Mohamud
2017-12-01
Full Text Available Synthetic glycine coated 50 nm polystyrene nanoparticles (NP (PS50G, unlike ambient NP, do not promote pulmonary inflammation, but instead, render lungs resistant to the development of allergic airway inflammation. In this study, we show that PS50G modulate the frequency and phenotype of regulatory T cells (Treg in the lung, specifically increasing the proportion of tumor necrosis factor 2 (TNFR2 expressing Treg. Mice pre-exposed to PS50G, which were sensitized and then challenged with an allergen a month later, preferentially expanded TNFR2+Foxp3+ Treg, which further expressed enhanced levels of latency associated peptide and cytotoxic T-lymphocyte associated molecule-4. Moreover, PS50G-induced CD103+ dendritic cell activation in the lung was associated with the proliferative expansion of TNFR2+Foxp3+ Treg. These findings provide the first evidence that engineered NP can promote the selective expansion of maximally suppressing TNFR2+Foxp3+ Treg and further suggest a novel mechanism by which NP may promote healthy lung homeostasis.
Ho, Jia-Jung; Ghosh, Ayanjeet; Zhang, Tianqi O; Zanni, Martin T
2018-02-08
Two-dimensional sum-frequency generation spectroscopy (2D SFG) is used to study the structures of the pentapeptide FGAIL on hydrogen bond promoting surfaces. FGAIL is the most amyloidogenic portion of the human islet amyloid polypeptide (hIAPP or amylin). In the presence of a pure gold surface, FGAIL does not form ordered structures. When the gold is coated with a self-assembled monolayer of mercaptobenzoic acid (MBA), 2D SFG spectra reveal features associated with β-sheets. Also observed are cross peaks between the FGAIL peptides and the carboxylic acid groups of the MBA monolayer, indicating that the peptides are in close contact with the surface headgroups. In the second set of samples, FGAIL peptides chemically ligated to the MBA monolayer also exhibited β-sheet features but with a much simpler spectrum. From simulations of the experiments, we conclude that the hydrogen bond promoting surface catalyzes the formation of both parallel and antiparallel β-sheet structures with several different orientations. When ligated, parallel sheets with only a single orientation are the primary structure. Thus, this hydrogen bond promoting surface creates a heterogeneous distribution of polymorph structures, consistent with a concentration effect that allows nucleation of many different amyloid seeding structures. A single well-defined seed favors one polymorph over the others, showing that the concentrating influence of a membrane can be counterbalanced by factors that favor directed fiber growth. These experiments lay the foundation for the measurement and interpretation of β-sheet structures with heterodyne-detected 2D SFG spectroscopy. The results of this model system suggest that a heterogeneous distribution of polymorphs found in nature are an indication of nonselective amyloid aggregation whereas a narrow distribution of polymorph structures is consistent with a specific protein or lipid interaction that directs fiber growth.
Energy Technology Data Exchange (ETDEWEB)
Zhao, Cunzhen; Chen, Xiaochang; Wu, Wenjing; Wang, Wusu; Pang, Weijun; Yang, Gongshe, E-mail: gsyang999@hotmail.com
2016-05-15
Intramuscular fat (IMF) has been demonstrated as one of the crucial factors of livestock meat quality. The MAT2B protein with MAT2α catalyzes the formation of methyl donor S- adenosylmethionine (SAMe) to mediate cell metabolism including proliferation and apoptosis. However, the regulatory effect of MAT2B on IMF deposition is still unclear. In this study, the effect of MAT2B on adipogenesis and its potential mechanism during porcine intramuscular preadipocyte differentiation was studied. The results showed that overexpression of MAT2B promoted adipogenesis and significantly up-regulated the mRNA and protein levels of adipogenic marker genes including FASN, PPARγ and aP2, consistently, knockdown of MAT2B inhibited lipid accumulation and down-regulated the mRNA and protein levels of the above genes. Furthermore, flow cytometry and EdU-labeling assay indicated that MAT2B regulate adipogenesis was partly due to influence intracellular SAMe levels and further affect cell clonal expansion. Also, increased expression of MAT2B activated the phosphorylations of AKT and ERK1/2, whereas knockdown of MAT2B blocked AKT signaling and repressed the phosphorylation of ERK1/2. Moreover, the inhibitory effect of LY294002 (a specific PI3K inhibitor) on the activities of AKT and ERK1/2 was partially recovered by overexpression of MAT2B in porcine intramuscular adipocytes. Finally, Co-IP experiments showed that MAT2B can directly interact with AKT. Taken together, our findings suggested that MAT2B acted as a positive regulator through modifying SAMe levels as well as activating AKT/ERK signaling pathway to promote porcine intramuscular adipocyte differentiation. - Highlights: • MAT2B up-regulates the expression of adipogenic marker genes and promotes porcine intramuscular preadipocyte differentiation. • MAT2B influences intracellular SAMe levels and further affects cell clonal expansion. • MAT2B interacts with AKT and activates AKT/ERK signaling pathway.
Directory of Open Access Journals (Sweden)
Jimena E. Díaz
2016-09-01
Full Text Available The first general procedure for the synthesis of 5 to 7-membered 1-aryl-2-iminoazacycloalkanes is presented, by microwave-assisted ring closure of ω-arylaminonitriles promoted by polyphosphoric acid (PPA esters. 1-Aryl-2-iminopyrrolidines were easily prepared from the acyclic precursors employing a chloroformic solution of ethyl polyphosphate (PPE. The use of trimethylsilyl polyphosphate (PPSE in solvent-free conditions allowed for the synthesis of 1-aryl-2-iminopiperidines and hitherto unreported 1-aryl-2-iminoazepanes. The cyclization reaction involves good to high yields and short reaction times, and represents a novel application of PPA esters in heterocyclic synthesis.
A drive through Web 2.0: an exploration of driving safety promotion on Facebook™.
Apatu, Emma J I; Alperin, Melissa; Miner, Kathleen R; Wiljer, David
2013-01-01
This study explored Facebook™ to capture the prevalence of driving safety promotion user groups, obtain user demographic information, to understand if Facebook™ user groups influence reported driving behaviors, and to gather a sense of perceived effectiveness of Facebook™ for driving safety promotion targeted to young adults. In total, 96 driving safety Facebook™ groups (DSFGs) were identified with a total of 33,368 members, 168 administrators, 156 officers, 1,598 wall posts representing 12 countries. A total of 85 individuals participated in the survey. Demographic findings of this study suggest that driving safety promotion can be targeted to young and older adults. Respondents' ages ranged from 18 to 66 years. A total of 62% of respondents aged ≤ 24 years and 57.8% of respondents aged ≥ 25 years reported changing their driving-related behaviors as a result of reading information on the DSFGs to which they belonged. A higher proportion of respondents ≥ 25 years were significantly more likely to report Facebook™ and YouTube™ as an effective technology for driving safety promotion. This preliminary study indicates that DSFGs may be effective tools for driving safety promotion among young adults. More research is needed to understand the cognition of Facebook™ users as it relates to adopting safe driving behavior. The findings from this study present descriptive data to guide public health practitioners for future health promotion activities on Facebook™.
Zhang, Jie; Zhang, Changbin; He, Hong
2015-09-01
OMS-2 nanorod catalysts were synthesized by a hydrothermal redox reaction method using MnSO4 (OMS-2-SO4) and Mn(CH3COO)2 (OMS-2-AC) as precursors. SO4(2-)-doped OMS-2-AC catalysts with different SO4(2-) concentrations were prepared next by adding (NH4)2SO4 solution into OMS-2-AC samples to investigate the effect of the anion SO4(2-) on the OMS-2-AC catalyst. All catalysts were then tested for the catalytic oxidation of ethanol. The OMS-2-SO4 catalyst synthesized demonstrated much better activity than OMS-2-AC. The SO4(2-) doping greatly influenced the activity of the OMS-2-AC catalyst, with a dramatic promotion of activity for suitable concentration of SO4(2-) (SO4/catalyst=0.5% W/W). The samples were characterized by X-ray diffraction (XRD), field emission scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), inductively coupled plasma optical emission spectroscopy (ICP-OES), NH3-TPD and H2-TPR techniques. The results showed that the presence of a suitable amount of SO4(2-) species in the OMS-2-AC catalyst could decrease the Mn-O bond strength and also enhance the lattice oxygen and acid site concentrations, which then effectively promoted the catalytic activity of OMS-2-AC toward ethanol oxidation. Thus it was confirmed that the better catalytic performance of OMS-2-SO4 compared to OMS-2-AC is due to the presence of some residual SO4(2-) species in OMS-2-SO4 samples. Copyright © 2015. Published by Elsevier B.V.
What do health-promoting schools promote?
DEFF Research Database (Denmark)
Simovska, Venka
2012-01-01
-promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...
Energy Technology Data Exchange (ETDEWEB)
Yuasa, Katsutoshi; Aoki, Natsumi; Hijikata, Takao, E-mail: hijikata@musashino-u.ac.jp
2015-08-15
Single-nucleotide polymorphisms associated with type 2 diabetes (T2D) have been identified in Jazf1, which is also involved in the oncogenesis of endometrial stromal tumors. To understand how Jazf1 variants confer a risk of tumorigenesis and T2D, we explored the functional roles of JAZF1 and searched for JAZF1 target genes in myogenic C2C12 cells. Consistent with an increase of Jazf1 transcripts during myoblast proliferation and their decrease during myogenic differentiation in regenerating skeletal muscle, JAZF1 overexpression promoted cell proliferation, whereas it retarded myogenic differentiation. Examination of myogenic genes revealed that JAZF1 overexpression transcriptionally repressed MEF2C and MRF4 and their downstream genes. AMP deaminase1 (AMPD1) was identified as a candidate for JAZF1 target by gene array analysis. However, promoter assays of Ampd1 demonstrated that mutation of the putative binding site for the TR4/JAZF1 complex did not alleviate the repressive effects of JAZF1 on promoter activity. Instead, JAZF1-mediated repression of Ampd1 occurred through the MEF2-binding site and E-box within the Ampd1 proximal regulatory elements. Consistently, MEF2C and MRF4 expression enhanced Ampd1 promoter activity. AMPD1 overexpression and JAZF1 downregulation impaired AMPK phosphorylation, while JAZF1 overexpression also reduced it. Collectively, these results suggest that aberrant JAZF1 expression contributes to the oncogenesis and T2D pathogenesis. - Highlights: • JAZF1 promotes cell cycle progression and proliferation of myoblasts. • JAZF1 retards myogenic differentiation and hypertrophy of myotubes. • JAZF1 transcriptionally represses Mef2C and Mrf4 expression. • JAZF1 has an impact on the phosphorylation of AMPK.
Lin, Fei-Xiang; Du, Shi-Xin; Liu, De-Zhong; Hu, Qin-Xiao; Yu, Guo-Yong; Wu, Chu-Cheng; Zheng, Gui-Zhou; Xie, Da; Li, Xue-Dong; Chang, Bo
2016-01-01
Naringin is an active compound extracted from Rhizoma Drynariae, and studies have revealed that naringin can promote proliferation and osteogenic differentiation of bone marrow stromal cells (BMSCs). In this study, we explored whether naringin could promote osteogenic differentiation of BMSCs by upregulating Foxc2 expression via the Indian hedgehog (IHH) signaling pathway. BMSCs were cultured in basal medium, basal medium with naringin, osteogenic induction medium, osteogenic induction medium with naringin and osteogenic induction medium with naringin in the presence of the IHH inhibitor cyclopamine (CPE). We examined cell proliferation by using a WST-8 assay, and differentiation by Alizarin Red S staining (for mineralization) and alkaline phosphatase (ALP) activity. In addition, we detected core-binding factor α1 (Cbfα1), osteocalcin (OCN), bone sialoprotein (BSP), peroxisome proliferation-activated receptor gamma 2 (PPARγ2) and Foxc2 expression by using RT-PCR. We also determined Foxc2 and IHH protein levels by western blotting. Naringin increased the mineralization of BMSCs, as shown by Alizarin red S assays, and induced ALP activity. In addition, naringin significantly increased the mRNA levels of Foxc2, Cbfα1, OCN, and BSP, while decreasing PPARγ2 mRNA levels. Furthermore, the IHH inhibitor CPE inhibited the osteogenesis-potentiating effects of naringin. Naringin increased Foxc2 and stimulated the activation of IHH, as evidenced by increased expression of proteins that were inhibited by CPE. Our findings indicate that naringin promotes osteogenic differentiation of BMSCs by up-regulating Foxc2 expression via the IHH signaling pathway.
International Nuclear Information System (INIS)
Patel, Divya; Chaudhary, Jaideep
2012-01-01
Highlights: ► E2A, considered as a tumor suppressor is highly expressed in prostate cancer. ► Silencing of E2A attenuates cell proliferation and promotes apoptosis. ► E2A regulates c-myc, Id1, Id3 and CDKN1A expression. ► Loss of E2A promotes doxorubicin dependent apoptosis in prostate cancer cells. ► Results suggest that E2A acts as a tumor promoter at least in prostate cancer. -- Abstract: E2A (TCF3) is a multifunctional basic helix loop helix (bHLH), transcription factor. E2A regulates transcription of target genes by homo- or heterodimerization with cell specific bHLH proteins. In general, E2A promotes cell differentiation, acts as a negative regulator of cell proliferation in normal cells and cancer cell lines and is required for normal B-cell development. Given the diverse biological pathways regulated/influenced by E2A little is known about its expression in cancer. In this study we investigated the expression of E2A in prostate cancer. Unexpectedly, E2A immuno-histochemistry demonstrated increased E2A expression in prostate cancer as compared to normal prostate. Silencing of E2A in prostate cancer cells DU145 and PC3 led to a significant reduction in proliferation due to G1 arrest that was in part mediated by increased CDKN1A(p21) and decreased Id1, Id3 and c-myc. E2A silencing in prostate cancer cell lines also resulted in increased apoptosis due to increased mitochondrial permeability and caspase 3/7 activation. Moreover, silencing of E2A increased sensitivity to doxorubicin induced apoptosis. Based on our results, we propose that E2A could be an upstream regulator of Id1 and c-Myc which are highly expressed in prostate cancer. These results for the first time demonstrate that E2A could in fact acts as a tumor promoter at least in prostate cancer.
Enzyme immobilization and biocatalysis of polysiloxanes
Poojari, Yadagiri
Lipases have been proven to be versatile and efficient biocatalysts which can be used in a broad variety of esterification, transesterification, and ester hydrolysis reactions. Due to the high chemo-, regio-, and stereo-selectivity and the mild conditions of lipase-catalyzed reactions, the vast potential of these biocatalysts for use in industrial applications has been increasingly recognized. Polysiloxanes (silicones) are well known for their unique physico-chemical properties and can be prepared in the form of fluids, elastomers, gels and resins for a wide variety of applications. However, the enzymatic synthesis of silicone polyesters and copolymers is largely unexplored. In the present investigations, an immobilized Candida antarctica lipase B (CALB) on macroporous acrylic resin beads (Novozym-435 RTM) has been successfully employed as a catalyst to synthesize silicone polyesters and copolymers under mild reaction conditions. The silicone aliphatic polyesters and the poly(dimethylsiloxane)--poly(ethylene glycol) (PDMS-PEG) copolymers were synthesized in the bulk (without using a solvent), while the silicone aromatic polyesters, the silicone aromatic polyamides and the poly(epsilon-caprolactone)--poly(dimethylsiloxane)--poly(epsilon-caprolactone) (PCL-PDMS-PCL) triblock copolymers were synthesized in toluene. The synthesized silicone polyesters and copolymers were characterized by Gel Permeation Chromatography (GPC), Fourier Transform Infrared Spectroscopy (FTIR), Thermogravimetric Analysis (TGA), Differential Scanning Calorimetry (DSC) and Wide Angle X-ray Diffraction (WAXD). This dissertation also describes a methodology for physical immobilization of the enzyme pepsin from Porcine stomach mucosa in silicone elastomers utilizing condensation-cure room temperature vulcanization (RTV) of silanol-terminated poly(dimethylsiloxane) (PDMS). The activity and the stability of free pepsin and pepsin immobilized in silicone elastomers were studied with respect to p
Placental Growth Factor Promotes Ovarian Cancer Cell Invasion via ZEB2
Directory of Open Access Journals (Sweden)
Ning Song
2016-01-01
Full Text Available Background/Aims: The aggressive manner of ovarian cancer (OVC cells accounts for the majority of its lethality. Recently, we have shown that placental growth factor (PLGF promotes metastases of OVC cells through miR-543-regulated MMP7. In the current study, we analyzed the effects of PLGF on another cell invasion associated protein, ZEB2, in OVC cells. Methods: The PLGF and ZEB2 levels in OVC tissues were compared to the paired adjacent non-tumor ovary tissue. We modified ZEB2 levels in OVC cells, and examined its effects on PLGF mRNA and protein levels by RT-qPCR and by Western blot, respectively. We also modified PLGF levels in OVC cells, and examined its effects on ZEB2 mRNA and protein levels by RT-qPCR and by Western blot, respectively. Then, we examined the cell invasiveness in PLGF-modified OVC cells in a transwell cell invasion assay. Finally, we used specific signal pathway inhibitors to treat PLGF-modified OVC cells and examined the effects on ZEB2 activation. Results: PLGF and ZEB2 levels were both significantly increased in OVC tissues, compared to the paired adjacent non-tumor ovary tissue. The PLGF and ZEB2 levels were strongly correlated. ZEB2 modification did not alter PLGF levels. Overexpression of PLGF in OVC cells significantly increased ZEB2 levels and cell invasiveness, while PLGF depletion in OVC cells significantly decreased ZEB2 levels and cell invasiveness. Application of a specific MAPK-p38 inhibitor, but not application of specific inhibitors for MAPK-p42/p44, PI3k/Akt, or JNK signaling pathways, to PLGF-overexpressing OVC cells substantially abolished the PLGF-induced ZEB2 activation. Conclusion: PLGF enhances OVC cell invasion through MAPK-p38-dependent activation of ZEB2.
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
Freund's vaccine adjuvant promotes Her2/Neu breast cancer
International Nuclear Information System (INIS)
Cotroneo, Michelle S; Haag, Jill D; Stapel, Nicholas R; Waller, Jordy L; Woditschka, Stephan; Gould, Michael N
2009-01-01
Inflammation has been linked to the etiology of many organ-specific cancers. Indirect evidence suggests a possible role for inflammation in breast cancer. We investigated whether the systemic inflammation induced by Freund's adjuvant (FA) promotes mammary carcinogenesis in a rat model in which cancer is induced by the neu oncogene. The effects of FA on hyperplastic mammary lesions and mammary carcinomas were determined in a neu-induced rat model. The inflammatory response to FA treatment was gauged by measuring acute phase serum haptoglobin. In addition, changes in cell proliferation and apoptosis following FA treatment were assessed. Rats receiving FA developed twice the number of mammary carcinomas as controls. Systemic inflammation following FA treatment is chronic, as shown by a doubling of the levels of the serum biomarker, haptoglobin, 15 days following initial treatment. We also show that this systemic inflammation is associated with the increased growth of hyperplastic mammary lesions. This increased growth results from a higher rate of cellular proliferation in the absence of changes in apoptosis. Our data suggests that systemic inflammation induced by Freund's adjuvant (FA) promotes mammary carcinogenesis. It will be important to determine whether adjuvants currently used in human vaccines also promote breast cancer
McNab, Finlay W; Ewbank, John; Rajsbaum, Ricardo; Stavropoulos, Evangelos; Martirosyan, Anna; Redford, Paul S; Wu, Xuemei; Graham, Christine M; Saraiva, Margarida; Tsichlis, Philip; Chaussabel, Damien; Ley, Steven C; O'Garra, Anne
2013-08-15
Tuberculosis, caused by Mycobacterium tuberculosis, remains a leading cause of mortality and morbidity worldwide, causing ≈ 1.4 million deaths per year. Key immune components for host protection during tuberculosis include the cytokines IL-12, IL-1, and TNF-α, as well as IFN-γ and CD4(+) Th1 cells. However, immune factors determining whether individuals control infection or progress to active tuberculosis are incompletely understood. Excess amounts of type I IFN have been linked to exacerbated disease during tuberculosis in mouse models and to active disease in patients, suggesting tight regulation of this family of cytokines is critical to host resistance. In addition, the immunosuppressive cytokine IL-10 is known to inhibit the immune response to M. tuberculosis in murine models through the negative regulation of key proinflammatory cytokines and the subsequent Th1 response. We show in this study, using a combination of transcriptomic analysis, genetics, and pharmacological inhibitors, that the TPL-2-ERK1/2 signaling pathway is important in mediating host resistance to tuberculosis through negative regulation of type I IFN production. The TPL-2-ERK1/2 signaling pathway regulated production by macrophages of several cytokines important in the immune response to M. tuberculosis as well as regulating induction of a large number of additional genes, many in a type I IFN-dependent manner. In the absence of TPL-2 in vivo, excess type I IFN promoted IL-10 production and exacerbated disease. These findings describe an important regulatory mechanism for controlling tuberculosis and reveal mechanisms by which type I IFN may promote susceptibility to this important disease.
DEFF Research Database (Denmark)
Mannervik, M; Fan, S; Ström, A C
1999-01-01
of the viral E4 open reading frame 4 (E4-ORF4) protein. This effect does not to require the retinoblastoma protein that previously has been shown to regulate E2F activity. The inhibitory activity of E4-ORF4 appears to be specific because E4-ORF4 had little effect on, for example, E4-ORF6/7 transactivation......Previous studies have shown that the cell cycle-regulated E2F transcription factor is subjected to both positive and negative control by phosphorylation. Here we show that in transient transfection experiments, adenovirus E1A activation of the viral E2 promoter is abrogated by coexpression...... of the E2 promoter. We further show that the repressive effect of E4-ORF4 on E2 transcription works mainly through the E2F DNA-binding sites in the E2 promoter. In agreement with this, we find that E4-ORF4 inhibits E2F-1/DP-1-mediated transactivation. We also show that E4-ORF4 inhibits E2 mRNA expression...
Zic-Proteins Are Repressors of Dopaminergic Forebrain Fate in Mice and C. elegans.
Tiveron, Marie-Catherine; Beclin, Christophe; Murgan, Sabrina; Wild, Stefan; Angelova, Alexandra; Marc, Julie; Coré, Nathalie; de Chevigny, Antoine; Herrera, Eloisa; Bosio, Andreas; Bertrand, Vincent; Cremer, Harold
2017-11-01
In the postnatal forebrain regionalized neural stem cells along the ventricular walls produce olfactory bulb (OB) interneurons with varying neurotransmitter phenotypes and positions. To understand the molecular basis of this region-specific variability we analyzed gene expression in the postnatal dorsal and lateral lineages in mice of both sexes from stem cells to neurons. We show that both lineages maintain transcription factor signatures of their embryonic site of origin, the pallium and subpallium. However, additional factors, including Zic1 and Zic2, are postnatally expressed in the dorsal stem cell compartment and maintained in the lineage that generates calretinin-positive GABAergic neurons for the OB. Functionally, we show that Zic1 and Zic2 induce the generation of calretinin-positive neurons while suppressing dopaminergic fate in the postnatal dorsal lineage. We investigated the evolutionary conservation of the dopaminergic repressor function of Zic proteins and show that it is already present in C. elegans SIGNIFICANCE STATEMENT The vertebrate brain generates thousands of different neuron types. In this work we investigate the molecular mechanisms underlying this variability. Using a genomics approach we identify the transcription factor signatures of defined neural stem cells and neuron populations. Based thereon we show that two related transcription factors, Zic1 and Zic2, are essential to control the balance between two defined neuron types in the postnatal brain. We show that this mechanism is conserved in evolutionary very distant species. Copyright © 2017 the authors 0270-6474/17/3710611-13$15.00/0.
Uemura, Mikiko; Maeshige, Noriaki; Koga, Yuka; Ishikawa-Aoyama, Michiko; Miyoshi, Makoto; Sugimoto, Masaharu; Terashi, Hiroto; Usami, Makoto
2016-01-01
The monophasic pulsed microcurrent is used to promote wound healing, and galvanotaxis regulation has been reported as one of the active mechanisms in the promotion of tissue repair with monophasic pulsed microcurrent. However, the optimum monophasic pulsed microcurrent parameters and intracellular changes caused by the monophasic pulsed microcurrent have not been elucidated in human dermal fibroblasts. The purpose of this study was to investigate the optimum intensity for promoting galvanotaxis and the effects of electrical stimulation on integrin α2β1 and actin filaments in human dermal fibroblasts. Human dermal fibroblasts were treated with the monophasic pulsed microcurrent of 0, 100, 200, or 300 μA for 8 hours, and cell migration and cell viability were measured 24 hours after starting monophasic pulsed microcurrent stimulation. Polarization of integrin α2β1 and lamellipodia formation were detected by immunofluorescent staining 10 minutes after starting monophasic pulsed microcurrent stimulation. The migration toward the cathode was significantly higher in the cells treated with the 200-μA monophasic pulsed microcurrent than in the controls (P microcurrent did not alter the migration ratio. The electrostimulus of 200 μA also promoted integrin α2β1 polarization and lamellipodia formation at the cathode edge (P microcurrent intensity to promote migration toward the cathode, and this intensity could regulate polarization of migration-related intracellular factors in human dermal fibroblasts.
A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation
International Nuclear Information System (INIS)
Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A.; Delgado, F.; Alcaraz, Y.; FRobles, J.; Martinez A, M.
2014-01-01
An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, 1 H NMR and 13 C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)
Oral treatment with enrofloxacin early in life promotes Th2-mediated immune response in mice.
Strzępa, Anna; Majewska-Szczepanik, Monika; Kowalczyk, Paulina; Woźniak, Dorota; Motyl, Sylwia; Szczepanik, Marian
2016-02-01
Th2 lymphocytes play a crucial role in the development of allergy. These pathologies are caused by coordinated production of the cytokines IL-4, IL-5 and IL-13 that regulate the activity of eosinophils, basophils and B cells. According to the 'hygiene hypothesis', the reduced exposure to microorganisms favors allergy occurrence. The advances in medicine in the field of infection therapy promoted an increasing application of antibiotics which, apart from eliminating pathogens, also partially eliminate the microbiota. Epicutaneous (EC) immunization with ovalbumin (OVA) followed by OVA challenge was used to study the influence of partial gut flora depletion by oral treatment with enrofloxacin on type-2 immune response. Current work describes the influence of enrofloxacin application on anti-OVA antibody production and cytokine synthesis in young and adult mice. Immune response in adult mice is less sensitive to modification of natural gut flora. We observed that enrofloxacin treatment of adult mice leads to significant decrease of anti-OVA IgG2a production while synthesis of anti-OVA IgE was not changed. The production of type-1 (IFN-γ), type-2 (IL-4, IL-5, IL-10, IL-13) and Th17-associated (IL-17A) cytokines was inhibited. On the other hand, treatment of young mice with enrofloxacin significantly upregulates the production of anti-OVA IgE and inhibits the secretion of anti-OVA IgG2a antibodies. Additionally, treatment with enrofloxacin early in life prior to OVA immunization results in increased production of type-2 (IL-4, IL-10 and IL-13) cytokines. Our results clearly indicate that the immune system is more vulnerable to decreased bacterial exposure early in life that may promote development of allergy. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
DA-9801 promotes neurite outgrowth via ERK1/2-CREB pathway in PC12 cells.
Won, Jong Hoon; Ahn, Kyong Hoon; Back, Moon Jung; Ha, Hae Chan; Jang, Ji Min; Kim, Ha Hyung; Choi, Sang-Zin; Son, Miwon; Kim, Dae Kyong
2015-01-01
In the present study, we examined the mechanisms underlying the effect of DA-9801 on neurite outgrowth. We found that DA-9801 elicits its effects via the mitogen-activated protein kinase (MEK) extracellular signal-regulated kinase (ERK)1/2-cAMP response element-binding protein (CREB) pathway. DA-9801, an extract from a mixture of Dioscorea japonica and Dioscorea nipponica, was reported to promote neurite outgrowth in PC12 cells. The effects of DA-9801 on cell viability and expression of neuronal markers were evaluated in PC12 cells. To investigate DA-9801 action, specific inhibitors targeting the ERK signaling cascade were used. No cytotoxicity was observed in PC12 cells at DA-9801 concentrations of less than 30 µg/mL. In the presence of nerve growth factor (NGF, 2 ng/mL), DA-9801 promoted neurite outgrowth and increased the relative mRNA levels of neurofilament-L (NF-L), a marker of neuronal differentiation. The Raf-1 inhibitor GW5074 and MEK inhibitor PD98059 significantly attenuated DA-9801-induced neurite outgrowth. Additionally, the MEK1 and MEK2 inhibitor SL327 significantly attenuated the increase in the percentage of neurite-bearing PC12 cells induced by DA-9801 treatment. Conversely, the selective p38 mitogen-activated protein kinase inhibitor SB203580 did not attenuate the DA-9801 treatment-induced increase in the percentage of neurite-bearing PC12 cells. DA-9801 enhanced the phosphorylation of ERK1/2 and CREB in PC12 cells incubated with and without NGF. Pretreatment with PD98059 blocked the DA-9801-induced phosphorylation of ERK1/2 and CREB. In conclusion, DA-9801 induces neurite outgrowth by affecting the ERK1/2-CREB signaling pathway. Insights into the mechanism underlying this effect of DA-9801 may suggest novel potential strategies for the treatment of peripheral neuropathy.
Directory of Open Access Journals (Sweden)
Carlos Enrique Daza
2012-01-01
Full Text Available Ce-promoted Ni-catalysts from hydrotalcites were obtained. The effect of calcination temperature on the chemical and physical properties of the catalysts was studied. Several techniques were used to determine the chemical and physical characteristics of oxides. The apparent activation energies of reduction were determined. Catalytic experiments at 48 L g-1h-1 without pre-reduction in CO2 reforming of methane were performed. The spinel-like phase in these oxides was only formed at 1000 ºC. The reduction of Ni2+ in the oxides was clearly affected by the calcination temperature which was correlated with catalytic performance. The catalyst calcined at 700 ºC showed the greatest activity.
Obesity Resistance Promotes Mild Contractile Dysfunction Associated with Intracellular Ca2+ Handling
International Nuclear Information System (INIS)
Sá, Felipe Gonçalves dos Santos de; Lima-Leopoldo, Ana Paula; Jacobsen, Bruno Barcellos; Ferron, Artur Junio Togneri; Estevam, Wagner Muller; Campos, Dijon Henrique Salomé; Castardeli, Edson; Cunha, Márcia Regina Holanda da; Cicogna, Antonio Carlos; Leopoldo, André Soares
2015-01-01
Diet-induced obesity is frequently used to demonstrate cardiac dysfunction. However, some rats, like humans, are susceptible to developing an obesity phenotype, whereas others are resistant to that. To evaluate the association between obesity resistance and cardiac function, and the impact of obesity resistance on calcium handling. Thirty-day-old male Wistar rats were distributed into two groups, each with 54 animals: control (C; standard diet) and obese (four palatable high-fat diets) for 15 weeks. After the experimental protocol, rats consuming the high-fat diets were classified according to the adiposity index and subdivided into obesity-prone (OP) and obesity-resistant (OR). Nutritional profile, comorbidities, and cardiac remodeling were evaluated. Cardiac function was assessed by papillary muscle evaluation at baseline and after inotropic maneuvers. The high-fat diets promoted increase in body fat and adiposity index in OP rats compared with C and OR rats. Glucose, lipid, and blood pressure profiles remained unchanged in OR rats. In addition, the total heart weight and the weight of the left and right ventricles in OR rats were lower than those in OP rats, but similar to those in C rats. Baseline cardiac muscle data were similar in all rats, but myocardial responsiveness to a post-rest contraction stimulus was compromised in OP and OR rats compared with C rats. Obesity resistance promoted specific changes in the contraction phase without changes in the relaxation phase. This mild abnormality may be related to intracellular Ca2+ handling
Wang, Zhaoyue; Jiang, Mingyue; Guo, Xuena; Liu, Zhaozheng; He, Xiuping
2018-04-11
2-phenylethanol (2-PE) is an important aromatic compound with a lovely rose-like scent. Saccharomyces cerevisiae is a desirable microbe for 2-PE production but its natural yield is not high, and one or two crucial genes' over-expression in S. cerevisiae did not improve 2-PE greatly. A new metabolic module was established here, in which, permease Gap1p for L-phenylalanine transportation, catalytic enzymes Aro8p, Aro10p and Adh2p in Ehrlich pathway respectively responsible for transamination, decarboxylation and reduction were assembled, besides, glutamate dehydrogenase Gdh2p was harbored for re-supplying another substrate 2-oxoglutarate, relieving product glutamate repression and regenerating cofactor NADH. Due to different promoter strengths, GAP1, ARO8, ARO9, ARO10, ADH2 and GDH2 in the new modularized YS58(G1-A8-A10-A2)-GDH strain enhanced 11.6-, 15.4-, 3.6-, 17.7-, 12.4- and 7.5-folds respectively, and crucial enzyme activities of aromatic aminotransferases and phenylpyruvate decarboxylase were 4.8- and 7-folds respectively higher than that of the control. Under the optimum medium and cell density, YS58(G1-A8-A10-A2)-GDH presented efficient 2-PE synthesis ability with ~ 6.3 g L -1 of 2-PE titer in 5-L fermenter reaching 95% of conversation ratio. Under fed-batch fermentation, 2-PE productivity at 24 h increased 29% than that of single-batch fermentation. Metabolic modularization with promoter strategy provides a new prospective for efficient 2-PE production.
Promoting people's health: challenges and opportunities.
Heitkamp, P
1998-01-01
Promoting health underlines the right of each individual to the highest attainable standard of health. It stresses the importance of the participation of people and recognizes different sociocultural values and beliefs that are prevalent throughout the world. Working on health development has a sustainable effect only when done comprehensively: personal development, community development, organizational development, and political development. The international conferences that have marked the way of health promotion have been goal posts of an energetic movement to strengthen health worldwide. The Ottawa Charter on Health Promotion has been a worldwide source of guidance for health promotion through its five strategies: building health policy, creating supportive elements, strengthening community action, developing personal skills, and reorienting health services. Moreover, the Jakarta Declaration on "Leading Health Promotion into the 21st Century" identifies five priorities in the next millennium: 1) promote social responsibility for health; 2) increase investments for health development; 3) consolidate and expand partnerships for health; 4) increase community capacity and empower the individual in matters of health; and 5) secure an infrastructure for health promotion. Increasing the investment in health development calls for the need to find new mechanisms for funding as well as reorienting existing resources towards health promotion and health education.
Alcohol promotions in Australian supermarket catalogues.
Johnston, Robyn; Stafford, Julia; Pierce, Hannah; Daube, Mike
2017-07-01
In Australia, most alcohol is sold as packaged liquor from off-premises retailers, a market increasingly dominated by supermarket chains. Competition between retailers may encourage marketing approaches, for example, discounting, that evidence indicates contribute to alcohol-related harms. This research documented the nature and variety of promotional methods used by two major supermarket retailers to promote alcohol products in their supermarket catalogues. Weekly catalogues from the two largest Australian supermarket chains were reviewed for alcohol-related content over 12 months. Alcohol promotions were assessed for promotion type, product type, number of standard drinks, purchase price and price/standard drink. Each store catalogue included, on average, 13 alcohol promotions/week, with price-based promotions most common. Forty-five percent of promotions required the purchase of multiple alcohol items. Wine was the most frequently promoted product (44%), followed by beer (24%) and spirits (18%). Most (99%) wine cask (2-5 L container) promotions required multiple (two to three) casks to be purchased. The average number of standard drinks required to be purchased to participate in catalogue promotions was 31.7 (SD = 24.9; median = 23.1). The median price per standard drink was $1.49 (range $0.19-$9.81). Cask wines had the lowest cost per standard drink across all product types. Supermarket catalogues' emphasis on low prices/high volumes of alcohol reflects that retailers are taking advantage of limited restrictions on off-premise sales and promotion, which allow them to approach market competition in ways that may increase alcohol-related harms in consumers. Regulation of alcohol marketing should address retailer catalogue promotions. [Johnston R, Stafford J, Pierce H, Daube M. Alcohol promotions in Australian supermarket catalogues. Drug Alcohol Rev 2017;36:456-463]. © 2016 Australasian Professional Society on Alcohol and other Drugs.
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
International Nuclear Information System (INIS)
Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi
2014-01-01
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
Energy Technology Data Exchange (ETDEWEB)
Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)
2014-07-18
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
17 CFR 200.70 - Business promotions.
2010-04-01
... AND ETHICS; AND INFORMATION AND REQUESTS Canons of Ethics § 200.70 Business promotions. A member must not engage in any other business, employment or vocation while in office, nor may he ever use the... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Business promotions. 200.70...
Directory of Open Access Journals (Sweden)
Hyun-Seop Shin
2018-04-01
Full Text Available A rechargeable lithium–oxygen (Li–O2 battery is considered as a promising technology for electrochemical energy storage systems because its theoretical energy density is much higher than those of state-of-the-art Li-ion batteries. The cathode (positive electrode for Li–O2 batteries is made of carbon and polymeric binders; however, these constituents undergo parasitic decomposition reactions during battery operation, which in turn causes considerable performance degradation. Therefore, the rational design of the cathode is necessary for building robust and high-performance Li–O2 batteries. Here, a binder-free carbon nanotube (CNT electrode surface-modified by atomic layer deposition (ALD of dual acting RuO2 as an inhibitor–promoter is proposed for rechargeable Li–O2 batteries. RuO2 nanoparticles formed directly on the binder-free CNT electrode by ALD play a dual role to inhibit carbon decomposition and to promote Li2O2 decomposition. The binder-free RuO2/CNT cathode with the unique architecture shows outstanding electrochemical performance as characterized by small voltage gaps (∼0.9 V as well as excellent cyclability without any signs of capacity decay over 80 cycles.
Shin, Hyun-Seop; Seo, Gi Won; Kwon, Kyoungwoo; Jung, Kyu-Nam; Lee, Sang Ick; Choi, Eunsoo; Kim, Hansung; Hwang, Jin-Ha; Lee, Jong-Won
2018-04-01
A rechargeable lithium-oxygen (Li-O2) battery is considered as a promising technology for electrochemical energy storage systems because its theoretical energy density is much higher than those of state-of-the-art Li-ion batteries. The cathode (positive electrode) for Li-O2 batteries is made of carbon and polymeric binders; however, these constituents undergo parasitic decomposition reactions during battery operation, which in turn causes considerable performance degradation. Therefore, the rational design of the cathode is necessary for building robust and high-performance Li-O2 batteries. Here, a binder-free carbon nanotube (CNT) electrode surface-modified by atomic layer deposition (ALD) of dual acting RuO2 as an inhibitor-promoter is proposed for rechargeable Li-O2 batteries. RuO2 nanoparticles formed directly on the binder-free CNT electrode by ALD play a dual role to inhibit carbon decomposition and to promote Li2O2 decomposition. The binder-free RuO2/CNT cathode with the unique architecture shows outstanding electrochemical performance as characterized by small voltage gaps (˜0.9 V) as well as excellent cyclability without any signs of capacity decay over 80 cycles.
Morphological evidence for novel enteric neuronal circuitry in guinea pig distal colon.
Smolilo, D J; Costa, M; Hibberd, T J; Wattchow, D A; Spencer, Nick J
2018-07-01
The gastrointestinal (GI) tract is unique compared to all other internal organs; it is the only organ with its own nervous system and its own population of intrinsic sensory neurons, known as intrinsic primary afferent neurons (IPANs). How these IPANs form neuronal circuits with other functional classes of neurons in the enteric nervous system (ENS) is incompletely understood. We used a combination of light microscopy, immunohistochemistry and confocal microscopy to examine the topographical distribution of specific classes of neurons in the myenteric plexus of guinea-pig colon, including putative IPANs, with other classes of enteric neurons. These findings were based on immunoreactivity to the neuronal markers, calbindin, calretinin and nitric oxide synthase. We then correlated the varicose outputs formed by putative IPANs with subclasses of excitatory interneurons and motor neurons. We revealed that calbindin-immunoreactive varicosities form specialized structures resembling 'baskets' within the majority of myenteric ganglia, which were arranged in clusters around calretinin-immunoreactive neurons. These calbindin baskets directly arose from projections of putative IPANs and represent morphological evidence of preferential input from sensory neurons directly to a select group of calretinin neurons. Our findings uncovered that these neurons are likely to be ascending excitatory interneurons and excitatory motor neurons. Our study reveals for the first time in the colon, a novel enteric neural circuit, whereby calbindin-immunoreactive putative sensory neurons form specialized varicose structures that likely direct synaptic outputs to excitatory interneurons and motor neurons. This circuit likely forms the basis of polarized neuronal pathways underlying motility. © 2018 Wiley Periodicals, Inc.
Chen, Li-You; Renn, Ting-Yi; Liao, Wen-Chieh; Mai, Fu-Der; Ho, Ying-Jui; Hsiao, George; Lee, Ai-Wei; Chang, Hung-Ming
2017-09-01
Prolonged exposure to gamma-hydroxybutyric acid (GHB) would cause drug intoxication in which impaired cognitive function results from enhanced hippocampal oxidative stress may serve as a major symptom in this deficiency. Considering melatonin possesses significant anti-oxidative efficacy, this study aimed to determine whether melatonin would successfully promote the nuclear factor erythroid 2-related factor 2 and antioxidant responsive element (Nrf2-ARE) signaling, depress oxidative stress, and rescue hippocampal bioenergetics and cognitive function following drug intoxication injury. Adolescent rats subjected to 10 days of GHB were received melatonin at doses of either 10 or 100 mg/kg. Time-of-flight secondary ion mass spectrometry, biochemical assay, quantitative histochemistry, [ 14 C]-2-deoxyglucose analysis, together with Morris water maze were employed to detect the molecular signaling, oxidative status, bioenergetic level, as well as the cognitive performances, respectively. Results indicated that in GHB-intoxicated rats, enhanced oxidative stress, increased cholesterol level, and decreased anti-oxidative enzymes activities were detected in hippocampal regions. Intense oxidative stress paralleled well with reduced bioenergetics and poor performance in behavioral testing. However, in rats treated with melatonin following GHB intoxication, all above parameters and cognitive function were gradually returned to nearly normal levels. Melatonin also remarkably promoted the translocation of Nrf2 from cytoplasm to nucleus in a dose-dependent manner, thereby increased the Nrf2-ARE signaling-related downstream anti-oxidative enzymes activities. As melatonin effectively rescues hippocampal bioenergetics through depressing the oxidative stress by promoting Nrf2-ARE molecular machinery, this study thus highlights for the first time that clinical use of melatonin may serve as a therapeutic strategy to improve the cognitive function in unsuspecting victims suffered from
Directory of Open Access Journals (Sweden)
Xiaoming Yang
Full Text Available Hydroxysteroid sulfotransferase 2B1b (SULT2B1b is highly selective for the addition of sulfate groups to 3β-hydroxysteroids. Although previous reports have suggested that SULT2B1b is correlated with cell proliferation of hepatocytes, the relationship between SULT2B1b and the malignant phenotype of hepatocarcinoma cells was not clear. In the present study, we found that SULT2B1 was comparatively higher in the human hepatocarcinoma tumorous tissues than their adjacent tissues. Besides, SULT2B1b overexpression promoted the growth of the mouse hepatocarcinoma cell line Hepa1-6, while Lentivirus-mediated SULT2B1b interference inhibited growth as assessed by the CCK-8 assay. Likewise, inhibition of SULT2B1b expression induced cell-cycle arrest and apoptosis in Hepa1-6 cells by upregulating the expression of FAS, downregulating the expression of cyclinB1, BCL2 and MYC in vitro and in vivo at both the transcript and protein levels. Knock-down of SULT2B1b expression significantly suppressed tumor growth in nude mouse xenografts. Moreover, proliferation rates and SULT2B1b expression were highly correlated in the human hepatocarcinoma cell lines Huh-7, Hep3B, SMMC-7721 and BEL-7402 cells. Knock-down of SULT2B1b inhibited cell growth and cyclinB1 levels in human hepatocarcinoma cells and suppressed xenograft growth in vivo. In conclusion, SULT2B1b expression promotes proliferation of hepatocellular carcinoma cells in vitro and in vivo, which may contribute to the progression of HCC.
FGFR2 promotes breast tumorigenicity through maintenance of breast tumor-initiating cells.
Directory of Open Access Journals (Sweden)
Sungeun Kim
Full Text Available Emerging evidence suggests that some cancers contain a population of stem-like TICs (tumor-initiating cells and eliminating TICs may offer a new strategy to develop successful anti-cancer therapies. As molecular mechanisms underlying the maintenance of the TIC pool are poorly understood, the development of TIC-specific therapeutics remains a major challenge. We first identified and characterized TICs and non-TICs isolated from a mouse breast cancer model. TICs displayed increased tumorigenic potential, self-renewal, heterogeneous differentiation, and bipotency. Gene expression analysis and immunostaining of TICs and non-TICs revealed that FGFR2 was preferentially expressed in TICs. Loss of FGFR2 impaired self-renewal of TICs, thus resulting in marked decreases in the TIC population and tumorigenic potential. Restoration of FGFR2 rescued the defects in TIC pool maintenance, bipotency, and breast tumor growth driven by FGFR2 knockdown. In addition, pharmacological inhibition of FGFR2 kinase activity led to a decrease in the TIC population which resulted in suppression of breast tumor growth. Moreover, human breast TICs isolated from patient tumor samples were found enriched in a FGFR2+ population that was sufficient to initiate tumor growth. Our data suggest that FGFR2 is essential in sustaining the breast TIC pool through promotion of self-renewal and maintenance of bipotent TICs, and raise the possibility of FGFR2 inhibition as a strategy for anti-cancer therapy by eradicating breast TICs.
Active CREB1 promotes a malignant TGFβ2 autocrine loop in glioblastoma.
Rodón, Laura; Gonzàlez-Juncà, Alba; Inda, María del Mar; Sala-Hojman, Ada; Martínez-Sáez, Elena; Seoane, Joan
2014-10-01
In advanced cancer, including glioblastoma, the TGFβ pathway acts as an oncogenic factor. Some tumors exhibit aberrantly high TGFβ activity, and the mechanisms underlying this phenomenon are not well understood. We have observed that TGFβ can induce TGFβ2, generating an autocrine loop leading to aberrantly high levels of TGFβ2. We identified cAMP-responsive element-binding protein 1 (CREB1) as the critical mediator of the induction of TGFβ2 by TGFβ. CREB1 binds to the TGFB2 gene promoter in cooperation with SMAD3 and is required for TGFβ to activate transcription. Moreover, the PI3K-AKT and RSK pathways regulate the TGFβ2 autocrine loop through CREB1. The levels of CREB1 and active phosphorylated CREB1 correlate with TGFβ2 in glioblastoma. In addition, using patient-derived in vivo models of glioblastoma, we found that CREB1 levels determine the expression of TGFβ2. Our results show that CREB1 can be considered a biomarker to stratify patients for anti-TGFβ treatments and a therapeutic target in glioblastoma. TGFβ is considered a promising therapeutic target, and several clinical trials using TGFβ inhibitors are generating encouraging results. Here, we discerned the molecular mechanisms responsible for the aberrantly high levels of TGFβ2 found in certain tumors, and we propose biomarkers to predict the clinical response to anti-TGFβ therapies. ©2014 American Association for Cancer Research.
DEFF Research Database (Denmark)
Vozarova, Barbora; Fernández-Real, José-Manuel; Knowler, William C
2003-01-01
Chronic low-grade activation of the immune system may play a role in the pathogenesis of type-2 diabetes mellitus (T2DM). Interleukin-6 (IL6), a powerful inducer of hepatic acute phase response, has been implicated in the etiology of insulin resistance and T2DM. Recently, an IL6 promoter...... polymorphism (G/C) at position -174 was found to be associated with measures of insulin sensitivity. Because we have previously found an association between high IL6 levels and insulin resistance in both Pima Indians - a population with high rates of insulin resistance and T2DM - and Caucasians, we aimed...... to assess whether the IL6 promoter polymorphism is associated with T2DM in these populations. We genotyped the IL6 (-174) G/C polymorphism using pyrosequencing in 463 Native Americans and by PCR-RFLP in 329 Spanish Caucasians. Among the Spanish Caucasian subjects, there was a significant difference...
Huang, Baolin; Tian, Yu; Zhang, Wenjing; Ma, Yifan; Yuan, Yuan; Liu, Changsheng
2017-11-01
Preserving and improving osteogenic activity of bone morphogenetic protein-2 (BMP-2) upon implants remains one of the key limitations in bone regeneration. With calcium phosphate cement (CPC) as model, we have developed a series of strontium (Sr)-doped CPC (SCPC) to address this issue. The effects of fixed Sr on the bioactivity of recombinant human BMP-2 (rhBMP-2) as well as the underlying mechanism were investigated. The results suggested that the rhBMP-2-induced osteogenic activity was significantly promoted upon SCPCs, especially with a low amount of fixed Sr (SrCO 3 content IA (BMPR-IA) to rhBMP-2 and an increased expression of BMPR-IA in C2C12 model cells. As a result, the activations of BMP-induced signaling pathways were different in C2C12 cells incubated upon CPC/rhBMP-2 and SCPCs/rhBMP-2. These findings explicitly decipher the mechanism of SCPCs promoting osteogenic bioactivity of rhBMP-2 and signify the promising application of the SCPCs/rhBMP-2 matrix in bone regeneration implants. Copyright © 2017 Elsevier B.V. All rights reserved.
Manganese oxide as a promoter for C2-C4 olefin production in the hydrogenation of carbon dioxide
International Nuclear Information System (INIS)
Kim, C.; Chen, K.; Hanson, F.V.; Oblad, A.G.; Tsai, Y.
1986-01-01
A number of active research and development programs have been initiated to explore the potential of CO hydrogenation process as a source of low molecular weight (C 2 -C 4 ) olefins. Metal catalysts such as Co-Mn, Ni-zeolite, Rd and Mo have been evaluated for low molecular weight olefin selectivity. The coprecipitated Fe-Mn system (Mn/Fe=9/1) was reported to be highly olefin selective. Recently, many investigators reported supporting evidence for the promotional effect of Mn for precipitated Fe catalysts. In this study, Raney Fe promoted with Mn has been evaluated for C 2 -C 4 olefin selectivity in the hydrogenation of CO relative to coprecipitated Fe-Mn catalysts. Catalyst characterization, including BET surface area, X-ray diffraction, selective chemisorption and ESCA, has been carried to provide insight into the role of manganese in both the Coprecipitated and Raney catalyst systems
Energy Technology Data Exchange (ETDEWEB)
Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)
2013-11-01
Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS
International Nuclear Information System (INIS)
Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching
2013-01-01
Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and
Secondary promoters in alumina-supported nickel-molybdenum hydroprocessing catalysts
Energy Technology Data Exchange (ETDEWEB)
Lewis, J.M.
1992-01-01
Two secondary promoters, phosphorus and fluoride, have been investigated for their influences on the physicochemical properties of alumina-supported nickel-molybdenum hydroprocessing catalysts. Model compound reactions and infrared spectroscopy were used to probe the functionalities of the different catalysts, and the catalysts were tested in the hydroprocessing of a low-nitrogen and a high-nitrogen (quinoline-spiked) gas oil feed to assess the utility of the model compound reaction studies. Fluoride-promoted catalysts with high cumene hydrocracking activity and with comparable thiophene hydrodesulphurization (HDS) activity to Ni-Mo/Al[sub 2]O[sub 3] can be prepared by coimpregnation of the F, Ni and Mo additives. Fluoride promotes the hydrogenation (HYD) and HDS activity of Ni-Mo/Al[sub 2]O[sub 3] in the hydroprocessing (HYD) and HDS activity of Ni-Mo/Al[sub 2]O[sub 3] in the hydroprocessing of a low-nitrogen feed. Fluoride promotes the quinoline hydrodenitrogenation (HDN) activity of Ni-Mo/Al[sub 2]O[sub 3] catalysts. Impregnation of phosphorus prior to the metal additives results in catalysts which are more active in HDS. Phosphorus increases indirectly the Broensted acidity of the catalyst by increasing the activity of the MoS[sub 2]-associated acid sites. Phosphorus promotes the HDSW and HYD activities of Ni-Mo/Al[sub 2]O[sub 3] in the hydroprocessing of the low-N feed. A promotional effect of phosphorus is seen in quinoline HDN. P- and F-promoted Ni-MO/Al[sub 2]O[sub 3] catalysts are very active in quinoline HDN and maintain good activity in HDS and HYD of the high-N feed. Thiophene HDS was a good reaction for probing the activity of catalysts in the HDS of sterically-unhindered molecules, but an inaccurate probe for the HDS of hindered compounds.
A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation
Energy Technology Data Exchange (ETDEWEB)
Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A. [Universidad de Guanajuato, Dapartamento de Quimica, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico); Delgado, F. [IPN, Escuela Nacional de Ciencias Biologicas, Departamento de Quimica Organica, Prol. Carpio y Plan de Ayala s/n, 11340 Mexico D. F. (Mexico); Alcaraz, Y.; FRobles, J.; Martinez A, M., E-mail: mvazquez@ugto.mx [Universidad de Guanajuato, Departamento de Farmacia, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico)
2014-10-01
An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, {sup 1}H NMR and {sup 13}C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)
Intelligent promotion of city and gas enterprise
Energy Technology Data Exchange (ETDEWEB)
1989-07-01
This paper studied the conception of intelligent promotion in cities, present situation and future trend, and reported how gas enterprises should respond. The intelligent promotion is divided into two areas, namely, that in the business buildings and that in private houses. Thia paper studied mainly for that in business buildings and then the concept of intelligent promotion in private houses was arranged. The intelligent promotion was thought by dividing four systems, that is, space and equipment system, service and management system, human system, and social system. But present intelligent promotion is carried out only a part of three systems except last one. A part of human system and social system are remained as the future problems. 4 figs., 2 tabs.
Uittenbogaard, Martine; Martinka, Debra L.; Johnson, Peter F.; Vinson, Charles; Chiaramello, Anne
2009-01-01
Expression of the bHLH transcription factor Nex1/MATH-2/NeuroD6, a member of the NeuroD subfamily, parallels overt neuronal differentiation and synaptogenesis during brain development. Our previous studies have shown that Nex1 is a critical effector of the NGF pathway and promotes neuronal differentiation and survival of PC12 cells in the absence of growth factors. In this study, we investigated the transcriptional regulation of the Nex1 gene during NGF-induced neuronal differentiation. We found that Nex1 expression is under the control of two conserved promoters, Nex1-P1 and Nex1-P2, located in two distinct non-coding exons. Both promoters are TATA-less with multiple transcription start sites, and are activated on NGF or cAMP exposure. Luciferase-reporter assays showed that the Nex1-P2 promoter activity is stronger than the Nex1-P1 promoter activity, which supports the previously reported differential expression levels of Nex1 transcripts throughout brain development. Using a combination of DNaseI footprinting, EMSA assays, and site-directed mutagenesis, we identified the essential regulatory elements within the first 2 kb of the Nex1 5′UTR. The Nex1-P1 promoter is mainly regulated by a conserved CRE element, whereas the Nex1-P2 promoter is under the control of a conserved C/EBP binding site. Overexpression of wild-type C/EBPβ resulted in increased Nex1-P2 promoter activity in NGF-differentiated PC12 cells. The fact that Nex1 is a target gene of C/EBPβ provides new insight into the C/EBP transcriptional cascade known to promote neurogenesis, while repressing gliogenesis. PMID:17075921
Synergistic interactions of biotic and abiotic environmental stressors on gene expression.
Altshuler, Ianina; McLeod, Anne M; Colbourne, John K; Yan, Norman D; Cristescu, Melania E
2015-03-01
Understanding the response of organisms to multiple stressors is critical for predicting if populations can adapt to rapid environmental change. Natural and anthropogenic stressors often interact, complicating general predictions. In this study, we examined the interactive and cumulative effects of two common environmental stressors, lowered calcium concentration, an anthropogenic stressor, and predator presence, a natural stressor, on the water flea Daphnia pulex. We analyzed expression changes of five genes involved in calcium homeostasis - cuticle proteins (Cutie, Icp2), calbindin (Calb), and calcium pump and channel (Serca and Ip3R) - using real-time quantitative PCR (RT-qPCR) in a full factorial experiment. We observed strong synergistic interactions between low calcium concentration and predator presence. While the Ip3R gene was not affected by the stressors, the other four genes were affected in their transcriptional levels by the combination of the stressors. Transcriptional patterns of genes that code for cuticle proteins (Cutie and Icp2) and a sarcoplasmic calcium pump (Serca) only responded to the combination of stressors, changing their relative expression levels in a synergistic response, while a calcium-binding protein (Calb) responded to low calcium stress and the combination of both stressors. The expression pattern of these genes (Cutie, Icp2, and Serca) were nonlinear, yet they were dose dependent across the calcium gradient. Multiple stressors can have complex, often unexpected effects on ecosystems. This study demonstrates that the dominant interaction for the set of tested genes appears to be synergism. We argue that gene expression patterns can be used to understand and predict the type of interaction expected when organisms are exposed simultaneously to natural and anthropogenic stressors.
DEFF Research Database (Denmark)
Søgaard-Andersen, L; Martinussen, J; Møllegaard, N E
1990-01-01
We have investigated the regulation of the Escherichia coli deoCp2 promoter by the CytR repressor and the cyclic AMP (cAMP) receptor protein (CRP) complexed to cAMP. Promoter regions controlled by these two proteins characteristically contain tandem cAMP-CRP binding sites. Here we show that (i) Cyt...
Resilient protein co-expression network in male orbitofrontal cortex layer 2/3 during human aging.
Pabba, Mohan; Scifo, Enzo; Kapadia, Fenika; Nikolova, Yuliya S; Ma, Tianzhou; Mechawar, Naguib; Tseng, George C; Sibille, Etienne
2017-10-01
The orbitofrontal cortex (OFC) is vulnerable to normal and pathologic aging. Currently, layer resolution large-scale proteomic studies describing "normal" age-related alterations at OFC are not available. Here, we performed a large-scale exploratory high-throughput mass spectrometry-based protein analysis on OFC layer 2/3 from 15 "young" (15-43 years) and 18 "old" (62-88 years) human male subjects. We detected 4193 proteins and identified 127 differentially expressed (DE) proteins (p-value ≤0.05; effect size >20%), including 65 up- and 62 downregulated proteins (e.g., GFAP, CALB1). Using a previously described categorization of biological aging based on somatic tissues, that is, peripheral "hallmarks of aging," and considering overlap in protein function, we show the highest representation of altered cell-cell communication (54%), deregulated nutrient sensing (39%), and loss of proteostasis (35%) in the set of OFC layer 2/3 DE proteins. DE proteins also showed a significant association with several neurologic disorders; for example, Alzheimer's disease and schizophrenia. Notably, despite age-related changes in individual protein levels, protein co-expression modules were remarkably conserved across age groups, suggesting robust functional homeostasis. Collectively, these results provide biological insight into aging and associated homeostatic mechanisms that maintain normal brain function with advancing age. Copyright © 2017 Elsevier Inc. All rights reserved.
Functional analysis of bipartite begomovirus coat protein promoter sequences
International Nuclear Information System (INIS)
Lacatus, Gabriela; Sunter, Garry
2008-01-01
We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters
Directory of Open Access Journals (Sweden)
Xiao-Li Chen
2016-01-01
Full Text Available Background. Epithelial-mesenchymal transition (EMT of retinal pigment epithelium (RPE is vital in proliferative vitreoretinopathy (PVR development. Apoptosis-stimulating proteins of p53 (ASPP2 have recently been reported to participate in EMT. However, the role of ASPP2 in PVR pathogenesis has not been identified. Methods. Immunohistochemistry was used to investigate the expression of ASPP2 in epiretinal membranes of PVR patients. ARPE-19 cells were transfected with ASPP2-siRNA, followed with measurement of cell cytotoxicity, proliferation, and migration ability. EMT markers and related inflammatory and fibrosis cytokines were measured by western blot or flow cytometry. Additionally, PVR rat models were induced by intravitreal injection of ARPE-19 cells transfected with ASPP2-siRNA and evaluated accordingly. Results. Immunofluorescence analysis revealed less intense expression of ASPP2 in PVR membranes. ASPP2 knockdown facilitated the proliferation and migration of RPE cells and enhanced the expression of mesenchymal markers such as alpha smooth muscle actin, fibronectin, and ZEB1. Meanwhile, ASPP2-siRNA increased EMT-related and inflammatory cytokines, including TGF-β, CTGF, VEGF, TNF-α, and interleukins. PVR severities were more pronounced in the rat models with ASPP2-siRNA treatment. Conclusions. ASPP2 knockdown promoted EMT of ARPE-19 cells in vitro and exacerbated the progression of experimental PVR in vivo, possibly via inflammatory and fibrosis cytokines.
Kinetic model of biodiesel production using immobilized lipase Candida antarctica lipase B
DEFF Research Database (Denmark)
Fedosov, Sergey; Brask, Jesper; Pedersen, Anders K.
2013-01-01
We have designed a kinetic model of biodiesel production using Novozym 435 (Nz435) with immobilized Candida antarctica lipase B (CALB) as a catalyst. The scheme assumed reversibility of all reaction steps and imitated phase effects by introducing various molecular species of water and methanol....... Residual enzymatic activity in biodiesel of standard quality causes increase of D above its specification level because of the reaction 2M↔D+G. Filtration or alkaline treatment of the product prior to storage resolves this problem. The optimal field of Nz435 application appears to be decrease of F, M, D...
DEFF Research Database (Denmark)
Lehn-Christiansen, Sine
The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills are concei......The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills...
Reduced graphene oxide is not a universal promoter for photocatalytic activities of TiO2
Directory of Open Access Journals (Sweden)
Hui Ling Tan
2017-03-01
Full Text Available Addition of reduced graphene oxide (RGO to P25 TiO2 was made and its impacts on photocatalytic oxidation of various organic substances were studied. Although the presence of RGO in TiO2 can enhance certain TiO2-based photocatalytic reactions, it is not a universal observation that can be expected in all types of organic substances. The factor of photocatalytic activity enhancement is strongly affected by the various functional groups appeared in the organic substances. In this work, it is realised that the length of alkyl chain in alcohols and carboxylic acids have the minimum influence on the overall activity while the number of hydroxyl groups can promote the further activity enhancement in the presence of RGO.
Coffelt, Seth B; Chen, Yung-Yi; Muthana, Munitta; Welford, Abigail F; Tal, Andrea O; Scholz, Alexander; Plate, Karl H; Reiss, Yvonne; Murdoch, Craig; De Palma, Michele; Lewis, Claire E
2011-04-01
Angiopoietin 2 (ANGPT2) is a proangiogenic cytokine whose expression is often upregulated by endothelial cells in tumors. Expression of its receptor, TIE2, defines a highly proangiogenic subpopulation of myeloid cells in circulation and tumors called TIE2-expressing monocytes/macrophages (TEMs). Genetic depletion of TEMs markedly reduces tumor angiogenesis in various tumor models, emphasizing their essential role in driving tumor progression. Previously, we demonstrated that ANGPT2 augments the expression of various proangiogenic genes, the potent immunosuppressive cytokine, IL-10, and a chemokine for regulatory T cells (Tregs), CCL17 by TEMs in vitro. We now show that TEMs also express higher levels of IL-10 than TIE2(-) macrophages in tumors and that ANGPT2-stimulated release of IL-10 by TEMs suppresses T cell proliferation, increases the ratio of CD4(+) T cells to CD8(+) T cells, and promotes the expansion of CD4(+)CD25(high)FOXP3(+) Tregs. Furthermore, syngeneic murine tumors expressing high levels of ANGPT2 contained not only high numbers of TEMs but also increased numbers of Tregs, whereas genetic depletion of tumor TEMs resulted in a marked reduction in the frequency of Tregs in tumors. Taken together, our data suggest that ANGPT2-stimulated TEMs represent a novel, potent immunosuppressive force in tumors.
Sun, Qiyu; Qi, Xian; Zhang, Yan; Wu, Xiaodong; Liang, Mifang; Li, Chuan; Li, Dexin; Cardona, Carol J.; Xing, Zheng
2016-01-01
Synaptogyrin-2 is a non-neuronal member of the synaptogyrin family involved in synaptic vesicle biogenesis and trafficking. Little is known about the function of synaptogyrin-2. Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease characterized by high fever, thrombocytopenia, and leukocytopenia with high mortality, caused by a novel tick-borne phlebovirus in the family Bunyaviridae. Our previous studies have shown that the viral nonstructural protein NSs forms inclusion bodies (IBs) that are involved in viral immune evasion, as well as viral RNA replication. In this study, we sought to elucidate the mechanism by which NSs formed the IBs, a lipid droplet-based structure confirmed by NSs co-localization with perilipin A and adipose differentiation-related protein (ADRP). Through a high throughput screening, we identified synaptogyrin-2 to be highly up-regulated in response to SFTS bunyavirus (SFTSV) infection and to be a promoter of viral replication. We demonstrated that synaptogyrin-2 interacted with NSs and was translocated into the IBs, which were reconstructed from lipid droplets into large structures in infection. Viral RNA replication decreased, and infectious virus titers were lowered significantly when synaptogyrin-2 was silenced in specific shRNA-expressing cells, which correlated with the reduced number of the large IBs restructured from regular lipid droplets. We hypothesize that synaptogyrin-2 is essential to promoting the formation of the IBs to become virus factories for viral RNA replication through its interaction with NSs. These findings unveil the function of synaptogyrin-2 as an enhancer in viral infection. PMID:27226560
Poudrier, J; Graber, P; Herren, S; Gretener, D; Elson, G; Berney, C; Gauchat, J F; Kosco-Vilbois, M H
1999-08-01
A functional IL-13R involves at least two cell surface proteins, the IL-13R alpha 1 and IL-4R alpha. Using a soluble form of the murine IL-13R alpha 1 (sIL-13R), we reveal several novel features of this system. The sIL-13R promotes proliferation and augmentation of Ag-specific IgM, IgG2a, and IgG2b production by murine germinal center (GC) B cells in vitro. These effects were enhanced by CD40 signaling and were not inhibited by an anti-IL4R alpha mAb, a result suggesting other ligands. In GC cell cultures, sIL-13R also promoted IL-6 production, and interestingly, sIL-13R-induced IgG2a and IgG2b augmentation was absent in GC cells isolated from IL-6-deficient mice. Furthermore, the effects of the sIL-13R molecule were inhibited in the presence of an anti-IL-13 mAb, and preincubation of GC cells with IL-13 enhanced the sIL-13R-mediated effects. When sIL-13R was injected into mice, it served as an adjuvant-promoting production to varying degrees of IgM and IgG isotypes. We thus propose that IL-13R alpha 1 is a molecule involved in B cell differentiation, using a mechanism that may involve regulation of IL-6-responsive elements. Taken together, our data reveal previously unknown activities as well as suggest that the ligand for the sIL-13R might be a component of the IL-13R complex or a counterstructure yet to be defined.
Nie, Rong; Han, Yanhong; Xu, Jiaqi; Huang, Qiao; Mao, Jing
2018-02-01
To explore illness perception and perceived risk of developing diabetes complications in relation to health-promoting self-care behaviors among Chinese patients with type 2 diabetes. Illness and risk perceptions are important determinants of various health behaviors. However, few studies have simultaneously examined the impacts of these two constructs on self-care among diabetic patients. Data were collected on participants' characteristics, illness perception, risk perception, and health-promoting self-care behaviors over 6months among 304 subjects from three general hospitals. Significant associations between illness perception and risk perception were observed. Illness perception and/or risk perception explained an independent, small but significant proportion of the variance in each health-promoting self-care behavior. One's perceptions of illness and future risk might be influential in understanding health-promoting self-care among diabetic patients. It may be useful to improve self-management by tailoring intervention content to individuals' illness-related perceptions. Copyright © 2017 Elsevier Inc. All rights reserved.
Huang, Yanshan; Wu, Dongqing; Wang, Jinzuan; Han, Sheng; Lv, Lu; Zhang, Fan; Feng, Xinliang
2014-06-12
3D macroporous graphene/SnO2 frameworks (MGTFs) are fabricated by amphiphilic polymer-promoted assembly method, which exhibit controllable macroporous structure and outstanding lithium storage performance. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yang, Xiao; Zhu, Fan; Yu, Chaoran; Lu, Jiaoyang; Zhang, Luyang; Lv, Yanfeng; Sun, Jing; Zheng, Minhua
2017-07-18
N-myc downstream-regulated gene1 (NDRG1) has been identified as a potent tumor suppressor gene. The molecular mechanisms of anti-tumor activity of NDRG1 involve its suppressive effects on a variety of tumorigenic signaling pathways. The purpose of this study was to investigate the role of NDRG1 in the apoptosis of colorectal cancer (CRC) cells. We first collected the clinical data of locally advanced rectal cancer (LARC) patients receiving oxaliplatin-based neoadjuvant chemotherapy in our medical center. Correlation analysis revealed that NDRG1 positively associated with the downstaging rates and prognosis of patients. Then, the effects of over-expression and depletion of NDRG1 gene on apoptosis of colorectal cancer were tested in vitro and in vivo. NDRG1 over-expression promoted apoptosis in colorectal cancer cells whereas depletion of NDRG1 resulted in resistance to oxaliplatin treatment. Furthermore, we observed that Bcl-2, a major anti-apoptotic protein, was regulated by NDRG1 at post-transcriptional level. By binding Protein kinase Cα (PKCα), a classical regulating factor of Bcl-2, NDRG1 enhanced the ubiquitination and degradation of Bcl-2, thus promoting apoptosis in CRC cells. In addition, NDRG1 inhibited tumor growth and promoted apoptosis in mouse xenograft model. In conclusion,NDRG1 promotes oxaliplatin-triggered apoptosis in colorectal cancer. Therefore, colorectal cancer patients can be stratified by the expression level of NDRG1. NDRG1-positive patients may benefit from oxaliplatin-containing chemotherapy regimens whereas those with negative NDRG1 expression should avoid the usage of this cytotoxic drug.
Directory of Open Access Journals (Sweden)
Maoyong Fu
Full Text Available Endometrial cancer is the most common gynecologic malignancy diagnosed among women in developed countries. One recent biomarker strongly associated with disease progression and survival is epithelial membrane protein-2 (EMP2, a tetraspan protein known to associate with and modify surface expression of certain integrin isoforms. In this study, we show using a xenograft model system that EMP2 expression is necessary for efficient endometrial tumor formation, and we have started to characterize the mechanism by which EMP2 contributes to this malignant phenotype. In endometrial cancer cells, the focal adhesion kinase (FAK/Src pathway appears to regulate migration as measured through wound healing assays. Manipulation of EMP2 levels in endometrial cancer cells regulates the phosphorylation of FAK and Src, and promotes their distribution into lipid raft domains. Notably, cells with low levels of EMP2 fail to migrate and poorly form tumors in vivo. These findings reveal the pivotal role of EMP2 in endometrial cancer carcinogenesis, and suggest that the association of elevated EMP2 levels with endometrial cancer prognosis may be causally linked to its effect on integrin-mediated signaling.
Israël-Assayag, Evelyne; Beaulieu, Marie-Josée; Cormier, Yvon
2015-01-01
Inhaled β2-adrenoreceptor agonists are widely used in asthma and chronic obstructive pulmonary disease (COPD) for bronchoconstriction relief. β2-Adrenoreceptor agonists relax airway smooth muscle cells via cyclic adenosine monophosphate (cAMP) mediated pathways. However, prolonged stimulation induces functional desensitization of the β2-adrenoreceptors (β2-AR), potentially leading to reduced clinical efficacy with chronic or prolonged administration. ASM-024, a small synthetic molecule in clinical stage development, has shown activity at the level of nicotinic receptors and possibly at the muscarinic level and presents anti-inflammatory and bronchodilator properties. Aerosolized ASM-024 reduces airway resistance in mice and promotes in-vitro relaxation of tracheal and bronchial preparations from animal and human tissues. ASM-024 increased in vitro relaxation response to maximally effective concentration of short-acting beta-2 agonists in dog and human bronchi. Although the precise mechanisms by which ASM-024 promotes airway smooth muscle (ASM) relaxation remain unclear, we hypothesized that ASM-024 will attenuate and/or abrogate agonist-induced contraction and remain effective despite β2-AR tachyphylaxis. β2-AR tachyphylaxis was induced with salbutamol, salmeterol and formoterol on guinea pig tracheas. The addition of ASM-024 relaxed concentration-dependently intact or β2-AR desensitized tracheal rings precontracted with methacholine. ASM-024 did not induce any elevation of intracellular cAMP in isolated smooth muscle cells; moreover, blockade of the cAMP pathway with an adenylate cyclase inhibitor had no significant effect on ASM-024-induced guinea pig trachea relaxation. Collectively, these findings show that ASM-024 elicits relaxation of β2-AR desensitized tracheal preparations and suggest that ASM-024 mediates smooth muscle relaxation through a different target and signaling pathway than β2-adrenergic receptor agonists. These findings suggest ASM-024
Angelici, Carlo|info:eu-repo/dai/nl/345731506; Meirer, Florian; van der Eerden, Ad M. J.|info:eu-repo/dai/nl/304840483; Schaink, Herrick L.; Goryachev, Andrey; Hofmann, Jan P.|info:eu-repo/dai/nl/355351110; Hensen, Emiel J. M.; Weckhuysen, Bert M.|info:eu-repo/dai/nl/285484397; Bruijnincx, Pieter C. A.|info:eu-repo/dai/nl/33799529X
2015-01-01
Dehydrogenation promoters greatly enhance the performance of SiO2-MgO catalysts in the Lebedev process. Here, the effect of preparation method and order of addition of Cu on the structure and performance of Cu-promoted SiO2-MgO materials is detailed. Addition of Cu to MgO via incipient wetness
The double bromodomain protein Brd2 promotes B cell expansion and mitogenesis.
Belkina, Anna C; Blanton, Wanda P; Nikolajczyk, Barbara S; Denis, Gerald V
2014-03-01
Bromodomain-containing transcriptional regulators represent new epigenetic targets in different hematologic malignancies. However, bromodomain-mediated mechanisms that couple histone acetylation to transcription in lymphopoiesis and govern mature lymphocyte mitogenesis are poorly understood. Brd2, a transcriptional coregulator that contains dual bromodomains and an extraterminal domain (the BET family), couples chromatin to cell-cycle progression. We reported previously the first functional characterization of a BET protein as an effector of mammalian mitogenic signal transduction: Eμ-Brd2 Tg mice develop "activated B cell" diffuse large B cell lymphoma. No other animal models exist for genetic or lentiviral expression of BET proteins, hampering testing of novel anti-BET anticancer drugs, such as JQ1. We transduced HSCs with Brd2 lentivirus and reconstituted recipient mice to test the hypothesis that Brd2 regulates hematopoiesis in BM and mitogenesis in the periphery. Forced expression of Brd2 provides an expansion advantage to the donor-derived B cell compartment in BM and increases mature B cell mitogenic responsiveness in vitro. Brd2 binds the cyclin A promoter in B cells, shown by ChIP, and increases cyclin A mRNA and protein levels, and S-phase progression in vitro in mitogen-stimulated primary B cells, but not T cells, reinforcing results from Eμ-Brd2 mice. The small molecule BET inhibitor JQ1 reduces B cell mitogenesis, consistent with the interpretation that BET inhibitors are antiproliferative. Brd2-specific knockdown experiments show that Brd2 is also required for hematopoiesis. We conclude that Brd2 plays a critical, independent role in regulation of mitogenic response genes, particularly cyclin A, in B cells.
N2-fixation and seedling growth promotion of lodgepole pine by endophytic Paenibacillus polymyxa.
Anand, Richa; Grayston, Susan; Chanway, Christopher
2013-08-01
We inoculated lodgepole pine (Pinus contorta var. latifolia (Dougl.) Engelm.) with Paenibacillus polymyxa P2b-2R, a diazotrophic bacterium previously isolated from internal stem tissue of a naturally regenerating pine seedling to evaluate biological nitrogen fixation and seedling growth promotion by this microorganism. Seedlings generated from pine seed inoculated with strain P2b-2R were grown for up to 13 months in a N-limited soil mix containing 0.7 mM available N labeled as Ca((15)NO3)2 to facilitate detection of N2-fixation. Strain P2b-2R developed a persistent endophytic population comprising 10(2)-10(6) cfu g(-1) plant tissue inside pine roots, stems, and needles during the experiment. At the end of the growth period, P2b-2R had reduced seedling mortality by 14 % and (15)N foliar N abundance 79 % and doubled foliar N concentration and seedling biomass compared to controls. Our results suggest that N2-fixation by P. polymyxa enhanced growth of pine seedlings and support the hypothesis that plant-associated diazotrophs capable of endophytic colonization can satisfy a significant proportion of the N required by tree seedlings growing under N-limited conditions.
Perceptions of health promoters about health promotion ...
African Journals Online (AJOL)
2013-02-11
Feb 11, 2013 ... regarding a health promotion programme for families with ... to contribute to high rates of not going to school (ibid. ... sector in order, amongst other objectives, to prevent health ... exercise and mental health promotion must be incorporated ..... (2009:141) identified ignorance and misconception about the.
Directory of Open Access Journals (Sweden)
Guangmang Liu
2013-07-01
Full Text Available Leucine, a branched chain amino acid, is well known to stimulate protein synthesis in skeletal muscle. However, the role of leucine in myoblast proliferation remains unclear. In this study, we found that leucine could promote proliferation of C2C12 cells. Moreover, expressions of miR-27a and myostatin (a bona fide target of miR-27a were upregulated and downregulated, respectively, following leucine treatment. We also found that miR-27a loss-of-function by transfection of a miR-27a inhibitor suppressed the promotion of myoblast proliferation caused by leucine. Our results suggest that miR-27a is induced by leucine and contributes to leucine-induced proliferation promotion of myoblast.
Directory of Open Access Journals (Sweden)
Cohn Steven M
2010-05-01
Full Text Available Abstract Background Intestinal cell kinase (ICK; GeneID 22858 is a conserved MAPK and CDK-like kinase that is widely expressed in human tissues. Data from the Cancer Genome Anatomy Project indicated ICK mRNA is increased in cancer, and that its expression correlated with expression of mRNA for an uncharacterized F-box protein, FBX9 (GeneID: 26268. ICK and FBX9 genes are arranged head-to-head on opposite strands, with start sites for transcription separated by ~3.3 kb. We hypothesized ICK and FBX9 are potentially important genes in cancer controlled by a bidirectional promoter. Results We assessed promoter activity of the intergenic region in both orientations in cancer cell lines derived from breast (AU565, SKBR3, colon (HCT-15, KM12, and stomach (AGS cancers, as well as in embryonic human kidney (HEK293T cells. The intergenic segment was active in both orientations in all of these lines, and ICK promoter activity was greater than FBX9 promoter activity. Results from deletions and truncations defined a minimal promoter for ICK, and revealed that repressors and enhancers differentially regulate ICK versus FBX9 promoter activity. The ICK promoter contains consensus motifs for several FOX-family transcription factors that align when mouse and human are compared using EMBOSS. FOXA1 and FOXA2 increase luciferase activity of a minimal promoter 10-20 fold in HEK293T cells. Consensus sites for TCF7L2 (TCF4 (Gene Id: 6934 are also present in both mouse and human. The expression of β-catenin increased activity of the minimal promoter ~10 fold. ICK reference mRNAs (NM_014920.3, NM_016513 are expressed in low copy number and increased in some breast cancers, using a ten base tag 5'-TCAACCTTAT-3' specific for both ICK transcripts. Conclusion ICK and FBX9 are divergently transcribed from a bidirectional promoter that is GC-rich and contains a CpG island. A minimal promoter for ICK contains functional sites for β-cateinin/TCF7L2 and FOXA. These data are
Energy Technology Data Exchange (ETDEWEB)
Chen, Yanjun; Chen, Jixiang, E-mail: jxchen@tju.edu.cn
2016-11-30
Graphical abstract: A suitable Ni/In ratio remarkably enhanced the acetylene conversion, the selectivity to ethylene and the catalyst stability. Display Omitted - Highlights: • There was a promotional effect of In on the performance of Ni/SiO{sub 2}. • A suitable Ni/In ratio was required for good performance of Ni{sub x}In/SiO{sub 2}. • Both geometrical and electronic effects of In contributed to good performance. • Ni/SiO{sub 2} deactivation is mainly owing to phase change from Ni to nickel carbide. • The carbonaceous deposit was the main reason for Ni{sub x}In/SiO{sub 2} deactivation. - Abstract: Ni/SiO{sub 2} and the bimetallic Ni{sub x}In/SiO{sub 2} catalysts with different Ni/In ratios were tested for the selective hydrogenation of acetylene, and their physicochemical properties before and after the reaction were characterized by means of N{sub 2}-sorption, H{sub 2}-TPR, XRD, TEM, XPS, H{sub 2} chemisorption, C{sub 2}H{sub 4}-TPD, NH{sub 3}-TPD, FT-IR of adsorbed pyridine, and TG/DTA and Raman. A promotional effect of In on the performance of Ni/SiO{sub 2} was found, and Ni{sub x}In/SiO{sub 2} with a suitable Ni/In ratio gave much higher acetylene conversion, ethylene selectivity and catalyst stability than Ni/SiO{sub 2}. This is ascribed to the geometrical isolation of the reactive Ni atoms with the inert In ones and the charge transfer from the In atoms to Ni ones, both of which are favorable for reducing the adsorption strength of ethylene and restraining the C−C hydrogenolysis and the polymerizations of acetylene and the intermediate compounds. On the whole, Ni{sub 6}In/SiO{sub 2} and Ni{sub 10}In/SiO{sub 2} had better performance. Nevertheless, with increasing the In content, the selectivity to the C4+ hydrocarbons tended to increase due to the enhanced catalyst acidity because of the charge transfer from the In atoms to Ni ones. As the Lewis acid ones, the In sites could promote the polymerization. The catalyst deactivation was also analyzed
Directory of Open Access Journals (Sweden)
Xiao Feng
2015-01-01
inhibited by the ERK1/2-specific inhibitor U0126. Conclusions: RIP140 overexpression promotes N2a cell neuronal differentiation by activating the ERK1/2 pathway.
Giri, Mrunmay K; Singh, Nidhi; Banday, Zeeshan Z; Singh, Vijayata; Ram, Hathi; Singh, Deepjyoti; Chattopadhyay, Sudip; Nandi, Ashis K
2017-09-01
G-BOX BINDING FACTOR 1 (GBF1) influences light-regulated seedling development in Arabidopsis, and inhibits CATALASE 2 (CAT2) expression during senescence. CAT2 functions as a scavenger of hydrogen peroxide. The role of GBF1 in the defense response is not known. We report here that GBF1 positively influences the defense against virulent and avirulent strains of Pseudomonas syringae. The gbf1 mutants are susceptible, whereas GBF1 over-expresser transgenic plants are resistant to bacterial pathogens. GBF1 negatively regulates pathogen-induced CAT2 expression and thereby positively regulates the hypersensitive response. In addition to CAT2 promoter, GBF1 binds to the G-box-like element present in the intron of PHYTOALEXIN DEFICIENT 4 (PAD4). This association of GBF1 with PAD4 intron is enhanced upon pathogenesis. GBF1 positively regulates PAD4 transcription in an intron-dependent manner. GBF1-mediated positive regulation of PAD4 expression is also evident in gbf1 mutant and GBF1 over-expression lines. Similar to pad4 mutants, pathogen-induced camalexin and salicylic acid (SA) accumulation, and expression of SA-inducible PATHOGENESIS RELATED1 (PR1) gene are compromised in the gbf1 mutant. Exogenous application of SA rescues the loss-of-defense phenotypes of gbf1 mutant. Thus, altogether, our results demonstrate that GBF1 is an important component of the plant defense response that functions upstream of SA accumulation and, by oppositely regulating CAT2 and PAD4, promotes disease resistance in Arabidopsis. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Montesinos, M Carmen; Desai-Merchant, Avani; Cronstein, Bruce N
2015-12-01
Impaired wound healing, as it occurs in diabetes mellitus or long-term corticoid treatment, is commonly associated with disability, diminished quality of life, and high economic costs. Selective agonists of the A2A receptor subtype of adenosine, an endogenous regulator of inflammation, promote tissue repair in animal models, both healthy and with impaired healing. Plasmin-mediated proteolysis of fibrin and other matrix proteins is essential for cell migration at sites of injury. Since adenosine A2A receptor activation increases plasminogen activator release from macrophages and mast cells, we studied the effect of a selective agonist, CGS-21680, on full-thickness excisional wound closure in wild-type, urokinase plasminogen activator (uPA)-deficient, and tissue plasminogen activator (tPA)-deficient mice. Wound closure was impaired in tPA- and uPA-deficient mice as compared with wild-type mice, and topical application of CGS-21680 significantly increased the rate at which wounds closed in wild-type mice and uPA-deficient mice, but not in tPA-deficient mice. Immunostaining of tissue sections showed that tPA was present in endothelial cells and histiocytes by day 3 post-wound and also by day 6. In contrast, uPA was more prominent in these cell types only by day 6 post-wound. Our results confirm that plasminogen activation contributes to wound repair and are consistent with the hypothesis that adenosine A2A receptor activation promotes wound closure by a mechanism that depends upon tPA, but not uPA. Moreover, our results suggest that topical adenosine A2A receptor agonists may be useful in promotion of wound closure in patients with impaired wound healing.
20 Years Health Promotion Research in and on settings
Directory of Open Access Journals (Sweden)
Heiko Waller
2007-12-01
Full Text Available In 2006 we celebrated the 20th anniversary of the Ottawa Charta for Health Promotion. During these 20 years health promotion became a very influential public health strategy. Let us - with reference to the WHO Health Promotion Glossary - recall some of the core elements of health promotion: “Health promotion represents a comprehensive social and political process, it not only embraces actions directed at strengthening skills and capabilities of individuals, but also actions directed towards changing social, environmental and economic conditions so as to alleviate their impact on public and individual health.Health promotion is the process of enabling people to increase control over the determinants of health and thereby improve their health. Participation is essential to sustain health promotion action.” The Ottawa Charter identifies three basic strategies for health promotion. These are (1 advocacy for health to create the essential conditions for health indicated above; (2 enabling all people to achieve their full health potential; and (3 mediating between different interests in society in the pursuit of health. The Ottawa Charter identifies three basic strategies for health promotion. These are (1 advocacy for health to create the essential conditions for health indicated above; (2 enabling all people to achieve their full health potential; and (3 mediating between different interests in society in the pursuit of health.
The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses.
Takahama, Michihiro; Fukuda, Mitsunori; Ohbayashi, Norihiko; Kozaki, Tatsuya; Misawa, Takuma; Okamoto, Toru; Matsuura, Yoshiharu; Akira, Shizuo; Saitoh, Tatsuya
2017-09-19
Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5), in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING), the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses
Directory of Open Access Journals (Sweden)
Michihiro Takahama
2017-09-01
Full Text Available Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5, in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING, the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis.
Health promotion in primary and secondary schools in Denmark
DEFF Research Database (Denmark)
Nabe-Nielsen, Kirsten; Krølner, Rikke; Mortensen, Laust Hvas
2015-01-01
BACKGROUND: Schools are important arenas for interventions among children as health promoting initiatives in childhood is expected to have substantial influence on health and well-being in adulthood. In countries with compulsory school attention, all children could potentially benefit from health...... promotion at the school level regardless of socioeconomic status or other background factors. The first aim was to elucidate time trends in the number and types of school health promoting activities by describing the number and type of health promoting activities in primary and secondary schools in Denmark....... The second aim was to investigate which characteristics of schools and students that are associated with participation in many (≥3) versus few (0-2) health promoting activities during the preceding 2-3 years. METHODS: We used cross-sectional data from the 2006- and 2010-survey of the Health Behaviour...
Identiifcation and validation of root-speciifc promoters in rice
Institute of Scientific and Technical Information of China (English)
HUANG Li-yu; ZHANG Fan; QIN Qiao; WANG Wen-sheng; ZHANG Ting; FU Bin-ying
2015-01-01
Novel promoters that confer root-speciifc expression would be useful for engineering resistance against problems of nutrient and water absorption by roots. In this study, the reverse transcriptase polymerase chain reaction was used to identify seven genes with root-speciifc expression in rice. The isolation and characterization of upstream promoter regions of ifve selected genes rice root-speciifc promoter (rRSP) 1 to 5 (rRSP1-rRSP5) and A2P (the promoter ofOsAct2) revealed that rRSP1, rRSP3, and rRSP5 are particularly important with respect to root-speciifc activities. Furthermore, rRSP1, rRSP3, and rRSP5 were observed to make different contributions to root activities in various species. These three promoters could be used for root-speciifc enhancement of target gene(s).
DEFF Research Database (Denmark)
Povlsen, Lene; Borup, I.
2015-01-01
and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...
Characterization of spinal afferent neurons projecting to different chambers of the rat heart.
Guić, Maja Marinović; Kosta, Vana; Aljinović, Jure; Sapunar, Damir; Grković, Ivica
2010-01-29
The pattern of distribution of spinal afferent neurons (among dorsal root ganglia-DRGs) that project to anatomically and functionally different chambers of the rat heart, as well as their morphological and neurochemical characteristics were investigated. Retrograde tracing using a patch loaded with Fast blue (FB) was applied to all four chambers of the rat heart and labeled cardiac spinal afferents were characterized by using three neurochemical markers. The majority of cardiac projecting neurons were found from T1 to T4 DRGs, whereas the peak was at T2 DRG. There was no difference in the total number of FB-labeled neurons located in ipsilateral and contralateral DRGs regardless of the chambers marked with the patch. However, significantly more FB-labeled neurons projected to the ventricles compared to the atria (859 vs. 715). The proportion of isolectin B(4) binding in FB-labeled neurons was equal among all neurons projecting to different heart chambers (2.4%). Neurofilament 200 positivity was found in greater proportions in DRG neurons projecting to the left side of the heart, whereas calretinin-immunoreactivity was mostly represented in neurons projecting to the left atrium. Spinal afferent neurons projecting to different chambers of the rat heart exhibit a variety of neurochemical phenotypes depending on binding capacity for isolectin B(4) and immunoreactivity for neurofilament 200 and calretinin, and thus represent important baseline data for future studies. (c) 2009 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Qin, Xian; Li, Changsheng; Guo, Tao; Chen, Jing; Wang, Hai-Tao; Wang, Yi-Tao; Xiao, Yu-Sha; Li, Jun; Liu, Pengpeng; Liu, Zhi-Su; Liu, Quan-Yan
2017-10-19
Infection with the hepatitis B virus (HBV) is closely associated with the development of hepatocellular carcinoma (HCC). The osmoregulatory transcription factor nuclear factor of activated T-cells 5 (NFAT5) has been shown to play an important role in the development of many types of human cancers. The role of NFAT5 in HBV-associated HCC has never previously been investigated. We compared expression profiles of NFAT5, DARS2 and miR-30e-5p in HCC samples, adjacent nontumor tissues and different hepatoma cell lines by quantitative real-time polymerase chain reaction and /or Western blot. Clinical data of HCC patients for up to 80 months were analyzed. The regulatory mechanisms upstream and convergent downstream pathways of NFAT5 in HBV-associated HCC were investigated by ChIP-seq, MSP, luciferase report assay and bioinformation anaylsis. We first found that higher levels of NFAT5 expression predict a good prognosis, suggesting that NFAT5 is a potential tumor-suppressing gene, and verified that NFAT5 promotes hepatoma cell apoptosis and inhibits cell growth in vitro. Second, our results showed that HBV could suppress NFAT5 expression by inducing hypermethylation of the AP1-binding site in the NFAT5 promoter in hepatoma cells. In addition, HBV also inhibited NFAT5 through miR-30e-5p targeted MAP4K4, and miR-30e-5p in turn inhibited HBV replication. Finally, we demonstrated that NFAT5 suppressed DARS2 by directly binding to its promoter. DARS2 was identified as an HCC oncogene that promotes HCC cell cycle progression and inhibits HCC cell apoptosis. HBV suppresses NFAT5 through the miR-30e-5p/mitogen-activated protein kinase (MAPK) signaling pathway upstream of NFAT5 and inhibits the NFAT5 to enhance HCC tumorigenesis via the downstream target genes of DARS2.
Energy Technology Data Exchange (ETDEWEB)
Silambarasan, Sivagnanam [Department of Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330 (Thailand); Vangnai, Alisa S., E-mail: alisa.v@chula.ac.th [Department of Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330 (Thailand); Center of Excellence on Hazardous Substance Management (HSM), Chulalongkorn University, Bangkok 10330 (Thailand)
2016-01-25
Highlights: • Acinetobacter sp. AVLB2 is a PGPB able to degrade high concentration of 4-NA. • Growth and degradation kinetics for 4-NA removal by AVLB2 were studied. • A novel biodegradation pathway for 4-nitroaniline has been proposed. • Toxicological studies revealed non-toxic nature of 4-NA biodegraded metabolites. • Acinetobacter sp. AVLB2 could maintain PGP traits under 4-NA stress. - Abstract: 4-nitroaniline (4-NA) is one of the major priority pollutants generated from industrial productions and pesticide transformation; however very limited biodegradation details have been reported. This work is the first to report 4-NA biodegradation kinetics and toxicity reduction using a newly isolated plant-growth promoting bacterium, Acinetobacter sp. AVLB2. The 4-NA-dependent growth kinetics parameters: μ{sub max}, K{sub s} and K{sub i}, were determined to be 0.039 h{sup −1}, 6.623 mg L{sup −1} and 25.57 mg L{sup −1}, respectively using Haldane inhibition model, while the maximum biodegradation rate (V{sub max}) of 4-NA was at 0.541 mg L{sup −1} h{sup −1} and 0.551 mg L{sup −1} h{sup −1}, following Michaelis–Menten and Hanes–Woolf models, respectively. Biodegradation pathway of 4-NA by Acinetobacter sp. AVLB2 was proposed, and successfully led to the reduction of 4-NA toxicity according to the following toxicity assessments: microbial toxicity using Escherichia coli DH5α, phytotoxicity with Vigna radiata and Crotalaria juncea, and cytogenotoxicity with Allium cepa root-tip cells. In addition, Acinetobacter sp. AVLB2 possess important plant-growth promoting traits, both in the presence and absence of 4-NA. This study has provided a new insight into 4-NA biodegradation ability and concurrent plant-growth promoting activities of Acinetobacter sp. AVLB2, which may indicate its potential role for rhizoremediation, while sustaining crop production even under 4-NA stressed environment.
Shilton, Trevor
2009-06-01
Understanding of health and its determinants is rapidly expanding and changing. The emergence of chronic diseases as the leading cause of global disease burden and improved understanding of social determinants of health has brought greater focus to the role of prevention in health. The IUHPE has shown outstanding leadership through the Galway Consensus Statement. Its three recommendations appropriately focus on stimulating dialogue, developing global consensus and communicating the results to key stakeholders. The IUHPE can further enhance progress of the statement by developing participative processes to ensure engagement and ownership by its members. The Galway Consensus Statement can be used to advance professional standards in global health promotion by: (1) providing a common language by which health promotion and its meaning can be communicated to others; (2) providing a framework for building capacity in the health promotion workforce and in the health workforce in general; (3) providing international consensus for consistency in university health promotion courses; (4) providing a framework for credentialing in health promotion; (5) better informing health promotion engagement with other significant workforce sectors and advancing partnership as a key way of working. A vital further application of the Galway Consensus Statement is to inform advocacy. Advocacy is vital to ensure health promotion is better resourced and prioritized by policy makers. Advocacy and communication are vital tools to highlight the evidence, establish the policy fit and infrastructure requirements of health promotion, and present health promotion solutions based on evidence of effectiveness.
Xiang, Yi; Yao, Xiaohong; Chen, Keqiang; Wang, Xiafei; Zhou, Jiamin; Gong, Wanghua; Yoshimura, Teizo; Huang, Jiaqiang; Wang, Rongquan; Wu, Yuzhang; Shi, Guochao; Bian, Xiuwu; Wang, Jiming
2016-01-01
The G-protein coupled chemoattractant receptor formylpeptide receptor-2 (FPR2 in human, Fpr2 in mice) is expressed by mouse colon epithelial cells and plays a critical role in mediating mucosal homeostasis and inflammatory responses. However, the biological role of FPR2 in human colon is unclear. Our investigation revealed that a considerable number of human colon cancer cell lines expressed FPR2 and its ligands promoted cell migration and proliferation. Human colon cancer cell lines expressing high levels of FPR2 also formed more rapidly growing tumors in immunocompromised mice as compared with cell lines expressing lower levels of FPR2. Knocking down of FPR2 from colon cancer cell lines highly expressing FPR2 reduced their tumorigenicity. Clinically, FPR2 is more highly expressed in progressive colon cancer, associated with poorer patient prognosis. These results suggest that FPR2 can be high-jacked by colon cancer cells for their growth advantage, thus becoming a potential target for therapeutic development. PMID:27904774
Sun, Qiyu; Qi, Xian; Zhang, Yan; Wu, Xiaodong; Liang, Mifang; Li, Chuan; Li, Dexin; Cardona, Carol J; Xing, Zheng
2016-07-29
Synaptogyrin-2 is a non-neuronal member of the synaptogyrin family involved in synaptic vesicle biogenesis and trafficking. Little is known about the function of synaptogyrin-2. Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease characterized by high fever, thrombocytopenia, and leukocytopenia with high mortality, caused by a novel tick-borne phlebovirus in the family Bunyaviridae. Our previous studies have shown that the viral nonstructural protein NSs forms inclusion bodies (IBs) that are involved in viral immune evasion, as well as viral RNA replication. In this study, we sought to elucidate the mechanism by which NSs formed the IBs, a lipid droplet-based structure confirmed by NSs co-localization with perilipin A and adipose differentiation-related protein (ADRP). Through a high throughput screening, we identified synaptogyrin-2 to be highly up-regulated in response to SFTS bunyavirus (SFTSV) infection and to be a promoter of viral replication. We demonstrated that synaptogyrin-2 interacted with NSs and was translocated into the IBs, which were reconstructed from lipid droplets into large structures in infection. Viral RNA replication decreased, and infectious virus titers were lowered significantly when synaptogyrin-2 was silenced in specific shRNA-expressing cells, which correlated with the reduced number of the large IBs restructured from regular lipid droplets. We hypothesize that synaptogyrin-2 is essential to promoting the formation of the IBs to become virus factories for viral RNA replication through its interaction with NSs. These findings unveil the function of synaptogyrin-2 as an enhancer in viral infection. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Health Promotion at the Ballpark.
Hodges, Bonni C
2017-03-01
The arrival of a new summer collegiate baseball league franchise to a small central New York city was seen as an opportunity for health promotion. The initiative was set up to explore two overarching questions: (1) Are summer collegiate baseball events acceptable to local public health organizations as viable places for health promotion activities addressing local health issues? (2) Are summer collegiate baseball organizations amenable to health promotion activities built in to their fan and/or player experiences? Planning and implementation were guided by precede-proceed, social cognitive theory, social marketing, and diffusion of innovations constructs. Environmental changes were implemented to support healthy eating and nontobacco use by players and fans; four health awareness nights were implemented at home games corresponding to local public health priorities and included public service announcements, between inning quizzes, information dissemination at concession and team market locations, and special guests. Sales and fan feedback support mostly healthy concession offerings and a tobacco-free ballpark; postseason evaluations from team staff and public health partners support continuing the trials of this sports event as a venue for health promotion.
DEFF Research Database (Denmark)
Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate
2009-01-01
within the region of DNA marked by PA. Footprinting analysis and electrophoretic mobility shift assays of PA and putative AP-2 binding regions with HeLa cell nuclear extract and recombinant AP-2alpha protein indicate that AP-2 transcription factors are central in the regulated expression of UNG2 m......The PA promoter in the human uracil-DNA glycosylase gene (UNG) directs expression of the nuclear form (UNG2) of UNG proteins. Using a combination of promoter deletion and mutation analyses, and transient transfection of HeLa cells, we show that repressor and derepressor activities are contained......alpha, lacking the activation domain but retaining the DNA binding and dimerization domains, stimulated PA to a level approaching that of full-length AP-2, suggesting that AP-2 overexpression stimulates PA activity by a mechanism involving derepression rather than activation, possibly by neutralizing...
Energy Technology Data Exchange (ETDEWEB)
Sá, Felipe Gonçalves dos Santos de; Lima-Leopoldo, Ana Paula; Jacobsen, Bruno Barcellos; Ferron, Artur Junio Togneri; Estevam, Wagner Muller [Centro de Educação Física e Desportos - Departamento de Desportos - Universidade Federal do Espírito Santo, Vitória, ES (Brazil); Campos, Dijon Henrique Salomé [Departamento de Clínica Médica - Faculdade de Medicina - Universidade Estadual Paulista, Botucatu, São Paulo (Brazil); Castardeli, Edson; Cunha, Márcia Regina Holanda da [Centro de Educação Física e Desportos - Departamento de Desportos - Universidade Federal do Espírito Santo, Vitória, ES (Brazil); Cicogna, Antonio Carlos [Departamento de Clínica Médica - Faculdade de Medicina - Universidade Estadual Paulista, Botucatu, São Paulo (Brazil); Leopoldo, André Soares, E-mail: andresoaresleopoldo@gmail.com [Centro de Educação Física e Desportos - Departamento de Desportos - Universidade Federal do Espírito Santo, Vitória, ES (Brazil)
2015-12-15
Diet-induced obesity is frequently used to demonstrate cardiac dysfunction. However, some rats, like humans, are susceptible to developing an obesity phenotype, whereas others are resistant to that. To evaluate the association between obesity resistance and cardiac function, and the impact of obesity resistance on calcium handling. Thirty-day-old male Wistar rats were distributed into two groups, each with 54 animals: control (C; standard diet) and obese (four palatable high-fat diets) for 15 weeks. After the experimental protocol, rats consuming the high-fat diets were classified according to the adiposity index and subdivided into obesity-prone (OP) and obesity-resistant (OR). Nutritional profile, comorbidities, and cardiac remodeling were evaluated. Cardiac function was assessed by papillary muscle evaluation at baseline and after inotropic maneuvers. The high-fat diets promoted increase in body fat and adiposity index in OP rats compared with C and OR rats. Glucose, lipid, and blood pressure profiles remained unchanged in OR rats. In addition, the total heart weight and the weight of the left and right ventricles in OR rats were lower than those in OP rats, but similar to those in C rats. Baseline cardiac muscle data were similar in all rats, but myocardial responsiveness to a post-rest contraction stimulus was compromised in OP and OR rats compared with C rats. Obesity resistance promoted specific changes in the contraction phase without changes in the relaxation phase. This mild abnormality may be related to intracellular Ca2+ handling.
Directory of Open Access Journals (Sweden)
Gabriel P. Costa
2017-04-01
Full Text Available The use of sonochemistry is described in the organocatalytic enamine–azide [3 + 2] cycloaddition between 1,3-diketones and aryl azidophenyl selenides. These sonochemically promoted reactions were found to be amenable to a range of 1,3-diketones or aryl azidophenyl selenides, providing an efficient access to new ((arylselanylphenyl-1H-1,2,3-triazol-4-ylketones in good to excellent yields and short reaction times. In addition, this protocol was extended to β-keto esters, β-keto amides and α-cyano ketones. Selanyltriazoyl carboxylates, carboxamides and carbonitriles were synthesized in high yields at short times of reaction under very mild reaction conditions.
Directory of Open Access Journals (Sweden)
Alexandru Lucian MIHAI
2013-10-01
Full Text Available In sport marketing, the word promotion covers a range of interrelated activities. All of these activities are designed to attract attention, stimulate the interest and awareness of consumers, and of course, encourage them to purchase a sport product. Promotion is about communicating with and educating consumers. The purpose of a sport promotional strategy is to build brand loyalty and product credibility, develop image, and position the brand. A promotional strategy is similar to a marketing strategy, but the promotional strategy seeks short-term objectives, both direct and indirect. Promotional objectives usually include increased sales, stimulate impulse buying, raise customer traffic, and present and reinforce image. It also provides information about products and services, publicizes new stores or websites, and creates and enhances customer satisfaction.
Wu, Pingsheng; Larkin, Emma K; Reiss, Sara S; Carroll, Kecia N; Summar, Marshall L; Minton, Patricia A; Woodward, Kimberly B; Liu, Zhouwen; Islam, Jessica Y; Hartert, Tina V; Moore, Paul E
2015-09-14
Despite the significant interest in β2-Adrenergic receptor (ADRB2) polymorphisms related to asthma, whether ADRB2 genetic variants are similarly associated with acute respiratory tract infections have not been studied. We hypothesized that genetic variants in ADRB2 associated with a response to asthma therapy during an asthma exacerbation were also associated with severity of acute respiratory tract infections. To test this hypothesis, we genotyped 5 common polymorphisms in the promoter region and coding block of the ADRB2 gene (loci -2387, -2274, -1343, +46, and +79) from 374 Caucasian and African American term infants who were enrolled at the time of acute respiratory illness over four respiratory viral seasons. Severity of respiratory tract infections was measured using a bronchiolitis severity score (BSS; range = 0-12, clinically significant difference = 0.5) with a higher score indicating more severe disease. We assigned the promoter, coding and combined promoter and coding haplotypes to the unphased genotype data. The associations between each of these five single-nucleotide polymorphisms (SNPs) as well as the haplotypes and infant BSS were analyzed using nonparametric univariate analysis and multivariable proportional odds model separately in Caucasians and African Americans. There was no significant association between infant BSS and each of the SNPs in both Caucasians and African Americans. However, promoter haplotype CCA was associated with a decreased BSS in African Americans in a dose dependent manner. The median (interquartile range) BSS of infants with no copies of the CCA haplotype, one copy, and two copies of the CCA haplotype were 5.5 (2.0, 8.0), 4.0 (1.0, 7.5), and 3.0 (1.0, 4.0), respectively. This dose dependent relationship persisted after adjusting for infant age, gender, daycare exposure, secondhand smoke exposure, prior history of breastfeeding, siblings at home, and enrollment season (adjusted odds ratio: 0.59, 95% confidence
International Nuclear Information System (INIS)
Rakib, A.; Gennequin, C.; Ringot, S.; Aboukais, A.; Abi-Aad, E.; Dhainaut, T.
2011-01-01
Hydrogen production by steam reforming of methane was studied over Ni catalysts supported on CeO 2 , Al 2 O 3 and CeO 2 -Al 2 O 3 . These catalysts were prepared using the impregnation method and characterized by XRD. The effect of CeO2 promoter on the catalytic performance of Ni/Al 2 O 3 catalyst for methane steam reforming reaction was investigated. In fact, CeO 2 had a positive effect on the catalytic activity in this reaction. Experimental results demonstrated that Ni/CeO 2 -Al 2 O 3 catalyst showed excellent catalytic activity and high reaction performance. In addition, the effects of reaction temperature and metal content on the conversion of CH 4 and H 2 /CO ratio were also investigated. Results indicated that CH4 conversion increased significantly with the increase of the reaction temperature and metal content. (author)
Tet1 and Tet2 maintain mesenchymal stem cell homeostasis via demethylation of the P2rX7 promoter.
Yang, Ruili; Yu, Tingting; Kou, Xiaoxing; Gao, Xiang; Chen, Chider; Liu, Dawei; Zhou, Yanheng; Shi, Songtao
2018-06-01
Ten-eleven translocation (Tet) family-mediated DNA oxidation represents an epigenetic modification capable of converting 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), which regulates various biological processes. However, it is unknown whether Tet family affects mesenchymal stem cells (MSCs) or the skeletal system. Here we show that depletion of Tet1 and Tet2 results in impaired self-renewal and differentiation of bone marrow MSCs (BMMSCs) and a significant osteopenia phenotype. Tet1 and Tet2 deficiency reduces demethylation of the P2rX7 promoter and downregulates exosome release, leading to intracellular accumulation of miR-297a-5p, miR-297b-5p, and miR-297c-5p. These miRNAs inhibit Runx2 signaling to impair BMMSC function. We show that overexpression of P2rX7 rescues the impaired BMMSCs and osteoporotic phenotype in Tet1 and Tet2 double knockout mice. These results indicate that Tet1 and Tet2 play a critical role in maintaining BMMSC and bone homeostasis through demethylation of P2rX7 to control exosome and miRNA release. This Tet/P2rX7/Runx2 cascade may serve as a target for the development of novel therapies for osteopenia disorders.
Energy Technology Data Exchange (ETDEWEB)
Winkel, L.
The Gas, Electricity and Water Works Cologne (GEW) supplies 4,115 objects with district heat. The connected load totals 830,000 kJ/s, which over the last 10 years has been expanded by an average of 5.3% annually and is currently 2.2% above the national average. The extension of district heat supply has been accomplished without subsidies from the two ZIP programmes. The major objects in Cologne city are to a large extent linked to the GEW district heating network. The goal now is to win more smaller objects in the supply area. To achieve notable new connected load increases in the future, the GEW is conducting a sales promotion drive together with Cologne heating construction firms. The promotion is running under the slogan 'Magically Simple: Heating with District Heat'. Its strategy and execution are described here by the author.
Liu, Hongyu; Jiang, Yue; Jin, Xiaoyan; Zhu, Lihua; Shen, Xiaoyue; Zhang, Qun; Wang, Bin; Wang, Junxia; Hu, Yali; Yan, Guijun; Sun, Haixiang
2013-07-15
Matrix metalloproteinase 2 (MMP-2) has been reported to be an important regulator of cell migration and invasion through degradation of the extracellular matrix (ECM) in many diseases, such as cancer and endometriosis. Here, we found calcium-activated neutral protease 7 (CAPN 7) expression was markedly upregulated in the eutopic endometrium and endometrial stromal cells of women diagnosed with endometriosis. Our studies were carried out to detect the effects of CAPN 7 on human endometrial stromal cell (hESC) migration and invasion. Western blotting and quantitative real-time PCR were used to detect the expression of CAPN 7 in endometriosis patients and normal fertile women. Scratch-wound-healing and invasion chamber assay were used to investigate the role of CAPN 7 in hESC migration and invasion. Western blotting, quantitative real-time PCR and zymography were carried out to detect the effect of CAPN 7 on the expressions and activity of MMP-2. CAPN 7 was markedly up-regulated in endometriosis, thereby promoting the migration and invasion of hESC. CAPN 7 overexpression led to increased expression of MMP-2 and tissue inhibitor of metalloproteinases 2 (TIMP-2); CAPN 7 knockdown reversed these changes. CAPN 7 increased MMP-2 activity by increasing the ratio of MMP-2 to TIMP-2. We also found that OA-Hy (an MMP-2 inhibitor) decreased the effects of CAPN 7 overexpression on hESC migration and invasion by approximately 50% and 55%, respectively. Additionally, a coimmunoprecipitation assay demonstrated that CAPN 7 interacted with activator protein 2α (AP-2α): an important transcription factor of MMP-2. CAPN 7 promotes hESC migration and invasion by increasing the activity of MMP-2 via an increased ratio of MMP-2 to TIMP-2.
Minimizing the cancer-promotional activity of cox-2 as a central strategy in cancer prevention.
McCarty, Mark F
2012-01-01
A recent meta-analysis examining long-term mortality in subjects who participated in controlled studies evaluating the impact of daily aspirin on vascular risk, has concluded that aspirin confers substantial protection from cancer mortality. Remarkably, low-dose aspirin was as effective as higher-dose regimens; hence this protection may be achievable with minimal risk. There is reason to believe that this protection stems primarily from inhibition of cox-2 in pre-neoplastic lesions. Since safe aspirin regimens can only achieve a partial and transitory inhibition of cox-2, it may be feasible to complement the cancer-protective benefit of aspirin with other measures which decrease cox-2 expression or which limit the bioactivity of cox-2-derived PGE2. Oxidative stress boosts cox-2 expression by up-regulating activation of NF-kappaB and MAP kinases; NADPH oxidase activation may thus promote carcinogenesis by increasing cox-2 expression while also amplifying oxidant-mediated mutagenesis. A prospective cohort study has observed that relatively elevated serum bilirubin levels are associated with a marked reduction in subsequent cancer mortality; this may reflect bilirubin's physiological role as a potent inhibitor of NADPH oxidase. It may be feasible to mimic this protective effect by supplementing with spirulina, a rich source of a phycobilin which shares bilirubin's ability to inhibit NADPH oxidase. Ancillary antioxidant measures - phase 2 inducing phytochemicals, melatonin, N-acetylcysteine, and astaxanthin - may also aid cox-2 down-regulation. The cancer protection often associated with high-normal vitamin D status may be attributable, in part, to the ability of the activated vitamin D receptor to decrease cox-2 expression while promoting PGE2 catabolism and suppressing the expression of PGE2 receptors. Diets with a relatively low ratio of omega-6 to long-chain omega-3 fats may achieve cancer protection by antagonizing the production and bioactivity of PGE2. Growth
The study on Egr-1 promoter which is radioactive promoter
International Nuclear Information System (INIS)
Zhang Chunzhi; Guo Yang; Lv Zhonghong
2006-01-01
Radiogenetic therapy is a heated reaseach on oncotherapy. Early growth response gene-1 (Egr-1) gene promoter is a probably means in radiogenetic therapy. The article review studying on Egr-1 gene promoter and constructing regulating gene expressing system by radiation-inducible Egr-1 gene promoter. (authors)
Development of Transcriptional Fusions to Assess Leptospira interrogans Promoter Activity
Cerqueira, Gustavo M.; Souza, Natalie M.; Araújo, Eduardo R.; Barros, Aline T.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Nascimento, Ana L. T. O.
2011-01-01
Background Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. Methodology and Principal Findings A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP) were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA) and Sphingomielynase 2 (sph2) promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. Conclusions The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa. PMID:21445252
Development of transcriptional fusions to assess Leptospira interrogans promoter activity.
Directory of Open Access Journals (Sweden)
Gustavo M Cerqueira
Full Text Available BACKGROUND: Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. METHODOLOGY AND PRINCIPAL FINDINGS: A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA and Sphingomyelinase 2 (sph2 promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. CONCLUSIONS: The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa.
Effect of Lanthanum as a Promoter on Fe-Co/SiO2 Catalyst for Fischer-Tropsch Synthesis
Directory of Open Access Journals (Sweden)
Ali Abbasi
2014-03-01
Full Text Available Iron-Cobalt catalyst is well known from both operational and economical aspects for Fischer-Tropsch synthesis. Effort to increase the efficiency of this kind of catalyst is an important research topic. In this work, the effect of lanthanum on characteristic behavior, conversion and selectivity of a Fe-Co/SiO2 Fischer-Tropsch catalyst was studied. The Fe-Co-La/SiO2 Catalysts were prepared using an incipient wetness impregnation method. These catalysts were then characterized by XRF-EDAX, BET and TPR techniques, and their performance were evaluated in a lab-scale reactor at 250ºC, H2/CO = 1.8 of molar ratio, 16 barg pressure and GHSV=600 h-1. TPR analysis showed that the addition of La lowered the reduction temperature of Fe-Co catalyst, and due to a lower temperature, the sintering of the catalyst can be mitigated. Furthermore, from the micro reactor tests (about 4 days, it was found that lanthanum promoted catalyst had higher selectivity toward hydrocarbons, and lower selectivity toward CO2.Received: 8th July 2013; Revised: 18th November 2013; Accepted: 1st December 2013[How to Cite: Abbasi, A., Ghasemi, M., Sadighi, S. (2014. Effect of Lanthanum as a Promoter on Fe-Co/SiO2 Catalyst for Fischer-Tropsch Synthesis. Bulletin of Chemical Reaction Engineering & Catalysis, 9 (1: 23-27. (doi:10.9767/bcrec.9.1.5142.23-27][Permalink/DOI: http://dx.doi.org/10.9767/bcrec.9.1.5142.23-27
Gan, Fang; Hu, Zhihua; Huang, Yu; Xue, Hongxia; Huang, Da; Qian, Gang; Hu, Junfa; Chen, Xingxiang; Wang, Tian; Huang, Kehe
2016-01-01
Porcine circovirus type 2 (PCV2) is the primary cause of porcine circovirus disease, and ochratoxin A (OTA)-induced oxidative stress promotes PCV2 replication. In humans, selenoprotein S (SelS) has antioxidant ability, but it is unclear whether SelS affects viral infection. Here, we stably transfected PK15 cells with pig pCDNA3.1-SelS to overexpress SelS. Selenium (Se) at 2 or 4 μM and SelS overexpression blocked the OTA-induced increases of PCV2 DNA copy number and infected cell numbers. SelS overexpression also increased glutathione (GSH), NF-E2-related factor 2 (Nrf2) mRNA, and γ-glutamyl-cysteine synthetase mRNA levels; decreased reactive oxygen species (ROS) levels; and inhibited p38 phosphorylation in PCV2-infected PK15 cells, regardless of OTA treatment. Buthionine sulfoximine reversed all of the above SelS-induced changes. siRNA-mediated SelS knockdown decreased Nrf2 mRNA and GSH levels, increased ROS levels, and promoted PCV2 replication in OTA-treated PK15 cells. These data indicate that pig SelS blocks OTA-induced promotion of PCV2 replication by inhibiting the oxidative stress and p38 phosphorylation in PK15 cells. PMID:26943035
Proper Calcium Use: Vitamin K2 as a Promoter of Bone and Cardiovascular Health.
Maresz, Katarzyna
2015-02-01
Inadequate calcium intake can lead to decreased bone mineral density, which can increase the risk of bone fractures. Supplemental calcium promotes bone mineral density and strength and can prevent osteoporosis. Recent scientific evidence, however, suggests that elevated consumption of calcium supplements may raise the risk for heart disease and can be connected with accelerated deposit of calcium in blood-vessel walls and soft tissues. In contrast, vitamin K2 is associated with the inhibition of arterial calcification and arterial stiffening. An adequate intake of vitamin K2 has been shown to lower the risk of vascular damage because it activates matrix GLA protein (MGP), which inhibits the deposits of calcium on the walls. Vitamin K, particularly as vitamin K2, is nearly nonexistent in junk food, with little being consumed even in a healthy Western diet. Vitamin K deficiency results in inadequate activation of MGP, which greatly impairs the process of calcium removal and increases the risk of calcification of the blood vessels. An increased intake of vitamin K2 could be a means of lowering calcium-associated health risks.
Directory of Open Access Journals (Sweden)
Derek K. Smith
2016-11-01
Full Text Available Pro-neural transcription factors and small molecules can induce the reprogramming of fibroblasts into functional neurons; however, the immediate-early molecular events that catalyze this conversion have not been well defined. We previously demonstrated that neurogenin 2 (NEUROG2, forskolin (F, and dorsomorphin (D can reprogram fibroblasts into functional neurons with high efficiency. Here, we used this model to define the genetic and epigenetic events that initiate an acquisition of neuronal identity. We demonstrate that NEUROG2 is a pioneer factor, FD enhances chromatin accessibility and H3K27 acetylation, and synergistic transcription activated by these factors is essential to successful reprogramming. CREB1 promotes neuron survival and acts with NEUROG2 to upregulate SOX4, which co-activates NEUROD1 and NEUROD4. In addition, SOX4 targets SWI/SNF subunits and SOX4 knockdown results in extensive loss of open chromatin and abolishes reprogramming. Applying these insights, adult human glioblastoma cell and skin fibroblast reprogramming can be improved using SOX4 or chromatin-modifying chemicals.
International Nuclear Information System (INIS)
Shebaita, M.K.
1975-01-01
The concept of radiation promotion was proposed in this study. The proposal of this concept was dependent upon stimulation in growth weight of survived chicks when fertile eggs were exposed to 60 Co gamma radiation. It was found that female chick (Promotive Sex) responded to this proposal concept rather than the male. Moreover, the dose level of 640 rads was found to be the Promotive Dose. It is important before applying ionizing radiation as a growth promotive to take into consideration whether you want increasing egg or meat production, as meat promotion in layers breed is bound to decrease egg production. (orig.) [de
Cloning of the human TASK-2 (KCNK5) promoter and its regulation by chronic hypoxia
International Nuclear Information System (INIS)
Brazier, Stephen P.; Mason, Helen S.; Bateson, Alan N.; Kemp, Paul J.
2005-01-01
The tandem P domain potassium channel family includes five members of the acid-sensing subfamily, TASK. TASK channels are active at resting potential and are inhibited by extracellular protons, suggesting they function as acid sensors and control excitability/ion homeostasis. Indeed, TASK-2 (KCNK5) has been shown to control excitability, volume regulation, bicarbonate handling, and apoptosis in a variety of tissues. With such diverse functions being ascribed to TASK-2, it is important to understand long-term as well as short-term regulation of this important channel. Thus, we have cloned the TASK-2 promoter, demonstrated that its transcriptional activity is dependent upon pO 2 , shown that deletion of overlapping consensus binding sites for NF-κB/Elk-1 ablates this O 2 sensitivity, and proved that Elk-1 binds preferentially to this site. Furthermore, the consequences of chronic hypoxia on natively expressed TASK-2 are decreased steady-state mRNA and cell depolarization showing that TASK-2 contributes to the excitability of this important lung cell type
Promoting Health in Early Childhood Environments: A Health-Promotion Approach
Minniss, Fiona Rowe; Wardrope, Cheryl; Johnston, Donni; Kendall, Elizabeth
2013-01-01
This paper investigates the mechanisms by which a health-promotion intervention might influence the health-promoting behaviours of staff members working in early childhood centres. The intervention was an ecological health-promotion initiative that was implemented within four early childhood centres in South-East Queensland, Australia. In-depth,…
Promotion effect of H2 on ethanol oxidation and NOx reduction with ethanol over Ag/Al2O3 catalyst.
Yu, Yunbo; Li, Yi; Zhang, Xiuli; Deng, Hua; He, Hong; Li, Yuyang
2015-01-06
The catalytic partial oxidation of ethanol and selective catalytic reduction of NOx with ethanol (ethanol-SCR) over Ag/Al2O3 were studied using synchrotron vacuum ultraviolet (VUV) photoionization mass spectrometry (PIMS). The intermediates were identified by PIMS and their photoionization efficiency (PIE) spectra. The results indicate that H2 promotes the partial oxidation of ethanol to acetaldehyde over Ag/Al2O3, while the simultaneously occurring processes of dehydration and dehydrogenation were inhibited. H2 addition favors the formation of ammonia during ethanol-SCR over Ag/Al2O3, the occurrence of which creates an effective pathway for NOx reduction by direct reaction with NH3. Simultaneously, the enhancement of the formation of ammonia benefits its reaction with surface enolic species, resulting in producing -NCO species again, leading to enhancement of ethanol-SCR over Ag/Al2O3 by H2. Using VUV-PIMS, the reactive vinyloxy radical was observed in the gas phase during the NOx reduction by ethanol for the first time, particularly in the presence of H2. Identification of such a reaction occurring in the gas phase may be crucial for understanding the reaction pathway of HC-SCR over Ag/Al2O3.
Knight, Emily; Werstine, Robert J; Rasmussen-Pennington, Diane M; Fitzsimmons, Deborah; Petrella, Robert J
2015-03-01
Care for chronic conditions and noncommunicable diseases is dominating health systems around the globe. For physical therapists, this strain presents a substantial opportunity for engaging patients in health promotion and disease management in the years to come. Examples of social media being used to engage consumers in the business landscape are pervasive, and research reports suggest that patients are ready for social media to be incorporated into the way health care systems deliver care. We propose that leveraging the power and utility of existing technologies, such as social media, could innovate the way physical therapists engage patients in rehabilitation and health promotion practices, thus contributing to the evolution of the profession: Physical Therapy 2.0. To continue to be relevant in the community, physical therapist practice must respond to patients' needs and expectations. Incorporating social media into how physical therapists are both designing and delivering care holds potential for enhancing patient engagement in prescribed health behaviors and improving treatment outcomes. This conceptual article presents the perspective that physical therapists can utilize social media to enhance care delivery and treatment outcomes. © 2015 American Physical Therapy Association.
Mojumdar, Kamalika; Liang, Feng; Giordano, Christian; Lemaire, Christian; Danialou, Gawiyou; Okazaki, Tatsuma; Bourdon, Johanne; Rafei, Moutih; Galipeau, Jacques; Divangahi, Maziar; Petrof, Basil J
2014-01-01
Myofiber necrosis and fibrosis are hallmarks of Duchenne muscular dystrophy (DMD), leading to lethal weakness of the diaphragm. Macrophages (MPs) are required for successful muscle regeneration, but the role of inflammatory monocyte (MO)-derived MPs in either promoting or mitigating DMD is unclear. We show that DMD (mdx) mouse diaphragms exhibit greatly increased expression of CCR2 and its chemokine ligands, along with inflammatory (Ly6Chigh) MO recruitment and accumulation of CD11bhigh MO-de...
FAN1 acts with FANCI-FANCD2 to promote DNA interstrand cross-link repair.
Liu, Ting; Ghosal, Gargi; Yuan, Jingsong; Chen, Junjie; Huang, Jun
2010-08-06
Fanconi anemia (FA) is caused by mutations in 13 Fanc genes and renders cells hypersensitive to DNA interstrand cross-linking (ICL) agents. A central event in the FA pathway is mono-ubiquitylation of the FANCI-FANCD2 (ID) protein complex. Here, we characterize a previously unrecognized nuclease, Fanconi anemia-associated nuclease 1 (FAN1), that promotes ICL repair in a manner strictly dependent on its ability to accumulate at or near sites of DNA damage and that relies on mono-ubiquitylation of the ID complex. Thus, the mono-ubiquitylated ID complex recruits the downstream repair protein FAN1 and facilitates the repair of DNA interstrand cross-links.