Biomedical neutron research at the Californium User Facility for neutron science

International Nuclear Information System (INIS)

Martin, R.C.; Byrne, T.E.; Miller, L.F.

1997-01-01

The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy

Californium source transfer

International Nuclear Information System (INIS)

Wallace, C.R.

1995-01-01

In early 1995, the receipt of four sealed californium-252 sources from Oak Ridge National Lab was successfully accomplished by a team comprised of Radiological Engineering, Radiological Operations and Health Physics Instrumentation personnel. A procedure was developed and walked-down by the participants during a Dry Run Evolution. Several special tools were developed during the pre-planning phases of the project which reduced individual and job dose to minimal levels. These included a mobile lifting device for attachment of a transfer ball valve assembly to the undercarriage of the Cannonball Carrier, a transfer tube elbow to ensure proper angle of the source transfer tube, and several tools used during emergency response for remote retrieval and handling of an unshielded source. Lessons were learned in the areas of contamination control, emergency preparedness, and benefits of thorough pre-planning, effectiveness of locally creating and designing special tools to reduce worker dose, and methods of successfully accomplishing source receipt evolutions during extreme or inclement weather

Biomedical neutron research at the Californium User Facility for Neutron Science

International Nuclear Information System (INIS)

Martin, R.C.; Byrne, T.E.; Miller, L.F.

1998-01-01

The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy. (author)

Prompt neutron spectrum of the spontaneous fission of californium-252

International Nuclear Information System (INIS)

Zamyatnin, Yu.S.; Kroshkin, N.I.; Korostylev, V.A.; Nefedov, V.N.; Ryazanov, D.K.; Starostov, B.I.; Semenov, A.F.

1976-01-01

The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252 Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252 Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252 Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references

Neutron reflector design with Californium 252 neutron for Boron neutron chapter therapy facility using MCNP5 simulation method

International Nuclear Information System (INIS)

Muhammad Fakhrurreza; Kusminanto; Y Sardjono

2014-01-01

In this research has made a reflector design to provide beams of Neutron for BNCT with Californium-252 radioactive source. This collimator is useful to obtain optimum epithermal neutron flux with the smallest impurity radiation (thermal neutron, fast neutron, and gamma). The design process is done using Monte Carlo N-Particle simulation version 5 (MCNP5) code to calculate the neutron flux tally form. The chosen reflector design is the reflectors which use material such as BeO ceramic with 13 cm thick. Moderator use sulfur material with the slope angle of the cone is 30°. From the calculation result, it is obtained that Reflector with 1 gram Californium-252 source can produce a neutron output thermal which has thermal neutron specification 2.23189 x 10 9 n/s.cm 2 , epithermal neutron 3.51548 x 10 9 n/s.cm 2 , and fast neutron 4.82241 x 10 9 n/s.cm 2 From the result, it needs additional collimator because the BNCT requirement. (author)

Measurements of integral cross sections in the californium-252 fission neutron spectrum

International Nuclear Information System (INIS)

Alberts, W.G.; Guenther, E.; Matzke, M.; Rassl, G.

1977-01-01

In a low-scattering arrangement cross sections averaged over the californium-252 spontaneous fission neutron spectrum were measured. The reactions 27 Al(n,α) 46 Ti, 47 Ti, 48 Ti(n,p), 54 Fe, 56 Fe(n,p), 58 Ni(n,p), 64 Zn(n,p), 115 In(n,n') were studied in order to obtain a consistent set of threshold detectors used in fast neutron flux density measurements. Overall uncertainties between 2 and 2.5% could be achieved; corrections due to neutron scattering in source and samples are discussed

Measurement of californium-252 gamma photons depth dose distribution in tissue equivalent material. Vol. 4

Energy Technology Data Exchange (ETDEWEB)

Fadel, M A; El-Fiki, M A; Eissa, H M; Abdel-Hafez, A; Naguib, S H [National Institute of Standards, Cairo (Egypt)

1996-03-01

Phantom of tissue equivalent material with and without bone was used measuring depth dose distribution of gamma-rays from californium-252 source. The source was positioned at center of perspex walled phantom. Depth dose measurements were recorded for X, Y and Z planes at different distances from source. TLD 700 was used for measuring the dose distribution. Results indicate that implantation of bone in tissue equivalent medium cause changes in the gamma depth dose distribution which varies according to variation in bone geometry. 9 figs.

Teratogenic effect of Californium-252 irradiation in rats

International Nuclear Information System (INIS)

Satow, Yukio; Lee, Juing-Yi; Hori, Hiroshi; Okuda, Hiroe; Tsuchimoto, Shigeo; Sawada, Shozo; Yokoro, Kenjiro

1989-01-01

The teratogenicity of Californium-252 (Cf-252) irradiation which generates approximately 70% 2.3 MeV fast neutron and 30% gamma rays was evaluated. A single whole body exposure of Cf-252 at various doses was given to pregnant rats on day 8 or 9 of pregnancy, followed by microscopic autopsy of the fetuses at the terminal stage of pregnancy to search for external and internal malformations. For comparison, pregnant rats were irradiated with various doses of Cobalt-60 (Co-60) standard gamma rays at the same dose rate (1 rad/min.). The doses were 20-120 rad of Cf-252 and 80-220 rad of Co-60. Using frequency of radiation induced malformations observed on day 8 of pregnancy as an index, relative biological effectiveness (RBE) of 2.3-2.7 was obtained from the straight line obtained by modifying by the least squares method the frequency curves of malformed fetuses in total implants and in surviving fetuses. The types of malformations induced by Cf-252 and Co-60 irradiation were alike. Using fetal LD 50 as an index, 2.4 was obtained as RBE when irradiated on day 8 of pregnancy and 3.1 as that when irradiated on day 9. The results showed that Cf-252 had stronger a teratogenic effect than Co-60 gamma rays. (author)

Long-term effects of an intracavitary treatment with californium-252 on normal tissue

International Nuclear Information System (INIS)

Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

1976-01-01

About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252 Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252 Cf and 7000 rad from 226 Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252 Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252 Cf and 5000 rad from 226 Ra

Use of californium-252 sources in Hungary for teaching and research

International Nuclear Information System (INIS)

Csikai, J.

1976-01-01

An activation facility was designed to accommodate up to 50 mg of 252 Cf; it contains at present a 500 μg source. The absolute values of thermal, epithermal and fast neutron fluxes were determined by the foil activation method using In, Dy, Au, Al and Fe detectors. Cross-sections averaged for unmoderated 252 Cf neutrons were determined for 22 different reactions for elements with atomic weights lying between A=27 and 204. The sensitivity for determination of Al, Ti, Cu, As, Sr, Mo, In, Cd, Ba, Au, Hg and Pb was calculated for NaI(Tl) and Ge(Li) detectors. Average (n,2n) cross-sections for 252 Cf spectrum were calculated for 49 nuclei lying between A=14 and 204. Angular distributions and cross-sections for the fragments from 252 Cf neutron-induced fission of 232 Th and 238 U were measured. Titanium in bauxite and manganese in aluminium alloys were determined with a 252 Cf source. The applicability of solid-state track detectors for neutron dosimetry, radiography and for the determination of fuel burn-up were investigated using 252 Cf neutron and fragment sources. Characteristics of a jumping spark counter for counting fission fragments were studied with 252 Cf sources. (author)

Use of polyethylene pellets in the design and construction of a storage safe, a transport vessel and a portable shield for californium-252

International Nuclear Information System (INIS)

Sharma, S.

1986-01-01

A storage and shielding facility for 300 μg of Californium-252 sources was designed and constructed. Though the safe was in a permanent location, the fact that it consisted of a lead bucket surrounded by polyethylene pellets made it simple, movable and inexpensive. If need be, more quantities of Cf-252 could be added without altering the basic design and sacrificing the radiation protection guidelines. The measured radiation levels from 300 μg of stored Cf-252 in and around the storage vault were lower than the expected dose rates by a factor of 5. The measured radiation levels around the occupied environs of the facility were below the maximum permissible yearly dose of 500mrem for non-occupational workers. A transport vessel was designed and constructed to carry up to 50 μg of Californium-252 sources. It consisted of a standard 55 gallon steel drum on casters containing cylindrical lead shield surrounded by polyethylene pellets. The measured maximum surface dose rates on the drum and at one meter away were within the radiation protection guidelines and were less than the expected dose rates. A portable shield was designed and constructed to protect the body in afterloading operations and handling of the sources. It consisted of polyethylene pellets in an aluminum box and an attached 10 cm thick plexiglass eye shield. The simple design, with the ease of using polyethylene pellets can be extended to construct bedside shields

Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source

International Nuclear Information System (INIS)

Cardoso, Antonio

1976-01-01

Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction 55 Mn (n.gamma) 56 Mn, high concentration of manganese in the matrix and short half - life of 56 Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions 56 Fe(n,p) 56 Mn and 59 Co (n, α) 56 were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

Energy Technology Data Exchange (ETDEWEB)

Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

1976-01-01

About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

Californium-252 Brachytherapy Combined With External-Beam Radiotherapy for Cervical Cancer: Long-Term Treatment Results

International Nuclear Information System (INIS)

Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu; Wang Dong

2011-01-01

Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ( 252 Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with 252 Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7–12 Gy per insertion per week, with a total dose of 29–45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16–38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44–56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of 252 Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.

Californium Multiplier. Part I. Design for neutron radiography

International Nuclear Information System (INIS)

Crosbie, K.L.; Preskitt, C.A.; John, J.; Hastings, J.D.

1982-01-01

The Californium Multiplier (CFX) is a subcritical assembly of enriched uranium surrounding a californium-252 neutron source. The function of the CFX is to multiply the neutrons emitted by the source to a number sufficient for neutron radiography. The CFX is designed to provide a collimated beam of thermal neutrons from which the gamma radiation is filtered, and the scattered neutrons are reduced to make it suitable for high resolution radiography. The entire system has inherent safety features, which provide for system and personnel safety, and it operates at moderate cost. In Part I, the CFX and the theory of its operation are described in detail. Part II covers the performance of the Mound Facility CFX

Neutron activation analysis of the calcium content in vivo, using a 50μg source of californium 252

International Nuclear Information System (INIS)

Guey, A.; Zech, P.Y.; Meary, M.F.; Leitienne, P.

1975-01-01

Owing to the recent commercialisation of californium 252 it is now possible to obtain neutron fluxes strong enough for precise activation of the calcium content of biological targets. After the preliminary measurements necessary to establish the most suitable conditions for irradiating 3 to 5cm thick targets, two parallel sets of experiments were developed. In the first the medium-term total calcium variation was studied in 20 rats, 16 suffering from chronic kidney deficiency. In the second the precision expected as a function of the calcium content of the irradiated target was examined, using 3 sets of tissue equivalent standards of calcium contents 5, 20 and 50g respectively. The first results obtained on calcium 49 in vivo show that a calcium content variation can be followed with a sensitivity threshold below that obtained by conventional methods [fr

Hypoxic versus normoxic external-beam irradiation of cervical carcinoma combined with californium-252 neutron brachytherapy. Comparative treatment results of a 5-year randomized study

Czech Academy of Sciences Publication Activity Database

Tačev, T.; Vacek, Antonín; Ptáčková, B.; Strnad, V.

2005-01-01

Roč. 181, č. 5 (2005), s. 273-284 ISSN 0179-7158 Institutional research plan: CEZ:AV0Z50040507 Keywords : cervical carcinoma * hypoxyradiotherapy * californium-252 Subject RIV: BO - Biophysics Impact factor: 3.490, year: 2005

Californium-252 interstitial implants in carcinoma of the tongue

International Nuclear Information System (INIS)

Vtyurin, B.M.; Ivanov, V.N.; Medvedev, V.S.; Galantseva, G.F.; Abdulkadyrov, S.A.; Ivanova, L.F.; Petrovskaya, G.A.; Plichko, V.I.

1985-01-01

A clinical study using 252 Cf sources in brachytherapy of tumors began in the Research Institute of Medical Radiology of the Academy of Medical Sciences of the USSR in 1973. 252 Cf afterloading cells were utilized by the method of simple afterloading. Dosimetry and radiation protection of medical personnel were developed. To substantiate optimal therapeutic doses of 252 Cf neutrons, a correlation of dose, time, and treatment volume factors with clinical results of 252 Cf interstitial implants in carcinoma of the tongue for 47 patients with a minimum follow-up period of 1 year was studied. Forty-nine interstitial implants have been performed. Seventeen patients received 252 Cf implants alone (Group I), 17 other patients received 252 Cf implants in combination with external radiation (Group II), and 15 patients were treated with interstitial implants for recurrent or residual tumors (Groups III). Complete regression of carcinoma of the tongue was obtained in 48 patients (98%). Thirteen patients (27%) developed radiation necrosis. The therapeutic dose of neutron radiation from 252 Cf sources in interstitial radiotherapy of primary tongue carcinomas (Group I) was found to be 7 to 9 Gy. Optimal therapeutic neutron dose in combined interstitial and external radiotherapy of primary tumors (Group II) was 5 to 6 Gy with an external radiation dose of 40 Gy. For recurrent and residual tumors (Group III), favorable results were obtained with tumor doses of 6.5 to 7 Gy

Californium loan programme

International Nuclear Information System (INIS)

1974-01-01

The offer of the United States to loan Californium-252 sources to the IAEA was made by Dr. Glenn T. Seaborg, then chairman of the USAEC, in his opening statement at the 15th. General Conference of the IAEA held in Vienna in 1971. The purpose of this loan was to make neutron emitting sources available to universities in the Member States for use in educational programmes. The sources, in the form of small needles designed for medical use in radiation therapy, were judged highly suitable for didactic applications due to their small size, limited activity and well documented radiological parameters. Subsequently, in May 1973, the Director General announced the availability of the Californium sources to the Member States. To date, numerous sources have been loaned to universities in Czechoslovakia, Costa Rica, the Federal Republic of Germany, Ghana, India, Iran, Israel, Japan, South Africa, Switzerland, the United Kingdom and Uruguay; additional applications for loans are being processed. It is anticipated that the loan programme will be terminated in 1975 once all the available sources have been distributed. n order to provide guidance for the Member States on the safe exploitation of these sources, a prototype use and storage facility was designed by IAEA staff of the Dosimetry Section of the Division of Life Sciences, and constructed at the IAEA laboratory in Seibersdorf, Austria. Figures 2-5 illustrate some of the details of this container, which is being given to the Ghana Nuclear Centre in support of a training programme for students at the university in Accra. Further advice to users of these sources will be provided by the publication of an instructional syllabus, a laboratory manual for experiments and the safety precautions inherent in the proper handling of neutron emitting radionuclides, authored by Professors Erich J. Hall and Harald H. Rossi of Columbia University. The syllabus and manual will be published as part of the IAEA Technical Series in September

Fabrication of 50-mg 252Cf neutron sources for the FDA [Food and Drug Administration] activation analysis facility

International Nuclear Information System (INIS)

Bigelow, J.E.; Cagle, E.B.; Knauer, J.B.

1987-01-01

The Transuranium Processing Plant (TPP) at ORNL has been requested by the Food and Drug Administration (FDA) to furnish 200 mg of 252 Cf for use in their new activation analysis facility. This paper discusses the procedure to be employed in fabricating the californium into four neutron sources, each containing a nominal 50-mg of 252 Cf. The ORNL Model LSD (Large, Stainless steel, Doubly encapsulated) neutron source consists of a 6.33-mm-diam aluminum pellet doubly encapsulated in Type 304L stainless steel. The pellet is comprised of an aluminum tube holding Cf 2 O 2 SO 4 microspheres confined by pressed aluminum powder. The microspheres are prepared in a separate vessel and then transferred into the specially designed aluminum tube prior to pressing

Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

Energy Technology Data Exchange (ETDEWEB)

Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: ce_delgado89@hotmail.com [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)

2015-10-15

Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

Atlantic Richfield Hanford Company californium multiplier/delayed neutron counter safety analysis

International Nuclear Information System (INIS)

Zimmer, W.H.

1976-08-01

The Californium Multiplier (CFX) is a subcritical assembly of uranium surrounding 252 Cf spontaneously fissioning neutron sources; its function is to multiply the neutron flux to a level useful for activation analysis. This document summarizes the safety analysis aspects of the CFX, DNC, pneumatic transfer system, and instrumentation and to detail all the aspects of the total facility as a starting point for the ARHCO Safety Analysis Review. Recognized hazards and steps already taken to neutralize them are itemized

Undergraduate experiments using the neutron radiation from californium-252

International Nuclear Information System (INIS)

Rossel, J.; Golecki, I.

1976-01-01

Three experiments designed to demonstrate and measure several properties of the neutron radiation emitted by a 3μg 252 Cf source are described. The experiments constitute a special project carried out by a third-year undergraduate student at the Institute of Physics of the University of Neuchatel. The 252 Cf source is enclosed in a shield which allows a pencil of fast neutrons to pass through a central tube, while reducing the ambient radiation below the tolerance level. The shield consists of layers of borated paraffin wax, iron and cadmium. The first experiment uses an air-alcohol diffusion cloud chamber for the demonstration of tracks of recoil protons produced by the neutrons. Semi-quantitative measurements of track lengths give the correct order of magnitude of the proton energies. In the second experiment a liquid scintillator detector is used to scan the beam profile across the radiation shield enclosing the source. A pulse-shape-discrimination system discriminates between neutrons and gamma photons. The third experiment makes use of the nuclear emulsion technique to study the neutron energy distribution of 252 Cf. Preliminary results are compared with published values. (author)

Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

Energy Technology Data Exchange (ETDEWEB)

Cardoso, Antonio

1976-07-01

Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

Energy Technology Data Exchange (ETDEWEB)

Cardoso, Antonio

1976-07-01

Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

Beyond Californium-A Neutron Generator Alternative for Dosimetry and Instrument Calibration in the U.S.

Science.gov (United States)

Piper, Roman K; Mozhayev, Andrey V; Murphy, Mark K; Thompson, Alan K

2017-09-01

Evaluations of neutron survey instruments, area monitors, and personal dosimeters rely on reference neutron radiations, which have evolved from the heavy reliance on (α,n) sources to a shared reliance on (α,n) and the spontaneous fission neutrons of californium-252 (Cf). Capable of producing high dose equivalent rates from an almost point source geometry, the characteristics of Cf are generally more favorable when compared to the use of (α,n) and (γ,n) sources or reactor-produced reference neutron radiations. Californium-252 is typically used in two standardized configurations: unmoderated, to yield a fission energy spectrum; or with the capsule placed within a heavy-water moderating sphere to produce a softened spectrum that is generally considered more appropriate for evaluating devices used in nuclear power plant work environments. The U.S. Department of Energy Cf Loan/Lease Program, a longtime origin of affordable Cf sources for research, testing and calibration, was terminated in 2009. Since then, high-activity sources have become increasingly cost-prohibitive for laboratories that formerly benefited from that program. Neutron generators, based on the D-T and D-D fusion reactions, have become economically competitive with Cf and are recognized internationally as important calibration and test standards. Researchers from the National Institute of Standards and Technology and the Pacific Northwest National Laboratory are jointly considering the practicality and technical challenges of implementing neutron generators as calibration standards in the U.S. This article reviews the characteristics of isotope-based neutron sources, possible isotope alternatives to Cf, and the rationale behind the increasing favor of electronically generated neutron options. The evaluation of a D-T system at PNNL has revealed characteristics that must be considered in adapting generators to the task of calibration and testing where accurate determination of a dosimetric quantity is

Californium-252 Program Equipment Evaluation

Energy Technology Data Exchange (ETDEWEB)

Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2017-12-01

To successfully continue the ²⁵²Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.

Neutron activation analysis at the Californium User Facility for Neutron Science

International Nuclear Information System (INIS)

Martin, R.C.; Smith, E.H.; Glasgow, D.C.; Jerde, E.A.; Marsh, D.L.; Zhao, L.

1997-12-01

The Californium User Facility (CUF) for Neutron Science has been established to provide 252 Cf-based neutron irradiation services and research capabilities including neutron activation analysis (NAA). A major advantage of the CUF is its accessibility and controlled experimental conditions compared with those of a reactor environment The CUF maintains the world's largest inventory of compact 252 Cf neutron sources. Neutron source intensities of ≤ 10 11 neutrons/s are available for irradiations within a contamination-free hot cell, capable of providing thermal and fast neutron fluxes exceeding 10 8 cm -2 s -1 at the sample. Total flux of ≥10 9 cm -2 s -1 is feasible for large-volume irradiation rabbits within the 252 Cf storage pool. Neutron and gamma transport calculations have been performed using the Monte Carlo transport code MCNP to estimate irradiation fluxes available for sample activation within the hot cell and storage pool and to design and optimize a prompt gamma NAA (PGNAA) configuration for large sample volumes. Confirmatory NAA irradiations have been performed within the pool. Gamma spectroscopy capabilities including PGNAA are being established within the CUF for sample analysis

Determination of the average number of neutrons per fission event for californium-252

International Nuclear Information System (INIS)

Aleksandrov, B.M.; Belov, L.M.; Drapchinskij, L.V.

1982-01-01

By means of a separate determination of neutron yields and fission event rates, the value of #betta#-bar( 252 Cf) has been measured for a series of new high-purity sources. The improved quality of the source active layers has reduced the error in determining the fission rate to 0.35%. The value obtained for #betta#-bar( 252 Cf) is 3.747+-0.036. A description is given of the design and the parameters of a spherical manganese bath in which the work on refining the value of #betta#-bar( 252 Cf) will be continued. (author)

A survey of uses and users of 252Cf

International Nuclear Information System (INIS)

Bigelow, J.E.; Alexander, C.W.; King, L.J.; Knauer, J.B.; Notz, K.J.

1989-01-01

Californium-252, which is one of the transuranium-element isotopes being produced in the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL), has found many applications in service to industry and medicine. As a neutron source, 252 Cf is unique in providing a highly concentrated and extremely reliable neutron spectrum from a very small assembly. Over the past 22 years, 252 Cf has been applied with great success to cancer therapy, to neutron radiography of objects ranging from flowers to entire aircraft, to startup sources for nuclear reactors, to fission activation assay for quality control and safeguards of all commercial nuclear fuel, and to many other beneficial uses, some of which are now poised for further growth. The extensive exploitation of this highly specialized product has been made possible through 252 Sales/Loan programs sponsored by the US DOE Office of Nuclear Materials Production, initially at the Savannah River Laboratory and now at ORNL

Graphite moderated 252Cf source

International Nuclear Information System (INIS)

Sajo B, L.; Barros, H.; Greaves, E. D.; Vega C, H. R.

2014-08-01

The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a 252 Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the 252 Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

Neutron flux characterization of californium-252 Neutron Research Facility at the University of Texas - Pan American by nuclear analytical technique

Science.gov (United States)

Wahid, Kareem; Sanchez, Patrick; Hannan, Mohammad

2014-03-01

In the field of nuclear science, neutron flux is an intrinsic property of nuclear reaction facilities that is the basis for experimental irradiation calculations and analysis. In the Rio Grande Valley (Texas), the UTPA Neutron Research Facility (NRF) is currently the only neutron facility available for experimental research purposes. The facility is comprised of a 20-microgram californium-252 neutron source surrounded by a shielding cascade containing different irradiation cavities. Thermal and fast neutron flux values for the UTPA NRF have yet to be fully investigated and may be of particular interest to biomedical studies in low neutron dose applications. Though a variety of techniques exist for the characterization of neutron flux, neutron activation analysis (NAA) of metal and nonmetal foils is a commonly utilized experimental method because of its detection sensitivity and availability. The aim of our current investigation is to employ foil activation in the determination of neutron flux values for the UTPA NSRF for further research purposes. Neutron spectrum unfolding of the acquired experimental data via specialized software and subsequent comparison for consistency with computational models lends confidence to the results.

Radiological Characterization Technical Report on Californium-252 Sealed Source Transuranic Debris Waste for the Off-Site Source Recovery Project at Los Alamos National Laboratory

Energy Technology Data Exchange (ETDEWEB)

Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2014-04-24

This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.

Use of californium-252 neutron irradiator for in-vivo analysis of the bone calcium content of the hand

International Nuclear Information System (INIS)

Guey, A.; Leitienne, P.; Zech, P.Y.; Traeger, J.; Doyen, J.B.; Breton, J.P.

1979-01-01

With californium-252 it is easy to obtain a high neutron flux of the order of 10 9 n/s. The mean energy of this radiation, which is close on 2 MeV, activates calcium very well. The authors describe a storage and irradiator unit with a 100 μg californium source, with which it will henceforth be possible to develop this technique of measuring the calcium of the hand in a hospital. The test programme has three distinct phases: (1) irradiation of the biological target for 10 min; (2) after a transfer period of 30 s, detection of the radiation emitted by the 49 Ca for 600 s; (3) processing of the numerical data received, which are transmitted on line to a T 1600 calculator. The weight is found by comparing the activity induced in the unknown calcium mass with that induced in a phantom chosen as the activity standard. The reproducibility of the method is of the order of 3% (5% at the worst). The gross standardized result is edited automatically. For physical and clinical reasons, the hand is chosen as the reference part of the body in 70 control subjects. The local irradiation dose is less than 2 rem. The bone calcium content is 14.3+-1.9 g in men and 10.1+-1.3 g in women. In clinical application of the technique it is necessary to differentiate between the normal calcium content and the calcium content found with a pathological state. This makes it necessary to express the measurement in the form of a volume mass (rho). The volume of the hand skeleton (V in cm 3 ) is calculated from the corresponding bone surface (S in cm 2 ) measured by planimetry with the relationship V=8.925 exp 0.0205.S, found after studying 80 hand skeletons. In our control subjects the calcium bone volume mass was 0.288 g/cm 3 in men and 0.282 g/cm 3 in women. There is a very significant difference (p<0.001) in a population of 88 subjects with chronic renal insufficiencies at the terminal stage: rho=0.233 in men and 0.235 in women

Graphite moderated {sup 252}Cf source

Energy Technology Data Exchange (ETDEWEB)

Sajo B, L.; Barros, H.; Greaves, E. D. [Universidad Simon Bolivar, Nuclear Physics Laboratory, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of); Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)

2014-08-15

The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a {sup 252}Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the {sup 252}Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

Feasibility and market potential of protein determination of wheat using californium-252

International Nuclear Information System (INIS)

Roberts, T.C. Jr.; Eckhoff, N.D.; Clack, R.W.; Roberts, T.C. Sr.

1976-01-01

To evaluate the feasibility of protein determination by capture gamma-ray analysis using californium-252 neutrons, an in-situ protein analysis system for use by grain handlers has been examined. Three 227 kilogram (approximately) lots of wheat were used to determine the amount of nitrogen present. Protein analyses by the Kjeldahl method were obtained from samples taken before and after the capture gamma-ray analyses. The 5.267-MeV gamma-ray was selected for use in this study as a compromise between efficiency and interference from other elements. The associated counting equipment was a multichannel analyzer with pulse shaping electronic and analysis computing equipment. A linear regression program was used to compare the regions of interest to the Kjeldahl protein averages. The counts composing each peak were summed and normalized using the total count of the hydrogen peak. The normalized nitrogen percentages indicate a significant correlation between the spectral regions and the Kjeldahl analyses. To a first approximation, the value of wheat is the wheat protein. At the present time, protein testing of wheat is destructive, cumbersome, and time-consuming as compared to the potential for capture gamma-ray analysis testing. Assuming that such a protein analysis unit can analyze 42 tonne of wheat per hour, over 120 units would be needed to monitor one-half the U.S. annual wheat production. A 0.5% improvement in processor realizations and grain throughput value of $167.00 per tonne will result in a projected savings of $150,000 per year per unit

Automated absolute activation analysis with californium-252 sources

International Nuclear Information System (INIS)

MacMurdo, K.W.; Bowman, W.W.

1978-09-01

A 100-mg 252 Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from 17 O. Detection sensitivities of 239 Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level

Survey of potential markets for devices using Californium-252

International Nuclear Information System (INIS)

Permar, P.H.

1975-01-01

Potential applications for devices or systems containing 252 Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252 Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252 Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252 Cf, which have been two to four times greater in Europe than in the US

Experimental studies on californium bioavailability to marine benthic invertebrates

International Nuclear Information System (INIS)

Fowler, S.W.; Carvalho, F.P.; Aston, S.R.

1986-01-01

252 Cf is readily taken up by benthic invertebrates from sea water, reaching whole-body concentration factors of 763 in the polychaete Hermione hystrix, 220 in the shrimp Lysmata seticaudata, 665 in the crab Pilumnus hirtellus and 78 in the bivalve mollusc Venerupis decussata after 3 weeks exposure. Surface sorption plays a predominant role in the uptake process. Depuration in clean sea water was a relatively slow process. The shrimp Lysmata eliminated 252 Cf very rapidly due to moulting. Absorption coefficients for ingested 252 Cf were high, approx. 23% in crabs and approx. 97% in brittlestars. The absorbed fraction was excreted twice as fast from crabs as brittlestars. Exposure of organisms to labelled sediment resulted in low transfer factors that were species dependent. There is some evidence to suggest that uptake from sediments is primarily due to 252 Cf transfer from the pore water. Comparison of these results with published experimental data on other transuranic nuclides in the same or similar species suggests that californium bioavailability is roughly equivalent to that of plutonium and americium. (author)

Properties of neutron sources

International Nuclear Information System (INIS)

1987-03-01

The Conference presentations were divided into sessions devoted to the following topics: white neutron sources, primarily pulsed (6 papers); fast neutron fields (5 papers); Californium-252 prompt fission neutron spectra (14 papers); monoenergetic sources and filtered beams (11 papers); 14 MeV neutron sources (10 papers); selected special application (one paper); and a general interest session (4 papers). Individual abstracts were prepared separately for the papers

Californium Cf-252 for pelvic radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Maruyama, Y; Feola, J M; Tai, D; Wilson, L C; Van Nagell, J R; Yoneda, J

1978-01-01

Clinical data about therapy concerning tumors of the female gynecological cancers of the cervix, vagina and uterus are reviewed. Dosimetric, laboratory and radiobiological research data form the basis for an approach to such tumors using Cf-252 as a form of boost brachytherapy. Extreme personnel hazards are a real and important consideration and indicate that maximal containment and isolation procedures should be exercised in its use.

Source storage and transfer cask: Users Guide

International Nuclear Information System (INIS)

Eccleston, G.W.; Speir, L.G.; Garcia, D.C.

1985-04-01

The storage and shield cask for the dual californium source is designed to shield and transport up to 3.7 mg (2 Ci) of 252 Cf. the cask meets Department of Transportation (DOT) license requirements for Type A materials (DOT-7A). The cask is designed to transfer sources to and from the Flourinel and Fuel Storage (FAST) facility delayed-neutron interrogator. Californium sources placed in the cask must be encapsulated in the SR-CF-100 package and attached to Teleflex cables. The cask contains two source locations. Each location contains a gear box that allows a Teleflex cable to be remotely moved by a hand crank into and out of the cask. This transfer procedure permits sources to be easily removed and inserted into the delayed-neutron interrogator and reduces personnel radiation exposure during transfer. The radiation dose rate with the maximum allowable quantity of californium (3.7 mg) in the cask is 30 mR/h at the surface and less than 2 mR/h 1 m from the cask surface. This manual contains information about the cask, californium sources, describes the method to ship the cask, and how to insert and remove sources from the cask. 28 figs

Magnetism in californium

International Nuclear Information System (INIS)

Moore, J.R.

1988-03-01

A SQUID-based magnetic susceptometer has been constructed for studying small radioactive samples at temperatures below 350 K and in magnetic fields up to 50 kilogauss. The device has been used to study californium (element 98) in a number of solid-state forms: the dhcp metal, several oxides (Cf 2 O 3 in both the bcc and monoclinic structures, Cf 7 O 12 , CfO 2 and BaCfO 3 ), several monopnictides (CfN, CfAs and CfSb) and the trichloride (in both the hexagonal and orthorhombic structures). All of these materials were studied in polycrystalline form, and hexagonal CfCl 3 was studied in single-crystal form as well. The susceptometer has the sensitivity to measure samples containing less than 10 micrograms of californium. The magnetic susceptibilities of all of the californium materials at temperatures above about 100 K are described well by the Curie-Weiss relationship. This behavior is consistent with the assumption that the magnetic 5f electrons are localized and that the paramagnetic behavior can be interpreted in terms of the properties of the free ion. The measured values of the effective paramagnetic moment, μ/sub eff/, for all the californium materials that were studied are reasonably consistent with theoretical values based on intermediate coupling models. All of the californium materials showed some indications of cooperative magnetic effects. The dhcp metal was observed to order ferromagnetically at 52 K, and all of the californium compounds studied showed signs of antiferromagnetic ordering, mostly at temperatures below 25 K. 91 refs., 50 figs., 19 tabs

Application of fission track detectors to californium-252 neutron dosimetry in tissue near the radiation source

International Nuclear Information System (INIS)

Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.

1981-01-01

Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads mg -1 h -1 +- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads mg -1 h -1 . These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less

Application of fission track detectors to californium-252 neutron dosimetry in tissue near the radiation source

International Nuclear Information System (INIS)

Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.

1981-01-01

Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads micrograms-1 h-1 +/- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads micrograms-1 h-1. These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less

Spectrum-averaged cross-section measurement of /sup 103/Rh(n,n)/sup 103m/Rh in the /sup 252/Cf fission neutron spectrum

International Nuclear Information System (INIS)

Lamaze, G.P.; Schima, F.J.; Eisenhauer, C.M.; Spiegel, V.

1988-01-01

Because of the similarity in energy dependence of the /sup 103/Rh(n,n') differential cross section to the kerma muscle response function for neutrons, rhodium may be useful as a neutron kerma monitor. In support of its use as a neutron monitor, the spectrum-averaged cross section σ-bar has been measured for a /sup 252/Cf fission neutron spectrum. Pairs of thin rhodium samples were irradiated on opposite sides of a thinly encapsulated /sup 252/Cf neutron source. The neutron emission rate of the /sup 252/Cf source was determined by the manganous sulfate (MnSO/sub 4/) bath technique. In this method, the californium source emission rate is determined by comparison to the known emission rate of NBS-I, a standard radium-beryllium neutron source. The neutron fluence incident on the rhodium samples is determined from the californium source strength, average sample-to-source distance, and the duration of the irradiation. Corrections are made for neutron scattering saturation of activity, and attenuation of the X rays by the sample during counting. The X rays were detected with an intrinsic germanium detector designed specifically for low-energy X-ray detection. The activity was not determined by absolute counting so that the final results depend on the value of P/sub Κx/, to total Κ X-ray emission probability. The results of five separate irradiations yield a value of σ-bar . P/sub Κx/ = 62.3 +- 1.9 mb. Using the most recently published value of P/sub Κx/ gives a value of σ-bar = 739 +- 22 mb. A discussion of systematic uncertainties is given

Instrumental neutron activation determination of gold in mineral raw materials using a californium neutron source

International Nuclear Information System (INIS)

Shilo, N.A.; Ippolitov, E.G.; Ivanenko, V.V.; Kustov, B.N.; Zheleznov, V.V.; Aristov, G.N.; Kovalenko, V.V.; Kondrat'ev, N.B.

1983-01-01

A facility using a californium neutron source and a method for the neutron activation analysis of gold were developed. The sensitivity of the determination is 0.1 g/t. The causes of random and systematic errors have been studied. It is concluded that in prospection and evaluation of gold ore deposists, the traditional test tube analysis for gold may be replaced with the developed method. (author)

Californium production at the transuranium processing plant

International Nuclear Information System (INIS)

King, L.J.

1976-01-01

The Transuranium Processing Plant (TRU) at ORNL, which is the production, storage, and distribution center for the ERDA heavy element research program, is described. About 0.5 percent of 252 Cf is currently being produced. TRU is a hot-cell, chemical processing facility of advanced design. New concepts have been incorporated into the facility for absolute containment, remote operation, remote equipment installation, and remote maintenance. The facilities include a battery of nine heavily shielded process cells served by master-slave manipulators and eight laboratories, four on each of two floors. Processing includes chemical dissolution of the targets followed by a series of solvent extraction, ion exchange, and precipitation steps to separate and purify the transuranium elements. The transcurium elements Bk, Cf, Es, and Fm are distributed to users. Remote techniques are used to fabricate the Am and Cm into target rods for reirradiation in the HFIR. Californium-252 that is in excess of the needs of the heavy element research program and the Cf sales program is stored at TRU and processed repeatedly to recover the daughter product 248 Cm, which is a highly desirable research material

Health physics aspects of 252Cf

International Nuclear Information System (INIS)

Bhagwat, A.M.

1974-01-01

After briefly describing the methods of production, radioactive, chemical and biological properties of californium-252, its health physics aspects are reviewed in detail. Its external and internal radiation hazards can be minimised through control of radiation and contamination and proper shield design. Use of various shielding materials is evaluated. The following aspects are also discussed : (1) radiation detectors for neutrons and gamma radiation (2) personnel monitoring techniques (3) bioassay and (4) storage and transportation. (M.G.B.)

Calculation of neutron and gamma-ray energy spectra in liquid air and liquid nitrogen due to 14-MeV neutron and californium-252 sources

International Nuclear Information System (INIS)

Straker, E.A.; Gritzner, M.L.; Harris, L. Jr.

1978-01-01

Calculations of neutron and gamma-ray fluences from 14-MeV neutron and 252 Cf sources in liquid air and liquid nitrogen have been performed. These calculations were made specifically for comparison with experimental data measured at Stohl, Federal Republic of Germany. The discrete-ordinates method was utilized with neutron and gamma-ray cross sections from ENDF/B-IV. One-dimensional calculational models were developed for the sources and tank. Limited comparisons are made with experimental data

Californium-252: isotope for modern radiotherapy of cervix, uterine and vaginal carcinomas

International Nuclear Information System (INIS)

Maruyama, J.; Beach, J.L.; Nagell, J.R. van

1984-01-01

Cf-252 is an isotope that can easily be afterloaded into available gynecological applicators and used for bulky cervix, uterus or vaginal cancer therapy. It is economical, time and cost effective in use, and can be applied to the therapy of many patients throughout the world. It is more effective for neutron therapy than machine fast neutron therapy and is the only form of neutron therapy producing consistent complication-free 5-year cure of advanced cancers currently available. Cf-252 is an isotope for modern gynecological tumor therapy for the future. Isodose curves for Cf-252 implants revealed dose distributions conforming well to tumor. (orig.) [de

System control for the modulated 252Cf source ''Shuffler''

International Nuclear Information System (INIS)

Stephens, M.M.

1975-06-01

The design and theory of operation of the control chassis for a 252 Cf nondestructive assay system are described. This system repetitively transfers a 252 Cf source from the irradiation region to a shielded position before measuring the delayed neutrons. The design criteria for the system were: rapid movement and precise positioning of the 252 Cf source, precise positioning of the sample, and very accurate timing of the irradiate and count cycles. To achieve these results crystal oscillators were used for timing, and stepping motors were used to position the sample and the source. (U.S.)

In situ x-ray fluorescence and californium-252 neutron activation analysis for marine and terrestrial mineral exploration

International Nuclear Information System (INIS)

Wogman, N.A.

1976-12-01

Instrumentation has been designed for in situ analysis of marine and terrestrial minerals using the techniques of x-ray fluorescence and neutron activation analysis. The energy-dispersive x-ray fluorescence analyzer allows more than 20 elements to be quantitatively measured at the 10 ppM level in water depths to 300 m. The analyzer consists of a solid cryogen-cooled Si(Li) detector, a 50 mCi 109 Cd or 57 Co excitation source, and an analyzer-computer system for data storage and manipulation. The neutron activation analysis, which is designed to measure up to 30 elements at parts per hundred to ppM levels, utilizes the man-made element 252 Cf as its neutron activation source. The resulting radioelements which emit characteristic gamma radiation are then analyzed in situ during 2- to 200-s counting intervals with Ge(Li) or NaI(T1) detector systems. An extension of this latter technique, which uses a 252 Cf- 235 U fueled subcritical multiplier, is also being studied. The subcritical facility allows the neutrons from the 252 Cf source to be multiplied, thus providing greater neutron flux. Details of these in situ analysis systems, actual in situ spectra, and recorded data are discussed with respect to the detection of minerals at their varying concentration levels. The system response of each illustrates its usefulness for various rapid environmental mineral exploration studies. These techniques can be utilized on terrestrial surfaces and marine or fresh water sediments. 5 figures, 2 tables

Fabrication of intense neutron sources for medical applications

International Nuclear Information System (INIS)

Boulogne, A.R.; Walker, V.W.

1975-01-01

Simulated sources containing 252 Cf equivalents of 0.1 to 1.0 milligrams were prepared. Samarium was used as the simulant in a modified chemical plating technique similar to that used to prepare palladium-californium oxide cermet for industrial applications. The length of the platinum-10 percent iridium doubly encapsulated source with its protective sheath is 0.545 in. (14.1 mm). Outside dia of the source, including its sheath, is 0.109 in. (2.8 mm). Existing ''Brachytrons'' can accommodate this source form. This capsule system will withstand internal gas pressures from helium due to alpha decay and fission gases from a 1 mg 252 Cf source after ten years if the source is subjected to a maximum temperature of 800 0 C, the theoretical temperature of an accidental fire. Under these conditions the safety factor is 3. The capsule system is being tested with tracer amounts of 252 Cf to ensure that it will withstand adverse service conditions as well as tests specified for Special Form Materials. (auth)

Test and evaluation results of the 252Cf shuffler at the Savannah River Plant

International Nuclear Information System (INIS)

Crane, T.W.

1981-03-01

The 252 Cf Shuffler, a nondestructive assay instrument employing californium neutron source irradiation and delayed-neutron counting, was developed for measuring 235 U content of scrap and waste items generated at the Savannah River Plant (SRP) reactor fuel fabrication facility. The scrap and waste items include high-purity uranium-aluminum alloy ingots as well as pieces of castings, saw and lathe chips from machining operations, low-purity items such as oxides of uranium or uranium intermixed with flux materials found in recovery operations, and materials not recoverable at SRP such as floor sweepings or residues from the uranium scrap recovery operation. The uranium contains about 60% 235 U with the remaining isotopes being 236 U, 238 U, and 234 U in descending order. The test and evaluation at SRP concluded that the accuracy, safety, reliability, and ease of use made the 252 Cf Shuffler a suitable instrument for routine use in an industrial, production-oriented plant

Trends in radioisotope development and utilization in the United States

Energy Technology Data Exchange (ETDEWEB)

Mott, W E [Energy Research and Development Administration, Washington, D.C. (USA)

1976-06-01

The current trends in radioisotope and radiation technology in the United States are overviewed with emphasis on the developments since the 1973 Conference. The comments focus primarily on the research and development activities receiving the most attention today from the various agencies of the Government. Among the many available radionuclides, technetium-99m has played the single most important role for making possible the developments in the field of nuclear medicine. Many other short lived medium-lived nuclides are applied in the fields of nuclear medicine, cardiac pacemaker, artificial heart, and blood irradiator. Radiation processing is now firmly established in the United States. The trends in sewage treatment, polymer-impregnated materials, bioengineering, and food irradiation are reviewed. The programs for californium-252, strontium-90, cesium-137, plutonium-238, and krypton-85 are also reviewed. The author concludes this paper with the acknowledgement that Japanese researchers have contributed to and have been closely involved in many of the programs discussed. Of particular note is the participation in the clinical phase of the californium-252 radiotherapy program. Several Japanese hospitals have been cooperating with the United States since the very beginning of the californium-252 program in determining the value of the californium-252 neutron therapy. The research being performed is unique, and will contribute greatly to the decisions on the ultimate future of californium-252 for therapeutic purposes.

The development and medical applications of a simple facility for partial body in vivo neutron activation analysis using californium-252 sources

International Nuclear Information System (INIS)

Boddy, K.

1978-11-01

A simple and cheap facility for partial body neutron activation analysis has been designed, based on the use of two 100 μg 252 Cf neutron sources. The results reported show that calcium can be measured in parts of the body such as the tibia with a precision as good as +- 1.6 % for a radiation dose of 2 rem. The uniformity of the thermal neutron flux density is better than +- 3 % over 10 cm. Some applications of this irradiation facility for studies of trace elements, in particular cadmium in liver and aluminium in liver or brain, have also been explored. However, the sensitivity attainable is not yet sufficient for the study of normal levels, but could be of interest in toxicological investigations

Frequency spectrum analysis of 252Cf neutron source based on LabVIEW

International Nuclear Information System (INIS)

Mi Deling; Li Pengcheng

2011-01-01

The frequency spectrum analysis of 252 Cf Neutron source is an extremely important method in nuclear stochastic signal processing. Focused on the special '0' and '1' structure of neutron pulse series, this paper proposes a fast-correlation algorithm to improve the computational rate of the spectrum analysis system. And the multi-core processor technology is employed as well as multi-threaded programming techniques of LabVIEW to construct frequency spectrum analysis system of 252 Cf neutron source based on LabVIEW. It not only obtains the auto-correlation and cross correlation results, but also auto-power spectrum,cross-power spectrum and ratio of spectral density. The results show that: analysis tools based on LabVIEW improve the fast auto-correlation and cross correlation code operating efficiency about by 25% to 35%, also verify the feasibility of using LabVIEW for spectrum analysis. (authors)

Neutron activation analysis detection limits using 252Cf sources

International Nuclear Information System (INIS)

DiPrete, D.P.; Sigg, R.A.

2000-01-01

The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes

Neutron Spectra, Fluence and Dose Rates from Bare and Moderated Cf-252 Sources

Energy Technology Data Exchange (ETDEWEB)

Radev, Radoslav P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2016-04-01

A new, stronger ²⁵²Cf source (serial number SR-CF-3050-OR) was obtained from Oak Ridge National Laboratory (ORNL) in 2014 to supplement the existing ²⁵²Cf sources which had significantly decayed. A new instrument positioning track system was designed and installed by Hopewell Designs, Inc. in 2011. The neutron field from the new, stronger ²⁵²Cf source in the modified calibration environment needed to be characterized as well as the modified neutron fields produced by the new source and seven different neutron moderators. Comprehensive information about our ²⁵²Cf source, its origin, production, and isotopic content and decay characteristics needed to be compiled as well. This technical report is intended to address these issues.

A new type-B cask design for transporting 252Cf

International Nuclear Information System (INIS)

Simmons, C.M.

2000-01-01

A project to design, certify, and build a new US Department of Energy (DOE) Type B container for transporting >5 mg of 252 Cf is more than halfway to completion. This project was necessitated by the fact that the existing Oak Ridge National Laboratory (ORNL) Type B containers were designed and built many years ago and thus do not have the records and supporting data that current regulations require. Once the new cask is available, it will replace the existing Type B containers. The cask design is driven by the unique properties of 252 Cf, which is a very intense spontaneous fission neutron source and necessitates a large amount of neutron shielding. The cask is designed to contain up to 60 mg of 252 Cf in the form of californium oxide or californium oxysulfate, in pellet, wire, or sintered material forms that are sealed inside small special-form capsules. The new cask will be capable of all modes of transport (land, sea, and air). The ORNL team, composed of technical and purchasing personnel and using rigorous selection criteria, chose NAC, International (NAC), as the subcontractor for the project. In January 1997, NAC started work on developing the conceptual design and performing the analyses. The original design concept was for a tungsten alloy gamma shield surrounded by two concentric shells of NS-4-FR neutron shield material. A visit to US Nuclear Regulatory Commission (NRC) regulators in November 1997 to present the conceptual design for their comments resulted in a design modification when the question of potential straight-line cracking in the NS-4-FR neutron shield material arose. NAC's modified design includes offset, wedgelike segments of the neutron shield material. The new geometry eliminates concerns about straight-line cracking but increases the weight of the packaging and makes the fabrication more complex. NAC has now completed the cask design and performed the analyses (shielding, structural, thermal, etc.) necessary to certify the cask. The cask

Reactor production of 252Cf and transcurium isotopes

International Nuclear Information System (INIS)

Alexander, C.W.; Halperin, J.; Walker, R.L.; Bigelow, J.E.

1990-01-01

Berkelium, californium, einsteinium, and fermium are currently produced in the High Flux Isotope Reactor (HFIR) and recovered in the Radiochemical Engineering Development Center (REDC) at the Oak Ridge National Laboratory (ORNL). All the isotopes are used for research. In addition, 252 Cf, 253 Es, and 255 Fm have been considered or are used for industrial or medical applications. ORNL is the sole producer of these transcurium isotopes in the western world. A wide range of actinide samples were irradiated in special test assemblies at the Fast Flux Test Facility (FFTF) at Hanford, Washington. The purpose of the experiments was to evaluate the usefulness of the two-group flux model for transmutations in the special assemblies with an eventual goal of determining the feasibility of producing macro amounts of transcurium isotopes in the FFTF. Preliminary results from the production of 254g Es from 252 Cf will be discussed. 14 refs., 5 tabs

Characteristics of polyethylene-moderated 252Cf neutron sources

International Nuclear Information System (INIS)

Alejnikov, V.E.; Beskrovnaya, L.G.; Florko, B.V.

2000-01-01

Polyethylene-moderated 252 Cf neutron sources were designed to produce neutron reference fields' spectra that simulate the spectra observed in the workplaces within nuclear reactors and accelerators. The paper describes the neutron sources and fields. Neutron spectra were calculated by Monte Carlo method and compared with experimental data

Separation of 248Cm (III) from 252Cf (III) and its use in time resolved fluorescence spectroscopic (TRFS) studies

International Nuclear Information System (INIS)

Murali, M.S.; Nair, A.G.C.; Gujar, R.B.; Jain, A.; Tomar, B.S.; Godbole, S.V.; Reddy, A.V.R.; Manchanda, V.K.

2008-07-01

The present report gives a description of the methodology for the separation of 248 Cm(III) from decayed 252 Cf (III) waste solution. The waste solution was first assayed for 252 Cf content by neutron counting using a neutron well coincidence counter. The sample was subjected to the chemical separation of 248 Cm (III) from 252 Cf (III) following anion and cation exchange chromatography. The alpha spectrum of the separated curium fraction showed peaks due to 246 Cm and 248 Cm while the corresponding alpha spectrum of californium fraction showed 249,250,251,252 Cf. The gamma ray abundances of 249 Cf were determined with respect to its gamma rays of 387 keV and the data agreed well with that in literature. Separated Cm(III) was further characterized by recording its time resolved fluorescence spectrum (TRFS) in aqueous medium. (author)

Testing of ENDF/B cross section data in the Californium-252 neutron benchmark field

International Nuclear Information System (INIS)

Mannhart, W.

1979-01-01

The fission neutron field of 252 Cf presently represents one of the most well-known neutron benchmark fields. For 13 neutron reactions which are of importance in reactor metrology, measurements of spectrum-averaged cross sections, [sigma], performed in this neutron field were compared with calculated average cross sections. This comparison allows one to draw conclusions as to the quality of different sigma(E) data taken from ENDF/B-IV, from ENDF/B-V, and from recent experiments and used in the calculation of average cross sections. The comparison includes an uncertainty analysis regarding the different uncertainty contributions of [sigma], of sigma(E), and of the spectral distribution of 252 Cf fission neutrons. Additionally, in a few examples, sensitivity studies were carried out. The sensitivity of the spectrum-averaged cross sections to individual characteristics of the sigma(E) data, such as normalization factors or shifts in the energy scale, was investigated. Similarly, the sensitivity of [sigma] to the spectral distribution of 252 Cf was determined. 4 figures, 2 tables

Provenance and composition study on Terengganu inscribed stone using in-situ nuclear technology

International Nuclear Information System (INIS)

Jaafar Abdullah; Roslan Yahya; Hearie Hassan; Engku Mohd Fahmi Engku Chik; Mohamad Rabaie Shari; Airwan Affendi Mahmood; Abdul Quddoss Abu Bakar; Ainul Mardhiah Terry

2012-01-01

This paper focused on the analysis of trace elements and provenance study of the Inscribed Stone of Terengganu (BBPT) using Neutron-induced Prompt Gamma-Ray Techniques (NIPGAT). In this study, portable NIPGAT system was designed and developed by using volume-based measurement. It is a nondestructive testing technique for the samples. This system uses low activity of isotopic neutron radioactive source from californium-252 (Cf-252) as an irradiation source. Gamma ray spectroscopy as well as specialized computer software has been utilized to conduct the research. The study has determined that the stone was a dolerite stone based on the composition of the stone elements. Although most of the scientific data for this study have been collected, this project is still running to complete the scope of provenance study. (author)

General purpose nuclear irradiation chamber

International Nuclear Information System (INIS)

Nurul Fadzlin Hasbullah; Nuurul Iffah Che Omar; Nahrul Khair Alang Md Rashid; Jaafar Abdullah

2013-01-01

Nuclear technology has found a great need for use in medicine, industry, and research. Smoke detectors in our homes, medical treatments and new varieties of plants by irradiating its seeds are just a few examples of the benefits of nuclear technology. Portable neutron source such as Californium-252, available at Industrial Technology Division (BTI/ PAT), Malaysian Nuclear Agency, has a 2.645 year half-life. However, 252 Cf is known to emit gamma radiation from the source. Thus, this chamber aims to provide a proper gamma shielding for samples to distinguish the use of mixed neutron with gamma-rays or pure neutron radiation. The chamber is compatible to be used with other portable neutron sources such as 241 Am-Be as well as the reactor TRIGA PUSPATI for higher neutron dose. This chamber was designed through a collaborative effort of Kulliyyah Engineering, IIUM with the Industrial Technology Division (BTI) team, Malaysian Nuclear Agency. (Author)

Neutron spectra from radionuclide sources for cardiac pacemakers

International Nuclear Information System (INIS)

Kluge, H.

1975-01-01

Neutron spectra from Plutonium 238 radioisotope batteries powering cardiac pacemakers are measured in the energy range above 0.7 MeV. The results are used to calculate radiation doses within a cylindrical phantom. There are only minor differences between the different types of plutonium 238-batteries and californium 252-batteries

Neutron shielding for a 252 Cf source

International Nuclear Information System (INIS)

Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Eduardo Gallego, Alfredo Lorente

2006-01-01

To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a 252 Cf isotopic neutron source. During calculations a detailed model for the 252 Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare 252 Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

Effective source size as related to 252Cf neutron radiography

International Nuclear Information System (INIS)

Wada, Nobuo; Enomoto, Shigemasa; Tachikawa, Noboru; Nojiri, Toshiaki.

1977-01-01

The effective source size in 252 Cf thermal neutron radiography, relating to its geometrical unsharpness in image formation, is experimentally studied. A neutron radiographic system consists of a 160 μg 252 Cf neutron source, water moderator and divergent cadmium lined collimator. Thermal neutron image detection is performed with using a LiF scintillator and a high speed X-ray film to employ direct exposure method. The modulation transfer function, used for describing image quality, is derived from radiographic image corresponding to a cadmium plate with sharp edge. The modulation transfer function for the system is expressed by the product of the function for both geometrical and inherent unsharpness, and allows isolation of geometrical unsharpness as related to the effective size of the thermal neutron source. It is found to be 80 -- 90% of the collimator inlet diameter. (auth.)

Implementation of 252Cf-source-driven power spectrum density measurement system

International Nuclear Information System (INIS)

Ren Yong; Wei Biao; Feng Peng; Li Jiansheng; Ye Cenming

2012-01-01

The principle of 252 Cf-source-driven power spectrum density measurement method is introduced. A measurement system and platform is realized accordingly, which is a combination of hardware and software, for measuring nuclear parameters. The detection method of neutron pulses based on an ultra-high-speed data acquisition card (three channels, 1 GHz sampling rate, 1 ns synchronization) is described, and the data processing process and the power spectrum density algorithm on PC are designed. This 252 Cf-source-driven power spectrum density measurement system can effectively obtain the nuclear tag parameters of nuclear random processes, such as correlation function and power spectrum density. (authors)

Neutron shielding for a {sup 252} Cf source

Energy Technology Data Exchange (ETDEWEB)

Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M. [Unidades Academicas de Estudios Nucleares e Ingenieria Electrica, Universidad Autonoma de Zacatecas, C. Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Eduardo Gallego, Alfredo Lorente [Depto. de Ingenieria Nuclear, ETS Ingenieros Industriales, Universidad Politecnica de Madrid, C. Jose Gutierrez Abascal 2, 28006 Madrid (Spain)]. e-mail: fermineutron@yahoo.com

2006-07-01

To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a {sup 252}Cf isotopic neutron source. During calculations a detailed model for the {sup 252}Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare {sup 252}Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

Uranium standards for Californium Shuffler

International Nuclear Information System (INIS)

Gibbs, A.; Boynton, S.P.

1978-10-01

The Laboratories Department analyzed pieces of a U-Al log which were to be canned and used as a set of standards for the nondestructive Californium Shuffler instrument. Evaluation of this instrument is part of an on-going Safeguards Program and is a joint project between LASL and SRP. A U-Al casting of a nominal 30% to 70% composition was made with enriched uranium (56 wt % 235 U). The log was 6 in. in diameter and approximately 2 ft long. A 1/4-in. slice was made before and after each 1-in. slice taken for use as a standard. The 1-in. slices were scanned nondestructively by collimated gamma pulse height analysis. The 1/4-in. slices were divided into quadrants and one quadrant for each slice was destructively analyzed. Results from these tests showed an approximate 1.5% relative variation in uranium concentration from the high to the low point. Successive pieces showed less than 1% relative difference. The 1-in. pieces have been canned and shipped to LASL for testing and will be returned with the Californium Shuffler. The remaining 1/4-in. slices have been sent to NBL and LASL for destructive analysis

Efficacy of brachytherapy with californium-252 neutrons versus cesium-137 photons for eradication of bulky localized cervical cancer: single-institution study

International Nuclear Information System (INIS)

Maruyama, Y.; van Nagell, J.R.; Yoneda, J.; Donaldson, E.; Gallion, H.; Higgins, R.; Powell, D.; Turner, C.; Kryscio, R.

1988-01-01

A fast-neutron-emitting radioisotope, 252 Cf, is being tested in clinical trials of neutron brachytherapy for cervical cancer. The efficacy for histological eradication of bulky stage IB cervical tumors (mean diameter, approximately 6 cm) using combined radiation and surgery was studied in 65 patients treated with 137 Cs or 252 Cf before surgery during 1983-1986. Forty-four patients were treated with 137 Cs and 21 were treated with 252 Cf at equivalent doses of radiation. Fifteen of the 44 specimens (34%) were positive after 137Cs therapy. Only one of the 21 specimens was positive after 252 Cf therapy (P = .025), and that patient was treated in a delayed schedule 21 days after the start of external-beam irradiation rather than early in the course. 252 Cf therapy required a much lower radiation dose and shorter treatment time. The study compared tumor destruction of an identically staged human cervical tumor in situ by direct histological means, using 252 Cf neutron therapy or conventional photon therapy at an identical and equivalent dose adjusted by a relative biological effectiveness of 6.0 for 252 Cf

Radiation protection data sheet. Radiation protection data sheets for the use of radionuclides in unsealed sources

International Nuclear Information System (INIS)

Anon.

1999-01-01

These radiation protection data sheet are devoted to responsible persons and employees of various laboratories or medical, pharmaceutical, university and industrial departments where radionuclides are handled as well as all the persons who attend to satisfy in this field. They contain the essential radiation protection data for the use of unsealed sources: physical characteristics, risk assessment, administrative procedures, recommendations, regulations and bibliography. This new series includes the following radionuclides: californium 252, curium 244, gallium 67, indium 113m, plutonium 238, plutonium 239, polonium 210, potassium 42, radium 226, thorium 232, uranium 238 and zinc 65. (O.M.)

Freeze drying method for preparing radiation source material

International Nuclear Information System (INIS)

Mosley, W.C.; Smith, P.K.

1976-01-01

Fabrication of a neutron source is specifically claimed. A palladium/californium solution is freeze dried to form a powder which, through conventional powder metallurgy, is shaped into a source containing the californium evenly distributed through a palladium metal matrix. (E.C.B.)

Determining {sup 252}Cf source strength by absolute passive neutron correlation counting

Energy Technology Data Exchange (ETDEWEB)

Croft, S. [Oak Ridge National Laboratory, Oak Ridge, TN 37831-6166 (United States); Henzlova, D., E-mail: henzlova@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

2013-06-21

Physically small, lightly encapsulated, radionuclide sources containing {sup 252}Cf are widely used for a vast variety of industrial, medical, educational and research applications requiring a convenient source of neutrons. For many quantitative applications, such as detector efficiency calibrations, the absolute strength of the neutron emission is needed. In this work we show how, by using a neutron multiplicity counter the neutron emission rate can be obtained with high accuracy. This provides an independent and alternative way to create reference sources in-house for laboratories such as ours engaged in international safeguards metrology. The method makes use of the unique and well known properties of the {sup 252}Cf spontaneous fission system and applies advanced neutron correlation counting methods. We lay out the foundation of the method and demonstrate it experimentally. We show that accuracy comparable to the best methods currently used by national bodies to certify neutron source strengths is possible.

Local Structure in Americium and Californium Hexa-cyanoferrates - Comparison with Their Lanthanide Analogues

International Nuclear Information System (INIS)

Dupouy, G.; Bonhoure, I.; Dumas, Th.; Moisy, Ph.; Petit, S.; Den Auwer, Ch.; Conradson, St.D.; Hennig, Ch.; Scheinost, A.C.; Le Naour, C.; Simoni, E.

2011-01-01

Metal hexa-cyanoferrates are well known molecular solids for a large variety of cations, although very little has been described for actinide adducts. Two new members of actinide(III) hexa-cyanoferrates were synthesized with the cations americium and californium. They were structurally characterized by infrared and X-ray absorption spectroscopy. Combined EXAFS data at the iron K edge and actinide L 3 edge provide evidence for a three-dimensional model for these two new compounds. Structural data in terms of bond lengths were compared to those reported for the parent lanthanide(III) compounds, neodymium and gadolinium hexa-cyanoferrates, respectively: the americium compound with (KNd(III)Fe(II)-Fe-III(CN) 6 .4H 2 O and the californium compound with (KGd(III)Fe(II)(CN) . 3.5H 2 O and (KGd(III)Fe(II)(CN) 6 .3H 2 O. This comparison between actinide and lanthanide homologues has been carried out on the basis of ionic radii considerations. The americium and neodymium environments appear to be very similar and are arranged in a tri-capped trigonal prism polyhedron of coordination number 9 (CN: 9), in which the americium atom is bonded to six nitrogen atoms and to three water molecules. For the californium adduct, a similar comparison and bond length and angle values derived from EXAFS studies suggest that the californium cation sits in a bi-capped trigonal prism (CN: 8) as in (KGd(III)Fe(II)(CN) 6 . 3H 2 O. This arrangement differs from that in the structure of (KGd(III)Fe(II)(CN) 6 .3.5H 2 O, in which the gadolinium atom is surrounded by 9 atoms. This is one of the rare pieces of information revealed by EXAFS spectroscopy for americium and californium in comparison to lanthanide atoms in molecular solid compounds. A discussion on the decrease in bond length and coordination number from americium to californium is also provided, on the basis of crystallographic results reported in the literature for actinide(III) and lanthanide(III) hydrate series. (authors)

Monte Carlo simulation using MCNP4B for an optimal shielding design of a 252 Cf source

International Nuclear Information System (INIS)

Silva, Ademir X. da; Crispim, Verginia R.

2001-01-01

This study aim to investigate an optimum shielding design against neutrons and gamma-rays from a source of 252 Cf, using Monte Carlo simulation. The shielding materials studied were: borated polyethylene, borated-lead polyethylene and stainless steel. The Monte Carlo code MCNP, version 4B, was used to design shielding for 252 Cf based neutron irradiator systems. By normalizing the dose equivalent rate values presented to the neutron production rate of the source, the resulting calculations are independents of the intensity of actual 252 Cf source. The results shown what the total dose equivalent rates were reduced significantly by the shielding system optimization. (author)

Simulation and design of an electron beam ion source charge breeder for the californium rare isotope breeder upgrade

Directory of Open Access Journals (Sweden)

Clayton Dickerson

2013-02-01

Full Text Available An electron beam ion source (EBIS will be constructed and used to charge breed ions from the californium rare isotope breeder upgrade (CARIBU for postacceleration into the Argonne tandem linear accelerator system (ATLAS. Simulations of the EBIS charge breeder performance and the related ion transport systems are reported. Propagation of the electron beam through the EBIS was verified, and the anticipated incident power density within the electron collector was identified. The full normalized acceptance of the charge breeder with a 2 A electron beam, 0.024π  mm mrad for nominal operating parameters, was determined by simulating ion injection into the EBIS. The optics of the ion transport lines were carefully optimized to achieve well-matched ion injection, to minimize emittance growth of the injected and extracted ion beams, and to enable adequate testing of the charge bred ions prior to installation in ATLAS.

4π-spectrometer technique for measurements of secondary neutron average number in nuclear fission by 252Cf neutrons

International Nuclear Information System (INIS)

Vasil'ev, Yu.A.; Barashkov, Yu.A.; Golovanov, O.A.; Sidorov, L.V.

1977-01-01

A method for determining the average number of secondary neutrons anti ν produced in nuclear fission by the neutrons of the 252 Cf fission spectra by means of a 4π time-of-flight spectrometer is described. Layers of 252 Cf and an isotope studied are placed close to each other; if the isotope layer density is 1 mg/cm 2 probability of its fission is about 10 -5 per one spontaneous fission of californium. Fission fragments of 252 Cf and the isotope investigated have been detected by two surface-barrier counters with an efficiency close to 100%. The layers and the counters are situated in a measuring chamber placed in the center of the 4π time-of-flight spectrometer. The latter is utilized as a neutron counter because of its fast response. The method has been verified by carrying out measurements for 235 U and 239 Pu. A comparison of the experimental and calculated results shows that the method suggested can apply to determine the number of secondary neutrons in fission of isotopes that have not been investigated yet

Neutron beam experiments using nuclear research reactors: honoring the retirement of professor Bernard W. Wehring -II. 5. Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields

International Nuclear Information System (INIS)

Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik

2001-01-01

In recent years, Georgia Institute of Technology (Georgia Tech) has been involved in a number of neutron dosimetry research projects. Several reference neutron fields are now available for such projects. They are all based on the use of a 252 Cf source. The source can be used by itself to create a reference un-moderated 252 Cf neutron field, or it can be placed inside several different moderating assemblies. The spectra created by placing the source inside these assemblies and the un-moderated source are employed to investigate detector and dosimeter responses. Currently, the set of moderators available includes a 30-cm diam cadmium-covered D 2 O spherical shell, a 30-cm-thick iron spherical shell, a 30-cm-diam polyethylene spherical shell, an 18.3-cm-thick tungsten spherical shell, a 16-cm-thick lead spherical shell, and a 9-cm-thick tantalum spherical shell. In addition, the 252 Cf source can be placed inside a neutron howitzer recently constructed at Georgia Tech. The howitzer is a WEP cylinder loaded with boron that has a 10.16-cm-diam cylindrical opening. When the source is placed in the cylindrical penetration of the howitzer, a neutron field ∼30 cm in diameter is created at a distance of 50 cm from the californium source. Over the last few years, Bonner sphere spectrometers using LiI(Eu) scintillators and LiF thermoluminescence dosimeters have been calibrated using this facility at Georgia Tech. Recently, the Neely Nuclear Research Center (NNRC) acquired an LB 6411 neutron probe (product of EG and G Berthold). This probe is designed to measure ambient dose equivalent in accordance with International Commission on Radiological Protection Publication 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diam spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV (Ref. 5). As a test of the instrument's ability to measure ambient

A new facility for non-destructive assay using a 252Cf source

International Nuclear Information System (INIS)

Stevanato, L.; Caldogno, M.; Dima, R.; Fabris, D.; Hao, Xin; Lunardon, M.; Moretto, S.; Nebbia, G.; Pesente, S.; Pino, F.; Sajo-Bohus, L.; Viesti, G.

2013-01-01

A new laboratory facility for non-destructive analysis (NDA) using a time-tagged 252 Cf source is presented. The system is designed to analyze samples having maximum size of about 20×25 cm 2 , the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. - Highlights: ► Tagged 252 Cf source setup. ► Material recognition and sample imaging with measurements of gamma ray and neutron transmission. ► Material identification via energy dependent neutron and gamma ray transmission measurements. ► Identification of layered material. ► Effects due to the sample thickness on the above identification techniques

INAA using 252Cf neutron source at University of Pune

International Nuclear Information System (INIS)

Rajurkar, N.S.

2006-01-01

The review presents the work done over last two decades on Instrumental Neutron Activation Analysis (INAA) by our research group at University of Pune using 252 Cf spontaneous fission neutron source. The technique has been applied in different fields viz. numismatics, industry, agriculture, ayurveda, environmental and health sciences and diffusion studies. A brief discussion of the work is presented in this article. (author)

Analysis of geological material and especially ores by means of a 252Cf source

International Nuclear Information System (INIS)

Barrandon, J.N.; Borderie, B.; Melky, S.; Halfon, J.; Marce, A.

1976-01-01

Tests were made on the possibilities for analysis by 252 Cf activation in the earth sciences and mining research. The results obtained show that while 252 Cf activation can only resolve certain very specific geochemical research problems, it does allow the exact and rapid determination of numerous elements whose ores are of great economic importance such as fluorine, titanium, vanadium, manganese, copper, antimony, barium, and tungsten. The utilization of activation analysis methods in the earth sciences is not a recent phenomenon. It has generally been limited to the analysis of traces in relatively small volumes by means of irradiation in nuclear reactors. Traditional neutron sources were little used and were not very applicable. The development of 252 Cf isotopic sources emitting more intense neutron fluxes make it possible to consider carrying out more sensitive determinations without making use of a nuclear reactor. In addition, this technique can be adapted for in situ analysis in mines and mine borings. Our work which is centered upon the possibilities of instrumental laboratory analyses of geological materials through 252 Cf activation is oriented in two principal directions: the study of the experimental sensitivities of the various elements in different rocks with the usual compositions; and the study of the possibilities for routine ore analyses

Calculation of dose distribution for 252Cf fission neutron source in tissue equivalent phantoms using Monte Carlo method

International Nuclear Information System (INIS)

Ji Gang; Guo Yong; Luo Yisheng; Zhang Wenzhong

2001-01-01

Objective: To provide useful parameters for neutron radiotherapy, the author presents results of a Monte Carlo simulation study investigating the dosimetric characteristics of linear 252 Cf fission neutron sources. Methods: A 252 Cf fission source and tissue equivalent phantom were modeled. The dose of neutron and gamma radiations were calculated using Monte Carlo Code. Results: The dose of neutron and gamma at several positions for 252 Cf in the phantom made of equivalent materials to water, blood, muscle, skin, bone and lung were calculated. Conclusion: The results by Monte Carlo methods were compared with the data by measurement and references. According to the calculation, the method using water phantom to simulate local tissues such as muscle, blood and skin is reasonable for the calculation and measurements of dose distribution for 252 Cf

Design of a setup for {sup 252}Cf neutron source for storage and analysis purpose

Energy Technology Data Exchange (ETDEWEB)

Hei, Daqian [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Zhuang, Haocheng [Xi’an Middle School of Shanxi Province, Xi’an 710000 (China); Jia, Wenbao, E-mail: jiawenbao@163.com [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China); Cheng, Can; Jiang, Zhou; Wang, Hongtao [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Chen, Da [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China)

2016-11-01

{sup 252}Cf is a reliable isotopic neutron source and widely used in the prompt gamma ray neutron activation analysis (PGNAA) technique. A cylindrical barrel made by polymethyl methacrylate contained with the boric acid solution was designed for storage and application of a 5 μg {sup 252}Cf neutron source. The size of the setup was optimized with Monte Carlo code. The experiments were performed and the results showed the doses were reduced with the setup and less than the allowable limit. The intensity and collimating radius of the neutron beam could also be adjusted through different collimator.

Fast and efficient charge breeding of the Californium rare isotope breeder upgrade electron beam ion source

International Nuclear Information System (INIS)

Ostroumov, P. N.; Barcikowski, A.; Dickerson, C. A.; Perry, A.; Sharamentov, S. I.; Vondrasek, R. C.; Zinkann, G. P.; Pikin, A. I.

2015-01-01

The Electron Beam Ion Source (EBIS), developed to breed Californium Rare Isotope Breeder Upgrade (CARIBU) radioactive beams at Argonne Tandem Linac Accelerator System (ATLAS), is being tested off-line. A unique property of the EBIS is a combination of short breeding times, high repetition rates, and a large acceptance. Overall, we have implemented many innovative features during the design and construction of the CARIBU EBIS as compared to the existing EBIS breeders. The off-line charge breeding tests are being performed using a surface ionization source that produces singly charged cesium ions. The main goal of the off-line commissioning is to demonstrate stable operation of the EBIS at a 10 Hz repetition rate and a breeding efficiency into single charge state higher than 15%. These goals have been successfully achieved and exceeded. We have measured (20% ± 0.7%) breeding efficiency into the single charge state of 28+ cesium ions with the breeding time of 28 ms. In general, the current CARIBU EBIS operational parameters can provide charge breeding of any ions in the full mass range of periodic table with high efficiency, short breeding times, and sufficiently low charge-to-mass ratio, 1/6.3 for the heaviest masses, for further acceleration in ATLAS. In this paper, we discuss the parameters of the EBIS and the charge breeding results in a pulsed injection mode with repetition rates up to 10 Hz

Validation of the MCNP-DSP Monte Carlo code for calculating source-driven noise parameters of subcritical systems

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.

1995-01-01

This paper describes calculations performed to validate the modified version of the MCNP code, the MCNP-DSP, used for: the neutron and photon spectra of the spontaneous fission of californium 252; the representation of the detection processes for scattering detectors; the timing of the detection process; and the calculation of the frequency analysis parameters for the MCNP-DSP code

Neutron dose rate for {sup 252} Cf AT source in medical applications

Energy Technology Data Exchange (ETDEWEB)

Paredes, L.; Balcazar, M. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Azorin, J. [UAM-I, 09340 Mexico D.F. (Mexico); Francois, J.L. [FI-UNAM, 04510 Mexico D.F. (Mexico)

2006-07-01

The AAPM TG-43 modified protocol was used for the calculation of the neutron dose rate of {sup 252}Cf sources for two tissue substitute materials, five normal tissues and six tumours. The {sup 252}Cf AT source model was simulated using the Monte Carlo MCNPX code in spherical geometry for the following factors: a) neutron air kerma strength conversion factor, b) dose rate constant, c) radial dose function, d) geometry factor, e) anisotropy function and f) neutron dose rate. The calculated dose rate in water at 1 cm and 90 degrees from the source long axis, using the Watt fission spectrum, was D{sub n}(r{sub 0}, {theta}{sub 0})= 1.9160 cGy/h-{mu}g. When this value is compared with Rivard et al. calculation using MCNP4B code, 1.8730 cGy/h-{mu}g, a difference of 2.30% is obtained. The results for the reference neutron dose rate in other media show how small variations in the elemental composition between the tissues and malignant tumours, produce variations in the neutron dose rate up to 12.25%. (Author)

Validating criticality calculations for spent fuel with 252Cf-source-driven noise measurements

International Nuclear Information System (INIS)

Mihalczo, J.T.; Krass, A.W.; Valentine, T.E.

1992-01-01

The 252 Cf-Source-driven noise analysis method can be used for measuring the subcritical neutron multiplication factor k of arrays of spent light water reactor (LWR) fuel. This type of measurement provides a parameter that is directly related to the criticality state of arrays of LWR fuel. Measurements of this parameter can verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. The practicality of a measurement depends on the ability to install the hardware required to perform the measurement. Source chambers containing the 252 Cf at the required source intensity for this application have been constructed and have operated successfully for ∼10 years and can be fabricated to fit into control rod guide tubes of PWR fuel elements. Fission counters especially developed for spent-fuel measurements are available that would allow measurements of a special 3 x 3 spent fuel array and a typical burnup credit rail cask with spent fuel in unborated water. Adding a moderator around these fission counters would allow measurements with the typical burnup credit rail cask with borated water and the special 3 x 3 array with borated water. The recent work of Ficaro on modifying the KENO Va code to calculate by the Monte Carlo method the time sequences of pulses at two detectors near a fissile assembly from the fission chain multiplication process, initiated by a 252 Cf source in the assembly allows a direct computer calculation of the noise analysis data from this measurement method

Radioactive materials production

International Nuclear Information System (INIS)

Anon.

1985-01-01

The Radiochemical Processing Plant (RPP) at ORNL has served as the national repository and distribution center for 233 U for > 20 years. Several hundred kilograms of uranium, containing approximately 90 to 98% 233 U, are stored there in the form of metal, oxides, and nitrate solutions. All of these uranium materials contain small, but significant, concentrations of 232 U, ranging from 2 to 225 ppm. Most of the radioactivity associated with the 233 U comes from the decay daughters of 232 U (74-year half-life). The 252 Cf Industrial Sales/Loan Program involves loans of 252 Cf neutron sources to agencies of the US Government and sales of 252 Cf as the bulk oxide and as palladium-californium alloy pellets and wires. The program has been operated since 1968 in temporary facilities at the Savannah River Laboratory (SRL). The obsolete hot-cell facilities at SRL are now being decommissioned, and the program activities are being transferred to ORNL's Californium Facility in Bldg. 7930, which is managed by the staff of the Transuranium Processing Plant

Sources of Radioactive Isotopes for Dirty Bombs

Science.gov (United States)

Lubenau, Joel

2004-05-01

From the security perspective, radioisotopes and radioactive sources are not created equal. Of the many radioisotopes used in industrial applications, medical treatments, and scientific research, only eight, when present in relatively large amounts in radioactive sources, pose high security risks primarily because of their prevalence and physical properties. These isotopes are americium-241, californium-252, cesium-137, cobalt-60, iridium-192, radium-226, plutonium-238, and strontium-90. Except for the naturally occurring radium-226, nuclear reactors produce the other seven in bulk commercial quantities. Half of these isotopes emit alpha radiation and would, thus, primarily pose internal threats to health; the others are mainly high-energy gamma emitters and would present both external and internal health hazards. Therefore, the response to a "dirty bomb" event depends on what type of radioisotope is chosen and how it is employed. While only a handful of major corporations produce the reactor-generated radioisotopes, they market these materials to thousands of smaller companies and users throughout the world. Improving the security of the high-risk radioactive sources will require, among other efforts, cooperation among source suppliers and regulatory agencies.

Monitoring taconite process streams with thermal neutron capture-gamma ray analysis. Report of investigations/1980

International Nuclear Information System (INIS)

Woodbury, F.B.W.

1980-12-01

The Bureau of Mines is evaluating alternative technologies to treat oxidized taconites. Since process control is an essential element in the application of these process technologies, research was performed on a prototype monitoring system utilizing a californium-252 (252-Cf) neutron source and a thermal neutron capture-gamma ray spectra analysis method to measure the amount of iron and percent solids in process slurries. The prototype system was used to monitor the concentrate and tailing streams in a 900-lb/hr flotation pilot plant during continuous around-the-clock tests. The iron content of the process slurries was determined by measuring the total peak areas under the capture spectrum peaks at 7.626-7.632 MeV, the associated escape peaks at 7.136-7.122 and 6.626-6.612 MeV, and the iron doublets at 4.900 and 4.998 MeV. A potential method for determining the percent solids in process slurries using the 2.22 MeV hydrogen capture peak is discussed

Single-event burnout of power MOSFET devices for satellite application

International Nuclear Information System (INIS)

Xue Yuxiong; Tian Kai; Cao Zhou; Yang Shiyu; Liu Gang; Cai Xiaowu; Lu Jiang

2008-01-01

Single-event burnout (SEB) sensitivity was tested for power MOSFET devices, JTMCS081 and JTMCS062, which were made in Institute of Microelectronics, Chinese Academy of Sciences, using californium-252 simulation source. SEB voltage threshold was found for devices under test (DUT). It is helpful for engineers to choose devices used in satellites. (authors)

Regularities in dose field formation for fixation of 252Cf and 60Co sources on the same plane

International Nuclear Information System (INIS)

Ivanov, V.N.; Vtyurin, B.M.; Ivanova, L.F.; Kondzhariya, Yu.R.

1983-01-01

A computerized study was made of a change in the correlation between the sizes of an irradiated volume and the distribution of sources. Criteria have been established for the utilization of 252 Cf and 60 Co sources of different active length and design placed on the same plane. Reference dose rate and its derivatives have been chosen as the main parameters that characterize a dose field. A dosimetric analysis was performed using the data for an adsorbed dose of neutrons in the tissue, taking account of high RBE of 252 Cf fast neutrons that equals 6-7, and a slight change of the local RBE value near the source resulting from a change of the effective spectrum of neutrons in combination with the growth of a contribution of #betta#-radiation into the summary dose with the removal from the source. The irradiated volume was evaluated by introducing 3 linear parameters - length, thickness and width. It has been shown that the ratio of the length of an irradiated volume to the active length of 252 Cf sources with radionuclide regular linear density changes from 0.7 with the isodose value of 85% up to 0.97 with the isodose value of 60%. For 60 Co sources with a higher linear density of the radionuclide on the edges the lower limit of this value equals 1. Intervals of changes in the rest of parameters have also been defined. The results obtained are presented graphically. The results of the study are used for a dosimetric control of the clinical trials of 252 Cf and 60 Co sources in the treatment of patients with tumors of the tongue, oral cavity fundus, lip and other sites

Radionuclide 252Cf neutron source

International Nuclear Information System (INIS)

Kolevatov, Yu.I.; Trykov, L.A.

1979-01-01

Characteristics of radionuclide neutron sourses of 252 Cf base with the activity from 10 6 to 10 9 n/s have been investigated. Energetic distributions of neutrons and gamma-radiation have been presented. The results obtained have been compared with other data available. The hardness parameter of the neutron spectrum for the energy range from 3 to 15 MeV is 1.4 +- 0.02 MeV

Moderator design studies for a new neutron reference source based on the D–T fusion reaction

International Nuclear Information System (INIS)

Mozhayev, Andrey V.; Piper, Roman K.; Rathbone, Bruce A.; McDonald, Joseph C.

2016-01-01

The radioactive isotope Californium-252 ( 252 Cf) is relied upon internationally as a neutron calibration source for ionizing radiation dosimetry because of its high specific activity. The source may be placed within a heavy-water (D 2 O) moderating sphere to produce a softened spectrum representative of neutron fields common to commercial nuclear power plant environments, among others. Due to termination of the U.S. Department of Energy loan/lease program in 2012, the expense of obtaining 252 Cf sources has undergone a significant increase, rendering high output sources largely unattainable. On the other hand, the use of neutron generators in research and industry applications has increased dramatically in recent years. Neutron generators based on deuteriumtritium (D–T) fusion reaction provide high neutron fluence rates and, therefore, could possibly be used as a replacement for 252 Cf. To be viable, the 14 MeV D–T output spectrum must be significantly moderated to approximate common workplace environments. This paper presents the results of an effort to select appropriate moderating materials and design a configuration to reshape the primary neutron field toward a spectrum approaching that from a nuclear power plant workplace. A series of Monte-Carlo (MCNP) simulations of single layer high- and low-Z materials are used to identify initial candidate moderators. Candidates are refined through a similar series of simulations involving combinations of 2–5 different materials. The simulated energy distribution using these candidate moderators are rated in comparison to a target spectrum. Other properties, such as fluence preservation and/or enhancement, prompt gamma production and other characteristics are also considered. - Highlights: • D–T generator neutron calibration field replacement for D 2 O-moderated 252 Cf. • Determination of representative nuclear power plant workplace neutron spectrum. • Simulations to assess moderating materials to soften 14

Activation analysis of stainless steel flux monitors using 252Cf neutron sources

International Nuclear Information System (INIS)

Williams, J.G.; Newton, T.H. Jr.; Cogburn, C.O.

1984-01-01

Activation analysis was performed on stainless steel beads from a chain which is used in reactor pressure vessel surveillance experiments at the Arkansas Power and Light Company reactors. The beads allow monitoring of two fast and three thermal neutron induced reactions: 58 Ni(n,p) 58 Co, 54 Fe(n,p) 54 Mn, 58 Fe(n,γ) 59 Fe, 59 Co(n,γ) 60 Co and 50 Cr(n,γ) 51 Cr. The analysis was performed using 12 beads from various positions along 5 different batches of chain and standard materials in an H 2 O moderator tank using two intense californium sources which had a total neutron emission rate of 3.97 x 10 10 /s. Semiconductor gamma spectrometers were used to count the products of the above reactions in the specimens. The percentage by weight of the iron, chromium and cobalt in the beads were found to be 62.1%, 20.2% and 0.120%, respectively. The excellent uniformity found in the bead compositions demonstrates the reproducibility of the experimental techniques and enhances considerably the value of the beads as neutron flux montitors

Spectroscopic and redox properties of curium and californium ions in concentrated aqueous carbonate-bicarbonate media

International Nuclear Information System (INIS)

Hobart, D.E.; Varlashkin, P.G.; Samhoun, K.; Haire, R.G.; Peterson, J.R.

1983-01-01

Multimilligram quantities of trivalent curium-248 and californium-249 were investigated by absorption spectroscopy, cyclic voltammetry, and bulk solution electrolysis in concentrated aqueous carbonate-bicarbonate solution. Actinide concentrations between 10 -4 and 10 -2 M were studied in 2 M sodium carbonate and 5.5 M potassium carbonate solutions at pH values from 8 to 14. The solution absorption spectra of Cm(III) and Cf(III) in carbonate media are presented for the first time and compared to literature spectra of these species in noncomplexing aqueous solution. It was anticipated that carbonate complexation of the actinide ions could provide a sufficient negative shift in the formal potentials of the M(IV)/M(III) couples of Cm and Cf to permit the generation and stabilization of their tetravalent states in aqueous carbonate-bicarbonate medium. No conclusive evidence was found in the present work to indicate the existence of any higher oxidation states of curium or californium in carbonate solution. Some possible reasons for our inability to generate and detect oxidized species of curium and californium in this medium are discussed

Fresnel zone plate imaging of a 252Cf spontaneous fission source

International Nuclear Information System (INIS)

Stalker, K.T.; Hessel, K.R.

1976-11-01

The feasibility of coded aperture imaging for nuclear fuel motion monitoring is shown using Cf 252 spontaneous fission source. The theory of coded aperture imaging for Fresnel zone plate apertures is presented and design considerations for zone plate construction are discussed. Actual images are obtained which demonstrate a transverse resolution of 1.7 mm and a tomographic resolution of 1.5 millimeters. The capability of obtaining images through 12.7 mm of stainless steel is also shown

Inverse gamma ray dose rate effect in californium-252 RBE experiment with human T-1 cells irradiated in vitro

International Nuclear Information System (INIS)

Todd, P.; Feola, J.M.

1986-01-01

Metabolically deoxygenated suspensions of human T-1 cells were used to determine the RBE in hypoxia of low dose rate (LDR) Cf-252 radiation compared to LDR gamma radiation. Based upon the initial portion of the survival curves the RBE was 5.0 ± 1.0 for all components of the Cf-252 radiation and 7.1 ± 1.7 for the neutrons alone. An inverse dose rate effect was observed for LDR gamma radiation in which greater cell sensitivity was observed at lower dose rates and longer irradiation periods. It was demonstrated that there was little or no sublethal damage repair or cell progression during LDR at 21 deg C, and the observed decrease in cell survival probability with increasing irradiation time at a given dose was attributable to reoxygenation of the cell suspensions during the course of LDR exposures. (Auth.)

Solid-State Neutron Multiplicity Counting System Using Commercial Off-the-Shelf Semiconductor Detectors

Energy Technology Data Exchange (ETDEWEB)

Rozhdestvenskyy, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2017-08-09

This work iterates on the first demonstration of a solid-state neutron multiplicity counting system developed at Lawrence Livermore National Laboratory by using commercial off-the-shelf detectors. The system was demonstrated to determine the mass of a californium-252 neutron source within 20% error requiring only one-hour measurement time with 20 cm² of active detector area.

X-ray-diffraction study of californium metal to 16 GPa

International Nuclear Information System (INIS)

Peterson, J.R.; Benedict, U.; Dufour, C.; Birkel, I.; Haire, R.G.

1983-01-01

The first series of measurements to determine the structural behavior of californium (Cf) metal under pressure has been carried out. The initial dhcp structure transformed sluggishly with increasing pressure to a fcc structure. A bulk modulus of 50(5) GPa was derived for dhcp Cf metal from the relative volume (V/V 0 ) data to 10 GPa

252Cf-source-driven noise analysis measurements for characterization of concrete highly enriched uranium (HEU) storage vaults

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.

1993-01-01

The 252 Cf-source-driven noise analysis method has been used in measurements for subcritical configurations of fissile systems for a variety of applications. Measurements of 25 fissile systems have been performed with a wide variety of materials and configurations. This method has been applied to measurements for (1) initial fuel loading of reactors, (2) quality assurance of reactor fuel elements, (3) fuel preparation facilities, (4) fuel processing facilities, (5) fuel storage facilities, (6) zero-power testing of reactors, and (7) verification of calculational methods for assemblies with the neutron k 252 Cf source and commercially available detectors was feasible and to determine if the measurement could characterize the ability of the concrete to isolate the fissile material

Fast neutron therapy with high intensity Cf-252 sources by remotely controlled afterloading and clinical experiences in the treatment of gynaecological cancers

International Nuclear Information System (INIS)

Yamashita, H.; Hashimoto, S.; Wada, M.; Dokiya, T.

1986-01-01

Cf-252 fast neutron therapy with high intensity Cf-252 sources was tested for the treatment of advanced gynaecological cancers using a remotely controlled afterloading machine designed by the author and manufactured by Toshiba. Using high intensity sources and short treatment times in a special treatment room, personnel or environment exposure to radiation was at a safe level, i.e. almost nil. During 1978-1983 18 stage III cases of cancer of the uterine cervix were treated with complete response in 78% and 44% 5 year survivals. The types of acute and delayed effects of Cf-252 were the same as Co-60 or Cs-137 but the rectum was found sensitive in this system of brachytherapy. A dose of 1,000-1,500 cGy/6-10 F in 10-22 days of Cf-252 radiation was tolerated and produced tumor cure

Neutron calibration field of bare {sup 252}Cf source in Vietnam

Energy Technology Data Exchange (ETDEWEB)

Le, Ngoc Thiem; Tran, Hoai Nam; Nguyen, Khai Tuan [Institute for Nuclear Science and Technology, Hanoi (Viet Nam); Trinh, Glap Van [Institute of Research and Development, Duy Tan University, Da Nang (Viet Nam)

2017-02-15

This paper presents the establishment and characterization of a neutron calibration field using a bare {sup 252}Cf source of low neutron source strength in Vietnam. The characterization of the field in terms of neutron flux spectra and neutron ambient dose equivalent rates were performed by Monte Carlo simulations using the MCNP5 code. The anisotropy effect of the source was also investigated. The neutron ambient dose equivalent rates at three reference distances of 75, 125, and 150 cm from the source were calculated and compared with the measurements using the Aloka TPS-451C neutron survey meters. The discrepancy between the calculated and measured values is found to be about 10%. To separate the scattered and the direct components from the total neutron flux spectra, an in-house shadow cone of 10% borated polyethylene was used. The shielding efficiency of the shadow cone was estimated using the MCNP5 code. The results confirmed that the shielding efficiency of the shadow cone is acceptable.

Photon contributions from the 252Cf and 241Am–Be neutron sources at the PSI Calibration Laboratory

International Nuclear Information System (INIS)

Hoedlmoser, H.; Boschung, M.; Meier, K.; Stadtmann, H.; Hranitzky, C.; Figel, M.; Mayer, S.

2012-01-01

At the accredited PSI Calibration Laboratory neutron reference fields traceable to the national standards of the Physikalisch-Technische Bundesanstalt (PTB) in Germany are available for the calibration of ambient and personal dose equivalent (rate) meters and passive dosimeters. The photon contribution to the ambient dose equivalent in the neutron fields of the 252 Cf and 241 Am–Be sources was measured using various photon dose rate meters and active and passive dosimeters. Measuring photons from a neutron source usually involves considerable uncertainties due to the presence of neutron induced photons in the room, due to a non-zero neutron sensitivity of the photon detector, and last but not least due to the energy response of the photon detectors. Therefore eight independent detectors and methods were used to obtain a reliable estimate for the photon contribution of the two sources as an average of the individual methods. For the 241 Am–Be source a photon contribution of approximately 4.9% was determined and for the 252 Cf source a contribution of 3.6%.

Multiplicity and correlated energy of gamma rays emitted in the spontaneous fission of Californium-252

International Nuclear Information System (INIS)

Brunson, G.S. Jr.

1982-06-01

An array of eight high-speed plastic scintillation detectors has been used to infer a mathematical model for the emission multipliciy of prompt gammas in the spontaneous fission of 252 Cf. Exceptional time resolution and coincidence capability permitted the separation of gammas from fast neutrons over a flight path of approximately 10 cm. About 20 different distribution models were tested. The average energy of the prompt gammas is inversely related to the number emitted; however, this inverse relationship is not strong and the total gamma energy does increase with increasing gamma number. An extension of the experiment incorporated a lithium-drifted germanium gamma spectrometer that resolved nearly 100 discrete gammas associated with fission. Of these gammas, some were preferentially associated with fission in which few gammas were emitted. Certain others were more frequent when many gammas were emitted. Results are presented

Glasses impregnated with lead for radiation shielding

International Nuclear Information System (INIS)

Abd El Monem, A.M.; Kansouh, W.A.; Megahid, R.M.; Ismail, A.L.; Awad, E.M.

2005-01-01

The attenuation properties of glasses with different concentration of lead have been investigated for the attenuation of gamma-rays from cesium-137 and for total gamma rays using a beam of neutrons and gamma rays emitted from californium-252 source. Measurements have been performed using a gamma-ray spectrometer with Nal(T1) detector for gamma-rays emitted from 137 Cs and a neutron/gamma spectrometer with stilbene scintillator for measurement of total gamma-rays from 252 Cf neutron source. The latter applied the pulse shape discrimination technique to distinguish between recoil proton and recoil electron pulses. The obtained results given the form displayed pulse height spectra and attenuation relations which were used to derive the linear attenuation coefficient (μ), and the mass attenuation coefficient (mu/p) of the investigated glasses. In addition, calculations were performed to determine the attenuation properties of glass shields under investigation using XCOM code given by the others. A comparison of the shielding properties of these glasses with some standard shielding materials indicated that, the investigated glasses process the shielding advantages required for different nuclear technology applications

Definitive Brachytherapy for Kaposi's Sarcoma

International Nuclear Information System (INIS)

Williams, A.; Ezzell, G.; Zalupski, M.; Fontanesi, J.

1996-01-01

Purpose: To assess the efficacy and possible complications in patients diagnosed with Kaposi's sarcoma and treated with definitive brachytherapy. Methods and Materials: Between January, 1995 and December, 1995, four patients with Kaposi's sarcoma (KS) were treated with brachytherapy. Three patients, all with positive HIV status were treated using Iridium 192 (Ir-192) sources via a high-dose rate remote afterloader. One patient with endemic KS was treated using the application of catheters loaded with Californium 252. Eight sites were treated and included scalp, feet, nose, penis, hand, neck, and back. Dose rate for Ir-192 was 330cGy/fx to a total dose of 990cGy. The Californium was delivered as 100nGy/b.i.d. to a total dose of 900nGy. Follow-up as ranged from 2-6 months. Results: All four patients remain alive. Seven of eight sites have had complete clinical response and each patient has reported durable pain relief that has not subsided through last follow-up of 1/96. Two of eight sites, both treated with surface mold technique with Californium 252 developed moist desquamation. The remaining six sites did not demonstrate significant toxicity. Conclusion: Brachytherapy can offer Kaposi's sarcoma patients results that are equivalent to external beam radiation therapy, with minimal complications, a shorter treatment time and potential cost effectiveness

252Cf-source-driven neutron noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; King, W.T.; Blakeman, E.D.

1985-01-01

The 252 Cf-source-driven neutron noise analysis method has been tested in a a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor, k/sub eff/ has been satisfactorily determined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments and the development of theoretical methods to predict the experimental observables

252Cf-source-driven neutron noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; King, W.T.; Blakeman, E.D.

1985-01-01

The 252 Cf-source-driven neutron noise analysis method has been tested in a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor k/sub eff/ has been satisfactorily detemined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments oriented toward particular applications including dynamic experiments and the development of theoretical methods to predict the experimental observables

A new facility for non-destructive assay using a 252Cf source.

Science.gov (United States)

Stevanato, L; Caldogno, M; Dima, R; Fabris, D; Hao, Xin; Lunardon, M; Moretto, S; Nebbia, G; Pesente, S; Pino, F; Sajo-Bohus, L; Viesti, G

2013-03-01

A new laboratory facility for non-destructive analysis (NDA) using a time-tagged (252)Cf source is presented. The system is designed to analyze samples having maximum size of about 20 × 25 cm(2), the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. Copyright © 2012 Elsevier Ltd. All rights reserved.

The status of low dose rate and future of high dose rate Cf-252 brachytherapy

International Nuclear Information System (INIS)

Rivard, M.J.; Wierzbicki, J.G.; Van den Heuvel, F.; Chuba, P.J.; Fontanesi, J.

1997-12-01

This work describes the current status of the US low dose rate (LDR) Cf-252 brachytherapy program. The efforts undertaken towards development of a high dose rate (HDR) remotely after loaded Cf-252 source, which can accommodate 1 mg or greater Cf-252, are also described. This HDR effort is a collaboration between Oak Ridge National Laboratory (ORNL), commercial remote after loader manufactures, the Gershenson Radiation Oncology Center (ROC), and Wayne State University. To achieve this goal, several advances in isotope chemistry and source preparation at ORNL must be achieved to yield a specific material source loading of greater than or equal 1 mg Cf-252 per mm3. Development work with both radioactive and non-radioactive stand-ins for Cf-252 have indicated the feasibility of fabricating such sources. As a result, the decreased catheter diameter and computer controlled source placement will permit additional sites (e.g. brain, breast, prostate, lung, parotid, etc.) to be treated effectively with Cf-252 sources. Additional work at the Radiochemical Engineering and Development Center (REDC) remains in source fabrication, after loader modification, and safe design. The current LDR Cf-252 Treatment Suite at the ROC is shielded and licensed to hold up to 1 mg of Cf-252. This was designed to maintain cumulative personnel exposure, both external to the room and in direct isotope handling, at less than 20 microSv/hr. However, cumulative exposure may be greatly decreased if a Cf-252 HDR unit is employed which would eliminate direct isotope handling and decrease treatment times from tilde 3 hours to an expected range of 3 to 15 minutes. Such a Cf-252 HDR source will also demonstrate improved dose distributions over current LDR treatments due to the ability to step the point-like source throughout the target volume and weight the dwell time accordingly

The protective cell petrus for the production of californium 252; Cellule blindee petrus pour la production et l'etude du californium 252

Energy Technology Data Exchange (ETDEWEB)

Sontag, R; Berger, R [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

1967-07-01

The alpha, beta, gamma, neutron cell which is described in the present paper is devoted to the transplutonium element production and study. It is located at the CEN in Fontenay-aux-Roses (France). The 4 feet ordinary concrete shielding made of stacked blocs allows the manipulation of radioactive sources as high as 1000 curies of 1 MeV gamma rays and with a fast neutrons flux of 10{sup 9} n.cm{sup -2}.s{sup -1}. The airtight alpha containment box is equipped with two transfer systems, one consists of a parallelepiped shaped airtight box located in a turntable, the other uses standard cylindrical containers made of polyethylene. The general equipment and the main setting up are also described. (authors) [French] La cellule alpha, beta, gamma, neutron, qui fait l'objet du present article, est destinee a la production et a l'etude des elements transplutoniens. Elle est construite au C.E.N. de Fontenay-aux-Roses (France). La protection biologique, calculee pour une activite de 1000 curies de rayonnement gamma d'energie 1 MeV accompagnee d'un flux de neutrons rapides de 10{sup 9}/cm{sup 2}s, est constituee par des parois en beton de 1,20 m d'epaisseur. L'enceinte alpha est une boite etanche qui comporte devx systemes de transferts: l'un consiste en une boite parallelepipedique etanche logee dans un barillet, l'autre fait appel a des recipients cylindriques standard en polyethylene. L'equipement general et les installations les plus importantes sont ensuite decrits. (auteurs)

Importance of the neutrons kerma coefficient in the planning of Brachytherapy treatments with Cf-252 sources

International Nuclear Information System (INIS)

Paredes G, L.; Balcazar G, M.; Azorin N, J.; Francois L, J.L.

2006-01-01

The Cf-252 is a fast neutrons emitting radioisotope by spontaneous fission that can be used as sealed source in medicine applications, industry and research. Commercially its offer sources of different sizes, compact and with a fast neutrons emission of the order of 10 6 n/s-μg and an energy spectra that presents respectively maxim and average energy in 2.1 MeV and 0.7 MeV. In medicine new applications are being developed for the treatment of patient with hypoxic and voluminous tumors, where the therapy with photons has not given positive results, as well as for the protocols of therapy treatment by boron neutron capture, where very small sources of Cf-252 will be used with the interstitial brachytherapy technique of high and low dose rate. In this work an analysis of how the small differences that exist in the elementary composition of 4 wicked tumors, 4 ICRU healthy tissues and 3 substitute materials of ICRU tissue used in dosimetry are presented, its generate changes in the neutrons kerma coefficient in function of the energy and consequently in the absorbed dose in the interval of 11 eV to 29 MeV. These differences can produce maximum variations of the neutron kerma coefficients ratio for E n > 1 keV of the one: 15% tumor/ICRU guest healthy tissue, 12% ICRU tumor/muscle, 12% ICRU healthy tissues ICRU/ICRU muscle, 22% substitutes tissue/tumor and 22% ICRU substitutes tissue/muscle. Also, it was found that the average value of the neutrons kerma coefficient for the 4 wicked tumors is from 6% to 7% smaller that the average value for the soft tissue in the interval energy of interest for therapy with fast neutrons with E n > 1 MeV. These results have a special importance during the planning process of brachytherapy treatments with sources of 252 Cf, to optimize and to individualize the patients treatments. (Author)

The legacy of Cf-252 operations at Savannah River Technology Center: Continuous releases of radioiodine to the atmosphere

International Nuclear Information System (INIS)

Kantelo, M.V.; Crandall, B.S.

1992-01-01

The iodine isotopes I-132, 1-133, I-134, and I-135, which have half-lives ranging from 53 minutes to 21 hours, are measured in the atmospheric effluent from the Savannah River Technology Center (SRTC) at the Savannah River Site (SRS) near Aiken, South Carolina. SRS is operated by Westinghouse Savannah River Company for the US Department of Energy (DOE). The isotopes' release rates range from 10 to 300 microcuries per week compared to the rate. The resulting annual dose from all iodine isotopes is minor; it comprises 0.01 percent of the total offsite dose due to atmospheric releases from SRS in 1990. Circumstantial evidence indicates the radioiodine originates from traces of unencapsulated Cf-252. The determination that spontaneous fission of Cf-252 is the source of the radioiodine has several ramifications. Radioactive fission-product isotopes of the noble gas elements krypton and xenon must also be released. Noble gases are more volatile and mobile than iodine. Also, the released iodine isotopes decay to xenon isotopes. The noble gases decay to non-gaseous elements that are transported along with radioiodine to the terrestrial environment by deposition from the SRTC plume. Only Sr-89 is believed to accumulate sufficiently in the environment to approach detectable levels. Given similar conditions in earlier years, releases of short-lived radioiodine have occurred undetected in routine monitoring since the early 1970s. Release rates 20 years ago would have been 200 times greater than current release rates. This report documents preliminary experiments conducted by SRTC and Environmental Monitoring Section (EMS) scientists. The release process and the environmental impact of fission products from Cf-252 should be thoroughly researched

The protective cell petrus for the production of californium 252

International Nuclear Information System (INIS)

Sontag, R.; Berger, R.

1967-01-01

The alpha, beta, gamma, neutron cell which is described in the present paper is devoted to the transplutonium element production and study. It is located at the CEN in Fontenay-aux-Roses (France). The 4 feet ordinary concrete shielding made of stacked blocs allows the manipulation of radioactive sources as high as 1000 curies of 1 MeV gamma rays and with a fast neutrons flux of 10 9 n.cm -2 .s -1 . The airtight alpha containment box is equipped with two transfer systems, one consists of a parallelepiped shaped airtight box located in a turntable, the other uses standard cylindrical containers made of polyethylene. The general equipment and the main setting up are also described. (authors) [fr

Californium Recovery from Palladium Wire

Energy Technology Data Exchange (ETDEWEB)

Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2014-08-01

The recovery of ²⁵²Cf from palladium-²⁵²Cf cermet wires was investigated to determine the feasibility of implementing it into the cermet wire production operation at Oak Ridge National Laboratory’s Radiochemical Engineering Development Center. The dissolution of Pd wire in 8 M HNO₃ and trace amounts of HCl was studied at both ambient and elevated temperatures. These studies showed that it took days to dissolve the wire at ambient temperature and only 2 hours at 60°C. Adjusting the ratio of the volume of solvent to the mass of the wire segment showed little change in the kinetics of dissolution, which ranged from 0.176 mL/mg down to 0.019 mL/mg. A successful chromatographic separation of ¹⁵³Gd, a surrogate for ²⁵²Cf, from Pd was demonstrated using AG 50x8 cation exchange resin with a bed volume of 0.5 mL and an internal diameter of 0.8 cm.

Californium oxygen system for 1.50 < O/Cf < 1.72

International Nuclear Information System (INIS)

Turcotte, R.P.; Haire, R.G.

1975-01-01

The californium-oxygen system was studied as a function of temperature, oxygen pressure, and stoichiometry by manometric and x-ray diffraction methods. The results establish rhombohedral Cf 7 O 12 as the stable compound obtained by heating Cf 2 O 3 in air. The isobaric oxidation-reduction cycles Cf 2 O 3 → Cf 7 O 12 → Cf 2 O 3 , observed in constant rate of heating (cooling) experiments, occur with large hysteresis. A close parallel to other fluorite related lanthanide and actinide oxide systems is established. (auth)

Development of the neutron reference calibration field using a 252Cf standard source surrounded with PMMA moderators

International Nuclear Information System (INIS)

Yoshida, T.; Kanai, K.; Tsujimura, N.

2002-01-01

The authors developed the neutron reference calibration fields using a 252 Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the 252 Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO 2 -UO 2 mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments

A pneumatic transfer system for special form 252Cf

International Nuclear Information System (INIS)

Gehrke, R.J.; Berry, S.M.; Grafwallner, E.G.; Hoggan, J.M.

1996-09-01

A pneumatic transfer system has been developed for use with series 100 Special Form 252 Cf. It was developed to reduce the exposure to personnel handling sources of 252 Cf with masses up to 150 microg by permitting remotely activated two-way transfer between the storage container and the irradiation position. The pneumatic transfer system also permits transfers for reproducible repetitive irradiation periods. In addition to the storage container equipped with quick-release fittings, the transfer system consists of an irradiation station, a control box with momentary contact switches to activate the air-pressure control valves and indicators to identify the location of the source, and connecting air hose and electrical wire. A source of 20 psig air and 110 volt electrical power are required for operation of the transfer system which can be easily moved and set up by one individual in 5 to 10 minutes. Tests have shown that rarely does a source become lodged in the transfer tubing, but two methods have been developed to handle incomplete transfers of the 252 Cf source. The first method consists of closing one air vent to allow a pressure impulse to propel the source to the opposite side. The second method applies to those 252 Cf capsules with a threaded or tapped end to which a small ferromagnetic piece can be attached; an incompletely transferred source in the transfer tube can then be guided to a position of safety by surrounding the transfer tubing containing the capsule with a horseshoe magnet attached to the end of a long pole

Radionuclides in rodents

International Nuclear Information System (INIS)

Taylor, G.N.

1985-01-01

Studies are being conducted in mice comparing the toxicity of radium-226, plutonium-239, americium-241, californium-249 and californium-252 in C57B1/Do (albino) mice and the toxicity of americium-241, plutonium-239 and radium-226 in deer mice (Peromyscus maniculatus) and grasshopper mice (Onychomys leucogaster). These experiments will ultimately enable comparison of the toxicity of the above actinide toxicity in man to be made using radium toxicity as the baseline

Design of a thermal neutron field by 252Cf source for measurement of 10B concentrations in the blood samples for BNCT

International Nuclear Information System (INIS)

Naito, H.; Sakurai, Y.; Maruhashi, A.

2006-01-01

10 B concentrations in the blood samples for BNCT has been estimated due to amounts of prompt gamma rays from 10 B in the fields of thermal neutrons from a special guide tube attached to research reactor. A system using radioisotopes as the source of thermal neutron fields has advantages that are convenient and low cost because it doesn't need running of a reactor or an accelerator. The validity of 252 Cf as a neutron source for 10 B concentrations detection system was investigated. This system is composed of D 2 O moderator, Pb reflector/filter, C reflector, and LiF filter. A thermal neutron field with low background gamma-rays is obtained. A large source of 252 Cf is required to obtain a sufficient flux. (author)

Physics of the 252Cf-source-driven noise analysis measurement

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.; Perez, R.B.; Mattingly, J.K.

1997-01-01

The 252 Cf-source-driven noise analysis method is a versatile measurements tool that has been applied to measurements for initial loading of reactors, quality assurance of reactor fuel elements, fuel processing facilities, fuel reprocessing facilities, fuel storage facilities, zero-power testing of reactors, verification of calculational methods, process monitoring, characterization of storage vaults, and nuclear weapons identification. This method's broad range of application is due to the wide variety of time- and frequency domain signatures, each with unique properties, obtained from the measurement. The following parameters are obtained from this measurement: average detector count rates, detector multiplicities, detector autocorrelations, cross-correlation between detectors, detector autopower spectral densities, cross-power spectral densities between detectors, coherences, and ratios of spectral densities. All of these measured parameters can also be calculated using the MCNP-DSP Monte Carlo code. This paper presents a review of the time-domain signatures obtained from this measurement

In-situ elemental analysis of coal by neutron activation

International Nuclear Information System (INIS)

Mikesell, J.L.; Senftle, F.E.; Tanner, A.B.

1986-01-01

The U.S. Geological Survey (USGS) has worked to develop neutron techniques for the borehole measurement of the elemental composition of ores since 1969, and first demonstrated a borehole ultimate analysis of coal in 1977. Borehole measurements such as these permit real-time evaluation of coal quality without the expense of coring or the delays associated with laboratory analyses. Two technological innovations make such measurements possible: the availability, from Savannah River Operations Office, DOE, of small californium-252 (/sup 252/Cf) fission neutron sources, and the development, by USGS and Princeton Gamma-Techn, of the melting-cryogen-cooled high-purity germanium borehole gamma-ray detector. A technique of relating mass fractions to measured gamma-ray intensities, which eliminates the need for detailed knowledge of the geometry of the neutron distribution, is used to calculate elemental compositions without resorting to the test pits or computer borehole modeling. In coal, all of the major constituents (C, H, N, S, Si, Al, Fe, Ti) except oxygen can be determined quantitatively by thermal neutron capture gamma-ray spectroscopy

252Cf-source-driven neutron noise measurements of subcriticality for a slab tank containing aqueous Pu-U nitrate

International Nuclear Information System (INIS)

Mihalczo, J.T.; Blakeman, E.D.; Ragan, G.E.; Kryter, R.C.; Robinson, R.C.; Seino, H.

1987-08-01

In order to study nuclear criticality safety related to the development of fast breeder technology, 252 Cf-source-driven neutron noise analysis measurements were performed with a Pu-U nitrate solution in a slab tank of various heights and thickness varying 11.43 cm to 19.05 cm. The results and conclusions of these experiments are (1) a capability to measure the subcriticality of a multiplying system of slab geometry to a k/sub eff/ as low as 0.7 was demonstrated, (2) calculated neutron multiplication factors agreed with those from the experiments within ∼0.02, and (3) the applicability of the method for plutonium solution systems was demonstrated. This paper describes measurements in which the height of the slab was varied for a fixed thickness and the thickness varied for a fixed height, which are the first applications of this measurement method to slab geometry

[An improved method of preparing protein and peptide probes in mass spectrometry with ionization of division fragments by californium-252 (TOF-PDMS)].

Science.gov (United States)

Chivanov, V D; Zubarev, R A; Aksenov, S A; Bordunova, O G; Eremenko, V I; Kabanets, V M; Tatarinova, V I; Mishnev, A K; Kuraev, V V; Knysh, A N; Eremenko, I A

1996-08-01

The addition of organic acids (picric, oxalic, citric, or tartaric) to peptide and protein samples was found to significantly increase the yield of their quasi-molecular ions (QMI) in time-of-flight 252Cf plasma desorption mass spectrometry. The yield of the ions depended on the pKa of the acid added.

Bias in calculated keff from subcritical measurements by the 252Cf-source-driven noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; Valentine, T.E.

1995-01-01

The development of MCNP-DSP, which allows direct calculation of the measured time and frequency analysis parameters from subcritical measurements using the 252 Cf-source-driven noise analysis method, permits the validation of calculational methods for criticality safety with in-plant subcritical measurements. In addition, a method of obtaining the bias in the calculations, which is essential to the criticality safety specialist, is illustrated using the results of measurements with 17.771-cm-diam, enriched (93.15), unreflected, and unmoderated uranium metal cylinders. For these uranium metal cylinders the bias obtained using MCNP-DSP and ENDF/B-V cross-section data increased with subcriticality. For a critical experiment [height (h) = 12.629 cm], it was -0.0061 ± 0.0003. For a 10.16-cm-high cylinder (k ∼ 0.93), it was 0.0060 ± 0.0016, and for a subcritical cylinder (h = 8.13 cm, k ∼ 0.85), the bias was -0.0137 ± 0.0037, more than a factor of 2 larger in magnitude. This method allows the nuclear criticality safety specialist to establish the bias in calculational methods for criticality safety from in-plant subcritical measurements by the 252 Cf-source-driven noise analysis method

Development of the neutron reference calibration field using a {sup 252}Cf standard source surrounded with PMMA moderators

Energy Technology Data Exchange (ETDEWEB)

Yoshida, T.; Kanai, K.; Tsujimura, N. [Japan Nuclear Cycle Development Institute, Ibaraki-ken (Japan)

2002-07-01

The authors developed the neutron reference calibration fields using a {sup 252} Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the {sup 252} Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO{sub 2}-UO{sub 2} mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments.

Laboratory-scale shielded cell for 252Cf

International Nuclear Information System (INIS)

Anderl, R.A.; Cargo, C.H.

1979-01-01

A shielded-cell facility for storing and handling remotely up to 2 milligram quantities of unencapsulated 252 Cf has been built in a radiochemistry laboratory at the Test Reactor Area of the Idaho National Engineering Laboratory. Unique features of this facility are its compact bulk radiation shield of borated gypsum and transfer lines which permit the transport of fission product activity from 252 Cf fission sources within the cell to a mass separator and to a fast radiochemistry system in nearby rooms

Sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to neutrons emitted by a 252Cf source

International Nuclear Information System (INIS)

Spurny, Frantisek; Medioni, Roger; Chapuis, A.; Portal, Guy.

1975-07-01

The specific sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to the neutron spectrum of a 252 Cf source was measured and the effect of the size and composition of the containers in which they might be put was investigated. PB33 radiophotoluminescent glasses, radiothermoluminescent alumina and calcium sulfate were less sensitive to fission neutrons whereas photographic emulsions were more sensitive. The former should be used for γ detection in mixed fields of photons and fission neutrons [fr

48 CFR 53.301-252 - Standard Form 252, Architect-Engineer Contract.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Standard Form 252, Architect-Engineer Contract. 53.301-252 Section 53.301-252 Federal Acquisition Regulations System FEDERAL..., Architect-Engineer Contract. EC01MY91.035 EC01MY91.036 ...

Measurement of Neutron Energy Spectrum Emitted by Cf-252 Source Using Time-of-Flight Method

Energy Technology Data Exchange (ETDEWEB)

Lee, Cheol Ho; Son, Jaebum; Kim, Tae Hoon; Lee, Sangmin; Kim, Yong-Kyun [Hanyang University, Seoul (Korea, Republic of)

2016-10-15

The techniques proposed to detect the neutrons usually require the detection of a secondary recoiling nucleus in a scintillator (or other type of detector) to indicate the rare collision of a neutron with a nucleus. This is the same basic technique, in this case detection of a recoil proton that was used by Chadwick in the 1930 s to discover and identify the neutron and determine its mass. It is primary technique still used today for detection of fast neutron, which typically involves the use of a hydrogen based organic plastic or liquid scintillator coupled to a photo-multiplier tube. The light output from such scintillators is a function of the cross section and nuclear kinematics of the n + nucleus collision. With the exception of deuterated scintillators, the scintillator signal does not necessarily produce a distinct peak in the scintillator spectrum directly related to the incident neutron energy. Instead neutron time-of-flight (TOF) often must be utilized to determine the neutron energy, which requires generation of a prompt start signal from the nuclear source emitting the neutrons. This method takes advantage of the high number of prompt gamma rays. The Time-of-Flight method was used to measure neutron energy spectrum emitted by the Cf-252 neutron source. Plastic scintillator that has a superior discrimination ability of neutron and gamma-ray was used as a stop signal detector and liquid scintillator was used as a stat signal detector. In experiment, neutron and gamma-ray spectrum was firstly measured and discriminated using the TOF method. Secondly, neutron energy spectrum was obtained through spectrum analysis. Equation of neutron energy spectrum that was emitted by Cf-252 source using the Gaussian fitting was obtained.

Radiation sources and process

International Nuclear Information System (INIS)

Honious, H.B.; Janzow, E.F.; Malson, H.A.; Moyer, S.E.

1980-01-01

The invention relates to radiation sources comprising a substrate having an electrically-conductive non-radioactive metal surface, a layer of a metal radioactive isotope of the scandium group, which in addition to scandium, yttrium, lanthanum and actinium, includes all the lanthanide and actinide series of elements, with the actinide series usually being preferred because of the nature of the radioactive isotopes therein, particularly americium-241, curium-244, plutonium-238, californium-252 and promethium-147, and a non-radioactive bonding metal codeposited on the surface by electroplating the isotope and bonding metal from an electrolytic solution, the isotope being present in the layer in minor amount as compared to the bonding metal, and with or without a non-radioactive protective metal coating covering the isotoype and bonding metal on the surface, the coating being sufficiently thin to permit radiation to pass through the coating. The invention also relates to a process for providing radiation sources comprising codepositing a layer of the metal radioactive isotope with a non-radioactive bonding metal from an electrolytic solution in which the isotope is present in minor molar amount as compared to the bonding metal such that the codeposited layer contains a minor molar amount of the isotope compared to the bonding metal by electroplating on an electrically-conductive non-radioactive metal surface of a cathode substrate, and with or without depositing a nonradioactive protective metal coating over the isotope and bonding metal on the surface, the coating being sufficiently thin to permit radiation to pass through the coating

Operational safety at the radiometallurgy laboratory of Fontenay-aux-Roses

International Nuclear Information System (INIS)

Hayet, Lucien; Petit, Pierre; Conche, Roger.

1976-01-01

Opened in 1967, the Radiometallurgy Laboratory is responsible for the examination of plutonium 239 based nuclear fuels of breeder reactors such as Rapsodie and Phenix. Part of the same laboratory is also responsible for the manufacture of californium 252 sources. These neutron sources can have a neutron fluency yield of 2,3 10 10 n/s/4π (i.e. 10mg of 252cf). This large laboratory includes a total area of 117m 2 of hot surfaces. It also includes 14 high activity cells with a capacity of 100000Ci at 1MeV. Located only 7km from the center of Paris, it must incorporate a special design and a particularly sure safety policy. Several statistics are given: irradiations, contaminations, incidents, quantity of fissile material, solid and liquid wastes etc... The principles of safety management are outlined and an analysis given of this basic nuclear facility [fr

Nuclear assay of coal. Volume 1. Coal composition by prompt neutron activation analysis: basic experiments. Final report

International Nuclear Information System (INIS)

Reynolds, G.; Bozorganesh, H.; Elias, E.; Gozani, T.; Maung, T.; Orphan, V.

1979-01-01

Using californium-252 as a source of exciting neutrons, prompt gamma photons emitted by elemental nuclei in the coal have been measured using several detectors, including sodium--iodide and germanium--lithium. Several coal types, including bituminous, subbituminous lignite and anthracite were crushed to various top sizes and analyzed carefully be traditional ASTM wet chemistry techniques at two or three different laboratories. The elements (sulfur, hydrogen, carbon, aluminum, silicon, iron, calcium, sodium, nitrogen, and chlorine) were determined by prompt neutron activations and the quantities compared with those of the wet chemical analyses

Calibration of a Modified Californium Shuffler

International Nuclear Information System (INIS)

Sadowski, E.T.; Armstrong, F.; Oldham, R.; Ceo, R.; Williams, N.

1995-01-01

A californium shuffler originally designed to assay hollow cylindrical pieces of UA1 has been modified to assay solid cylinders. Calibration standards were characterized via chemical analysis of the molten UA1 taken during casting of the standards. The melt samples yielded much more reliable characterization data than drill samples taken from standards after the standards had solidified. By normalizing one well-characterized calibration curve to several standards at different enrichments, a relatively small number of standards was required to develop an enrichment-dependent calibration. The precision of this shuffler is 0.65%, and the typical random and systematic uncertainties are 0.53% and 0.73%, respectively, for a six minute assay of an ingot containing approximately 700 grams of 235 U. This paper will discuss (1) the discrepancies encountered when UA1 standards were characterized via melt samples versus drill samples, (2) a calibration methodology employing a small number of standards, and (3) a comparison of results from a previously unused shuffler with an existing shuffler. A small number of UA1 standards have been characterized using samples from the homogeneous molten state and have yielded enrichment-dependent and enrichment-independent calibration curves on two different shufflers

Exclusive radiation therapy of endometrial carcinoma using HDR Co-60 and Cf-252 sources

International Nuclear Information System (INIS)

Inciura, A.; Janulionis, E.; Atkocius, V.

2000-01-01

Although the main treatment of endometrial cancer is surgery, the gross spread of carcinoma in pelvis, elderly age of the patients and serious therapeutical diseases do not allow to operate 20% of the patients. For these patients only radical treatment decision is the combined radiation therapy. However, using various modalities of combined radiotherapy, the treatment results are not satisfying: only 52% of patients survive 5 years. There was implemented a new method of combined radiotherapy, using a three-channel applicator with two-positional locating of HDR Co-60 radioactive sources (group I). A new method of brachytherapy for endometrial carcinoma using a HDR Cf 252 sources (group II) was implemented too. For group I the medium total dose of the point A was 77.6 Gy, point I - 69.6 Gy. point 2 - 84.2 Gy, point B - 52.6 Gy, For group II the medium total dose the points A, 3 and 4 was 50 iGy. For group I 1 year overaII survival rate was 85%, 3 year - 73%. The 3 year survival rate for stage I was 79%, for stage II - 89%, for stage III - 33%. 3 year survival for highly virulent tumours - 56% and for low virulent (adenocarcinoma) - 82% was statistically different. The loss of tumour differentiation correlated with the worse prognosis: 3 year survival for G1 and G2 tumours was 92%, for G3 - 45%. Low hemoglobin level was also associated with low survival rate: 2 year survival for Hb≥120g/l was 85% and Hb<120g/l - 23%. 1 year survival rate was 87%, 3 year - 66%, 5 year - 58% for group II, treated with Cf-252. Radiation complications occurred for 13.8% of the patients for group I and 6.2% for group II. Good survival rates and a small number of complications sufficiently proofed treatment method. (author)

Transuranium Processing Plant semiannual report of production, status, and plans for period ending June 30, 1975

International Nuclear Information System (INIS)

King, L.J.; Bigelow, J.E.; Collins, E.D.

1976-03-01

During the period January 1, 1975, through June 30, 1975, the following amounts of transuranium elements were recovered from 22 irradiated HFIR targets: 2g 243 Am, 59 g 244 Cm, 51 mg 249 Bk, 465 mg 252 Cf, 2.5 mg 253 Es, and 1.4 pg 257 Fm. In addition, 45 mg of high-purity 248 Cm was operated from 252 Cf which had been recovered and purified during earlier periods, and 56 mg of a lower-quality 248 Cm was separated from californium purification rework solutions. Five HFIR targets, each containing approximately 9 g of actinides (predominantly curium), were fabricated. A new long-term projection showed that 252 Cf production in the TRU-HFIR complex could increase to as much as 2.5 g/year. During the next 18 months, we expect to recover totals of 46 mg of 249 Bk, 520 mg of 252 Cf, 2.0 mg of 253 Es (in a mixture of isotopes), 220 μg of high-purity 253 Es, and 1.6 pg of 257 Fm. We also expect to obtain 125 mg of high-purity 248 Cm from purified californium now in storage. There are no plans to process any of the remaining SRP Pu-Al tubes or to irradiate any plutonium targets in the HFIR; thus, we do not expect to recover any 244 Pu. Two neutron sources were fabricated, bringing the total fabricated to 77. Two sources that had been used previously in various projects were returned to the TRU inventory and are available for reassignment. In special projects, we (1) produced about 1 mg of 250 Cf by irradiation of 249 Bk in HFIR rabbits, and (2) processed some irradiated 248 Cm samples and obtained yield and isotopic composition data for use in determining the capture cross section of 249 Cm in the HFIR. The values that are currently being used for transuranium element decay data and for cross-section data in planning irradiation-processing cycles, calculating production forecasts, and assaying products are tabulated in the Appendix

Designing on-line analyzer for coal on belt conveyor using neutron activation technique

International Nuclear Information System (INIS)

Rony Djokorayono; Agus Cahyono

2014-01-01

Basic design of on-line analyzer for coal on belt conveyor using neutron activation technique has been carried out. Compared with sampling technique, this neutron activation technique has some advantages in term of analysis accuracy and time. The design activities performed include the establishment of design requirements, functional requirements, technical requirements, technical specification, detection sub-system design, data acquisition subsystem design, and operator computer console design. This program will use Nal(Tl) scintillation detector to detect gamma-rays emitted by elements in coal due to neutron activation of a neutron source, "2"5"2Cf (Californium-252). This basic design of on-line analyzer for coal on belt conveyor using neutron activation technique should be followed up with the development of detailed design, prototype construction, and field testing. (author)

Study the Possibility of measuring Heavy Metals Arising from Gold Mining Sample using 252Cf Neutron Source

International Nuclear Information System (INIS)

Soliman, N.F.

2012-01-01

Mining activities contribute immensely to trace element pollution .The present work studied the possibility of measuring heavy metals arising from gold mining areas Eastern Desert in Egypt using the isotopic 252 Cf neutron source. 38.5 g of the sample is irradiated in a neutron field of 252 Cf for 36.75 days and 0.3 mg of the sample is irradiated at the Pneumatic Irradiation Rabbit System (PIRS) built in the vertical thermal column of the ET-RR-2 reactor . The induced activities in the samples are measured using two high resolution f ray spectrometry systems (including two calibrated HPGe detectors). The kο standardization neutron activation analysis (kο-NAA) method was used to analyze the sample under investigation. Thermal to epithermal flux ratio fat the two irradiation positions are measured. The obtained results indicated that the values of the suspected heavy metals such as sodium, magnesium, potassium, manganese, arsenic, ruthenium and tantalum were higher than the background values, signifying accumulation of these heavy metals due to gold mining activities .The accuracy and precision of the method has been evaluated

A Monte Carlo Study on the Effect of Various Neutron Capturers on Dose Distribution in Brachytherapy with 252Cf Source

Directory of Open Access Journals (Sweden)

Firoozabadi M. M.

2017-03-01

Full Text Available Background: In neutron interaction with matter and reduction of neutron energy due to multiple scatterings to the thermal energy range, increasing the probability of thermal neutron capture by neutron captures makes dose enhancement in the tumors loaded with these materials. Objective: The purpose of this study is to evaluate dose distribution in the presence of 10B, 157Gd and 33S neutron capturers and to determine the effect of these materials on dose enhancement rate for 252Cf brachytherapy source. Methods: Neutron-ray flux and energy spectra, neutron and gamma dose rates and dose enhancement factor (DEF are determined in the absence and presence of 10B, 157Gd and 33S using Monte Carlo simulation. Results: The difference in the thermal neutron flux rate in the presence of 10B and 157Gd is significant, while the flux changes in the fast and epithermal energy ranges are insensible. The dose enhancement factor has increased with increasing distance from the source and reached its maximum amount equal to 258.3 and 476.1 cGy/h/µg for 157Gd and 10B, respectively at about 8 cm distance from the source center. DEF for 33S is equal to one. Conclusion: Results show that the magnitude of dose augmentation in tumors containing 10B and 157Gd in brachytherapy with 252Cf source will depend not only on the capture product dose level, but also on the tumor distance from the source. 33S makes dose enhancement under specific conditions that these conditions depend on the neutron energy spectra of source, the 33S concentration in tumor and tumor distance from the source.

Importance of the neutrons kerma coefficient in the planning of Brachytherapy treatments with Cf-252 sources; Importancia del coeficiente de kerma de neutrones en la planeacion de tratamientos de Braquiterapia con fuentes de Cf-252

Energy Technology Data Exchange (ETDEWEB)

Paredes G, L.; Balcazar G, M. [ININ, 52045 Ocoyocac, Estado de Mexico (Mexico); Azorin N, J. [Universidad Autonoma Metropolitana, 09000 Mexico D.F. (Mexico); Francois L, J.L. [UNAM, 04500 Mexico D.F. (Mexico)]. e-mail: lpg@nuclear.inin.mx

2006-07-01

The Cf-252 is a fast neutrons emitting radioisotope by spontaneous fission that can be used as sealed source in medicine applications, industry and research. Commercially its offer sources of different sizes, compact and with a fast neutrons emission of the order of 10{sup 6} n/s-{mu}g and an energy spectra that presents respectively maxim and average energy in 2.1 MeV and 0.7 MeV. In medicine new applications are being developed for the treatment of patient with hypoxic and voluminous tumors, where the therapy with photons has not given positive results, as well as for the protocols of therapy treatment by boron neutron capture, where very small sources of Cf-252 will be used with the interstitial brachytherapy technique of high and low dose rate. In this work an analysis of how the small differences that exist in the elementary composition of 4 wicked tumors, 4 ICRU healthy tissues and 3 substitute materials of ICRU tissue used in dosimetry are presented, its generate changes in the neutrons kerma coefficient in function of the energy and consequently in the absorbed dose in the interval of 11 eV to 29 MeV. These differences can produce maximum variations of the neutron kerma coefficients ratio for E{sub n} > 1 keV of the one: 15% tumor/ICRU guest healthy tissue, 12% ICRU tumor/muscle, 12% ICRU healthy tissues ICRU/ICRU muscle, 22% substitutes tissue/tumor and 22% ICRU substitutes tissue/muscle. Also, it was found that the average value of the neutrons kerma coefficient for the 4 wicked tumors is from 6% to 7% smaller that the average value for the soft tissue in the interval energy of interest for therapy with fast neutrons with E{sub n} > 1 MeV. These results have a special importance during the planning process of brachytherapy treatments with sources of {sup 252}Cf, to optimize and to individualize the patients treatments. (Author)

Measurements of gamma-ray dose from a moderated 252Cf source

International Nuclear Information System (INIS)

McDonald, J.C.; Griffith, R.V.; Plato, P.; Miklos, J.

1983-06-01

The gamma-ray dose fraction from a moderated 252 Cf source was determined by using three types of dosimetry systems. Measurements were carried out in air at a distance of 35 cm from the surface of the moderating sphere (50 cm from the source which is at the center of the sphere) to the geometrical center of each detector. The moderating sphere is 0.8-mm-thick stainless steel shell filled with D 2 O and covered with 0.5 mm of cadmium. Measurements were also carried out with instruments and dosimeters positioned at the surface of a 40 cm x 40 cm x 15 cm plexiglass irradiation phantom whose front surface was also 35 cm from the surface of the moderating sphere. A-150 tissue-equivalent (TE) plastic ionization chambers and a TE proportional counter (TEPC) were used to measure tissue dose, from which the neutron dose equivalent was computed. The ratio of gamma-ray dose to the neutron dose equivalent was determined by using a relatively neutron-insensitive Geiger-Mueller (GM) counter and thermoluminescent dosimeters (TLD). In addition, the event-size spectrum measured by the TEPC was also used to compute the gamma-ray dose fraction. The average value for the ratio of gamma-ray dose to neutron dose equivalent was found to be 0.18 with an uncertainty of about +-18%

Shielding experiments in different materials with 252Cf neutron spectra

International Nuclear Information System (INIS)

Sathian, Deepa; Marathe, P.K.; Pal, Rupali; Jayalakshmi, V.; Chourasiya, G.; Mayya, Y.S.

2008-01-01

Adequate shielding for neutron sources can be determined using analytical method or by actually measuring the attenuation for the target configuration. This paper describes the measurement of Half Value Thickness (HVT), Tenth Value Thickness (TVT), Σ values for four different shielding materials, using a standard 252 Cf neutron source and comparing with the values calculated using an empirical relationship. BF 3 based REM-counter is used for measurement of neutron dose equivalent, against different thickness of the shielding material. The experimental HVT and S values are in good agreement with the calculated values. From this study, it is concluded that, among the four materials studied, high density polyethylene (HDPE) is best suitable for the shielding of a 252 Cf neutron source. (author)

Safety Analysis Report for Packaging (SARP) of the Oak Ridge National Laboratory TRU Californium Shipping Container

International Nuclear Information System (INIS)

Box, W.D.; Shappert, L.B.; Seagren, R.D.; Klima, B.B.; Jurgensen, M.C.; Hammond, C.R.; Watson, C.D.

1980-01-01

An analytical evaluation of the Oak Ridge National Laboratory TRU Californium Shipping Container was made in order to demonstrate its compliance with the regulations governing off-site shipment of packages that contain radioactive material. The evaluation encompassed five primary categories: structural integrity, thermal resistance, radiation shielding, nuclear criticality safety, and quality assurance. The results of this evaluation demonstrate that the container complies with the applicable regulations

Neutron gauging applications using a small 252Cf source

International Nuclear Information System (INIS)

Helf, S.

1975-01-01

The use of a small 252 Cf source, in the 3 to 4 μg range, for neutron gauging applications is described. Emphasis is placed on determination of low concentrations of moisture in homogeneous media, e.g., solvents, explosives, dried food products, etc. and on measurement of charge or fill weight of hydrogenous materials in sealed items, e.g., propellant in a cartridge case. Both moderation of fast neutrons and attenuation of thermalized neutrons have been explored for these applications. Parameters related to the attainment of optimum sensitivity for each method are discussed. Fast neutron moderation is superior for low level moisture measurement whereas thermal neutron attenuation is more sensitive for ''neutron weighing'' applications. Under optimum conditions, sensitivity for moisture measurement approaches 0.1 weight percent whereas ''neutron weighing'' can detect changes in hydrogeneous material content as little as a fraction of a gram. Examples are given for each technique. A number of different thermal neutron detectors are compared for neutron gauging measurements. A 6 LiI (Eu) scintillation detector is judged to be superior with regard to high thermal neutron detection efficiency and low fast neutron and gamma ray response. In this study, emphasis is placed on the use of simple, portable equipment easily adaptable to field or plant use and for on-line process or quality control. (U.S.)

Neutron emission in fission of highly excited californium nuclei (E*=76 MeV)

International Nuclear Information System (INIS)

Blinov, M.V.; Bordyug, V.M.; Kozulin, Eh.M.; Mozhaev, A.N.; Levitovich, M.; Muzychka, Yu.A.; Penionzhkevich, Yu.Eh.; Pustyl'nik, B.I.

1990-01-01

The differential cross sections for neutron production in the fission of highly excited californium nuclei formed in the 238 U+ 12 C (105 MeV) reaction have been measured. From the analysis of the experimental data is follows that the number of pre-fission neutrons substantially exceeds the value obtained in the framework of the standard statistical model. The saddle-to-scission time of the excited nucleus is estimated on the basis of the neutron multiplicity. The dependences of the neutron number and neutron average energies upon the fragment mass are determined

Neutron emission in fission of highly excited californium nuclei (E* = 76 MeV)

International Nuclear Information System (INIS)

Blinov, M.V.; Bordyug, V.M.; Kozulin, E.M.; Levitovich, M.; Mozhaev, A.N.; Muzychka, Yu.A.; Penionzhkevich, Yu.E.; Pustyl'nik, B.I.

1990-01-01

Differential cross sections for neutron production have been measured in fission of excited californium nuclei produced in the reaction 238 U + 12 C (105 MeV). It follows from analysis of the experimental results that the number of neutrons emitted before fission considerably exceeds the number obtained in the framework of the standard statistical model. On the basis of the multiplicity of neutrons they authors have estimated the time of fission of the excited nucleus. The dependence of the number of neutrons and their average energies on the mass of the fragments is determined

Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields

International Nuclear Information System (INIS)

Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik

2001-01-01

Calibration measurements were carried out on a probe designed to measure ambient dose equivalent in accordance with ICRP Pub 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diameter spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV. The instrument was used to measure the dose rate in four separate neutron fields: unmoderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and WEP neutron howitzer with 252 Cf at its center. Dose equivalent measurements were performed at source-detector centerline distances from 50 to 200 cm. The ratio of air-scatter- and room-return-corrected ambient dose equivalent rates to ambient dose equivalent rates calculated with the code MCNP are tabulated

Comparison of the Savannah River Site billet active well coincidence counter and two Californium Shufflers

International Nuclear Information System (INIS)

Sadowski, E.T.; Griffin, J.C.; Rinard, P.M.

1991-01-01

A Scrap Californium Shuffler at the Savannah River Site (SRS) was calibrated to assay the U-Al cores of billets (an intermediate step in the SRS reactor fuel fabrication cycle.) The precision of the Scrap Shuffler over several years has been approximately 0.50%. A typical total uncertainty for the assay of a core on the Scrap Shuffler is approximately 0.33% for a twelve minute assay. The precision over several months and a typical total uncertainty for the Billet Active Well (neutron) Coincidence Counter (BAWCC) are approximately 1.0% and 1.9%, respectively, for a fifteen minute assay. A new Billet Californium Shuffler specifically designed for assaying SRS billets has yielded precision (over one month) and total uncertainty results of 0.40% and 0.69%, respectively, for an eight minute assay. The introduction of a measurement point into the fuel fabrication cycle to replace estimates based upon material weight will greatly enhance material and process control in the Reactor Materials area of SRS. The use of all three instruments provides a comparison of the relative merits of Active Well (neutron) Coincidence Counters (AWCCs) and shufflers for assay of homogeneous and geometrically simple material containing 235 U. The measurement precisions, systematic and random uncertainties, as well as the procurement and operation of each instrument will be compared. 3 refs., 5 figs., 1 tab

Environmental assessment of the thermal neutron activation explosive detection system for concourse use at US airports

Energy Technology Data Exchange (ETDEWEB)

Jones, C.G.

1990-08-01

This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs.

Environmental assessment of the thermal neutron activation explosive detection system for concourse use at US airports

International Nuclear Information System (INIS)

Jones, C.G.

1990-08-01

This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs

Savannah River Plant californium-252 Shuffler electronics manual

International Nuclear Information System (INIS)

Bourret, S.C.; Crane, T.W.; Eccleston, G.W.; Gallegos, E.A.; Garcia, D.L.

1980-03-01

Detailed information is presented in this report, an electronics manual for the Savannah River Plant Shuffler, about the electronics associated with the various control and data acquisition functions of the Shuffler subsystems. Circuit diagrams, interconnection information, and details about computer control and programming are included

Savannah River Plant Californium-252 Shuffler software manual

International Nuclear Information System (INIS)

Johnson, S.S.; Crane, T.W.; Eccleston, G.W.

1979-03-01

A software manual for operating the Savannah River Plant Shuffler nondestructive assay instrument is presented. The procedures for starting up the instrument, making assays, calibrating, and checking the performance of the hardware units are described. A list of the error messages with an explanation of the circumstances prompting the message and possible corrective measures is given. A summary of the software package is included showing the names and contents of the files and subroutines. The procedure for modifying the software package is outlined

Evaluation of the 252Cf-source-driven neutron noise analysis method for measuring the subcriticality of LWR fuel storage casks

International Nuclear Information System (INIS)

Mihalczo, J.T.

1987-01-01

The 252 Cf-source-driven neutron noise analysis method was evaluated to determine if it could be used to measure the subcriticality of storage casks of burnt LWR fuel submerged in fuel storage pools, fully loaded and as they are being loaded. The motivation for this evaluation was that measurements of k/sub eff/ would provide the parameter most directly related to the criticality safety of storage cask configurations of LWR fuel and could allow proper credit for fuel burnup without reliance on calculations. This in turn could lead to more cost-effective cask designs. Evaluation of the method for this application was based on (1) experiments already completed at a critical experiments facility using arrays of PWR fuel pins typical of the size of storage cask configurations, (2) the existence of neutron detectors that can function in shipping cask environments, and (3) the ability to construct ionization chambers containing 252 Cf of adequate intensity for these measurements. These three considerations are discussed

Experimental research on specific activity of 24Na using Chinese reference man phantom irradiated by 252Cf neutrons source

International Nuclear Information System (INIS)

Wang Yuexing; Yang Yifang; Lu Yongjie; Zhang Jianguo; Xing Hongchuan

2011-01-01

Objective: To investigate the specific activity of '2 4 Na per unit neutron fluence, A B/Φ ,in blood produced for Chinese reference man irradiated by 252 Cf neutron source,and to analyze the effects of scattering neutrons from ground,wall,and ceiling in irradiation site on it.Methods: A 252 Cf neutron source of 3×10 8 n/s and the anthropomorphic phantom were used for experiments. The phantom was made from 4 mm thick of outer covering by perspex and the liquid tissue-equivalent substitute in it. The data of phantom dimensions fit into Chinese reference man.The weight ratios of H, N, O and C in substitute equal from source to long axis of phantom were 1.1, 2.1, 3.1 and 4.1 m, respectively. Both the neutron source and the position of xiphisternum of the phantom were 1.6 m above the floor. Results: The average specific activity of 24 Na per unit neutron fluence was related to the irradiation-distances, d, and its maximum value, A B/ΦM , deduced by experimental data was about 1.85×10 -7 Bq·cm 2 ·g -1 . Conclusions: The A B/ΦM corresponds to that of phantom irradiated by plane-parallel beams, and the value is about more 3% than that by BOMAB phantom reported in literature. It has shown that floor-(wall-)scattered neutrons in irradiation site have significant contribution to the specific activity of 24 Na, but they contributed relatively little to the induced neutron doses. Consequently,using the specific activity of 24 Na for assessing accidental neutron doses received by an individual, the contribution of scattered neutrons in accident site will lead dose to be overestimated, and need to be correct. (authors)

Dicty_cDB: SLH252 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH252 (Link to dictyBase) - - - - SLH252F (Link to Original site) SLH2...52F 158 - - - - - - Show SLH252 Library SL (Link to library) Clone ID SLH252 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...52Q.Seq.d/ Representative seq. ID SLH252F (Link to Original site) R...epresentative DNA sequence >SLH252 (SLH252Q) /CSM/SL/SLH2-C/SLH252Q.Seq.d/ ACAGAATGGGTAAAGTACATGGTGGTTTGAATC

Ab initio full-potential study of mechanical properties and magnetic phase stability of californium monopnictides (CfN and CfP)

Energy Technology Data Exchange (ETDEWEB)

Amari, S., E-mail: siham_amari@yahoo.fr [Faculté des Sciences de la Nature et de la Vie, Université Hassiba Benbouali, Chlef, 02000 (Algeria); Bouhafs, B. [Laboratoire de Modélisation et Simulation en Sciences des Matériaux, Université Djillali Liabès de Sidi Bel-Abbés, Sidi Bel-Abbés, 22000 (Algeria)

2016-09-15

Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young’s modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.

15 CFR 25.2 - Definitions.

Science.gov (United States)

2010-01-01

... head means the Secretary of the Department of Commerce, or designee. Benefit means, except as the... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Definitions. 25.2 Section 25.2 Commerce and Foreign Trade Office of the Secretary of Commerce PROGRAM Fraud Civil Remedies § 25.2...

Possibilities of activation analysis with 252Cf sources in the area of earth sciences and mining prospection

International Nuclear Information System (INIS)

Melky, Sami.

1975-01-01

The 252 Cf neutron activation experimental set-up is composed of four sources of 225μg each, symmetrically disposed with regard to the sample axis. This installation permits the irradiation of 5 to 40cm 3 of ores, so that the analysis is done on sample weighing about 100g. This method allows, not only the determination of major and minor constituents in the sample, but also the determination of some trace elements. The experimental sensitivity of some important elements are given in mining prospection and it is shown that direct gamma spectrometry after activation permits a fast and precise determination of many elements in ores [fr

Determination of kinetics parameters using stochastic methods in a 252Cf system

International Nuclear Information System (INIS)

Difilippo, F.C.

1988-01-01

Safety analysis and control system design of nuclear systems require the knowledge of neutron kinetics related parameters like effective delayed neutron fraction, neutron lifetime, time between neutron generations and subcriticality margins. Many methods, deterministic and stochastic, are being used, some since the beginning of nuclear power, to measure these important parameters. The method based on the use of the 252 Cf neutron source has been under intense study at the Oak Ridge National Laboratory, both experimentally and theoretically, during the last years. The increasing demand for this isotope in industrial and medical applications and new designs of advanced high flux reactors to produce it make the isotope available as neutron source (only few micrograms are necessary). A thin layer of 252 Cf is deposited in one of the electrodes of a fission chamber which produces pulses each time the 252 Cf disintegrates via α or spontaneous fission decay; the smaller pulses associated with the α decay can be easily discriminated with the important result that we known the time when v/sub c/ neutrons are injected into the system (number of neutrons per fission of 252 Cf). Thus, a small (few cm 3 ) and nonintrusive device can be used as a random pulsed neutron source with known natural properties that do no depend on biases associated with more complex interrogating devices like accelerators. This paper presents a general formalism that relates the kinetics parameters with stochastic descriptors that naturally appear because of the random nature of the production and transport of neutrons

Possible stabilization of the tetravalent oxidation state of berkelium and californium in acetonitrile with triphenylarsine oxide

International Nuclear Information System (INIS)

Payne, G.F.; Peterson, J.R.

1987-01-01

It appears that we may have prepared Bk(IV) nitrate.nTPAs0 and Bk(IV) perchlorate.nTPAs0 complexes which formed the corresponding Cf(IV) complexes through the beta decay of Bk-249. Definitive proof should come from similar experiments with quantities of Bk-249 large enough to allow spectrophotometric detection of the characteristic f→f transitions in these berkelium and californium species. It is clear, however, that TPAs0 and acetonitrile can play a pivotal role in the stabilization of lanact(IV) species

Development of a transportable neutron radiography system for non-destructive tests application

International Nuclear Information System (INIS)

Silva, Ademir X. da; Crispim, Verginia R.

1999-01-01

This paper presents a study of a transportable neutron radiography system utilizing californium-252. Studies about moderation, collimation and shielding are showed. A Monte Carlo Code, MCNP3b, has been used to obtain a maximum and more homogeneous thermal neutron flux in the collimator outlet next to the image plain, and an adequate radiation shielding to attend radiological protection rules. With the presented collimator, it was possible to obtain for the thermal neutron flux, at the collimator outlet and next to the image plain, a L/D ratio 7,5, for neutron flux up to 6 X 10 -6 cm -2 .s -1 per neutron source. (author)

Feasibility of fissile mass assay of spent nuclear fuel using 252Cf-source-driven frequency-analysis

International Nuclear Information System (INIS)

Mattingly, J.K.; Valentine, T.E.; Mihalczo, J.T.

1996-01-01

The feasibility was evaluated using MCNP-DSP, an analog Monte Carlo transport cod to simulate source-driven measurements. Models of an isolated Westinghouse 17x17 PWR fuel assembly in a 1500-ppM borated water storage pool were used. In the models, the fuel burnup profile was represented using seven axial burnup zones, each with isotopics estimated by the PDQ code. Four different fuel assemblies with average burnups from fresh to 32 GWd/MTU were modeled and analyzed. Analysis of the fuel assemblies was simulated by inducing fission in the fuel using a 252 Cf source adjacent to the assembly and correlating source fissions with the response of a bank of 3 He detectors adjacent to the assembly opposite the source. This analysis was performed at 7 different axial positions on each of the 4 assemblies, and the source-detector cross-spectrum signature was calculated for each of these 28 simulated measurements. The magnitude of the cross-spectrum signature follows a smooth upward trend with increasing fissile material ( 235 U and 239 Pu) content, and the signature is independent of the concentration of spontaneously fissioning isotopes (e.g., 244 Cm) and (α,n) sources. Furthermore, the cross-spectrum signature is highly sensitive to changes in fissile material content. This feasibility study indicated that the signature would increase ∼100% in response to an increase of only 0.1 g/cm 3 of fissile material

Transport-level description of the 252Cf-source method using the Langevin technique

International Nuclear Information System (INIS)

Stolle, A.M.; Akcasu, A.Z.

1991-01-01

The fluctuations in the neutron number density and detector outputs in a nuclear reactor can be analyzed conveniently by using the Langevin equation approach. This approach can be implemented at any level of approximation to describe the time evolution of the neutron population, from the most complete transport-level description to the very basic point reactor analysis of neutron number density fluctuations. In this summary, the complete space- and velocity-dependent transport-level formulation of the Langevin equation approach is applied to the analysis of the 252 Cf-source-driven noise analysis (CSDNA) method, an experimental technique developed by J.T. Mihalczo at Oak Ridge National Laboratory, which makes use of noise analysis to determine the reactivity of subcritical media. From this analysis, a theoretical expression for the subcritical multiplication factor is obtained that can then be used to interpret the experimental data. Results at the transport level are in complete agreement with an independent derivation performed by Sutton and Doub, who used the probability density method to interpret the CSDNA experiment, but differed from other expressions that have appeared in the literature

Resistive plate chamber neutron and gamma sensitivity measurement with a {sup 252}Cf source

Energy Technology Data Exchange (ETDEWEB)

Abbrescia, M.; Altieri, S.; Baratti, V.; Barnaba, O.; Belli, G.; Bruno, G.; Colaleo, A.; DeVecchi, C.; Guida, R. E-mail: roberto.guida@pv.infn.it; Iaselli, G.; Imbres, E.; Loddo, F.; Maggi, M.; Marangelli, B.; Musitelli, G.; Nardo, R.; Natali, S.; Nuzzo, S.; Pugliese, G.; Ranieri, A.; Ratti, S.; Riccardi, C.; Romano, F.; Torre, P.; Vicini, A.; Vitulo, P.; Volpe, F

2003-06-21

A bakelite double gap Resistive Plate Chamber (RPC), operating in avalanche mode, has been exposed to the radiation emitted from a {sup 252}Cf source to measure its neutron and gamma sensitivity. One of the two gaps underwent the traditional electrodes surface coating with linseed oil. RPC signals were triggered by fission events detected using BaF{sub 2} scintillators. A Monte Carlo code, inside the GEANT 3.21 framework with MICAP interface, has been used to identify the gamma and neutron contributions to the total number of collected RPC signals. A neutron sensitivity of (0.63{+-}0.02)x10{sup -3} (average energy 2 MeV) and a gamma sensitivity of (14.0{+-}0.5)x10{sup -3} (average energy 1.5 MeV) have been measured in double gap mode. Measurements done in single gap mode have shown that both neutron and gamma sensitivity are independent of the oiling treatment.

7 CFR 3565.252 - Housing types.

Science.gov (United States)

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Housing types. 3565.252 Section 3565.252 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Property Requirements § 3565.252 Housing types. The property may...

14 CFR 252.9 - Ventilation systems.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Ventilation systems. 252.9 Section 252.9... REGULATIONS SMOKING ABOARD AIRCRAFT § 252.9 Ventilation systems. Air carriers shall prohibit smoking whenever the ventilation system is not fully functioning. Fully functioning for this purpose means operating so...

NAA using Cf-252 after preconcentration

International Nuclear Information System (INIS)

Panyo, O.; Moebius, S.; Keller, C.

1988-01-01

Neutron activation analysis (NAA) with thermal neutron using Cf-252 sources was applied to elemental analysis of elements in water samples. A high-resolution Ge(Li) detector was employed for gamma-radiation detection. Both suspended particulate matter and liquid fraction were investigated after filtration. Preconcentration method by co-precipitation using iron (III) hydroxide and oxine were chosen for use. Elements which were considered to be able to detect in the present study are Al, As, Cl, K, Mg, Mn, Na, Sr, Ti, U, V and Zn

Comparison Of ²⁵²Cf Time Correlated Induced Fisssion With AmLi Induced Fission On Fresh MTR Research Reactor Fuel

Energy Technology Data Exchange (ETDEWEB)

Joshi, Jay Prakash [Los Alamos National Laboratory

2017-03-30

The effective application of international safeguards to research reactors requires verification of spent fuel as well as fresh fuel. To accomplish this goal various nondestructive and destructive assay techniques have been developed in the US and around the world. The Advanced Experimental Fuel Counter (AEFC) is a nondestructive assay (NDA) system developed at Los Alamos National Laboratory (LANL) combining both neutron and gamma measurement capabilities. Since spent fuel assemblies are stored in water, the system was designed to be watertight to facilitate underwater measurements by inspectors. The AEFC is comprised of six ³He detectors as well as a shielded and collimated ion chamber. The ³He detectors are used for active and passive neutron coincidence counting while the ion chamber is used for gross gamma counting. Active coincidence measurement data is used to measure residual fissile mass, whereas the passive coincidence measurement data along with passive gamma measurement can provide information about burnup, cooling time, and initial enrichment. In the past, most of the active interrogation systems along with the AEFC used an AmLi neutron interrogation source. Owing to the difficulty in obtaining an AmLi source, a ²⁵²Cf spontaneous fission (SF) source was used during a 2014 field trail in Uzbekistan as an alternative. In this study, experiments were performed to calibrate the AEFC instrument and compare use of the ²⁵²Cf spontaneous fission source and the AmLi (α,n) neutron emission source. The ²⁵²Cf source spontaneously emits bursts of time-correlated prompt fission neutrons that thermalize in the water and induce fission in the fuel assembly. The induced fission (IF) neutrons are also time correlated resulting in more correlated neutron detections inside the ³He detector, which helps reduce the statistical errors in doubles when using the ²⁵²Cf interrogation source instead of

Thermal neutron imaging with rare-earth-ion-doped LiCaAlF6 scintillators and a sealed 252Cf source

International Nuclear Information System (INIS)

Kawaguchi, Noriaki; Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei; Fukuda, Kentaro; Suyama, Toshihisa; Watanabe, Kenichi; Yamazaki, Atsushi; Chani, Valery; Yoshikawa, Akira

2011-01-01

Thermal neutron imaging with Ce-doped LiCaAlF 6 crystals has been performed. The prototype of the neutron imager using a Ce-doped LiCaAlF 6 scintillating crystal and a position sensitive photomultiplier tube (PSPMT) which had 64 multi-channel anode was developed. The Ce-doped LiCaAlF 6 single crystal was grown by the Czochralski method. A plate with dimensions of a diameter of 50x2 mm 2 was cut from the grown crystal, polished, and optically coupled to PSPMT by silicone grease. The 252 Cf source ( 6 .

252Cf-source-correlated transmission measurements for uranyl fluoride deposit in a 24-in.-OD process pipe

International Nuclear Information System (INIS)

Uckan, T.; Mihalczo, J.T.; Valentine, T.E.; Mullens, J.A.

1998-01-01

Characterization of a hydrated uranyl fluoride (UO 2 F 2 ·nH 2 O) deposit in a 17-ft-long, 24-in.-OD process pipe at the former Oak Ridge Gaseous Diffusion Plant was successfully performed by using 252 Cf-source-correlated time-of-flight (TOF) transmission measurements. These measurements of neutrons and gamma rays through the pipe from an external 2521 Cf fission source were used to measure the deposit profile and its distribution along the pipe, the hydration (or H/U), and the total uranium mass. The measurements were performed with a source in an ionization chamber on one side of the pipe and detectors on the other. Scanning the pipe vertically and horizontally produced a spatial and time-dependent radiograph of the deposit in which transmitted gamma rays and neutrons were separated in time. The cross-correlation function between the source and the detector was measured with the Nuclear Weapons Identification System. After correcting for pipe effects, the deposit thickness was determined from the transmitted neutrons and H/U from the gamma rays. Results were consistent with a later intrusive observation of the shape and the color of the deposit; i.e., the deposit was annular and was on the top of the pipe at some locations, demonstrating the usefulness of this method for deposit characterization

46 CFR 252.13 - Contract.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Contract. 252.13 Section 252.13 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING SUBSIDIZED VESSELS AND OPERATORS OPERATING... Contract. Upon approval by the Board of an application for ODS, the applicant and the United States may...

7 CFR 252.3 - Administration.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 252.3 Section 252.3 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Administration. (a) Role of FNS. The Secretary will designate those commodities which will be available under the...

Characterization of neutron spectra using sources of {sup 241}AmBe, {sup 238}PuBe e {sup 252}Cf moderated in water; Caracterização de espectros neutrônicos com fontes de {sup 241}AmBe, {sup 238}PuBe e {sup 252}Cf moderados em água

Energy Technology Data Exchange (ETDEWEB)

Gonçalves, A.S.; Silva, F.S.; Patrão, K.C.S.; Fonseca, E.S. da; Pereira, W.W., E-mail: angela.souzagon@gmail.com [Instituto de Radioproteção e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Laboratório de Metrologia de Nêutrons

2017-07-01

Recent studies have demonstrated the importance of characterizing the spectrum of neutron sources for various energies in order to make the understanding of neutron interaction closer to reality they work with. This work presents the determination of neutron energy flux from the source of {sup 241}AmBe (0.6 TBq), {sup 238}PuBe (1.8 TBq) and {sup 252}Cf (120 μg) free in the air and inserted into spheres of various diameters containing distilled water. The determination of the spectrum is based on the measurement and simulation by the Monte Carlo computational method, using the sources under study, with the Bonner multisphere spectrometer containing readings with the detector without sphere and covered with polyethylene balls of diameters: 5,08 cm (2 ″), 7.62 cm (3″), 12.70 cm (5 ″), 20.32 cm (8 ″), 25.40 cm (10 ″) and 30.48 cm (12 ″). It is sought to characterize a new moderate spectrum in water using the sources of {sup 241}AmBe, {sup 238}PuBe and {sup 252}Cf that may be useful for testing, calibration and irradiation of individual and area monitors for neutrons.

Monte Carlo design study of a moderated {sup 252}Cf source for in vivo neutron activation analysis of aluminium

Energy Technology Data Exchange (ETDEWEB)

Lewis, D.G.; Natto, S.S.A.; Evans, C.J. [Swansea In Vivo Analysis and Cancer Research Group, Department of Physics, University of Wales, Swansea (United Kingdom); Ryde, S.J.S. [Swansea In Vivo Analysis and Cancer Research Group, Department of Medical Physics and Clinical Engineering, Singleton Hospital, Swansea (United Kingdom)

1997-04-01

The Monte Carlo computer code MCNP has been used to design a moderated 2{sup 52}Cf neutron source for in vivo neutron activation analysis of aluminium (Al) in the bones of the hand. The clinical motivation is the need to monitor l body burden in subjects with renal dysfunction, at risk of Al toxicity. The design involves the source positioned on the central axis at one end of a cylindrical deuterium oxide moderator. The moderator is surrounded by a graphite reflector, with the hand inserted at the end of the moderator opposing the source. For a 1 mg {sup 252}Cf source, 15 cm long x 20 cm radius moderator and 20 cm thick reflector, the estimated minimum detection limit is .5 mg Al for a 20 min irradiation, with an equivalent dose of 16.5 mSv to the hand. Increasing the moderator length and/or introducing a fast neutron filter (for example silicon) further reduces interference from fast-neutron-induced reactions on phosphorus in bone, at the expense of decreased fluence of the thermal neutrons which activate Al. Increased source strengths may be necessary to compensate for this decreased thermal fluence, or allow measurements to be made within an acceptable time limit for the comfort of the patient. (author)

Functional design criteria for project W-252, phase II liquid effluent treatment and disposal. Revision 2

International Nuclear Information System (INIS)

Hatch, C.E.

1995-05-01

This document is the Functional Design Criteria for Project W-252. Project W-252 provides the scope to provide BAT/AKART (best available technology...) to 200 Liquid Effluent Phase II streams (B-Plant). This revision (Rev. 2) incorporates a major descoping of the project. The descoping was done to reflect a combination of budget cutting measures allowed by a less stringent regulatory posture toward the Phase II streams

Physical and biological dosimetries of Cf-252 radiation

International Nuclear Information System (INIS)

Yamashita, Hisao; Wada, Tadashi; Dokiya, Takushi; Hashimoto, Shozo

1986-01-01

Recently Cf-252 sources containing 300 μg have become available in a size identical to 1 Ci of Cs-137 and with the use of remotely controlled afterloading apparatus, safe therapy with little exposure to the therapist is now possible. Radiation leakage from the Cf-252 apparatus and from the treatment room was measured with REM-meter and it was possible to reduce the leakage from the treatment room to less than 1 mrem/h (gamma rays) and 0.5 mrem/h (neutrons). Measurement of fast neutrons was made with a twin chamber composed of a tissue equivalent ionization chamber and a carbon ionization chamber. The neutron dose in air and the absorbed dose in tissue equivalent water tank were measured, which showed that in air, neutrons were 70% and photons were 30% of dose. In water, greater distances from the source, neutrons attenuate and gamma rays increase in dose. The results of studies on the skin reaction of mice and sperm cleavage delay time of sea urchins indicated that the RBE ranges from 1.5 to 3.0 using the high dose rate system. Neutrons are remarkably affected by a time factor. With the use of high dose rate sources, the dose rate has become higher, but the overall time has been extended through dose fractionation and it was considered advisable to employ an RBE of 3-4 in these studies. (Auth.)

Operation manual for the INEL on-line mass-separator facility

International Nuclear Information System (INIS)

Anderl, R.A.

1984-06-01

This report is an operation manual for an on-line mass-separator facility which is located in Building 661 at the Test Reactor Area of the Idaho National Engineering Laboratory. The facility provides mass-separated sources of short-lived fission-product radionuclides whose decay properties can be studied using a variety of nuclear spectroscopic techniques. This facility is unique in that it utilizes the gas-jet technique to transport fission products from a 252 Cf source located in a hot cell to the ion source of the mass separator. This document includes the following: (a) a detailed description of the facility, (b) identification of equipment hazards and safety controls, (c) detailed operating procedures for startup, continuous operation and shutdown, (d) operating procedures for the californium hot cell, and (e) an operator's manual for the automated moving tape collector/data acquisition system. 7 references, 16 figures, 8 tables

Design and construction of an explosive detection system by Tna methods, using 252Cf radioisotope source

International Nuclear Information System (INIS)

Tavakkoli Farsouli, A.

1999-01-01

Bombs concealed in luggage have threatened human life and property throughout the world's traffic. The plastic explosives could not checked by the X-ray detecting device. Thermal Neutron Activation method has been tested in the present work for non-destructive detection of explosives. A radioisotope neutron source 252 Cf and two gamma spectroscopy systems have been used as a tool to find explosives, regardless of the bomb's shape and the packing materials. The MCNP code has been used to design the neutronic section of the system. The measured thermal neutron fluxes by the gold foils in some location of the system were in good agreement with those data obtained by the MCNP code. Also, detection limits for nitrogen in various counting times were measured. The measurements show that the system is capable to detect 417 gr of HMX explosive material (158 gr nitrogen) by 10 minutes of counting time. To modify the system and to decrease the detection limits some opinions are given

48 CFR 252.231-7000 - Supplemental cost principles.

Science.gov (United States)

2010-10-01

... principles. 252.231-7000 Section 252.231-7000 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.231-7000 Supplemental cost principles. As prescribed in 231.100-70, use the following clause: Supplemental Cost Principles (DEC 1991) When the allowability of costs under...

Transuranium Processing Plant semiannual report of production, status, and plans for period ending June 30, 1975

Energy Technology Data Exchange (ETDEWEB)

King, L.J.; Bigelow, J.E.; Collins, E.D.

1976-03-01

During the period January 1, 1975, through June 30, 1975, the following amounts of transuranium elements were recovered from 22 irradiated HFIR targets: 2g /sup 243/Am, 59 g /sup 244/Cm, 51 mg /sup 249/Bk, 465 mg /sup 252/Cf, 2.5 mg /sup 253/Es, and 1.4 pg /sup 257/Fm. In addition, 45 mg of high-purity /sup 248/Cm was operated from /sup 252/Cf which had been recovered and purified during earlier periods, and 56 mg of a lower-quality /sup 248/Cm was separated from californium purification rework solutions. Five HFIR targets, each containing approximately 9 g of actinides (predominantly curium), were fabricated. A new long-term projection showed that /sup 252/Cf production in the TRU-HFIR complex could increase to as much as 2.5 g/year. During the next 18 months, we expect to recover totals of 46 mg of /sup 249/Bk, 520 mg of /sup 252/Cf, 2.0 mg of /sup 253/Es (in a mixture of isotopes), 220 ..mu..g of high-purity /sup 253/Es, and 1.6 pg of /sup 257/Fm. We also expect to obtain 125 mg of high-purity /sup 248/Cm from purified californium now in storage. There are no plans to process any of the remaining SRP Pu-Al tubes or to irradiate any plutonium targets in the HFIR; thus, we do not expect to recover any /sup 244/Pu. No changes were made in the chemical processing flowsheets normally used at TRU. Two neutron sources were fabricated, bringing the total fabricated to 77. In special projects, we (1) produced about 1 mg of /sup 250/Cf by irradiation of /sup 249/Bk in HFIR rabbits, and (2) processed some irradiated /sup 248/Cm samples and obtained yield and isotopic composition data for use in determining the capture cross section of /sup 249/Cm in the HFIR. The values that are currently being used for transuranium element decay data and for cross-section data in planning irradiation-processing cycles, calculating production forecasts, and assaying products are tabulated in the Appendix.

Sensitivity Analysis of Cf-252 (sf) Neutron and Gamma Observables in CGMF

Energy Technology Data Exchange (ETDEWEB)

Carter, Austin Lewis [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Talou, Patrick [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Stetcu, Ionel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kiedrowski, Brian Christopher [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Jaffke, Patrick John [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-12-06

CGMF is a Monte Carlo code that simulates the decay of primary fission fragments by emission of neutrons and gamma rays, according to the Hauser-Feshbach equations. As the CGMF code was recently integrated into the MCNP6.2 transport code, great emphasis has been placed on providing optimal parameters to CGMF such that many different observables are accurately represented. Of these observables, the prompt neutron spectrum, prompt neutron multiplicity, prompt gamma spectrum, and prompt gamma multiplicity are crucial for accurate transport simulations of criticality and nonproliferation applications. This contribution to the ongoing efforts to improve CGMF presents a study of the sensitivity of various neutron and gamma observables to several input parameters for Californium-252 spontaneous fission. Among the most influential parameters are those that affect the input yield distributions in fragment mass and total kinetic energy (TKE). A new scheme for representing Y(A,TKE) was implemented in CGMF using three fission modes, S1, S2 and SL. The sensitivity profiles were calculated for 17 total parameters, which show that the neutron multiplicity distribution is strongly affected by the TKE distribution of the fragments. The total excitation energy (TXE) of the fragments is shared according to a parameter RT, which is defined as the ratio of the light to heavy initial temperatures. The sensitivity profile of the neutron multiplicity shows a second order effect of RT on the mean neutron multiplicity. A final sensitivity profile was produced for the parameter alpha, which affects the spin of the fragments. Higher values of alpha lead to higher fragment spins, which inhibit the emission of neutrons. Understanding the sensitivity of the prompt neutron and gamma observables to the many CGMF input parameters provides a platform for the optimization of these parameters.

Neutron source for a reactor

International Nuclear Information System (INIS)

Kobayashi, Hiromasa.

1975-01-01

Object: To easily increase a start-up power of a reactor without irradiation in other reactors. Structure: A neutron source comprises Cf 252 , a natural antimony rod, a layer of beryllium, and a vessel of neutron source. On upper and lower portion of Cf 252 are arranged natural antimony rods, which are surrounded by the Be layer, the entirety being charged into the vessel. The Cf 252 may emit neutron, has a half life more than a period of operating cycle of the reactor and is less deteriorated even irradiated by radioactive rays while being left within the reactor. The natural antimony rod is radioactivated by neutron from Cf 252 and neutron as reactor power increases to emit γ rays. The Be absorbs γ rays to emit the neutron. The antimony rod is irradiated within the reactor. Further, since the Cf 252 is small in neutron absorption cross section, it is hard to be deteriorated even while being inserted within the reactor. (Kamimura, M.)

46 CFR 252.33 - Hull and machinery insurance.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 252.33 Section 252.33... Subsidy Rates § 252.33 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery, increased value, excess general average...

Optimization of in situ prompt gamma-ray analysis using a HPGe-252Cf probe

International Nuclear Information System (INIS)

Chien Chung; Jiunnhsing Chao

1991-01-01

Application of in situ measurements by the neutron-induced prompt gamma-ray activation analysis (PGAA) technique to geochemical analysis and mineral survey have been investigated. An in situ survey of water pollutants by PGAA techniques was first proposed in the authors' previous study, where a 2.7-μg 252 Cf neutron source used in connection with a gamma-ray detecting system to determine water pollutants was described. In this paper the authors describe a modified detection probe designed and constructed to look for the optimum conditions of various-intensity 252 Cf neutron sources in measurement of some elements in lake water. Detecting efficiencies at high-energy regions and detection limits for elements commonly found in polluted lakes were evaluated and predicted to investigate the potential application of the probe for in situ measurements

Brachytherapy of carcinoma of vulva with 252Cf

International Nuclear Information System (INIS)

Spikalovas, V.; Sinkevicius, V.; Drulia, E.; Kurtinaitis, J.

1996-01-01

Thirty patients with carcinoma of vulva were treated with interstitial neutron radiotherapy with 252 Cf. Age of patients was from 32 to 83 years. Stage I was in I patient, stage II - in 12, stage III was in 10 patients. The diagnosis of vulvar cancer was made for the first time in 11 cases, 19 patients had recurrences after the initial treatment. Most of these patients also received external irradiation for cancer of vulva and bilateral inguinal sites with a single fraction dose of 2 Gy to a total dose 30-50 Gy. Enlarged inguinal lymph nodes were irradiated additionally to 60 Gy with reduced field of irradiation. When radiotherapy was used repeatedly interstitial brachytherapy comprised the major part of irradiation dose or the therapy was used alone delivering 35-55 iGy. We used 252 Cf sources with increased activity at the ends 20-30 mm long. A number of inserted sources varied from 2 to 10, irradiation dose rate from 20.3 to 236.7 cGy/h, time of irradiation from 10.2 to 12. hours, RBE from 4.6 to 6.33. Special template device made it possible to implant sources in strictly pre-set geometry. Analysis of survival of patients showed that 2 years survival was 66%, 3 years - 60%, and 5 years survival was 49%. In two cases necrotic epithelitis developed with following radiation ulcer which were cured in 3-4 months. Clinical data showed great effectiveness of interstitial neutron therapy having in mind that 19 patients were treated for recurrences of vulvar cancer after previuos treatment

Development of neutron induced prompt γ-ray spectroscopy system using 252Cf

International Nuclear Information System (INIS)

Park, Yong-Joon; Song, Byung-Chul; Jee, Kwang-Yong

2003-01-01

For the design and set-up of neutron induced prompt γ-ray spectroscopy system using 252 Cf neutron source, the effects of shielding and moderator materials have been examined. The 252 Cf source being used for TLD badge calibration in Korea Atomic Energy Research Institute was utilized for this preliminary experiment. The γ-ray background and prompt γ-ray spectrum of the sample containing Cl were measured using HPGe (GMX 69% relative efficiency) located at the inside of the system connected to notebook PC at the outside of the system (about 20 meter distance). The background activities of neutron and γ-rays were measured with neutron survey meter as well as γ-ray survey meters, respectively and the system was designed to minimize the activities. Prompt γ-ray spectrum was measured using γ-γ coincident system for reduce the background and the continuum spectrum. The optimum system was designed and set up using the experimental data obtained

48 CFR 252.217-7010 - Performance.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance. 252.217-7010... Clauses 252.217-7010 Performance. As prescribed in 217.7104(a), use the following clause: Performance (JUL..., scrap or other ship's material of the Government resulting from performance of the work as items of...

A 252Cf based nondestructive assay system for fissile material

International Nuclear Information System (INIS)

Menlove, H.O.; Crane, T.W.

1978-01-01

A modulated 252 Cf source assay system 'Shuffler' based on fast-or-thermal-neutron interrogation combined with delayed-neutron counting has been developed for the assay of fissile material. The 252 Cf neutron source is repetitively transferred from the interrogation position to a shielded position while the delayed neutrons are counted in a high efficiency 3 He neutron well-counter. For samples containing plutonium, this well-counter is also used in the passive coincidence mode to assay the effective 240 Pu content. The design of an optimized neutron tailoring assembly for fast-neutron interrogation using a Monte Carlo Neutron Computer Code is described. The Shuffler system has been applied to the assay of fuel pellets, inventory samples, irradiated fuel and plutonium mixed-oxide fuel. The system can assay samples with fissile contents from a few milligrams up to several kilograms using thermal-neutron interrogation for the low mass samples and fast-neutron interrogation for the high mass samples. Samples containing 235 U- 238 U, or 233 U-Th, or UO 2 -PuO 2 fuel mixtures have been assayed with the Shuffler system. (Auth.)

Make or Buy: A Systematic Approach to Department of Defense Sourcing Decisions

Science.gov (United States)

2013-07-30

law (31 U.S.C. 1104(b)). OMB Circular A-11 lays out five broad object classes:  10 – Personal compensation and benefits  20 – Contractual services ...Rental payments to others (land/structures) Overhead Information Technology 2331 Telephone Services and Equipment 23.3 Communications ...Equipment Overhead Information Technology 252G Audiovisual Production and Services . 25.2 Other Services Overhead Information Technology 252H

A fast neutron and dual-energy gamma-ray absorption method (NEUDEG) for investigating materials using a 252Cf source

International Nuclear Information System (INIS)

Bartle, C. Murray

2014-01-01

DEXA (dual-energy X-ray absorption) is widely used in airport scanners, industrial scanners and bone densitometers. DEXA determines the properties of materials by measuring the absorption differences of X-rays from a bremsstrahlung tube source with and without filtering. Filtering creates a beam with a higher mean energy, which causes lower material absorption. The absorption difference between measurements (those with a filter subtracted from those without a filter) is a positive number that increases with the effective atomic number of the material. In this paper, the concept of using a filter to create a dual beam and an absorption difference in materials is applied to radiation from a 252 Cf source, called NEUDEG (neutron and dual-energy gamma absorption). NEUDEG includes absorptions for fast neutrons as well as the dual photon beams and thus an incentive for developing the method is that, unlike DEXA, it is inherently sensitive to the hydrogen content of materials. In this paper, a model for the absorption difference and absorption sum in NEUDEG is presented using the combined gamma ray and fast neutron mass attenuation coefficients. Absorption differences can be either positive or negative in NEUDEG, increasing with increases in the effective atomic number and decreasing with increases in the hydrogen content. Sample sets of absorption difference curves are calculated for materials with typical gamma-ray and fast neutron mass attenuation coefficients. The model, which uses tabulated mass attenuated coefficients, agrees with experimental data for porcelain tiles and polyethylene sheets. The effects of “beam hardening” are also investigated. - Highlights: • Creation of a dual neutron/gamma beam from 252 Cf is described. • An absorption model is developed using mass attenuation coefficients. • A graphical method is used to show sample results from the model. • The model is successfully compared with experimental results. • The importance of

Time domain measurements for fast metal assemblies with /sup 252/Cf

Energy Technology Data Exchange (ETDEWEB)

Mihalczo, J T

1975-06-01

Time correlation measurements between the pulses from an ionization counter containing a /sup 252/Cf neutron source, which provided the initiators of fission chains in a neutron multiplying assembly and from sensors that detected particles from the fission chains are reviewed for fast uranium or plutonium metal assemblies. Comparisons are made between the correlated count rate from a /sup 252/Cf measurement and that from both one and two-detector Rossi-..cap alpha.. measurements. The assemblies studied were (1) unmoderated and polyethylene-moderated uranium (93 wt percent /sup 235/U) cylinders with masses from 12 to 160 kg; prompt neutron decay constants from 3 to 10/sup 3/ to 10/sup 8/ sec/sup -1/ and (2) unmoderated plutonium spheres and parts of spheres with plutonium masses from 2.2 to 16 kg with /sup 240/Pu contents of 4.5 to 20.1 at. percent. Measurements with a delayed critical uranium metal sphere determined the effective delayed neutron fraction and served as the basis for verification of the theory of the /sup 252/Cf measurement method in the time domain within a few per cent. (auth)

48 CFR 252.217-7009 - Default.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Default. 252.217-7009... Clauses 252.217-7009 Default. As prescribed in 217.7104(a), use the following clause: Default (DEC 1991... of default to the Contractor, terminate the whole or any part of a job order if the Contractor fails...

Cf-252 based neutron radiography using real-time image processing system

International Nuclear Information System (INIS)

Mochiki, Koh-ichi; Koiso, Manabu; Yamaji, Akihiro; Iwata, Hideki; Kihara, Yoshitaka; Sano, Shigeru; Murata, Yutaka

2001-01-01

For compact Cf-252 based neutron radiography, a real-time image processing system by particle counting technique has been developed. The electronic imaging system consists of a supersensitive imaging camera, a real-time corrector, a real-time binary converter, a real-time calculator for centroid, a display monitor and a computer. Three types of accumulated NR image; ordinary, binary and centroid images, can be observed during a measurement. Accumulated NR images were taken by the centroid mode, the binary mode and ordinary mode using of Cf-252 neutron source and those images were compared. The centroid mode presented the sharpest image and its statistical characteristics followed the Poisson distribution, while the ordinary mode showed the smoothest image as the averaging effect by particle bright spots with distributed brightness was most dominant. (author)

40 CFR 265.252 - Waste analysis.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.252 Section 265... FACILITIES Waste Piles § 265.252 Waste analysis. In addition to the waste analyses required by § 265.13, the... in the pile to which it is to be added. The analysis conducted must be capable of differentiating...

48 CFR 252.236-7000 - Modification proposals-price breakdown.

Science.gov (United States)

2010-10-01

...-price breakdown. 252.236-7000 Section 252.236-7000 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.236-7000 Modification proposals—price breakdown. As prescribed in 236.570(a), use the following clause: Modification Proposals—Price Breakdown (DEC 1991) (a) The...

48 CFR 252.217-7002 - Offering property for exchange.

Science.gov (United States)

2010-10-01

... exchange. 252.217-7002 Section 252.217-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.217-7002 Offering property for exchange. As prescribed in 217.7005, use the following provision: Offering Property for Exchange (DEC 1991) (a) The property described in item...

Subcriticality determination by a new time-domain correlation experiment with a 252Cf neutron source

International Nuclear Information System (INIS)

Nishina, K.; Yamane, Y.; Ishiguro, S.; Miyoshi, Y.; Suzaki, T.; Kobayahi, I.

1985-01-01

As a candidate for the on-site subcriticality-monitoring method, a new time-domain correlation experiment is proposed. Hinted by the Cf-252 detector method of Mihalczo, three covariances are taken between the count of three detectors; namely an ionization chamber with Cf-252 coating, and two He-3 proportional counters. A ratio Q is formed from the three quantities such that it does not depend either on detector efficiencies or counting gate duration T, and then related to reactivity. A formulation is given deriving a theoretical expression for this Q, with the effect of higher spatial modes included. Experiments were carried out with a loading at Tank-type Critical Assembly of Japan Atomic Energy Research Institute, which is a slightly-enriched, and light-water moderated system. With fundamental mode approximation adopted in the data processing, reasonable agreements are observed between the present method and the reactivity scale that has been calibrated by water-level variety. The possibility of the present method is to be investigated further beyond the range of 7$ reported

Transuranium Processing Plant semiannual report of production, status, and plans for period ending December 31, 1976

International Nuclear Information System (INIS)

King, L.J.; Bigelow, J.E.; Collins, E.D.

1977-10-01

During the period July 1, 1976, through December 31, 1976, transuranium elements were obtained from 11 irradiated HFIR targets; products recovered are 0.3 g 243 Am, 16.6 g 244 Cm, 23 g 249 Bk, 211 g 252 Cf, 1.15 mg 253 Es, and 0.4 pg 247 Fm. Two batches of high-purity 248 Cm were purified chemically for shipment, and another batch containing about 62 mg of 248 Cm was separated from 252 Cf. Thirty shipments were made from TRU during the period; recipients and the amounts of nuclides are listed in tabular form. Nine HFIR targets, each containing 8 to 9 g of curium, were fabricated. The sequence of chemical processing steps used to purify the californium product was changed; this change yielded a shorter recovery time for high-purity 253 Es, which enabled a 50% increase in the amount obtained. Eight neutron sources were fabricated during this report period, bringing the total fabricated to date to 92. Three sources that had previously been returned to TRU were reassigned; two others are also available for reassignment. The values currently being used for transuranium element decay data and for cross-section data in planning irradiation-processing cycles, calculating production forecasts, and assaying products are tabulated in the Appendix

46 CFR 252.31 - Wages of officers and crews.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Wages of officers and crews. 252.31 Section 252.31... Subsidy Rates § 252.31 Wages of officers and crews. (a) Definitions. When used in this part: (1) Base period. The first base period under the wage index systems, as provided in section 603 of the Act, is the...

Nuclear assay of coal. Volume 8. Continuous nuclear assay of coal (CONAC). Final report

International Nuclear Information System (INIS)

Lagarias, J.; Irminger, P.; Dodson, W.

1979-01-01

Using californium-252 as a source of exciting neutrons, prompt gamma photons emitted by elemental nuclei in the coal have been measured using several detectors, including sodium-iodide and germanium-lithium. Several coal types, including bituminous, subbituminous lignite and anthracite were crushed to various top sizes and analyzed carefully by traditional ASTM wet chemistry techniques at two or three different laboratories. The elements (sulfur, hydrogen, carbon, aluminum, silicon, iron, calcium, sodium, nitrogen, and chlorine) were determined by prompt neutron activations and the quantities compared with those of the wet chemical analyses. Since satisfactory correlation has been obtained at bench-scale level using 100 to 200 kG samples, an apparatus has been designed to analyze a coal stream of up to 50 ton/hour, at an electric power generating station

48 CFR 252.237-7011 - Preparation history.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Preparation history. 252... Provisions And Clauses 252.237-7011 Preparation history. As prescribed in 237.7003(b), use the following clause: Preparation History (DEC 1991) For each body prepared, or for each casket handled in a group...

48 CFR 252.217-7016 - Plant protection.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Plant protection. 252.217... Clauses 252.217-7016 Plant protection. As prescribed in 217.7104(a), use the following clause: Plant Protection (DEC 1991) (a) The Contractor shall provide, for the plant and work in process, reasonable...

48 CFR 252.227-7000 - Non-estoppel.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Non-estoppel. 252.227-7000... Clauses 252.227-7000 Non-estoppel. As prescribed at 227.7009-1, insert the following clause in patent releases, license agreements, and assignments: Non-Estoppel (OCT 1966) The Government reserves the right at...

Determination of the multiplication factor and its bias by the 252Cf-source technique: A method for code benchmarking with subcritical configurations

International Nuclear Information System (INIS)

Perez, R.B.; Valentine, T.E.; Mihalczo, J.T.; Mattingly, J.K.

1997-01-01

A brief discussion of the Cf-252 source driven method for subcritical measurements serves as an introduction to the concept and use of the spectral ratio, Γ. It has also been shown that the Monte Carlo calculation of spectral densities and effective multiplication factors have as a common denominator the transport propagator. This commonality follows from the fact that the Neumann series expansion of the propagator lends itself to the Monte Carlo method. On this basis a linear relationship between the spectral ratio and the effective multiplication factor has been shown. This relationship demonstrates the ability of subcritical measurements of the ratio of spectral densities to validate transport theory methods and cross sections

48 CFR 252.217-7001 - Surge option.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Surge option. 252.217-7001... Clauses 252.217-7001 Surge option. As prescribed in 217.208-70(b), use the following clause: Surge Option (AUG 1992) (a) General. The Government has the option to— (1) Increase the quantity of supplies or...

48 CFR 252.225-7025 - Restriction on acquisition of forgings.

Science.gov (United States)

2010-10-01

... of forgings. 252.225-7025 Section 252.225-7025 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.225-7025 Restriction on acquisition of forgings. As prescribed in 225.7102-4, use the following clause: Restriction on Acquisition of Forgings (DEC 2009) (a...

48 CFR 252.225-7031 - Secondary Arab boycott of Israel.

Science.gov (United States)

2010-10-01

... Israel. 252.225-7031 Section 252.225-7031 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.225-7031 Secondary Arab boycott of Israel. As prescribed in 225.7605, use the following provision: Secondary Arab Boycott of Israel (JUN 2005) (a) Definitions. As used in...

24 CFR 92.252 - Qualification as affordable housing: Rental housing.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Qualification as affordable housing: Rental housing. 92.252 Section 92.252 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HOME INVESTMENT PARTNERSHIPS PROGRAM Project Requirements § 92.252...

48 CFR 252.235-7011 - Final scientific or technical report.

Science.gov (United States)

2010-10-01

... technical report. 252.235-7011 Section 252.235-7011 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.235-7011 Final scientific or technical report. As prescribed in 235.072(d), use the following clause: Final Scientific or Technical Report (NOV 2004) The Contractor...

{sup 5}He ternary fission yields of {sup 252}Cf and {sup 235}U(n,f)

Energy Technology Data Exchange (ETDEWEB)

Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Ramayya, A. V. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Hamilton, J. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Beyer, C. J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Kormicki, J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Zhang, X. Q. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Rodin, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Formichev, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Kliman, J. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Krupa, L. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation)] (and others)

2000-04-01

The relative {sup 4}He and {sup 5}He ternary fission yields were determined from a careful analysis of the energy distribution of {alpha} spectra from a new measurement with a {sup 252}Cf source and from published data on {sup 252}Cf and {sup 235}U(n,f). The kinetic energies of the {sup 5}He and {sup 4}He ternary particles were found to be approximately 11 and 16 MeV, respectively. {sup 5}He particles contribute 10-20 % to the total alpha yield with the remainder originating from {sup 4}He accompanied fission. (c) 2000 The American Physical Society.

48 CFR 252.235-7002 - Animal welfare.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Animal welfare. 252.235... Clauses 252.235-7002 Animal welfare. As prescribed in 235.072(a), use the following clause: Animal Welfare... animals only from dealers licensed by the Secretary of Agriculture under 7 U.S.C. 2133 and 9 CFR subpart A...

48 CFR 252.229-7001 - Tax relief.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the United...

The fast neutron emission spectrum of 252-Cf

International Nuclear Information System (INIS)

Bensch, F.

1979-07-01

The aim of this work was a new measurement of the neutron emission spectrum of 252-Cf neutron standard sources as the IAEA is offering to users. The main feature was the application of gas-filled proton-recoil spectrometers and no TOF technique. The special interest of this document was in the temperature parameter of the Maxwellian distribution and in its relative deviations. In this connection, special measurements with high energy resolution were carried out in a search for fine structure neutron groups, which have been observed in some TOF measurements, but could not be reproduced during this measurement

Clinical measurements of part-body calcium using neutron activation analysis

International Nuclear Information System (INIS)

Tothill, P.; Smith, M.A.; Simpson, J.D.; Chew, I.; MacPherson, J.N.; Winney, R.J.; Strong, J.A.

1979-01-01

Californium-252 sources have been used in a clinical environment for neutron activation analysis studies for a period of 2 1/2 years. During this period, changes in bone calcium in response to different treatment regimes have been measured in patients suffering from primary or secondary bone disease. The first measurements were performed on peripheral bone, in particular the forearm, using two sources of 252 Cf, minimum total activity 56mCi, for bilateral irradiation and two 15cmx10cm NaI crystals for detection. Optimization of the irradiation geometry and the patient irradiation programme enabled measurements to be performed with a precision of 1.6% and a dose of 3 rem. The precision estimate was based on 64 sets of repeated patient measurements and included errors due to patient movement. Apparatus was also developed to measure changes of calcium in the lumbar spine, particular attention being devoted to obtaining uniformity of sensitivity in the vertebrae. Unilateral irradiation with two 252 Cf sources, activity 100mCi each, separated by 20cm, and detection in whole-body counter with four 15cmx10cm NaI detectors gave a precision of 2% based on repeated measurements of 10 patients, with a dose of 1.3 rem to the spine and 10 rem to the skin surface. The following studies were undertaken: the effect of 1 α-hydroxycholecalciferol on 19 patients undergoing chronic haemodialysis, the use of vitamin D 2 and vitamin D 3 in the treatment of 33 patients with potential anticonvulsant osteomalacia, the effect of lithium carbonate in 20 patients with manic depression and the efficacy of conventional treatments in combating thyrotoxic osteodystrophy. (author)

Cross-sections of 197Au(n,α)198Au and 63Cu(n,α)64Cu induced by 252Cf neutrons

International Nuclear Information System (INIS)

Mandal, Ranjita; Sengupta, D.; Roy, Malobika; Naik, Mamta; Bhoraskar, V.N.

2014-01-01

Analytical work, employing nuclear techniques, is normally carried out through (n,α) reaction because of the availability of neutrons either from reactors or laboratory sources such as Sb-Be, Am-Be, Ra-Be, Po-Be, 252 Cf, etc. The laboratory neutron sources are though portable and adaptable to a particular experimental arrangement, suffer from the disadvantage of slow neutron yield (except 252 Cf). In this set up since the neutrons available are monoenergetic, it was thought appropriate to initiate a program to measure cross-sections of a few nuclear reactions which have practical applications. Earlier studies on cross-section measurement of the reaction 197 Au(n,α) 198 Au and 63 Cu(n,α) 64 Cu has been carried out using different sources, monitors and techniques

Ion Source Physics and Technology (1/2)

CERN Multimedia

CERN. Geneva

2016-01-01

This series of lectures starts with an introduction in some aspects of atomic and plasma physics as base for the ion source physics. The main part covers aspects of ion source physics, technology and operation. Several source types are presented. Some information on infrastructure and supporting services (as high voltage, cooling, microwaves etc) are given to better understand the source environment. The last part on engineering aims to show that, in the field of ion sources, many different technologies are combined in a quite small environment, which is challenging and interesting at the same time.

Ion Source Physics and Technology (2/2)

CERN Multimedia

CERN. Geneva

2016-01-01

This series of lectures starts with an introduction in some aspects of atomic and plasma physics as base for the ion source physics. The main part covers aspects of ion source physics, technology and operation. Several source types are presented. Some information on infrastructure and supporting services (as high voltage, cooling, microwaves etc) are given to better understand the source environment. The last part on engineering aims to show that, in the field of ion sources, many different technologies are combined in a quite small environment, which is challenging and interesting at the same time.

Burnout and gate rupture of power MOS transistors with fission fragments of 252Cf

International Nuclear Information System (INIS)

Tang Benqi; Wang Yanping; Geng Bin; Chen Xiaohua; He Chaohui; Yang Hailiang

2000-01-01

A study to determine the single event burnout (SEB) and single event gate rupture (SEGR) sensitivities of power MOSFET devices is carried out by exposure to fission fragments from 252 Cf source. The test method, test results, a description of observed burnout current waveforms and a discussion of a possible failure mechanism are presented. The test results include the observed dependence upon applied drain or gate to source bias and effect of external capacitors and limited resistors

Technological regimes and sources of entrepreneurship

NARCIS (Netherlands)

Marsili, O.

2000-01-01

This paper concerns the technological detenninants of entrepreneurial behaviour. By applying a typology of technological regimes, which describes the nature of the technological environment in which finns operate, this paper examines the sources and obstacle to entrepreneurial entry related to the

Technological regimes and sources of entrepreneurship

NARCIS (Netherlands)

Marsili, O.

2002-01-01

This paper concerns the technological determinants of entrepreneurial behaviour. By applying a typology of technological regimes, which describes the nature of the technological environment in which firms operate, this paper examines the sources and obstacles to entrepreneurial entry related to the

Charge breeding of radioactive isotopes at the CARIBU facility with an electron beam ion source

Science.gov (United States)

Vondrasek, R. C.; Dickerson, C. A.; Hendricks, M.; Ostroumov, P.; Pardo, R.; Savard, G.; Scott, R.; Zinkann, G.

2018-05-01

An Electron Beam Ion Source Charge Breeder (EBIS-CB) has been developed at Argonne National Laboratory as part of the californium rare ion breeder upgrade. For the past year, the EBIS-CB has been undergoing commissioning as part of the ATLAS accelerator complex. It has delivered both stable and radioactive beams with A/Q 18% into a single charge state. The operation of this device, challenges during the commissioning phase, and future improvements will be discussed.

Source Taxation of Technological Services in Finnish Tax Treaties

OpenAIRE

Kiviranta, Tuomas

2016-01-01

In this study, I analyze the various means of source taxation of technological and other services permitted by Finnish double taxation conventions and the future of source taxation of technological and other services. I attempt to shed light on the various means of source taxation of technological services permitted by Finnish tax treaties and by tax treaties also more generally. I analyze 1) the taxation of technological services in the source country as the profits of a permanent establishm...

Utilization of radiation facilities at TNRC for shielding researches and related topics

Energy Technology Data Exchange (ETDEWEB)

Akki, T S [Physics Department, Nuclear Physics and Radiation Shielding Division Tajura Nuclear Research Center, Tripoli (Libyan Arab Jamahiriya)

1997-12-31

This paper presents the running shielding research activities at Tajura Nuclear research center. The main area of researches are concentrated on the investigation of different types of concrete made from local materials such as conventional concrete, Magnetite-Limonite concrete, and heat resistant concrete. The measuring techniques used were neutron-gamma spectrometry, and activation foils. The measurements were performed using collimated beam of reactor neutrons emitted from one of the horizontal channels, as well as from californium-252 neutron source. The transmitted neutron spectra through concrete barriers of different thicknesses were measured by a scintillation spectrometer with NE-213 liquid organic scintillator. A non-destructive testing of some reactor materials were also carried out using neutron and gamma ray computerized tomography technique (CT). Some experiments were also carried out related to measurements of neutron depth dose distributions inside tissue equivalent materials. 10 figs.

48 CFR 252.222-7002 - Compliance with local labor laws (overseas).

Science.gov (United States)

2010-10-01

... labor laws (overseas). 252.222-7002 Section 252.222-7002 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7002 Compliance with local labor laws (overseas). As prescribed in 222.7201(a), use the following clause: Compliance with Local Labor Laws (Overseas) (JUN 1997...

24 CFR 252.6 - Method of payment of mortgage insurance premiums.

Science.gov (United States)

2010-04-01

... insurance premiums. 252.6 Section 252.6 Housing and Urban Development Regulations Relating to Housing and..., AND BOARD AND CARE HOMES § 252.6 Method of payment of mortgage insurance premiums. The provisions of..., DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT...

24 CFR 236.252 - First, second, and third mortgage insurance premiums.

Science.gov (United States)

2010-04-01

... insurance premiums. 236.252 Section 236.252 Housing and Urban Development Regulations Relating to Housing... insurance premiums. All of the provisions of § 207.252 of this chapter governing the first, second, and third mortgage insurance premiums shall apply to mortgages insured under this subpart, except: (a) Where...

Ternary-fragmentation-driving potential energies of 252Cf

Science.gov (United States)

Karthikraj, C.; Ren, Zhongzhou

2017-12-01

Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.

Dosimetric analysis of BNCT - Boron Neutron Capture Therapy - coupled to 252Cf brachytherapy

International Nuclear Information System (INIS)

Brandao, Samia F.; Campos, Tarcisio P.R.

2009-01-01

The incidence of brain tumors is increasing in world population; however, the treatments employed in this type of tumor have a high rate of failure and in some cases have been considered palliative, depending on histology and staging of tumor. Its necessary to achieve the control tumor dose without the spread irradiation cause damage in the brain, affecting patient neurological function. Stereotactic radiosurgery is a technique that achieves this; nevertheless, other techniques that can be used on the brain tumor control must be developed, in order to guarantee lower dose on health surroundings tissues other techniques must be developing. The 252 Cf brachytherapy applied to brain tumors has already been suggested, showing promising results in comparison to photon source, since the active source is placed into the tumor, providing greater dose deposition, while more distant regions are spared. BNCT - Boron Neutron Capture Therapy - is another technique that is in developing to brain tumors control, showing theoretical superiority on the rules of conventional treatments, due to a selective irradiation of neoplasics cells, after the patient receives a borate compound infusion and be subjected to a epithermal neutrons beam. This work presents dosimetric studies of the coupling techniques: BNCT with 252 Cf brachytherapy, conducted through computer simulation in MCNP5 code, using a precise and well discretized voxel model of human head, which was incorporated a representative Glioblastoma Multiform tumor. The dosimetric results from MCNP5 code were exported to SISCODES program, which generated isodose curves representing absorbed dose rate in the brain. Isodose curves, neutron fluency, and dose components from BNCT and 252 Cf brachytherapy are presented in this paper. (author)

In situ prompt gamma-ray activation analysis of water pollutants using a shallow 252Cf-HPGe probe

International Nuclear Information System (INIS)

Chung Chien; Tseng Tzucheng

1988-01-01

A shallow 252 Cf-HPGe probe used for in situ prompt γ-ray activation of water pollutants is described. A 2.7 μg 252 Cf neutron source and a 10% HPGe detector are inserted into a waterproof stainless steel probe, which is designed to be submerged and recovered in field operation. A laboratory test is performed to obtain the neutron flux distribution and prompt γ-ray contribution to the HPGe detector counts from around the submerged probe. The concentrations of toxic cadmium and chlorine in water are determined in the prompt γ-ray spectrum. The detection limit of industrial pollutants and some improvements of the current design are discussed. (orig.)

Gamma-ray multiplicity measurement of the spontaneous fission decay of 252Cf in a segmented HPGe/BGO detector array

Energy Technology Data Exchange (ETDEWEB)

Bleuel, D L; Bernstein, L A; Burke, J T; Gibelin, J; Heffner, M D; Mintz, J; Norman, E B; Phair, L; Scielzo, N D; Sheets, S A; Snyderman, N J; Stoyer, M A; Wiedeking, M

2008-04-23

Coincident {gamma} rays from a {sup 252}Cf source were measured using an array of six segmented high-purity germanium (HPGe) Clover detectors each enclosed by 16 bismuth-germanate (BGO) detectors. The detectors were arranged in a cubic pattern around a 1 {micro}Ci {sup 252}Cf source to cover a large solid angle for {gamma}-ray measurement with a reasonable reconstruction of the multiplicity. Neutron multiplicity was determined in certain cases by identifying the prompt {gamma} rays from individual fission fragment pairs. Multiplicity distributions from previous experiments and theoretical models were convolved with the response function of the array and compared to the present results. These results suggest a {gamma}-ray multiplicity spectrum broader than previous measurements and models, and provide no evidence of correlation with neutron multiplicity.

Vacuum Technology for Ion Sources

International Nuclear Information System (INIS)

Chiggiato, P

2013-01-01

The basic notions of vacuum technology for ion sources are presented, with emphasis on pressure profile calculation and choice of pumping technique. A Monte Carlo code (Molflow+) for the evaluation of conductances and the vacuum-electrical analogy for the calculation of time-dependent pressure variations are introduced. The specific case of the Linac4 H - source is reviewed. (author)

7 CFR 766.252 - Unauthorized assistance resulting from submission of false information.

Science.gov (United States)

2010-01-01

... false information. 766.252 Section 766.252 Agriculture Regulations of the Department of Agriculture... Unauthorized Assistance § 766.252 Unauthorized assistance resulting from submission of false information. A... behalf, submits information to the Agency that the borrower knows to be false. ...

Application of modular neutron spectrometer to measure neutron spectra from fission of 252Cf

International Nuclear Information System (INIS)

Szeflinski, Z.; Osuch, S.; Popkiewicz, M.; Wilhelmi, Z.; Zelazny, Z.

1996-01-01

The neutron spectrometer MONA (Modular Neutron Array) and its test has been described. The spectrometers consist of eight BC-501A liquid scintillator detectors of BICRON which allow one to distinguish between the pulses from gamma quanta and neutrons using pulse shape discrimination (PSD) method. The electronic equipment for the PSD and the test result using the 252 Cf radioactive source are presented

Feasibility of subcriticality and NDA measurements for spent fuel by frequency analysis techniques with 252Cf

International Nuclear Information System (INIS)

Mihalczo, J.T.; Valentine, T.E.; Mattingly, J.K.

1996-01-01

The 252 Cf-source-driven frequency analysis method can be used for measuring the subcritical neutron multiplication factor of arrays of LWR fuel and as little as a single PWR fuel assembly. These measurements can be used to verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. In addition, the data can be used to validate calculational methods for criticality safety. These measurements provide parameters that have a higher sensitivity to changes in fissile mass than neutron multiplication factor and thus serve as a better test of calculational methods. The analysis have also shown that measurement of the cross power spectral density (CPSD) between detectors on one side of a single fuel assembly and an internal or external 252 Cf source driving the fission chain multiplication process can be used for nondestructive assay of fissile mass along the length of the assembly. This CPSD is a smooth function of fissile mass and does not depend on the varying inherent source in the fuel assembly and thus is ideal for fissile mass assay

46 CFR 252.23 - Financial and other reporting requirements.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Financial and other reporting requirements. 252.23... SERVICES Operation § 252.23 Financial and other reporting requirements. (a) Voyage report. The operator... total loss covered by a policy of insurance. (d) Financial statements. The operator shall submit, in...

Extraction of Trivalent Actinides and Lanthanides from Californium Campaign Rework Solution Using TODGA-based Solvent Extraction System

Energy Technology Data Exchange (ETDEWEB)

Benker, Dennis [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dryman, Joshua Cory [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2017-07-01

This report presents the studies carried out to demonstrate the possibility of quantitatively extracting trivalent actinides and lanthanides from highly acidic solutions using a neutral ligand-based solvent extraction system. These studies stemmed from the perceived advantage of such systems over cationexchange- based solvent extraction systems that require an extensive feed adjustment to make a low-acid feed. The targeted feed solutions are highly acidic aqueous phases obtained after the dissolution of curium targets during a californium (Cf) campaign. Results obtained with actual Cf campaign solutions, but highly diluted to be manageable in a glove box, are presented, followed by results of tests run in the hot cells with Cf campaign rework solutions. It was demonstrated that a solvent extraction system based on the tetraoctyl diglycolamide molecule is capable of quantitatively extracting trivalent actinides from highly acidic solutions. This system was validated using actual feeds from a Cf campaign.

48 CFR 252.204-7001 - Commercial and Government Entity (CAGE) code reporting.

Science.gov (United States)

2010-10-01

... Entity (CAGE) code reporting. 252.204-7001 Section 252.204-7001 Federal Acquisition Regulations System... Entity (CAGE) Code Reporting (AUG 1999) (a) The offeror is requested to enter its CAGE code on its offer... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.204-7001 Commercial and Government Entity...

48 CFR 252.222-7005 - Prohibition on use of nonimmigrant aliens-Guam.

Science.gov (United States)

2010-10-01

... nonimmigrant aliens-Guam. 252.222-7005 Section 252.222-7005 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7005 Prohibition on use of nonimmigrant aliens—Guam. As prescribed in 222.7302, use the following clause: Prohibition on Use of Nonimmigrant Aliens—Guam (SEP 1999...

24 CFR 207.252e - Method of payment of mortgage insurance premiums.

Science.gov (United States)

2010-04-01

... insurance premiums. 207.252e Section 207.252e Housing and Urban Development Regulations Relating to Housing... Premiums § 207.252e Method of payment of mortgage insurance premiums. In the cases that the Commissioner... mortgagees, that mortgage insurance premiums be remitted electronically. [63 FR 1303, Jan. 8, 1998] ...

Study of reproducibility of measurements with the spectrometer of Bonner multispheres

International Nuclear Information System (INIS)

Azevedo, G.A.; Pereira, W.W.; Patrao, K.C.S.; Fonseca, E.S.

2013-01-01

This work aims to study the metrological behavior of the Bonner Multisphere Spectrometer (BMS) of the LN / LNMRI / IRD - Laboratorio Metrologia de Neutrons / Laboratorio Nacional de Metrologia e Radiacao Ionizante / Instituto de Radioprotecao e Dosimetria, for measurements in repeatability and reproducibility conditions. Initially, a simulation was done by applying the Monte Carlo method, using the MCNP code and respecting the ISO 8529-1 (2001), using the sources of Californium ( 252 Cf), Americium-Beryllium ( 241 AmBe) and californium in heavy water (Cf + D 2 O), all located at a distance of 100 cm from the neutron detector ( 6 Li (Eu) - crystal scintillator). In this program, the counting of neutrons that are captured by the detector was made. The source is located in the center of a sphere of radius 300 cm. Analyzes the impact of these neutrons in a point of the sphere wall, which in this case acted as a neutron detector and from there, it is estimated the number of neutrons that collide in the whole sphere. The purpose is to obtain the neutron count for different energy bands in a solid field of neutrons, since they have a spectrum ranging from a low to a high energy that can also vary within a particular environment. Wishes to obtain new fields with different sources and moderators materials to be used as new reference fields. Measurements are being conducted for these fields, with the aim of analyzing the variability conditions of the measurement (repeatability and reproducibility) in LEN - Laboratorio de Espectrometria de Neutrons of the LN/LMNRI/IRD. Thus, the spectrometer will be used to improve both the knowledge of the spectrum as the standard of neutrons of the lab, proving that a spectrometry is essential for correct measurement

A Phase I/II Protocol Using 252Cf for the Treatment of Cervical Carcinoma

International Nuclear Information System (INIS)

Anita Mahajan; Mark J. Rivard; Evelyn R. Nunez; David E. Wazer

2000-01-01

For this clinical study, external photon beam irradiation will be given in a standard fashion with intravenous cisplatinum (CDDP) every week as a radiosensitizing agent. We will incorporate 252 Cf as the brachytherapy source replacing 192 Ir, theoretically improving patient outcomes with its lack of cell cycle and oxygen dependence, and a therapeutic ratio possibly greater than unity. Local tumor control and control of systemic disease are potentially feasible using 252 Cf to initially debulk and destroy local bulky tumor with CDDP and X rays to enhance treatment efficacy and treat minimal microscopic and distant micrometastases. The initial 22 Cf dose will be 1 Gy per weekly fraction with 0.25-Gy increments toward a 2.5-Gy limit. Patients will be stratified according to their stage, toxicities and outcomes will be monitored closely, and the study will be halted if undo morbidities are noted

48 CFR 252.227-7012 - Patent license and release contract.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Patent license and release contract. 252.227-7012 Section 252.227-7012 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text...

Spectrometry and dosimetry of isotopic sources of neutrons by means of artificial neural networks

International Nuclear Information System (INIS)

Vega C, H. R.; Ortiz R, J. M.; Hernandez D, V. M; Martinez B, M. R.; Gallego, E.; Lorente, A.; Barquero, R.

2010-09-01

The artificial neural networks technology has been applied to reconstruct the neutrons spectra of two isotopic sources: 252 Cf, and 241 Am-Be. Also, this technology has been applied to obtain the effective dose, E, and the personal dose equivalents, Hp(10) and environmental, H *(10). To obtain the spectra and the doses only were used the count rates produced in a Bonner Spheres spectrometer with a scintillator of 6 LiI(Eu) of 0.4 φ x 0.4 cm 2 . The equivalent environmental dose and the spectra of the sources were also obtained by means of the reconstruction code BUNKIUT. When comparing the results obtained by means of both procedures it was found that they are consistent. (Author)

Californium-252 neutron activation analysis of high-level processed nuclear tank waste

International Nuclear Information System (INIS)

Troyer, G.L.; Purcell, M.A.

2000-01-01

The basis for production assessment of the vitrification of Hanford nuclear fuel reprocessing wastes will be high-precision measurements of the elemental sodium content. However, the chemical analysis of both radioactive and nonradioactive components in nuclear waste can be challenged by high radiation dose rates. The dose rates compromise many analytical techniques as well as pose personnel dosimetry risks. In many cases, reduction of dose rates through dilution compromises the precision and sensitivity for certain key components. The use of neutron activation analysis (NAA) provides a method of analysis that avoids the need for dilutions or extensive sample preparation. These waste materials also contain trace quantities of fissionable isotopes, which, through neutron activation, can be estimated by delayed neutron counting of fissioned fragments

Developments in broad-beam, ion-source technology and applications

International Nuclear Information System (INIS)

Kaufman, H.R.; Harper, J.M.E.; Cuomo, J.J.

1982-01-01

Recent advances in broad-beam, ion-source technology are summarized, including low-energy ion optics, improved extraction grid fabrication, a compact ion-source design and a gridless ion-source design. Recent applications have emphasized concepts such as stress modification of vapor deposited films, very low energy ion beams to minimize the physical sputtering portion in reactive etching, and the use of multiple sources and targets to sputter deposit alloys and compounds. A comprehensive critical review by the same authors appears concurrently, describing in detail the developments in broad-beam, ion-source technology 1 and the applications of these sources. 2

About possibilities of obtaining focused beams of thermal neutrons of radionuclide source

International Nuclear Information System (INIS)

Aripov, G.A.; Kurbanov, B.I.; Sulaymanov, N.T.; Ergashev, A.

2004-01-01

Full text: In the last years significant progress is achieved in development of neutron focusing methods (concentrating neutrons in a given direction and a small area). In this, main attention is given to focusing of neutron beams of reactor, particularly cold neutrons and their applications. [1,2]. However, isotope sources also let obtain intensive neutron beams and solve quite important (tasks) problems (e.g. neutron capture therapy for malignant tumors) [3], and an actual problems is focusing of neutrons. We developed a device on the basis of californium source of neutrons, allowing to obtain focused (preliminarily) beam of thermal neutrons with the aid of respective choice of moderators, reflectors and geometry of their disposition. Here, fast neutrons and gamma rays in the beam are minimized. With the aid of the model we developed on the basis of Monte-Carlo method, it is possible to modify aforementioned device and dynamics of output neutrons in wide energy range and analyze ways of optimization of neutron beams of isotope sources with different neutron outputs. Device of preliminary focusing of thermal neutrons can serve as a basis for further focus of neutrons using micro- and nano-capillar systems. It is known that, capillary systems performed with certain technology can form beam of thermal neutrons increasing its density by more than two orders of magnitude and effectively divert beams up to 20 o with length of system 15 cm

About possibilities of obtaining focused beams of thermal neutrons of radionuclide source

International Nuclear Information System (INIS)

Aripov, G.A.; Kurbanov, B.I.; Sulaymanov, N.T.; Ergashev, A.

2004-01-01

In the last years significant progress is achieved in development of neutron focusing methods (concentrating neutrons in a given direction and a small area). In this, main attention is given to focusing of neutron beams of reactor, particularly cold neutrons and their applications. [1,2]. However, isotope sources also let obtain intensive neutron beams and solve quite important (tasks) problems (e.g. neutron capture therapy for malignant tumors) [3], and an actual problems is focusing of neutrons. We developed a device on the basis of californium source of neutrons, allowing to obtain focused (preliminarily) beam of thermal neutrons with the aid of respective choice of moderators, reflectors and geometry of their disposition. Here, fast neutrons and gamma rays in the beam are minimized. With the aid of the model we developed on the basis of Monte-Carlo method, it is possible to modify aforementioned device and dynamics of output neutrons in wide energy range and analyze ways of optimization of neutron beams of isotope sources with different neutron outputs. Device of preliminary focusing of thermal neutrons can serve as a basis for further focus of neutrons using micro- and nano-capillary systems. It is known that, capillary systems performed with certain technology can form beam of thermal neutrons increasing its density by more than two orders of magnitude and effectively divert beams up to 20 o with length of system 15 cm. (author)

On the sources of technological change: What do the models assume?

International Nuclear Information System (INIS)

Clarke, Leon; Weyant, John; Edmonds, Jae

2008-01-01

It is widely acknowledged that technological change can substantially reduce the costs of stabilizing atmospheric concentrations of greenhouse gases. This paper discusses the sources of technological change and the representations of these sources in formal models of energy and the environment. The paper distinguishes between three major sources of technological change-R and D, learning-by-doing and spillovers-and introduces a conceptual framework for linking modeling approaches to assumptions about these real-world sources. A selective review of modeling approaches, including those employing exogenous technological change, suggests that most formal models have meaningful real-world interpretations that focus on a subset of possible sources of technological change while downplaying the roles of others

The physics and technology of ion sources

International Nuclear Information System (INIS)

Brown, I.G.

1989-01-01

New applications call for ion beams of unprecedented energy, current, species, focus, uniformity, size, and charge states. This comprehensive, up-to-date review and reference for the rapidly evolving field of ion source technology relates improvements to traditional ion sources and describes the development of the new kinds of ion sources. Also provides background material on the physics of ion sources. Chapters are self-contained, making for easy reference

Equivalent properties of single event burnout induced by different sources

International Nuclear Information System (INIS)

Yang Shiyu; Cao Zhou; Da Daoan; Xue Yuxiong

2009-01-01

The experimental results of single event burnout induced by heavy ions and 252 Cf fission fragments in power MOSFET devices have been investigated. It is concluded that the characteristics of single event burnout induced by 252 Cf fission fragments is consistent to that in heavy ions. The power MOSFET in the 'turn-off' state is more susceptible to single event burnout than it is in the 'turn-on' state. The thresholds of the drain-source voltage for single event burnout induced by 173 MeV bromine ions and 252 Cf fission fragments are close to each other, and the burnout cross section is sensitive to variation of the drain-source voltage above the threshold of single event burnout. In addition, the current waveforms of single event burnouts induced by different sources are similar. Different power MOSFET devices may have different probabilities for the occurrence of single event burnout. (authors)

Thermal neutron imaging with rare-earth-ion-doped LiCaAlF{sub 6} scintillators and a sealed {sup 252}Cf source

Energy Technology Data Exchange (ETDEWEB)

Kawaguchi, Noriaki, E-mail: famicom@mail.tagen.tohoku.ac.jp [Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Fukuda, Kentaro; Suyama, Toshihisa [Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); Watanabe, Kenichi; Yamazaki, Atsushi [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Chani, Valery [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yoshikawa, Akira [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); New Industry Creation Hatchery Center, Tohoku University, Sendai 980-8579 (Japan)

2011-10-01

Thermal neutron imaging with Ce-doped LiCaAlF{sub 6} crystals has been performed. The prototype of the neutron imager using a Ce-doped LiCaAlF{sub 6} scintillating crystal and a position sensitive photomultiplier tube (PSPMT) which had 64 multi-channel anode was developed. The Ce-doped LiCaAlF{sub 6} single crystal was grown by the Czochralski method. A plate with dimensions of a diameter of 50x2 mm{sup 2} was cut from the grown crystal, polished, and optically coupled to PSPMT by silicone grease. The {sup 252}Cf source (<1 MBq) was sealed with 43 mm of polyethylene for neutron thermalization. Alphabet-shaped Cd pieces with a thickness of 2 mm were used as a mask for the thermal neutrons. After corrections for the pedestals and gain of each pixel, we successfully obtained two-dimensional neutron images using Ce-doped LiCaAlF{sub 6}.

Radiation ulcers in patients with cancer of the torgue after 252Cf therapy

International Nuclear Information System (INIS)

Galantseva, G.F.; Guseva, L.I.; Plichko, V.I.

1984-01-01

Interstitial therapy with 252 Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with 252 Cf doesn't differ sufficiently from the course of radiation injuries, occurring after γ-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with 252 Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongUe ulcers after interstitial therapy with 252 Cf

27 CFR 25.252 - Records.

Science.gov (United States)

2010-04-01

... TREASURY LIQUORS BEER Removal of Brewer's Yeast and Other Articles § 25.252 Records. (a) Production. The brewer shall keep records of the production of malt syrup, wort, and other articles which are removed... of brewer's yeast, malt and other articles from the brewery. The record shall include the quantity...

Sources of capabilities, integration and technology commercialization

DEFF Research Database (Denmark)

Zahra, Shaker A.; Nielsen, Anders

2002-01-01

In recent years, companies have increased their use of internal and external sources in pursuit of a competitive advantage through the effective and timely commercialization of new technology. Grounded in the resource-based view of the firm, this study examines the effect of a company's use...... of internal and external sources on multiple dimensions of successful technology commercialization (TC). The study also explores the moderating role of formal vs. informal integration mechanisms on these relationships. Applying a longitudinal design and data from 119 companies, the results show that internal...

Radiological Threat Reduction (RTR) program: implementing physical security to protect large radioactive sources worldwide

International Nuclear Information System (INIS)

Lowe, Daniel L.

2004-01-01

The U.S. Department of Energy's Radiological Threat Reduction (RTR) Program strives to reduce the threat of a Radiological Dispersion Device (RDD) incident that could affect U.S. interests worldwide. Sandia National Laboratories supports the RTR program on many different levels. Sandia works directly with DOE to develop strategies, including the selection of countries to receive support and the identification of radioactive materials to be protected. Sandia also works with DOE in the development of guidelines and in training DOE project managers in physical protection principles. Other support to DOE includes performing rapid assessments and providing guidance for establishing foreign regulatory and knowledge infrastructure. Sandia works directly with foreign governments to establish cooperative agreements necessary to implement the RTR Program efforts to protect radioactive sources. Once necessary agreements are in place, Sandia works with in-country organizations to implement various security related initiatives, such as installing security systems and searching for (and securing) orphaned radioactive sources. The radioactive materials of interest to the RTR program include Cobalt 60, Cesium 137, Strontium 90, Iridium 192, Radium 226, Plutonium 238, Americium 241, Californium 252, and Others. Security systems are implemented using a standardized approach that provides consistency through out the RTR program efforts at Sandia. The approach incorporates a series of major tasks that overlap in order to provide continuity. The major task sequence is to: Establish in-country contacts - integrators, Obtain material characterizations, Perform site assessments and vulnerability assessments, Develop upgrade plans, Procure and install equipment, Conduct acceptance testing and performance testing, Develop procedures, and Conduct training. Other tasks are incorporated as appropriate and commonly include such as support of reconfiguring infrastructure, and developing security

Source zone remediation by zero valent iron technologies

DEFF Research Database (Denmark)

Fjordbøge, Annika Sidelmann

at a fifth of these contaminated sites. These source zones pose a serious threat to soil and groundwater quality. Remediation of the heterogeneous source zones is challenging due to irregular downwards migration patterns in the subsurface, low aqueous solubility and matrix diffusion. To protect the soil...... and groundwater resources from long-term deterioration, the development of in situ technologies suitable for remediation of DNAPL is warranted. Currently, an array of aggressive in situ remediation technologies remediation exists. These technologies may be suitable under various site specific conditions; however......, most of them are limited by subsurface heterogeneities and/or the risk of inadvertent DNAPL displacement during field application. This thesis presents the results of an investigation of the potential for remediation of chlorinated solvent source zones by emerging zero valent iron (ZVI) based...

48 CFR 252.225-7044 - Balance of Payments Program-Construction Material.

Science.gov (United States)

2010-10-01

... Program-Construction Material. 252.225-7044 Section 252.225-7044 Federal Acquisition Regulations System...—Construction Material. As prescribed in 225.7503(a), use the following clause: Balance of Payments Program—Construction Material (JAN 2009) (a) Definitions. As used in this clause— Commercially available off-the-shelf...

Ultrashort pulse laser technology laser sources and applications

CERN Document Server

Schrempel, Frank; Dausinger, Friedrich

2016-01-01

Ultrashort laser pulses with durations in the femtosecond range up to a few picoseconds provide a unique method for precise materials processing or medical applications. Paired with the recent developments in ultrashort pulse lasers, this technology is finding its way into various application fields. The book gives a comprehensive overview of the principles and applications of ultrashort pulse lasers, especially applied to medicine and production technology. Recent advances in laser technology are discussed in detail. This covers the development of reliable and cheap low power laser sources as well as high average power ultrashort pulse lasers for large scale manufacturing. The fundamentals of laser-matter-interaction as well as processing strategies and the required system technology are discussed for these laser sources with respect to precise materials processing. Finally, different applications within medicine, measurement technology or materials processing are highlighted.

Neutron sources and its dosimetric characteristics

International Nuclear Information System (INIS)

Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Mercado S, G.A.; Gallego D, E.; Lorente F, A.

2005-01-01

By means of Monte Carlo methods the spectra of the produced neutrons 252 Cf, 252 Cf/D 2 O, 241 Am Be, 239 Pu Be, 140 La Be, 239 Pu 18 O 2 and 226 Ra Be have been calculated. With the information of the spectrum it was calculated the average energy of the neutrons of each source. By means of the fluence coefficients to dose it was determined, for each one of the studied sources, the fluence factors to dose. The calculated doses were H, H * (10), H p,sIab (10, 0 0 ), E AP and E ISO . During the phase of the calculations the sources were modeled as punctual and their characteristics were determined to 100 cm in the hole. Also, for the case of the sources of 239 Pu Be and 241 Am Be, were carried out calculations modeling the sources with their respective characteristics and the dosimetric properties were determined in a space full with air. The results of this last phase of the calculations were compared with the experimental results obtained for both sources. (Author)

38 CFR 3.252 - Annual income; pension; Mexican border period and later war periods.

Science.gov (United States)

2010-07-01

...; Mexican border period and later war periods. 3.252 Section 3.252 Pensions, Bonuses, and Veterans' Relief... Dependency, Income and Estate § 3.252 Annual income; pension; Mexican border period and later war periods. (a) Annual income limitations; old-law pension. Where the right to old-law pension is payable under section...

Identification of new neutron-rich rare-earth nuclei produced in /sup 252/Cf spontaneous fission

CERN Document Server

Greenwood, R C; Gehrke, R J; Meikrantz, D H

1981-01-01

A program of systematic study of the decay properties of neutron-rich rare-earth nuclei with 30 s252/Cf spontaneous fission, is currently underway using the Idaho ESOL (Elemental Separation On Line) Facility. The chemistry system used for the rare-earth elemental separations consists of two high-performance chromatography columns connected in series and coupled to the /sup 252 /Cf fission source via a helium gas-jet transport arrangement. The time delay for separation and initiation of gamma -ray counting with results which have been obtained to date with this system include the identification of a number of new neutron-rich rare-earth isotopes including /sup 155/Pm (t/sub 1/2/=48+or-4 s) and /sup 163/Gd (t/sub 1 /2/=68+or-3 s), in addition to 5.51 min /sup 158/Sm which was identified in an earlier series of experiments. (11 refs).

24 CFR 207.252c - Premiums-mortgages insured pursuant to section 238(c) of the Act.

Science.gov (United States)

2010-04-01

.... All of the provisions of §§ 207.252 and 207.252a governing mortgage insurance premiums shall apply to... insurance premiums due on such mortgages in accordance with §§ 207.252 and 207.252a shall be calculated on... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Premiums-mortgages insured pursuant...

50 CFR 14.252 - What definitions do I need to know?

Science.gov (United States)

2010-10-01

... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What definitions do I need to know? 14.252... PLANTS IMPORTATION, EXPORTATION, AND TRANSPORTATION OF WILDLIFE Captive Wildlife Safety Act § 14.252 What... which any individual other than an authorized keeper or caregiver may potentially touch or otherwise...

48 CFR 252.244-7000 - Subcontracts for Commercial Items and Commercial Components (DoD Contracts).

Science.gov (United States)

2010-10-01

... under this contract: (a) 252.225-7009 Restriction on Acquisition of Certain Articles Containing... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Subcontracts for Commercial Items and Commercial Components (DoD Contracts). 252.244-7000 Section 252.244-7000 Federal...

K-252a, a novel microbial product, inhibits smooth muscle myosin light chain kinase

International Nuclear Information System (INIS)

Nakanishi, S.; Yamada, K.; Kase, H.; Nakamura, S.; Nonomura, Y.

1988-01-01

Effects of K-252a, purified from the culture broth of Nocardiopsis sp., on the activity of myosin (light chain kinase were investigated. 1) K-252a affected three characteristic properties of chicken gizzard myosin-B, natural actomyosin, to a similar degree: the Ca 2+ -dependent activity of ATPase, superprecipitation, and the phosphorylation of the myosin light chain. 2) K-252a inhibited the activities of the purified myosin light chain kinase and a Ca 2+ -independent form of the enzyme which was constructed by cross-linking of myosin light chain kinase and calmodulin using glutaraldehyde. The degrees of inhibition by 3 x 10 -6 M K-252a were 69 and 48% of the control activities with the purified enzyme and the cross-linked complex, respectively. Chlorpromazine (3 x 10 -4 M), a calmodulin antagonist, inhibited the native enzyme, but not the cross-linked one. These results suggested that K-252a inhibited myosin light chain kinase by direct interaction with the enzyme, whereas chlorpromazine suppressed the enzyme activation by interacting with calmodulin. 3) The inhibition by K-252a of the cross-linked kinase was affected by the concentration of ATP, a phosphate donor. The concentration causing 50% inhibition was two orders magnitude lowere in the presence of 100 μM ATP than in the presence of 2 mM ATP. 4) Kinetic analyses using [γ- 32 P]ATP indicated that the inhibitory mode of K-252a was competitive with respect to ATP. These results suggest that K-252a interacts at the ATP-binding domain of myosin light chain kinase

Radiation ulcers in patients with cancer of the tongue after /sup 252/Cf therapy

Energy Technology Data Exchange (ETDEWEB)

Galantseva, G.F.; Guseva, L.I.; Plichko, V.I. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)

1984-01-01

Interstitial therapy with /sup 252/Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with /sup 252/Cf doesn't differ sufficiently from the course of radiation injuries, occurring after ..gamma..-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with /sup 252/Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongue ulcers after interstitial therapy with /sup 252/Cf.

48 CFR 252.245-7000 - Government-furnished mapping, charting, and geodesy property.

Science.gov (United States)

2010-10-01

... mapping, charting, and geodesy property. 252.245-7000 Section 252.245-7000 Federal Acquisition Regulations..., charting, and geodesy property. As prescribed in 245.107-70, use the following clause: Government-Furnished Mapping, Charting, and Geodesy Property (DEC 1991) (a) Definition—Mapping, charting, and geodesy (MC&G...

48 CFR 53.236-2 - Architect-engineer services (SF's 252 and 330).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Architect-engineer... ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.236-2 Architect-engineer...-engineer and related services: (a) SF 252 (Rev. 10/83), Architect-Engineer Contract. SF 252 is prescribed...

Application of TSH bioindicator for studying the biological efficiency of radiation

International Nuclear Information System (INIS)

Cebulska-Wasilewska, A.; Rekas, K.; Kim, J.K.

1999-01-01

The effectiveness of neutrons from a californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH assay) was studied. Special attention was paid to check whether any enhancement in effects caused by the process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescences, normal or prepared with chemicals containing boron, were irradiated in the air with neutrons from the 252 Cf source at KOREI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) of the boron under the study, Tradescantia inflorescences without chemical pretreatment were irradiated with various doses of X-rays. The ranges of radiation doses for neutrons were 0-0.1Gy and for X-rays 0-0.5 Gy. After time needed to complete the postirradiation repair tradescantia cuttings were transported to Cracow were screening of gene and lethal mutations in somatic cells of stamen hairs have been done and dose response relationships were plotted. In two independent experimental studies an alternation of dose-response curves was observed, probably due to slight changes in the postexposure plant treatment. However, it has not results in the change of the maximal RBE values, which for the induction of gene mutations were estimated as 5.6 in the pilot studies and 5.8 one year later. Inflorescences pretreated with borax and BSH responded to neutrons differently. The values of RBE have changed from 5.6 to 7.9 in the case of plants pretreated with 240 ppm of B-10 from borax, and 5.8 to 7.2 in the case of 400 ppm of B-10 from BSH. The results showed an increase, although statistically insignificant, in biological efficiency of radiation from the 252 Cf source in the samples pretreated with boron containing chemicals. (author)

Methods for Cf-252 cervix cancer therapy and treatment planning for GYN malignancies in Lexington

International Nuclear Information System (INIS)

Coffey, C.W.; Yoneda, J.; Beach, J.L.; Maruyama, Y.

1986-01-01

This paper presents the clinical physics methods and treatment planning techniques used in both the external beam and brachytherapy treatment of GYN malignancies in the Radiotherapy Department of the University of Kentucky Medical Center. Specific description of the departmental implant suite and brachytherapy procedures are included. The optimization of brachytherapy applicator placement, source arrangement, and normal and tumor total dose and dose distributions are presented. Quality assurance protocols for teletherapy and brachytherapy and patient and staff safety procedures with Cf-252 are discussed

Use of neutron activation and X-ray fluorescence with radioactive sources (Cf-252 and Am-241) for the instrumental qualiquantitative simultaneous analysis of some elements in samples of mineral supplement for animals

International Nuclear Information System (INIS)

Simabuco, S.M.

1984-01-01

To study the possibility of using two non-destructive (neutron activation and X-ray fluorescence) analyses in simultaneous quali-quantitative evaluations of some elements in mineral supplement for animals, a Cf-252 neutron source (11.3 mCi; 21.1 μgrams) and a Am-241 low energy gamma-ray emitter source (59.5 KeV; 100 mCi) were employed. For these sources, shieldings and sample irradiation systems were built. For the neutron activation analysis a reservoir of 72 cm height and 43 cm diameter was filled with paraffine, and the samples and neutron sources were put inside this reservoir using polypropilene and nylon tubes. To detect the gamma-rays emitted by the radioisotopes a well-type solid NaI(Tl) crystal scintillator (3x3') was used, coupled to a multi-channel analyser. For the X-ray fluorescence analysis a lead cylinder of 9.75 cm height and 5.6 cm diameter (with 0.7 cm thickness) was made and internally lined with a 0.36 mm copper and 0.1 mm aluminium foil. (Author) [pt

Energy technology sources, systems and frontier conversion

CERN Document Server

Ohta, Tokio

1994-01-01

This book provides a concise and technical overview of energy technology: the sources of energy, energy systems and frontier conversion. As well as serving as a basic reference book for professional scientists and students of energy, it is intended for scientists and policy makers in other disciplines (including practising engineers, biologists, physicists, economists and managers in energy related industries) who need an up-to-date and authoritative guide to the field of energy technology.Energy systems and their elemental technologies are introduced and evaluated from the view point

Optical technologies for extreme-ultraviolet and soft X-ray coherent sources

International Nuclear Information System (INIS)

Canova, Federico; Poletto, Luca

2015-01-01

The book reviews the most recent achievements in optical technologies for XUV and X-ray coherent sources. Particular attention is given to free-electron-laser facilities, but also to other sources available at present, such as synchrotrons, high-order laser harmonics and X-ray lasers. The optical technologies relevant to each type of source are discussed. In addition, the main technologies used for photon handling and conditioning, namely multilayer mirrors, adaptive optics, crystals and gratings are explained. Experiments using coherent light received during the last decades a lot of attention for the X-ray regime. Strong efforts were taken for the realization of almost fully coherent sources, e.g. the free-electron lasers, both as independent sources in the femtosecond and attosecond regimes and as seeding sources for free-electron-lasers and X-ray gas lasers. In parallel to the development of sources, optical technologies for photon handling and conditioning of such coherent and intense X-ray beams advanced. New problems were faced for the realization of optical components of beamlines demanding to manage coherent X-ray photons, e.g. the preservation of coherence and time structure of ultra short pulses.

Curious exceptions? : open source software and "open" technology

NARCIS (Netherlands)

Nuvolari, A.; Rullani, F.; St. Amant, Kirk; Still, Brian

2007-01-01

The aim of thts chapter is to explore the differences and commonalities between open source software and other cases of open technology. The concept of open technology is used here to indicate various models of innovation based on the participation of a wide range of different actors who freely

Interface detection by neutron scattering

International Nuclear Information System (INIS)

De Monchy, A.R.; Kok, C.A.; Dorrepaal, J.

1979-01-01

A method and apparatus for detecting an interface of materials having different hydrogen content present in a metal vessel or pipe eg. made of steel, are described. Steel walls of columns, reactors, pipelines etc can be monitored. It is very suitable for detection of liquid water or hydrocarbons present in gas pipelines and also for the detection of a liquid hydrocarbon in a vessel or column. A series of measurements of the hydrogen density of the contents of a vessel or pipe are made using at least one californium-252 neutron source located near the outer side of the pipe. Neutrons are emitted and are scattered by the contents of the pipe. At least one neutron detector is located near the outer side of the metal wall. The detectors have a higher sensitivity for scattered neutrons (from the light hydrogen nuclei present in water or hydrocarbons). A source of 0.1 - 1 micrograms produces enough neutrons for most technical applications so the handling is relatively safe although shielding is advocated. The detectors contain helium-3 at a pressure of about 10 bar. Current pulses from the detector are counted. (U.K.)

Design of active-neutron fuel rod scanner

International Nuclear Information System (INIS)

Griffith, G.W.; Menlove, H.O.

1996-01-01

An active-neutron fuel rod scanner has been designed for the assay of fissile materials in mixed oxide fuel rods. A 252 Cf source is located at the center of the scanner very near the through hole for the fuel rods. Spontaneous fission neutrons from the californium are moderated and induce fissions within the passing fuel rod. The rod continues past a combined gamma-ray and neutron shield where delayed gamma rays above 1 MeV are detected. We used the Monte Carlo code MCNP to design the scanner and review optimum materials and geometries. An inhomogeneous beryllium, graphite, and polyethylene moderator has been designed that uses source neutrons much more efficiently than assay systems using polyethylene moderators. Layers of borated polyethylene and tungsten are used to shield the detectors. Large NaI(Tl) detectors were selected to measure the delayed gamma rays. The enrichment zones of a thermal reactor fuel pin could be measured to within 1% counting statistics for practical rod speeds. Applications of the rod scanner include accountability of fissile material for safeguards applications, quality control of the fissile content in a fuel rod, and the verification of reactivity potential for mixed oxide fuels. (orig.)

Study of biological effects of varying mixtures of Cf-252 and gamma radiation on the acute radiation syndromes: Relevance to clinical radiotherapy of radioresistant cancer

International Nuclear Information System (INIS)

Maruyama, Y.; Wierzbicki, J.; Feola, J.M.

1993-01-01

Data for the 30 day bone marrow syndrome (BM-50) and the 6-10 day gastrointestinal (GI-50) syndrome for a one and two fraction schedule and acute and low dose rate irradiation using pure and mixed Cf-252 and photon radiation are presented. The radiation of Cf-252 is a mixture of neutrons and gamma rays. Balb/c mice of both sexes were total body irradiated with acute Co-60, low dose rate Cs-137 and Cf-252 using a 1 x and 2 x schedule. For low linear energy transfer radiations of Co-60 or Cs-137 there was expected to be an increase in the dose to produce the gastrointestinal and bone marrow syndromes with minimal change for Cf-252 neutrons. The proportion of photons in the Cf-252 radiation field were further altered by mixing Cs-137 with the Cf-252 sources and mice were total body irradiated with different proportions of photons to determine the effect on the radiation syndromes. The effects of mixing Cf-252 neutrons with different proportions of photons on the syndromes was determined. There was increase in BM-50 and GI-50 doses with fractionated or low dose rate photon irradiations and the dose modifying factors were 1.3-1.4 for the GI syndrome and 1.2 for the bone marrow syndrome. For Cf-252 there was minimal fractionation effect for the GI-50 syndrome, which increased by 1.1 for x 1 vs. x 2 fractions; for the BM-50 syndrome it rose by a 1.1 factor. For LDR Cs-137 the dose for the GI-50 syndrome rose 2.2-fold. For mixed neutron-photon radiation of 0%, 15%, 35%, and 65% η/γ mixtures, the dose to produce the BM-50 and GI-50 endpoints dropped sharply from 0 to 35% neutrons and remained flat thereafter. For major tissues such as the bone marrow and GI tract, Cf-252 behaved as high linear energy transfer for mixtures of neutrons and gamma rays when the radiations were delivered simultaneously at the low dose rates studied. 35 refs., 3 figs., 2 tabs

24 CFR 252.2 - GNMA right to assignment.

Science.gov (United States)

2010-04-01

... COINSURANCE OF MORTGAGES COVERING NURSING HOMES, INTERMEDIATE CARE FACILITIES, AND BOARD AND CARE HOMES § 252... section, in order to allow an appropriate endorsement and necessary changes in the Commissioner's records...

An absolute measurement of 252Cf prompt fission neutron spectrum at low energy range

International Nuclear Information System (INIS)

Lajtai, A.; Dyachenko, P.P.; Kutzaeva, L.S.; Kononov, V.N.; Androsenko, P.A.; Androsenko, A.A.

1983-01-01

Prompt neutron energy spectrum at low energies (25 keV 252 Cf spontaneous fission has been measured with a time-of-flight technique on a 30 cm flight-path. Ionization chamber and lithium-glass were used as fission fragment and neutron detectors, respectively. Lithium glasses of NE-912 (containing 6 Li) and of NE-913 (containing 7 Li) 45 mm in diameter and 9.5 mm in thickness have been employed alternatively, for the registration of fission neutrons and gammas. For the correct determination of the multiscattering effects - the main difficulty of the low energy neutron spectrum measurements - a special geometry for the neutron detector was used. Special attention was paid also to the determination of the absolute efficiency of the neutron detector. The real response function of the spectrometer was determined by a Monte-Carlo calculation. The scattering material content of the ionization chamber containing a 252 Cf source was minimized. As a result of this measurement a prompt fission neutron spectrum of Maxwell type with a T=1.42 MeV parameter was obtained at this low energy range. We did not find any neutron excess or irregularities over the Maxwellian. (author)

Source technology as the foundation for modern infra-red counter measures (IRCM)

Science.gov (United States)

Grasso, Robert J.

2010-10-01

Protection of military aircraft from IR guided threats is paramount to ensure the survivability of aircrews, platforms, and to ensure mission success. At the foundation of all IRCM systems is the source; that component that provides the in-band radiant energy required for threat defeat. As such, source technology has evolved with IRCM technology to encompass the evolving systems architectures that encompass IRCM: 1) "Hot Brick" omni-directional sources; 2) arc lamps, and; 3) lasers. Lasers, as IRCM sources continue to evolve to meet the challenges of ever-evolving threats, superior techniques, economy of installation, and superior source technology. Lasers represent the single greatest advance in IRCM source technology and continue to evolve to meet ever more sophisticated threats. And have been used with great effect in all modern IRCM systems; evolving from frequency doubled CO2 lasers, to solid state lasers with OPOs, to semiconductor lasers including Quantum Cascade Lasers (QCLs); these last devices represent the latest advance in IRCM source technology offering all-band coverage, architectural simplicity, and economy of scale. While QCLs represent the latest advance in IRCM laser technology, fiber lasers show much promise in addressing multi-band operation as well as the ability to be coherently combined to achieve even greater output capability. Also, ultra-short pulse lasers are evolving to become practical for IRCM applications. Stay tuned ......

Rotation and Morphology of Comet 252P/LINEAR

Science.gov (United States)

Woodney, Laura; Schambeau, Charles A.; Fernandez, Yanga R.

2017-10-01

Comet 252P/LINEAR had an incredibly close approach early in 2016 - minimum distance 0.036 AU on March 21 - that allowed detailed investigation of its behavior. Analysis of observations of the morphology of 252P have resulted in several possible rotational periods. Knight and Schleicher found that repetition of features in narrowband imaging from April 2016 indicated a period of 7.35 +/- 0.05 hr [1]. HST broadband data obtained by Li et al. in March and April partially fit the 7.35 hr period, but found 5.5 hr was a better fit for the April 4 r’ band data [2]. Given this discrepancy, additional observations may shed light on the true rotation state, and we present here the pieces of the puzzle obtained by our group.We observed 252P with the Kitt Peak National Observatory WIYN 0.9 m telescope on 7 nights: May 2 - 5 and June 6,8,9, 2016 using a Harris R filter. An oscillating jet is clearly visible in our data. While there is insufficient phase coverage to determine a best fit period from our data alone, we will present how our observations of the morphology fit the two proposed periods.[1] Knight, M.M and D.G. Schleicher. AAS, DPS Meeting #48, id.207.02, 2016 [2] Li, J.-Y. et al. AAS, DPS Meeting #48, id. 206.03, 2016.

Phenotype abnormality: 252 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available lant flowering stage in environment of short day length regimen in environment of short day length regimen h... 252 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u758i delayed whole p

Fission-fragment attachment to aerosols and their transport through capillary tubes

International Nuclear Information System (INIS)

Novick, V.J.; Alvarez, J.L.; Greenwood, R.C.

1981-01-01

The transport of radioactive aerosols was studied using equipment, collectively called the Helium jet, that has been constructed to provide basic nuclear physics data on fission product nuclides. The transport of the fission products in the system depends on their attachment to aerosol particles. The system consists of 1) a tube furnace which generates aerosols by the sublimation or evaporation of source material, 2) a helium stream used to transport the aerosols, 3) a 25 m settling tube to eliminate the larger aerosols and smaller aerosols that would deposit in the capillary, 4) a Californium-252 self-fissioning source of fission product nuclides, and 5) a small capillary to carry the radioactive aerosols from the hot cell to the laboratory. Different source materials were aerosolized but NaCl is generally used because it yielded the highest transport efficiencies through the capillary. Particle size measurments were made with NaCl aerosols by using a cascade impactor, an optical light scattering device, and the capillary itself as a diffusion battery by performing radiation measurements and/or electrical conductivity measurements. Both radioactive and nonradioactive aerosols were measured in order to investigate the possibility of a preferential size range for fission product attachment. The measured size distributions were then used to calculate attachment coefficients and finally an attachment time

The significance of chromosome deletions in atomic-bomb survivors

International Nuclear Information System (INIS)

Tanaka, Kimio; Shigeta, Chiharu; Oguma, Nobuo; Kamada, Nanao; Deng, Z.; Niimi, Masanobu; Aisaka, Tadaichi.

1986-01-01

In 39 A-bomb survivors 40 years after exposure at ≤ 1,000 m from ground zero, the frequency and features of chromosome deletions in peripheral lymphocytes were examined using a differential staining technique. Simultaneously, in vitro irradiation experiment with Cf-252 was made to infer chromosome aberrations occuring immediately after exposure. Californium-252 with 100 rad induced dicentric and ring chromosomes in 40 % of the cells and acentric fragments in 44 %. Among the A-bomb survivors, chromosome aberrations were observed in 651 (21 %) of the total 3,136 cells. There were 146 cells with deletions (22 % of abnormal cells; 5 % of the total cells), and 10 cells with acentric fragment (0.3 % of the total cells). The figure for deletions was far higher than that reported in the literature. A large number of deletions were seen in chromosomes no.4, no.21, and no.22, and a few deletions in chromosomes no.7 and no.20. Significance of chromosome deletions is discussed. (Namekawa, K.)

48 CFR 252.225-7016 - Restriction on acquisition of ball and roller bearings.

Science.gov (United States)

2010-10-01

... of ball and roller bearings. 252.225-7016 Section 252.225-7016 Federal Acquisition Regulations System... and roller bearings. As prescribed in 225.7009-5, use the following clause: Restriction on Acquisition of Ball and Roller Bearings (MAR 2006) (a) Definitions. As used in this clause' (1) Bearing...

48 CFR 252.227-7027 - Deferred ordering of technical data or computer software.

Science.gov (United States)

2010-10-01

... technical data or computer software. 252.227-7027 Section 252.227-7027 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(b), use the following clause: Deferred Ordering of Technical Data or Computer Software (APR 1988) In addition to technical data or computer software...

48 CFR 252.227-7026 - Deferred delivery of technical data or computer software.

Science.gov (United States)

2010-10-01

... technical data or computer software. 252.227-7026 Section 252.227-7026 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(a), use the following clause: Deferred Delivery of Technical Data or Computer Software (APR 1988) The Government shall have the right to require, at...

48 CFR 252.247-7017 - Erroneous shipments.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Erroneous shipments. 252... SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of..., articles of personal property inadvertently packed with goods of other than the rightful owner. (2) Ensure...

The use of polyimide foils to prevent contamination from self-sputtering of {sup 252}Cf deposits in high-accuracy fission counting

Energy Technology Data Exchange (ETDEWEB)

Gilliam, David M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)], E-mail: david.gilliam@nist.gov; Yue, Andrew [Department of Physics and Astronomy, University of Tennessee, Knoxville, TN (United States); Scott Dewey, M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)

2008-06-01

It is demonstrated that a thin polyimide foil can be employed to prevent contamination from the self-sputtering of a {sup 252}Cf source under vacuum, with small energy loss of the emitted fission fragments, with very small effect on the efficiency of counting the fission fragments, and with a long lifetime of the plastic foils.

Shielding of radiation fields generated by 252Cf in a concrete maze. Part 2 -- Simulation

International Nuclear Information System (INIS)

Fasso, A.; Ipe, N.E.; Reyna, A.

1998-03-01

A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare 252 Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation

Review of microscopic integral cross section data in fundamental reactor dosimetry benchmark neutron fields

International Nuclear Information System (INIS)

Fabry, A.; McElroy, W.N.; Kellogg, L.S.; Lippincott, E.P.; Grundl, J.A.; Gilliam, D.M.; Hansen, G.E.

1976-01-01

This paper is intended to review and critically discuss microscopic integral cross section measurement and calculation data for fundamental reactor dosimetry benchmark neutron fields. Specifically the review covers the following fundamental benchmarks: the spontaneous californium-252 fission neutron spectrum standard field; the thermal-neutron induced uranium-235 fission neutron spectrum standard field; the (secondary) intermediate-energy standard neutron field at the center of the Mol-ΣΣ, NISUS, and ITN-ΣΣ facilities; the reference neutron field at the center of the Coupled Fast Reactor Measurement Facility; the reference neutron field at the center of the 10% enriched uranium metal, cylindrical, fast critical; the (primary) Intermediate-Energy Standard Neutron Field

48 CFR 252.229-7004 - Status of contractors as a direct contractor (Spain).

Science.gov (United States)

2010-10-01

... direct contractor (Spain). 252.229-7004 Section 252.229-7004 Federal Acquisition Regulations System... contractor (Spain). As prescribed in 229.402-70(d), use the following clause: Status of Contractor as a Director Contractor (Spain) (JUN 1997) (a) “Direct Contractor,” as used in this clause, means an individual...

Project 252Cf-D2O. The multisphere system of neutron dosimetry and spectrometry (M.S.-N.D.S.). Studies of applications to health physics

International Nuclear Information System (INIS)

Zaborowski, H.L.

1976-10-01

The project 252 Cf-D 2 O is articulated upon the utilization of a 200μg nominal 252 Cf spontaneous neutron fission source, used bare and under D 2 O spherical moderators, giving leakage neutron spectra experimentally known and/or calculated. This project has for objective the applications of those sources to Health Physics, in dosimetry (calibration of ''rad'' and ''rem-meters'') and in spectrometry, associated with the experimental system of measurements made by the generalization of the BONNER Spheres, known as ''the Multisphere System''. This communication describes the normalization method used and the results obtained leading to the adoption of a reference matrix called ''the Log-Normal Multisphere Matrix'' (LN-MM) giving the energies response functions of the generalized system for all the spheres diameters between 40 and 400 millimeters and for all the energies between 0.4eV and 15MeV [fr

Industrial applications of radiotracer and sealed source technology promoted by IAEA

International Nuclear Information System (INIS)

Joon-Ha Jin; Thereska, J.

2004-01-01

Great technical and economical benefits can be obtained by applying radioisotope technologies to various industries. The International Atomic Energy Agency (IAEA) has contributed to the development of radiotracer and sealed source technology as applied to industry and environment through coordinated research projects (CRPs). The mature and competitive techniques have been transferred and implemented to developing countries through the Agency's technical co-operation (TC) projects. The paper presents the main achievements in radiotracer and sealed source technology promoted by IAEA as well as the perspective of the technology transfer to developing countries. (author)

Asymptotically approaching the past: historiography and critical use of sources in art technological source research

NARCIS (Netherlands)

Clarke, M.; Kroustallis, S.; Townsend, J.H.; Cenalmor Bruquetas, E.; Stijnman, A.; San Andres Moya, M.

2008-01-01

This paper proposes that historiographic methods should be applied during art technological source research. Sources cannot always be used uncritically as being simply reliable records of contemporary workshop practice. The accuracy, date and origin of the technical information embedded within

48 CFR 252.237-7017 - Individual laundry.

Science.gov (United States)

2010-10-01

... clause: Individual Laundry (DEC 1991) (a) The Contractor shall provide laundry service under this... services. (c) Charges for individual laundry will be on a per unit bundle or a piece-rate basis. The... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Individual laundry. 252...

Small compact pulsed electron source for radiation technologies

International Nuclear Information System (INIS)

Korenev, Sergey

2002-01-01

The small compact pulsed electron source for radiation technologies is considered in the report. The electron source consists of pulsed high voltage Marx generator and vacuum diode with explosive emission cathode. The main parameters of electron source are next: kinetic energy is 100-150 keV, beam current is 5-200 A and pulse duration is 100-400 nsec. The distribution of absorbed doses in irradiated materials is considered. The physical feasibility of pulsed low energy electron beam for applications is considered

Measurement of uranium and plutonium in solid waste by passive photon or neutron counting and isotopic neutron source interrogation

Energy Technology Data Exchange (ETDEWEB)

Crane, T.W.

1980-03-01

A summary of the status and applicability of nondestructive assay (NDA) techniques for the measurement of uranium and plutonium in 55-gal barrels of solid waste is reported. The NDA techniques reviewed include passive gamma-ray and x-ray counting with scintillator, solid state, and proportional gas photon detectors, passive neutron counting, and active neutron interrogation with neutron and gamma-ray counting. The active neutron interrogation methods are limited to those employing isotopic neutron sources. Three generic neutron sources (alpha-n, photoneutron, and /sup 252/Cf) are considered. The neutron detectors reviewed for both prompt and delayed fission neutron detection with the above sources include thermal (/sup 3/He, /sup 10/BF/sub 3/) and recoil (/sup 4/He, CH/sub 4/) proportional gas detectors and liquid and plastic scintillator detectors. The instrument found to be best suited for low-level measurements (< 10 nCi/g) is the /sup 252/Cf Shuffler. The measurement technique consists of passive neutron counting followed by cyclic activation using a /sup 252/Cf source and delayed neutron counting with the source withdrawn. It is recommended that a waste assay station composed of a /sup 252/Cf Shuffler, a gamma-ray scanner, and a screening station be tested and evaluated at a nuclear waste site. 34 figures, 15 tables.

Design, Construction, and Modeling of a 252Cf Neutron Irradiator

Directory of Open Access Journals (Sweden)

Blake C. Anderson

2016-01-01

Full Text Available Neutron production methods are an integral part of research and analysis for an array of applications. This paper examines methods of neutron production, and the advantages of constructing a radioisotopic neutron irradiator assembly using 252Cf. Characteristic neutron behavior and cost-benefit comparative analysis between alternative modes of neutron production are also examined. The irradiator is described from initial conception to the finished design. MCNP modeling shows a total neutron flux of 3 × 105 n/(cm2·s in the irradiation chamber for a 25 μg source. Measurements of the gamma-ray and neutron dose rates near the external surface of the irradiator assembly are 120 μGy/h and 30 μSv/h, respectively, during irradiation. At completion of the project, total material, and labor costs remained below $50,000.

Open Source Cloud-Based Technologies for Bim

Science.gov (United States)

Logothetis, S.; Karachaliou, E.; Valari, E.; Stylianidis, E.

2018-05-01

This paper presents a Cloud-based open source system for storing and processing data from a 3D survey approach. More specifically, we provide an online service for viewing, storing and analysing BIM. Cloud technologies were used to develop a web interface as a BIM data centre, which can handle large BIM data using a server. The server can be accessed by many users through various electronic devices anytime and anywhere so they can view online 3D models using browsers. Nowadays, the Cloud computing is engaged progressively in facilitating BIM-based collaboration between the multiple stakeholders and disciplinary groups for complicated Architectural, Engineering and Construction (AEC) projects. Besides, the development of Open Source Software (OSS) has been rapidly growing and their use tends to be united. Although BIM and Cloud technologies are extensively known and used, there is a lack of integrated open source Cloud-based platforms able to support all stages of BIM processes. The present research aims to create an open source Cloud-based BIM system that is able to handle geospatial data. In this effort, only open source tools will be used; from the starting point of creating the 3D model with FreeCAD to its online presentation through BIMserver. Python plug-ins will be developed to link the two software which will be distributed and freely available to a large community of professional for their use. The research work will be completed by benchmarking four Cloud-based BIM systems: Autodesk BIM 360, BIMserver, Graphisoft BIMcloud and Onuma System, which present remarkable results.

OPEN SOURCE CLOUD-BASED TECHNOLOGIES FOR BIM

Directory of Open Access Journals (Sweden)

S. Logothetis

2018-05-01

Full Text Available This paper presents a Cloud-based open source system for storing and processing data from a 3D survey approach. More specifically, we provide an online service for viewing, storing and analysing BIM. Cloud technologies were used to develop a web interface as a BIM data centre, which can handle large BIM data using a server. The server can be accessed by many users through various electronic devices anytime and anywhere so they can view online 3D models using browsers. Nowadays, the Cloud computing is engaged progressively in facilitating BIM-based collaboration between the multiple stakeholders and disciplinary groups for complicated Architectural, Engineering and Construction (AEC projects. Besides, the development of Open Source Software (OSS has been rapidly growing and their use tends to be united. Although BIM and Cloud technologies are extensively known and used, there is a lack of integrated open source Cloud-based platforms able to support all stages of BIM processes. The present research aims to create an open source Cloud-based BIM system that is able to handle geospatial data. In this effort, only open source tools will be used; from the starting point of creating the 3D model with FreeCAD to its online presentation through BIMserver. Python plug-ins will be developed to link the two software which will be distributed and freely available to a large community of professional for their use. The research work will be completed by benchmarking four Cloud-based BIM systems: Autodesk BIM 360, BIMserver, Graphisoft BIMcloud and Onuma System, which present remarkable results.

Accelerating discovery with open-source technology at eLife

OpenAIRE

Penfold, Naomi

2017-01-01

Accelerating discovery with open-source technology. Talks presented May 2017.Files can be found at https://github.com/npscience/eLife-innovation-May2017-presentation.These slides are derived from a deck shared by Jennifer McLennan. All other sources acknowledged throughout the presentation.

48 CFR 252.225-7045 - Balance of Payments Program-Construction Material Under Trade Agreements.

Science.gov (United States)

2010-10-01

.... Designated country means— (1) A World Trade Organization Government Procurement Agreement (WTO GPA) country... another country, has been substantially transformed in a Free Trade Agreement country into a new and... Program-Construction Material Under Trade Agreements. 252.225-7045 Section 252.225-7045 Federal...

Calibration of brachytherapy sources using ferrous sulphate-benzoic acid-xylenol orange dosimeter

International Nuclear Information System (INIS)

Madhvanath, U.; Kini, U.R.; Gupta, B.L.

1976-01-01

A solution containing 0.20 mM of ferrous ammonium sulphate, 5.0 mM benzoic acid and 0.20 mM xylenol orange in 0.05 N sulphuric acid was used for the calibration of 252 Cf, 137 Cs, 226 Ra and 60 Co needle sources. A known volume of this solution contained in a pyrex glass tube was irradiated with the source kept in a glass capillary at the centre of the solution. A few hours of irradiation were required for each needle and the absorbance of the solution was measured at 540 nm against the unirradiated solution. The accuracy of this method was found to be within a few percent and is particularly useful for 252 Cf sources as the neutron component of the source contributes significantly to the absorbance produced. (author)

Discussion on application of water source heat pump technology to uranium mines

International Nuclear Information System (INIS)

An Qiang

2011-01-01

Application of water source heat pump units in recovering waste heat from uranium mines is discussed, and several forms of waste heat recovery are introduced. The problems in the application of water source heat pump technology are analyzed. Analysis results show that the water source heat pump technology has broad application prospects in uranium mines, and it is a way to exchange existing structure of heat and cold sources in uranium mines. (authors)

Conditioning technology of spent radium sources

International Nuclear Information System (INIS)

Kang, Il Sik; Kim, K. J.; Jang, K. D.

2001-03-01

In order to avoid accidents that could be resulted from improper storage of spent radium sources, it is necessary to condition and store them safely. The program for safe conditioning of spent radium sources by IAEA has been established to assist the developing countries. The main object of this report is to understand well and apply the technology that was applied in conditioning the national inventory of Ra-226 sources in Myanmar, as a part of IAEA's project by the Korean expert team. The report is the result that the Korean expert team carried out in Myanmar under the project title 'Radium Conditioning Service in Myanmar(INT4131-06646C)'. As a result of the mission, a whole inventory, 1,429.5 mCi of spent radium sources was safely conditioned by the Korean expert team according to the manual under the supervision of IAEA's technical officer, Mr. Al-Mughrabi, and under the control of DAE authority. These sources were encapsuled in 27 small capsules and 3 large capsules, and conditioned in 3 lead shields, producing 3 packages. The inventories were distributed into 3 shielding devices, holding 500, 459.5, and 470 mCi

DWH MC 252: Subsurface Oil Transport

Science.gov (United States)

Beegle-Krause, C. J.; Boyer, T.; Murray, D.

2010-12-01

Before reaching the ocean surface, the oil and gas released from the DWH MC 252 blowout at 1500 m moves as a buoyant plume until the trapping depth and plume transition point are reached (Zheng et al 2002). At the transition point, the oil droplets and bubbles move independently of each other, and rise at a rate related to their diameter. The oil density, droplet size distribution and currents primarily determine the distribution of the oil between: Large droplets that rise quickly and create a surface expression of the oil. Moderate size droplets that rise over the course of days, and so spread out quite differently than the surface oil, and commonly do not reach the surface in large enough quantities to create a surface sheen. These droplets separate in the currents, particularly in the strong current shear in upper 500 m currents. Very tiny droplets that rise very slowly, over the course or weeks to months, and may be removed by dissolution, biodegradation or marine snow before ever reaching the surface. Modeling and observations (Joint Analysis Group, 2010) confirm the presence of a deep layer of oil and gas between approximately 1100 and 1300 m over the release location and spreading out along the isopycnal surfaces. Later in the event, a small oxygen depression was a proxy for where oil and gas had been. The DWH MC252 well is located at intermediate depth in the Gulf of Mexico (GoM). The water mass is Antarctic Intermediate Water, which enters and exits the GoM through the Yucatan Straits. Surface influences, such as Loop Current Frontal Eddies (e.g. Berger et al 2000) can reach down to these depths, and alter the flow within De Soto Canyon. The water mass containing the deep layer of oil droplets changes depth within the GoM, but does not reach above a depth of about 900 m. There are no physical processes that could cause this deep layer of oil to reach the continental shelf or the Florida Straits. Observed and historical hydrographic data, observations

Optical and near-infrared survey of the stellar contents associated with the star-forming complex Sh2-252

Science.gov (United States)

Jose, Jessy; Pandey, A. K.; Ogura, K.; Samal, M. R.; Ojha, D. K.; Bhatt, B. C.; Chauhan, N.; Eswaraiah, C.; Mito, H.; Kobayashi, N.; Yadav, R. K.

2012-08-01

We present the analyses of the stellar contents associated with the extended H II region Sh2-252 using deep optical UBVRI photometry, slit and slitless spectroscopy along with the near-infrared (NIR) data from Two-Micron All-Sky Survey (2MASS) for an area ˜ 1 × 1 deg2. We have studied the sub-regions of Sh2-252, which includes four compact-H II (CH II ) regions, namely A, B, C and E, and two clusters, NGC 2175s and Teutsch 136 (Teu 136). Of the 15 spectroscopically observed bright stars, eight have been identified as massive members of spectral class earlier than B3. From the spectrophotometric analyses, we derived the average distance of the region as 2.4 ± 0.2 kpc, and the reddening E(B - V) of the massive members is found to vary between 0.35 and 2.1 mag. We found that NGC 2175s and Teu 136, located towards the eastern edge of the complex, are the sub-clusters of Sh2-252. The stellar surface density distribution in K band shows clustering associated with the regions A, C, E, NGC 2175s and Teu 136. We have also identified the candidate ionizing sources of the CH II regions. 61 Hα emission sources are identified using slitless spectroscopy. The distribution of the Hα emission sources and candidate young stellar objects (YSOs) with IR excess on the V/(V - I) colour-magnitude diagram (CMD) shows that a majority of them have approximate ages between 0.1 and 5 Myr and masses in the range of 0.3-2.5 M⊙. The optical CMDs of the candidate pre-main-sequence (PMS) sources in the individual regions also show an age spread of 0.1-5 Myr for each of them. We calculated the K-band luminosity functions (KLFs) for the sub-regions A, C, E, NGC 2175s and Teu 136. Within errors, the KLFs for all the sub-regions are found to be similar and comparable to that of young clusters of age <5 Myr. We also estimated the mass function of the PMS sample of the individual regions in the mass range of 0.3-2.5 M⊙. In general, the slopes of the MFs of all the sub-regions are found

Time-of-flight mass spectrometry with desorption-ionization multiprobes (UV photons and KeV and MeV particles). Cluster atoms are used as projectiles

International Nuclear Information System (INIS)

Brunelle, A.

1990-09-01

A new time-of-flight mass spectrometer, Super-Depil, is used to study secondary ion emission from solid surfaces bombarded by various kinds of primary particles. Three different desorption probes were set up on this machine: a 252 californium source, providing by spontaneous fission about 1 MeV/u energy heavy ions, a 5 to 30 keV energy pulsed caesium ion gun and a pulsed nitrogen laser, which wavelength is 337 mm. A two stages electrostatic mirror was added to the spectrometer. The time spread due to the initial kinetic energy of secondary ions leaving the surface was minimized. The mass resolution is greater than 5000. The analysis of glycosidic terpenes showed the complementarity of the three probes. The study of such metastable ions, with the electrostatic mirror, showed that some fragment ions may conserve the memory of the stereochemistry of the neutral lost. Clusters ions were used as projectiles in the energy range 5-60 keV. A strong non linear enhancement was observed in the secondary ion yield from various targets [fr

Fast neutron tomography with real-time pulse-shape discrimination in organic scintillation detectors

Energy Technology Data Exchange (ETDEWEB)

Joyce, Malcolm J., E-mail: m.joyce@lancaster.ac.uk [Department of Engineering, Lancaster University, Lancaster, Lancashire LA1 4YW (United Kingdom); Agar, Stewart [Department of Engineering, Lancaster University, Lancaster, Lancashire LA1 4YW (United Kingdom); Aspinall, Michael D. [Hybrid Instruments Ltd., Gordon Manley Building, Lancaster Environment Centre, Lancaster University, Lancaster LA1 4YW (United Kingdom); Beaumont, Jonathan S.; Colley, Edmund; Colling, Miriam; Dykes, Joseph; Kardasopoulos, Phoevos; Mitton, Katie [Department of Engineering, Lancaster University, Lancaster, Lancashire LA1 4YW (United Kingdom)

2016-10-21

A fast neutron tomography system based on the use of real-time pulse-shape discrimination in 7 organic liquid scintillation detectors is described. The system has been tested with a californium-252 source of dose rate 163 μSv/h at 1 m and neutron emission rate of 1.5×10{sup 7} per second into 4π and a maximum acquisition time of 2 h, to characterize two 100×100×100 mm{sup 3} concrete samples. The first of these was a solid sample and the second has a vertical, cylindrical void. The experimental data, supported by simulations with both Monte Carlo methods and MATLAB®, indicate that the presence of the internal cylindrical void, corners and inhomogeneities in the samples can be discerned. The potential for fast neutron assay of this type with the capability to probe hydrogenous features in large low-Z samples is discussed. Neutron tomography of bulk porous samples is achieved that combines effective penetration not possible with thermal neutrons in the absence of beam hardening.

Test and evaluation of infrared detectors and arrays; Proceedings of the Meeting, Orlando, FL, Mar. 27-29, 1989

Science.gov (United States)

Hoke, Forney M.

Papers on the testing and evaluation of IR detectors and arrays are presented, covering topics such as a short wavelength IR test system, pulse height analysis, the use of an expert system for IR detector testing, low-background IR focal plane testing, electron beam testing, high performance silicide Schottky photodiodes, the SDI organization focal plane test program, the absorption cross section of arsenic in silicon, and long wavelength IR hybrids. Other topics include low background radiometric detector measurements, an ultralow background dewar for IR detector characterization studies, a computer assisted mosaic array test station, a configurable detector array test station, automated detector material characterization capabilities, and a test system for mercury cadmium telluride photoconductor arrays. Additional topics include ionization dosimetry measurements inside a dewar for linac electron and californium-252 neutron environments, a radiation test facility using a variable-flux electron beam source, automated visual inspection of IR focal plane arrays, a titanium cryostat for low temperature radiation effects studies, a low dose rate gamma test facility, and the test and evaluation of stability in IR staring focal plane arrays after nonuniformity correction.

1987 Neutron and gamma personnel dosimeter intercomparison study using a D2O-moderated 252Cf source

International Nuclear Information System (INIS)

Swaja, R.E.; West, L.E.; Sims, C.S.; Welty, T.J.

1989-05-01

The thirteenth Personnel Dosimetry Intercomparison Study (i.e., PDIS 13) was conducted during April 1987 as a joint effort by Oak Ridge National Laboratory's (ORNL) Dosimetry Applications Research Group and the Southwest Radiation Calibration Center at the University of Arkansas. A total of 48 organizations (34 from the US and 14 from abroad) participated in PDIS 13. Participants submitted a total of 1,113 neutron and gamma dosimeters for this mixed field study. The dosimeters were transferred by mail and were handled by experimental personnel at ORNL and the University of Arkansas. The type of neutron dosimeter and the percentage of participants submitting that type are as follows: TLD-albedo (49%), direct interaction TLD (31%), CR-39 (17%), film (3%). The type of gamma dosimeter and the percentage of participants submitting that type are as follows: Li 2 B 4 O 7 , alone or in combination with CaSO 4 , (69%), 7 LiF (28%), natural LiF (3%). Radiation exposures in PDIS 13 were limited to 0.5 and 1.5 mSv from 252 Cf moderated by 15-cm of D 2 O. Traditional exposures using the Health Physics Research Reactor (HPRR) were not possible due to the fact that all reactors at ORNL, including the HPRR, were shutdown by order of the Department of Energy at the time the intercomparison was performed. Planned exposures using a 238 PuBe source were negated by a faulty timing mechanism. Based on accuracy and precision, direct interaction TLD dosimeters exhibited the best performance in PDIS 13 neutron measurements. They were followed, in order of best performance, by CR-39, TLD albedo, and film. The Li 2 B 4 O 7 type TLD dosimeters exhibited the best performance in PDIS 13 gamma measurements. They were followed by natural LiF, 7 LiF, and film. 12 refs., 1 fig., 5 tabs

46 CFR 252.40 - Payment of subsidy.

Science.gov (United States)

2010-10-01

... Payment and Billing Procedures § 252.40 Payment of subsidy. (a) Submission of voucher. At the close of each calendar month, the subsidized operator may submit a voucher, and include for payment in such... submit an initial voucher and include for payment in such voucher a percentage of the ODS payable for the...

48 CFR 252.227-7005 - License term.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term. 252.227-7005..., DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And... referred to in the “License Grant” clause of this contract and any and all patents hereafter issued on...

Implementation of the Fissile Mass Flow Monitor Source Verification and Confirmation

Energy Technology Data Exchange (ETDEWEB)

Uckan, Taner [ORNL; March-Leuba, Jose A [ORNL; Powell, Danny H [ORNL; Nelson, Dennis [Sandia National Laboratories (SNL); Radev, Radoslav [Lawrence Livermore National Laboratory (LLNL)

2007-12-01

This report presents the verification procedure for neutron sources installed in U.S. Department of Energy equipment used to measure fissile material flow. The Fissile Mass Flow Monitor (FMFM) equipment determines the {sup 235}U fissile mass flow of UF{sub 6} gas streams by using {sup 252}Cf neutron sources for fission activation of the UF{sub 6} gas and by measuring the fission products in the flow. The {sup 252}Cf sources in each FMFM are typically replaced every 2 to 3 years due to their relatively short half-life ({approx} 2.65 years). During installation of the new FMFM sources, the source identity and neutronic characteristics provided by the manufacturer are verified with the following equipment: (1) a remote-control video television (RCTV) camera monitoring system is used to confirm the source identity, and (2) a neutron detection system (NDS) is used for source-strength confirmation. Use of the RCTV and NDS permits remote monitoring of the source replacement process and eliminates unnecessary radiation exposure. The RCTV, NDS, and the confirmation process are described in detail in this report.

Implementation of the Fissile Mass Flow Monitor Source Verification and Confirmation

International Nuclear Information System (INIS)

Uckan, Taner; March-Leuba, Jose A.; Powell, Danny H.; Nelson, Dennis; Radev, Radoslav

2007-01-01

This report presents the verification procedure for neutron sources installed in U.S. Department of Energy equipment used to measure fissile material flow. The Fissile Mass Flow Monitor (FMFM) equipment determines the 235 U fissile mass flow of UF 6 gas streams by using 252 Cf neutron sources for fission activation of the UF 6 gas and by measuring the fission products in the flow. The 252 Cf sources in each FMFM are typically replaced every 2 to 3 years due to their relatively short half-life (∼ 2.65 years). During installation of the new FMFM sources, the source identity and neutronic characteristics provided by the manufacturer are verified with the following equipment: (1) a remote-control video television (RCTV) camera monitoring system is used to confirm the source identity, and (2) a neutron detection system (NDS) is used for source-strength confirmation. Use of the RCTV and NDS permits remote monitoring of the source replacement process and eliminates unnecessary radiation exposure. The RCTV, NDS, and the confirmation process are described in detail in this report.

Radiation sources and methods for producing them

International Nuclear Information System (INIS)

Malson, H.A.; Moyer, S.E.; Honious, H.B.; Janzow, E.F.

1979-01-01

The radiation sources contain a substrate with an electrically conducting, non-radioactive metal surface, a layer of a metal isotope of the scandium group as well as a percentage of non-radioactive binding metal being coated on the surface by means of an electroplating method. Besides examples for β sources ( 147 Pm), γ sources ( 241 Am), and neutron sources ( 252 Cf) there is described an α-radiation source ( 241 Am, 244 Cu, 238 Pu) for smoke detectors. There are given extensive tables and a bibliography. (DG) [de

48 CFR 252.225-7023 - Preference for products or services from Iraq or Afghanistan.

Science.gov (United States)

2010-10-01

... services from Iraq or Afghanistan. 252.225-7023 Section 252.225-7023 Federal Acquisition Regulations System... from Iraq or Afghanistan. As prescribed in 225.7703-5(a), use the following provision: Requirement for Products or Services from Iraq or Afghanistan (APR 2010) (a) Definitions. Product from Iraq or Afghanistan...

Shielding of radiation fields generated by {sup 252}Cf in a concrete maze. Part 2 -- Simulation

Energy Technology Data Exchange (ETDEWEB)

Fasso, A.; Ipe, N.E.; Reyna, A. [Stanford Univ., CA (US). Stanford Linear Accelerator Center; McCall, R.C. [McCall Associates, Woodside, CA (US)

1998-03-01

A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare {sup 252}Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation.

Synchrotron light sources: A powerful tool for science and technology

International Nuclear Information System (INIS)

Schlachter, F.; Robinson, A.

1996-01-01

A new generation of synchrotron light sources is producing extremely bright beams of vacuum-ultraviolet and x-ray radiation, poweful new tools for research in a wide variety of basic and applied sciences. Spectromicroscopy using high spectral and spatial resolution is a new way of seeing, offering many opportunities in the study of matter. Development of a new light source provides the country or region of the world in which the light source is located many new opportunities: a focal point for research in many scientific and technological areas, a means of upgrading the technology infrastructure of the country, a means of training students, and a potential service to industry. A light source for Southeast Asia would thus be a major resource for many years. Scientists and engineers from light sources around the world look forward to providing assistance to make this a reality in Southeast Asia

Synchrotron light sources: A powerful tool for science and technology

International Nuclear Information System (INIS)

Schlachter, F.; Robinson, A.

1996-01-01

A new generation of synchrotron light sources is producing extremely bright beams of vacuum-ultraviolet and x-ray radiation, powerful new tools for research in a wide variety of basic and applied sciences. Spectromicroscopy using high spectral and spatial resolution is a new way of seeing, offering many opportunities in the study of matter. Development of a new light source provides the country or region of the world in which the light source is located many new opportunities: a focal point for research in many scientific and technological areas, a means of upgrading the technology infrastructure of the country, a means of training students, and a potential service to industry. A light source for Southeast Asia would thus be a major resource for many years. Scientists and engineers from light sources around the world look forward to providing assistance to make this a reality in Southeast Asia

48 CFR 252.225-7020 - Trade Agreements Certificate.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade Agreements... of Provisions And Clauses 252.225-7020 Trade Agreements Certificate. As prescribed in 225.1101(5), use the following provision: Trade Agreements Certificate (JAN 2005) (a) Definitions. Designated...

48 CFR 252.225-7024 - Requirement for products or services from Iraq or Afghanistan.

Science.gov (United States)

2010-10-01

... or services from Iraq or Afghanistan. 252.225-7024 Section 252.225-7024 Federal Acquisition... products or services from Iraq or Afghanistan. As prescribed in 225.7703-5(b), use the following clause: Requirement for Products or Services From Iraq or Afghanistan (SEP 2008) (a) Definitions. As used in this...

48 CFR 252.235-7001 - Indemnification under 10 U.S.C. 2354-cost reimbursement.

Science.gov (United States)

2010-10-01

....S.C. 2354-cost reimbursement. 252.235-7001 Section 252.235-7001 Federal Acquisition Regulations.... 2354—cost reimbursement. As prescribed in 235.070-3, use the following clause: Indemnification Under 10 U.S.C. 2354—Cost Reimbursement (DEC 1991) (a) This clause provides for indemnification under 10 U.S...

30 CFR 250.252 - What environmental monitoring information must accompany the DPP or DOCD?

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What environmental monitoring information must accompany the DPP or DOCD? 250.252 Section 250.252 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... incidental take of marine mammals as may be necessary under the MMPA. (c) Flower Garden Banks National Marine...

50 CFR 216.252 - Permissible methods of taking.

Science.gov (United States)

2010-10-01

... ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking Marine Mammals Incidental to Conducting Precision Strike Weapon Missions in the Gulf of Mexico § 216.252 Permissible methods of taking. (a) Under Letters of Authorization issued pursuant to...

A review of neutron scattering correction for the calibration of neutron survey meters using the shadow cone method

Energy Technology Data Exchange (ETDEWEB)

Kim, Sang In; Kim, Bong Hwan; Kim, Jang Lyul; Lee, Jung Il [Health Physics Team, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2015-12-15

The calibration methods of neutron-measuring devices such as the neutron survey meter have advantages and disadvantages. To compare the calibration factors obtained by the shadow cone method and semi-empirical method, 10 neutron survey meters of five different types were used in this study. This experiment was performed at the Korea Atomic Energy Research Institute (KAERI; Daejeon, South Korea), and the calibration neutron fields were constructed using a {sup 252}Californium ({sup 252}Cf) neutron source, which was positioned in the center of the neutron irradiation room. The neutron spectra of the calibration neutron fields were measured by a europium-activated lithium iodide scintillator in combination with KAERI's Bonner sphere system. When the shadow cone method was used, 10 single moderator-based survey meters exhibited a smaller calibration factor by as much as 3.1 - 9.3% than that of the semi-empirical method. This finding indicates that neutron survey meters underestimated the scattered neutrons and attenuated neutrons (i.e., the total scatter corrections). This underestimation of the calibration factor was attributed to the fact that single moderator-based survey meters have an under-ambient dose equivalent response in the thermal or thermal-dominant neutron field. As a result, when the shadow cone method is used for a single moderator-based survey meter, an additional correction and the International Organization for Standardization standard 8529-2 for room-scattered neutrons should be considered.

A review of neutron scattering correction for the calibration of neutron survey meters using the shadow cone method

International Nuclear Information System (INIS)

Kim, Sang In; Kim, Bong Hwan; Kim, Jang Lyul; Lee, Jung Il

2015-01-01

The calibration methods of neutron-measuring devices such as the neutron survey meter have advantages and disadvantages. To compare the calibration factors obtained by the shadow cone method and semi-empirical method, 10 neutron survey meters of five different types were used in this study. This experiment was performed at the Korea Atomic Energy Research Institute (KAERI; Daejeon, South Korea), and the calibration neutron fields were constructed using a 252 Californium ( 252 Cf) neutron source, which was positioned in the center of the neutron irradiation room. The neutron spectra of the calibration neutron fields were measured by a europium-activated lithium iodide scintillator in combination with KAERI's Bonner sphere system. When the shadow cone method was used, 10 single moderator-based survey meters exhibited a smaller calibration factor by as much as 3.1 - 9.3% than that of the semi-empirical method. This finding indicates that neutron survey meters underestimated the scattered neutrons and attenuated neutrons (i.e., the total scatter corrections). This underestimation of the calibration factor was attributed to the fact that single moderator-based survey meters have an under-ambient dose equivalent response in the thermal or thermal-dominant neutron field. As a result, when the shadow cone method is used for a single moderator-based survey meter, an additional correction and the International Organization for Standardization standard 8529-2 for room-scattered neutrons should be considered

Spectrometry and dosimetry of isotopic sources of neutrons by means of artificial neural networks; Espectrometria y dosimetria de fuentes isotopicas de neutrones mediante redes neuronales artificiales

Energy Technology Data Exchange (ETDEWEB)

Vega C, H. R.; Ortiz R, J. M.; Hernandez D, V. M; Martinez B, M. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Calle Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Gallego, E.; Lorente, A. [Universidad Politecnica de Madrid, Departamento de Ingenieria Nuclear, C/Jose Gutierrez Abascal No. 2, 28006 Madrid (Spain); Barquero, R., E-mail: fermineutron@yahoo.co [Hospital del Rio Hortega, C/Dulzaina No. 2, 47012 Valladolid (Spain)

2010-09-15

The artificial neural networks technology has been applied to reconstruct the neutrons spectra of two isotopic sources: {sup 252}Cf, and {sup 241}Am-Be. Also, this technology has been applied to obtain the effective dose, E, and the personal dose equivalents, Hp(10) and environmental, H *(10). To obtain the spectra and the doses only were used the count rates produced in a Bonner Spheres spectrometer with a scintillator of {sup 6}LiI(Eu) of 0.4 {phi} x 0.4 cm{sup 2}. The equivalent environmental dose and the spectra of the sources were also obtained by means of the reconstruction code BUNKIUT. When comparing the results obtained by means of both procedures it was found that they are consistent. (Author)

RBE of Cf-252 neutrons as determined by its lethal, mutagenic, and cytogenetic effects on human cells

International Nuclear Information System (INIS)

Ban, Sadayuki

1989-01-01

To assess the biological effects of neutrons, a man-made spontaneously fissioning isotope, Cf-252, is useful as an experimental model to obtain basic biological data on mixed radiation of gamma-rays and neutrons. The paper describes the lethal effect of Cf-252 radiation on human skin fibroblasts, its lethal and mutagenic effect on HeLa MR cells, and the micronuclei inducing effect on human peripheral lymphocytes. Dose-survival responses of three fibroblast cell strains exposed to Cf-252 radiation are measured. Individual difference is larger than the experimental fluctuation. D 10 values of each strain are obtained from the linear model and linear-quadratic model. Though the dose rate of X-ray is higher than that of Cf-252 radiations, the mean value of RBE(n+γ) is simply obtained as 1.86+0.31 (RBE:relative biological effectiveness). RBE(n) of Cf-252 neutrons to high-dose-rate X-rays is 2.29. After X-ray irradiation, the survival curve of HeLa MR cells gives an extrapolation number of 3.6. It is 1.3 after Cf-252 irradiation. At 50% survival, RBE(n+γ) and RBE(n) are 2.05 and 2.6, respectively. At 10% survival they are 2.05 and 2.6. The mutation frequencies after X-ray irradiation showed a significant non-linear increase with dose. Those after Cf-252 irradiation increase linearly with dose. (N.K.)

Determination of disintegration half-life of 252Cf

International Nuclear Information System (INIS)

Chen Keliang; Liu Guoxing; Wang Sufang; Zheng Jiwen

1991-01-01

The follow-up measurements have been made by using a Si(Au) detector with small solid angle geometry for α disintegration of 252 Cf. The measured half-life of disintegration is 2.638 ± 0.009 year. This value is in accordance with other previous results

48 CFR 252.225-7041 - Correspondence in English.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Correspondence in English... of Provisions And Clauses 252.225-7041 Correspondence in English. As prescribed in 225.1103(2), use the following clause: Correspondence in English (JUN 1997) The Contractor shall ensure that all...

48 CFR 252.229-7002 - Customs exemptions (Germany).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Customs exemptions... of Provisions And Clauses 252.229-7002 Customs exemptions (Germany). As prescribed in 229.402-70(b), use the following clause: Customs Exemptions (Germany) (JUN 1997) Imported products required for the...

48 CFR 252.237-7005 - Performance and delivery.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance and delivery... of Provisions And Clauses 252.237-7005 Performance and delivery. As prescribed in 237.7003(b), use the following clause: Performance and Delivery (DEC 1991) (a) The Contractor shall furnish the...

Decorporation of 241Am and 252Cf by Ca-DTPA from rat, Syrian and Chinese hamster

International Nuclear Information System (INIS)

Seidel, A.

1977-01-01

Retention and mobilization by Ca-DTPA of 241 Am and 252 Cf from rats, Syrian and Chinese hamsters are compared. Previous observations of a much longer residence time of actinides in hamsters liver than in rat liver are confirmed. Identical dose-effect functions were obtained for skeleton of rats and Syrian hamsters whereas 252 Cf removal from Chinese hamster skeleton was lower. The mobilization of 241 Am was lower than that of 252 Cf. With regard to species differences, qualitatively similar results were obtained for 241 Am as for 252 Cf. The results will be discussed with regard to the reduction by DTPA treatment of radiation risk in animal species with different biological half times of actinides in their livers. In this connection, attention will be paid to the usefulness of long-term DTPA treatment

Global Sourcing, Technology, and Factor Intensity: Firm-level Relationships

OpenAIRE

TOMIURA Eiichi

2007-01-01

This paper empirically examines how technology and capital intensity are related with the firm's global sourcing decision. Firm-level data are derived from a survey covering all manufacturing industries in Japan without any firm-size threshold. Firms are disaggregated by their make-or-buy decision (in-house or outsourcing) and by their choice of sourcing location (offshore or domestic). Capital-intensive or R&D-intensive firms tend to source in-house from their FDI affiliates rather than outs...

48 CFR 252.229-7005 - Tax exemptions (Spain).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax exemptions (Spain... of Provisions And Clauses 252.229-7005 Tax exemptions (Spain). As prescribed in 229.402-70(e), use the following clause: Tax Exemptions (Spain) (JUN 1997) (a) The Contractor represents that the...

Review of microscopic integral cross section data in fundamental reactor dosimetry benchmark neutron fields

International Nuclear Information System (INIS)

Fabry, A.; McElroy, W.N.; Kellogg, L.S.; Lippincott, E.P.; Grundl, J.A.; Gilliam, D.M.; Hansen, G.E.

1976-10-01

The paper is intended to review and critically discuss microscopic integral cross section measurement and calculation data for fundamental reactor dosimetry benchmark neutron fields. Specifically the review covers the following fundamental benchmarks: (1) the spontaneous californium-252 fission neutron spectrum standard field; (2) the thermal-neutron induced uranium-235 fission neutron spectrum standard field; (3) the (secondary) intermediate-energy standard neutron field at the center of the Mol-ΣΣ, NISUS, and ITN--ΣΣ facilities; (4) the reference neutron field at the center of the Coupled Fast Reactor Measurement Facility (CFRMF); (5) the reference neutron field at the center of the 10 percent enriched uranium metal, cylindrical, fast critical; and (6) the (primary) Intermediate-Energy Standard Neutron Field

48 CFR 252.225-7026 - Acquisition Restricted to Products or Services from Iraq or Afghanistan.

Science.gov (United States)

2010-10-01

... Products or Services from Iraq or Afghanistan. 252.225-7026 Section 252.225-7026 Federal Acquisition... to Products or Services from Iraq or Afghanistan. As prescribed in 225.7703-5(c), use the following clause: Acquisition Restricted to Products or Services From Iraq or Afghanistan (APR 2010) (a...

48 CFR 252.225-7036 - Buy American Act-Free Trade Agreements-Balance of Payments Program.

Science.gov (United States)

2010-10-01

... Trade Agreements-Balance of Payments Program. 252.225-7036 Section 252.225-7036 Federal Acquisition... Trade Agreements—Balance of Payments Program. As prescribed in 225.1101(11)(i), use the following clause: Buy American Act—Free Trade Agreements—Balance of Payments Program (JUL 2009) (a) Definitions. As used...

DUV light source availability improvement via further enhancement of gas management technologies

Science.gov (United States)

Riggs, Daniel J.; O'Brien, Kevin; Brown, Daniel J. W.

2011-04-01

The continuous evolution of the semiconductor market necessitates ever-increasing improvements in DUV light source uptime as defined in the SEMI E10 standard. Cymer is developing technologies to exceed current and projected light source availability requirements via significant reduction in light source downtime. As an example, consider discharge chamber gas management functions which comprise a sizable portion of DUV light source downtime. Cymer's recent introduction of Gas Lifetime Extension (GLXTM) as a productivity improvement technology for its DUV lithography light sources has demonstrated noteworthy reduction in downtime. This has been achieved by reducing the frequency of full gas replenishment events from once per 100 million pulses to as low as once per 2 billion pulses. Cymer has continued to develop relevant technologies that target further reduction in downtime associated with light source gas management functions. Cymer's current subject is the development of technologies to reduce downtime associated with gas state optimization (e.g. total chamber gas pressure) and gas life duration. Current gas state optimization involves execution of a manual procedure at regular intervals throughout the lifetime of light source core components. Cymer aims to introduce a product enhancement - iGLXTM - that eliminates the need for the manual procedure and, further, achieves 4 billion pulse gas lives. Projections of uptime on DUV light sources indicate that downtime associated with gas management will be reduced by 70% when compared with GLX2. In addition to reducing downtime, iGLX reduces DUV light source cost of operation by constraining gas usage. Usage of fluorine rich Halogen gas mix has been reduced by 20% over GLX2.

Neutron spectra and dosimetric features of isotopic neutron sources: a review

International Nuclear Information System (INIS)

Vega C, H. R.; Martinez O, S. A.

2015-10-01

A convenient way to produce neutrons is the isotopic neutron source, where the production is through (α, n), (γ, n), and spontaneous fission reactions. Isotopic neutron sources are small, easy to handle, and have a relative low cost. On the other hand the neutron yield is small and mostly of them produces neutrons with a wide energy distribution. In this work, a review is carried out about the the main features of 24 NaBe, 24 NaD 2 O, 116 InBe, 140 LaBe, 238 PuLi, 239 PuBe, 241 AmB, 241 AmBe, 241 AmF, 241 AmLi, 242 CmBe, 210 PoBe, 226 RaBe, 252 Cf and 252 Cf/D 2 O isotopic neutron source. Also, using Monte Carlo methods, the neutron spectra in 31 energy groups, the neutron mean energy; the Ambient dose equivalent, the Personal dose equivalent and the Effective dose were calculated for these isotopic neutron sources. (Author)

48 CFR 252.237-7007 - Termination for default.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Termination for default... of Provisions And Clauses 252.237-7007 Termination for default. As prescribed in 237.7003(b), use the following clause: Termination for Default (DEC 1991) (a) This clause supplements and is in addition to the...

Natural and technologically enhanced sources of radon-222

International Nuclear Information System (INIS)

Travis, C.C.; Watson, A.P.; McDowell-Boyer, L.M.; Cotter, S.J.; Randolph, M.L.; Fields, D.E.

1979-01-01

An assessment of 222 Rn releases (curies/year) from major natural and technologically enhanced sources in the United States is presented. The resulting inhalation population dose commitments to the bronchial epithelium of the lung (lung-rem) are also estimated. The sources of radon considered are natural soil, evapotranspiration, potable water supplies, building materials, natural gas, uranium mining and milling, coal and phosphate mining, phosphate fertilizer, liquefied petroleum gas, geothermal power facilities, coal-fired power plants, and gas and oil wells. The most important natural source of 222 Rn is decay of 226 Ra in the soil and rocks of the earth's crust. This source results in approximately 40% of the total population dose from all sources of radon. The largest technoligcally enhanced contributor to population dose is airborne 222 Rn in building interiors, which is estimated to contribute 55% to the total population exposure to 222 Rn. Each of the other sources is estimated to contribute less than 3% to the total

Transfer of technology: Management of disused radioactive sources

International Nuclear Information System (INIS)

Friedrich, V.

2001-01-01

The number of sealed radioactive sources worldwide is estimated to be in the millions, although the existing registries indicate a much smaller number. If a source is no longer needed or has become unfit for the intended application, it is classified as spent or disused source. The activity of a disused source may still be in the order of GBq or TBq. Recognizing the risk associated with disused radioactive sources and the number of incidents and accidents with a wide range of consequences including widespread contamination and deterministic health effects, the IAEA has embarked on various activities dealing with the safe management of disused radioactive sources. These activities include publication of up-to-date technical information and guidance, development and distribution of management tools, transfer of technology and know-how through training and technical co-operation projects and direct assistance to solve specific safety and technical problems. This paper briefly describes these activities with reference to publications and projects carried out in various Member States. (author)

High sensitivity isotope analysis with a 252Cf--235U fueled subcritical multiplier and low background photon detector systems

International Nuclear Information System (INIS)

Wogman, N.A.; Rieck, H.G. Jr.; Laul, J.C.; MacMurdo, K.W.

1976-09-01

A 252 Cf activation analysis facility has been developed for routine multielement analysis of a wide variety of solid and liquid samples. The facility contains six sources of 252 Cf totaling slightly over 100 mg. These sources are placed in a 93 percent 235 U-enriched uranium core which is subcritical with a K effective of 0.985 (multiplication factor of 66). The system produces a thermal flux on the order of 10 +1 neutrons per square centimeter per second. A pneumatic rabbit system permits automatic irradiation, decay, and counting regimes to be performed unattended on the samples. The activated isotopes are analyzed through their photon emissions with state-of-the-art intrinsic Ge detectors, Ge(Li) detectors, and NaI(Tl) multidimensional gamma ray spectrometers. High efficiency (25 percent), low background, anticoincidence shielded Ge(Li) gamma ray detector systems have been constructed to provide the lowest possible background, yet maintain a peak to Compton ratio of greater than 1000 to 1. The multidimensional gamma ray spectrometer systems are composed of 23 cm diameter x 20 cm thick NaI(Tl) crystals surrounded by NaI(Tl) anticoincidence shields. The detection limits for over 65 elements have been determined for this system. Over 40 elements are detectable at the 1 part per million level at a precision of +-10 percent

Investigation of short-living fission products from the spontaneous fission of Cf-252

International Nuclear Information System (INIS)

Klonk, H.

1976-01-01

In this paper, a method of separating and measuring fission products of Cf-252 is presented. The measurement was achieved by means of γ-spectrometry and thus provides a quantitative analysis with a good separation of the fission products with respect to both atomic number Z and mass number A. The separation of the fission products from the fission source was achieved by means of solid traps. An automatic changing apparatus made it possible to keep irradiation and measuring times short, so even very short-lived fission products could be registered. The quantitative evaluation of primary fission products was made possible by correction according to Bateman equations. With that, the yields of single nuclides and the dispersion of charge can be determined. (orig./WL) [de

Energy and angular distributions of neutrons from 252Cf spontaneous fission

International Nuclear Information System (INIS)

Vasil'ev, Yu.A.; Sidorov, L.V.; Vasil'eva, N.K.

1982-01-01

Some results from a first series of measurements of energy and angular distributions of neutrons from 252 Cf spontaneous fission using a spectrometer with high neutron detection efficiency, i.e. a 4π neutron time-of-flight spectrometer, were already presented. Subsequently, a second series of measurements was performed using a more sophisticated technique. For this second series, we used a more intense 252 Cf layer (25,000 spontaneous fissions per second). The angular resolution was improved by a factor of 2-3 by combining the hexahedral counter modules, placed at the same angle with respect to the direction of motion of the fragments, in new panoramic counters. The neutron counters were calibrated against the average 252 Cf neutron spectrum at several positions of the axis of the fragment detector with respect to the neutron counters. In the spectrum measurements and calibration work, the scattered neutron background was not determined theoretically, as in the first series of measurements, but experimentally using four extra scintillation counters with scatter cones; the counters were set up at 60 deg., 80 deg., 100 deg., and 120 deg. to the direction of separation of the fragments

Shielding evaluation of a medical linear accelerator vault in preparation for installing a high-dose rate 252Cf remote after-loader

International Nuclear Information System (INIS)

Melhus, C. S.; Rivard, M. J.; KurKomelis, J.; Liddle, C. B.; Masse, F. X.

2005-01-01

In support of the effort to begin high-dose rate 252 Cf brachytherapy treatments at Tufts-New England Medical Center, the shielding capabilities of a clinical accelerator vault against the neutron and photon emissions from a 1.124 mg 252 Cf source were examined. Outside the clinical accelerator vault, the fast neutron dose equivalent rate was below the lower limit of detection of a CR-39 etched track detector and below 0.14 ± 0.02 μSv h -1 with a proportional counter, which is consistent, within the uncertainties, with natural background. The photon dose equivalent rate was also measured to be below background levels (0.1 μSv h -1 ) using an ionisation chamber and an optically stimulated luminescence dosemeter. A Monte Carlo simulation of neutron transport through the accelerator vault was performed to validate measured values and determine the thermal-energy to low-energy neutron component. Monte Carlo results showed that the dose equivalent rate from fast neutrons was reduced by a factor of 100,000 after attenuation through the vault wall, and the thermal-energy neutron dose equivalent rate would be an additional factor of 1000 below that of the fast neutrons. Based on these findings, the shielding installed in this facility is sufficient for the use of at least 5.0 mg of 252 Cf. (authors)

Neutron emission during acceleration of 252Cf fission fragments

International Nuclear Information System (INIS)

Batenkov, O.I.; Blinov, M.V.; Blinov, A.B.; Smirnov, S.N.

1991-01-01

We investigate neutron emission during acceleration of fission fragments in the process of spontaneous fission of 252 Cf. Experimental angular and energy distributions of neutrons are compared with the results of calculations of neutron evaporation during fragment acceleration. (author). 8 refs, 3 figs

The Implications of the Excited Rotation of Comet 252P/2000 G1 (LINEAR)

Science.gov (United States)

Li, Jian-Yang; Samarasinha, Nalin H.; Kelley, Michael S. P.; Farnocchia, Davide; Mutchler, Max J.; Ren, Yanqiong; Lu, Xiaoping; Tholen, David J.; Lister, Tim; Micheli, Marco

2018-01-01

Jupiter Family comet (JFC) 252P/LINEAR had a close encounter to Earth on 2016 March 21. We imaged the comet with the Hubble Space Telescope Wide Field Camera 3 UVIS channel through the V- and r’-band filters spanning ~8 hours on 2016 April 4. The pixel scale of 2.7 km/pixel allowed us to study the structure of the cometary coma at scales of a few kilometers to a few hundred kilometers from the nucleus, a characteristic that is unique to our data. The dust coma of 252P showed a strong, well defined, narrow and nearly linear feature in the sunward direction, and its projected position angle moved about the nucleus for ~60 deg in 8 hours, consistent with an apparent periodicity of ~7.24 hours. On the other hand, the lightcurve measured in both V- and r’-band images from a 13 km radius aperture, after corrected for color term, showed a variability of >0.14 mag that is consistent with an apparent periodicity of ~5.4 hours or its multiples. We suggest that the two different periodicities derived from coma morphology and the lightcurve is a strong indication that the nucleus of 252P is in a non-principal axis (NPA) rotation, joining two other confirmed NPA rotators (1P/Halley and 103P/Hartley 2) and comets that are potentially in NPA rotational states (e.g., 2P/Encke). However, this apparition has been unusual for 252P. In the past three perihelion passages since discovery, the comet was very weakly active compared to other JFCs. Meteor evidence also exists that it probably has been very weakly active for a few hundred years. But in our data, we saw a very active comet in this 2016 apparition with an active fraction of 40% to >100%, representing an increase of 100x with respect to its recent past. Based on our observations, 252P has a small nucleus with a radius of ~0.3 km, which suggests that its rotational state could be relatively easily changed by torques caused by outgassing. Since the very weak outgassing in the past is not likely to change the rotational state

48 CFR 252.225-7035 - Buy American Act-Free Trade Agreements-Balance of Payments Program Certificate.

Science.gov (United States)

2010-10-01

... Trade Agreements-Balance of Payments Program Certificate. 252.225-7035 Section 252.225-7035 Federal... Trade Agreements—Balance of Payments Program Certificate. As prescribed in 225.1101(10), use the following provision: Buy American Act—Free Trade Agreements—Balance of Payments Program Certificate (DEC...

Evaluation of neutron sources for ISAGE-in-situ-NAA for a future lunar mission

International Nuclear Information System (INIS)

Li, X.; Breitkreutz, H.; Burfeindt, J.; Bernhardt, H.-G.; Trieloff, M.; Hopp, J.; Jessberger, E.K.; Schwarz, W.H.; Hofmann, P.; Hiesinger, H.

2011-01-01

For a future Moon landing, a concept for an in-situ NAA involving age determination using the 40 Ar- 39 Ar method is developed. A neutron source 252 Cf is chosen for sample irradiation on the Moon. A special sample-in-source irradiation geometry is designed to provide a homogeneous distribution of neutron flux at the irradiation position. Using reflector, the neutron flux is likely to increase by almost 200%. Sample age of 1 Ga could be determined. Elemental analysis using INAA is discussed. - Highlights: → We developed a concept for an in-situ age determination on the Moon. → 252 Cf is chosen as the neutron source for the 40 Ar- 39 Ar-method. → A sample-in-source geometry is designed to provide homogeneous neutron flux. → Determination of U, Th, K and Ir using NAA on the Moon is possible.

Methods of computer experiment in gamma-radiation technologies using new radiation sources

CERN Document Server

Bratchenko, M I; Rozhkov, V V

2001-01-01

Presented id the methodology of computer modeling application for physical substantiation of new irradiation technologies and irradiators design work flow. Modeling tasks for irradiation technologies are structured along with computerized methods of their solution and appropriate types of software. Comparative analysis of available packages for Monte-Carlo modeling of electromagnetic processes in media is done concerning their application to irradiation technologies problems. The results of codes approbation and preliminary data on gamma-radiation absorbed dose distributions for nuclides of conventional sources and prospective Europium-based gamma-sources are presented.

Precision linac and laser technologies for nuclear photonics gamma-ray sources

Energy Technology Data Exchange (ETDEWEB)

Albert, F.; Hartemann, F. V.; Anderson, S. G.; Cross, R. R.; Gibson, D. J.; Hall, J.; Marsh, R. A.; Messerly, M.; Wu, S. S.; Siders, C. W.; Barty, C. P. J. [Lawrence Livermore National Laboratory, NIF and Photon Science, 7000 East Avenue, Livermore, California 94550 (United States)

2012-05-15

Tunable, high precision gamma-ray sources are under development to enable nuclear photonics, an emerging field of research. This paper focuses on the technological and theoretical challenges related to precision Compton scattering gamma-ray sources. In this scheme, incident laser photons are scattered and Doppler upshifted by a high brightness electron beam to generate tunable and highly collimated gamma-ray pulses. The electron and laser beam parameters can be optimized to achieve the spectral brightness and narrow bandwidth required by nuclear photonics applications. A description of the design of the next generation precision gamma-ray source currently under construction at Lawrence Livermore National Laboratory is presented, along with the underlying motivations. Within this context, high-gradient X-band technology, used in conjunction with fiber-based photocathode drive laser and diode pumped solid-state interaction laser technologies, will be shown to offer optimal performance for high gamma-ray spectral flux, narrow bandwidth applications.

Estimation of the sub-criticality of the sodium-cooled fast reactor Monju using the modified neutron source multiplication method

International Nuclear Information System (INIS)

Truchet, G.; Van Rooijen, W. F. G.; Shimazu, Y.; Yamaguchi, K.

2012-01-01

The Modified Neutron Source Method (MNSM) is applied to the Monju reactor. This static method to estimate sub-criticality has already given good results on commercial Pressurized Water Reactors. The MNSM consists both in the extraction of the fundamental mode seen by a detector to avoid the effect of higher modes near sources, and the correction of flux distortion effects due to control rod movement. Among Monju's particularities that have a big influence on MNSM factors are: the presence of two californium sources and the position of the detector which is located far from the core outside of the reactor vessel. The importance of spontaneous fission and (α, n) reactions which have increased during the shutdown period of 15 years will also be discussed. The relative position of detectors and sources deeply affect the correction factors in some regions. In order to evaluate the detector count rate, an analytical propagation has been conducted from the reactor vessel. For two subcritical states, an estimation of the reactivity has been made and compared to experimental data obtained in the restart experiments at Monju (2010). (authors)

Standardized UXO Technology Demonstration Site Blind Grid Scoring Record No. 252

National Research Council Canada - National Science Library

Overbay, Larry, Jr; Boutin, Matthew; Fling, Rick; McClung, Christina

2005-01-01

...) utilizing the APG Standardized UXO Technology Demonstration Site Blind Grid. The scoring record was coordinated by Larry Overbay and the Standardized UXO Technology Demonstration Site Scoring Committee...

A YOUNG ECLIPSING BINARY AND ITS LUMINOUS NEIGHBORS IN THE EMBEDDED STAR CLUSTER Sh 2-252E

Energy Technology Data Exchange (ETDEWEB)

Lester, Kathryn V.; Gies, Douglas R.; Guo, Zhao, E-mail: lester@chara.gsu.edu, E-mail: gies@chara.gsu.edu, E-mail: guo@chara.gsu.edu [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 5060, Atlanta, GA 30302-5060 (United States)

2016-12-01

We present a photometric and light curve analysis of an eccentric eclipsing binary in the K2 Campaign 0 field, which resides in Sh 2-252E, a young star cluster embedded in an H ii region. We describe a spectroscopic investigation of the three brightest stars in the crowded aperture to identify which is the binary system. We find that none of these stars are components of the eclipsing binary system, which must be one of the fainter nearby stars. These bright cluster members all have remarkable spectra: Sh 2-252a (EPIC 202062176) is a B0.5 V star with razor sharp absorption lines, Sh 2-252b is a Herbig A0 star with disk-like emission lines, and Sh 2-252c is a pre-main-sequence star with very red color.

External technology sourcing : The effect of uncertainty on governance mode choice

NARCIS (Netherlands)

van de Vrande, V.; Vanhaverbeke, W.P.M.; Duijsters, G.M.

2009-01-01

External knowledge sourcing is increasingly important for corporate entrepreneurship. In this study, we examine the effect of external and relational uncertainty on the governance choice for inter-organizational technology sourcing. We develop a number of hypotheses about the impact of environmental

8 CFR 252.5 - Special procedures for deserters from Spanish or Greek ships of war.

Science.gov (United States)

2010-01-01

... Spanish or Greek ships of war. 252.5 Section 252.5 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY... Greek ships of war. (a) General. Under E.O. 11267 of January 19, 1966 (31 FR 807) and 28 CFR 0.109, and... a ship of war of that government, while in any port of the United States, and on proof by the...

48 CFR 252.232-7005 - Reimbursement of subcontractor advance payments-DoD pilot mentor-protege program.

Science.gov (United States)

2010-10-01

... subcontractor advance payments-DoD pilot mentor-protege program. 252.232-7005 Section 252.232-7005 Federal... subcontractor advance payments—DoD pilot mentor-protege program. As prescribed in 232.412-70(c), use the following clause: Reimbursement of Subcontractor Advance Payments—DoD Pilot Mentor-Protege Program (SEP 2001...

X-Ray Measurements Of A Thermo Scientific P385 DD Neutron Generator

International Nuclear Information System (INIS)

Wharton, C. J.; Seabury, E. H.; Chichester, D. L.; Caffrey, A. J.; Simpson, J.; Lemchak, M.

2011-01-01

Idaho National Laboratory is experimenting with electrical neutron generators, as potential replacements for californium-252 radioisotopic neutron sources in its PINS prompt gamma-ray neutron activation analysis (PGNAA) system for the identification of military chemical warfare agents and explosives. In addition to neutron output, we have recently measured the x-ray output of the Thermo Scientific P385 deuterium-deuterium neutron generator. X rays are a normal byproduct from neutron generators, but depending on their intensity and energy, x rays can interfere with gamma rays from the object under test, increase gamma-spectrometer dead time, and reduce PGNAA system throughput. The P385 x-ray energy spectrum was measured with a high-purity germanium (HPGe) detector, and a broad peak is evident at about 70 keV. To identify the source of the x rays within the neutron generator assembly, it was scanned by collimated scintillation detectors along its long axis. At the strongest x-ray emission points, the generator also was rotated 60 deg. between measurements. The scans show the primary source of x-ray emission from the P385 neutron generator is an area 60 mm from the neutron production target, in the vicinity of the ion source. Rotation of the neutron generator did not significantly alter the x-ray count rate, and its x-ray emission appears to be axially symmetric. A thin lead shield, 3.2 mm (1/8 inch) thick, reduced the 70-keV generator x rays to negligible levels.

48 CFR 252.234-7002 - Earned Value Management System.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Earned Value Management... of Provisions And Clauses 252.234-7002 Earned Value Management System. As prescribed in 234.203(2), use the following clause: Earned Value Management System (APR 2008) (a) In the performance of this...

48 CFR 252.227-7007 - License term-running royalty.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term-running... of Provisions And Clauses 252.227-7007 License term—running royalty. As prescribed at 227.7009-4(b), insert the following clause in patent releases, license agreements, and assignments: License Term—Running...

Evaluation of neutron sources for ISAGE-in-situ-NAA for a future lunar mission

Energy Technology Data Exchange (ETDEWEB)

Li, X., E-mail: xiaosong.li@frm2.tum.de [Forschungs-Neutronenquelle Heinz Maier-Leibnitz, FRM II, Technische Universitaet Muenchen, Lichtenbergstr. 1, D-85747 Garching (Germany); Breitkreutz, H. [Forschungs-Neutronenquelle Heinz Maier-Leibnitz, FRM II, Technische Universitaet Muenchen, Lichtenbergstr. 1, D-85747 Garching (Germany); Burfeindt, J.; Bernhardt, H.-G. [Kayser-Threde GmbH, Wolfratshauser Str. 48, D-81379 Muenchen (Germany); Trieloff, M.; Hopp, J. [Institut fuer Geowissenschaften, Ruprecht-Karls-Universitaet Heidelberg, D-69120 Heidelberg (Germany); Jessberger, E.K. [Institut fuer Planetologie, Westfaelische Wilhelms-Universitaet Muenster, D-48149 Muenster (Germany); Schwarz, W.H. [Institut fuer Geowissenschaften, Ruprecht-Karls-Universitaet Heidelberg, D-69120 Heidelberg (Germany); Hofmann, P. [Kayser-Threde GmbH, Wolfratshauser Str. 48, D-81379 Muenchen (Germany); Hiesinger, H. [Institut fuer Planetologie, Westfaelische Wilhelms-Universitaet Muenster, D-48149 Muenster (Germany)

2011-11-15

For a future Moon landing, a concept for an in-situ NAA involving age determination using the {sup 40}Ar-{sup 39}Ar method is developed. A neutron source {sup 252}Cf is chosen for sample irradiation on the Moon. A special sample-in-source irradiation geometry is designed to provide a homogeneous distribution of neutron flux at the irradiation position. Using reflector, the neutron flux is likely to increase by almost 200%. Sample age of 1 Ga could be determined. Elemental analysis using INAA is discussed. - Highlights: > We developed a concept for an in-situ age determination on the Moon. > {sup 252}Cf is chosen as the neutron source for the {sup 40}Ar-{sup 39}Ar-method. > A sample-in-source geometry is designed to provide homogeneous neutron flux. > Determination of U, Th, K and Ir using NAA on the Moon is possible.

Multielemental nondestructive neutron activation analysis of Dy, Mn, Eu, Na, Ga, W, La and Sm involving cyclic irradiations with 252Cf

International Nuclear Information System (INIS)

Narkhede, S.S.; Turel, Z.R.

1995-01-01

Dy, Mn, Eu, Na, Ga, W, La and Sm respond very well to INAA technique because of their favourable nuclear properties such as high thermal neutron cross-section or abundance. In the present work a method has been developed for the determination of these elements employing cycle irradiation with 252 Cf thermal neutron source. Radioassaying of the irradiated sample and standard was done employing HPGe detector in conjunction with a PC based MCA units. (author). 2 tabs

Evaluation of mass distribution data from 252Cf spontaneous fission

International Nuclear Information System (INIS)

Liu Tingjin

2003-01-01

The mass distribution data of 252 Cf spontaneous fission were evaluated based on 7 sets of available experimental data. The measured data were corrected for the standards and γ intensity used by using the new evaluated ones. The errors were made necessary adjusting. The evaluated experimental data were fitted with spline function without any restriction and with symmetric restriction. These two sets of fit data were recommended as reference data of the mass distribution of 252 Cf spontaneous fission. The errors of the recommended data were considerably reduced comparing with the measured ones. The light and heavy peaks are not completely symmetric. Also there are fine structures on the right side of the light peak at A=109-111 and left side of the heavy peak at A=137-139. These should be paid attention and studied further. (author)

Neutron spectra and dosimetric features of isotopic neutron sources: a review

Energy Technology Data Exchange (ETDEWEB)

Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98060 Zacatecas, Zac. (Mexico); Martinez O, S. A., E-mail: fermineutron@yahoo.com [Universidad Pedagogica y Tecnologica de Colombia, Grupo de Fisica Nuclear Aplicada y Simulacion, Av. Central del Norte 39-115, 150003 Tunja, Boyaca (Colombia)

2015-10-15

A convenient way to produce neutrons is the isotopic neutron source, where the production is through (α, n), (γ, n), and spontaneous fission reactions. Isotopic neutron sources are small, easy to handle, and have a relative low cost. On the other hand the neutron yield is small and mostly of them produces neutrons with a wide energy distribution. In this work, a review is carried out about the the main features of {sup 24}NaBe, {sup 24}NaD{sub 2}O, {sup 116}InBe, {sup 140}LaBe, {sup 238}PuLi, {sup 239}PuBe, {sup 241}AmB, {sup 241}AmBe, {sup 241}AmF, {sup 241}AmLi, {sup 242}CmBe, {sup 210}PoBe, {sup 226}RaBe, {sup 252}Cf and {sup 252}Cf/D{sub 2}O isotopic neutron source. Also, using Monte Carlo methods, the neutron spectra in 31 energy groups, the neutron mean energy; the Ambient dose equivalent, the Personal dose equivalent and the Effective dose were calculated for these isotopic neutron sources. (Author)

A portable measurement system for subcriticality measurements by the CF-source-driven neutron noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; Ragan, G.E.; Blakeman, E.D.

1988-01-01

A portable measurement system consisting of a personal computer used as a Fourier analyzer and three detection channels (with associated electronics that provide the signals to analog-to-digital (A/D) convertors) has been assembled to measure subcriticality by the /sup 252/Cf-source-driven neutron noise analysis method. The /sup 252/Cf-source-driven neutron noise analysis method for obtaining the subcritical neutron multiplication factor of a configuration of fissile material requires measurement of the frequency-dependent cross-power spectral density (CPSD), G/sub 23/(ω), between a pair of detectors (Nos. 2 and 3) located in or near the fissile material and CPSDs G/sub 12/(ω) and G/sub 13/(ω) between these same detectors and a source of neutrons emanating from an ionization chamber (No. 1) containing /sup 252/Cf, also positioned in or near the fissile material. The auto-power spectral density (APSD), G/sub 11/(ω), of the source is also required. A particular ratio of spectral densities, G/sub 12//sup */G/sub 13//G/sub 11/G/sub 23/ (/sup */ denotes complex conjugation), is then formed. This ratio is related to the subcritical neutron multiplication factor and is independent of detector efficiencies

48 CFR 252.227-7006 - License grant-running royalty.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License grant-running... of Provisions And Clauses 252.227-7006 License grant—running royalty. As prescribed at 227.7009-4(a...—Running Royalty (AUG 1984) (a) The Contractor hereby grants to the Government, as represented by the...

48 CFR 252.227-7033 - Rights in shop drawings.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in shop drawings... of Provisions And Clauses 252.227-7033 Rights in shop drawings. As prescribed in 227.7107-(1)(c), use the following clause: Rights in Shop Drawings (APR 1966) (a) Shop drawings for construction means...

Federal Technology Alert: Ground-Source Heat Pumps Applied to Federal Facilities-Second Edition; FINAL

International Nuclear Information System (INIS)

Hadley, Donald L

2001-01-01

This Federal Technology Alert, which was sponsored by the U.S. Department of Energy's Office of Federal Energy Management Programs, provides the detailed information and procedures that a Federal energy manager needs to evaluate most ground-source heat pump applications. This report updates an earlier report on ground-source heat pumps that was published in September 1995. In the current report, general benefits of this technology to the Federal sector are described, as are ground-source heat pump operation, system types, design variations, energy savings, and other benefits. In addition, information on current manufacturers, technology users, and references for further reading are provided

Preliminary MCNP-POLIMI Simulations for the Evaluation of the ''Floor Effect'' Comparison of APSTNG and Cf Sources

CERN Document Server

Pozzi, S A

2002-01-01

The present simulations performed with the Monte Carlo code MCNP-POLIMI [1] have the scope of evaluating the associated-particle sealed tube neutron generator (APSTNG) for use as an interrogation source in the source-driven noise analysis method for the assay of nuclear materials. In the Nuclear Materials Identification System (NMIS) developed at the Oak Ridge National Laboratory, the time dependent cross-correlation of the timed neutron source and detector responses is one of the signatures acquired. Previous studies and measurements have demonstrated the sensitivity of this and other related signatures to fissile mass [2-3]. In a recent report [4], we outlined the advantages of the APSTNG interrogation source for use with NMIS when compared with the Cf-252 source. In particular, we showed that when the distance between the source and the sample and the sample and the detectors is large, the APSTNG source outperforms the Cf-252 in sensitivity to fissile mass. This is the case when performing measurements of ...

Innovative ion sources for accelerators: the benefits of the plasma technology

Czech Academy of Sciences Publication Activity Database

Gammino, S.; Ciavola, G.; Celona, L.; Torrisi, L.; Ando, L.; Presti, M.; Láska, Leoš; Krása, Josef; Wolowski, J.

2004-01-01

Roč. 54, Suppl. C (2004), s. C883-C888 ISSN 0011-4626. [Symposium on Plasma Physics and Technology /21./. Praha, 14.06.2004-17.06.2004] R&D Projects: GA AV ČR IAA1010405 Institutional research plan: CEZ:AV0Z1010921 Keywords : plasma sources * ion sources * proton sources * ECR Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 0.292, year: 2004

Specific factors influencing information system/information and communication technology sourcing strategies in healthcare facilities.

Science.gov (United States)

Potančok, Martin; Voříšek, Jiří

2016-09-01

Healthcare facilities use a number of information system/information and communication technologies. Each healthcare facility faces a need to choose sourcing strategies most suitable to ensure provision of information system/information and communication technology services, processes and resources. Currently, it is possible to observe an expansion of sourcing possibilities in healthcare informatics, which creates new requirements for sourcing strategies. Thus, the aim of this article is to identify factors influencing information system/information and communication technology sourcing strategies in healthcare facilities. The identification was based on qualitative research, namely, a case study. This study provides a set of internal and external factors with their impact levels. The findings also show that not enough attention is paid to these factors during decision-making. © The Author(s) 2015.

Interactive effects between Lymphotoxin α +252 polymorphism and habits of substance use on risk of hepatocellular carcinoma

Directory of Open Access Journals (Sweden)

Jung-Fa Tsai

2017-07-01

Full Text Available This case–control study aimed to assess the interactive effect between polymorphisms of lymphotoxin (LT α +252 and habitual substance use on risk of hepatocellular carcinoma (HCC. We enrolled 150 pairs of sex- and age-matched HCC patients and unrelated healthy controls. LTα genotypes were detected with polymerase-chain reaction and restrictive fragment length polymorphisms. Information about habits of substance use was obtained through personal interview. Multivariate analysis indicated that LTα +252 G/G genotypes [odds ratio (OR = 3.36], Hepatitis B surface antigen (OR = 16.68, antibodies to hepatitis C virus (OR = 34.88 and having at least two habits of substance use (OR = 2.50 were independent risk factors for HCC. There were additive interactions among LTα +252 G/G genotype, chronic viral hepatitis, and habit of each substance use. In conclusion: There are independent and additive interactions between LTα +252 G/G genotype, chronic viral hepatitis, and habits of substance use on risk of HCC.

Neutron activation determination of gold in technogenic raw materials with different mineral composition

Directory of Open Access Journals (Sweden)

Yudakov Aleksandr A.

2015-01-01

Full Text Available The methods used to determine the gold content in the technogenic objects of gold mining were analyzed regarding their non-homogeneity and complexity of chemical and mineral compositions. A possible application of the neutron activation analysis with the use of the californium source of neutrons for determining the content of fine-grained and extra-fine-grained gold in the technogenic objects, including the bottom-ash waste of energy providers, is considered. It was demonstrated that the chemical composition of the sample affects the neuron flux distribution in the sample, which can essentially distort the results of the neutron activation analysis. In order to eliminate possible systematic errors investigations of the effect of the sample mineral composition on the results of the gold determination using the neutron activation analysis were carried out. Namely, a large mass of rock (3-5 kg was loaded into an activation zone using four matrix types such as silicate, carbon-containing, iron-containing, and titanium magnetite. It was shown that there wereno significant difference between the dispersal of the fluxes of thermal and resonance neutrons emitted from 252Cf during activation of the gold-containing technogenic samples with different mineral compositions.

48 CFR 252.228-7001 - Ground and flight risk.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Ground and flight risk... of Provisions And Clauses 252.228-7001 Ground and flight risk. As prescribed in 228.370(b), use the following clause: Ground and Flight Risk (JUN 2010) (a) Definitions. As used in this clause— (1) Aircraft...

48 CFR 252.227-7020 - Rights in special works.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in special works... of Provisions And Clauses 252.227-7020 Rights in special works. As prescribed in 227.7105-3, 227.7106(a) or 227.7205(a), use the following clause: Rights in Special Works (JUN 1995) (a) Applicability...

BIOSENSOR TECHNOLOGY EVALUATIONS FOR REAL-TIME/SOURCE WATER PROTECTION

Science.gov (United States)

Recent advances in electronics and computer technology have made great strides in the field of remote sensing and biomonitoring. The quality of drinking water sources has come under closer scrutiny in recent years. Issues ranging from ecological to public health and national se...

Public support for energy sources and related technologies: The impact of simple information provision

International Nuclear Information System (INIS)

Hobman, Elizabeth V.; Ashworth, Peta

2013-01-01

Increasing public awareness and understanding of alternative energy sources and related technologies is an essential component of informed decision-making regarding new options of generating energy for a low carbon future. The current study examined the influence of psychological factors (i.e., pro-environmental beliefs, and subjective norms) and the provision of factual information on public support for a range of energy sources and related technologies. A representative sample of 1907 Australians completed an on-line survey that measured perceptions of a range of climate change and energy issues. Results showed that support for renewables is stronger than support for traditional fossil-fuel based energy sources (i.e., coal or gas) or nuclear energy. The provision of factual information about generation cost and emissions significantly changed support ratings, particularly when cost information was provided. Regression analyses revealed that pro-environmental beliefs were significantly related to support ratings for alternative energy sources. Subjective norms, however, were the strongest positive explanatory factor, suggesting that social mechanisms may be key drivers of support for new and emerging energy sources and related technologies. - Highlights: • We examine support for a wide range of energy sources and technologies. • Support changes when information on cost and emissions is provided. • Pro-environmental beliefs and social norms positively relate to support

48 CFR 252.225-7008 - Restriction on Acquisition of Specialty Metals.

Science.gov (United States)

2010-10-01

... CLAUSES Text of Provisions And Clauses 252.225-7008 Restriction on Acquisition of Specialty Metals. As... more of the following limits: Manganese, 1.65 percent; silicon, 0.60 percent; or copper, 0.60 percent...

48 CFR 252.216-7000 - Economic price adjustment-basic steel, aluminum, brass, bronze, or copper mill products.

Science.gov (United States)

2010-10-01

...-basic steel, aluminum, brass, bronze, or copper mill products. 252.216-7000 Section 252.216-7000 Federal... adjustment—basic steel, aluminum, brass, bronze, or copper mill products. As prescribed in 216.203-4-70(a... Mill Products (JUL 1997) (a) Definitions. As used in this clause— Established price means a price which...

Beyond Open Source: According to Jim Hirsch, Open Technology, Not Open Source, Is the Wave of the Future

Science.gov (United States)

Villano, Matt

2006-01-01

This article presents an interview with Jim Hirsch, an associate superintendent for technology at Piano Independent School District in Piano, Texas. Hirsch serves as a liaison for the open technologies committee of the Consortium for School Networking. In this interview, he shares his opinion on the significance of open source in K-12.

Neutron sources and its dosimetric characteristics; Fuentes de neutrones y sus caracteristicas dosimetricas

Energy Technology Data Exchange (ETDEWEB)

Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Mercado S, G.A. [Universidad Autonoma de Zacatecas, A.P. 336, 98000 Zacatecas (Mexico); Gallego D, E.; Lorente F, A. [Universidad Politecnica de Madrid, C/Jose Gutierrez Abascal 2, E-28006 Madrid (Spain)

2005-07-01

By means of Monte Carlo methods the spectra of the produced neutrons {sup 252} Cf, {sup 252} Cf/D{sub 2}O, {sup 241} Am Be, {sup 239} Pu Be, {sup 140} La Be, {sup 239} Pu{sup 18}O{sub 2} and {sup 226} Ra Be have been calculated. With the information of the spectrum it was calculated the average energy of the neutrons of each source. By means of the fluence coefficients to dose it was determined, for each one of the studied sources, the fluence factors to dose. The calculated doses were H, H{sup *}(10), H{sub p,sIab} (10, 0{sup 0}), E{sub AP} and E{sub ISO}. During the phase of the calculations the sources were modeled as punctual and their characteristics were determined to 100 cm in the hole. Also, for the case of the sources of {sup 239} Pu Be and {sup 241} Am Be, were carried out calculations modeling the sources with their respective characteristics and the dosimetric properties were determined in a space full with air. The results of this last phase of the calculations were compared with the experimental results obtained for both sources. (Author)

Chromatographic cation exchange separation of decigram quantities of californium and other transplutonium elements

Energy Technology Data Exchange (ETDEWEB)

Benker, D.E.; Chattin, F.R.; Collins, E.D.; Knauer, J.B.; Orr, P.B.; Ross, R.G.; Wiggins, J.T.

1980-01-01

Decigram quantities of highly radioactive transplutonium elements are routinely partitioned at TRU by chromatographic elution from cation resin using AHIB eluent. By using two high-pressure ion exchange columns, a small one for the initial loading of the feed and a large one for the elution, batch runs containing up to 200 mg of /sup 252/Cf can be made in about 5 hours (2 hours to load the feed and 3 hours for the elution). The number of effluent product fractions and the amount of actinides that must be collected in intermediate fractions are minimized by monitoring response from a flow-through alpha-detector. This process has been reliable and relatively easy to operate, and will continue to be used for partitioning transplutonium elements at TRU.

Redefining Requirements of Ancillary Services for Technology Agnostic Sources

DEFF Research Database (Denmark)

Bondy, Daniel Esteban Morales; MacDonald, Jason; Kara, Emre Can

2018-01-01

New sources for ancillary services are needed, yet the requirements for service provision in most countries are explicitly formulated for traditional generators. This leads to waste of the potential for new technologies to deliver ancillary services. In order to harness this potential, we propose...... to parameterize the requirements of ancillary services so that reserves can be built by combining the advantageous properties of different technologies. The proposal is exemplified through a laboratory test where it shown that the system needs can be covered through cheaper and smaller reserves....

Broadband integrated mid infrared light sources as enabling technology for point of care mid-infrared spectroscopy

Science.gov (United States)

2017-08-20

AFRL-AFOSR-JP-TR-2017-0061 Broadband integrated mid-infrared light sources as enabling technology for point-of-care mid- infrared spectroscopy Alex...mid-infrared light sources as enabling technology for point-of-care mid-infrared spectroscopy 5a.  CONTRACT NUMBER 5b.  GRANT NUMBER FA2386-16-1-4037...Broadband integrated mid-infrared light sources as enabling technology for point-of-care mid- infrared spectroscopy ” Date: 16th August 2017 Name

48 CFR 252.242-7004 - Material management and accounting system.

Science.gov (United States)

2010-10-01

... CLAUSES Text of Provisions And Clauses 252.242-7004 Material management and accounting system. As prescribed in 242.7204, use the following caluse: Material Management and Accounting System (JUL 2009) (a) Definitions. As used in this clause— (1) Material management and accounting system (MMAS) means the Contractor...

Calculation of neutron spectra for a 252Cf transport cask using ANISN running on a PC

International Nuclear Information System (INIS)

West, L.; Akin, B.P.; Lemley, E.C.

1995-01-01

Neutron spectra have been calculated using the ANISN one-dimensional discrete ordinates code for the case of a 152 Cf source in a transport cask of a particular design. All computations were done on personal computers (PCs) (mostly 486 models) with the ANISN-ORNL (486 version) computer code. With a source of 252 Cf fission neutrons, the neutron flux spectrum in the cask cannot be characterized as open-quotes moderated.close quotes Concern about an appropriate choice for the cross-section data set has led to a comparison, for this application, of three different cross-section libraries: DABL, HILO, and BUGLE-80. Although the cross-section sets were not originally designed for PC use, the libraries have been successfully employed for PC computations. Work with yet another data library, BUGLE-93, is incomplete at this stage. From neutron flux spectra on the surface of the cask, personnel dosimetric quantities (such as dose equivalent) have been determined for the DABL, HILO, and BUGLE-80 ANISN calculations

The D-D Neutron Generator as an Alternative to Am(Li) Isotopic Neutron Source in the Active Well Coincidence Counter

Energy Technology Data Exchange (ETDEWEB)

McElroy, Robert Dennis [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Cleveland, Steven L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2017-03-01

The ²³⁵U mass assay of bulk uranium items, such as oxide canisters, fuel pellets, and fuel assemblies, is not achievable by traditional gamma-ray assay techniques due to the limited penetration of the item by the characteristic ²³⁵U gamma rays. Instead, fast neutron interrogation methods such as active neutron coincidence counting must be used. For international safeguards applications, the most commonly used active neutron systems, the Active Well Coincidence Counter (AWCC), Uranium Neutron Collar (UNCL) and ²⁵²Cf Shuffler, rely on fast neutron interrogation using an isotopic neutron source [i.e., ²⁵²Cf or Am(Li)] to achieve better measurement accuracies than are possible using gamma-ray techniques for high-mass, high-density items. However, the Am(Li) sources required for the AWCC and UNCL systems are no longer manufactured, and newly produced systems rely on limited supplies of sources salvaged from disused instruments. The ²⁵²Cf shuffler systems rely on the use of high-output ²⁵²Cf sources, which while still available have become extremely costly for use in routine operations and require replacement every five to seven years. Lack of a suitable alternative neutron interrogation source would leave a potentially significant gap in the safeguarding of uranium processing facilities. In this work, we made use of Oak Ridge National Laboratory’s (ORNL’s) Large Volume Active Well Coincidence Counter (LV-AWCC) and a commercially available deuterium-deuterium (D-D) neutron generator to examine the potential of the D-D neutron generator as an alternative to the isotopic sources. We present the performance of the LV-AWCC with D-D generator for the assay of ²³⁵U based on the results of Monte Carlo N-Particle (MCNP) simulations and measurements of depleted uranium (DU), low enriched uranium (LEU), and highly enriched uranium (HEU) items.

The comparison of four neutron sources for Prompt Gamma Neutron Activation Analysis (PGNAA) in vivo detections of boron.

Science.gov (United States)

Fantidis, J G; Nicolaou, G E; Potolias, C; Vordos, N; Bandekas, D V

A Prompt Gamma Ray Neutron Activation Analysis (PGNAA) system, incorporating an isotopic neutron source has been simulated using the MCNPX Monte Carlo code. In order to improve the signal to noise ratio different collimators and a filter were placed between the neutron source and the object. The effect of the positioning of the neutron beam and the detector relative to the object has been studied. In this work the optimisation procedure is demonstrated for boron. Monte Carlo calculations were carried out to compare the performance of the proposed PGNAA system using four different neutron sources ( 241 Am/Be, 252 Cf, 241 Am/B, and DT neutron generator). Among the different systems the 252 Cf neutron based PGNAA system has the best performance.

Spallation sources in support of technology

Energy Technology Data Exchange (ETDEWEB)

Pynn, R [Los Alamos National Lab., NM (United States)

1996-05-01

In this contribution I summarize a number of recent experiments at the Los Alamos Neutron Science Center (LANSCE) that have contributed to strategic and applied research. A number of new tools have been developed to address these problems, including software that allows materials texture to be obtained during Rietveld refinement, Bragg-edge diffraction, resonant-neutron and proton radiography. These tools have the potential to impact basic as well as applied research. It is clear that a new, more powerful neutron source such as the planned Japanese Hadron Project will be able to use these and other techniques to contribute in a direct way to important industrial technologies. (author)

40 CFR 450.24 - New source performance standards reflecting the best available demonstrated control technology...

Science.gov (United States)

2010-07-01

... performance standards reflecting the best available demonstrated control technology (NSPS). Any new source... 40 Protection of Environment 29 2010-07-01 2010-07-01 false New source performance standards reflecting the best available demonstrated control technology (NSPS). 450.24 Section 450.24 Protection of...

[Evaluation of treatment technology of odor pollution source in petrochemical industry].

Science.gov (United States)

Mu, Gui-Qin; Sui, Li-Hua; Guo, Ya-Feng; Ma, Chuan-Jun; Yang, Wen-Yu; Gao, Yang

2013-12-01

Using an environmental technology assessment system, we put forward the evaluation index system for treatment technology of the typical odor pollution sources in the petroleum refining process, which has been applied in the assessment of the industrial technology. And then the best available techniques are selected for emissions of gas refinery sewage treatment plant, headspace gas of acidic water jars, headspace gas of cold coke jugs/intermediate oil tank/dirty oil tank, exhaust of oxidative sweetening, and vapors of loading and unloading oil.

Integration Of Data From Heterogeneous Sources Using Etl Technology.

Directory of Open Access Journals (Sweden)

Marek Macura

2014-01-01

Full Text Available Data integration is a crucial issue in environments of heterogeneous data sources. At present mentioned heterogeneity is becoming widespread. Whenever, based on various data sources, we want to gain useful information and knowledge we must solve data integration problem in order to apply appropriate analytical methods on comprehensive and uniform data. Such activity is known as knowledge discovery from data process. Therefore approaches to data integration problem are very interesting and bring us closer to the "age of information". The paper presents an architecture, which implements knowledge discovery from data process. The solution combines ETL technology and wrapper layer known from mediated systems. It also provides semantic integration through connections mechanism between data elements. The solution allows for integration of any data sources and implementation of analytical methods in one environment. The proposed environment is verified by applying it to data sources on the foundry industry.

Technologies for the treatment of source-separated urine in the ...

African Journals Online (AJOL)

Technologies for the treatment of source-separated urine in the eThekwini ... This practice can lead to environmental pollution, since urine contains high amounts of ... produces only distilled water and a small amount of sludge as by-products.

48 CFR 252.228-7000 - Reimbursement for war-hazard losses.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reimbursement for war... CLAUSES Text of Provisions And Clauses 252.228-7000 Reimbursement for war-hazard losses. As prescribed in 228.370(a), use the following clause: Reimbursement for War-Hazard Losses (DEC 1991) (a) Costs for...

The UMLS Knowledge Source Server: an experience in Web 2.0 technologies.

Science.gov (United States)

Thorn, Karen E; Bangalore, Anantha K; Browne, Allen C

2007-10-11

The UMLS Knowledge Source Server (UMLSKS), developed at the National Library of Medicine (NLM), makes the knowledge sources of the Unified Medical Language System (UMLS) available to the research community over the Internet. In 2003, the UMLSKS was redesigned utilizing state-of-the-art technologies available at that time. That design offered a significant improvement over the prior version but presented a set of technology-dependent issues that limited its functionality and usability. Four areas of desired improvement were identified: software interfaces, web interface content, system maintenance/deployment, and user authentication. By employing next generation web technologies, newer authentication paradigms and further refinements in modular design methods, these areas could be addressed and corrected to meet the ever increasing needs of UMLSKS developers. In this paper we detail the issues present with the existing system and describe the new system's design using new technologies considered entrants in the Web 2.0 development era.

Termocoagulación facetaria lumbar: Experiencia en 252 pacientes Thermocoagulation of lumbar facet joints: Experience in 252 patients

OpenAIRE

J. E. Martínez-Suárez; L. Camblor; S. Salva; W. A. de Jongh

2005-01-01

Se presentan 252 pacientes con el diagnóstico de dolor lumbar facetario a los que se le realizó la técnica quirúrgica de termocoagulación percutánea de la faceta articular. Nuestro propósito principal fue aliviar el dolor en estos pacientes, evaluamos la eficacia de la técnica con un 74,7% de resultados quirúrgicos satisfactorios, así como la descripción de diferentes aspectos como: edad, sexo, causas y la topografía segmentaria del dolor.Two hundred fifty two patients with diagnosis of lumba...

Use of regenerative energy sources and hydrogen technology 2006. Proceedings

International Nuclear Information System (INIS)

Lehmann, J.; Luschtinetz, T.

2006-01-01

This volume contains 25 contributions, which were held on the 13th symposium ''Use of regenerative energy sources and hydrogen technology'' in Stralsund (Germany). Separate documentation items analysing 16 of the contributions have been prepared for the ENERGY database

Fission-neutrons source with fast neutron-emission timing

Energy Technology Data Exchange (ETDEWEB)

Rusev, G., E-mail: rusev@lanl.gov; Baramsai, B.; Bond, E.M.; Jandel, M.

2016-05-01

A neutron source with fast timing has been built to help with detector-response measurements. The source is based on the neutron emission from the spontaneous fission of {sup 252}Cf. The time is provided by registering the fission fragments in a layer of a thin scintillation film with a signal rise time of 1 ns. The scintillation light output is measured by two silicon photomultipliers with rise time of 0.5 ns. Overall time resolution of the source is 0.3 ns. Design of the source and test measurements using it are described. An example application of the source for determining the neutron/gamma pulse-shape discrimination by a stilbene crystal is given.

Technology collaboration by means of an open source government

Science.gov (United States)

Berardi, Steven M.

2009-05-01

The idea of open source software originally began in the early 1980s, but it never gained widespread support until recently, largely due to the explosive growth of the Internet. Only the Internet has made this kind of concept possible, bringing together millions of software developers from around the world to pool their knowledge. The tremendous success of open source software has prompted many corporations to adopt the culture of open source and thus share information they previously held secret. The government, and specifically the Department of Defense (DoD), could also benefit from adopting an open source culture. In acquiring satellite systems, the DoD often builds walls between program offices, but installing doors between programs can promote collaboration and information sharing. This paper addresses the challenges and consequences of adopting an open source culture to facilitate technology collaboration for DoD space acquisitions. DISCLAIMER: The views presented here are the views of the author, and do not represent the views of the United States Government, United States Air Force, or the Missile Defense Agency.

137Cs - Brachytherapy sources : a technology scenario

International Nuclear Information System (INIS)

Varma, R.N.

2001-01-01

Cancer has emerged as one of the major cause of morbidity and mortality all over the world. India houses world's second largest population and registers 4-5 lakhs new cancer cases every year. Cancer of cervix is most common form of malignancy among Indian women. Radiation therapy, especially intracavity brachytherapy in conjunction with other modalities like surgery, chemotherapy has been found to be highly effective for the management and control of cervical carcinoma at all stages. A technology has been developed indigenously for the fabrication of 137 Cs sources for brachytherapy applications

48 CFR 252.227-7019 - Validation of asserted restrictions-Computer software.

Science.gov (United States)

2010-10-01

..., creates or implies privity of contract between the Government and the Contractor's subcontractors or... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7019 Validation of asserted restrictions..., unless otherwise specifically indicated, the term “Contractor” means the Contractor and its...

Clinicopathological study of 252 jaw bone periapical lesions from a private pathology laboratory.

Science.gov (United States)

Lin, Hung-Pin; Chen, Hsin-Ming; Yu, Chuan-Hang; Kuo, Ru-Cheng; Kuo, Ying-Shiung; Wang, Yi-Ping

2010-11-01

Periapical lesions are common sequelae of pulp diseases. This retrospective study evaluated the clinical and histopathological features of periapical lesions sent to a private pathology laboratory by dentists in private clinics. Two hundred and fifty-two consecutive cases of periapical lesions were collected from September 2005 to October 2009. Clinical data and histopathological features of these periapical lesions were reviewed and analyzed. The 252 periapical lesions consisted of 128 periapical granulomas, 117 periapical cysts, and seven periapical scars. These 252 lesions were taken from 252 patients (92 men and 160 women; mean age = 43.6 years; range, 9-81 years). Of the 252 periapical lesions, 186 were found in the maxilla and 66 in the mandible. The most common site for periapical lesions was the maxillary anterior region (134 cases, including 73 granulomas, 54 cysts and 7 scars), and the most frequently involved tooth was the maxillary lateral incisor (64 cases, including 29 granulomas, 31 cysts and 4 scars). Of the 117 periapical cysts, 116 were lined by stratified squamous epithelium and one by mucoepidermoid epithelium. Hyaline bodies were discovered in the lining epithelium of four periapical cysts. Odontogenic epithelial rest, cholesterol cleft, foamy histiocytes, hemosiderin-laden macrophages, dystrophic calcification, foreign bodies, and bacterial clumps were found in five, three, nine, two, 28, 10 and one periapical granulomas, respectively, as well as in six, 11, eight, seven, 19, nine and eight periapical cysts, respectively. Granulomas and cysts were the two most common periapical lesions. Periapical lesions occurred more frequently in female patients and in those in their fourth to fifth decades. The most commonly affected site for periapical lesions was the maxillary anterior region, and the most frequently involved tooth was the maxillary lateral incisor. Copyright © 2010 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All

Cf-252 neutron brachytherapy: an advance for bulky localized cancer therapy

International Nuclear Information System (INIS)

Maruyama, Y.

1984-01-01

The physical and radiobiogical basis as well as the rationale for neutron brachytherapy, using Cf-252, in human cancer therapy is reviewed. Cf-252 brachytherapy represents an economical and effective form of neutron radiotherapy that is readily and safely applied clinically. It can be used anywhere in the world without unusual personnel, equipment or facilities, or prohibitive expenses or maintenance costs. Used on bulky head and neck, thoracic, abdominal, pelvic, brain and appendage cancers, it overcomes hypoxic radioresistance and produces remarkable rates of tumor clearance. It is easily combined with photon radiotherapy and in proper schedules and doses, it can control advanced but still localized regional cancers to produce tumor cure. It will clear the local manifestations of recurrent or metastatic tumors or advanced stages of primary tumors and therefore in conjunction with other adjuvant therapies offers much more effective tumor control and palliation than present conventional therapy. (Auth.)

Neutron radiography for nondestructive testing

International Nuclear Information System (INIS)

John, J.

1979-01-01

Neutron radiography is similar to X-ray inspection in that both depend upon use of radiation that penetrates some materials and is absorbed by others to provide a contrast image of conditions not readily available for visual inspection. X-rays are absorbed by dense materials, such as metals, whereas neutrons readily penetrate metals, but are absorbed by materials containing hydrogen. The neutron radiography has been successfully applied to a number of inspection situations. These include the inspection of explosives, advanced composites, adhesively bonded structures and a number of aircraft engine components. With the availability of Californium-252, it has become feasible to construct mobile neutron radiography systems suitable for field use. Such systems have been used for in-situ inspection of flight line aircraft, particularly to locate and measure hidden corrosion

Reliability of semiconductor and gas-filled diodes for over-voltage protection exposed to ionizing radiation

Directory of Open Access Journals (Sweden)

Stanković Koviljka

2009-01-01

Full Text Available The wide-spread use of semiconductor and gas-filled diodes for non-linear over-voltage protection results in a variety of possible working conditions. It is therefore essential to have a thorough insight into their reliability in exploitation environments which imply exposure to ionizing radiation. The aim of this paper is to investigate the influence of irradiation on over-voltage diode characteristics by exposing the diodes to californium-252 combined neutron/gamma radiation field. The irradiation of semiconductor over-voltage diodes causes severe degradation of their protection characteristics. On the other hand, gas-filled over-voltage diodes exhibit a temporal improvement of performance. The results are presented with the accompanying theoretical interpretations of the observed changes in over-voltage diode behaviour, based on the interaction of radiation with materials constituting the diodes.

Neutron dosimetry and spectrometry with Bonner spheres. Working out a log-normal reference matrix

International Nuclear Information System (INIS)

Zaborowski, Henrick.

1981-11-01

From the experimental and theoretical studies made upon the BONNER's spheres System with a I 6 Li(Eu) crystal and with a miniaturized 3 He counter we get the normalized energy response functions R*sub(i)(E). This normalization is obtained by the mathematization of the Resolution Function R*(i,E) in the Log-Normal distribution hypothesis to mono energetic neutrons given in April 1976 to the International Symposium on Californium 252. The fit of the Log-Normal Hypothesis with the experimental and Theoretical data is very satisfactory. The parameter's tabulated values allow a precise interpolation, at all energies between 0.4 eV and 15 MeV and for all spheres diameters between 2 and 12 inches, of the discretized R*sub(ij) Reference Matrix for the applications to neutron dosimetry and spectrometry [fr

An Analysis of Sources of Technological Change in Efficiency Improvement of Fluorescent Lamp Systems

Science.gov (United States)

Imanaka, Takeo

In Japan, energy efficient fluorescent lamp systems which use “rare-earth phosphors” and “electronic ballasts” have shown rapid diffusion since 1990s. This report investigated sources of technological change in the efficiency improvement of fluorescent lamp systems: (i) Fluorescent lamp and luminaires have been under steady technological development for getting more energy efficient lighting and the concepts to achieve high efficiency had been found in such activities; however, it took long time until they realized and become widely used; (ii) Electronic ballasts and rare-earth phosphors add fluorescent lamp systems not only energy efficiency but also various values such as compactness, lightweight, higher output, and better color rendering properties, which have also been expected and have induced research and development (R&D) (iii) Affordable electronic ballasts are realized by the new technology “power MOSFET” which is based on IC technologies and has been developed for large markets of information and communication technologies and mobile devices; and (iv) Rare-earth phosphors became available after rare-earth industries developed for the purpose of supplying rare-earth phosphors for color television. In terms of sources of technological change, (i) corresponds to “R&D” aiming at the particular purpose i.e. energy efficiency in this case, on the other hand, (ii), (iii), and (iv) correspond to “spillovers” from activities aiming at other purposes. This case exhibits an actual example in which “spillovers” were the critical sources of technological change in energy technology.

48 CFR 252.227-7021 - Rights in data-existing works.

Science.gov (United States)

2010-10-01

... of Provisions And Clauses 252.227-7021 Rights in data—existing works. As prescribed at 227.7105-2(a), use the following clause: Rights in Data—Existing Works (MAR 1979) (a) The term works as used herein... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in data-existing...

Bacterial community shift in the coastal Gulf of Mexico salt-marsh sediment microcosm in vitro following exposure to the Mississippi Canyon Block 252 oil (MC252)

KAUST Repository

Koo, Hyunmin; Mojib, Nazia; Huang, Jonathan P.; Donahoe, Rona J.; Bej, Asim K.

2014-01-01

In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.

Bacterial community shift in the coastal Gulf of Mexico salt-marsh sediment microcosm in vitro following exposure to the Mississippi Canyon Block 252 oil (MC252)

KAUST Repository

Koo, Hyunmin

2014-07-10

In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.

48 CFR 252.219-7004 - Small business subcontracting plan (test program).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7004 Small business subcontracting plan (test program). As prescribed in 219.708(b)(1)(B), use the following clause: Small Business...

The application of n-γ discrimination in 252Cf spontaneous neutron TOF spectra measurement

International Nuclear Information System (INIS)

Zhou Haojun; Zhang Yi; Li Jiansheng; Jin Yu; Wang Jie; Li Chunyuan

2004-01-01

The BC501 scintillator is used as a fast neutron detector. The effect that the pulse rise time method was used to discriminate γ from 252 Cf spontaneous neutron TOF spectra is studied in the experiment. A pulse rise time separation spectra of γ and 252 Cf spontaneous neuron upon 1 MeV is obtained, the n-γ separation function reaches to 4.6. When the result of pulse rise time separation coincides with the time-of-flight spectra in which the neutron energy is upon 0.5 MeV, 0.8 MeV and 1.0 MeV, comparing with the anticoincidence, γ was eliminated 99.90% at least. (authors)

48 CFR 252.229-7009 - Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom).

Science.gov (United States)

2010-10-01

... and value added tax on fuel (passenger vehicles) (United Kingdom). 252.229-7009 Section 252.229-7009... Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom). As prescribed in 229.402-70(i), use the following clause: Relief from Customs Duty and Value Added Tax on Fuel...

48 CFR 252.239-7016 - Telecommunications security equipment, devices, techniques, and services.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Telecommunications... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.239-7016 Telecommunications... clause: Telecommunications Security Equipment, Devices, Techniques, and Services (DEC 1991) (a...

Understanding the different rotational behaviors of $^{252}$No and $^{254}$No in terms of high-order deformation

CERN Document Server

Liu, H L; Walker, P M

2012-01-01

Total Routhian surface calculations have been performed to investigate rapidly rotating transfermium nuclei, the heaviest nuclei accessible by detailed spectroscopy experiments. The observed fast alignment in $^{252}$No and slow alignment in $^{254}$No are well reproduced by the calculations incorporating high-order deformations. The different rotational behaviors of $^{252}$No and $^{254}$No can be understood for the first time in terms of $\\beta_6$ deformation that decreases the energies of the $\

Open-source digital technologies for low-cost monitoring of historical constructions

OpenAIRE

Basto, Camilo; Pelà, Luca; Chacón Flores, Rolando Antonio

2017-01-01

This paper shows new possibilities of using novel, open-source, low-cost platforms for the structural health monitoring of heritage structures. The objective of the study is to present an assessment of increasingly available open-source digital modeling and fabrication technologies in order to identify the suitable counterparts of the typical components of a continuous static monitoring system for a historical construction. The results of the research include a simple case-study, which is pre...

48 CFR 252.228-7006 - Compliance with Spanish laws and insurance.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Compliance with Spanish... CLAUSES Text of Provisions And Clauses 252.228-7006 Compliance with Spanish laws and insurance. As prescribed at 228.370(e), use the following clause: Compliance with Spanish Laws and Insurance (DEC 1998) (a...

48 CFR 252.229-7006 - Value added tax exclusion (United Kingdom).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Value added tax exclusion... CLAUSES Text of Provisions And Clauses 252.229-7006 Value added tax exclusion (United Kingdom). As prescribed in 229.402-70(f), use the following clause: Value Added Tax Exclusion (United Kingdom) (JUN 1997...

Validation of IRDFF in 252Cf Standard and IRDF-2002 Reference Neutron Fields

Directory of Open Access Journals (Sweden)

Simakov Stanislav

2016-01-01

Full Text Available The results of validation of the latest release of International Reactor Dosimetry and Fusion File, IRDFF-1.03, in the standard 252Cf(s.f. and reference 235U(nth,f neutron benchmark fields are presented. The spectrum-averaged cross sections were shown to confirm IRDFF-1.03 in the 252Cf standard spontaneous fission spectrum; that was not the case for the current recommended spectra for 235U(nth,f. IRDFF was also validated in the spectra of the research reactor facilities ISNF, Sigma-Sigma and YAYOI, which are available in the IRDF-2002 collection. The ISNF facility was re-simulated to remove unphysical oscillations in the spectrum. IRDFF-1.03 was shown to reproduce reasonably well the spectrum-averaged data measured in these fields except for the case of YAYOI.

Prompt neutron energy spectrum for the spontaneous fission of Cf-252

International Nuclear Information System (INIS)

Blinov, M.V.; Boykov, G.S.; Vitenko, V.A.

1985-06-01

The prompt neutron spectrum for the spontaneous fission of Cf-252 has been measured in 0.01-10 MeV region by the time-of-flight technique using a fast ionization chamber with U-235 layers as the neutron detector. Numerical data for the spectrum are presented, with an error file. (author)

Essentials of energy technology sources, transport, storage, conservation

CERN Document Server

Fricke, Jochen

2013-01-01

An in-depth understanding of energy technology, sources, conversion, storage, transport and conservation is crucial for developing a sustainable and economically viable energy infrastructure. This need, for example, is addressed in university courses with a special focus on the energy mix of renewable and depletable energy resources. Energy makes our lives comfortable, and the existence of amenities such as heaters, cars, warm water, household appliances and electrical light is characteristic for a developed economy. Supplying the industrial or individual energy consumer with energy 24 hours

Investigation of Workplace-like Calibration Fields via a Deuterium-Tritium (D-T) Neutron Generator.

Science.gov (United States)

Mozhayev, Andrey V; Piper, Roman K; Rathbone, Bruce A; McDonald, Joseph C

2017-04-01

Radiation survey meters and personal dosimeters are typically calibrated in reference neutron fields based on conventional radionuclide sources, such as americium-beryllium (Am-Be) or californium-252 (Cf), either unmodified or heavy-water moderated. However, these calibration neutron fields differ significantly from the workplace fields in which most of these survey meters and dosimeters are being used. Although some detectors are designed to yield an approximately dose-equivalent response over a particular neutron energy range, the response of other detectors is highly dependent upon neutron energy. This, in turn, can result in significant over- or underestimation of the intensity of neutron radiation and/or personal dose equivalent determined in the work environment. The use of simulated workplace neutron calibration fields that more closely match those present at the workplace could improve the accuracy of worker, and workplace, neutron dose assessment. This work provides an overview of the neutron fields found around nuclear power reactors and interim spent fuel storage installations based on available data. The feasibility of producing workplace-like calibration fields in an existing calibration facility has been investigated via Monte Carlo simulations. Several moderating assembly configurations, paired with a neutron generator using the deuterium tritium (D-T) fusion reaction, were explored.

48 CFR 252.227-7037 - Validation of restrictive markings on technical data.

Science.gov (United States)

2010-10-01

.... However, this clause neither creates nor implies privity of contract between the Government and... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7037 Validation of restrictive markings on... following clause: Validation of Restrictive Markings on Technical Data (SEP 1999) (a) Definitions. The terms...

Approaches for the generation of a covariance matrix for the Cf-252 fission-neutron spectrum

International Nuclear Information System (INIS)

Mannhart, W.

1983-01-01

After a brief retrospective glance is cast at the situation, the evaluation of the Cf-252 neutron spectrum with a complete covariance matrix based on the results of integral experiments is proposed. The different steps already taken in such an evaluation and work in progress are reviewed. It is shown that special attention should be given to the normalization of the neutron spectrum which must be reflected in the covariance matrix. The result of the least-squares adjustment procedure applied can easily be combined with the results of direct spectrum measurements and should be regarded as the first step in a new evaluation of the Cf-252 fission-neutron spectrum. (author)

Californium interrogation prompt neutron (CIPN) instrument for non-destructive assay of spent nuclear fuel—Design concept and experimental demonstration

International Nuclear Information System (INIS)

Henzlova, D.; Menlove, H.O.; Rael, C.D.; Trellue, H.R.; Tobin, S.J.; Park, Se-Hwan; Oh, Jong-Myeong; Lee, Seung-Kyu; Ahn, Seong-Kyu; Kwon, In-Chan; Kim, Ho-Dong

2016-01-01

This paper presents results of the first experimental demonstration of the Californium Interrogation Prompt Neutron (CIPN) instrument developed within a multi-year effort launched by the Next Generation Safeguards Initiative Spent Fuel Project of the United States Department of Energy. The goals of this project focused on developing viable non-destructive assay techniques with capabilities to improve an independent verification of spent fuel assembly characteristics. For this purpose, the CIPN instrument combines active and passive neutron interrogation, along with passive gamma-ray measurements, to provide three independent observables. This paper describes the initial feasibility demonstration of the CIPN instrument, which involved measurements of four pressurized-water-reactor spent fuel assemblies with different levels of burnup and two initial enrichments. The measurements were performed at the Post-Irradiation Examination Facility at the Korea Atomic Energy Institute in the Republic of Korea. The key aim of the demonstration was to evaluate CIPN instrument performance under realistic deployment conditions, with the focus on a detailed assessment of systematic uncertainties that are best evaluated experimentally. The measurements revealed good positioning reproducibility, as well as a high degree of insensitivity of the CIPN instrument's response to irregularities in a radial burnup profile. Systematic uncertainty of individual CIPN instrument signals due to assembly rotation was found to be <4.5%, even for assemblies with fairly extreme gradients in the radial burnup profile. These features suggest that the CIPN instrument is capable of providing a good representation of assembly average characteristics, independent of assembly orientation in the instrument.

Californium interrogation prompt neutron (CIPN) instrument for non-destructive assay of spent nuclear fuel—Design concept and experimental demonstration

Energy Technology Data Exchange (ETDEWEB)

Henzlova, D., E-mail: henzlova@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Menlove, H.O.; Rael, C.D.; Trellue, H.R.; Tobin, S.J. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Park, Se-Hwan; Oh, Jong-Myeong; Lee, Seung-Kyu; Ahn, Seong-Kyu; Kwon, In-Chan; Kim, Ho-Dong [Korea Atomic Energy Research Institute, Daejeong (Korea, Republic of)

2016-01-11

This paper presents results of the first experimental demonstration of the Californium Interrogation Prompt Neutron (CIPN) instrument developed within a multi-year effort launched by the Next Generation Safeguards Initiative Spent Fuel Project of the United States Department of Energy. The goals of this project focused on developing viable non-destructive assay techniques with capabilities to improve an independent verification of spent fuel assembly characteristics. For this purpose, the CIPN instrument combines active and passive neutron interrogation, along with passive gamma-ray measurements, to provide three independent observables. This paper describes the initial feasibility demonstration of the CIPN instrument, which involved measurements of four pressurized-water-reactor spent fuel assemblies with different levels of burnup and two initial enrichments. The measurements were performed at the Post-Irradiation Examination Facility at the Korea Atomic Energy Institute in the Republic of Korea. The key aim of the demonstration was to evaluate CIPN instrument performance under realistic deployment conditions, with the focus on a detailed assessment of systematic uncertainties that are best evaluated experimentally. The measurements revealed good positioning reproducibility, as well as a high degree of insensitivity of the CIPN instrument's response to irregularities in a radial burnup profile. Systematic uncertainty of individual CIPN instrument signals due to assembly rotation was found to be <4.5%, even for assemblies with fairly extreme gradients in the radial burnup profile. These features suggest that the CIPN instrument is capable of providing a good representation of assembly average characteristics, independent of assembly orientation in the instrument.

48 CFR 252.219-7003 - Small business subcontracting plan (DoD contracts).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7003 Small business subcontracting plan (DoD contracts). As prescribed in 219.708(b)(1)(A), use the following clause: Small Business...

Enabling instrumentation and technology for 21st century light sources

Energy Technology Data Exchange (ETDEWEB)

Byrd, J.M.; Shea, T.J.; Denes, P.; Siddons, P.; Attwood, D.; Kaertner, F.; Moog, L.; Li, Y.; Sakdinawat, A.; Schlueter, R.

2010-06-01

We present the summary from the Accelerator Instrumentation and Technology working group, one of the five working groups that participated in the BES-sponsored Workshop on Accelerator Physics of Future Light Sources held in Gaithersburg, MD September 15-17, 2009. We describe progress and potential in three areas: attosecond instrumentation, photon detectors for user experiments, and insertion devices.

Questions to the radiological protection in the Universidad Nacional Autonoma de Mexico

International Nuclear Information System (INIS)

Salas M, B.

2014-08-01

In the Physics Department of the Sciences Faculty of the Universidad Nacional Autonoma de Mexico (UNAM) exist at least 3 sites where radioactive sources and generating equipment s of ionizing radiation are managed: The Modern Physics Laboratory, the Radiological Analysis of Environmental Samples Workshop and the Collisions Workshop; the first of them has two neutron sources, in addition to other emitted sources of gamma and beta radiation. The neutron sources are of Americium 241-Beryllium and other of Californium-252 which have been operated outside of the control of the Comision Nacional de Seguridad Nuclear y Salvaguardias (CNSNS) that is the regulator organ in Mexico in nuclear matter, because the Operation License No. 183/85, with file number 657 that protected them, lost their validity from August 13, 1987 (25 years behind), what motivated to that the CNSNS assured them. Later to the closing of the Radiological Analysis of Environmental Samples Workshop was believed that a Barium-133 source had been extracted in an illegal way; an investigation realized by the CNSNS determined that the radioactive source was always inside of the detection systems and radiation measurement, for what this source was never lost. In the Collisions Workshop operated an Experimental Accelerator of Particles that the CNSNS prohibited its operation for not having the corresponding license. These examples can be considered as bad practices of radiological protection that should be pointed out to eradicate their promotion and to avoid this way the exposure to the radiation of the occupational exposed personnel and people in general, being also avoided dose of unnecessary radiation. The Instituto Federal de Acceso a la Informacion Publica y Proteccion de Datos (IFAI) in Mexico was a key factor to obtain the information that allowed the realization of this work that was carried out in the Sciences Faculty of the UNAM. (Author)

Questions to the radiological protection in the Universidad Nacional Autonoma de Mexico; Cuestionamientos a la proteccion radiologica en la Universidad Nacional Autonoma de Mexico

Energy Technology Data Exchange (ETDEWEB)

Salas M, B., E-mail: salasmarb@yahoo.com.mx [UNAM, Facultad de Ciencias, Departamento de Fisica, Circuito exterior s/n, Ciudad Universitaria, 04510 Mexico D. F. (Mexico)

2014-08-15

In the Physics Department of the Sciences Faculty of the Universidad Nacional Autonoma de Mexico (UNAM) exist at least 3 sites where radioactive sources and generating equipment s of ionizing radiation are managed: The Modern Physics Laboratory, the Radiological Analysis of Environmental Samples Workshop and the Collisions Workshop; the first of them has two neutron sources, in addition to other emitted sources of gamma and beta radiation. The neutron sources are of Americium 241-Beryllium and other of Californium-252 which have been operated outside of the control of the Comision Nacional de Seguridad Nuclear y Salvaguardias (CNSNS) that is the regulator organ in Mexico in nuclear matter, because the Operation License No. 183/85, with file number 657 that protected them, lost their validity from August 13, 1987 (25 years behind), what motivated to that the CNSNS assured them. Later to the closing of the Radiological Analysis of Environmental Samples Workshop was believed that a Barium-133 source had been extracted in an illegal way; an investigation realized by the CNSNS determined that the radioactive source was always inside of the detection systems and radiation measurement, for what this source was never lost. In the Collisions Workshop operated an Experimental Accelerator of Particles that the CNSNS prohibited its operation for not having the corresponding license. These examples can be considered as bad practices of radiological protection that should be pointed out to eradicate their promotion and to avoid this way the exposure to the radiation of the occupational exposed personnel and people in general, being also avoided dose of unnecessary radiation. The Instituto Federal de Acceso a la Informacion Publica y Proteccion de Datos (IFAI) in Mexico was a key factor to obtain the information that allowed the realization of this work that was carried out in the Sciences Faculty of the UNAM. (Author)

Simultaneous investigation of fission fragments and neutrons in 252Cf(s,f)

International Nuclear Information System (INIS)

Budtz-Joergensen, C.; Knitter, H.H.

1986-01-01

The gridded twin ion chamber developed at CBNM is used to measure the kinetic energy-, mass- and angular distributions of the fission fragments of 252 Cf in an advantageous 4π-geometry. Together with a neutron time-of-flight detector this experimental arrangement permits to measure the correlation between neutron emission, fragment angle, mass and energy in the spontaneous fission of 252 Cf. With the present experimental set-up a mass resolution for fission fragments of 0.5 a.m.u., an angular resolution of Δcosθ = 0.05 and a timing resolution of 0.7 ns FWHM were observed. Preliminary evaluations of the raw experimental data are presented for the fission fragment mass distribution, the average total kinetic energy and their variance as function of mass, the angular distribution between fragments and neutrons, the number of neutrons emitted per fragment as function of fragment mass, the average neutron emission energies as function of mass, and the prompt fission neutron spectrum averaged over all fragments. (author)

What makes Chinese firms to choose international external technology sources? An inquiry on internationalization, innovation and institutions

DEFF Research Database (Denmark)

Li-Ying, Jason; Wang, Yuandi

2013-01-01

. However, we have also witnessed an emerging trend of external acquisition of technology by EMFs firms in both international and domestic markets. Why some EMFs are active in sourcing both domestic and international technologies instead of being significantly in favour of foreign technologies from...... framework. Based on a unique sample of 389 Chinese firms on their inward technology licensing activities through an observation period from 2000 to 2005, it is found that (1) firms’ international market orientation; (2) firm’s technological capability; (3) regional innovation capability; and (4......External technology sourcing from developed countries has been one of the most important vehicles by which emerging market firms (EMFs) sustain competiveness. Foreign advanced technologies offer EMFs opportunities to gain access to state-of-the-art technologies and upgrade their competitiveness...

Calculated NWIS signatures for enriched uranium metal

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.; Koehler, P.E.

1995-01-01

Nuclear Weapons Identification System (NWIS) signatures have been calculated using a Monte Carlo transport code for measurement configurations of a 252 Cf source, detectors, and a uranium metal casting. NWIS signatures consist of a wide variety of time-and frequency-analysis signatures such as the time distribution of neutrons after californium fission, the time distribution of counts in a detector after a previous count, the number of times n pulses occur in a time interval, and various frequency-analysis signatures, such as auto-power and cross-power spectral densities, coherences, and a ratio of spectral densities. This ratio is independent of detection efficiency. The analysis presented here, using the MCNP-DSP code, evaluates the applicability of this method for measurement of the 235 U content of 19-kg castings of depleted uranium and uranium with enrichments of 20, 40, 60, 80, 90, and 93.2 wt % 235 U. The dependence of the wide variety of NWIS signatures on 235 U content and possible configurations of a measurement system are presented. These preliminary calculations indicate short measurement times. Additional calculations are being performed to optimize the source-detector-moderator-casting configuration for the shortest measurement time. Although the NWIS method was developed for nuclear weapons identification, the development of a small processor now allows it to be also applied in a practical way to subcriticality measurements, nuclear fuel process monitoring and qualitative nondestructive assay of special nuclear material

Attachment and spreadout study of 3T3 cells onto PP track etched films

International Nuclear Information System (INIS)

Smolko, Eduardo; Mazzei, Ruben; Tadey, Daniel; Lombardo, Daniel

2001-01-01

Polymer surface modifications are obtained by the application of radiation treatments and other physico-chemical methods: fission fragment (ff) irradiation and etching. The biocompatibility of the surface is then observed by cell seeding and cell adhesion experiments. Approaches to improvement of the cell adhesion are obtained by different methods: for example, in PS, cell adhesion is improved after ion implantation; in PMMA, after bombarding the polymer, the surface is reconditioned with surfactants and proteins and in PVDF, cell adhesion is assayed on nuclear tracks membranes. In this work, we obtained important cell adhesion improvements in PP films by irradiation with swift heavy ions and subsequent etching of the nuclear tracks. We use BOPP (isotactic -25 μm thickness). Irrradiations were performed with a Cf-252 californium ff source. The source has a heavy ff and a light one, with 160-200 MeV energy divided among them corresponding to ff energies between 1 and 2 MeV/amu. A chemical etching procedure consisting of a solution of sulphuric acid and chromium three oxide at 85 deg. C was used. The 3T3 NIH fibroblast cell line was used for the cell adhesion experiment. Here we report for the first time, the results of a series of experiments by varying the ff fluence and the etching time showing that attachment and spreadout of cells are very much improved in this cell line according to the number of pores and the pore size

78 FR 60700 - Source Specific Federal Implementation Plan for Implementing Best Available Retrofit Technology...

Science.gov (United States)

2013-10-02

... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 49 [EPA-R09-OAR-2013-0489; FRL-9901-58-Region 9] Source Specific Federal Implementation Plan for Implementing Best Available Retrofit Technology for Four... Plan (FIP) to implement the Best Available Retrofit Technology (BART) requirement of the Regional Haze...

78 FR 41731 - Source Specific Federal Implementation Plan for Implementing Best Available Retrofit Technology...

Science.gov (United States)

2013-07-11

... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 49 [EPA-R09-OAR-2013-0489; FRL-9830-5] Source Specific Federal Implementation Plan for Implementing Best Available Retrofit Technology for Four Corners Power... Implementation Plan (FIP) to implement the Best Available Retrofit Technology (BART) requirement of the Regional...

Dosimetric evaluation of 252Cf beam for use in radiobiology studies at Hiroshima University

International Nuclear Information System (INIS)

Hoshi, M.; Takeoka, S.; Tsujimura, T.; Kuroda, T.; Kawami, M.; Sawada, S.

1988-01-01

This report provides reliable tissue kerma in free air data by characterising the 252 Cf irradiating system and by comparing three dosimetry methods, paired chambers (ICRU 1977, 1978), Fricke and thermoluminescence dosemeter. (author)

47 CFR 51.807 - Arbitration and mediation of agreements by the Commission pursuant to section 252(e)(5) of the Act.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 3 2010-10-01 2010-10-01 false Arbitration and mediation of agreements by the Commission pursuant to section 252(e)(5) of the Act. 51.807 Section 51.807 Telecommunication FEDERAL... Implementation of Section 252 of the Act § 51.807 Arbitration and mediation of agreements by the Commission...

Web-Based Medical Service: Technology Attractiveness, Medical Creditability, Information Source, and Behavior Intention.

Science.gov (United States)

Wang, Shan Huei

2017-08-02

Web-based medical service (WBMS), a cooperative relationship between medical service and Internet technology, has been called one of the most innovative services of the 21st century. However, its business promotion and implementation in the medical industry have neither been expected nor executed. Few studies have explored this phenomenon from the viewpoint of inexperienced patients. The primary goal of this study was to explore whether technology attractiveness, medical creditability, and diversified medical information sources could increase users' behavior intention. This study explored the effectiveness of web-based medical service by using three situations to manipulate sources of medical information. A total of 150 questionnaires were collected from people who had never used WBMS before. Hierarchical regression was used to examine the mediation and moderated-mediation effects. Perceived ease of use (P=.002) and perceived usefulness (P=.001) significantly enhance behavior intentions. Medical credibility is a mediator (P=.03), but the relationship does not significantly differ under diverse manipulative information channels (P=.39). Medical credibility could explain the extra variation between technology attractiveness and behavior intention, but not significant under different moderating effect of medical information sources. ©Shan Huei Wang. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 02.08.2017.

Molecular weight determination of bisbenzyl-isoquinoline alkaloids by 252Cf-plasma desorption mass spectrometer

International Nuclear Information System (INIS)

Kohno, Hiroyuki; Tatsunami, Shinobu; Hiroi, Tomoko; Kouyama, Hiroshi; Taniguchi, Masashi; Yago, Nagasumi; Nakamura, Iwao

1995-01-01

Bisbenzylisoquinoline alkaloids of Stephania cepharantha have been used for various clinical purposes and recently reevaluated as stimulators of interleukin secretion in tissues. We analyzed molecular stuctures of bisbenzylisoquinoline alkaloids by determining their molecular weights using the 252 Cf-plasma desorption mass spectrometry (PDMS). The spectra were accumulated for 500 000 fission events. The acceleration voltage used here was 15 kV. Samples were analyzed using nitrocellulose-coated sample targets. Of the 5 alkaloids studied here, cepharanthine gave a main peak of molecular weight of 606.1 for the theoretical molecular weight of 606.7. The other minor peaks were considered to be demethylated fragment ions. 252 Cf-PDMS should be quite useful in studying structure, metabolism and pharmacokinetics of various drugs with extremely low coefficients of variation. (author)

Power spectral density measurements with 252Cf for a light water moderated research reactor

International Nuclear Information System (INIS)

King, W.T.; Mihalczo, J.T.

1979-01-01

A method of determining the reactivity of far subcritical systems from neutron noise power spectral density measurements with 252 Cf has previously been tested in fast reactor critical assemblies: a mockup of the Fast Flux Test Facility reactor and a uranium metal sphere. Calculations indicated that this measurement was feasible for a pressurized water reactor (PWR). In order to evaluate the ability to perform these measurements with moderated reactors which have long prompt neutron lifetimes, measurements were performed with a small plate-type research reactor whose neutron lifetime (57 microseconds) was about a factor of three longer than that of a PWR and approx. 50% longer than that of a boiling water reactor. The results of the first measurements of power spectral densities with 252 Cf for a water moderated reactor are presented

Particle and heavy ion transport code system, PHITS, version 2.52

International Nuclear Information System (INIS)

Sato, Tatsuhiko; Matsuda, Norihiro; Hashimoto, Shintaro; Iwamoto, Yosuke; Noda, Shusaku; Ogawa, Tatsuhiko; Nakashima, Hiroshi; Fukahori, Tokio; Okumura, Keisuke; Kai, Tetsuya; Niita, Koji; Iwase, Hiroshi; Chiba, Satoshi; Furuta, Takuya; Sihver, Lembit

2013-01-01

An upgraded version of the Particle and Heavy Ion Transport code System, PHITS2.52, was developed and released to the public. The new version has been greatly improved from the previously released version, PHITS2.24, in terms of not only the code itself but also the contents of its package, such as the attached data libraries. In the new version, a higher accuracy of simulation was achieved by implementing several latest nuclear reaction models. The reliability of the simulation was improved by modifying both the algorithms for the electron-, positron-, and photon-transport simulations and the procedure for calculating the statistical uncertainties of the tally results. Estimation of the time evolution of radioactivity became feasible by incorporating the activation calculation program DCHAIN-SP into the new package. The efficiency of the simulation was also improved as a result of the implementation of shared-memory parallelization and the optimization of several time-consuming algorithms. Furthermore, a number of new user-support tools and functions that help users to intuitively and effectively perform PHITS simulations were developed and incorporated. Due to these improvements, PHITS is now a more powerful tool for particle transport simulation applicable to various research and development fields, such as nuclear technology, accelerator design, medical physics, and cosmic-ray research. (author)

Design of a portable directional neutron source finder

International Nuclear Information System (INIS)

Yamanishi, Hirokuni

2005-01-01

An instrument that determines the direction of a remote existing neutron source has been designed. This instrument combines a polyethylene block and four 3 He counter tubes. The advantages of the instrument are portability and good angular resolution. The count from the detector was varied with the neutron incident angle due to the moderator. Using this characteristic, the direction of the neutron source can be measured precisely by revising the axis of the instrument so that the difference between the four detectors measurements is minimized. Consequently, the direction of the central axis of the instrument in which the response difference of the four detectors reaches a minimum indicates the direction of the neutron source. The practical use of the instrument was demonstrated by 252 Cf source irradiation experiment and MCNP simulation

Nuclear detection systems in traffic

International Nuclear Information System (INIS)

Farkas, T.; Pernicka, L.; Svec, A.

2005-01-01

Illicit trafficking in nuclear materials (nuclear criminality) has become a problem, due to the circulation of a high number of radioactive sources caused by the changes of the organisational infrastructures to supervise these material within the successor states of the former Soviet Union. Aim of this paper is to point out the technical requirements and the practicability of an useful monitoring system at preselected traffic check points (railway and highway border crossings, industrial sites entry gates, international airports). The ITRAP lab test was designed to work as strict benchmark to qualify border monitoring systems 67 with very low false alarm rates, in addition the minimum sensitivity to give an alarm has been defined for fix-installed systems, pocket type and hand held instruments. For the neutron tests a special prepared Californium source ( 252 Cf) was used to simulate the weapons plutonium. The source is shielded against gamma radiation, use a moderator and provides the required neutron rate of 20000 n/s at 2 rn distance. To test the false alarm rate (rate of false positive ) the same test facility , under the same background conditions, was used but without a radioactive test source. The ITRAP lab tests for the fix-installed systems started at May 1998 and first results were given in September 1998. Only 2 of 14 fix-installed monitoring systems could fulfil the minimum requirement for neutron detection. 7 of 14 fix-installed monitoring systems (50%) passed the ITRAP lab test. The analytical method developed and used for certification of installed radiation monitors in the Slovak Institute of Metrology consists in measurement of radiation activity of selected radionuclide in defined conditions. (authors)

Comparative analyses of seven technologies to facilitate the integration of fluctuating renewable energy sources

DEFF Research Database (Denmark)

Mathiesen, Brian Vad; Lund, Henrik

2009-01-01

An analysis of seven different technologies is presented. The technologies integrate fluctuating renewable energy sources (RES) such as wind power production into the electricity supply, and the Danish energy system is used as a case. Comprehensive hour-by-hour energy system analyses are conducted...... of a complete system meeting electricity, heat and transport demands, and including RES, power plants, and combined heat and power production (CHP) for district heating and transport technologies. In conclusion, the most fuel-efficient and least-cost technologies are identified through energy system...

Fuel-efficiency of hydrogen and heat storage technologies for integration of fluctuating renewable energy sources

DEFF Research Database (Denmark)

Mathiesen, Brian Vad; Lund, Henrik

2005-01-01

This paper presents the methodology and results of analysing the use of different energy storage technologies in the task of integration of fluctuating renewable energy sources (RES) into the electricity supply. The analysis is done on the complete electricity system including renewable energy...... sources as well as power plants and CHP (Combined heat and power production). Emphasis is put on the need for ancillary services. Devices to store electricity as well as devices to store heat can be used to help the integration of fluctuating sources. Electricity storage technologies can be used...... to relocate electricity production directly from the sources, while heat storage devices can be used to relocate the electricity production from CHP plants and hereby improve the ability to integrate RES. The analyses are done by advanced computer modelling and the results are given as diagrams showing...

Technological yields of sources for radiation processing

International Nuclear Information System (INIS)

Zagorski, Z.P.

1990-01-01

The present report is prepared for planners of radiation processing of any material. Sources with cobalt-60 are treated marginally, because most probably, there will be no installation of technically meaningful activity in Poland before the year 2000. Calculations are focused on accelerators of electrons, divided into two groups: versatile linacs of energy up to 13 MeV and accelerators of lower energy, below 2 MeV, of better energetical yield but of limited applications. The calculations are connected with the confrontation of the author's technological expectations during the preparation of the linac project in the late '60s, with the results of twenty years of exploitation of the machine. One has to realize that from the 150 kV input power from the mains, only 5 kV of bent and scanned beam is recovered on the conveyor. That power is only partially used for radiation induced phenomena, sometimes only a few percent, because of the demanded homogeneity of the dose, of the mode of packing of the object and its shape, of losses at the edges of the scanned area and in the spaces between boxes, and of losses during the dead time due to the tuning of the machine and dosimetric operations. The use of lower energy accelerators may be more economical in case of objects of optimum type. At the first stage, that is of the conversion of electrical power into that of the low energy electron beam, the yield is 2-3 times better than in the case of linacs. Attention has been paid to the technological aspects of electron beam conversion into the more penetrating bremsstrahlung similar to gamma radiation. The advantages of these technologies, which make it possible to control the shape of the processed object are stressed. Ten parameters necessary for a proper calculation of technological yields of radiation processing are listed. Additional conditions which must be taken into account in the comparison of the cost of radiation processing with the cost of other technologies are also

Group Representation of the Prompt Fission Neutron Spectrum of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Croft, S.; Miller, K. A. [Safeguards Science and Technology Group (N-1), Nuclear Nonproliferation Division, Los Alamos National Laboratory, Los Alamos(United States)

2011-12-15

We review the spectral representation used for the prompt fission neutron spectrum of 252Cf in the International Organization for Standardization document ISO 8529-1. We find corrections to Table A.2, the discrete group structure form, of this report are needed. We describe the approach to generating replacement values and provide a new tabulation.

Industrial ion sources broadbeam gridless ion source technology

CERN Document Server

Zhurin, Viacheslav V

2012-01-01

Due to the large number of uses of ion sources in academia and industry, those who utilize these sources need up to date and coherent information to keep themselves abreast of developments and options, and to chose ideal solutions for quality and cost-effectiveness. This book, written by an author with a strong industrial background and excellent standing, is the comprehensive guide users and developers of ion sources have been waiting for. Providing a thorough refresher on the physics involved, this resource systematically covers the source types, components, and the operational parameters.

Development of an asymmetric multiple-position neutron source (AMPNS) method to monitor the criticality of a degraded reactor core

International Nuclear Information System (INIS)

Kim, S.S.; Levine, S.H.

1985-01-01

An analytical/experimental method has been developed to monitor the subcritical reactivity and unfold the k/sub infinity/ distribution of a degraded reactor core. The method uses several fixed neutron detectors and a Cf-252 neutron source placed sequentially in multiple positions in the core. Therefore, it is called the Asymmetric Multiple Position Neutron Source (AMPNS) method. The AMPNS method employs nucleonic codes to analyze the neutron multiplication of a Cf-252 neutron source. An optimization program, GPM, is utilized to unfold the k/sub infinity/ distribution of the degraded core, in which the desired performance measure minimizes the error between the calculated and the measured count rates of the degraded reactor core. The analytical/experimental approach is validated by performing experiments using the Penn State Breazeale TRIGA Reactor (PSBR). A significant result of this study is that it provides a method to monitor the criticality of a damaged core during the recovery period

Neutron Sources for Standard-Based Testing

Energy Technology Data Exchange (ETDEWEB)

Radev, Radoslav [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); McLean, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2014-11-10

The DHS TC Standards and the consensus ANSI Standards use ²⁵²Cf as the neutron source for performance testing because its energy spectrum is similar to the ²³⁵U and ²³⁹Pu fission sources used in nuclear weapons. An emission rate of 20,000 ± 20% neutrons per second is used for testing of the radiological requirements both in the ANSI standards and the TCS. Determination of the accurate neutron emission rate of the test source is important for maintaining consistency and agreement between testing results obtained at different testing facilities. Several characteristics in the manufacture and the decay of the source need to be understood and accounted for in order to make an accurate measurement of the performance of the neutron detection instrument. Additionally, neutron response characteristics of the particular instrument need to be known and taken into account as well as neutron scattering in the testing environment.