Californium-252 progress, report No. 7, April 1971
Energy Technology Data Exchange (ETDEWEB)
1971-12-31
This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.
Historical review of californium-252 discovery and development
International Nuclear Information System (INIS)
Stoddard, D.H.
1985-01-01
This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252 Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed
Medical applications of californium-252
International Nuclear Information System (INIS)
Oliver, G.D. Jr.
1975-01-01
Primarily, californium-252 sources have been utilized in medicine for the treatment of neoplastic lesions. For five years, a coordinated effort between several cancer research institutions and national laboratories has developed the necessary physics, radiobiology, and engineering skills to establish an evaluation program for californium. Several more years of combined effort are required before it is known whether californium therapy is as good as or better than conventional therapy with sources like radium. Recently, development of diagnostic applications of californium in medicine has received attention. Studies comparing neutron decay activation analysis versus prompt capture gamma ray analysis are in progress. A hopeful application of prompt analysis with reasonable quantities (200 μg) of californium is the elemental analysis of bone in the human body. (U.S.)
Radiography using californium-252 neutron sources
International Nuclear Information System (INIS)
Ray, J.W.
1975-01-01
The current status in the technology of neutron radiography using californium-252 neutron sources is summarized. Major emphasis is on thermal neutron radiography since it has the widest potential applicability at the present time. Attention is given to four major factors which affect the quality and useability of thermal neutron radiography: source neutron thermalization, neutron beam extraction geometry, neutron collimator dimensions, and neutron imaging methods. Each of these factors has a major effect on the quality of the radiographs which are obtained from a californium source neutron radiography system and the exposure times required to obtain the radiographs; radiograph quality and exposure time in turn affect the practicality of neutron radiography for specific nondestructive inspection applications. A brief discussion of fast neutron radiography using californium-252 neutron sources is also included. (U.S.)
Californium-252 radiotherapy sources for interstitial afterloading
International Nuclear Information System (INIS)
Permar, P.H.; Walker, V.W.
1976-01-01
Californium-252 neutron sources for interstitial afterloading were developed to investigate the value of this radionuclide in cancer therapy. Californium-252 seed assemblies contain essentially point sources of 252 Cf permanently sealed on 1-cm centers within a flexible plastic tube. The seed assemblies are fabricated with remotely operated, specially designed machines. The fabrication process involves the production of a Pt-10 percent Ir-clad wire with a 252 Cf 2 O 3 -Pd cermet core. The wire is swaged and drawn to size, cut to length, and welded in a Pt-10 percent Ir capsule 0.8 mm in diameter and 6 mm long. Each seed capsule contains approximately 0.5 microgram of 252 Cf. Because the effective half-life of 252 Cf is 2.6 years, the seed assemblies are not disposable and must be reused until their activities have decreased to unsuitable levels. The flexible plastic components must therefore have sufficient resistance to radiation damage to survive the neutron-plus-gamma radiation from 252 Cf. On the basis of accelerated irradiation tests with a large 252 Cf source, a recently developed fluoropolymer, ''Tefzel'' (trademark of E. I. du Pont de Nemours and Company) has adequate radiation resistance for this application. Californium-252 seed assembly systems are loaned by the United States Energy Research and Development Administration for clinical investigations under a protocol of the Radiation Therapy Oncology Group, U.S. National Cancer Institute
Californium-252: a remarkable versatile radioisotope
International Nuclear Information System (INIS)
Osborne-Lee, I.W.; Alexander, C.W.
1995-01-01
A product of the nuclear age, Californium-252 ( 252 Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252 Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252 Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252 Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252 Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252 Cf from ORNL is summarized herein
Californium-252: a remarkable versatile radioisotope
Energy Technology Data Exchange (ETDEWEB)
Osborne-Lee, I.W.; Alexander, C.W.
1995-10-10
A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.
Californium-252 sales and loans at Oak Ridge National Laboratory
International Nuclear Information System (INIS)
King, L.J.
1987-01-01
The production and distribution in the United States of 252 Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252 Cf Industrial Sales/Loan Program and the 252 Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252 Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point
Fabrication of californium-252 sources in the United Kingdom
International Nuclear Information System (INIS)
Ainsworth, A.; Brady, M.W.; Thornett, W.H.
1975-01-01
The advent of californium-252 in weighable quantities and at a reasonable price has caused some rethinking among neutron source suppliers. To explore this market the Radiochemical Center Ltd. has purchased 2 mg of californium-252, and subdivided this into a wide range of sources. To take advantage of its high specific neutron emission, a small double welded stainless steel capsule 7.8mm diameter x 10mm high was chosen for stock sources and this entailed the use of a microdispensing technique which had to be specially developed. The apparatus and procedure for subdividing milligram amounts of californium-252 are described. Some details of our experience in processing these one milligram shipments are given. 100 sources with activities from 200 microgram to 0.01 microgram have been produced. Losses have been small. Measurement of neutron spectra gamma spectra and dose rates from encapsulated sources has confirmed published data. Though it is early days, little industrial interest in californium-252 sources has been detected, most of the sources have so far been required for research into activation analysis and two examples of this are given. (U.S.)
Production, Distribution, and Applications of Californium-252 Neutron Sources
International Nuclear Information System (INIS)
Balo, P.A.; Knauer, J.B.; Martin, R.C.
1999-01-01
The radioisotope 252 Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10 11 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252 Cf to commercial reencapsulators domestically and internationally. Sealed 252 Cf sources are also available for loan to agencies and subcontractors of the U.S. government and to universities for educational, research, and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252 Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments, and irradiation of rice to induce genetic mutations
International Nuclear Information System (INIS)
1975-01-01
This meeting constituted the third phase of a project initiated by the Dosimetry Section of the IAEA in 1973. The first step, early in 1973, consisted of the development of a programme for the loan of Cf-252 sources to the Member States in support of education, training and some limited research. To date, 14 institutions in 13 Member States have participated in this loan programme. In August last year, the Agency published an instructional syllabus and laboratory manual authored by Professors Eric J. Hall and Harald H. Rossi of Columbia University (Californium-252 in Teaching and Research, Technical Reports Series No. 159). The appearance of this publication, including guidance on the design and construction of a storage and use facility, was the second phase of this programme aimed at providing some support to potential users in the fields of radiation biology and dosimetry. The objective of the programme's third phase - the convening of an Educational Seminar - was to provide a forum to bring together participants in the Agency's loan programme and experts in various scientific fields. Specifically, the Seminar consisted of a series of expert presentations in spectrometry, activation and prompt gamma analyses, on-stream analysis, dosimetry, health physics, radiology and radiotherapy. (author)
Proposed Californium-252 User Facility for Neutron Science at Oak Ridge National Laboratory
International Nuclear Information System (INIS)
Martin, R.C.; Laxson, R.R.; Knauer, J.B.
1996-01-01
The Radiochemical Engineering Development Center (REDC) at ORNL has petitioned to establish a Californium-252 User Facility for Neutron Science for academic, industrial, and governmental researchers. The REDC Californium Facility (CF) stores the national inventory of sealed 252 Cf neutron source for university and research loans. Within the CF, the 252 Cf storage pool and two uncontaminated hot cells currently in service for the Californium Program will form the physical basis for the User Facility. Relevant applications include dosimetry and experiments for neutron tumor therapy; fast and thermal neutron activation analysis of materials; experimental configurations for prompt gamma neutron activation analysis; neutron shielding and material damage studies; and hardness testing of radiation detectors, cameras, and electronics. A formal User Facility simplifies working arrangements and agreements between US DOE facilities, academia, and commercial interests
Prompt neutron spectrum of the spontaneous fission of californium-252
International Nuclear Information System (INIS)
Zamyatnin, Yu.S.; Kroshkin, N.I.; Korostylev, V.A.; Nefedov, V.N.; Ryazanov, D.K.; Starostov, B.I.; Semenov, A.F.
1976-01-01
The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252 Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252 Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252 Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references
Study of the shielding for spontaneous fission sources of Californium-252
International Nuclear Information System (INIS)
Davila R, I.
1991-06-01
A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)
Teratogenic effect of Californium-252 irradiation in rats
International Nuclear Information System (INIS)
Satow, Yukio; Lee, Juing-Yi; Hori, Hiroshi; Okuda, Hiroe; Tsuchimoto, Shigeo; Sawada, Shozo; Yokoro, Kenjiro
1989-01-01
The teratogenicity of Californium-252 (Cf-252) irradiation which generates approximately 70% 2.3 MeV fast neutron and 30% gamma rays was evaluated. A single whole body exposure of Cf-252 at various doses was given to pregnant rats on day 8 or 9 of pregnancy, followed by microscopic autopsy of the fetuses at the terminal stage of pregnancy to search for external and internal malformations. For comparison, pregnant rats were irradiated with various doses of Cobalt-60 (Co-60) standard gamma rays at the same dose rate (1 rad/min.). The doses were 20-120 rad of Cf-252 and 80-220 rad of Co-60. Using frequency of radiation induced malformations observed on day 8 of pregnancy as an index, relative biological effectiveness (RBE) of 2.3-2.7 was obtained from the straight line obtained by modifying by the least squares method the frequency curves of malformed fetuses in total implants and in surviving fetuses. The types of malformations induced by Cf-252 and Co-60 irradiation were alike. Using fetal LD 50 as an index, 2.4 was obtained as RBE when irradiated on day 8 of pregnancy and 3.1 as that when irradiated on day 9. The results showed that Cf-252 had stronger a teratogenic effect than Co-60 gamma rays. (author)
International Nuclear Information System (INIS)
Landolt, R.R.; Hem, S.L.
1983-01-01
A commercial antacid suspension containing aluminum hydroxide and magnesium hydroxide products was used as a model sample to study the use of a californium-252 thermal neutron activation as a method for quantifying aluminum content as well as for the simultaneous assay of aluminum and magnesium. A 3.5-micrograms californium-252 source was used for the activation, and the induced aluminum-28 and magnesium-27 activity was simultaneously measured by sodium iodide crystal gamma-ray spectrometry using dual single-channel analyzers and scalers. The antacid suspension was contained in a chamber designed with the unique capability of serving as the container for counting the induced radioactivity in addition to being the irradiation chamber itself. This pilot study demonstrated that use of more intense californium-252 sources, which are commonly available, would provide a method that is competitive with the ethylenediaminetetraacetic acid titration method in precision and in other aspects as well
Application of californium-252 neutron sources for analytical chemistry
International Nuclear Information System (INIS)
Ishii, Daido
1976-01-01
The researches made for the application of Cf-252 neutron sources to analytical chemistry during the period from 1970 to 1974 including partly 1975 are reviewed. The first part is the introduction to the above. The second part deals with general review of symposia, publications and the like. Attention is directed to ERDA publishing the periodical ''Californium-252 Progress'' and to a study group of Cf-252 utilization held by Japanese Radioisotope Association in 1974. The third part deals with its application for radio activation analysis. The automated absolute activation analysis (AAAA) of Savannha River is briefly explained. The joint experiment of Savannha River operation office with New Brunswick laboratory is mentioned. Cf-252 radiation source was used for the non-destructive analysis of elements in river water. East neutrons of Cf-252 were used for the quantitative analysis of lead in paints. Many applications for industrial control processes have been reported. Attention is drawn to the application of Cf-252 neutron sources for the field search of neutral resources. For example, a logging sonde for searching uranium resources was developed. the fourth part deals with the application of the analysis with gamma ray by capturing neutrons. For example, a bore hole sonde and the process control analysis of sulfur in fuel utilized capture gamma ray. The prompt gamma ray by capturing neutrons may be used for the nondestructive analysis of enrivonment. (Iwakiri, K.)
Energy Technology Data Exchange (ETDEWEB)
Davila R, I
1991-06-15
A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)
International Nuclear Information System (INIS)
Kohno, Hiroyuki; Tatsunami, Shinobu; Hiroi, Tomoko; Kouyama, Hiroshi; Taniguchi, Masashi; Yago, Nagasumi; Nakamura, Iwao
1995-01-01
Bisbenzylisoquinoline alkaloids of Stephania cepharantha have been used for various clinical purposes and recently reevaluated as stimulators of interleukin secretion in tissues. We analyzed molecular stuctures of bisbenzylisoquinoline alkaloids by determining their molecular weights using the 252 Cf-plasma desorption mass spectrometry (PDMS). The spectra were accumulated for 500 000 fission events. The acceleration voltage used here was 15 kV. Samples were analyzed using nitrocellulose-coated sample targets. Of the 5 alkaloids studied here, cepharanthine gave a main peak of molecular weight of 606.1 for the theoretical molecular weight of 606.7. The other minor peaks were considered to be demethylated fragment ions. 252 Cf-PDMS should be quite useful in studying structure, metabolism and pharmacokinetics of various drugs with extremely low coefficients of variation. (author)
Assessment of the neutron component in a neutron-gamma field of a californium-252 source
International Nuclear Information System (INIS)
Tetteh, G.K.
1978-12-01
Experiments have been performed to determine the percentages of the different components in the radiation field of californium-252 which has now some clinical applications. Using Rossi Chambers in conjunction with absorption investigations involving lead and aluminium thimbles, it is observed that the dose rates due to the different components are: neutrons 54%; gammas 30%; betas 16%
Measurements of integral cross sections in the californium-252 fission neutron spectrum
International Nuclear Information System (INIS)
Alberts, W.G.; Guenther, E.; Matzke, M.; Rassl, G.
1977-01-01
In a low-scattering arrangement cross sections averaged over the californium-252 spontaneous fission neutron spectrum were measured. The reactions 27 Al(n,α) 46 Ti, 47 Ti, 48 Ti(n,p), 54 Fe, 56 Fe(n,p), 58 Ni(n,p), 64 Zn(n,p), 115 In(n,n') were studied in order to obtain a consistent set of threshold detectors used in fast neutron flux density measurements. Overall uncertainties between 2 and 2.5% could be achieved; corrections due to neutron scattering in source and samples are discussed
International Nuclear Information System (INIS)
Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu; Wang Dong
2011-01-01
Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ( 252 Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with 252 Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7–12 Gy per insertion per week, with a total dose of 29–45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16–38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44–56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of 252 Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.
International Nuclear Information System (INIS)
Muhammad Fakhrurreza; Kusminanto; Y Sardjono
2014-01-01
In this research has made a reflector design to provide beams of Neutron for BNCT with Californium-252 radioactive source. This collimator is useful to obtain optimum epithermal neutron flux with the smallest impurity radiation (thermal neutron, fast neutron, and gamma). The design process is done using Monte Carlo N-Particle simulation version 5 (MCNP5) code to calculate the neutron flux tally form. The chosen reflector design is the reflectors which use material such as BeO ceramic with 13 cm thick. Moderator use sulfur material with the slope angle of the cone is 30°. From the calculation result, it is obtained that Reflector with 1 gram Californium-252 source can produce a neutron output thermal which has thermal neutron specification 2.23189 x 10 9 n/s.cm 2 , epithermal neutron 3.51548 x 10 9 n/s.cm 2 , and fast neutron 4.82241 x 10 9 n/s.cm 2 From the result, it needs additional collimator because the BNCT requirement. (author)
Biomedical neutron research at the Californium User Facility for neutron science
International Nuclear Information System (INIS)
Martin, R.C.; Byrne, T.E.; Miller, L.F.
1997-01-01
The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy
Biomedical neutron research at the Californium User Facility for Neutron Science
International Nuclear Information System (INIS)
Martin, R.C.; Byrne, T.E.; Miller, L.F.
1998-01-01
The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy. (author)
A californium-252 source for radiobiological studies at Hiroshima University
International Nuclear Information System (INIS)
Kato, Kazuo; Takeoka, Seiji; Kuroda, Tokue; Tsujimura, Tomotaka; Kawami, Masaharu; Hoshi, Masaharu; Sawada, Shozo
1987-01-01
A 1.93 Ci (3.6 mg) californium-252 source was installed in the radiation facility of the Research Institute for Nuclear Medicine and Biology, Hiroshima University. This source produces fission neutrons (8.7 x 10 9 n/s at the time of its installation), which are similar to neutron spectrum of the atomic bombs. It is useful for studying biological effects of fission neutrons and neutron dosimetry. An apparatus was dosigned to accomodate this source and to apply it to such studies. It has resulted in profitable fission neutron exposures, while suppressing scattered neutrons and secondary gamma rays. This apparatus incorporates many safety systems, including one which interlocks with all of doors and an elevator serving the exposure room, so as to prevent accidents involving users. (author)
Long-term effects of an intracavitary treatment with californium-252 on normal tissue
International Nuclear Information System (INIS)
Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.
1976-01-01
About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252 Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252 Cf and 7000 rad from 226 Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252 Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252 Cf and 5000 rad from 226 Ra
Energy Technology Data Exchange (ETDEWEB)
Fadel, M A; El-Fiki, M A; Eissa, H M; Abdel-Hafez, A; Naguib, S H [National Institute of Standards, Cairo (Egypt)
1996-03-01
Phantom of tissue equivalent material with and without bone was used measuring depth dose distribution of gamma-rays from californium-252 source. The source was positioned at center of perspex walled phantom. Depth dose measurements were recorded for X, Y and Z planes at different distances from source. TLD 700 was used for measuring the dose distribution. Results indicate that implantation of bone in tissue equivalent medium cause changes in the gamma depth dose distribution which varies according to variation in bone geometry. 9 figs.
Czech Academy of Sciences Publication Activity Database
Tačev, T.; Vacek, Antonín; Ptáčková, B.; Strnad, V.
2005-01-01
Roč. 181, č. 5 (2005), s. 273-284 ISSN 0179-7158 Institutional research plan: CEZ:AV0Z50040507 Keywords : cervical carcinoma * hypoxyradiotherapy * californium-252 Subject RIV: BO - Biophysics Impact factor: 3.490, year: 2005
Chivanov, V D; Zubarev, R A; Aksenov, S A; Bordunova, O G; Eremenko, V I; Kabanets, V M; Tatarinova, V I; Mishnev, A K; Kuraev, V V; Knysh, A N; Eremenko, I A
1996-08-01
The addition of organic acids (picric, oxalic, citric, or tartaric) to peptide and protein samples was found to significantly increase the yield of their quasi-molecular ions (QMI) in time-of-flight 252Cf plasma desorption mass spectrometry. The yield of the ions depended on the pKa of the acid added.
International Nuclear Information System (INIS)
Sharma, S.
1986-01-01
A storage and shielding facility for 300 μg of Californium-252 sources was designed and constructed. Though the safe was in a permanent location, the fact that it consisted of a lead bucket surrounded by polyethylene pellets made it simple, movable and inexpensive. If need be, more quantities of Cf-252 could be added without altering the basic design and sacrificing the radiation protection guidelines. The measured radiation levels from 300 μg of stored Cf-252 in and around the storage vault were lower than the expected dose rates by a factor of 5. The measured radiation levels around the occupied environs of the facility were below the maximum permissible yearly dose of 500mrem for non-occupational workers. A transport vessel was designed and constructed to carry up to 50 μg of Californium-252 sources. It consisted of a standard 55 gallon steel drum on casters containing cylindrical lead shield surrounded by polyethylene pellets. The measured maximum surface dose rates on the drum and at one meter away were within the radiation protection guidelines and were less than the expected dose rates. A portable shield was designed and constructed to protect the body in afterloading operations and handling of the sources. It consisted of polyethylene pellets in an aluminum box and an attached 10 cm thick plexiglass eye shield. The simple design, with the ease of using polyethylene pellets can be extended to construct bedside shields
Energy Technology Data Exchange (ETDEWEB)
Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.
1976-01-01
About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.
Energy Technology Data Exchange (ETDEWEB)
Shapiro, A; Lin, B I [Cincinnati Univ., Ohio (USA). Dept. of Chemical and Nuclear Engineering; Windham, J P; Kereiakes, J G
1976-07-01
..gamma.. flux density and dose rate distributions have been calculated about implantable californium-252 sources for an infinite tissue medium. Point source flux densities as a function of energy and position were obtained from a discrete-ordinates calculation, and the flux densities were multiplied by their corresponding kerma factors and added to obtain point source dose rates. The point dose rates were integrated over the line source to obtain line dose rates. Container attenuation was accounted for by evaluating the point dose rate as a function of platinum thickness. Both primary and secondary flux densities and dose rates are presented. The agreement with an independent Monte Carlo calculation was excellent. The data presented should be useful for the design of new source configurations.
International Nuclear Information System (INIS)
Belogorlov, E.A.; Britvich, G.I.; Getmanov, V.B.
1985-01-01
Construction of labyrinths in points of communication output from the storage-ring under construction is accompanied by numerous difficulties due to a considerable number of gas and cryogenic pipelines, which require large cross sections at the minimal length of the pipelines proper for their location. It results in unfavourable for radiation attenuation ratios between cross section and length of the labyrinth separate sections. Neutron spectra in a model concrete labyrinth, at the entrance to which a neutron source with fission spectrum (californium-252) and the same source in a polyethylene moderator are located, are measured. On the basis of the spectra obtained the formation of fluence and equivalent dose along the labyrinth geometric axis is analyzed. Conditions permitting actually to reduce radiation dose in the labyrinth (dead end provision, the use of cover materials, construction of diaphragms and shielding plates) are simulated
International Nuclear Information System (INIS)
Kamensky, I.; Haakansson, P.; Kjellberg, J.; Sundqvist, B.; Fohlman, J.; Peterson, P.A.
1983-01-01
A method involving fast heavy-ion bombardment of a solid sample called 252 Cf-plasma desorption mass spectrometry has been used to study a non-enzymatic, non-toxic phospholipase homolog from Australian tiger snake (Notechis scutatus) venom. The protein consists of 119 amino acids in a single polypeptide chain cross-linked by 7 disulfide bridges. The isotopically averaged molecular mass as determined by protein sequence analysis is 13309 atomic mass units (amu). The mass distributions were studied by means of time-of-flight measurements. Quasi-molecular ions associated to the molecule and its dimer were observed. The mass of the quasi-molecular ion corresponding to the molecule was determined to be 13285 +- 25 amu. (Auth.)
Californium Multiplier. Part I. Design for neutron radiography
International Nuclear Information System (INIS)
Crosbie, K.L.; Preskitt, C.A.; John, J.; Hastings, J.D.
1982-01-01
The Californium Multiplier (CFX) is a subcritical assembly of enriched uranium surrounding a californium-252 neutron source. The function of the CFX is to multiply the neutrons emitted by the source to a number sufficient for neutron radiography. The CFX is designed to provide a collimated beam of thermal neutrons from which the gamma radiation is filtered, and the scattered neutrons are reduced to make it suitable for high resolution radiography. The entire system has inherent safety features, which provide for system and personnel safety, and it operates at moderate cost. In Part I, the CFX and the theory of its operation are described in detail. Part II covers the performance of the Mound Facility CFX
Californium-252 Program Equipment Evaluation
Energy Technology Data Exchange (ETDEWEB)
Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2017-12-01
To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.
Neutron activation analysis of the calcium content in vivo, using a 50μg source of californium 252
International Nuclear Information System (INIS)
Guey, A.; Zech, P.Y.; Meary, M.F.; Leitienne, P.
1975-01-01
Owing to the recent commercialisation of californium 252 it is now possible to obtain neutron fluxes strong enough for precise activation of the calcium content of biological targets. After the preliminary measurements necessary to establish the most suitable conditions for irradiating 3 to 5cm thick targets, two parallel sets of experiments were developed. In the first the medium-term total calcium variation was studied in 20 rats, 16 suffering from chronic kidney deficiency. In the second the precision expected as a function of the calcium content of the irradiated target was examined, using 3 sets of tissue equivalent standards of calcium contents 5, 20 and 50g respectively. The first results obtained on calcium 49 in vivo show that a calcium content variation can be followed with a sensitivity threshold below that obtained by conventional methods [fr
Feasibility and market potential of protein determination of wheat using californium-252
International Nuclear Information System (INIS)
Roberts, T.C. Jr.; Eckhoff, N.D.; Clack, R.W.; Roberts, T.C. Sr.
1976-01-01
To evaluate the feasibility of protein determination by capture gamma-ray analysis using californium-252 neutrons, an in-situ protein analysis system for use by grain handlers has been examined. Three 227 kilogram (approximately) lots of wheat were used to determine the amount of nitrogen present. Protein analyses by the Kjeldahl method were obtained from samples taken before and after the capture gamma-ray analyses. The 5.267-MeV gamma-ray was selected for use in this study as a compromise between efficiency and interference from other elements. The associated counting equipment was a multichannel analyzer with pulse shaping electronic and analysis computing equipment. A linear regression program was used to compare the regions of interest to the Kjeldahl protein averages. The counts composing each peak were summed and normalized using the total count of the hydrogen peak. The normalized nitrogen percentages indicate a significant correlation between the spectral regions and the Kjeldahl analyses. To a first approximation, the value of wheat is the wheat protein. At the present time, protein testing of wheat is destructive, cumbersome, and time-consuming as compared to the potential for capture gamma-ray analysis testing. Assuming that such a protein analysis unit can analyze 42 tonne of wheat per hour, over 120 units would be needed to monitor one-half the U.S. annual wheat production. A 0.5% improvement in processor realizations and grain throughput value of $167.00 per tonne will result in a projected savings of $150,000 per year per unit
International Nuclear Information System (INIS)
Cardoso, Antonio
1976-01-01
Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction 55 Mn (n.gamma) 56 Mn, high concentration of manganese in the matrix and short half - life of 56 Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions 56 Fe(n,p) 56 Mn and 59 Co (n, α) 56 were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)
Californium-252 interstitial implants in carcinoma of the tongue
International Nuclear Information System (INIS)
Vtyurin, B.M.; Ivanov, V.N.; Medvedev, V.S.; Galantseva, G.F.; Abdulkadyrov, S.A.; Ivanova, L.F.; Petrovskaya, G.A.; Plichko, V.I.
1985-01-01
A clinical study using 252 Cf sources in brachytherapy of tumors began in the Research Institute of Medical Radiology of the Academy of Medical Sciences of the USSR in 1973. 252 Cf afterloading cells were utilized by the method of simple afterloading. Dosimetry and radiation protection of medical personnel were developed. To substantiate optimal therapeutic doses of 252 Cf neutrons, a correlation of dose, time, and treatment volume factors with clinical results of 252 Cf interstitial implants in carcinoma of the tongue for 47 patients with a minimum follow-up period of 1 year was studied. Forty-nine interstitial implants have been performed. Seventeen patients received 252 Cf implants alone (Group I), 17 other patients received 252 Cf implants in combination with external radiation (Group II), and 15 patients were treated with interstitial implants for recurrent or residual tumors (Groups III). Complete regression of carcinoma of the tongue was obtained in 48 patients (98%). Thirteen patients (27%) developed radiation necrosis. The therapeutic dose of neutron radiation from 252 Cf sources in interstitial radiotherapy of primary tongue carcinomas (Group I) was found to be 7 to 9 Gy. Optimal therapeutic neutron dose in combined interstitial and external radiotherapy of primary tumors (Group II) was 5 to 6 Gy with an external radiation dose of 40 Gy. For recurrent and residual tumors (Group III), favorable results were obtained with tumor doses of 6.5 to 7 Gy
Survey of potential markets for devices using Californium-252
International Nuclear Information System (INIS)
Permar, P.H.
1975-01-01
Potential applications for devices or systems containing 252 Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252 Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252 Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252 Cf, which have been two to four times greater in Europe than in the US
Experimental studies on californium bioavailability to marine benthic invertebrates
International Nuclear Information System (INIS)
Fowler, S.W.; Carvalho, F.P.; Aston, S.R.
1986-01-01
252 Cf is readily taken up by benthic invertebrates from sea water, reaching whole-body concentration factors of 763 in the polychaete Hermione hystrix, 220 in the shrimp Lysmata seticaudata, 665 in the crab Pilumnus hirtellus and 78 in the bivalve mollusc Venerupis decussata after 3 weeks exposure. Surface sorption plays a predominant role in the uptake process. Depuration in clean sea water was a relatively slow process. The shrimp Lysmata eliminated 252 Cf very rapidly due to moulting. Absorption coefficients for ingested 252 Cf were high, approx. 23% in crabs and approx. 97% in brittlestars. The absorbed fraction was excreted twice as fast from crabs as brittlestars. Exposure of organisms to labelled sediment resulted in low transfer factors that were species dependent. There is some evidence to suggest that uptake from sediments is primarily due to 252 Cf transfer from the pore water. Comparison of these results with published experimental data on other transuranic nuclides in the same or similar species suggests that californium bioavailability is roughly equivalent to that of plutonium and americium. (author)
Californium Cf-252 for pelvic radiotherapy
Energy Technology Data Exchange (ETDEWEB)
Maruyama, Y; Feola, J M; Tai, D; Wilson, L C; Van Nagell, J R; Yoneda, J
1978-01-01
Clinical data about therapy concerning tumors of the female gynecological cancers of the cervix, vagina and uterus are reviewed. Dosimetric, laboratory and radiobiological research data form the basis for an approach to such tumors using Cf-252 as a form of boost brachytherapy. Extreme personnel hazards are a real and important consideration and indicate that maximal containment and isolation procedures should be exercised in its use.
International Nuclear Information System (INIS)
Wallace, C.R.
1995-01-01
In early 1995, the receipt of four sealed californium-252 sources from Oak Ridge National Lab was successfully accomplished by a team comprised of Radiological Engineering, Radiological Operations and Health Physics Instrumentation personnel. A procedure was developed and walked-down by the participants during a Dry Run Evolution. Several special tools were developed during the pre-planning phases of the project which reduced individual and job dose to minimal levels. These included a mobile lifting device for attachment of a transfer ball valve assembly to the undercarriage of the Cannonball Carrier, a transfer tube elbow to ensure proper angle of the source transfer tube, and several tools used during emergency response for remote retrieval and handling of an unshielded source. Lessons were learned in the areas of contamination control, emergency preparedness, and benefits of thorough pre-planning, effectiveness of locally creating and designing special tools to reduce worker dose, and methods of successfully accomplishing source receipt evolutions during extreme or inclement weather
International Nuclear Information System (INIS)
Moore, J.R.
1988-03-01
A SQUID-based magnetic susceptometer has been constructed for studying small radioactive samples at temperatures below 350 K and in magnetic fields up to 50 kilogauss. The device has been used to study californium (element 98) in a number of solid-state forms: the dhcp metal, several oxides (Cf 2 O 3 in both the bcc and monoclinic structures, Cf 7 O 12 , CfO 2 and BaCfO 3 ), several monopnictides (CfN, CfAs and CfSb) and the trichloride (in both the hexagonal and orthorhombic structures). All of these materials were studied in polycrystalline form, and hexagonal CfCl 3 was studied in single-crystal form as well. The susceptometer has the sensitivity to measure samples containing less than 10 micrograms of californium. The magnetic susceptibilities of all of the californium materials at temperatures above about 100 K are described well by the Curie-Weiss relationship. This behavior is consistent with the assumption that the magnetic 5f electrons are localized and that the paramagnetic behavior can be interpreted in terms of the properties of the free ion. The measured values of the effective paramagnetic moment, μ/sub eff/, for all the californium materials that were studied are reasonably consistent with theoretical values based on intermediate coupling models. All of the californium materials showed some indications of cooperative magnetic effects. The dhcp metal was observed to order ferromagnetically at 52 K, and all of the californium compounds studied showed signs of antiferromagnetic ordering, mostly at temperatures below 25 K. 91 refs., 50 figs., 19 tabs
Atlantic Richfield Hanford Company californium multiplier/delayed neutron counter safety analysis
International Nuclear Information System (INIS)
Zimmer, W.H.
1976-08-01
The Californium Multiplier (CFX) is a subcritical assembly of uranium surrounding 252 Cf spontaneously fissioning neutron sources; its function is to multiply the neutron flux to a level useful for activation analysis. This document summarizes the safety analysis aspects of the CFX, DNC, pneumatic transfer system, and instrumentation and to detail all the aspects of the total facility as a starting point for the ARHCO Safety Analysis Review. Recognized hazards and steps already taken to neutralize them are itemized
Use of californium-252 sources in Hungary for teaching and research
International Nuclear Information System (INIS)
Csikai, J.
1976-01-01
An activation facility was designed to accommodate up to 50 mg of 252 Cf; it contains at present a 500 μg source. The absolute values of thermal, epithermal and fast neutron fluxes were determined by the foil activation method using In, Dy, Au, Al and Fe detectors. Cross-sections averaged for unmoderated 252 Cf neutrons were determined for 22 different reactions for elements with atomic weights lying between A=27 and 204. The sensitivity for determination of Al, Ti, Cu, As, Sr, Mo, In, Cd, Ba, Au, Hg and Pb was calculated for NaI(Tl) and Ge(Li) detectors. Average (n,2n) cross-sections for 252 Cf spectrum were calculated for 49 nuclei lying between A=14 and 204. Angular distributions and cross-sections for the fragments from 252 Cf neutron-induced fission of 232 Th and 238 U were measured. Titanium in bauxite and manganese in aluminium alloys were determined with a 252 Cf source. The applicability of solid-state track detectors for neutron dosimetry, radiography and for the determination of fuel burn-up were investigated using 252 Cf neutron and fragment sources. Characteristics of a jumping spark counter for counting fission fragments were studied with 252 Cf sources. (author)
International Nuclear Information System (INIS)
Guey, A.; Leitienne, P.; Zech, P.Y.; Traeger, J.; Doyen, J.B.; Breton, J.P.
1979-01-01
With californium-252 it is easy to obtain a high neutron flux of the order of 10 9 n/s. The mean energy of this radiation, which is close on 2 MeV, activates calcium very well. The authors describe a storage and irradiator unit with a 100 μg californium source, with which it will henceforth be possible to develop this technique of measuring the calcium of the hand in a hospital. The test programme has three distinct phases: (1) irradiation of the biological target for 10 min; (2) after a transfer period of 30 s, detection of the radiation emitted by the 49 Ca for 600 s; (3) processing of the numerical data received, which are transmitted on line to a T 1600 calculator. The weight is found by comparing the activity induced in the unknown calcium mass with that induced in a phantom chosen as the activity standard. The reproducibility of the method is of the order of 3% (5% at the worst). The gross standardized result is edited automatically. For physical and clinical reasons, the hand is chosen as the reference part of the body in 70 control subjects. The local irradiation dose is less than 2 rem. The bone calcium content is 14.3+-1.9 g in men and 10.1+-1.3 g in women. In clinical application of the technique it is necessary to differentiate between the normal calcium content and the calcium content found with a pathological state. This makes it necessary to express the measurement in the form of a volume mass (rho). The volume of the hand skeleton (V in cm 3 ) is calculated from the corresponding bone surface (S in cm 2 ) measured by planimetry with the relationship V=8.925 exp 0.0205.S, found after studying 80 hand skeletons. In our control subjects the calcium bone volume mass was 0.288 g/cm 3 in men and 0.282 g/cm 3 in women. There is a very significant difference (p<0.001) in a population of 88 subjects with chronic renal insufficiencies at the terminal stage: rho=0.233 in men and 0.235 in women
Undergraduate experiments using the neutron radiation from californium-252
International Nuclear Information System (INIS)
Rossel, J.; Golecki, I.
1976-01-01
Three experiments designed to demonstrate and measure several properties of the neutron radiation emitted by a 3μg 252 Cf source are described. The experiments constitute a special project carried out by a third-year undergraduate student at the Institute of Physics of the University of Neuchatel. The 252 Cf source is enclosed in a shield which allows a pencil of fast neutrons to pass through a central tube, while reducing the ambient radiation below the tolerance level. The shield consists of layers of borated paraffin wax, iron and cadmium. The first experiment uses an air-alcohol diffusion cloud chamber for the demonstration of tracks of recoil protons produced by the neutrons. Semi-quantitative measurements of track lengths give the correct order of magnitude of the proton energies. In the second experiment a liquid scintillator detector is used to scan the beam profile across the radiation shield enclosing the source. A pulse-shape-discrimination system discriminates between neutrons and gamma photons. The third experiment makes use of the nuclear emulsion technique to study the neutron energy distribution of 252 Cf. Preliminary results are compared with published values. (author)
Wahid, Kareem; Sanchez, Patrick; Hannan, Mohammad
2014-03-01
In the field of nuclear science, neutron flux is an intrinsic property of nuclear reaction facilities that is the basis for experimental irradiation calculations and analysis. In the Rio Grande Valley (Texas), the UTPA Neutron Research Facility (NRF) is currently the only neutron facility available for experimental research purposes. The facility is comprised of a 20-microgram californium-252 neutron source surrounded by a shielding cascade containing different irradiation cavities. Thermal and fast neutron flux values for the UTPA NRF have yet to be fully investigated and may be of particular interest to biomedical studies in low neutron dose applications. Though a variety of techniques exist for the characterization of neutron flux, neutron activation analysis (NAA) of metal and nonmetal foils is a commonly utilized experimental method because of its detection sensitivity and availability. The aim of our current investigation is to employ foil activation in the determination of neutron flux values for the UTPA NSRF for further research purposes. Neutron spectrum unfolding of the acquired experimental data via specialized software and subsequent comparison for consistency with computational models lends confidence to the results.
Californium production at the transuranium processing plant
International Nuclear Information System (INIS)
King, L.J.
1976-01-01
The Transuranium Processing Plant (TRU) at ORNL, which is the production, storage, and distribution center for the ERDA heavy element research program, is described. About 0.5 percent of 252 Cf is currently being produced. TRU is a hot-cell, chemical processing facility of advanced design. New concepts have been incorporated into the facility for absolute containment, remote operation, remote equipment installation, and remote maintenance. The facilities include a battery of nine heavily shielded process cells served by master-slave manipulators and eight laboratories, four on each of two floors. Processing includes chemical dissolution of the targets followed by a series of solvent extraction, ion exchange, and precipitation steps to separate and purify the transuranium elements. The transcurium elements Bk, Cf, Es, and Fm are distributed to users. Remote techniques are used to fabricate the Am and Cm into target rods for reirradiation in the HFIR. Californium-252 that is in excess of the needs of the heavy element research program and the Cf sales program is stored at TRU and processed repeatedly to recover the daughter product 248 Cm, which is a highly desirable research material
International Nuclear Information System (INIS)
1974-01-01
The offer of the United States to loan Californium-252 sources to the IAEA was made by Dr. Glenn T. Seaborg, then chairman of the USAEC, in his opening statement at the 15th. General Conference of the IAEA held in Vienna in 1971. The purpose of this loan was to make neutron emitting sources available to universities in the Member States for use in educational programmes. The sources, in the form of small needles designed for medical use in radiation therapy, were judged highly suitable for didactic applications due to their small size, limited activity and well documented radiological parameters. Subsequently, in May 1973, the Director General announced the availability of the Californium sources to the Member States. To date, numerous sources have been loaned to universities in Czechoslovakia, Costa Rica, the Federal Republic of Germany, Ghana, India, Iran, Israel, Japan, South Africa, Switzerland, the United Kingdom and Uruguay; additional applications for loans are being processed. It is anticipated that the loan programme will be terminated in 1975 once all the available sources have been distributed. n order to provide guidance for the Member States on the safe exploitation of these sources, a prototype use and storage facility was designed by IAEA staff of the Dosimetry Section of the Division of Life Sciences, and constructed at the IAEA laboratory in Seibersdorf, Austria. Figures 2-5 illustrate some of the details of this container, which is being given to the Ghana Nuclear Centre in support of a training programme for students at the university in Accra. Further advice to users of these sources will be provided by the publication of an instructional syllabus, a laboratory manual for experiments and the safety precautions inherent in the proper handling of neutron emitting radionuclides, authored by Professors Erich J. Hall and Harald H. Rossi of Columbia University. The syllabus and manual will be published as part of the IAEA Technical Series in September
Health physics aspects of 252Cf
International Nuclear Information System (INIS)
Bhagwat, A.M.
1974-01-01
After briefly describing the methods of production, radioactive, chemical and biological properties of californium-252, its health physics aspects are reviewed in detail. Its external and internal radiation hazards can be minimised through control of radiation and contamination and proper shield design. Use of various shielding materials is evaluated. The following aspects are also discussed : (1) radiation detectors for neutrons and gamma radiation (2) personnel monitoring techniques (3) bioassay and (4) storage and transportation. (M.G.B.)
Neutron activation analysis at the Californium User Facility for Neutron Science
International Nuclear Information System (INIS)
Martin, R.C.; Smith, E.H.; Glasgow, D.C.; Jerde, E.A.; Marsh, D.L.; Zhao, L.
1997-12-01
The Californium User Facility (CUF) for Neutron Science has been established to provide 252 Cf-based neutron irradiation services and research capabilities including neutron activation analysis (NAA). A major advantage of the CUF is its accessibility and controlled experimental conditions compared with those of a reactor environment The CUF maintains the world's largest inventory of compact 252 Cf neutron sources. Neutron source intensities of ≤ 10 11 neutrons/s are available for irradiations within a contamination-free hot cell, capable of providing thermal and fast neutron fluxes exceeding 10 8 cm -2 s -1 at the sample. Total flux of ≥10 9 cm -2 s -1 is feasible for large-volume irradiation rabbits within the 252 Cf storage pool. Neutron and gamma transport calculations have been performed using the Monte Carlo transport code MCNP to estimate irradiation fluxes available for sample activation within the hot cell and storage pool and to design and optimize a prompt gamma NAA (PGNAA) configuration for large sample volumes. Confirmatory NAA irradiations have been performed within the pool. Gamma spectroscopy capabilities including PGNAA are being established within the CUF for sample analysis
Californium-252: isotope for modern radiotherapy of cervix, uterine and vaginal carcinomas
International Nuclear Information System (INIS)
Maruyama, J.; Beach, J.L.; Nagell, J.R. van
1984-01-01
Cf-252 is an isotope that can easily be afterloaded into available gynecological applicators and used for bulky cervix, uterus or vaginal cancer therapy. It is economical, time and cost effective in use, and can be applied to the therapy of many patients throughout the world. It is more effective for neutron therapy than machine fast neutron therapy and is the only form of neutron therapy producing consistent complication-free 5-year cure of advanced cancers currently available. Cf-252 is an isotope for modern gynecological tumor therapy for the future. Isodose curves for Cf-252 implants revealed dose distributions conforming well to tumor. (orig.) [de
A survey of uses and users of 252Cf
International Nuclear Information System (INIS)
Bigelow, J.E.; Alexander, C.W.; King, L.J.; Knauer, J.B.; Notz, K.J.
1989-01-01
Californium-252, which is one of the transuranium-element isotopes being produced in the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL), has found many applications in service to industry and medicine. As a neutron source, 252 Cf is unique in providing a highly concentrated and extremely reliable neutron spectrum from a very small assembly. Over the past 22 years, 252 Cf has been applied with great success to cancer therapy, to neutron radiography of objects ranging from flowers to entire aircraft, to startup sources for nuclear reactors, to fission activation assay for quality control and safeguards of all commercial nuclear fuel, and to many other beneficial uses, some of which are now poised for further growth. The extensive exploitation of this highly specialized product has been made possible through 252 Sales/Loan programs sponsored by the US DOE Office of Nuclear Materials Production, initially at the Savannah River Laboratory and now at ORNL
Determination of the average number of neutrons per fission event for californium-252
International Nuclear Information System (INIS)
Aleksandrov, B.M.; Belov, L.M.; Drapchinskij, L.V.
1982-01-01
By means of a separate determination of neutron yields and fission event rates, the value of #betta#-bar( 252 Cf) has been measured for a series of new high-purity sources. The improved quality of the source active layers has reduced the error in determining the fission rate to 0.35%. The value obtained for #betta#-bar( 252 Cf) is 3.747+-0.036. A description is given of the design and the parameters of a spherical manganese bath in which the work on refining the value of #betta#-bar( 252 Cf) will be continued. (author)
Energy Technology Data Exchange (ETDEWEB)
Cardoso, Antonio
1976-07-01
Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)
Energy Technology Data Exchange (ETDEWEB)
Cardoso, Antonio
1976-07-01
Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)
Energy Technology Data Exchange (ETDEWEB)
Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: ce_delgado89@hotmail.com [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)
2015-10-15
Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)
Reactor production of 252Cf and transcurium isotopes
International Nuclear Information System (INIS)
Alexander, C.W.; Halperin, J.; Walker, R.L.; Bigelow, J.E.
1990-01-01
Berkelium, californium, einsteinium, and fermium are currently produced in the High Flux Isotope Reactor (HFIR) and recovered in the Radiochemical Engineering Development Center (REDC) at the Oak Ridge National Laboratory (ORNL). All the isotopes are used for research. In addition, 252 Cf, 253 Es, and 255 Fm have been considered or are used for industrial or medical applications. ORNL is the sole producer of these transcurium isotopes in the western world. A wide range of actinide samples were irradiated in special test assemblies at the Fast Flux Test Facility (FFTF) at Hanford, Washington. The purpose of the experiments was to evaluate the usefulness of the two-group flux model for transmutations in the special assemblies with an eventual goal of determining the feasibility of producing macro amounts of transcurium isotopes in the FFTF. Preliminary results from the production of 254g Es from 252 Cf will be discussed. 14 refs., 5 tabs
International Nuclear Information System (INIS)
Murali, M.S.; Nair, A.G.C.; Gujar, R.B.; Jain, A.; Tomar, B.S.; Godbole, S.V.; Reddy, A.V.R.; Manchanda, V.K.
2008-07-01
The present report gives a description of the methodology for the separation of 248 Cm(III) from decayed 252 Cf (III) waste solution. The waste solution was first assayed for 252 Cf content by neutron counting using a neutron well coincidence counter. The sample was subjected to the chemical separation of 248 Cm (III) from 252 Cf (III) following anion and cation exchange chromatography. The alpha spectrum of the separated curium fraction showed peaks due to 246 Cm and 248 Cm while the corresponding alpha spectrum of californium fraction showed 249,250,251,252 Cf. The gamma ray abundances of 249 Cf were determined with respect to its gamma rays of 387 keV and the data agreed well with that in literature. Separated Cm(III) was further characterized by recording its time resolved fluorescence spectrum (TRFS) in aqueous medium. (author)
Testing of ENDF/B cross section data in the Californium-252 neutron benchmark field
International Nuclear Information System (INIS)
Mannhart, W.
1979-01-01
The fission neutron field of 252 Cf presently represents one of the most well-known neutron benchmark fields. For 13 neutron reactions which are of importance in reactor metrology, measurements of spectrum-averaged cross sections, [sigma], performed in this neutron field were compared with calculated average cross sections. This comparison allows one to draw conclusions as to the quality of different sigma(E) data taken from ENDF/B-IV, from ENDF/B-V, and from recent experiments and used in the calculation of average cross sections. The comparison includes an uncertainty analysis regarding the different uncertainty contributions of [sigma], of sigma(E), and of the spectral distribution of 252 Cf fission neutrons. Additionally, in a few examples, sensitivity studies were carried out. The sensitivity of the spectrum-averaged cross sections to individual characteristics of the sigma(E) data, such as normalization factors or shifts in the energy scale, was investigated. Similarly, the sensitivity of [sigma] to the spectral distribution of 252 Cf was determined. 4 figures, 2 tables
Piper, Roman K; Mozhayev, Andrey V; Murphy, Mark K; Thompson, Alan K
2017-09-01
Evaluations of neutron survey instruments, area monitors, and personal dosimeters rely on reference neutron radiations, which have evolved from the heavy reliance on (α,n) sources to a shared reliance on (α,n) and the spontaneous fission neutrons of californium-252 (Cf). Capable of producing high dose equivalent rates from an almost point source geometry, the characteristics of Cf are generally more favorable when compared to the use of (α,n) and (γ,n) sources or reactor-produced reference neutron radiations. Californium-252 is typically used in two standardized configurations: unmoderated, to yield a fission energy spectrum; or with the capsule placed within a heavy-water moderating sphere to produce a softened spectrum that is generally considered more appropriate for evaluating devices used in nuclear power plant work environments. The U.S. Department of Energy Cf Loan/Lease Program, a longtime origin of affordable Cf sources for research, testing and calibration, was terminated in 2009. Since then, high-activity sources have become increasingly cost-prohibitive for laboratories that formerly benefited from that program. Neutron generators, based on the D-T and D-D fusion reactions, have become economically competitive with Cf and are recognized internationally as important calibration and test standards. Researchers from the National Institute of Standards and Technology and the Pacific Northwest National Laboratory are jointly considering the practicality and technical challenges of implementing neutron generators as calibration standards in the U.S. This article reviews the characteristics of isotope-based neutron sources, possible isotope alternatives to Cf, and the rationale behind the increasing favor of electronically generated neutron options. The evaluation of a D-T system at PNNL has revealed characteristics that must be considered in adapting generators to the task of calibration and testing where accurate determination of a dosimetric quantity is
International Nuclear Information System (INIS)
Brunelle, A.
1990-09-01
A new time-of-flight mass spectrometer, Super-Depil, is used to study secondary ion emission from solid surfaces bombarded by various kinds of primary particles. Three different desorption probes were set up on this machine: a 252 californium source, providing by spontaneous fission about 1 MeV/u energy heavy ions, a 5 to 30 keV energy pulsed caesium ion gun and a pulsed nitrogen laser, which wavelength is 337 mm. A two stages electrostatic mirror was added to the spectrometer. The time spread due to the initial kinetic energy of secondary ions leaving the surface was minimized. The mass resolution is greater than 5000. The analysis of glycosidic terpenes showed the complementarity of the three probes. The study of such metastable ions, with the electrostatic mirror, showed that some fragment ions may conserve the memory of the stereochemistry of the neutral lost. Clusters ions were used as projectiles in the energy range 5-60 keV. A strong non linear enhancement was observed in the secondary ion yield from various targets [fr
International Nuclear Information System (INIS)
Bigelow, J.E.; Cagle, E.B.; Knauer, J.B.
1987-01-01
The Transuranium Processing Plant (TPP) at ORNL has been requested by the Food and Drug Administration (FDA) to furnish 200 mg of 252 Cf for use in their new activation analysis facility. This paper discusses the procedure to be employed in fabricating the californium into four neutron sources, each containing a nominal 50-mg of 252 Cf. The ORNL Model LSD (Large, Stainless steel, Doubly encapsulated) neutron source consists of a 6.33-mm-diam aluminum pellet doubly encapsulated in Type 304L stainless steel. The pellet is comprised of an aluminum tube holding Cf 2 O 2 SO 4 microspheres confined by pressed aluminum powder. The microspheres are prepared in a separate vessel and then transferred into the specially designed aluminum tube prior to pressing
Automated absolute activation analysis with californium-252 sources
International Nuclear Information System (INIS)
MacMurdo, K.W.; Bowman, W.W.
1978-09-01
A 100-mg 252 Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from 17 O. Detection sensitivities of 239 Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level
A new type-B cask design for transporting 252Cf
International Nuclear Information System (INIS)
Simmons, C.M.
2000-01-01
A project to design, certify, and build a new US Department of Energy (DOE) Type B container for transporting >5 mg of 252 Cf is more than halfway to completion. This project was necessitated by the fact that the existing Oak Ridge National Laboratory (ORNL) Type B containers were designed and built many years ago and thus do not have the records and supporting data that current regulations require. Once the new cask is available, it will replace the existing Type B containers. The cask design is driven by the unique properties of 252 Cf, which is a very intense spontaneous fission neutron source and necessitates a large amount of neutron shielding. The cask is designed to contain up to 60 mg of 252 Cf in the form of californium oxide or californium oxysulfate, in pellet, wire, or sintered material forms that are sealed inside small special-form capsules. The new cask will be capable of all modes of transport (land, sea, and air). The ORNL team, composed of technical and purchasing personnel and using rigorous selection criteria, chose NAC, International (NAC), as the subcontractor for the project. In January 1997, NAC started work on developing the conceptual design and performing the analyses. The original design concept was for a tungsten alloy gamma shield surrounded by two concentric shells of NS-4-FR neutron shield material. A visit to US Nuclear Regulatory Commission (NRC) regulators in November 1997 to present the conceptual design for their comments resulted in a design modification when the question of potential straight-line cracking in the NS-4-FR neutron shield material arose. NAC's modified design includes offset, wedgelike segments of the neutron shield material. The new geometry eliminates concerns about straight-line cracking but increases the weight of the packaging and makes the fabrication more complex. NAC has now completed the cask design and performed the analyses (shielding, structural, thermal, etc.) necessary to certify the cask. The cask
Uranium standards for Californium Shuffler
International Nuclear Information System (INIS)
Gibbs, A.; Boynton, S.P.
1978-10-01
The Laboratories Department analyzed pieces of a U-Al log which were to be canned and used as a set of standards for the nondestructive Californium Shuffler instrument. Evaluation of this instrument is part of an on-going Safeguards Program and is a joint project between LASL and SRP. A U-Al casting of a nominal 30% to 70% composition was made with enriched uranium (56 wt % 235 U). The log was 6 in. in diameter and approximately 2 ft long. A 1/4-in. slice was made before and after each 1-in. slice taken for use as a standard. The 1-in. slices were scanned nondestructively by collimated gamma pulse height analysis. The 1/4-in. slices were divided into quadrants and one quadrant for each slice was destructively analyzed. Results from these tests showed an approximate 1.5% relative variation in uranium concentration from the high to the low point. Successive pieces showed less than 1% relative difference. The 1-in. pieces have been canned and shipped to LASL for testing and will be returned with the Californium Shuffler. The remaining 1/4-in. slices have been sent to NBL and LASL for destructive analysis
Trends in radioisotope development and utilization in the United States
Energy Technology Data Exchange (ETDEWEB)
Mott, W E [Energy Research and Development Administration, Washington, D.C. (USA)
1976-06-01
The current trends in radioisotope and radiation technology in the United States are overviewed with emphasis on the developments since the 1973 Conference. The comments focus primarily on the research and development activities receiving the most attention today from the various agencies of the Government. Among the many available radionuclides, technetium-99m has played the single most important role for making possible the developments in the field of nuclear medicine. Many other short lived medium-lived nuclides are applied in the fields of nuclear medicine, cardiac pacemaker, artificial heart, and blood irradiator. Radiation processing is now firmly established in the United States. The trends in sewage treatment, polymer-impregnated materials, bioengineering, and food irradiation are reviewed. The programs for californium-252, strontium-90, cesium-137, plutonium-238, and krypton-85 are also reviewed. The author concludes this paper with the acknowledgement that Japanese researchers have contributed to and have been closely involved in many of the programs discussed. Of particular note is the participation in the clinical phase of the californium-252 radiotherapy program. Several Japanese hospitals have been cooperating with the United States since the very beginning of the californium-252 program in determining the value of the californium-252 neutron therapy. The research being performed is unique, and will contribute greatly to the decisions on the ultimate future of californium-252 for therapeutic purposes.
Test and evaluation results of the 252Cf shuffler at the Savannah River Plant
International Nuclear Information System (INIS)
Crane, T.W.
1981-03-01
The 252 Cf Shuffler, a nondestructive assay instrument employing californium neutron source irradiation and delayed-neutron counting, was developed for measuring 235 U content of scrap and waste items generated at the Savannah River Plant (SRP) reactor fuel fabrication facility. The scrap and waste items include high-purity uranium-aluminum alloy ingots as well as pieces of castings, saw and lathe chips from machining operations, low-purity items such as oxides of uranium or uranium intermixed with flux materials found in recovery operations, and materials not recoverable at SRP such as floor sweepings or residues from the uranium scrap recovery operation. The uranium contains about 60% 235 U with the remaining isotopes being 236 U, 238 U, and 234 U in descending order. The test and evaluation at SRP concluded that the accuracy, safety, reliability, and ease of use made the 252 Cf Shuffler a suitable instrument for routine use in an industrial, production-oriented plant
International Nuclear Information System (INIS)
Maruyama, Y.; van Nagell, J.R.; Yoneda, J.; Donaldson, E.; Gallion, H.; Higgins, R.; Powell, D.; Turner, C.; Kryscio, R.
1988-01-01
A fast-neutron-emitting radioisotope, 252 Cf, is being tested in clinical trials of neutron brachytherapy for cervical cancer. The efficacy for histological eradication of bulky stage IB cervical tumors (mean diameter, approximately 6 cm) using combined radiation and surgery was studied in 65 patients treated with 137 Cs or 252 Cf before surgery during 1983-1986. Forty-four patients were treated with 137 Cs and 21 were treated with 252 Cf at equivalent doses of radiation. Fifteen of the 44 specimens (34%) were positive after 137Cs therapy. Only one of the 21 specimens was positive after 252 Cf therapy (P = .025), and that patient was treated in a delayed schedule 21 days after the start of external-beam irradiation rather than early in the course. 252 Cf therapy required a much lower radiation dose and shorter treatment time. The study compared tumor destruction of an identically staged human cervical tumor in situ by direct histological means, using 252 Cf neutron therapy or conventional photon therapy at an identical and equivalent dose adjusted by a relative biological effectiveness of 6.0 for 252 Cf
International Nuclear Information System (INIS)
Dupouy, G.; Bonhoure, I.; Dumas, Th.; Moisy, Ph.; Petit, S.; Den Auwer, Ch.; Conradson, St.D.; Hennig, Ch.; Scheinost, A.C.; Le Naour, C.; Simoni, E.
2011-01-01
Metal hexa-cyanoferrates are well known molecular solids for a large variety of cations, although very little has been described for actinide adducts. Two new members of actinide(III) hexa-cyanoferrates were synthesized with the cations americium and californium. They were structurally characterized by infrared and X-ray absorption spectroscopy. Combined EXAFS data at the iron K edge and actinide L 3 edge provide evidence for a three-dimensional model for these two new compounds. Structural data in terms of bond lengths were compared to those reported for the parent lanthanide(III) compounds, neodymium and gadolinium hexa-cyanoferrates, respectively: the americium compound with (KNd(III)Fe(II)-Fe-III(CN) 6 .4H 2 O and the californium compound with (KGd(III)Fe(II)(CN) . 3.5H 2 O and (KGd(III)Fe(II)(CN) 6 .3H 2 O. This comparison between actinide and lanthanide homologues has been carried out on the basis of ionic radii considerations. The americium and neodymium environments appear to be very similar and are arranged in a tri-capped trigonal prism polyhedron of coordination number 9 (CN: 9), in which the americium atom is bonded to six nitrogen atoms and to three water molecules. For the californium adduct, a similar comparison and bond length and angle values derived from EXAFS studies suggest that the californium cation sits in a bi-capped trigonal prism (CN: 8) as in (KGd(III)Fe(II)(CN) 6 . 3H 2 O. This arrangement differs from that in the structure of (KGd(III)Fe(II)(CN) 6 .3.5H 2 O, in which the gadolinium atom is surrounded by 9 atoms. This is one of the rare pieces of information revealed by EXAFS spectroscopy for americium and californium in comparison to lanthanide atoms in molecular solid compounds. A discussion on the decrease in bond length and coordination number from americium to californium is also provided, on the basis of crystallographic results reported in the literature for actinide(III) and lanthanide(III) hydrate series. (authors)
International Nuclear Information System (INIS)
Vasil'ev, Yu.A.; Barashkov, Yu.A.; Golovanov, O.A.; Sidorov, L.V.
1977-01-01
A method for determining the average number of secondary neutrons anti ν produced in nuclear fission by the neutrons of the 252 Cf fission spectra by means of a 4π time-of-flight spectrometer is described. Layers of 252 Cf and an isotope studied are placed close to each other; if the isotope layer density is 1 mg/cm 2 probability of its fission is about 10 -5 per one spontaneous fission of californium. Fission fragments of 252 Cf and the isotope investigated have been detected by two surface-barrier counters with an efficiency close to 100%. The layers and the counters are situated in a measuring chamber placed in the center of the 4π time-of-flight spectrometer. The latter is utilized as a neutron counter because of its fast response. The method has been verified by carrying out measurements for 235 U and 239 Pu. A comparison of the experimental and calculated results shows that the method suggested can apply to determine the number of secondary neutrons in fission of isotopes that have not been investigated yet
International Nuclear Information System (INIS)
Lamaze, G.P.; Schima, F.J.; Eisenhauer, C.M.; Spiegel, V.
1988-01-01
Because of the similarity in energy dependence of the /sup 103/Rh(n,n') differential cross section to the kerma muscle response function for neutrons, rhodium may be useful as a neutron kerma monitor. In support of its use as a neutron monitor, the spectrum-averaged cross section σ-bar has been measured for a /sup 252/Cf fission neutron spectrum. Pairs of thin rhodium samples were irradiated on opposite sides of a thinly encapsulated /sup 252/Cf neutron source. The neutron emission rate of the /sup 252/Cf source was determined by the manganous sulfate (MnSO/sub 4/) bath technique. In this method, the californium source emission rate is determined by comparison to the known emission rate of NBS-I, a standard radium-beryllium neutron source. The neutron fluence incident on the rhodium samples is determined from the californium source strength, average sample-to-source distance, and the duration of the irradiation. Corrections are made for neutron scattering saturation of activity, and attenuation of the X rays by the sample during counting. The X rays were detected with an intrinsic germanium detector designed specifically for low-energy X-ray detection. The activity was not determined by absolute counting so that the final results depend on the value of P/sub Κx/, to total Κ X-ray emission probability. The results of five separate irradiations yield a value of σ-bar . P/sub Κx/ = 62.3 +- 1.9 mb. Using the most recently published value of P/sub Κx/ gives a value of σ-bar = 739 +- 22 mb. A discussion of systematic uncertainties is given
International Nuclear Information System (INIS)
Wogman, N.A.
1976-12-01
Instrumentation has been designed for in situ analysis of marine and terrestrial minerals using the techniques of x-ray fluorescence and neutron activation analysis. The energy-dispersive x-ray fluorescence analyzer allows more than 20 elements to be quantitatively measured at the 10 ppM level in water depths to 300 m. The analyzer consists of a solid cryogen-cooled Si(Li) detector, a 50 mCi 109 Cd or 57 Co excitation source, and an analyzer-computer system for data storage and manipulation. The neutron activation analysis, which is designed to measure up to 30 elements at parts per hundred to ppM levels, utilizes the man-made element 252 Cf as its neutron activation source. The resulting radioelements which emit characteristic gamma radiation are then analyzed in situ during 2- to 200-s counting intervals with Ge(Li) or NaI(T1) detector systems. An extension of this latter technique, which uses a 252 Cf- 235 U fueled subcritical multiplier, is also being studied. The subcritical facility allows the neutrons from the 252 Cf source to be multiplied, thus providing greater neutron flux. Details of these in situ analysis systems, actual in situ spectra, and recorded data are discussed with respect to the detection of minerals at their varying concentration levels. The system response of each illustrates its usefulness for various rapid environmental mineral exploration studies. These techniques can be utilized on terrestrial surfaces and marine or fresh water sediments. 5 figures, 2 tables
Energy Technology Data Exchange (ETDEWEB)
King, Sean W., E-mail: sean.king@intel.com; Tanaka, Satoru; Davis, Robert F. [Department of Materials Science and Engineering, North Carolina State University, Raleigh, North Carolina 27695 (United States); Nemanich, Robert J. [Department of Physics, North Carolina State University, Raleigh, North Carolina 27695 (United States)
2015-09-15
Due to the extreme chemical inertness of silicon carbide (SiC), in-situ thermal desorption is commonly utilized as a means to remove surface contamination prior to initiating critical semiconductor processing steps such as epitaxy, gate dielectric formation, and contact metallization. In-situ thermal desorption and silicon sublimation has also recently become a popular method for epitaxial growth of mono and few layer graphene. Accordingly, numerous thermal desorption experiments of various processed silicon carbide surfaces have been performed, but have ignored the presence of hydrogen, which is ubiquitous throughout semiconductor processing. In this regard, the authors have performed a combined temperature programmed desorption (TPD) and x-ray photoelectron spectroscopy (XPS) investigation of the desorption of molecular hydrogen (H{sub 2}) and various other oxygen, carbon, and fluorine related species from ex-situ aqueous hydrogen fluoride (HF) and in-situ remote hydrogen plasma cleaned 6H-SiC (0001) surfaces. Using XPS, the authors observed that temperatures on the order of 700–1000 °C are needed to fully desorb C-H, C-O and Si-O species from these surfaces. However, using TPD, the authors observed H{sub 2} desorption at both lower temperatures (200–550 °C) as well as higher temperatures (>700 °C). The low temperature H{sub 2} desorption was deconvoluted into multiple desorption states that, based on similarities to H{sub 2} desorption from Si (111), were attributed to silicon mono, di, and trihydride surface species as well as hydrogen trapped by subsurface defects, steps, or dopants. The higher temperature H{sub 2} desorption was similarly attributed to H{sub 2} evolved from surface O-H groups at ∼750 °C as well as the liberation of H{sub 2} during Si-O desorption at temperatures >800 °C. These results indicate that while ex-situ aqueous HF processed 6H-SiC (0001) surfaces annealed at <700 °C remain terminated by some surface C–O and
Sample and plume luminescence in fast heavy ion induced desorption
International Nuclear Information System (INIS)
Tuszynski, W.; Koch, K.; Hilf, E.R.
1996-01-01
The luminescence arising in 252 Cf-fission fragment induced desorption events has been measured using the time-correlated single photon counting technique. Photons emitted from the sample have been guided from a plasma desorption ion source to a photodetector by an optical fibre. Spectra and decay functions have been obtained using thin layers of Coronene or POPOP as samples. The results are strongly dependent on the acceleration field applied for ion extraction. Approximately 10 photons per fission fragment have been produced when applying no accelerating voltage. The results clearly show that these photons come from radiative electronic relaxations of molecules in the solid sample. Considerably more photons per fission fragment have been produced when applying a positive acceleration voltage. The intensity increases almost linearly for acceleration fields below 10 kV/cm and saturates at a nearly 10-fold higher value when compared to no acceleration. The intensity is also affected by the homogeneity of the accelerating field. These additional photons are attributed to radiative electronic relaxations of desorbed neutral molecules in the plume excited by inelastic collisions with accelerated positive ions. No additional photons have been observed when extracting negative ions. The negative ions produced do obviously not hit and/or excite desorbed neutral molecules, presumably due to their specific desorption characteristics. The experimental data have been analyzed by comparing with the cw and time-resolved sample luminescence obtained by optical excitation. The findings demonstrate that valuable information on ion-solid interactions, on specific desorption quantities and on processes in the plume can be obtained by measuring and analyzing the luminescence induced by the impact of high energy primary ions. (orig.)
International Nuclear Information System (INIS)
Hobart, D.E.; Varlashkin, P.G.; Samhoun, K.; Haire, R.G.; Peterson, J.R.
1983-01-01
Multimilligram quantities of trivalent curium-248 and californium-249 were investigated by absorption spectroscopy, cyclic voltammetry, and bulk solution electrolysis in concentrated aqueous carbonate-bicarbonate solution. Actinide concentrations between 10 -4 and 10 -2 M were studied in 2 M sodium carbonate and 5.5 M potassium carbonate solutions at pH values from 8 to 14. The solution absorption spectra of Cm(III) and Cf(III) in carbonate media are presented for the first time and compared to literature spectra of these species in noncomplexing aqueous solution. It was anticipated that carbonate complexation of the actinide ions could provide a sufficient negative shift in the formal potentials of the M(IV)/M(III) couples of Cm and Cf to permit the generation and stabilization of their tetravalent states in aqueous carbonate-bicarbonate medium. No conclusive evidence was found in the present work to indicate the existence of any higher oxidation states of curium or californium in carbonate solution. Some possible reasons for our inability to generate and detect oxidized species of curium and californium in this medium are discussed
Desorption of organic molecules with fast incident atomic and polyatomic ions
International Nuclear Information System (INIS)
Hunt, J.E.; Salehpour, M.; Fishel, D.L.
1989-01-01
In 1974, Macfarlane and coworkers introduced a new mass spectrometric technique based on desorption-ionization of sample molecules from solid targets by the impact of fast heavy ions (fission fragments) from 252 Cf. The process of ion-induced desorption of molecular ions from surfaces is not yet fully understood, although a large amount of experimental data related to the mechanism has been published. This paper concerns the use of fast incident polyatomic ions to induce desorption of secondary molecular ions of valine and chlorophyll from surfaces. Polyatomic ions are unique in that they are a collection of temporally and spatially correlated atoms. The main finding in this study is that incident polyatomic ions produce drastic enhancements in the secondary ion yields over atomic ions. Also, two types of nonlinear effects in desorption have been observed and will be discussed
International Nuclear Information System (INIS)
Todd, P.; Feola, J.M.
1986-01-01
Metabolically deoxygenated suspensions of human T-1 cells were used to determine the RBE in hypoxia of low dose rate (LDR) Cf-252 radiation compared to LDR gamma radiation. Based upon the initial portion of the survival curves the RBE was 5.0 ± 1.0 for all components of the Cf-252 radiation and 7.1 ± 1.7 for the neutrons alone. An inverse dose rate effect was observed for LDR gamma radiation in which greater cell sensitivity was observed at lower dose rates and longer irradiation periods. It was demonstrated that there was little or no sublethal damage repair or cell progression during LDR at 21 deg C, and the observed decrease in cell survival probability with increasing irradiation time at a given dose was attributable to reoxygenation of the cell suspensions during the course of LDR exposures. (Auth.)
On-line high-resolution mass spectroscopy. Progress report, January 1, 1975--July 1, 1975
International Nuclear Information System (INIS)
Macfarlane, R.D.
1975-01-01
The report begins with a brief introduction, summary of activities, and lists of personnel, facilities used, publications, and presentations. Work on xanthine--tyrosine and sulfuric acid esters was completed in the project on 252 Cf-plasma desorption mass spectroscopy of involatile molecules. Work is continuing in the following areas: beta--gamma directional correlations and second-class currents in nuclear beta decay (mass-20 system), beta--neutrino directional correlations in mass 8, atomic mass measurements, and 252 Cf-plasma desorption mass spectroscopy of large biomolecules. (3 figures) (RWR)
X-ray-diffraction study of californium metal to 16 GPa
International Nuclear Information System (INIS)
Peterson, J.R.; Benedict, U.; Dufour, C.; Birkel, I.; Haire, R.G.
1983-01-01
The first series of measurements to determine the structural behavior of californium (Cf) metal under pressure has been carried out. The initial dhcp structure transformed sluggishly with increasing pressure to a fcc structure. A bulk modulus of 50(5) GPa was derived for dhcp Cf metal from the relative volume (V/V 0 ) data to 10 GPa
International Nuclear Information System (INIS)
Brunson, G.S. Jr.
1982-06-01
An array of eight high-speed plastic scintillation detectors has been used to infer a mathematical model for the emission multipliciy of prompt gammas in the spontaneous fission of 252 Cf. Exceptional time resolution and coincidence capability permitted the separation of gammas from fast neutrons over a flight path of approximately 10 cm. About 20 different distribution models were tested. The average energy of the prompt gammas is inversely related to the number emitted; however, this inverse relationship is not strong and the total gamma energy does increase with increasing gamma number. An extension of the experiment incorporated a lithium-drifted germanium gamma spectrometer that resolved nearly 100 discrete gammas associated with fission. Of these gammas, some were preferentially associated with fission in which few gammas were emitted. Certain others were more frequent when many gammas were emitted. Results are presented
Deuterium desorption from tungsten using laser heating
Directory of Open Access Journals (Sweden)
J.H. Yu
2017-08-01
Full Text Available Retention and desorption of hydrogenic species need to be accurately modeled to predict the tritium inventory of next generation fusion devices, which is needed both for tritium fuel recovery and for tritium safety concerns. In this paper, experiments on thermal desorption of deuterium from intrinsic polycrystalline tungsten defects using laser heating are compared to TMAP-7 modeling. The samples during deuterium plasma exposure were at a temperature of 373K for this benchmark study with ion fluence of 0.7–1.0 ×1024Dm−2. Following plasma exposure, a fiber laser (λ= 1100nm heated the samples to peak surface temperatures ranging from ∼500 to 1400K with pulse widths from 10ms to 1s, and 1 to 10 pulses applied to each sample. The remaining deuterium retention was measured using temperature programmed desorption (TPD. Results show that > 95% of deuterium is desorbed when the peak surface temperature reached ∼950K for > 1s. TMAP-7 is used to predict deuterium desorption from tungsten for a range of surface temperatures and heating durations, and is compared to previous work on desorption from beryllium codeposits.
Modeling of hydrogen desorption from tungsten surface
Energy Technology Data Exchange (ETDEWEB)
Guterl, J., E-mail: jguterl@ucsd.edu [University of California, San Diego, La Jolla, CA 92093 (United States); Smirnov, R.D. [University of California, San Diego, La Jolla, CA 92093 (United States); Krasheninnikov, S.I. [University of California, San Diego, La Jolla, CA 92093 (United States); Nuclear Research National University MEPhI, Moscow 115409 (Russian Federation); Uberuaga, B.; Voter, A.F.; Perez, D. [Los Alamos National Laboratory, Los Alamos, NM 8754 (United States)
2015-08-15
Hydrogen retention in metallic plasma-facing components is among key-issues for future fusion devices. For tungsten, which has been chosen as divertor material in ITER, hydrogen desorption parameters experimentally measured for fusion-related conditions show large discrepancies. In this paper, we therefore investigate hydrogen recombination and desorption on tungsten surfaces using molecular dynamics simulations and accelerated molecular dynamics simulations to analyze adsorption states, diffusion, hydrogen recombination into molecules, and clustering of hydrogen on tungsten surfaces. The quality of tungsten hydrogen interatomic potential is discussed in the light of MD simulations results, showing that three body interactions in current interatomic potential do not allow to reproduce hydrogen molecular recombination and desorption. Effects of surface hydrogen clustering on hydrogen desorption are analyzed by introducing a kinetic model describing the competition between surface diffusion, clustering and recombination. Different desorption regimes are identified and reproduce some aspects of desorption regimes experimentally observed.
Iwai, Takahiro; Kakegawa, Ken; Aida, Mari; Nagashima, Hisayuki; Nagoya, Tomoki; Kanamori-Kataoka, Mieko; Miyahara, Hidekazu; Seto, Yasuo; Okino, Akitoshi
2015-06-02
A gas-cylinder-free plasma desorption/ionization system was developed to realize a mobile on-site analytical device for detection of chemical warfare agents (CWAs). In this system, the plasma source was directly connected to the inlet of a mass spectrometer. The plasma can be generated with ambient air, which is drawn into the discharge region by negative pressure in the mass spectrometer. High-power density pulsed plasma of 100 kW could be generated by using a microhollow cathode and a laboratory-built high-intensity pulsed power supply (pulse width: 10-20 μs; repetition frequency: 50 Hz). CWAs were desorbed and protonated in the enclosed space adjacent to the plasma source. Protonated sample molecules were introduced to the mass spectrometer by airflow through the discharge region. To evaluate the analytical performance of this device, helium and air plasma were directly irradiated to CWAs in the gas-cylinder-free plasma desorption/ionization system and the protonated molecules were analyzed by using an ion-trap mass spectrometer. A blister agent (nitrogen mustard 3) and nerve gases [cyclohexylsarin (GF), tabun (GA), and O-ethyl S-2-N,N-diisopropylaminoethyl methylphosphonothiolate (VX)] in solution in n-hexane were applied to the Teflon rod and used as test samples, after solvent evaporation. As a result, protonated molecules of CWAs were successfully observed as the characteristic ion peaks at m/z 204, 181, 163, and 268, respectively. In air plasma, the limits of detection were estimated to be 22, 20, 4.8, and 1.0 pmol, respectively, which were lower than those obtained with helium plasma. To achieve quantitative analysis, calibration curves were made by using CWA stimulant dipinacolyl methylphosphonate as an internal standard; straight correlation lines (R(2) = 0.9998) of the peak intensity ratios (target per internal standard) were obtained. Remarkably, GA and GF gave protonated dimer ions, and the ratios of the protonated dimer ions to the protonated
International Nuclear Information System (INIS)
Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.
1981-01-01
Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads mg -1 h -1 +- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads mg -1 h -1 . These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less
International Nuclear Information System (INIS)
Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.
1981-01-01
Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads micrograms-1 h-1 +/- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads micrograms-1 h-1. These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less
Californium Recovery from Palladium Wire
Energy Technology Data Exchange (ETDEWEB)
Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2014-08-01
The recovery of 252Cf from palladium-252Cf cermet wires was investigated to determine the feasibility of implementing it into the cermet wire production operation at Oak Ridge National Laboratory’s Radiochemical Engineering Development Center. The dissolution of Pd wire in 8 M HNO3 and trace amounts of HCl was studied at both ambient and elevated temperatures. These studies showed that it took days to dissolve the wire at ambient temperature and only 2 hours at 60°C. Adjusting the ratio of the volume of solvent to the mass of the wire segment showed little change in the kinetics of dissolution, which ranged from 0.176 mL/mg down to 0.019 mL/mg. A successful chromatographic separation of 153Gd, a surrogate for 252Cf, from Pd was demonstrated using AG 50x8 cation exchange resin with a bed volume of 0.5 mL and an internal diameter of 0.8 cm.
Californium oxygen system for 1.50 < O/Cf < 1.72
International Nuclear Information System (INIS)
Turcotte, R.P.; Haire, R.G.
1975-01-01
The californium-oxygen system was studied as a function of temperature, oxygen pressure, and stoichiometry by manometric and x-ray diffraction methods. The results establish rhombohedral Cf 7 O 12 as the stable compound obtained by heating Cf 2 O 3 in air. The isobaric oxidation-reduction cycles Cf 2 O 3 → Cf 7 O 12 → Cf 2 O 3 , observed in constant rate of heating (cooling) experiments, occur with large hysteresis. A close parallel to other fluorite related lanthanide and actinide oxide systems is established. (auth)
International Nuclear Information System (INIS)
Taylor, G.N.
1985-01-01
Studies are being conducted in mice comparing the toxicity of radium-226, plutonium-239, americium-241, californium-249 and californium-252 in C57B1/Do (albino) mice and the toxicity of americium-241, plutonium-239 and radium-226 in deer mice (Peromyscus maniculatus) and grasshopper mice (Onychomys leucogaster). These experiments will ultimately enable comparison of the toxicity of the above actinide toxicity in man to be made using radium toxicity as the baseline
Energy Technology Data Exchange (ETDEWEB)
Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2014-04-24
This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.
Energetic particle induced desorption of water vapor cryo-condensate
International Nuclear Information System (INIS)
Menon, M.M.; Owen, L.W.; Simpkins, J.E.; Uckan, T.; Mioduszewski, P.K.
1990-01-01
An in-vessel cryo-condensation pump is being designed for the Advanced Divertor configuration of the DIII-D tokamak. To assess the importance of possible desorption of water vapor from the cryogenic surfaces of the pump due to impingement of energetic particles from the plasma, a 77 K surface on which a thin layer of water vapor was condensed was exposed to a tenuous plasma (density = 2 x 10 10 cm -3 , electron temperature = 3 eV). Significant desorption of the condensate occurred, suggesting that impingement of energeticparticles (10 eV) at flux levels of ∼10 16 cm 2 s -1 on cryogenic surfaces could potentially induce impurity problems in the tokamak plasma. A pumping configuration is presented in which this problem is minimized without sacrificing the pumping speed
Shevchenko, Valeriy E; Arnotskaya, Natalia E; Zaridze, David G
2010-01-01
There are no satisfactory plasma biomarkers which are available for the early detection and monitoring of lung cancer, one of the most frequent cancers worldwide. The aim of this study is to explore the application of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-ToF MS) to plasma proteomic patterns to distinguish lung cancer patients from healthy individuals. The EDTA plasma samples have been pre-fractionated using magnetic bead kits functionalized with weak cation exchange coatings. We compiled MS protein profiles for 90 patients with squamous cell carcinomas (SCC) and compared them with profiles from 187 healthy controls. The MALDI-ToF spectra were analyzed statistically using ClinProTools bioinformatics software. Depending on the sample used, up to 441 peaks/spectrum could be detected in a mass range of 1000-20,000 Da; 33 of these proteins had statistically differential expression levels between SCC and control plasma (P 90%) in external validation test. These results suggest that plasma MALDI-ToF MS protein profiling can distinguish patients with SCC and also from healthy individuals with relatively high sensitivity and specificity and that MALDI- ToF MS is a potential tool for the screening of lung cancer.
Directory of Open Access Journals (Sweden)
E. Pajuste
2017-08-01
Experimental results revealed that > 95% of the tritium was localized in the top 30 – 45µm of the ‘plasma-facing’ surface, however, possible tritium presence up to 100µm cannot be excluded. During temperature programmed desorption at 4.8K/min in the flow of purge gas He+ 0.1% H2 the tritium release started below 475K, the most intense release occurred at 725 – 915K and the degree of detritiation of > 91% can be obtained upon reaching 1075K. The total tritium activity in the samples was in range of 2 – 32kilo Becquerel per square centimetre of the plasma-facing surface area.
Particle desorption mass spectrometric surface characterization
International Nuclear Information System (INIS)
Summers, W.R.
1986-01-01
The feasibility of utilizing 252 Cf-Particle Desorption Mass Spectrometry (PDMS) to characterize the surface region of solid samples has been evaluated. The PDMS experiment was adapted to an ultrahigh vacuum (UHV) environment and was configured so as to allow the analysis of thick as well as thin samples. This apparatus included an in situ sputter cleaning/depth profiling facility. The mass resolution was variable from 300 to 200 at 133 daltons by changing the drift length from 27 cm to 20 cm. Desorbed ions were focused by using either a dual grid assembly or an einzel lens. The overall instrumental transmission efficiency with the einzel lens operative was approximately 50%. The applicability of 252 Cf-PDMS to samples that were thick and insulating was demonstrated in the analysis of geological specimens. Pollucite, Microcline, Amblygonite, and Lepidolite were analyzed without complications associated with sample thickness or charge accumulation. Substitution occurring between the alkali metals in the environment was observed by PDMS and was corroborated by SIMS, XPS, and EMP analyses. The analysis of NBM SRM glasses addressed the suitability of combining the PDMS technique was sputter etching. This application demonstrated the ability of this technique to sense changes in the chemical environment brought about by sputter cleaning. The analysis of these samples also allowed the estimation of detection limits for lithium, rubidium, and cesium in a glass matrix as 300 ppm, 400 ppm, and 400 ppm, respectively. Sputter depth profiling combined with 252 Cf-PDMS analysis of an aluminum layer on a silicon substrate established the utility of the PDMS technique in surface characterization
In this study, we describe and evaluate the performance of a simple and rapid mass spectral method for screening fish plasma for estrogen-responsive biomarkers using matrix assisted laster desorption/ionization time of flight mass spectrometry (MALDI-TOF-MS) couopled with a short...
48 CFR 53.301-252 - Standard Form 252, Architect-Engineer Contract.
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Standard Form 252, Architect-Engineer Contract. 53.301-252 Section 53.301-252 Federal Acquisition Regulations System FEDERAL..., Architect-Engineer Contract. EC01MY91.035 EC01MY91.036 ...
International Nuclear Information System (INIS)
Shilo, N.A.; Ippolitov, E.G.; Ivanenko, V.V.; Kustov, B.N.; Zheleznov, V.V.; Aristov, G.N.; Kovalenko, V.V.; Kondrat'ev, N.B.
1983-01-01
A facility using a californium neutron source and a method for the neutron activation analysis of gold were developed. The sensitivity of the determination is 0.1 g/t. The causes of random and systematic errors have been studied. It is concluded that in prospection and evaluation of gold ore deposists, the traditional test tube analysis for gold may be replaced with the developed method. (author)
Radioactive materials production
International Nuclear Information System (INIS)
Anon.
1985-01-01
The Radiochemical Processing Plant (RPP) at ORNL has served as the national repository and distribution center for 233 U for > 20 years. Several hundred kilograms of uranium, containing approximately 90 to 98% 233 U, are stored there in the form of metal, oxides, and nitrate solutions. All of these uranium materials contain small, but significant, concentrations of 232 U, ranging from 2 to 225 ppm. Most of the radioactivity associated with the 233 U comes from the decay daughters of 232 U (74-year half-life). The 252 Cf Industrial Sales/Loan Program involves loans of 252 Cf neutron sources to agencies of the US Government and sales of 252 Cf as the bulk oxide and as palladium-californium alloy pellets and wires. The program has been operated since 1968 in temporary facilities at the Savannah River Laboratory (SRL). The obsolete hot-cell facilities at SRL are now being decommissioned, and the program activities are being transferred to ORNL's Californium Facility in Bldg. 7930, which is managed by the staff of the Transuranium Processing Plant
Calibration of a Modified Californium Shuffler
International Nuclear Information System (INIS)
Sadowski, E.T.; Armstrong, F.; Oldham, R.; Ceo, R.; Williams, N.
1995-01-01
A californium shuffler originally designed to assay hollow cylindrical pieces of UA1 has been modified to assay solid cylinders. Calibration standards were characterized via chemical analysis of the molten UA1 taken during casting of the standards. The melt samples yielded much more reliable characterization data than drill samples taken from standards after the standards had solidified. By normalizing one well-characterized calibration curve to several standards at different enrichments, a relatively small number of standards was required to develop an enrichment-dependent calibration. The precision of this shuffler is 0.65%, and the typical random and systematic uncertainties are 0.53% and 0.73%, respectively, for a six minute assay of an ingot containing approximately 700 grams of 235 U. This paper will discuss (1) the discrepancies encountered when UA1 standards were characterized via melt samples versus drill samples, (2) a calibration methodology employing a small number of standards, and (3) a comparison of results from a previously unused shuffler with an existing shuffler. A small number of UA1 standards have been characterized using samples from the homogeneous molten state and have yielded enrichment-dependent and enrichment-independent calibration curves on two different shufflers
In situ measurements of fuel retention by laser induced desorption spectroscopy in TEXTOR
Zlobinski, M.; Philipps, V.; Schweer, B.; Huber, A.; Stoschus, H.; Brezinsek, S.; Samm, U.; TEXTOR Team
2011-12-01
In future fusion devices such as ITER tritium retention due to tritium co-deposition in mixed material layers can be a serious safety problem. Laser induced desorption spectroscopy (LIDS) can measure the hydrogen content of hydrogenic carbon layers locally on plasma-facing components, while hydrogen is used as a tritium substitute. For several years, this method has been applied in the TEXTOR tokamak in situ during plasma operation to monitor the hydrogen content in space and time. This work shows the LIDS signal reproducibility and studies the effects of different plasma conditions, desorption distances from the plasma and different laser energies using a dedicated sample with constant hydrogen amount. Also the LIDS signal evaluation procedure is described in detail and the detection limits for different conditions in the TEXTOR tokamak are estimated.
International Nuclear Information System (INIS)
Box, W.D.; Shappert, L.B.; Seagren, R.D.; Klima, B.B.; Jurgensen, M.C.; Hammond, C.R.; Watson, C.D.
1980-01-01
An analytical evaluation of the Oak Ridge National Laboratory TRU Californium Shipping Container was made in order to demonstrate its compliance with the regulations governing off-site shipment of packages that contain radioactive material. The evaluation encompassed five primary categories: structural integrity, thermal resistance, radiation shielding, nuclear criticality safety, and quality assurance. The results of this evaluation demonstrate that the container complies with the applicable regulations
Neutron emission in fission of highly excited californium nuclei (E*=76 MeV)
International Nuclear Information System (INIS)
Blinov, M.V.; Bordyug, V.M.; Kozulin, Eh.M.; Mozhaev, A.N.; Levitovich, M.; Muzychka, Yu.A.; Penionzhkevich, Yu.Eh.; Pustyl'nik, B.I.
1990-01-01
The differential cross sections for neutron production in the fission of highly excited californium nuclei formed in the 238 U+ 12 C (105 MeV) reaction have been measured. From the analysis of the experimental data is follows that the number of pre-fission neutrons substantially exceeds the value obtained in the framework of the standard statistical model. The saddle-to-scission time of the excited nucleus is estimated on the basis of the neutron multiplicity. The dependences of the neutron number and neutron average energies upon the fragment mass are determined
Neutron emission in fission of highly excited californium nuclei (E* = 76 MeV)
International Nuclear Information System (INIS)
Blinov, M.V.; Bordyug, V.M.; Kozulin, E.M.; Levitovich, M.; Mozhaev, A.N.; Muzychka, Yu.A.; Penionzhkevich, Yu.E.; Pustyl'nik, B.I.
1990-01-01
Differential cross sections for neutron production have been measured in fission of excited californium nuclei produced in the reaction 238 U + 12 C (105 MeV). It follows from analysis of the experimental results that the number of neutrons emitted before fission considerably exceeds the number obtained in the framework of the standard statistical model. On the basis of the multiplicity of neutrons they authors have estimated the time of fission of the excited nucleus. The dependence of the number of neutrons and their average energies on the mass of the fragments is determined
International Nuclear Information System (INIS)
Sadowski, E.T.; Griffin, J.C.; Rinard, P.M.
1991-01-01
A Scrap Californium Shuffler at the Savannah River Site (SRS) was calibrated to assay the U-Al cores of billets (an intermediate step in the SRS reactor fuel fabrication cycle.) The precision of the Scrap Shuffler over several years has been approximately 0.50%. A typical total uncertainty for the assay of a core on the Scrap Shuffler is approximately 0.33% for a twelve minute assay. The precision over several months and a typical total uncertainty for the Billet Active Well (neutron) Coincidence Counter (BAWCC) are approximately 1.0% and 1.9%, respectively, for a fifteen minute assay. A new Billet Californium Shuffler specifically designed for assaying SRS billets has yielded precision (over one month) and total uncertainty results of 0.40% and 0.69%, respectively, for an eight minute assay. The introduction of a measurement point into the fuel fabrication cycle to replace estimates based upon material weight will greatly enhance material and process control in the Reactor Materials area of SRS. The use of all three instruments provides a comparison of the relative merits of Active Well (neutron) Coincidence Counters (AWCCs) and shufflers for assay of homogeneous and geometrically simple material containing 235 U. The measurement precisions, systematic and random uncertainties, as well as the procurement and operation of each instrument will be compared. 3 refs., 5 figs., 1 tab
Energy Technology Data Exchange (ETDEWEB)
Mizota, Takeshi; Nakao, Setsuo; Niwa, Hiroaki; Saito, Kazuo [Particle Beam Sceince Laboratory, Multi-Function Material Science Department, National Industrial Research Inst. of Nagoya, Nagoya (Japan)
2001-02-01
Plasma Desorption Mass Spectrometry (PDMS) analysis was studied using TANDEM accelerator. The heavy ions of MeV range emit the secondary ions of atoms, molecules, polymers and clusters from the irradiated samples without destruction. The analysis system of PDMS designed and set-up using a mass spectrometer of Time of Flight and the TANDEM accelerator. The system performance was tested for C-60 fullerene on the surface of the samples using 11.2 MeV {sup 28}Si beams produced by the TANDEM accelerator of 1.7MV. The result shows that the hydrogen and hydrocarbons can be analyzed in the range of 1amu unit. The resolution (M/{delta}M) of the Mass Spectrometry system is confirmed to be about 1000 from the separation of the 720 and 721amu peaks, which is attributed to the C-60 fullerene including {sup 13}C atoms. (H. Katsuta)
Neutron activation analysis detection limits using 252Cf sources
International Nuclear Information System (INIS)
DiPrete, D.P.; Sigg, R.A.
2000-01-01
The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes
International Nuclear Information System (INIS)
Boddy, K.
1978-11-01
A simple and cheap facility for partial body neutron activation analysis has been designed, based on the use of two 100 μg 252 Cf neutron sources. The results reported show that calcium can be measured in parts of the body such as the tibia with a precision as good as +- 1.6 % for a radiation dose of 2 rem. The uniformity of the thermal neutron flux density is better than +- 3 % over 10 cm. Some applications of this irradiation facility for studies of trace elements, in particular cadmium in liver and aluminium in liver or brain, have also been explored. However, the sensitivity attainable is not yet sufficient for the study of normal levels, but could be of interest in toxicological investigations
Savannah River Plant californium-252 Shuffler electronics manual
International Nuclear Information System (INIS)
Bourret, S.C.; Crane, T.W.; Eccleston, G.W.; Gallegos, E.A.; Garcia, D.L.
1980-03-01
Detailed information is presented in this report, an electronics manual for the Savannah River Plant Shuffler, about the electronics associated with the various control and data acquisition functions of the Shuffler subsystems. Circuit diagrams, interconnection information, and details about computer control and programming are included
Savannah River Plant Californium-252 Shuffler software manual
International Nuclear Information System (INIS)
Johnson, S.S.; Crane, T.W.; Eccleston, G.W.
1979-03-01
A software manual for operating the Savannah River Plant Shuffler nondestructive assay instrument is presented. The procedures for starting up the instrument, making assays, calibrating, and checking the performance of the hardware units are described. A list of the error messages with an explanation of the circumstances prompting the message and possible corrective measures is given. A summary of the software package is included showing the names and contents of the files and subroutines. The procedure for modifying the software package is outlined
International Nuclear Information System (INIS)
Straker, E.A.; Gritzner, M.L.; Harris, L. Jr.
1978-01-01
Calculations of neutron and gamma-ray fluences from 14-MeV neutron and 252 Cf sources in liquid air and liquid nitrogen have been performed. These calculations were made specifically for comparison with experimental data measured at Stohl, Federal Republic of Germany. The discrete-ordinates method was utilized with neutron and gamma-ray cross sections from ENDF/B-IV. One-dimensional calculational models were developed for the sources and tank. Limited comparisons are made with experimental data
Laser induced desorption as hydrogen retention diagnostic method
Energy Technology Data Exchange (ETDEWEB)
Zlobinski, Miroslaw
2016-07-15
Laser Induced Desorption Spectroscopy (LIDS) is a diagnostic method to measure the hydrogen content in the surface of a material exposed to a hydrogen isotope (H,D,T) plasma. It is developed mainly to monitor hydrogen retention in the walls of magnetic fusion devices that have to limit the amount of their fuel tritium mainly due to safety reasons. The development of fusion increasingly focusses on plasma-wall interactions for which in situ diagnostics like LIDS are required that work during plasma operation and without tile removal. The method has first been developed for thin amorphous hydrocarbon (a-C:H < 500 nm) layers successfully and is studied in the present work on thick (15 μm) layers, carbon fibre composites (CFCs), bulk tungsten (W), W fuzz and mixed C/W materials. In LID a 3 ms Nd:YAG (1064 nm) laser pulse heats a spot of diameter 3 mm with 500 {sup MW}/{sub m{sup 2}} on W to 1800 K at the surface and thus above 1300 K within ca. 0.2 mm depth. On C materials (graphite, CFC, a-C:H) this temperature guarantees a nearly complete (>95%) desorption already within 1.5 ms pulse duration. The retained hydrogen atoms are desorbed locally, recombine to molecules and migrate promptly to the surface via internal channels like pores and grain boundaries. Whereas, in W the retained hydrogen atoms have to diffuse through the bulk material, which is a relatively slow process also directed into the depth. The desorbed hydrogen fraction can thus be strongly reduced to 18-91% as observed here. This fraction is measured by melting the central part of a previously heated spot ca. 40 μm deep with a diameter 2 mm, 3 ms laser pulse, releasing the remaining hydrogen. W samples exposed to different plasmas in TEXTOR, Pilot-PSI, PSI-2, PADOS and PlaQ show that the desorption fraction of LID mainly decreases due to higher sample temperature during plasma exposure. The heat causes deeper hydrogen diffusion and/or stronger hydrogen trapping due to creation of traps with higher
Laser induced desorption as hydrogen retention diagnostic method
International Nuclear Information System (INIS)
Zlobinski, Miroslaw
2016-01-01
Laser Induced Desorption Spectroscopy (LIDS) is a diagnostic method to measure the hydrogen content in the surface of a material exposed to a hydrogen isotope (H,D,T) plasma. It is developed mainly to monitor hydrogen retention in the walls of magnetic fusion devices that have to limit the amount of their fuel tritium mainly due to safety reasons. The development of fusion increasingly focusses on plasma-wall interactions for which in situ diagnostics like LIDS are required that work during plasma operation and without tile removal. The method has first been developed for thin amorphous hydrocarbon (a-C:H < 500 nm) layers successfully and is studied in the present work on thick (15 μm) layers, carbon fibre composites (CFCs), bulk tungsten (W), W fuzz and mixed C/W materials. In LID a 3 ms Nd:YAG (1064 nm) laser pulse heats a spot of diameter 3 mm with 500 MW / m 2 on W to 1800 K at the surface and thus above 1300 K within ca. 0.2 mm depth. On C materials (graphite, CFC, a-C:H) this temperature guarantees a nearly complete (>95%) desorption already within 1.5 ms pulse duration. The retained hydrogen atoms are desorbed locally, recombine to molecules and migrate promptly to the surface via internal channels like pores and grain boundaries. Whereas, in W the retained hydrogen atoms have to diffuse through the bulk material, which is a relatively slow process also directed into the depth. The desorbed hydrogen fraction can thus be strongly reduced to 18-91% as observed here. This fraction is measured by melting the central part of a previously heated spot ca. 40 μm deep with a diameter 2 mm, 3 ms laser pulse, releasing the remaining hydrogen. W samples exposed to different plasmas in TEXTOR, Pilot-PSI, PSI-2, PADOS and PlaQ show that the desorption fraction of LID mainly decreases due to higher sample temperature during plasma exposure. The heat causes deeper hydrogen diffusion and/or stronger hydrogen trapping due to creation of traps with higher binding energy
Desorption/ablation of lithium fluoride induced by extreme ultraviolet laser radiation
Czech Academy of Sciences Publication Activity Database
Blejchař, T.; Nevrlý, V.; Vašinek, M.; Dostál, M.; Kozubková, M.; Dlabka, J.; Stachoň, M.; Juha, Libor; Bitala, P.; Zelinger, Zdeněk; Pira, Peter; Wild, J.
2016-01-01
Roč. 61, č. 2 (2016), s. 131-138 ISSN 0029-5922. [PLASMA 2015 : International Conference on Research and Applications of Plasmas. Warsaw, 07.09.2015-11.09.2015] R&D Projects: GA ČR(CZ) GAP108/11/1312 Institutional support: RVO:68378271 ; RVO:61388955 Keywords : desorption * fluid dynamics * lithium fluoride * numerical simulation * plume expansion * pulsed laser ablation Subject RIV: BL - Plasma and Gas Discharge Physics; CF - Physical ; Theoretical Chemistry (UFCH-W) Impact factor: 0.760, year: 2016
Definitive Brachytherapy for Kaposi's Sarcoma
International Nuclear Information System (INIS)
Williams, A.; Ezzell, G.; Zalupski, M.; Fontanesi, J.
1996-01-01
Purpose: To assess the efficacy and possible complications in patients diagnosed with Kaposi's sarcoma and treated with definitive brachytherapy. Methods and Materials: Between January, 1995 and December, 1995, four patients with Kaposi's sarcoma (KS) were treated with brachytherapy. Three patients, all with positive HIV status were treated using Iridium 192 (Ir-192) sources via a high-dose rate remote afterloader. One patient with endemic KS was treated using the application of catheters loaded with Californium 252. Eight sites were treated and included scalp, feet, nose, penis, hand, neck, and back. Dose rate for Ir-192 was 330cGy/fx to a total dose of 990cGy. The Californium was delivered as 100nGy/b.i.d. to a total dose of 900nGy. Follow-up as ranged from 2-6 months. Results: All four patients remain alive. Seven of eight sites have had complete clinical response and each patient has reported durable pain relief that has not subsided through last follow-up of 1/96. Two of eight sites, both treated with surface mold technique with Californium 252 developed moist desquamation. The remaining six sites did not demonstrate significant toxicity. Conclusion: Brachytherapy can offer Kaposi's sarcoma patients results that are equivalent to external beam radiation therapy, with minimal complications, a shorter treatment time and potential cost effectiveness
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLH252 (Link to dictyBase) - - - - SLH252F (Link to Original site) SLH2...52F 158 - - - - - - Show SLH252 Library SL (Link to library) Clone ID SLH252 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...52Q.Seq.d/ Representative seq. ID SLH252F (Link to Original site) R...epresentative DNA sequence >SLH252 (SLH252Q) /CSM/SL/SLH2-C/SLH252Q.Seq.d/ ACAGAATGGGTAAAGTACATGGTGGTTTGAATC
Energy Technology Data Exchange (ETDEWEB)
Amari, S., E-mail: siham_amari@yahoo.fr [Faculté des Sciences de la Nature et de la Vie, Université Hassiba Benbouali, Chlef, 02000 (Algeria); Bouhafs, B. [Laboratoire de Modélisation et Simulation en Sciences des Matériaux, Université Djillali Liabès de Sidi Bel-Abbés, Sidi Bel-Abbés, 22000 (Algeria)
2016-09-15
Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young’s modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.
2010-01-01
... head means the Secretary of the Department of Commerce, or designee. Benefit means, except as the... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Definitions. 25.2 Section 25.2 Commerce and Foreign Trade Office of the Secretary of Commerce PROGRAM Fraud Civil Remedies § 25.2...
Neutron spectra from radionuclide sources for cardiac pacemakers
International Nuclear Information System (INIS)
Kluge, H.
1975-01-01
Neutron spectra from Plutonium 238 radioisotope batteries powering cardiac pacemakers are measured in the energy range above 0.7 MeV. The results are used to calculate radiation doses within a cylindrical phantom. There are only minor differences between the different types of plutonium 238-batteries and californium 252-batteries
International Nuclear Information System (INIS)
Payne, G.F.; Peterson, J.R.
1987-01-01
It appears that we may have prepared Bk(IV) nitrate.nTPAs0 and Bk(IV) perchlorate.nTPAs0 complexes which formed the corresponding Cf(IV) complexes through the beta decay of Bk-249. Definitive proof should come from similar experiments with quantities of Bk-249 large enough to allow spectrophotometric detection of the characteristic f→f transitions in these berkelium and californium species. It is clear, however, that TPAs0 and acetonitrile can play a pivotal role in the stabilization of lanact(IV) species
Energy Technology Data Exchange (ETDEWEB)
Sontag, R; Berger, R [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires
1967-07-01
The alpha, beta, gamma, neutron cell which is described in the present paper is devoted to the transplutonium element production and study. It is located at the CEN in Fontenay-aux-Roses (France). The 4 feet ordinary concrete shielding made of stacked blocs allows the manipulation of radioactive sources as high as 1000 curies of 1 MeV gamma rays and with a fast neutrons flux of 10{sup 9} n.cm{sup -2}.s{sup -1}. The airtight alpha containment box is equipped with two transfer systems, one consists of a parallelepiped shaped airtight box located in a turntable, the other uses standard cylindrical containers made of polyethylene. The general equipment and the main setting up are also described. (authors) [French] La cellule alpha, beta, gamma, neutron, qui fait l'objet du present article, est destinee a la production et a l'etude des elements transplutoniens. Elle est construite au C.E.N. de Fontenay-aux-Roses (France). La protection biologique, calculee pour une activite de 1000 curies de rayonnement gamma d'energie 1 MeV accompagnee d'un flux de neutrons rapides de 10{sup 9}/cm{sup 2}s, est constituee par des parois en beton de 1,20 m d'epaisseur. L'enceinte alpha est une boite etanche qui comporte devx systemes de transferts: l'un consiste en une boite parallelepipedique etanche logee dans un barillet, l'autre fait appel a des recipients cylindriques standard en polyethylene. L'equipement general et les installations les plus importantes sont ensuite decrits. (auteurs)
7 CFR 3565.252 - Housing types.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Housing types. 3565.252 Section 3565.252 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Property Requirements § 3565.252 Housing types. The property may...
Single-event burnout of power MOSFET devices for satellite application
International Nuclear Information System (INIS)
Xue Yuxiong; Tian Kai; Cao Zhou; Yang Shiyu; Liu Gang; Cai Xiaowu; Lu Jiang
2008-01-01
Single-event burnout (SEB) sensitivity was tested for power MOSFET devices, JTMCS081 and JTMCS062, which were made in Institute of Microelectronics, Chinese Academy of Sciences, using californium-252 simulation source. SEB voltage threshold was found for devices under test (DUT). It is helpful for engineers to choose devices used in satellites. (authors)
14 CFR 252.9 - Ventilation systems.
2010-01-01
... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Ventilation systems. 252.9 Section 252.9... REGULATIONS SMOKING ABOARD AIRCRAFT § 252.9 Ventilation systems. Air carriers shall prohibit smoking whenever the ventilation system is not fully functioning. Fully functioning for this purpose means operating so...
International Nuclear Information System (INIS)
Valentine, T.E.; Mihalczo, J.T.
1995-01-01
This paper describes calculations performed to validate the modified version of the MCNP code, the MCNP-DSP, used for: the neutron and photon spectra of the spontaneous fission of californium 252; the representation of the detection processes for scattering detectors; the timing of the detection process; and the calculation of the frequency analysis parameters for the MCNP-DSP code
Bibliography on plasma-wall interactions
International Nuclear Information System (INIS)
Okano, J.
1980-05-01
Bibliography is compiled for the following subjects: (1) Plasma-wall interactions, general, (2) Sputtering, (3) Chemical sputtering, (4) Blistering, (5) Electron-impact desorption, (6) Thermal desorption and photo-desorption, (7) Emission of secondary electrons and ions, emission of photoelectrons, and material for getters, (8) Gas release and trapping, (9) Approach from surface diagnostics (review). The compilation has not been intended to be complete, but to give a first step toward a further study of the respective subjects. (author)
Source storage and transfer cask: Users Guide
International Nuclear Information System (INIS)
Eccleston, G.W.; Speir, L.G.; Garcia, D.C.
1985-04-01
The storage and shield cask for the dual californium source is designed to shield and transport up to 3.7 mg (2 Ci) of 252 Cf. the cask meets Department of Transportation (DOT) license requirements for Type A materials (DOT-7A). The cask is designed to transfer sources to and from the Flourinel and Fuel Storage (FAST) facility delayed-neutron interrogator. Californium sources placed in the cask must be encapsulated in the SR-CF-100 package and attached to Teleflex cables. The cask contains two source locations. Each location contains a gear box that allows a Teleflex cable to be remotely moved by a hand crank into and out of the cask. This transfer procedure permits sources to be easily removed and inserted into the delayed-neutron interrogator and reduces personnel radiation exposure during transfer. The radiation dose rate with the maximum allowable quantity of californium (3.7 mg) in the cask is 30 mR/h at the surface and less than 2 mR/h 1 m from the cask surface. This manual contains information about the cask, californium sources, describes the method to ship the cask, and how to insert and remove sources from the cask. 28 figs
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Contract. 252.13 Section 252.13 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING SUBSIDIZED VESSELS AND OPERATORS OPERATING... Contract. Upon approval by the Board of an application for ODS, the applicant and the United States may...
Energy Technology Data Exchange (ETDEWEB)
Rozhdestvenskyy, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2017-08-09
This work iterates on the first demonstration of a solid-state neutron multiplicity counting system developed at Lawrence Livermore National Laboratory by using commercial off-the-shelf detectors. The system was demonstrated to determine the mass of a californium-252 neutron source within 20% error requiring only one-hour measurement time with 20 cm2 of active detector area.
2010-01-01
... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 252.3 Section 252.3 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Administration. (a) Role of FNS. The Secretary will designate those commodities which will be available under the...
Energy Technology Data Exchange (ETDEWEB)
Castro, A. de, E-mail: alfonso.decastro@ciemat.es [Fusion National Laboratory-CIEMAT, Av Complutense 40, 28040 Madrid (Spain); Valson, P. [Max-Planck-Institut für Plasmaphysik, Wendelsteinstraße 1, 17491 Greifswald (Germany); Tabarés, F.L. [Fusion National Laboratory-CIEMAT, Av Complutense 40, 28040 Madrid (Spain)
2017-04-15
For the design of a Fusion Reactor based on a liquid lithium divertor target and a tungsten first wall at high temperature, the interaction of the wall material with plasmas of significant lithium content must be assessed, as issues like fuel retention, tungsten embrittlement and enhanced sputtering may represent a showstopper for the selection of the first wall material compatible with the presence of liquid metal divertor. In this work we address this topic for the first time at the laboratory level, hot W samples (100 °C) have been exposed to Glow Discharges of H{sub 2} or Li-seeded H{sub 2} followed by in situ thermal desorption studies (TDS) of the uptake of H{sub 2} on the samples. Pure and pre-lithiated tungsten was investigated in order to evaluate the differential effect of Li ion implantation on H retention. Global particle balance was also used for the determination of trapped H into the full W wall of the plasma chamber. A factor of 3-4 lower retention was deduced for samples and main W wall exposed to H/Li plasma than that measured on pre-lithiated W.
Symposium on fast atom and ion induced mass spectrometry of nonvolatile organic solids
International Nuclear Information System (INIS)
McNeal, C.J.
1982-01-01
The mechanisms of molecular and fragment ion production and the various parameters affecting ion yields were discussed by 6 invited speakers from Europe, Canada, and the US at this symposium. The work reported was almost equally divided between that using low-energy (keV) primary ion (or atom) beams, e.g. fast atom bombardment mass spectrometry (FABMS) and secondary ion mass spectrometry (SIMS) and that using high energy (MeV) particles, e.g. heavy ion induced mass spectrometry (HIIDMS) and 252 Cf-plasma desorption mass spectrometry ( 252 Cf-PDMS). Both theoretical foundations and observed experimental results for both techniques are included
48 CFR 252.231-7000 - Supplemental cost principles.
2010-10-01
... principles. 252.231-7000 Section 252.231-7000 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.231-7000 Supplemental cost principles. As prescribed in 231.100-70, use the following clause: Supplemental Cost Principles (DEC 1991) When the allowability of costs under...
International Nuclear Information System (INIS)
1987-03-01
The Conference presentations were divided into sessions devoted to the following topics: white neutron sources, primarily pulsed (6 papers); fast neutron fields (5 papers); Californium-252 prompt fission neutron spectra (14 papers); monoenergetic sources and filtered beams (11 papers); 14 MeV neutron sources (10 papers); selected special application (one paper); and a general interest session (4 papers). Individual abstracts were prepared separately for the papers
Sensitivity Analysis of Cf-252 (sf) Neutron and Gamma Observables in CGMF
Energy Technology Data Exchange (ETDEWEB)
Carter, Austin Lewis [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Talou, Patrick [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Stetcu, Ionel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kiedrowski, Brian Christopher [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Jaffke, Patrick John [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-12-06
CGMF is a Monte Carlo code that simulates the decay of primary fission fragments by emission of neutrons and gamma rays, according to the Hauser-Feshbach equations. As the CGMF code was recently integrated into the MCNP6.2 transport code, great emphasis has been placed on providing optimal parameters to CGMF such that many different observables are accurately represented. Of these observables, the prompt neutron spectrum, prompt neutron multiplicity, prompt gamma spectrum, and prompt gamma multiplicity are crucial for accurate transport simulations of criticality and nonproliferation applications. This contribution to the ongoing efforts to improve CGMF presents a study of the sensitivity of various neutron and gamma observables to several input parameters for Californium-252 spontaneous fission. Among the most influential parameters are those that affect the input yield distributions in fragment mass and total kinetic energy (TKE). A new scheme for representing Y(A,TKE) was implemented in CGMF using three fission modes, S1, S2 and SL. The sensitivity profiles were calculated for 17 total parameters, which show that the neutron multiplicity distribution is strongly affected by the TKE distribution of the fragments. The total excitation energy (TXE) of the fragments is shared according to a parameter RT, which is defined as the ratio of the light to heavy initial temperatures. The sensitivity profile of the neutron multiplicity shows a second order effect of RT on the mean neutron multiplicity. A final sensitivity profile was produced for the parameter alpha, which affects the spin of the fragments. Higher values of alpha lead to higher fragment spins, which inhibit the emission of neutrons. Understanding the sensitivity of the prompt neutron and gamma observables to the many CGMF input parameters provides a platform for the optimization of these parameters.
Data compilation for particle impact desorption
International Nuclear Information System (INIS)
Oshiyama, Takashi; Nagai, Siro; Ozawa, Kunio; Takeuchi, Fujio.
1984-05-01
The desorption of gases from solid surfaces by incident electrons, ions and photons is one of the important processes of hydrogen recycling in the controlled thermonuclear reactors. We have surveyed the literature concerning the particle impact desorption published through 1983 and compiled the data on the desorption cross sections and desorption yields with the aid of a computer. This report presents the results obtained for electron stimulated desorption, the desorption cross sections and yields being given in graphs and tables as functions of incident electron energy, surface temperature and gas exposure. (author)
46 CFR 252.33 - Hull and machinery insurance.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 252.33 Section 252.33... Subsidy Rates § 252.33 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery, increased value, excess general average...
Carbon tetrachloride desorption from activated carbon
International Nuclear Information System (INIS)
Jonas, L.A.; Sansone, E.B.
1981-01-01
Carbon tetrachloride was desorbed from a granular activated carbon subsequent to its adsorption under various vapor exposure periods. The varied conditions of exposure resulted in a range of partially saturated carbon beds which, when followed by a constant flow rate for desorption, generated different forms of the desorbing concentration versus time curve. A method of analyzing the desorption curves is presented which permits extraction of the various desorbing rates from the different desorption and to relate this to the time required for such regeneration. The Wheeler desorption kinetic equation was used to calculate the pseudo first order desorption rate constant for the carbon. The desorption rate constant was found to increase monotonically with increasing saturation of the bed, permitting the calculation of the maximum desorption rate constant for the carbon at 100% saturation. The Retentivity Index of the carbon, defined as the dimensionless ratio of the adsorption to the desorption rate constant, was found to be 681
48 CFR 252.217-7010 - Performance.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance. 252.217-7010... Clauses 252.217-7010 Performance. As prescribed in 217.7104(a), use the following clause: Performance (JUL..., scrap or other ship's material of the Government resulting from performance of the work as items of...
Stankevich, Vladimir G.; Sukhanov, Leonid P.; Svechnikov, Nicolay Yu.; Lebedev, Alexey M.; Menshikov, Kostantin A.; Kolbasov, Boris N.
2017-10-01
Investigations of the effect of Fe impurities on D2 thermal desorption (TD) from homogeneous CDx films (x ˜ 0.5) formed in the D-plasma discharge of the T-10 tokamak were carried out. The experimental TD spectra of the films showed two groups of peaks at 650-850 K and 900-1000 K for two adsorption states. The main result of the iron catalysis effect consists in the shift of the high-temperature peak by -24 K and in the increase in the fraction of the weakly bonded adsorption states. To describe the effect of iron impurities on TD of hydrogen isotopes, a structural cluster model based on the interaction of the Fe+ ion with the 1,3-C6H8 molecule was proposed. The potential energy surfaces of chemical reactions with the H2 elimination were calculated using ab initio methods of quantum chemistry. It was established that the activation barrier of hydrogen TD is reduced by about 1 eV due to the interaction of the Fe+ ion with the π-subsystem of the 1,3-C6H8 molecule leading to a redistribution of the double bonds along the carbon system. Contribution to the topical issue "Plasma Sources and Plasma Processes (PSPP)"", edited by Luis Lemos Alves, Thierry Belmonte and Tiberiu Minea
International Nuclear Information System (INIS)
Garcia-Rosales, C.; Franzen, P.; Plank, H.; Roth, J.; Gauthier, E.
1996-01-01
The trapping and release of deuterium implanted with an energy of 100 eV in wrought and in plasma sprayed tungsten of different manufacture and structure has been investigated by means of re-emission as well as thermal and isothermal desorption spectroscopy. The experimental data for wrought tungsten are compared with model calculations with the PIDAT code in order to estimate the parameters governing diffusion, surface recombination and trapping in tungsten. The amount of retained deuterium in tungsten is of the same order of magnitude as in graphite for the implantation parameters used in this work. The mobile hydrogen concentration in tungsten during the implantation is of the same order of magnitude than the trapped one, being released after the termination of the implantation. The fraction of deuterium trapped to defects increases strongly with the porosity of the samples. The temperature needed for the release of the trapped deuterium (∝600 K) are considerably lower than for graphite, due to the smaller trapping energy (≤1.5 eV). (orig.)
48 CFR 252.217-7009 - Default.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Default. 252.217-7009... Clauses 252.217-7009 Default. As prescribed in 217.7104(a), use the following clause: Default (DEC 1991... of default to the Contractor, terminate the whole or any part of a job order if the Contractor fails...
The protective cell petrus for the production of californium 252
International Nuclear Information System (INIS)
Sontag, R.; Berger, R.
1967-01-01
The alpha, beta, gamma, neutron cell which is described in the present paper is devoted to the transplutonium element production and study. It is located at the CEN in Fontenay-aux-Roses (France). The 4 feet ordinary concrete shielding made of stacked blocs allows the manipulation of radioactive sources as high as 1000 curies of 1 MeV gamma rays and with a fast neutrons flux of 10 9 n.cm -2 .s -1 . The airtight alpha containment box is equipped with two transfer systems, one consists of a parallelepiped shaped airtight box located in a turntable, the other uses standard cylindrical containers made of polyethylene. The general equipment and the main setting up are also described. (authors) [fr
40 CFR 265.252 - Waste analysis.
2010-07-01
... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.252 Section 265... FACILITIES Waste Piles § 265.252 Waste analysis. In addition to the waste analyses required by § 265.13, the... in the pile to which it is to be added. The analysis conducted must be capable of differentiating...
Energy Technology Data Exchange (ETDEWEB)
Vogt, Patrick, E-mail: vogt@pdi-berlin.de; Bierwagen, Oliver, E-mail: bierwagen@pdi-berlin.de [Paul-Drude-Institut für Festkörperelektronik, Hausvogteiplatz 5–7, D-10117 Berlin (Germany)
2016-08-08
We present a comprehensive study of the In{sub 2}O{sub 3} growth kinetics during plasma-assisted molecular beam epitaxy and compare it to that of the related oxide Ga{sub 2}O{sub 3} [P. Vogt and O. Bierwagen, Appl. Phys. Lett. 108, 072101 (2016)]. The growth rate and desorbing fluxes were measured during growth in-situ by a laser reflectometry set-up and line-of-sight quadrupole mass spectrometer, respectively. We extracted the In incorporation as a function of the provided In flux, different growth temperatures T{sub G}, and In-to-O flux ratios r. The data are discussed in terms of the competing formation of In{sub 2}O{sub 3} and desorption of the suboxide In{sub 2}O and O. The same three growth regimes as in the case of Ga{sub 2}O{sub 3} can be distinguished: (i) In-transport limited, O-rich (ii) In{sub 2}O-desorption limited, O-rich, and (iii) O-transport limited, In-rich. In regime (iii), In droplets are formed on the growth surface at low T{sub G}. The growth kinetics follows qualitatively that of Ga{sub 2}O{sub 3} in agreement with their common oxide and suboxide stoichiometry. The quantitative differences are mainly rationalized by the difference in In{sub 2}O and Ga{sub 2}O desorption rates and vapor pressures. For the In{sub 2}O, Ga{sub 2}O, and O desorption, we extracted the activation energies and frequency factors by means of Arrhenius-plots.
48 CFR 252.236-7000 - Modification proposals-price breakdown.
2010-10-01
...-price breakdown. 252.236-7000 Section 252.236-7000 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.236-7000 Modification proposals—price breakdown. As prescribed in 236.570(a), use the following clause: Modification Proposals—Price Breakdown (DEC 1991) (a) The...
Dynamic vortex dust structures in a nuclear-track plasma
International Nuclear Information System (INIS)
Rykov, V A; Khudyakov, A V; Filinov, V S; Vladimirov, V I; Deputatova, L V; Krutov, D V; Fortov, V E
2003-01-01
Results are presented from Monte Carlo calculations of the electric charge on dust grains in a plasma produced during the slowing down of radioactive decay products of californium nuclei in neon. The dust grain charging is explained as being due to the drift of electrons and ions in an external electric field. It is shown that the charges of the grains depend on their coordinates and strongly fluctuate with time. The time-averaged grain charges agree with the experimental data obtained on ordered liquid-like dust structures in a nuclear-track plasma. The time-averaged dust grain charges are used to carry out computer modelling of the formation of dynamic vortex structures observed in experiments. Evidence is obtained for the fact that the electrostatic forces experienced by the dust grains are potential in character. The paper is supplemented by a video clip showing the typical dynamics of the simulated vortex dust structure
48 CFR 252.217-7002 - Offering property for exchange.
2010-10-01
... exchange. 252.217-7002 Section 252.217-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.217-7002 Offering property for exchange. As prescribed in 217.7005, use the following provision: Offering Property for Exchange (DEC 1991) (a) The property described in item...
Spreading of lithium on a stainless steel surface at room temperature
Energy Technology Data Exchange (ETDEWEB)
Skinner, C.H., E-mail: cskinner@pppl.gov [Princeton Plasma Physics Laboratory, Princeton, NJ 08543 (United States); Capece, A.M. [Princeton Plasma Physics Laboratory, Princeton, NJ 08543 (United States); Roszell, J.P.; Koel, B.E. [Department of Chemical and Biological Engineering, Princeton University, NJ 08540 (United States)
2016-01-15
Lithium conditioned plasma facing surfaces have lowered recycling and enhanced plasma performance on many fusion devices and liquid lithium plasma facing components are under consideration for future machines. A key factor in the performance of liquid lithium components is the wetting by lithium of its container. We have observed the surface spreading of lithium from a mm-scale particle to adjacent stainless steel surfaces using a scanning Auger microprobe that has elemental discrimination. The spreading of lithium occurred at room temperature (when lithium is a solid) from one location at a speed of 0.62 μm/day under ultrahigh vacuum conditions. Separate experiments using temperature programmed desorption (TPD) investigated bonding energetics between monolayer-scale films of lithium and stainless steel. While multilayer lithium desorption from stainless steel begins to occur just above 500 K (E{sub des} = 1.54 eV), sub-monolayer Li desorption occurred in a TPD peak at 942 K (E{sub des} = 2.52 eV) indicating more energetically favorable lithium-stainless steel bonding (in the absence of an oxidation layer) than lithium–lithium bonding.
46 CFR 252.31 - Wages of officers and crews.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Wages of officers and crews. 252.31 Section 252.31... Subsidy Rates § 252.31 Wages of officers and crews. (a) Definitions. When used in this part: (1) Base period. The first base period under the wage index systems, as provided in section 603 of the Act, is the...
48 CFR 252.237-7011 - Preparation history.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Preparation history. 252... Provisions And Clauses 252.237-7011 Preparation history. As prescribed in 237.7003(b), use the following clause: Preparation History (DEC 1991) For each body prepared, or for each casket handled in a group...
48 CFR 252.217-7016 - Plant protection.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Plant protection. 252.217... Clauses 252.217-7016 Plant protection. As prescribed in 217.7104(a), use the following clause: Plant Protection (DEC 1991) (a) The Contractor shall provide, for the plant and work in process, reasonable...
48 CFR 252.227-7000 - Non-estoppel.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Non-estoppel. 252.227-7000... Clauses 252.227-7000 Non-estoppel. As prescribed at 227.7009-1, insert the following clause in patent releases, license agreements, and assignments: Non-Estoppel (OCT 1966) The Government reserves the right at...
Fukushi, Keisuke; Sakai, Haruka; Itono, Taeko; Tamura, Akihiro; Arai, Shoji
2014-09-16
Fine clay particles have functioned as transport media for radiocesium in terrestrial environments after nuclear accidents. Because radiocesium is expected to be retained in clay minerals by a cation-exchange reaction, ascertaining trace cesium desorption behavior in response to changing solution conditions is crucially important. This study systematically investigated the desorption behavior of intrinsic Cs (13 nmol/g) in well-characterized Na-montmorillonite in electrolyte solutions (NaCl, KCl, CaCl2, and MgCl2) under widely differing cation concentrations (0.2 mM to 0.2 M). Batch desorption experiments demonstrated that Cs(+) desorption was inhibited significantly in the presence of the environmental relevant concentrations of Ca(2+) and Mg(2+) (>0.5 mM) and high concentrations of K(+). The order of ability for Cs desorption was Na(+) = K(+) > Ca(2+) = Mg(2+) at the highest cation concentration (0.2 M), which is opposite to the theoretical prediction based on the cation-exchange selectivity. Laser diffraction grain-size analyses revealed that the inhibition of Cs(+) desorption coincided with the increase of the clay tactoid size. Results suggest that radiocesium in the dispersed fine clay particles adheres on the solid phase when the organization of swelling clay particles occurs because of changes in solution conditions caused by both natural processes and artificial treatments.
48 CFR 252.217-7001 - Surge option.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Surge option. 252.217-7001... Clauses 252.217-7001 Surge option. As prescribed in 217.208-70(b), use the following clause: Surge Option (AUG 1992) (a) General. The Government has the option to— (1) Increase the quantity of supplies or...
Desorption/ablation of lithium fluoride induced by extreme ultraviolet laser radiation
Directory of Open Access Journals (Sweden)
Blejchař Tomáš
2016-06-01
Full Text Available The availability of reliable modeling tools and input data required for the prediction of surface removal rate from the lithium fluoride targets irradiated by the intense photon beams is essential for many practical aspects. This study is motivated by the practical implementation of soft X-ray (SXR or extreme ultraviolet (XUV lasers for the pulsed ablation and thin film deposition. Specifically, it is focused on quantitative description of XUV laser-induced desorption/ablation from lithium fluoride, which is a reference large band-gap dielectric material with ionic crystalline structure. Computational framework was proposed and employed here for the reconstruction of plume expansion dynamics induced by the irradiation of lithium fluoride targets. The morphology of experimentally observed desorption/ablation craters were reproduced using idealized representation (two-zone approximation of the laser fluence profile. The calculation of desorption/ablation rate was performed using one-dimensional thermomechanic model (XUV-ABLATOR code taking into account laser heating and surface evaporation of the lithium fluoride target occurring on a nanosecond timescale. This step was followed by the application of two-dimensional hydrodynamic solver for description of laser-produced plasma plume expansion dynamics. The calculated plume lengths determined by numerical simulations were compared with a simple adiabatic expansion (blast-wave model.
48 CFR 252.225-7025 - Restriction on acquisition of forgings.
2010-10-01
... of forgings. 252.225-7025 Section 252.225-7025 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.225-7025 Restriction on acquisition of forgings. As prescribed in 225.7102-4, use the following clause: Restriction on Acquisition of Forgings (DEC 2009) (a...
48 CFR 252.225-7031 - Secondary Arab boycott of Israel.
2010-10-01
... Israel. 252.225-7031 Section 252.225-7031 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.225-7031 Secondary Arab boycott of Israel. As prescribed in 225.7605, use the following provision: Secondary Arab Boycott of Israel (JUN 2005) (a) Definitions. As used in...
24 CFR 92.252 - Qualification as affordable housing: Rental housing.
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Qualification as affordable housing: Rental housing. 92.252 Section 92.252 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HOME INVESTMENT PARTNERSHIPS PROGRAM Project Requirements § 92.252...
48 CFR 252.235-7011 - Final scientific or technical report.
2010-10-01
... technical report. 252.235-7011 Section 252.235-7011 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.235-7011 Final scientific or technical report. As prescribed in 235.072(d), use the following clause: Final Scientific or Technical Report (NOV 2004) The Contractor...
48 CFR 252.235-7002 - Animal welfare.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Animal welfare. 252.235... Clauses 252.235-7002 Animal welfare. As prescribed in 235.072(a), use the following clause: Animal Welfare... animals only from dealers licensed by the Secretary of Agriculture under 7 U.S.C. 2133 and 9 CFR subpart A...
48 CFR 252.229-7001 - Tax relief.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the United...
Energy Technology Data Exchange (ETDEWEB)
Perdian, David C. [Iowa State Univ., Ames, IA (United States)
2009-01-01
Mass spectrometric methods that are able to analyze solid samples or biological materials with little or no sample preparation are invaluable to science as well as society. Fundamental research that has discovered experimental and instrumental parameters that inhibit fractionation effects that occur during the quantification of elemental species in solid samples by laser ablation inductively coupled plasma mass spectrometry is described. Research that determines the effectiveness of novel laser desorption/ionization mass spectrometric methods for the molecular analysis of biological tissues at atmospheric pressure and at high spatial resolution is also described. A spatial resolution is achieved that is able to analyze samples at the single cell level.
International Nuclear Information System (INIS)
Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik
2001-01-01
In recent years, Georgia Institute of Technology (Georgia Tech) has been involved in a number of neutron dosimetry research projects. Several reference neutron fields are now available for such projects. They are all based on the use of a 252 Cf source. The source can be used by itself to create a reference un-moderated 252 Cf neutron field, or it can be placed inside several different moderating assemblies. The spectra created by placing the source inside these assemblies and the un-moderated source are employed to investigate detector and dosimeter responses. Currently, the set of moderators available includes a 30-cm diam cadmium-covered D 2 O spherical shell, a 30-cm-thick iron spherical shell, a 30-cm-diam polyethylene spherical shell, an 18.3-cm-thick tungsten spherical shell, a 16-cm-thick lead spherical shell, and a 9-cm-thick tantalum spherical shell. In addition, the 252 Cf source can be placed inside a neutron howitzer recently constructed at Georgia Tech. The howitzer is a WEP cylinder loaded with boron that has a 10.16-cm-diam cylindrical opening. When the source is placed in the cylindrical penetration of the howitzer, a neutron field ∼30 cm in diameter is created at a distance of 50 cm from the californium source. Over the last few years, Bonner sphere spectrometers using LiI(Eu) scintillators and LiF thermoluminescence dosimeters have been calibrated using this facility at Georgia Tech. Recently, the Neely Nuclear Research Center (NNRC) acquired an LB 6411 neutron probe (product of EG and G Berthold). This probe is designed to measure ambient dose equivalent in accordance with International Commission on Radiological Protection Publication 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diam spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV (Ref. 5). As a test of the instrument's ability to measure ambient
Absorption/desorption in sprays
International Nuclear Information System (INIS)
Naimpally, A.
1987-01-01
This survey paper shall seek to present the present state of knowledge concerning absorption and desorption in spray chambers. The first part of the paper presents the theories and formulas for the atomization and break-up of sprays in nozzles. Formulas for the average (sauter-mean) diameters are then presented. For the case of absorption processes, the formulas for the dimensionless mass transfer coefficients is in drops. The total; mass transfer is the total of the transfer in individual drops. For the case of desorption of sparingly soluble gases from liquids in a spray chamber, the mass transfer occurs in the spray just at the point of break-up of the jet. Formulas for the desorption of gases are presented
Dust grain charges in a nuclear-track plasma and the formation of dynamic vortex dust structures
International Nuclear Information System (INIS)
Rykov, V.A.; Khudyakov, A.V.; Filinov, V.S.; Vladimirov, V.I.; Deputatova, L.V.; Krutov, D.V.; Nefedov, A.P.; Fortov, V.E.
2002-01-01
Results are presented from Monte Carlo calculations of the electric charge of dust grains in a plasma produced during the slowing down of the radioactive decay products of californium nuclei in neon. The dust grain charging is explained for the first time as being due to the drift of electrons and ions in an external electric field. It is shown that the charges of the grains depend on their coordinates and strongly fluctuate with time. The time-averaged grain charges agree with the experimental data obtained on ordered liquidlike dust structures in a nuclear-track plasma. The time-averaged dust grain charges are used to carry out computer modeling of the formation of dynamic vortex structures observed in experiments. Evidence is obtained of the fact that the electrostatic forces experienced by the dust grains are potential in character
Data compilation for particle-impact desorption, 2
International Nuclear Information System (INIS)
Oshiyama, Takashi; Nagai, Siro; Ozawa, Kunio; Takeutchi, Fujio.
1985-07-01
The particle impact desorption is one of the elementary processes of hydrogen recycling in controlled thermonuclear fusion reactors. We have surveyed the literature concerning the ion impact desorption and photon stimulated desorption published through the end of 1984 and compiled the data on the desorption cross sections and yields with the aid of a computer. This report presents the results of the compilation in graphs and tables as functions of incident energy, surface temperature and surface coverage. (author)
STM-Induced Hydrogen Desorption via a Hole Resonance
DEFF Research Database (Denmark)
Stokbro, Kurt; Thirstrup, C.; Sakurai, M.
1998-01-01
We report STM-induced desorption of H from Si(100)-H(2 X 1) at negative sample bias. The desorption rate exhibits a power-law dependence on current and a maximum desorption rate at -7 V. The desorption is explained by vibrational heating of H due to inelastic scattering of tunneling holes...... with the Si-H 5 sigma hole resonance. The dependence of desorption rate on current and bias is analyzed using a novel approach for calculating inelastic scattering, which includes the effect of the electric field between tip and sample. We show that the maximum desorption rate at -7 V is due to a maximum...
Structure of a streptococcal adhesion carbohydrate receptor
International Nuclear Information System (INIS)
Cassels, F.J.; Fales, H.M.; London, J.; Carlson, R.W.; van Halbeek, H.
1990-01-01
Interactions between complementary protein and carbohydrate structures on different genera of human oral bacteria have been implicated in the formation of dental plaque. The carbohydrate receptor on Streptococcus sanguis H1 that is specific for the adhesion on Capnocytophaga ochracea ATCC 33596 has been isolated from the streptococcal cell wall, purified, and structurally characterized. The hexasaccharide repeating unit of the polysaccharide was purified by reverse-phase, amino-bonded silica, and gel permeation high performance liquid chromatography. Earlier studies established that the repeating unit was a hexasaccharide composed of rhamnose, galactose, and glucose in the ration of 2:3:1, respectively. In the present study, determination of absolute configuration by gas chromatography of the trimethylsilyl (+)-2-butyl glycosides revealed that the rhamnose residues were of the L configuration while the hexoses were all D. 252Californium plasma desorption mass spectrometry of the native, the acetylated and the reduced and acetylated hexasaccharide determined that the molecular mass of the native hexasaccharide was 959, and that the 2 rhamnose residues were linked to each other at the nonreducing terminus of the linear molecule. Methylation analysis revealed the positions of the glycosidic linkages in the hexasaccharide and showed that a galactose residue was present at the reducing end. The structural characterization of the hexasaccharide was completed by one and two dimensional 1H and 13C NMR spectroscopy. Complete 1H and 13C assignments for each glycosyl residue were established by two-dimensional (1H,1H) correlation spectroscopy, homonuclear Hartmann-Hahn, and (13C,1H) correlation experiments. The configurations of the glycosidic linkages were inferred from the chemical shifts and coupling constants of the anomeric 1H and 13C resonances
de Vos, Wiebe Matthijs; Cattoz, B.; Avery, M.P.; Cosgrove, T.; Prescott, S.W.
2014-01-01
Optical flow cell reflectometry was used to study the adsorption of poly(vinylpyrrolidone) (PVP) to a silica surface and the subsequent surfactant adsorption and polymer desorption upon exposure to the anionic surfactant sodium dodecyl sulfate (SDS). We have studied these effects as a function of pH
International Nuclear Information System (INIS)
Stankevich, V.G.; Svechnikov, N.Y.; Lebedev, A.M.; Menshikov, K.A.; Kolbasov, B.N.; Sukhanov, L.P.
2017-01-01
A comprehensive study of hydrocarbon films obtained in the plasma discharge of large fusion facilities will allow the minimization of parasitic capture. The investigation of the effect of Fe impurities on D 2 thermal desorption (TD) from homogeneous CD x films (x ∼ 0.5) formed in the D-plasma discharge of the T-10 tokamak were carried out. The experimental TD spectra of the films showed 2 groups of peaks at 650-850 K and 900-1000 K for 2 adsorption states. The main result of the iron catalysis effect consists in the shift of the high-temperature peak by -24 K and in the increase in the fraction of the weakly bonded adsorption states. To describe the effect of iron impurities on TD of hydrogen isotopes, a structural cluster model based on the interaction of the Fe + ion with the 1,3-C 6 H 8 molecule was proposed. The potential energy surfaces of chemical reactions with the H 2 elimination were calculated using ab initio methods of quantum chemistry. It was established that the activation barrier of hydrogen TD is reduced by about 1 eV due to the interaction of the Fe + ion with the π-subsystem of the 1,3-C 6 H 8 molecule leading to a redistribution of the double bonds along the carbon system
Hydrocarbon analysis using desorption atmospheric pressure chemical ionization
Jjunju, Fred Paul Mark; Badu-Tawiah, Abraham K.; Li, Anyin; Soparawalla, Santosh; Roqan, Iman S.; Cooks, Robert Graham
2013-01-01
Characterization of the various petroleum constituents (hydronaphthalenes, thiophenes, alkyl substituted benzenes, pyridines, fluorenes, and polycyclic aromatic hydrocarbons) was achieved under ambient conditions without sample preparation by desorption atmospheric pressure chemical ionization (DAPCI). Conditions were chosen for the DAPCI experiments to control whether ionization was by proton or electron transfer. The protonated molecule [M+H]+ and the hydride abstracted [MH]+ form were observed when using an inert gas, typically nitrogen, to direct a lightly ionized plasma generated by corona discharge onto the sample surface in air. The abundant water cluster ions generated in this experiment react with condensed-phase functionalized hydrocarbon model compounds and their mixtures at or near the sample surface. On the other hand, when naphthalene was doped into the DAPCI gas stream, its radical cation served as a charge exchange reagent, yielding molecular radical cations (M+) of the hydrocarbons. This mode of sample ionization provided mass spectra with better signal/noise ratios and without unwanted side-products. It also extended the applicability of DAPCI to petroleum constituents which could not be analyzed through proton transfer (e.g., higher molecular PAHs such as chrysene). The thermochemistry governing the individual ionization processes is discussed and a desorption/ionization mechanism is inferred. © 2012 Elsevier B.V.
Hydrocarbon analysis using desorption atmospheric pressure chemical ionization
Jjunju, Fred Paul Mark
2013-07-01
Characterization of the various petroleum constituents (hydronaphthalenes, thiophenes, alkyl substituted benzenes, pyridines, fluorenes, and polycyclic aromatic hydrocarbons) was achieved under ambient conditions without sample preparation by desorption atmospheric pressure chemical ionization (DAPCI). Conditions were chosen for the DAPCI experiments to control whether ionization was by proton or electron transfer. The protonated molecule [M+H]+ and the hydride abstracted [MH]+ form were observed when using an inert gas, typically nitrogen, to direct a lightly ionized plasma generated by corona discharge onto the sample surface in air. The abundant water cluster ions generated in this experiment react with condensed-phase functionalized hydrocarbon model compounds and their mixtures at or near the sample surface. On the other hand, when naphthalene was doped into the DAPCI gas stream, its radical cation served as a charge exchange reagent, yielding molecular radical cations (M+) of the hydrocarbons. This mode of sample ionization provided mass spectra with better signal/noise ratios and without unwanted side-products. It also extended the applicability of DAPCI to petroleum constituents which could not be analyzed through proton transfer (e.g., higher molecular PAHs such as chrysene). The thermochemistry governing the individual ionization processes is discussed and a desorption/ionization mechanism is inferred. © 2012 Elsevier B.V.
48 CFR 252.222-7002 - Compliance with local labor laws (overseas).
2010-10-01
... labor laws (overseas). 252.222-7002 Section 252.222-7002 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7002 Compliance with local labor laws (overseas). As prescribed in 222.7201(a), use the following clause: Compliance with Local Labor Laws (Overseas) (JUN 1997...
24 CFR 252.6 - Method of payment of mortgage insurance premiums.
2010-04-01
... insurance premiums. 252.6 Section 252.6 Housing and Urban Development Regulations Relating to Housing and..., AND BOARD AND CARE HOMES § 252.6 Method of payment of mortgage insurance premiums. The provisions of..., DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT...
24 CFR 236.252 - First, second, and third mortgage insurance premiums.
2010-04-01
... insurance premiums. 236.252 Section 236.252 Housing and Urban Development Regulations Relating to Housing... insurance premiums. All of the provisions of § 207.252 of this chapter governing the first, second, and third mortgage insurance premiums shall apply to mortgages insured under this subpart, except: (a) Where...
Ternary-fragmentation-driving potential energies of 252Cf
Karthikraj, C.; Ren, Zhongzhou
2017-12-01
Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.
Smith, R Scott; Kay, Bruce D
2018-05-03
The desorption of benzene, 1,3,5-trifluorobenzene (TFB), and hexafluorobenzene (HFB) from a graphene covered Pt(111) substrate was investigated using temperature programmed desorption (TPD). All three species have well resolved monolayer and second layer desorption peaks. The desorption spectra for submonolayer coverages of benzene and hexafluorobenzene are consistent with first order desorption kinetics. In contrast, the submonolayer TPD spectra for 1,3,5-trifluorobenzene align on a common leading-edge which is indicative of zero order desorption kinetics. The desorption behavior of the three molecules can be correlated with the strength of the quadrupole moments. Calculations (second-order Møller-Plesset perturbation and density functional theory) show that the potential minimum for coplanar TFB dimers is more than a factor of two greater than that for either benzene or HFB dimers. The calculations support the interpretation that benzene and HFB are less likely to form the two dimensional islands that are needed for submonolayer zero order desorption kinetics.
International Nuclear Information System (INIS)
Behrisch, Rainer
1978-01-01
The plasma wall interactions for two extreme cases, the 'vacuum model' and the 'cold gas blanket' are outlined. As a first step for understanding the plasma wall interactions the elementary interaction processes at the first wall are identified. These are energetic ion and neutral particle trapping and release, ion and neutral backscattering, ion sputtering, desorption by ions, photons and electrons and evaporation. These processes have only recently been started to be investigated in the parameter range of interest for fusion research. The few measured data and their extrapolation into regions not yet investigated are reviewed
Graphite moderated 252Cf source
International Nuclear Information System (INIS)
Sajo B, L.; Barros, H.; Greaves, E. D.; Vega C, H. R.
2014-08-01
The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a 252 Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the 252 Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)
7 CFR 766.252 - Unauthorized assistance resulting from submission of false information.
2010-01-01
... false information. 766.252 Section 766.252 Agriculture Regulations of the Department of Agriculture... Unauthorized Assistance § 766.252 Unauthorized assistance resulting from submission of false information. A... behalf, submits information to the Agency that the borrower knows to be false. ...
System control for the modulated 252Cf source ''Shuffler''
International Nuclear Information System (INIS)
Stephens, M.M.
1975-06-01
The design and theory of operation of the control chassis for a 252 Cf nondestructive assay system are described. This system repetitively transfers a 252 Cf source from the irradiation region to a shielded position before measuring the delayed neutrons. The design criteria for the system were: rapid movement and precise positioning of the 252 Cf source, precise positioning of the sample, and very accurate timing of the irradiate and count cycles. To achieve these results crystal oscillators were used for timing, and stepping motors were used to position the sample and the source. (U.S.)
Laboratory-scale shielded cell for 252Cf
International Nuclear Information System (INIS)
Anderl, R.A.; Cargo, C.H.
1979-01-01
A shielded-cell facility for storing and handling remotely up to 2 milligram quantities of unencapsulated 252 Cf has been built in a radiochemistry laboratory at the Test Reactor Area of the Idaho National Engineering Laboratory. Unique features of this facility are its compact bulk radiation shield of borated gypsum and transfer lines which permit the transport of fission product activity from 252 Cf fission sources within the cell to a mass separator and to a fast radiochemistry system in nearby rooms
46 CFR 252.23 - Financial and other reporting requirements.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Financial and other reporting requirements. 252.23... SERVICES Operation § 252.23 Financial and other reporting requirements. (a) Voyage report. The operator... total loss covered by a policy of insurance. (d) Financial statements. The operator shall submit, in...
International Nuclear Information System (INIS)
King, L.J.; Bigelow, J.E.; Collins, E.D.
1976-03-01
During the period January 1, 1975, through June 30, 1975, the following amounts of transuranium elements were recovered from 22 irradiated HFIR targets: 2g 243 Am, 59 g 244 Cm, 51 mg 249 Bk, 465 mg 252 Cf, 2.5 mg 253 Es, and 1.4 pg 257 Fm. In addition, 45 mg of high-purity 248 Cm was operated from 252 Cf which had been recovered and purified during earlier periods, and 56 mg of a lower-quality 248 Cm was separated from californium purification rework solutions. Five HFIR targets, each containing approximately 9 g of actinides (predominantly curium), were fabricated. A new long-term projection showed that 252 Cf production in the TRU-HFIR complex could increase to as much as 2.5 g/year. During the next 18 months, we expect to recover totals of 46 mg of 249 Bk, 520 mg of 252 Cf, 2.0 mg of 253 Es (in a mixture of isotopes), 220 μg of high-purity 253 Es, and 1.6 pg of 257 Fm. We also expect to obtain 125 mg of high-purity 248 Cm from purified californium now in storage. There are no plans to process any of the remaining SRP Pu-Al tubes or to irradiate any plutonium targets in the HFIR; thus, we do not expect to recover any 244 Pu. Two neutron sources were fabricated, bringing the total fabricated to 77. Two sources that had been used previously in various projects were returned to the TRU inventory and are available for reassignment. In special projects, we (1) produced about 1 mg of 250 Cf by irradiation of 249 Bk in HFIR rabbits, and (2) processed some irradiated 248 Cm samples and obtained yield and isotopic composition data for use in determining the capture cross section of 249 Cm in the HFIR. The values that are currently being used for transuranium element decay data and for cross-section data in planning irradiation-processing cycles, calculating production forecasts, and assaying products are tabulated in the Appendix
Chen, Di; Hu, Yu-Ning; Hussain, Dilshad; Zhu, Gang-Tian; Huang, Yun-Qing; Feng, Yu-Qi
2016-05-15
Appropriate sample preparations prior to analysis can significantly enhance the sensitivity of ambient ionization techniques, especially during the enrichment or purification of analytes in the presence of complex biological matrix. Here in, we developed a rapid analysis method by the combination of thin film microextraction (TFME) and desorption corona beam ionization (DCBI) for the determination of antidepressants in human plasma. Thin films used for extraction consisted of sub-micron sized highly ordered mesoporous silica-carbon composite fibers (OMSCFs), simply prepared by electrospinning and subsequent carbonization. Typically, OMSCFs thin film was immersed into the diluted plasma for extraction of target analytes and then directly subjected to the DCBI-MS for detection. Size-exclusion effect of mesopores contributed to avoid of the protein precipitation step prior to extraction. Mass transfer was benefited from high surface-to-volume ratio which is attributed to macroporous network and ordered mesostructures. Moreover, the OMSCFs provided mixed-mode hydrophobic/ion-exchange interactions towards target analytes. Thus, the detection sensitivity was greatly improved due to effective enrichment of the target analytes and elimination of matrix interferences. After optimization of several parameters related to extraction performance, the proposed method was eventually applied for the determination of three antidepressants in human plasma. The calibration curves were plotted in the range of 5-1000 ng/mL with acceptable linearity (R(2) >0.983). The limits of detection (S/N=3) of three antidepressants were in ranges of 0.3-1 ng/mL. Reproducibility was achieved with RSD less than 17.6% and the relative recoveries were in ranges of 83.6-116.9%. Taken together, TFME-DCBI-MS method offers a powerful capacity for rapid analysis to achieve much-improved sensitivity. Copyright © 2016 Elsevier B.V. All rights reserved.
Matsuno, T; Niida, T; Tsurumaki, H; Namiki, A
2005-01-08
We studied coverage dependence of time-of-flight (TOF) spectra of D2 molecules thermally desorbed from the D/Si(100) surface. The mean translational energies Et of desorbed D2 molecules were found to increase from 0.20+/-0.05 eV to 0.40+/-0.04 eV as the desorption coverage window was decreased from 1.0 ML> or =thetaD> or =0.9 ML to 0.2 ML> or =thetaD> or =0 ML, being consistent with the kinetics switch predicted in the interdimer mechanism. The measured TOF spectra were deconvoluted into 2H, 3H, and 4H components by a curve fitting method along the principle of detailed balance. As a result, it turned out that the desorption kinetics changes from the 4H to the 3H situation at high coverage above thetaD=0.9 ML, while the 2H desorption is dominant for a quite wide coverage region up to thetaD=0.8 ML. A dynamic desorption mechanism by which the desorption is promoted by D-atom diffusion to dangling bonds was proposed. 2005 American Institute of Physics.
Energy Technology Data Exchange (ETDEWEB)
Benker, Dennis [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dryman, Joshua Cory [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2017-07-01
This report presents the studies carried out to demonstrate the possibility of quantitatively extracting trivalent actinides and lanthanides from highly acidic solutions using a neutral ligand-based solvent extraction system. These studies stemmed from the perceived advantage of such systems over cationexchange- based solvent extraction systems that require an extensive feed adjustment to make a low-acid feed. The targeted feed solutions are highly acidic aqueous phases obtained after the dissolution of curium targets during a californium (Cf) campaign. Results obtained with actual Cf campaign solutions, but highly diluted to be manageable in a glove box, are presented, followed by results of tests run in the hot cells with Cf campaign rework solutions. It was demonstrated that a solvent extraction system based on the tetraoctyl diglycolamide molecule is capable of quantitatively extracting trivalent actinides from highly acidic solutions. This system was validated using actual feeds from a Cf campaign.
Energy Technology Data Exchange (ETDEWEB)
Bender, Markus
2008-02-22
The ion beam loss induced desorption is a performance limitation for low charge state heavy ion accelerators. If charge exchanged projectile ions get lost onto the beam pipe, desorption of gas is stimulated resulting in a pressure increase inside of the synchrotron and thus, a dramatically reduction of the beam life time. To minimize the amount of desorbed gas an experimental program has been started to measure the desorption yields (released gas molecules per incident ion) of various materials and different projectile ions. The present work is a contribution to the understanding of the physical processes behind the ion beam loss induced desorption. The yield measurements by the pressure rise method have been combined for the rst time with in situ ion beam analysis technologies such as ERDA and RBS. With this unique method the desorption behavior of a sample can be correlated to its surface and bulk properties. The performed experiments with 1,4 MeV/u Xenon-Ions show that the ion induced desorption is mainly a surface effect. Sputtered oxide layers or impurities do not contribute to the desorbed gas significantly. Nevertheless bulk properties play an important role in the desorption strength. Pure metallic samples desorb less gas than isolating materials under swift heavy ion irradiation. From the experimental results it was possible to estimate the desorption yields of various materials under ion bombardment by means of an extended inelastic thermal-spike-model. The extension is the combination of the thermal-spike's temperature map with thermal desorption. Within this model the ion induced desorption can be regarded as the release of adsorbates from a transient overheated spot on the samples surface around the ion impact. Finally a copper substrate with a gold coated surface was developed and proposed as a suitable material for a beam loss collimator with minimum desorption to ensure the performance of GSI's SIS18 in high current beam operation. (orig.)
48 CFR 252.204-7001 - Commercial and Government Entity (CAGE) code reporting.
2010-10-01
... Entity (CAGE) code reporting. 252.204-7001 Section 252.204-7001 Federal Acquisition Regulations System... Entity (CAGE) Code Reporting (AUG 1999) (a) The offeror is requested to enter its CAGE code on its offer... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.204-7001 Commercial and Government Entity...
48 CFR 252.222-7005 - Prohibition on use of nonimmigrant aliens-Guam.
2010-10-01
... nonimmigrant aliens-Guam. 252.222-7005 Section 252.222-7005 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7005 Prohibition on use of nonimmigrant aliens—Guam. As prescribed in 222.7302, use the following clause: Prohibition on Use of Nonimmigrant Aliens—Guam (SEP 1999...
24 CFR 207.252e - Method of payment of mortgage insurance premiums.
2010-04-01
... insurance premiums. 207.252e Section 207.252e Housing and Urban Development Regulations Relating to Housing... Premiums § 207.252e Method of payment of mortgage insurance premiums. In the cases that the Commissioner... mortgagees, that mortgage insurance premiums be remitted electronically. [63 FR 1303, Jan. 8, 1998] ...
Designing on-line analyzer for coal on belt conveyor using neutron activation technique
International Nuclear Information System (INIS)
Rony Djokorayono; Agus Cahyono
2014-01-01
Basic design of on-line analyzer for coal on belt conveyor using neutron activation technique has been carried out. Compared with sampling technique, this neutron activation technique has some advantages in term of analysis accuracy and time. The design activities performed include the establishment of design requirements, functional requirements, technical requirements, technical specification, detection sub-system design, data acquisition subsystem design, and operator computer console design. This program will use Nal(Tl) scintillation detector to detect gamma-rays emitted by elements in coal due to neutron activation of a neutron source, "2"5"2Cf (Californium-252). This basic design of on-line analyzer for coal on belt conveyor using neutron activation technique should be followed up with the development of detailed design, prototype construction, and field testing. (author)
Provenance and composition study on Terengganu inscribed stone using in-situ nuclear technology
International Nuclear Information System (INIS)
Jaafar Abdullah; Roslan Yahya; Hearie Hassan; Engku Mohd Fahmi Engku Chik; Mohamad Rabaie Shari; Airwan Affendi Mahmood; Abdul Quddoss Abu Bakar; Ainul Mardhiah Terry
2012-01-01
This paper focused on the analysis of trace elements and provenance study of the Inscribed Stone of Terengganu (BBPT) using Neutron-induced Prompt Gamma-Ray Techniques (NIPGAT). In this study, portable NIPGAT system was designed and developed by using volume-based measurement. It is a nondestructive testing technique for the samples. This system uses low activity of isotopic neutron radioactive source from californium-252 (Cf-252) as an irradiation source. Gamma ray spectroscopy as well as specialized computer software has been utilized to conduct the research. The study has determined that the stone was a dolerite stone based on the composition of the stone elements. Although most of the scientific data for this study have been collected, this project is still running to complete the scope of provenance study. (author)
Initial screening of thermal desorption for soil remediation
International Nuclear Information System (INIS)
Yezzi, J.J. Jr.; Tafuri, A.N.; Rosenthal, S.; Troxler, W.L.
1994-01-01
Petroleum-contaminated soils--caused by spills, leaks, and accidental discharges--exist at many sites throughout the United States. Thermal desorption technologies which are increasingly being employed to treat these soils, have met soil cleanup criteria for a variety of petroleum products. Currently the United States Environmental Protection Agency is finalizing a technical report entitled Use of Thermal Desorption for Treating Petroleum-Contaminated Soils to assist remedial project managers, site owners, remediation contractors, and equipment vendors in evaluating the use of thermal desorption technologies for petroleum-contaminated soil applications. The report will present a three-level screening method to help a reader predict the success of applying thermal desorption at a specific site. The objective of screening level one is to determine the likelihood of success in a specific application of thermal desorption. It will take into account procedures for collecting and evaluating data on site characteristics, contaminant characteristics, soil characteristics, and regulatory requirements. This level will establish whether or not thermal desorption should be evaluated further for site remediation, whether treatment should occur on-site or off-site, and if on-site is a viable option, what system size will be most cost-effective. The scope of this paper addresses only screening level one which provides a preliminary assessment of the applicability of thermal desorption to a particular site. This topic encompasses worksheets that are an integral part of the ''user friendly'' screening process. Level one screening provides a foundation for the subsequent two levels which follow a similar ''user friendly'' worksheet approach to evaluating thermal desorption technologies and establishing costs for thermal desorption in an overall remediation project
Rugged miniaturized mass sensors for use in plutonium conversion processes
International Nuclear Information System (INIS)
Schweikert, E.A.; James, W.D.
1999-05-01
Ionization is produced either through Plasma Desorption, in the case of a solid, using fission fragments from a Cf-252 source; or in the case of a gas, via an electron avalanche from the impact on a microsphere detector of α particles from a radioactive source. The gaseous compound analysis yielded multiple peaks on parent ion and molecular fragments. In the solid compound analysis, the results indicated that solid-state mass spectrometry will provide important information about the degradation of materials by measured changes in molecular weight
Rugged miniaturized mass sensors for use in plutonium conversion processes
Energy Technology Data Exchange (ETDEWEB)
Schweikert, E.A.; James, W.D. [Texas A and M Univ., College Station, TX (United States). Center for Chemical Characterization and Analysis
1999-05-01
Ionization is produced either through Plasma Desorption, in the case of a solid, using fission fragments from a Cf-252 source; or in the case of a gas, via an electron avalanche from the impact on a microsphere detector of {alpha} particles from a radioactive source. The gaseous compound analysis yielded multiple peaks on parent ion and molecular fragments. In the solid compound analysis, the results indicated that solid-state mass spectrometry will provide important information about the degradation of materials by measured changes in molecular weight.
Combined liquid chromatography-mass spectrometry for trace analysis of pharmaceuticals
International Nuclear Information System (INIS)
Schmidt, L.; Danigel, H.; Jungclas, H.
1982-01-01
A 252 Cf-plasma desorption mass spectrometer (PDMS) for the analysis of thin layers from nonvolatile organic samples has been set up to be combined with a liquid chromatograph. A novel interface performs the direct inlet of the liquid sample through a capillary into the vacuum system of the spectrometer. Samples of drugs are periodically collected, transferred to the ion source and analysed using a rotating disk. This on-line sample preparation has been tested for three antiarrhythmic drugs using various solvents and mixtures. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Stafford, Luc; Poirier, Jean-Sebastien; Margot, Joelle [Departement de Physique, Universite de Montreal, Montreal, Quebec, H3C 3J7 (Canada); Khare, Rohit; Guha, Joydeep; Donnelly, Vincent M, E-mail: luc.stafford@umontreal.c, E-mail: vmdonnelly@uh.ed [Department of Chemical and Biomolecular Engineering, University of Houston, Houston, TX 77204 (United States)
2009-03-07
We investigated the interactions of atomic and molecular chlorine with plasma-conditioned stainless steel surfaces through both experiments and modelling. The recombination of Cl during adsorption and desorption of Cl{sub 2} was characterized using a rotating-substrate technique in which portions of the cylindrical substrate surface are periodically exposed to an inductively coupled chlorine plasma and then to an Auger electron spectrometer in separate, differentially pumped chambers. After several hours of exposure to the Cl{sub 2} plasma, the stainless steel substrate became coated with a Si-oxychloride-based layer (Fe : Si : O : Cl {approx} 1 : 13 : 13 : 3) due to chlorine adsorption and the erosion of the silica discharge tube. Desorption of Cl{sub 2} from this surface was monitored through measurements of pressure rises in the Auger chamber as a function of substrate rotation frequency. Significant adsorption and desorption of Cl{sub 2} was observed with the plasma off, similar to that observed previously on plasma-conditioned anodized aluminium surfaces, but with much faster desorption rates that are most likely attributable to the smoother and non-porous stainless steel surface morphology. When the plasma was turned on, a much larger pressure rise was observed due to Langmuir-Hinshelwood recombination of Cl atoms. Recombination coefficients, {gamma}{sub Cl}, ranged from 0.004 to 0.03 and increased with Cl-to-Cl{sub 2} number density ratio. This behaviour was observed previously for anodized aluminium surfaces, and was explained by the blocking of Cl recombination sites by adsorbed Cl{sub 2}. Application of this variable recombination coefficient to the modelling of high-density chlorine plasmas gives a much better agreement with measured Cl{sub 2} percent dissociations compared with predictions obtained with a recombination coefficient that is independent of plasma conditions.
48 CFR 252.227-7012 - Patent license and release contract.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Patent license and release contract. 252.227-7012 Section 252.227-7012 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text...
Testosterone sorption and desorption: Effects of soil particle size
Energy Technology Data Exchange (ETDEWEB)
Qi, Yong, E-mail: yqi01@unomaha.edu [Civil Engineering Dept., University of Nebraska-Lincoln at Omaha Campus, Omaha, NE 68182 (United States); Zhang, Tian C. [Civil Engineering Dept., University of Nebraska-Lincoln at Omaha Campus, Omaha, NE 68182 (United States); Ren, Yongzheng [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)
2014-08-30
Graphical abstract: - Highlights: • Smaller soil particles have higher sorption and lower desorption rates. • The sorption capacity ranks as clay > silt > sand. • Small particles like clays have less potential for desorption. • Colloids (clays) have high potential to facilitate the transport of hormones in soil–water environments. - Abstract: Soils contain a wide range of particles of different diameters with different mobility during rainfall events. Effects of soil particles on sorption and desorption behaviors of steroid hormones have not been investigated. In this study, wet sieve washing and repeated sedimentation methods were used to fractionate the soils into five ranges. The sorption and desorption properties and related mechanisms of testosterone in batch reactors filled with fractionated soil particles were evaluated. Results of sorption and desorption kinetics indicate that small soil particles have higher sorption and lower desorption rates than that of big ones. Thermodynamic results show the sorption processes are spontaneous and exothermal. The sorption capacity ranks as clay > silt > sand, depending mainly on specific surface area and surface functional groups. The urea control test shows that hydrogen bonding contributes to testosterone sorption onto clay and silt but not on sand. Desorption tests indicate sorption is 36–65% irreversible from clay to sand. Clays have highest desorption hysteresis among these five soil fractions, indicating small particles like clays have less potential for desorption. The results provide indirect evidence on the colloid (clay)-facilitated transport of hormones (micro-pollutants) in soil environments.
International Nuclear Information System (INIS)
Reynolds, G.; Bozorganesh, H.; Elias, E.; Gozani, T.; Maung, T.; Orphan, V.
1979-01-01
Using californium-252 as a source of exciting neutrons, prompt gamma photons emitted by elemental nuclei in the coal have been measured using several detectors, including sodium--iodide and germanium--lithium. Several coal types, including bituminous, subbituminous lignite and anthracite were crushed to various top sizes and analyzed carefully be traditional ASTM wet chemistry techniques at two or three different laboratories. The elements (sulfur, hydrogen, carbon, aluminum, silicon, iron, calcium, sodium, nitrogen, and chlorine) were determined by prompt neutron activations and the quantities compared with those of the wet chemical analyses
Graphite moderated {sup 252}Cf source
Energy Technology Data Exchange (ETDEWEB)
Sajo B, L.; Barros, H.; Greaves, E. D. [Universidad Simon Bolivar, Nuclear Physics Laboratory, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of); Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)
2014-08-15
The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a {sup 252}Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the {sup 252}Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)
Directory of Open Access Journals (Sweden)
Clayton Dickerson
2013-02-01
Full Text Available An electron beam ion source (EBIS will be constructed and used to charge breed ions from the californium rare isotope breeder upgrade (CARIBU for postacceleration into the Argonne tandem linear accelerator system (ATLAS. Simulations of the EBIS charge breeder performance and the related ion transport systems are reported. Propagation of the electron beam through the EBIS was verified, and the anticipated incident power density within the electron collector was identified. The full normalized acceptance of the charge breeder with a 2 A electron beam, 0.024π mm mrad for nominal operating parameters, was determined by simulating ion injection into the EBIS. The optics of the ion transport lines were carefully optimized to achieve well-matched ion injection, to minimize emittance growth of the injected and extracted ion beams, and to enable adequate testing of the charge bred ions prior to installation in ATLAS.
Modeling Organic Contaminant Desorption from Municipal Solid Waste Components
Knappe, D. R.; Wu, B.; Barlaz, M. A.
2002-12-01
Approximately 25% of the sites on the National Priority List (NPL) of Superfund are municipal landfills that accepted hazardous waste. Unlined landfills typically result in groundwater contamination, and priority pollutants such as alkylbenzenes are often present. To select cost-effective risk management alternatives, better information on factors controlling the fate of hydrophobic organic contaminants (HOCs) in landfills is required. The objectives of this study were (1) to investigate the effects of HOC aging time, anaerobic sorbent decomposition, and leachate composition on HOC desorption rates, and (2) to simulate HOC desorption rates from polymers and biopolymer composites with suitable diffusion models. Experiments were conducted with individual components of municipal solid waste (MSW) including polyvinyl chloride (PVC), high-density polyethylene (HDPE), newsprint, office paper, and model food and yard waste (rabbit food). Each of the biopolymer composites (office paper, newsprint, rabbit food) was tested in both fresh and anaerobically decomposed form. To determine the effects of aging on alkylbenzene desorption rates, batch desorption tests were performed after sorbents were exposed to toluene for 30 and 250 days in flame-sealed ampules. Desorption tests showed that alkylbenzene desorption rates varied greatly among MSW components (PVC slowest, fresh rabbit food and newsprint fastest). Furthermore, desorption rates decreased as aging time increased. A single-parameter polymer diffusion model successfully described PVC and HDPE desorption data, but it failed to simulate desorption rate data for biopolymer composites. For biopolymer composites, a three-parameter biphasic polymer diffusion model was employed, which successfully simulated both the initial rapid and the subsequent slow desorption of toluene. Toluene desorption rates from MSW mixtures were predicted for typical MSW compositions in the years 1960 and 1997. For the older MSW mixture, which had a
Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields
International Nuclear Information System (INIS)
Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik
2001-01-01
Calibration measurements were carried out on a probe designed to measure ambient dose equivalent in accordance with ICRP Pub 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diameter spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV. The instrument was used to measure the dose rate in four separate neutron fields: unmoderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and WEP neutron howitzer with 252 Cf at its center. Dose equivalent measurements were performed at source-detector centerline distances from 50 to 200 cm. The ratio of air-scatter- and room-return-corrected ambient dose equivalent rates to ambient dose equivalent rates calculated with the code MCNP are tabulated
Thermal desorption study of physical forces at the PTFE surface
Wheeler, D. R.; Pepper, S. V.
1987-01-01
Thermal desorption spectroscopy (TDS) of the polytetrafluoroethylene (PTFE) surface was successfully employed to study the possible role of physical forces in the enhancement of metal-PTFE adhesion by radiation. The thermal desorption spectra were analyzed without assumptions to yield the activation energy for desorption over a range of xenon coverage from less than 0.1 monolayer to more than 100 monolayers. For multilayer coverage, the desorption is zero-order with an activation energy equal to the sublimation energy of xenon. For submonolayer coverages, the order for desorption from the unirradiated PTFE surface is 0.73 and the activation energy for desorption is between 3.32 and 3.36 kcal/mol; less than the xenon sublimation energy. The effect of irradiation is to increase the activation energy for desorption to as high as 4 kcal/mol at low coverage.
Barker, Charles E.; Dallegge, Todd A.
2005-01-01
Coal desorption techniques typically use the U.S. Bureau of Mines (USBM) canister-desorption method as described by Diamond and Levine (1981), Close and Erwin (1989), Ryan and Dawson (1993), McLennan and others (1994), Mavor and Nelson (1997) and Diamond and Schatzel (1998). However, the coal desorption canister designs historically used with this method have an inherent flaw that allows a significant gas-filled headspace bubble to remain in the canister that later has to be compensated for by correcting the measured desorbed gas volume with a mathematical headspace volume correction (McLennan and others, 1994; Mavor and Nelson, 1997).
Californium-252 neutron activation analysis of high-level processed nuclear tank waste
International Nuclear Information System (INIS)
Troyer, G.L.; Purcell, M.A.
2000-01-01
The basis for production assessment of the vitrification of Hanford nuclear fuel reprocessing wastes will be high-precision measurements of the elemental sodium content. However, the chemical analysis of both radioactive and nonradioactive components in nuclear waste can be challenged by high radiation dose rates. The dose rates compromise many analytical techniques as well as pose personnel dosimetry risks. In many cases, reduction of dose rates through dilution compromises the precision and sensitivity for certain key components. The use of neutron activation analysis (NAA) provides a method of analysis that avoids the need for dilutions or extensive sample preparation. These waste materials also contain trace quantities of fissionable isotopes, which, through neutron activation, can be estimated by delayed neutron counting of fissioned fragments
Energy Technology Data Exchange (ETDEWEB)
Maurer, Christoph
2017-07-03
A central component of FAIR, the Facility for Antiproton and Ion Research, will be the superconducting heavy ion synchrotron SIS100, which is supposed to provide reliable, high intensity beams for various applications. Its beam intensity is governed by the space charge limit, while the maximum energy is determined by the machine's magnetic rigidity. That means, ions with higher charge state can be accelerated to a higher energy, but with less intensity. For highest intensity beams, intermediate charge states have to be used instead of high charge state ions. This alleviates the issue of space charge but gives rise to dynamic vacuum effects, which also limit beam intensity: beam particles collide with residual gas particles, which leads to charge exchange and their subsequent loss. Impacting on the chamber wall, these ions release adsorbed gas particles. This process is called desorption and leads to a localized increase in pressure, which in turn causes more charge exchange. After a few rounds of self amplification, this can lead to total beam loss. This ''runaway-desorption'' is typically the main beam intensity limiting process for intermediate charge state (heavy) ion beams. The extent of this phenomenon is governed by two factors: the initial beam intensity and the desorption yield. The latter is examined within the scope of this thesis. Special emphasis is placed on the influence of the target's temperature, since the SIS100 will be a superconducting machine with cryogenic vacuum chamber walls. In order to investigate this topic, an experimental setup has been devised, built at the SIS18 and taken into commission. Based on the experience gained during operation, it has been continuously improved and extended. Another central innovation presented in this thesis is the use of gas dynamics simulations for an improved method of data analysis. Using this technique, environmental conditions like the chamber geometry and the connected
Reiding, Karli R.; Ruhaak, L. Renee; Uh, Hae-Won; el Bouhaddani, Said; van den Akker, Erik B.; Plomp, Rosina; McDonnell, Liam A.; Houwing-Duistermaat, Jeanine J.; Slagboom, P. Eline; Beekman, Marian; Wuhrer, Manfred
2017-01-01
Glycosylation is an abundant co- and post-translational protein modification of importance to protein processing and activity. Although not template-defined, glycosylation does reflect the biological state of an organism and is a high-potential biomarker for disease and patient stratification. However, to interpret a complex but informative sample like the total plasma N-glycome, it is important to establish its baseline association with plasma protein levels and systemic processes. Thus far, large-scale studies (n >200) of the total plasma N-glycome have been performed with methods of chromatographic and electrophoretic separation, which, although being informative, are limited in resolving the structural complexity of plasma N-glycans. MS has the opportunity to contribute additional information on, among others, antennarity, sialylation, and the identity of high-mannose type species. Here, we have used matrix-assisted laser desorption/ionization (MALDI)-Fourier transform ion cyclotron resonance (FTICR)-MS to study the total plasma N-glycome of 2144 healthy middle-aged individuals from the Leiden Longevity Study, to allow association analysis with markers of metabolic health and inflammation. To achieve this, N-glycans were enzymatically released from their protein backbones, labeled at the reducing end with 2-aminobenzoic acid, and following purification analyzed by negative ion mode intermediate pressure MALDI-FTICR-MS. In doing so, we achieved the relative quantification of 61 glycan compositions, ranging from Hex4HexNAc2 to Hex7HexNAc6dHex1Neu5Ac4, as well as that of 39 glycosylation traits derived thereof. Next to confirming known associations of glycosylation with age and sex by MALDI-FTICR-MS, we report novel associations with C-reactive protein (CRP), interleukin 6 (IL-6), body mass index (BMI), leptin, adiponectin, HDL cholesterol, triglycerides (TG), insulin, gamma-glutamyl transferase (GGT), alanine aminotransferase (ALT), and smoking. Overall, the
Radiation ulcers in patients with cancer of the torgue after 252Cf therapy
International Nuclear Information System (INIS)
Galantseva, G.F.; Guseva, L.I.; Plichko, V.I.
1984-01-01
Interstitial therapy with 252 Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with 252 Cf doesn't differ sufficiently from the course of radiation injuries, occurring after γ-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with 252 Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongUe ulcers after interstitial therapy with 252 Cf
2010-04-01
... TREASURY LIQUORS BEER Removal of Brewer's Yeast and Other Articles § 25.252 Records. (a) Production. The brewer shall keep records of the production of malt syrup, wort, and other articles which are removed... of brewer's yeast, malt and other articles from the brewery. The record shall include the quantity...
Secondary ion shadow-cone enhanced desorption
Energy Technology Data Exchange (ETDEWEB)
Chechen Chang (Hawaii Univ., Honolulu (USA). Dept. of Chemistry)
1990-02-01
The incident angle dependence of the secondary particle emission process under keV ion bombardment has been investigated. The results from the full molecular dynamics calculations indicate that the flux anisotropy of the incident beam, resulting from the non-uniform impact parameters for the surface atom of a single crystal, affects the particle desorption in a systematic fashion. The enhanced desorption at certain angles of incidence corresponds to the intensive focusing of the incident beam to the near-surface atom and the extended dissipation of momentum by large-angle scattering. This observation has let us to develop a new theoretical model in which the enhanced desorption is described by the distance of closest encounter along the trajectory of the incident particle to the surface atom. The computer time for the simulation of the incident-angle-dependent emission process is significantly reduced. The results from the calculation based on this model are in good agreement both with the results from the full dynamics calculation and with the experimental results. The new model also allows a complementary evaluation of the microscopic dynamics involved in the shadow-cone enhanced desorption. (author).
Thermal desorption and surface modification of He+ implanted into tungsten
International Nuclear Information System (INIS)
Fu Zhang; Yoshida, N.; Iwakiri, H.; Xu Zengyu
2004-01-01
Tungsten divertor plates in fusion reactors will be subject to helium bombardment. Helium retention and thermal desorption is a concerned issue in controlling helium ash. In the present study, fluence dependence of thermal desorption behavior of helium in tungsten was studied at different irradiation temperatures and ion energies. Results showed that helium desorption could start at ∼400 K with increasing fluence, while no noticeable peaks were detected at low fluence. Total helium desorption reached a saturation value at high fluence range, which was not sensitive to irradiation temperature or ion energy for the conditions evaluated. Surface modifications caused by either ion irradiation or thermal desorption were observed by SEM. The relationship of surface modifications and helium desorption behavior was discussed. Some special features of elevated irradiation temperature and lower ion energy were also indicated
Fabrication of intense neutron sources for medical applications
International Nuclear Information System (INIS)
Boulogne, A.R.; Walker, V.W.
1975-01-01
Simulated sources containing 252 Cf equivalents of 0.1 to 1.0 milligrams were prepared. Samarium was used as the simulant in a modified chemical plating technique similar to that used to prepare palladium-californium oxide cermet for industrial applications. The length of the platinum-10 percent iridium doubly encapsulated source with its protective sheath is 0.545 in. (14.1 mm). Outside dia of the source, including its sheath, is 0.109 in. (2.8 mm). Existing ''Brachytrons'' can accommodate this source form. This capsule system will withstand internal gas pressures from helium due to alpha decay and fission gases from a 1 mg 252 Cf source after ten years if the source is subjected to a maximum temperature of 800 0 C, the theoretical temperature of an accidental fire. Under these conditions the safety factor is 3. The capsule system is being tested with tracer amounts of 252 Cf to ensure that it will withstand adverse service conditions as well as tests specified for Special Form Materials. (auth)
Auger decay mechanism in photon-stimulated desorption of ions from surfaces
International Nuclear Information System (INIS)
Parks, C.C.
1983-11-01
Photon-stimulated desorption (PSD) of positive ions was studied with synchrotron radiation using an angle-integrating time-of-flight mass spectrometer. Ion yields as functions of photon energy near core levels were measured from condensed gases, alkali fluorides, and other alkali and alkaline earth halides. These results are compared to bulk photoabsorption measurements with emphasis on understanding fundamental desorption mechanisms. The applicability of the Auger decay mechanism, in which ion desorption is strictly proportional to surface absorption, is discussed in detail. The Auger decay model is developed in detail to describe Na + and F + desorption from NaF following Na(1s) excitation. The major decay pathways of the Na(1s) hole leading to desorption are described and equations for the energetics of ion desorption are developed. Ion desorption spectra of H + , Li + , and F + are compared to bulk photoabsorption near the F(2s) and Li(1s) edges of LiF. A strong photon beam exposure dependence of ion yields from alkali fluorides is revealed, which may indicate the predominance of metal ion desorption from defect sites. The large role of indirect mechanisms in ion desorption condensed N 2 -O 2 multilayers is demonstrated and discussed. Ion desorption spectra from several alkali halides and alkaline earth halides are compared to bulk photoabsorption spectra. Relative ion yields from BaF 2 and a series of alkali halides are discussed in terms of desorption mechanisms
Characterization of aerosols containing radiopharmaceuticals
International Nuclear Information System (INIS)
Cunha, Kenya Dias da; Santos, Maristela Souza
2008-01-01
The objective of this study is to present the main lines of action of the Laboratorio de Caracterizacao de Aerossois (LCA /IRD) in the study of aerosols, the techniques available and the capability of these techniques as a tool in the biokinetics behavior study of radiopharmaceuticals and evaluating the particle exposed individuals containing these molecules. The LCA provides the following analytical techniques: spectrometry alpha, gamma and alpha counting and gross beta; PIXE (Particle Induced X rays Emission) and mass spectrometry-based flight time measurement of molecular ions ( 252 Cf-PDMS - 252 Cf-Plasma Desorption Mass Spectrometry). This technique is used to identify compounds mass to 10 000 a.m.u. The combination of these techniques has been applied to the study in vitro of the toxicology of the metals and radionuclides both in the respiratory tract as in the gastrointestinal
An infrared measurement of chemical desorption from interstellar ice analogues
Oba, Y.; Tomaru, T.; Lamberts, T.; Kouchi, A.; Watanabe, N.
2018-03-01
In molecular clouds at temperatures as low as 10 K, all species except hydrogen and helium should be locked in the heterogeneous ice on dust grain surfaces. Nevertheless, astronomical observations have detected over 150 different species in the gas phase in these clouds. The mechanism by which molecules are released from the dust surface below thermal desorption temperatures to be detectable in the gas phase is crucial for understanding the chemical evolution in such cold clouds. Chemical desorption, caused by the excess energy of an exothermic reaction, was first proposed as a key molecular release mechanism almost 50 years ago1. Chemical desorption can, in principle, take place at any temperature, even below the thermal desorption temperature. Therefore, astrochemical network models commonly include this process2,3. Although there have been a few previous experimental efforts4-6, no infrared measurement of the surface (which has a strong advantage to quantify chemical desorption) has been performed. Here, we report the first infrared in situ measurement of chemical desorption during the reactions H + H2S → HS + H2 (reaction 1) and HS + H → H2S (reaction 2), which are key to interstellar sulphur chemistry2,3. The present study clearly demonstrates that chemical desorption is a more efficient process for releasing H2S into the gas phase than was previously believed. The obtained effective cross-section for chemical desorption indicates that the chemical desorption rate exceeds the photodesorption rate in typical interstellar environments.
Universal scaling for biomolecule desorption induced by swift heavy ions
International Nuclear Information System (INIS)
Szenes, G.
2005-01-01
A thermal activation mechanism is proposed for the desorption of biomolecules. Good agreement is found with the experiments in a broad range of the electronic stopping power. The activation energies of desorption U are 0.33, 1.57 and 5.35 eV for positive, negative and neutral leucine molecules, respectively, and 2.05 eV for positive ergosterol molecules. The desorption of valine clusters is analyzed. The magnitude of the specific heat shows that the internal degrees of freedom are not excited up to the moment of desorption. The effect of irradiation temperature and of ion velocity on the desorption yield is discussed on the basis of the author's model. The scaling function derived in the model for the desorption of biomolecules is applied also to the sputtering of SiO 2 and U = 0.42 eV is obtained
Neutron shielding for a 252 Cf source
International Nuclear Information System (INIS)
Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Eduardo Gallego, Alfredo Lorente
2006-01-01
To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a 252 Cf isotopic neutron source. During calculations a detailed model for the 252 Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare 252 Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)
48 CFR 252.225-7044 - Balance of Payments Program-Construction Material.
2010-10-01
... Program-Construction Material. 252.225-7044 Section 252.225-7044 Federal Acquisition Regulations System...—Construction Material. As prescribed in 225.7503(a), use the following clause: Balance of Payments Program—Construction Material (JAN 2009) (a) Definitions. As used in this clause— Commercially available off-the-shelf...
Kinetics of Hydrogen Absorption and Desorption in Titanium
Directory of Open Access Journals (Sweden)
Suwarno Suwarno
2017-10-01
Full Text Available Titanium is reactive toward hydrogen forming metal hydride which has a potential application in energy storage and conversion. Titanium hydride has been widely studied for hydrogen storage, thermal storage, and battery electrodes applications. A special interest is using titanium for hydrogen production in a hydrogen sorption-enhanced steam reforming of natural gas. In the present work, non-isothermal dehydrogenation kinetics of titanium hydride and kinetics of hydrogenation in gaseous flow at isothermal conditions were investigated. The hydrogen desorption was studied using temperature desorption spectroscopy (TDS while the hydrogen absorption and desorption in gaseous flow were studied by temperature programmed desorption (TPD. The present work showed that the path of dehydrogenation of the TiH2 is d®b®a hydride phase with possible overlapping steps occurred. The fast hydrogen desorption rate observed at the TDS main peak temperature were correlated with the fast transformation of the d-TiH1.41 to b-TiH0.59. In the gaseous flow, hydrogen absorption and desorption were related to the transformation of b-TiH0.59 Û d-TiH1.41 with 2 wt.% hydrogen reversible content. Copyright © 2017 BCREC Group. All rights reserved Received: 21st November 2016; Revised: 20th March 2017; Accepted: 9th April 2017; Available online: 27th October 2017; Published regularly: December 2017 How to Cite: Suwarno, S., Yartys, V.A. (2017. Kinetics of Hydrogen Absorption and Desorption in Titanium. Bulletin of Chemical Reaction Engineering & Catalysis, 12 (3: 312-317 (doi:10.9767/bcrec.12.3.810.312-317
38 CFR 3.252 - Annual income; pension; Mexican border period and later war periods.
2010-07-01
...; Mexican border period and later war periods. 3.252 Section 3.252 Pensions, Bonuses, and Veterans' Relief... Dependency, Income and Estate § 3.252 Annual income; pension; Mexican border period and later war periods. (a) Annual income limitations; old-law pension. Where the right to old-law pension is payable under section...
24 CFR 207.252c - Premiums-mortgages insured pursuant to section 238(c) of the Act.
2010-04-01
.... All of the provisions of §§ 207.252 and 207.252a governing mortgage insurance premiums shall apply to... insurance premiums due on such mortgages in accordance with §§ 207.252 and 207.252a shall be calculated on... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Premiums-mortgages insured pursuant...
50 CFR 14.252 - What definitions do I need to know?
2010-10-01
... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What definitions do I need to know? 14.252... PLANTS IMPORTATION, EXPORTATION, AND TRANSPORTATION OF WILDLIFE Captive Wildlife Safety Act § 14.252 What... which any individual other than an authorized keeper or caregiver may potentially touch or otherwise...
The status of low dose rate and future of high dose rate Cf-252 brachytherapy
International Nuclear Information System (INIS)
Rivard, M.J.; Wierzbicki, J.G.; Van den Heuvel, F.; Chuba, P.J.; Fontanesi, J.
1997-12-01
This work describes the current status of the US low dose rate (LDR) Cf-252 brachytherapy program. The efforts undertaken towards development of a high dose rate (HDR) remotely after loaded Cf-252 source, which can accommodate 1 mg or greater Cf-252, are also described. This HDR effort is a collaboration between Oak Ridge National Laboratory (ORNL), commercial remote after loader manufactures, the Gershenson Radiation Oncology Center (ROC), and Wayne State University. To achieve this goal, several advances in isotope chemistry and source preparation at ORNL must be achieved to yield a specific material source loading of greater than or equal 1 mg Cf-252 per mm3. Development work with both radioactive and non-radioactive stand-ins for Cf-252 have indicated the feasibility of fabricating such sources. As a result, the decreased catheter diameter and computer controlled source placement will permit additional sites (e.g. brain, breast, prostate, lung, parotid, etc.) to be treated effectively with Cf-252 sources. Additional work at the Radiochemical Engineering and Development Center (REDC) remains in source fabrication, after loader modification, and safe design. The current LDR Cf-252 Treatment Suite at the ROC is shielded and licensed to hold up to 1 mg of Cf-252. This was designed to maintain cumulative personnel exposure, both external to the room and in direct isotope handling, at less than 20 microSv/hr. However, cumulative exposure may be greatly decreased if a Cf-252 HDR unit is employed which would eliminate direct isotope handling and decrease treatment times from tilde 3 hours to an expected range of 3 to 15 minutes. Such a Cf-252 HDR source will also demonstrate improved dose distributions over current LDR treatments due to the ability to step the point-like source throughout the target volume and weight the dwell time accordingly
48 CFR 252.244-7000 - Subcontracts for Commercial Items and Commercial Components (DoD Contracts).
2010-10-01
... under this contract: (a) 252.225-7009 Restriction on Acquisition of Certain Articles Containing... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Subcontracts for Commercial Items and Commercial Components (DoD Contracts). 252.244-7000 Section 252.244-7000 Federal...
Energy Technology Data Exchange (ETDEWEB)
King, L.J.; Bigelow, J.E.; Collins, E.D.
1976-03-01
During the period January 1, 1975, through June 30, 1975, the following amounts of transuranium elements were recovered from 22 irradiated HFIR targets: 2g /sup 243/Am, 59 g /sup 244/Cm, 51 mg /sup 249/Bk, 465 mg /sup 252/Cf, 2.5 mg /sup 253/Es, and 1.4 pg /sup 257/Fm. In addition, 45 mg of high-purity /sup 248/Cm was operated from /sup 252/Cf which had been recovered and purified during earlier periods, and 56 mg of a lower-quality /sup 248/Cm was separated from californium purification rework solutions. Five HFIR targets, each containing approximately 9 g of actinides (predominantly curium), were fabricated. A new long-term projection showed that /sup 252/Cf production in the TRU-HFIR complex could increase to as much as 2.5 g/year. During the next 18 months, we expect to recover totals of 46 mg of /sup 249/Bk, 520 mg of /sup 252/Cf, 2.0 mg of /sup 253/Es (in a mixture of isotopes), 220 ..mu..g of high-purity /sup 253/Es, and 1.6 pg of /sup 257/Fm. We also expect to obtain 125 mg of high-purity /sup 248/Cm from purified californium now in storage. There are no plans to process any of the remaining SRP Pu-Al tubes or to irradiate any plutonium targets in the HFIR; thus, we do not expect to recover any /sup 244/Pu. No changes were made in the chemical processing flowsheets normally used at TRU. Two neutron sources were fabricated, bringing the total fabricated to 77. In special projects, we (1) produced about 1 mg of /sup 250/Cf by irradiation of /sup 249/Bk in HFIR rabbits, and (2) processed some irradiated /sup 248/Cm samples and obtained yield and isotopic composition data for use in determining the capture cross section of /sup 249/Cm in the HFIR. The values that are currently being used for transuranium element decay data and for cross-section data in planning irradiation-processing cycles, calculating production forecasts, and assaying products are tabulated in the Appendix.
Cs-137 sorption and desorption in relation to properties of 17 soils
International Nuclear Information System (INIS)
Kerpen, W.
1988-01-01
For Cs-137 sorption and desorption studies material of Ap and Ah horizons from 17 soils with wide varying soil properties was selected. The soils were: Podsol, Luvisol, Chernozem, Cambisol, Phaeozem, Arenosol, Gleysol and other soils. The Cs-137 sorption and desorption experiments were carried out in aqueous solution (20 g of soil) under standardized conditions for two reasons: (1) to determine the amounts of Cs-137 sorption, desorption and remains as a function of different soils and (2) to evaluate the soil parameters which govern the sorption, desorption processes. Concerning the second point the sorption values, the amount of 137 Cs desorbed within four desorption cycles and the 137 Cs remains after four desorption cycles were correlated with pH, grain size, sorption capacity (CEC), and other soil properties. It will be shown that generally Cs-137 sorption, desorption and remains depend primarily on the pH of the soil. The middle sand proved to be an indicator for the strenght of sorption, and desorption processes. Sorption and desorption studies lead to the same results as found in biotest experiments
International Nuclear Information System (INIS)
Anon.
1999-01-01
These radiation protection data sheet are devoted to responsible persons and employees of various laboratories or medical, pharmaceutical, university and industrial departments where radionuclides are handled as well as all the persons who attend to satisfy in this field. They contain the essential radiation protection data for the use of unsealed sources: physical characteristics, risk assessment, administrative procedures, recommendations, regulations and bibliography. This new series includes the following radionuclides: californium 252, curium 244, gallium 67, indium 113m, plutonium 238, plutonium 239, polonium 210, potassium 42, radium 226, thorium 232, uranium 238 and zinc 65. (O.M.)
Neutron Spectra, Fluence and Dose Rates from Bare and Moderated Cf-252 Sources
Energy Technology Data Exchange (ETDEWEB)
Radev, Radoslav P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-04-01
A new, stronger 252Cf source (serial number SR-CF-3050-OR) was obtained from Oak Ridge National Laboratory (ORNL) in 2014 to supplement the existing 252Cf sources which had significantly decayed. A new instrument positioning track system was designed and installed by Hopewell Designs, Inc. in 2011. The neutron field from the new, stronger 252Cf source in the modified calibration environment needed to be characterized as well as the modified neutron fields produced by the new source and seven different neutron moderators. Comprehensive information about our 252Cf source, its origin, production, and isotopic content and decay characteristics needed to be compiled as well. This technical report is intended to address these issues.
Long-term desorption of trichloroethylene from flint clay using multiplexed optical detection
International Nuclear Information System (INIS)
Stager, M.P.; Perram, G.P.
1999-01-01
The long-term desorption of trichloroethylene (TCE) from powdered flint clay was examined using a multiplexed, phase sensitive infrared technique which provided a gas phase detection limit of 0.0045 torr for continuous monitoring of the desorption process for at least 3 days. The vapor phase TCE concentrations as a function of desorption time exhibit a significant deviation from Langmuir kinetics. The desorption process is adequately described by bonding sites with a gamma distribution for the desorption rate coefficients. The mean desorption rate for powdered flint clay at 25°C is k d = 0.50 ± 0.02 h −1 . (author)
Reiding, Karli R; Ruhaak, L Renee; Uh, Hae-Won; El Bouhaddani, Said; van den Akker, Erik B; Plomp, Rosina; McDonnell, Liam A; Houwing-Duistermaat, Jeanine J; Slagboom, P Eline; Beekman, Marian; Wuhrer, Manfred
2017-02-01
Glycosylation is an abundant co- and post-translational protein modification of importance to protein processing and activity. Although not template-defined, glycosylation does reflect the biological state of an organism and is a high-potential biomarker for disease and patient stratification. However, to interpret a complex but informative sample like the total plasma N-glycome, it is important to establish its baseline association with plasma protein levels and systemic processes. Thus far, large-scale studies (n >200) of the total plasma N-glycome have been performed with methods of chromatographic and electrophoretic separation, which, although being informative, are limited in resolving the structural complexity of plasma N-glycans. MS has the opportunity to contribute additional information on, among others, antennarity, sialylation, and the identity of high-mannose type species.Here, we have used matrix-assisted laser desorption/ionization (MALDI)-Fourier transform ion cyclotron resonance (FTICR)-MS to study the total plasma N-glycome of 2144 healthy middle-aged individuals from the Leiden Longevity Study, to allow association analysis with markers of metabolic health and inflammation. To achieve this, N-glycans were enzymatically released from their protein backbones, labeled at the reducing end with 2-aminobenzoic acid, and following purification analyzed by negative ion mode intermediate pressure MALDI-FTICR-MS. In doing so, we achieved the relative quantification of 61 glycan compositions, ranging from Hex 4 HexNAc 2 to Hex 7 HexNAc 6 dHex 1 Neu5Ac 4 , as well as that of 39 glycosylation traits derived thereof. Next to confirming known associations of glycosylation with age and sex by MALDI-FTICR-MS, we report novel associations with C-reactive protein (CRP), interleukin 6 (IL-6), body mass index (BMI), leptin, adiponectin, HDL cholesterol, triglycerides (TG), insulin, gamma-glutamyl transferase (GGT), alanine aminotransferase (ALT), and smoking. Overall
Experimental study on desorption characteristics of SAPO-34 and ZSM-5 zeolite
Yuan, Z. X.; Zhang, X.; Wang, W. C.; Du, C. X.; Liu, Z. B.; Chen, Y. C.
2018-03-01
The dynamic characteristics of SAPO-34 and ZSM-5 zeolite in the desorption process have been experimentally studied with the gravimetric method. The weight change of the test sample was recorded continually for different conditions of temperature and pressure. The curve of the desorption degree with the temperature and the pressure was obtained and discussed. With the intrinsic different micro-structure, the two zeolites showed distinguished characteristics of the desorption. In contrast to an S-shaped desorption curve of the SAPO-34, the ZSM-5 showed an exponential desorption curve. In comparison, the desorption characteristics of the ZSM-5 were better than that of the SAPO-34 in the temperature range of 40 °C 90 °C. Nevertheless, the effect of the pressure on the desorption degree was stronger for the SAPO-34 than for the ZSM-5. Further analysis revealed that the desorption speed was affected more strongly by the temperature than by the pressure.
K-252a, a novel microbial product, inhibits smooth muscle myosin light chain kinase
International Nuclear Information System (INIS)
Nakanishi, S.; Yamada, K.; Kase, H.; Nakamura, S.; Nonomura, Y.
1988-01-01
Effects of K-252a, purified from the culture broth of Nocardiopsis sp., on the activity of myosin (light chain kinase were investigated. 1) K-252a affected three characteristic properties of chicken gizzard myosin-B, natural actomyosin, to a similar degree: the Ca 2+ -dependent activity of ATPase, superprecipitation, and the phosphorylation of the myosin light chain. 2) K-252a inhibited the activities of the purified myosin light chain kinase and a Ca 2+ -independent form of the enzyme which was constructed by cross-linking of myosin light chain kinase and calmodulin using glutaraldehyde. The degrees of inhibition by 3 x 10 -6 M K-252a were 69 and 48% of the control activities with the purified enzyme and the cross-linked complex, respectively. Chlorpromazine (3 x 10 -4 M), a calmodulin antagonist, inhibited the native enzyme, but not the cross-linked one. These results suggested that K-252a inhibited myosin light chain kinase by direct interaction with the enzyme, whereas chlorpromazine suppressed the enzyme activation by interacting with calmodulin. 3) The inhibition by K-252a of the cross-linked kinase was affected by the concentration of ATP, a phosphate donor. The concentration causing 50% inhibition was two orders magnitude lowere in the presence of 100 μM ATP than in the presence of 2 mM ATP. 4) Kinetic analyses using [γ- 32 P]ATP indicated that the inhibitory mode of K-252a was competitive with respect to ATP. These results suggest that K-252a interacts at the ATP-binding domain of myosin light chain kinase
Operational safety at the radiometallurgy laboratory of Fontenay-aux-Roses
International Nuclear Information System (INIS)
Hayet, Lucien; Petit, Pierre; Conche, Roger.
1976-01-01
Opened in 1967, the Radiometallurgy Laboratory is responsible for the examination of plutonium 239 based nuclear fuels of breeder reactors such as Rapsodie and Phenix. Part of the same laboratory is also responsible for the manufacture of californium 252 sources. These neutron sources can have a neutron fluency yield of 2,3 10 10 n/s/4π (i.e. 10mg of 252cf). This large laboratory includes a total area of 117m 2 of hot surfaces. It also includes 14 high activity cells with a capacity of 100000Ci at 1MeV. Located only 7km from the center of Paris, it must incorporate a special design and a particularly sure safety policy. Several statistics are given: irradiations, contaminations, incidents, quantity of fissile material, solid and liquid wastes etc... The principles of safety management are outlined and an analysis given of this basic nuclear facility [fr
Rogers, Kevin; Milnes, John; Gormally, John
1993-02-01
Laser desorption/laser ionization time-of-flight mass spectra of caffeine, theophylline, theobromine and xanthine are reported. These mass spectra are compared with published spectra obtained using electron impact ionization. Mass spectra of caffeine and theophylline obtained by IR laser desorption from thin layer chromatography plates are also described. The laser desorption of materials from thin layer chromatography plates is discussed.
Radiation ulcers in patients with cancer of the tongue after /sup 252/Cf therapy
Energy Technology Data Exchange (ETDEWEB)
Galantseva, G.F.; Guseva, L.I.; Plichko, V.I. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)
1984-01-01
Interstitial therapy with /sup 252/Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with /sup 252/Cf doesn't differ sufficiently from the course of radiation injuries, occurring after ..gamma..-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with /sup 252/Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongue ulcers after interstitial therapy with /sup 252/Cf.
48 CFR 252.245-7000 - Government-furnished mapping, charting, and geodesy property.
2010-10-01
... mapping, charting, and geodesy property. 252.245-7000 Section 252.245-7000 Federal Acquisition Regulations..., charting, and geodesy property. As prescribed in 245.107-70, use the following clause: Government-Furnished Mapping, Charting, and Geodesy Property (DEC 1991) (a) Definition—Mapping, charting, and geodesy (MC&G...
48 CFR 53.236-2 - Architect-engineer services (SF's 252 and 330).
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Architect-engineer... ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.236-2 Architect-engineer...-engineer and related services: (a) SF 252 (Rev. 10/83), Architect-Engineer Contract. SF 252 is prescribed...
Radionuclide 252Cf neutron source
International Nuclear Information System (INIS)
Kolevatov, Yu.I.; Trykov, L.A.
1979-01-01
Characteristics of radionuclide neutron sourses of 252 Cf base with the activity from 10 6 to 10 9 n/s have been investigated. Energetic distributions of neutrons and gamma-radiation have been presented. The results obtained have been compared with other data available. The hardness parameter of the neutron spectrum for the energy range from 3 to 15 MeV is 1.4 +- 0.02 MeV
Energy Technology Data Exchange (ETDEWEB)
Wang, Guohui
2008-07-01
Understanding sorption/desorption is an important prerequisite for the prediction of fate and transport of pollutants in the environment. During the last two decades, numerous studies have reported hysteresis phenomenon for the interaction of hydrophobic organic contaminants (HOCs) with natural organic matter (NOM). It manifests as nonsingular sorption/desorption isotherms or different rates for sorption and desorption, where during desorption a higher affinity of a compound on a given sorbent and a longer time scale for release than for sorption is observed. Other studies showed that some of the reported sorption/desorption hysteresis phenomena are due to experimental artifacts, mainly resulting from non-attainment of sorption equilibrium before desorption experiments, which result in 'pseudo-hysteresis'. Except for the hypothesis of sorbent reconfiguration, clear experimental evidence for the physical or chemical mechanisms proposed to lead to hysteresis is still lacking. In this study, sorption/desorption equilibrium and kinetics of phenanthrene sorption/desorption from two soils and three carbonaceous samples were investigated using both batch and column techniques. The main objective of this work was to monitor hysteresis phenomenon by carefully recovering the solute mass in the system and to compare sorption/desorption equilibria and kinetics thermodynamically. Nonsingular isotherms and higher desorption enthalpies as well as increased activation energies with proceeding desorption are expected if significant hysteresis exists. Sorption-desorption cycles were carried out to compare equilibrium isotherms and associated sorption/desorption enthalpies (AeH, isosteric heats). Instead of the traditional decant-and-refill batch method, the experiments were conducted using a newly designed batch protocol, which enables the determination of sorption/desorption isotherms at different temperatures using a closed batch system. This method additionally allows
Energy Technology Data Exchange (ETDEWEB)
Wang, Guohui
2008-07-01
Understanding sorption/desorption is an important prerequisite for the prediction of fate and transport of pollutants in the environment. During the last two decades, numerous studies have reported hysteresis phenomenon for the interaction of hydrophobic organic contaminants (HOCs) with natural organic matter (NOM). It manifests as nonsingular sorption/desorption isotherms or different rates for sorption and desorption, where during desorption a higher affinity of a compound on a given sorbent and a longer time scale for release than for sorption is observed. Other studies showed that some of the reported sorption/desorption hysteresis phenomena are due to experimental artifacts, mainly resulting from non-attainment of sorption equilibrium before desorption experiments, which result in 'pseudo-hysteresis'. Except for the hypothesis of sorbent reconfiguration, clear experimental evidence for the physical or chemical mechanisms proposed to lead to hysteresis is still lacking. In this study, sorption/desorption equilibrium and kinetics of phenanthrene sorption/desorption from two soils and three carbonaceous samples were investigated using both batch and column techniques. The main objective of this work was to monitor hysteresis phenomenon by carefully recovering the solute mass in the system and to compare sorption/desorption equilibria and kinetics thermodynamically. Nonsingular isotherms and higher desorption enthalpies as well as increased activation energies with proceeding desorption are expected if significant hysteresis exists. Sorption-desorption cycles were carried out to compare equilibrium isotherms and associated sorption/desorption enthalpies (AeH, isosteric heats). Instead of the traditional decant-and-refill batch method, the experiments were conducted using a newly designed batch protocol, which enables the determination of sorption/desorption isotherms at different temperatures using a closed batch system. This method additionally allows the
Desorption Kinetics and Mechanisms of CO2 on Amine-Based Mesoporous Silica Materials
Directory of Open Access Journals (Sweden)
Yang Teng
2017-01-01
Full Text Available Tetraethylenepentamine (TEPA-based mesoporous MCM-41 is used as the adsorbent to determine the CO2 desorption kinetics of amine-modified materials after adsorption. The experimental data of CO2 desorption as a function of time are derived by zero-length column at different temperatures (35, 50, and 70 °C and analyzed by Avrami’s fractional-order kinetic model. A new method is used to distinguish the physical desorption and chemical desorption performance of surface-modified mesoporous MCM-41. The activation energy Ea of CO2 physical desorption and chemical desorption calculated from Arrhenius equation are 15.86 kJ/mol and 57.15 kJ/mol, respectively. Furthermore, intraparticle diffusion and Boyd’s film models are selected to investigate the mechanism of CO2 desorption from MCM-41 and surface-modified MCM-41. For MCM-41, there are three rate-limiting steps during the desorption process. Film diffusion is more prominent for the CO2 desorption rates at low temperatures, and pore diffusion mainly governs the rate-limiting process under higher temperatures. Besides the surface reaction, the desorption process contains four rate-limiting steps on surface-modified MCM-41.
A pneumatic transfer system for special form 252Cf
International Nuclear Information System (INIS)
Gehrke, R.J.; Berry, S.M.; Grafwallner, E.G.; Hoggan, J.M.
1996-09-01
A pneumatic transfer system has been developed for use with series 100 Special Form 252 Cf. It was developed to reduce the exposure to personnel handling sources of 252 Cf with masses up to 150 microg by permitting remotely activated two-way transfer between the storage container and the irradiation position. The pneumatic transfer system also permits transfers for reproducible repetitive irradiation periods. In addition to the storage container equipped with quick-release fittings, the transfer system consists of an irradiation station, a control box with momentary contact switches to activate the air-pressure control valves and indicators to identify the location of the source, and connecting air hose and electrical wire. A source of 20 psig air and 110 volt electrical power are required for operation of the transfer system which can be easily moved and set up by one individual in 5 to 10 minutes. Tests have shown that rarely does a source become lodged in the transfer tubing, but two methods have been developed to handle incomplete transfers of the 252 Cf source. The first method consists of closing one air vent to allow a pressure impulse to propel the source to the opposite side. The second method applies to those 252 Cf capsules with a threaded or tapped end to which a small ferromagnetic piece can be attached; an incompletely transferred source in the transfer tube can then be guided to a position of safety by surrounding the transfer tubing containing the capsule with a horseshoe magnet attached to the end of a long pole
Neutron shielding for a {sup 252} Cf source
Energy Technology Data Exchange (ETDEWEB)
Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M. [Unidades Academicas de Estudios Nucleares e Ingenieria Electrica, Universidad Autonoma de Zacatecas, C. Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Eduardo Gallego, Alfredo Lorente [Depto. de Ingenieria Nuclear, ETS Ingenieros Industriales, Universidad Politecnica de Madrid, C. Jose Gutierrez Abascal 2, 28006 Madrid (Spain)]. e-mail: fermineutron@yahoo.com
2006-07-01
To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a {sup 252}Cf isotopic neutron source. During calculations a detailed model for the {sup 252}Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare {sup 252}Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)
Photon- and electron-stimulated desorption from laboratory models of interstellar ice grains
International Nuclear Information System (INIS)
Thrower, J. D.; Abdulgalil, A. G. M.; Collings, M. P.; McCoustra, M. R. S.; Burke, D. J.; Brown, W. A.; Dawes, A.; Holtom, P. J.; Kendall, P.; Mason, N. J.; Jamme, F.; Fraser, H. J.; Rutten, F. J. M.
2010-01-01
The nonthermal desorption of water from ice films induced by photon and low energy electron irradiation has been studied under conditions mimicking those found in dense interstellar clouds. Water desorption following photon irradiation at 250 nm relies on the presence of an absorbing species within the H 2 O ice, in this case benzene. Desorption cross sections are obtained and used to derive first order rate coefficients for the desorption processes. Kinetic modeling has been used to compare the efficiencies of these desorption mechanisms with others known to be in operation in dense clouds.
Baking and helium glow discharge cleaning of SST-1 tokamak with graphite plasma facing components
International Nuclear Information System (INIS)
Semwal, Pratibha; Khan, Ziauddin; Raval, Dilip
2015-01-01
Graphite plasma facing components (PFCs) were installed inside SST-1 vacuum vessel. Prior to installation, all the graphite tiles were baked at 1000 °C in a vacuum furnace operated below 1.0 X 10 -5 mbar. However due to the porous structure of graphite, they absorb a significant amount of water vapour from air during the installation process. Rapid desorption of water vapour requires high temperature bake-out of the PFCs at ≥ 250 °C. In SST-1 the PFCs were baked at 250 °C using hot nitrogen gas facility to remove the absorbed water vapour. Also device with large graphite surface area has the disadvantage that a large quantity of hydrogen gets trapped inside it during plasma discharges which makes density control difficult. Helium (He) glow discharge cleaning (GDC) effectively removes this stored hydrogen as well as other impurities like oxygen and hydrocarbon within few nanometers from the surface by particle induced desorption. Before plasma operation in SST-1 tokamak, both baking of PFCs and He-GDC were carried out so that these impurities were removed effectively. The mean desorption yield of hydrogen was found to be 0.48. In this paper, the results of effect of baking and He-GDC experiments of SST-1 will be presented in detail. (author)
Baking and helium glow discharge cleaning of SST-1 Tokamak with graphite plasma facing components
Semwal, P.; Khan, Z.; Raval, D. C.; Dhanani, K. R.; George, S.; Paravastu, Y.; Prakash, A.; Thankey, P.; Ramesh, G.; Khan, M. S.; Saikia, P.; Pradhan, S.
2017-04-01
Graphite plasma facing components (PFCs) were installed inside the SST-1 vacuum vessel. Prior to installation, all the graphite tiles were baked at 1000 °C in a vacuum furnace operated below 1.0 × 10-5 mbar. However due to the porous structure of graphite, they absorb a significant amount of water vapour from air during the installation process. Rapid desorption of this water vapour requires high temperature bake-out of the PFCs at ≥ 250 °C. In SST-1 the PFCs were baked at 250 °C using hot nitrogen gas facility to remove the absorbed water vapour. Also device with large graphite surface area has the disadvantage that a large quantity of hydrogen gets trapped inside it during plasma discharges which makes density control difficult. Helium glow discharge cleaning (He-GDC) effectively removes this stored hydrogen as well as other impurities like oxygen and hydrocarbon within few nano-meters from the surface by particle induced desorption. Before plasma operation in SST-1 tokamak, both baking of PFCs and He-GDC were carried out so that these impurities were removed effectively. The mean desorption yield of hydrogen was found to be 0.24. In this paper the results of baking and He-GDC experiments of SST-1 will be presented in detail.
Defect annealing and thermal desorption of deuterium in low dose HFIR neutron-irradiated tungsten
International Nuclear Information System (INIS)
Shimada, Masashi; Hara, Masanori; Otsuka, Teppei; Oya, Yasuhisa; Hatano, Yuji
2015-01-01
Three tungsten samples irradiated at High Flux Isotope Reactor at Oak Ridge National Laboratory were exposed to deuterium plasma (ion fluence of 1 × 10 26 m −2 ) at three different temperatures (100, 200, and 500 °C) in Tritium Plasma Experiment at Idaho National Laboratory. Subsequently, thermal desorption spectroscopy was performed with a ramp rate of 10 °C min −1 up to 900 °C, and the samples were annealed at 900 °C for 0.5 h. These procedures were repeated three times to uncover defect-annealing effects on deuterium retention. The results show that deuterium retention decreases approximately 70% for at 500 °C after each annealing, and radiation damages were not annealed out completely even after the 3rd annealing. TMAP modeling revealed the trap concentration decreases approximately 80% after each annealing at 900 °C for 0.5 h
Defect annealing and thermal desorption of deuterium in low dose HFIR neutron-irradiated tungsten
Shimada, Masashi; Hara, Masanori; Otsuka, Teppei; Oya, Yasuhisa; Hatano, Yuji
2015-08-01
Three tungsten samples irradiated at High Flux Isotope Reactor at Oak Ridge National Laboratory were exposed to deuterium plasma (ion fluence of 1 × 1026 m-2) at three different temperatures (100, 200, and 500 °C) in Tritium Plasma Experiment at Idaho National Laboratory. Subsequently, thermal desorption spectroscopy was performed with a ramp rate of 10 °C min-1 up to 900 °C, and the samples were annealed at 900 °C for 0.5 h. These procedures were repeated three times to uncover defect-annealing effects on deuterium retention. The results show that deuterium retention decreases approximately 70% for at 500 °C after each annealing, and radiation damages were not annealed out completely even after the 3rd annealing. TMAP modeling revealed the trap concentration decreases approximately 80% after each annealing at 900 °C for 0.5 h.
Defect annealing and thermal desorption of deuterium in low dose HFIR neutron-irradiated tungsten
Energy Technology Data Exchange (ETDEWEB)
Shimada, Masashi, E-mail: Masashi.Shimada@inl.gov [Fusion Safety Program, Idaho National Laboratory, Idaho Falls, ID (United States); Hara, Masanori [Hydrogen Isotope Research Center, University of Toyama, Toyama (Japan); Otsuka, Teppei [Kyushu University, Interdisciplinary Graduate School of Engineering Science, Higashi-ku, Fukuoka (Japan); Oya, Yasuhisa [Radioscience Research Laboratory, Faculty of Science, Shizuoka University, Shizuoka (Japan); Hatano, Yuji [Hydrogen Isotope Research Center, University of Toyama, Toyama (Japan)
2015-08-15
Three tungsten samples irradiated at High Flux Isotope Reactor at Oak Ridge National Laboratory were exposed to deuterium plasma (ion fluence of 1 × 10{sup 26} m{sup −2}) at three different temperatures (100, 200, and 500 °C) in Tritium Plasma Experiment at Idaho National Laboratory. Subsequently, thermal desorption spectroscopy was performed with a ramp rate of 10 °C min{sup −1} up to 900 °C, and the samples were annealed at 900 °C for 0.5 h. These procedures were repeated three times to uncover defect-annealing effects on deuterium retention. The results show that deuterium retention decreases approximately 70% for at 500 °C after each annealing, and radiation damages were not annealed out completely even after the 3rd annealing. TMAP modeling revealed the trap concentration decreases approximately 80% after each annealing at 900 °C for 0.5 h.
Desorption dynamics of deuterium in CuCrZr alloy
Thi Nguyen, Lan Anh; Lee, Sanghwa; Noh, S. J.; Lee, S. K.; Park, M. C.; Shu, Wataru; Pitcher, Spencer; Torcy, David; Guillermain, David; Kim, Jaeyong
2017-12-01
Desorption behavior of deuterium (D2) in CuCrZr alloy was investigated considering sample thickness, loading and baking temperature of deuterium followed by the ITER scopes. Cylindrical specimens of 1, 3, 5 mm thick with 4 mm diameter were exposed to deuterium at a pressure of 25 bar at 120, 240 and 350 °C for 24 h, then baked at 800 °C in a vacuum chamber maintained at a pressure lower than 10-7 Torr. Deuterium desorption characteristics such as desorption rate and amount of deuterium in the sample were estimated by analyzing the desorption peaks monitored with a residual gas analyzer (RGA), and the trapping energy of deuterium was calculated using thermal desorption spectroscopy (TDS). Secondary ion mass spectroscopy (SIMS) results showed that deuterium atoms embedded in the sample at a depth of less than 15 μm and desorbed as low as 400 °C. All absorbed deuterium atoms in the specimen were completely retrieved by dynamic pumping at 800 °C in 15 min. The desorption rate of deuterium per unit area was inversely proportional to the increment of the thickness of the sample, and was proportional to the loading temperature. Based on the assumption that a uniform distribution of interstitial sites for deuterium follows the Femi-Dirac statistics, the result of TDS demonstrated that the CuCrZr alloy has two types of trapping energies, which were estimated to be 62 and 79 kJ/mol.
Sorption-desorption behavior of polybrominated diphenyl ethers in soils
International Nuclear Information System (INIS)
Olshansky, Yaniv; Polubesova, Tamara; Vetter, Walter; Chefetz, Benny
2011-01-01
Polybrominated diphenyl ethers (PBDEs) are flame retardants that are commonly found in commercial and household products. These compounds are considered persistent organic pollutants. In this study, we used 4,4'-dibromodiphenyl ether (BDE-15) as a model compound to elucidate the sorption and desorption behavior of PBDEs in soils. The organic carbon-normalized sorption coefficient (K OC ) of BDE-15 was more than three times higher for humin than for bulk soils. However, pronounced desorption hysteresis was obtained mainly for bulk soils. For humin, increasing concentration of sorbed BDE-15 resulted in decreased desorption. Our data illustrate that BDE-15 and probably other PBDEs exhibit high sorption affinity to soils. Moreover, sorption is irreversible and thus PBDEs can potentially accumulate in the topsoil layer. We also suggest that although humin is probably a major sorbent for PBDEs in soils, other humic materials are also responsible for their sequestration. - Highlights: → BDE-15 exhibited pronounced desorption hysteresis. → BDE-15 sowed higher sorption affinity to humin as compared to the bulk soils. → Sequestration of PBDEs depends on soil organic matter constitutes other than humin. - Pronounced desorption hysteresis was observed for BDE-15 in natural soils.
Dust vortices, clouds, and jets in nuclear-induced plasmas
International Nuclear Information System (INIS)
Vladimirov, V.I.; Deputatova, L.V.; Nefedov, A.P.; Fortov, V.E.; Rykov, V.A.; Khudyakov, A.V.
2001-01-01
The collective movement of dust particles in a plasma formed during deceleration of decay products of californium nuclei in neon is investigated experimentally. For the first time, compact vortex structures containing a large number of coagulating dust particles and dense dust clouds evolving in time are observed. Dust formations have clearly defined boundaries and particles in them form ordered liquid-type structures. Under steady-state conditions, dust structures exist from several minutes to hours. An increase in the voltage applied to the high-voltage electrode leads to the formation of dust particle jets. A change in the electric field configuration transforms the structures from one type to another. A strong recombination of electrons and ions at dust particles is observed. The momentum transfer from ions drifting in an external field to gas molecules is studied using the Monte Carlo method. It is shown that the transferred momentum is so large that it may cause a gas flow. The characteristic features of vortex flow in neon and in air are explained
Study on Energetic Ions Behavior in Plasma Facing Materials at Lower Temperature
International Nuclear Information System (INIS)
Morimoto, Y.; Sugiyama, T.; Akahori, S.; Kodama, H.; Tega, E.; Sasaki, M.; Oyaidu, M.; Kimura, H.; Okuno, K.
2003-01-01
An apparatus equipped with X-ray Photoelectron Spectroscopy (XPS) and Thermal Desorption Spectroscopy (TDS) was constructed to study interactions of energetic hydrogen isotopes with plasma facing materials. It is a remarkable feature of the apparatus that energetic ion implantation is carried out at around 150K to study reactions of energetic ions with matrix by suppressing the reactions of thermalized ions. Using this apparatus, TDS experiments for pyrolytic graphite implanted with energetic D 2 ions at 173 and 373K were carried out. The experimental results suggest that the deuterium implanted was released through a four-step release processes, involving three D 2 and one CD x (x = 2, 3 and 4) desorption processes. Two deuterium and CD x desorption processes were observed in the temperature range from 700 to 1200 K. In addition, a new deuterium desorption process was observed for the deuterium-implanted sample at 173 K. This has never been observed for deuterium-implanted graphite implanted at temperatures higher than room temperature
Treating high-mercury-containing lamps using full-scale thermal desorption technology.
Chang, T C; You, S J; Yu, B S; Chen, C M; Chiu, Y C
2009-03-15
The mercury content in high-mercury-containing lamps are always between 400 mg/kg and 200,000 mg/kg. This concentration is much higher than the 260 mg/kg lower boundary recommended for the thermal desorption process suggested by the US Resource Conservation and Recovery Act. According to a Taiwan EPA survey, about 4,833,000 cold cathode fluorescent lamps (CCFLs), 486,000 ultraviolet lamps and 25,000 super high pressure mercury lamps (SHPs) have been disposed of in the industrial waste treatment system, producing 80, 92 and 9 kg-mercury/year through domestic treatment, offshore treatment and air emissions, respectively. To deal with this problem we set up a full-scale thermal desorption process to treat and recover the mercury from SHPs, fluorescent tube tailpipes, fluorescent tubes containing mercury-fluorescent powder, and CCFLs containing mercury-fluorescent powder and monitor the use of different pre-heating temperatures and desorption times. The experimental results reveal that the average thermal desorption efficiency of SHPs and fluorescent tube tailpipe were both 99.95%, while the average thermal desorption efficiencies of fluorescent tubes containing mercury-fluorescent powder were between 97% and 99%. In addition, a thermal desorption efficiency of only 69.37-93.39% was obtained after treating the CCFLs containing mercury-fluorescent powder. These differences in thermal desorption efficiency might be due to the complexity of the mercury compounds contained in the lamps. In general, the thermal desorption efficiency of lamps containing mercury-complex compounds increased with higher temperatures.
Exciton-Promoted Desorption From Solid Water Surfaces A2
DEFF Research Database (Denmark)
McCoustra, M.R.S.; Thrower, J.D.
2018-01-01
Abstract Desorption from solid water surfaces resulting from interaction with electromagnetic and particle radiation is reviewed in the context of the role of nonthermal desorption in astrophysical environments. Experimental observations are interpreted in terms of mechanisms sharing a common basis...
24 CFR 252.2 - GNMA right to assignment.
2010-04-01
... COINSURANCE OF MORTGAGES COVERING NURSING HOMES, INTERMEDIATE CARE FACILITIES, AND BOARD AND CARE HOMES § 252... section, in order to allow an appropriate endorsement and necessary changes in the Commissioner's records...
Impact of neutron irradiation on thermal helium desorption from iron
Energy Technology Data Exchange (ETDEWEB)
Hu, Xunxiang, E-mail: hux1@ornl.gov [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Field, Kevin G. [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Taller, Stephen [University of Michigan, Ann Arbor, MI 48109 (United States); Katoh, Yutai [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Wirth, Brian D. [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); University of Tennessee, Knoxville, TN 37996 (United States)
2017-06-15
The synergistic effect of neutron irradiation and transmutant helium production is an important concern for the application of iron-based alloys as structural materials in fission and fusion reactors. In this study, we investigated the impact of neutron irradiation on thermal helium desorption behavior in high purity iron. Single crystalline and polycrystalline iron samples were neutron irradiated in HFIR to 5 dpa at 300 °C and in BOR-60 to 16.6 dpa at 386 °C, respectively. Following neutron irradiation, 10 keV He ion implantation was performed at room temperature on both samples to a fluence of 7 × 10{sup 18} He/m{sup 2}. Thermal desorption spectrometry (TDS) was conducted to assess the helium diffusion and clustering kinetics by analyzing the desorption spectra. The comparison of He desorption spectra between unirradiated and neutron irradiated samples showed that the major He desorption peaks shift to higher temperatures for the neutron-irradiated iron samples, implying that strong trapping sites for He were produced during neutron irradiation, which appeared to be nm-sized cavities through TEM examination. The underlying mechanisms controlling the helium trapping and desorption behavior were deduced by assessing changes in the microstructure, as characterized by TEM, of the neutron irradiated samples before and after TDS measurements.
Rotation and Morphology of Comet 252P/LINEAR
Woodney, Laura; Schambeau, Charles A.; Fernandez, Yanga R.
2017-10-01
Comet 252P/LINEAR had an incredibly close approach early in 2016 - minimum distance 0.036 AU on March 21 - that allowed detailed investigation of its behavior. Analysis of observations of the morphology of 252P have resulted in several possible rotational periods. Knight and Schleicher found that repetition of features in narrowband imaging from April 2016 indicated a period of 7.35 +/- 0.05 hr [1]. HST broadband data obtained by Li et al. in March and April partially fit the 7.35 hr period, but found 5.5 hr was a better fit for the April 4 r’ band data [2]. Given this discrepancy, additional observations may shed light on the true rotation state, and we present here the pieces of the puzzle obtained by our group.We observed 252P with the Kitt Peak National Observatory WIYN 0.9 m telescope on 7 nights: May 2 - 5 and June 6,8,9, 2016 using a Harris R filter. An oscillating jet is clearly visible in our data. While there is insufficient phase coverage to determine a best fit period from our data alone, we will present how our observations of the morphology fit the two proposed periods.[1] Knight, M.M and D.G. Schleicher. AAS, DPS Meeting #48, id.207.02, 2016 [2] Li, J.-Y. et al. AAS, DPS Meeting #48, id. 206.03, 2016.
Ionic Adsorption and Desorption of CNT Nanoropes
Directory of Open Access Journals (Sweden)
Jun-Jun Shang
2016-09-01
Full Text Available A nanorope is comprised of several carbon nanotubes (CNTs with different chiralities. A molecular dynamic model is built to investigate the ionic adsorption and desorption of the CNT nanoropes. The charge distribution on the nanorope is obtained by using a modified gradient method based on classical electrostatic theory. The electrostatic interactions among charged carbon atoms are calculated by using the Coulomb law. It was found here that the charged nanorope can adsorb heavy metal ions, and the adsorption and desorption can be realized by controlling the strength of applied electric field. The distance between the ions and the nanorope as well as the amount of ions have an effect on the adsorption capacity of the nanorope. The desorption process takes less time than that of adsorption. The study indicates that the CNT nanorope can be used as a core element of devices for sewage treatment.
Phenotype abnormality: 252 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available lant flowering stage in environment of short day length regimen in environment of short day length regimen h... 252 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u758i delayed whole p
Investigations into ultraviolet matrix-assisted laser desorption
Energy Technology Data Exchange (ETDEWEB)
Heise, Theodore W. [Iowa State Univ., Ames, IA (United States)
1993-07-01
Matrix-assisted laser desorption (MALD) is a technique for converting large biomolecules into gas phase ions. Some characteristics of the commonly used uv matrices are determined. Solubilities in methanol range from 0.1 to 0.5 M. Solid phase absorption spectra are found to be similar to solution, but slightly red-shifted. Acoustic and quartz crystal microbalance signals are investigated as possible means of uv-MALD quantitation. Evidence for the existence of desorption thresholds is presented. Threshold values are determined to be in the range of 2 to 3 MW/cm2. A transient imaging technique based on laser-excited fluorescence for monitoring MALD plumes is described. Sensitivity is well within the levels required for studying matrix-assisted laser desorption, where analyte concentrations are significantly lower than those in conventional laser desorption. Results showing the effect of film morphology, particularly film thickness, on plume dynamics are presented. In particular, MALD plumes from thicker films tend to exhibit higher axial velocities. Fluorescent labeling of protein and of DNA is used to allow imaging of their uv-MALD generated plumes. Integrated concentrations are available with respect to time, making it possible to assess the rate of fragmentation. The spatial and temporal distributions are important for the design of secondary ionization schemes to enhance ion yields and for the optimization of ion collection in time-of-flight MS instruments to maximize resolution. Such information could also provide insight into whether ionization is closely associated with the desorption step or whether it is a result of subsequent collisions with the matrix gas (e.g., proton transfer). Although the present study involves plumes in a normal atmosphere, adaptation to measurements in vacuum (e.g., inside a mass spectrometer) should be straightforward.
Various causes behind the desorption hysteresis of carboxylic acids on mudstones.
Rasamimanana, S; Lefèvre, G; Dagnelie, R V H
2017-02-01
Adsorption desorption is a key factor for leaching, migration and (bio)degradation of organic pollutants in soils and sediments. Desorption hysteresis of apolar organic compounds is known to be correlated with adsorption/diffusion into soil organic matter. This work focuses on the desorption hysteresis of polar organic compounds on a natural mudstone sample. Acetic, citric and ortho-phthalic acids displayed adsorption-desorption hysteresis on Callovo-Oxfordian mudstone. The non-reversible behaviours resulted from three different mechanisms. Adsorption and desorption kinetics were evaluated using 14C- and 3H-labelled tracers and an isotopic exchange method. The solid-liquid distribution ratio of acetate decreased using a NaN 3 bactericide, indicating a rapid bacterial consumption compared with negligible adsorption. The desorption hysteresis of phthalate was apparent and suppressed by the equilibration of renewal pore water with mudstone. This confirms the significant and reversible adsorption of phthalate. Finally, persistent desorption hysteresis was evidenced for citrate. In this case, a third mechanism should be considered, such as the incorporation of citrate in the solid or a chemical perturbation, leading to strong desorption resilience. The results highlighted the different pathways that polar organic pollutants might encounter in a similar environment. Data on phthalic acid is useful to predict the retarded transport of phthalate esters and amines degradation products in sediments. The behaviour of citric acid is representative of polydentate chelating agents used in ore and remediation industries. The impact of irreversible adsorption on solid/solution partitioning and transport deserves further investigation. Copyright © 2016 Elsevier Ltd. All rights reserved.
The significance of chromosome deletions in atomic-bomb survivors
International Nuclear Information System (INIS)
Tanaka, Kimio; Shigeta, Chiharu; Oguma, Nobuo; Kamada, Nanao; Deng, Z.; Niimi, Masanobu; Aisaka, Tadaichi.
1986-01-01
In 39 A-bomb survivors 40 years after exposure at ≤ 1,000 m from ground zero, the frequency and features of chromosome deletions in peripheral lymphocytes were examined using a differential staining technique. Simultaneously, in vitro irradiation experiment with Cf-252 was made to infer chromosome aberrations occuring immediately after exposure. Californium-252 with 100 rad induced dicentric and ring chromosomes in 40 % of the cells and acentric fragments in 44 %. Among the A-bomb survivors, chromosome aberrations were observed in 651 (21 %) of the total 3,136 cells. There were 146 cells with deletions (22 % of abnormal cells; 5 % of the total cells), and 10 cells with acentric fragment (0.3 % of the total cells). The figure for deletions was far higher than that reported in the literature. A large number of deletions were seen in chromosomes no.4, no.21, and no.22, and a few deletions in chromosomes no.7 and no.20. Significance of chromosome deletions is discussed. (Namekawa, K.)
International Nuclear Information System (INIS)
Woodbury, F.B.W.
1980-12-01
The Bureau of Mines is evaluating alternative technologies to treat oxidized taconites. Since process control is an essential element in the application of these process technologies, research was performed on a prototype monitoring system utilizing a californium-252 (252-Cf) neutron source and a thermal neutron capture-gamma ray spectra analysis method to measure the amount of iron and percent solids in process slurries. The prototype system was used to monitor the concentrate and tailing streams in a 900-lb/hr flotation pilot plant during continuous around-the-clock tests. The iron content of the process slurries was determined by measuring the total peak areas under the capture spectrum peaks at 7.626-7.632 MeV, the associated escape peaks at 7.136-7.122 and 6.626-6.612 MeV, and the iron doublets at 4.900 and 4.998 MeV. A potential method for determining the percent solids in process slurries using the 2.22 MeV hydrogen capture peak is discussed
General purpose nuclear irradiation chamber
International Nuclear Information System (INIS)
Nurul Fadzlin Hasbullah; Nuurul Iffah Che Omar; Nahrul Khair Alang Md Rashid; Jaafar Abdullah
2013-01-01
Nuclear technology has found a great need for use in medicine, industry, and research. Smoke detectors in our homes, medical treatments and new varieties of plants by irradiating its seeds are just a few examples of the benefits of nuclear technology. Portable neutron source such as Californium-252, available at Industrial Technology Division (BTI/ PAT), Malaysian Nuclear Agency, has a 2.645 year half-life. However, 252 Cf is known to emit gamma radiation from the source. Thus, this chamber aims to provide a proper gamma shielding for samples to distinguish the use of mixed neutron with gamma-rays or pure neutron radiation. The chamber is compatible to be used with other portable neutron sources such as 241 Am-Be as well as the reactor TRIGA PUSPATI for higher neutron dose. This chamber was designed through a collaborative effort of Kulliyyah Engineering, IIUM with the Industrial Technology Division (BTI) team, Malaysian Nuclear Agency. (Author)
Adsorption and desorption of radioactive inert gases in various materials
International Nuclear Information System (INIS)
Butkus, D.
1999-01-01
Peculiarities of the 85 Kr and 133 Xe adsorption and desorption processes in active carbon and paraffin are considered in the work. During the desorption process, the distribution of 85 Kr and 133 Xe atoms in active carbon particles is uneven: atoms in narrow micropores desorb the last. It is shown that by changing adsorption conditions the presence time of radioactive inert gases in an active carbon can be prolonged. The adsorption and desorption processes change in the adsorbent, which changes its aggregation state: adsorption occurs in a liquid absorbent and desorption - in a solid absorbent. Paraffin is just such an absorbent changing its aggregation state with low energy losses. It has been obtained that 133 Xe accumulates less in liquid paraffin that in an active carbon. The absorption of 85 Kr in paraffin is larger than in an active carbon (at 18-20 degrees Celsius), while desorption is slower. The velocity of radioactive inert gas atom motion in different places of a solid paraffin sample is different - it increases approaching the borders of the sample. Prolongation of the desorption time of radioactive inert gases from adsorbents and adsorbents in many cases is of a practical importance. In this work, it has been shown by model experiments that the intensity of adsorption and desorption processes for the same sorbents can be changed. Desorption intensity changes are related to the distribution of gas atoms on the surface of particles and in micropores. Desorption velocity decreases if inert gas atoms having entered micropores are 'closed' by condensed liquids in the environment. In this case an inert gas atom diffuses within the whole particle volume or through the condensed liquid. Radioactive inert gases 85 Kr and 133 Xe are absorbed not only in liquid paraffin but in solid one as well. Therefore, after a paraffin sample is hermetically closed in a glass dish, 85 Kr (gas) having diffused from this sample is repeatedly absorbed in it. The 85 Kr
Acoustic emission during hydrogen absorption and desorption in palladium
International Nuclear Information System (INIS)
Ramesh, R.; Mukhopadhyay, C.K.; Jayakumar, T.; Baldev Raj
1996-01-01
Acoustic emission technique has been used to study charging and discharging of hydrogen in palladium. During charging, breaking of oxide film due to surface activation and saturation of hydrogen absorption have been identified by acoustic emission. In the discharging cycle, the desorption of hydrogen from the specimen leads to high AE activity immediately after initiation of discharging, followed by gradual decrease in the acoustic activity, which reaches a minimum upon completion of the desorption. The potential of the acoustic emission technique for studying the kinetics of hydrogen absorption and desorption in metals has been shown. (author)
Desorption of large organic molecules by laser-induced plasmon excitation
International Nuclear Information System (INIS)
Lee, I.; Callcott, T.A.
1991-01-01
Ejection of large organic molecules from surfaces by laser-induced electronic-excited desorption has attracted considerable interest in recent years. In addition to the importance of this effect for fundamental investigations of the ejection process, this desorption technique has been applied to the study of large, fragile molecules by mass spectrometry. In this paper, we present a new method to induce electronic excitation on the metal surface for the desorption of large organic molecules. 3 refs., 3 figs
48 CFR 252.225-7016 - Restriction on acquisition of ball and roller bearings.
2010-10-01
... of ball and roller bearings. 252.225-7016 Section 252.225-7016 Federal Acquisition Regulations System... and roller bearings. As prescribed in 225.7009-5, use the following clause: Restriction on Acquisition of Ball and Roller Bearings (MAR 2006) (a) Definitions. As used in this clause' (1) Bearing...
48 CFR 252.227-7027 - Deferred ordering of technical data or computer software.
2010-10-01
... technical data or computer software. 252.227-7027 Section 252.227-7027 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(b), use the following clause: Deferred Ordering of Technical Data or Computer Software (APR 1988) In addition to technical data or computer software...
48 CFR 252.227-7026 - Deferred delivery of technical data or computer software.
2010-10-01
... technical data or computer software. 252.227-7026 Section 252.227-7026 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(a), use the following clause: Deferred Delivery of Technical Data or Computer Software (APR 1988) The Government shall have the right to require, at...
Hydrogen desorption kinetics from zirconium hydride and zirconium metal in vacuum
International Nuclear Information System (INIS)
Hu, Xunxiang; Terrani, Kurt A.; Wirth, Brian D.
2014-01-01
The kinetics of hydrogen desorption from zirconium hydride is important in many nuclear design and safety applications. In this paper, a coordinated experimental and modeling study has been used to explicitly demonstrate the applicability of existing kinetic theories for hydrogen desorption from zirconium hydride and α-zirconium. A static synthesis method was used to produce δ-zirconium hydride, and the crystallographic phases of the zirconium hydride were confirmed by X-ray diffraction (XRD). Three obvious stages, involving δ-zirconium hydride, a two-phase region, and α-zirconium, were observed in the hydrogen desorption spectra of two zirconium hydride specimens with H/Zr ratios of 1.62 and 1.64, respectively, which were obtained using thermal desorption spectroscopy (TDS). A continuous, one-dimensional, two-phase moving boundary model, coupled with the zero- and second-order kinetics of hydrogen desorption from δ-zirconium hydride and α-zirconium, respectively, has been developed to reproduce the TDS experimental results. A comparison of the modeling predictions with the experimental results indicates that a zero-order kinetic model is valid for description of hydrogen flux away from the δ-hydride phase, and that a second-order kinetic model works well for hydrogen desorption from α-Zr if the activation energy of desorption is optimized to be 70% of the value reported in the literature
48 CFR 252.247-7017 - Erroneous shipments.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Erroneous shipments. 252... SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of..., articles of personal property inadvertently packed with goods of other than the rightful owner. (2) Ensure...
Bacterial desorption from food container and food processing surfaces.
McEldowney, S; Fletcher, M
1988-03-01
The desorption ofStaphylococcus aureus, Acinetobacter calcoaceticus, and a coryneform from the surfaces of materials used for manufacturing food containers (glass, tin plate, and polypropylene) or postprocess canning factory conveyor belts (stainless steel and nylon) was investigated. The effect of time, pH, temperature, and adsorbed organic layers on desorption was studied.S. aureus did not detach from the substrata at any pH investigated (between pH 5 and 9).A. calcoaceticus and the coryneform in some cases detached, depending upon pH and substratum composition. The degree of bacterial detachment from the substrata was not related to bacterial respiration at experimental pH values. Bacterial desorption was not affected by temperature (4-30°C) nor by an adsorbed layer of peptone and yeast extract on the substrata. The results indicate that bacterial desorption, hence bacterial removal during cleaning or their transfer via liquids flowing over colonized surfaces, is likely to vary with the surface composition and the bacterial species colonizing the surfaces.
Electron Stimulated Desorption of Condensed Gases on Cryogenic Surfaces
Tratnik, H; Hilleret, Noël
2005-01-01
In ultra-high vacuum systems outgassing from vacuum chamber walls and desorption from surface adsorbates are usually the factors which in°uence pressure and residual gas composition. In particular in beam vacuum systems of accelerators like the LHC, where surfaces are exposed to intense synchro- tron radiation and bombardment by energetic ions and electrons, properties like the molecular desorption yield or secondary electron yield can strongly in°uence the performance of the accelerator. In high-energy particle accelerators operating at liquid helium temperature, cold surfaces are exposed to the bombardment of energetic photons, electrons and ions. The gases released by the subsequent desorption are re-condensed on the cold surfaces and can be re-desorbed by the impinging electrons and ions. The equilibrium coverage reached on the surfaces exposed to the impact of energetic particles depends on the desorption yield of the condensed gases and can a®ect the operation of the accelerator by modifying th...
International Nuclear Information System (INIS)
Fabry, A.; McElroy, W.N.; Kellogg, L.S.; Lippincott, E.P.; Grundl, J.A.; Gilliam, D.M.; Hansen, G.E.
1976-01-01
This paper is intended to review and critically discuss microscopic integral cross section measurement and calculation data for fundamental reactor dosimetry benchmark neutron fields. Specifically the review covers the following fundamental benchmarks: the spontaneous californium-252 fission neutron spectrum standard field; the thermal-neutron induced uranium-235 fission neutron spectrum standard field; the (secondary) intermediate-energy standard neutron field at the center of the Mol-ΣΣ, NISUS, and ITN-ΣΣ facilities; the reference neutron field at the center of the Coupled Fast Reactor Measurement Facility; the reference neutron field at the center of the 10% enriched uranium metal, cylindrical, fast critical; the (primary) Intermediate-Energy Standard Neutron Field
Development of a transportable neutron radiography system for non-destructive tests application
International Nuclear Information System (INIS)
Silva, Ademir X. da; Crispim, Verginia R.
1999-01-01
This paper presents a study of a transportable neutron radiography system utilizing californium-252. Studies about moderation, collimation and shielding are showed. A Monte Carlo Code, MCNP3b, has been used to obtain a maximum and more homogeneous thermal neutron flux in the collimator outlet next to the image plain, and an adequate radiation shielding to attend radiological protection rules. With the presented collimator, it was possible to obtain for the thermal neutron flux, at the collimator outlet and next to the image plain, a L/D ratio 7,5, for neutron flux up to 6 X 10 -6 cm -2 .s -1 per neutron source. (author)
48 CFR 252.229-7004 - Status of contractors as a direct contractor (Spain).
2010-10-01
... direct contractor (Spain). 252.229-7004 Section 252.229-7004 Federal Acquisition Regulations System... contractor (Spain). As prescribed in 229.402-70(d), use the following clause: Status of Contractor as a Director Contractor (Spain) (JUN 1997) (a) “Direct Contractor,” as used in this clause, means an individual...
Deuterium retention and desorption behavior in an advanced reduced-activation alloy
Energy Technology Data Exchange (ETDEWEB)
Noh, S.J., E-mail: sjnoh@dankook.ac.kr [Department of Applied Physics, Dankook University, Yongin-si, Gyeonggi-do 448-701 (Korea, Republic of); Kim, H.S.; Byeon, W.J.; Shin, H.W. [Department of Applied Physics, Dankook University, Yongin-si, Gyeonggi-do 448-701 (Korea, Republic of); Lee, Cheol Eui [Department of Physics, Korea University, Seoul 136-713 (Korea, Republic of); Lee, S.K. [Nuclear Fusion Development Division, Korea Atomic Energy Research Institute, 989-111 Daedeok-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of)
2017-07-15
We present the first experimental results of the deuterium retention and desorption behavior in an advanced reduced-activation alloy (ARAA) under development in Korea. For the in-situ measurement of desorbed gases from samples immediately after irradiation, a thermal desorption spectroscopy (TDS) system clustered with an inductively coupled plasma ion source has been built. Samples were and were not irradiated with helium ions at energies of 1.4, 3.5, and 5.0 keV and then continuously irradiated with 1.7-keV deuterium ions. TDS measurements were performed in situ immediately after deuterium irradiation and after exposure to air for one week. The amount of desorbed deuterium is the largest for the sample without helium irradiation from the TDS results measured in situ immediately after irradiation. Further, the amount of desorbed deuterium is significantly lowered when the helium energy is increased to 3.5 keV with no significant changes thereafter, indicating that the layer formed by implanted helium at near or deeper than the stopping range for 1.7-keV deuterium ions effectively acts as a barrier against deuterium diffusion into the depth. Because of the strong diffusivity of deuterium into the ambient atmosphere, the amounts of desorbed deuterium are greatly reduced for the samples without helium irradiation and with 1.4-keV helium irradiation after exposure to air for one week. In addition, our deuterium results for the ARAA are also compared with the results for F82H by other authors. - Highlights: •The first result of the deuterium retention and desorption in an ARAA is presented. •The ARAA was irradiated with helium and then continuously irradiated with deuterium. •TDS measurements were performed in situ immediately after deuterium irradiation. •TDS measurements were performed after exposure to air for one week. •The effects of helium irradiation and exposure to air were investigated.
Lead sorption-desorption from organic residues.
Duarte Zaragoza, Victor M; Carrillo, Rogelio; Gutierrez Castorena, Carmen M
2011-01-01
Sorption and desorption are mechanisms involved in the reduction of metal mobility and bioavailability in organic materials. Metal release from substrates is controlled by desorption. The capacity of coffee husk and pulp residues, vermicompost and cow manure to adsorb Pb2+ was evaluated. The mechanisms involved in the sorption process were also studied. Organic materials retained high concentrations of lead (up to 36,000 mg L(-1)); however, the mechanisms of sorption varied according to the characteristics of each material: degree of decomposition, pH, cation exchange capacity and percentage of organic matter. Vermicompost and manure removed 98% of the Pb from solution. Lead precipitated in manure and vermicompost, forming lead oxide (PbO) and lead ferrite (PbFe4O7). Adsorption isotherms did not fit to the typical Freundlich and Langmuir equations. Not only specific and non-specific adsorption was observed, but also precipitation and coprecipitation. Lead desorption from vermicompost and cow manure was less than 2%. For remediation of Pb-polluted sites, the application of vermicompost and manure is recommended in places with alkaline soils because Pb precipitation can be induced, whereas coffee pulp residue is recommended for acidic soils where Pb is adsorbed.
Desorption of metals from Cetraria islandica (L. Ach. Lichen using solutions simulating acid rain
Directory of Open Access Journals (Sweden)
Čučulović Ana A.
2014-01-01
Full Text Available Desorption of metals K, Al, Ca, Mg, Fe, Ba, Zn, Mn, Cu and Sr from Cetraria islandica (L. with solutions whose composition was similar to that of acid rain, was investigated. Desorption of metals from the lichen was performed by five successive desorption processes. Solution mixtures containing H2SO4, HNO3 and H2SO4-HNO3 were used for desorption. Each solution had three different pH values: 4.61, 5.15 and 5.75, so that the desorptions were performed with nine different solutions successively five times, always using the same solution volume. The investigated metals can be divided into two groups. One group was comprised of K, Ca and Mg, which were desorbed in each of the five desorption processes at all pH values used. The second group included Al, Fe, Zn, Ba, Mn and Sr; these were not desorbed in each individual desorption and not at all pH values, whereas Cu was not desorbed at all under any circumstances. Using the logarithmic dependence of the metal content as a function of the desorption number, it was found that potassium builds two types of links and is connected with weaker links in lichen. Potassium is completely desorbed, 80% in the first desorption, and then gradually in the following desorptions. Other metals are linked with one weaker link (desorption 1-38% and with one very strong link (desorption below the metal detection limit. [Projekat Ministarstva nauke Republike Srbije, br. III43009 i br. ON 172019
Non-isothermal desorption and nucleate boiling in a water-salt droplet LiBr
Directory of Open Access Journals (Sweden)
Misyura Sergey Ya.
2018-01-01
Full Text Available Experimental data on desorption and nucleate boiling in a droplet of LiBr-water solution were obtained. An increase in salt concentration in a liquid-layer leads to a considerable decrease in the rate of desorption. The significant decrease in desorption intensity with a rise of initial mass concentration of salt has been observed. Evaporation rate of distillate droplet is constant for a long time period. At nucleate boiling of a water-salt solution of droplet several characteristic regimes occur: heating, nucleate boiling, desorption without bubble formation, formation of the solid, thin crystalline-hydrate film on the upper droplet surface, and formation of the ordered crystalline-hydrate structures during the longer time periods. For the final stage of desorption there is a big difference in desorption rate for initial salt concentration, C0, 11% and 51%. This great difference in the rate of desorption is associated with significantly more thin solution film for C0 = 11% and higher heat flux.
Baking and helium glow discharge cleaning of SST-1 Tokamak with graphite plasma facing components
International Nuclear Information System (INIS)
Semwal, P; Khan, Z; Raval, D C; Dhanani, K R; George, S; Paravastu, Y; Prakash, A; Thankey, P; Ramesh, G; Khan, M S; Saikia, P; Pradhan, S
2017-01-01
Graphite plasma facing components (PFCs) were installed inside the SST-1 vacuum vessel. Prior to installation, all the graphite tiles were baked at 1000 °C in a vacuum furnace operated below 1.0 × 10 -5 mbar. However due to the porous structure of graphite, they absorb a significant amount of water vapour from air during the installation process. Rapid desorption of this water vapour requires high temperature bake-out of the PFCs at ≥ 250 °C. In SST-1 the PFCs were baked at 250 °C using hot nitrogen gas facility to remove the absorbed water vapour. Also device with large graphite surface area has the disadvantage that a large quantity of hydrogen gets trapped inside it during plasma discharges which makes density control difficult. Helium glow discharge cleaning (He-GDC) effectively removes this stored hydrogen as well as other impurities like oxygen and hydrocarbon within few nano-meters from the surface by particle induced desorption. Before plasma operation in SST-1 tokamak, both baking of PFCs and He-GDC were carried out so that these impurities were removed effectively. The mean desorption yield of hydrogen was found to be 0.24. In this paper the results of baking and He-GDC experiments of SST-1 will be presented in detail. (paper)
48 CFR 252.237-7017 - Individual laundry.
2010-10-01
... clause: Individual Laundry (DEC 1991) (a) The Contractor shall provide laundry service under this... services. (c) Charges for individual laundry will be on a per unit bundle or a piece-rate basis. The... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Individual laundry. 252...
Energy Technology Data Exchange (ETDEWEB)
Son, H.K. [Department of Health and Environment, Kosin University, Dong Sam Dong, Young Do Gu, Busan (Korea, Republic of); Sivakumar, S., E-mail: ssivaphd@yahoo.com [Department of Bioenvironmental Energy, College of Natural Resource and Life Science, Pusan National University, Miryang-si, Gyeongsangnam-do 627-706 (Korea, Republic of); Rood, M.J. [Department of Civil and Environmental Engineering, University of Illinois, Urbana, IL (United States); Kim, B.J. [Construction Engineering Research Laboratory, U.S. Army Engineer Research and Development Center (ERDC-CERL), Champaign, IL (United States)
2016-01-15
Highlights: • We study the adsorption and desorption of VOCs by an activated carbon fiber cloth. • Desorption concentration was controlled via electrothermal heating. • The desorption rate was successfully equalized and controlled by this system. - Abstract: Adsorption is an effective means to selectively remove volatile organic compounds (VOCs) from industrial gas streams and is particularly of use for gas streams that exhibit highly variable daily concentrations of VOCs. Adsorption of such gas streams by activated carbon fiber cloths (ACFCs) and subsequent controlled desorption can provide gas streams of well-defined concentration that can then be more efficiently treated by biofiltration than streams exhibiting large variability in concentration. In this study, we passed VOC-containing gas through an ACFC vessel for adsorption and then desorption in a concentration-controlled manner via electrothermal heating. Set-point concentrations (40–900 ppm{sub v}) and superficial gas velocity (6.3–9.9 m/s) were controlled by a data acquisition and control system. The results of the average VOC desorption, desorption factor and VOC in-and-out ratio were calculated and compared for various gas set-point concentrations and superficial gas velocities. Our results reveal that desorption is strongly dependent on the set-point concentration and that the VOC desorption rate can be successfully equalized and controlled via an electrothermal adsorption system.
Sorption and desorption of diuron in Oxisol under biochar application
Petter, Fabiano André; Ferreira, Tamara Santos; Sinhorin, Adilson Paulo; Lima, Larissa Borges de; Morais, Leidimar Alves de; Pacheco, Leandro Pereira
2016-01-01
ABSTRACT The objective of this study was to verify the kinetics of sorption and desorption of diuron in an Oxisol under application of biochar. The samples were collected in a field experiment conducted in randomized design blocks consisted of 2 base fertilization levels (0 and 400 kg∙ha−1 NPK 00-20-20 fertilizer formula) and 3 doses of biochar (0, 8 and 16 Mg∙ha−1). In the evaluation of sorption and desorption, Batch Equilibrium method was used. The kinetics of sorption and desorption of diu...
Influence of surface coverage on the chemical desorption process
Energy Technology Data Exchange (ETDEWEB)
Minissale, M.; Dulieu, F., E-mail: francois.dulieu@obspm.fr [LERMA, Université de Cergy Pontoise et Observatoire de Paris, UMR 8112 du CNRS. 5, mail Gay Lussac, 95031 Cergy Pontoise (France)
2014-07-07
In cold astrophysical environments, some molecules are observed in the gas phase whereas they should have been depleted, frozen on dust grains. In order to solve this problem, astrochemists have proposed that a fraction of molecules synthesized on the surface of dust grains could desorb just after their formation. Recently the chemical desorption process has been demonstrated experimentally, but the key parameters at play have not yet been fully understood. In this article, we propose a new procedure to analyze the ratio of di-oxygen and ozone synthesized after O atoms adsorption on oxidized graphite. We demonstrate that the chemical desorption efficiency of the two reaction paths (O+O and O+O{sub 2}) is different by one order of magnitude. We show the importance of the surface coverage: for the O+O reaction, the chemical desorption efficiency is close to 80% at zero coverage and tends to zero at one monolayer coverage. The coverage dependence of O+O chemical desorption is proved by varying the amount of pre-adsorbed N{sub 2} on the substrate from 0 to 1.5 ML. Finally, we discuss the relevance of the different physical parameters that could play a role in the chemical desorption process: binding energy, enthalpy of formation, and energy transfer from the new molecule to the surface or to other adsorbates.
Sorption-desorption dynamics of radiocaesium in organic matter soils
International Nuclear Information System (INIS)
Valcke, E.; Cremers, A.
1994-01-01
A systematic study has been carried out on the radiocaesium sorption properties of 25 soils (forest, peat) covering organic matter (OM) contents in the range of 10-97%. Predictions are made for radiocaesium partitioning between micaceous Frayed Edge Sites (FES) and regular exchange sites (RES) on the basis of specific radiocaesium interception potentials of the soil and overall exchange capacity. It is shown that for soils with a very high OM content (>80%), significant fractions are present in a readily reversible form in the OM phase. In soils of low-medium OM content (<40%), only a very minor fraction is present in the OM exchange complex. Experimental findings, based on a desorption screening with a variety of desorption agents are in agreement with these predictions. On the basis of a study of sorption kinetics, some additional tools are available for identifying problem soils. In cases of very high OM content, radiocaesium adsorption is completed within hours demonstrating the involvement of the OM sites. In soils for which interception occurs in the FES, sorption continues to proceed for periods of 2-3 weeks. In conclusion, some examples are presented on radiocaesium desorption using ion exchangers as radiocaesium sinks in promoting desorption. For a peaty soil, near quantitative desorption is accomplished. For forest soils with OM contents in a range of 10-40%, fixation levels of 30-50% are demonstrated
Adsorption-desorption and leaching of pyraclostrobin in Indian soils.
Reddy, S Navakishore; Gupta, Suman; Gajbhiye, Vijay T
2013-01-01
Pyraclostrobin is a new broad-spectrum foliar applied and seed protectant fungicide of the strobilurin group. In this paper, adsorption-desorption of pyraclostrobin has been investigated in three different soils viz. Inceptisol (sandy loam, Delhi), Vertisol (sandy clay, Hyderabad) and Ultisol (sandy clay loam, Thrissur). Effect of organic matter and clay content on sorption was also studied in Inceptisol of Delhi. Leaching potential of pyraclostrobin as influenced by rainfall was studied in intact soil columns to confirm the results of adsorption-desorption studies. The adsorption studies were carried out at initial concentrations of 0.05, 0.1, 0.5, 1 and 1.5 μg mL(-1). The distribution coefficient (Kd) values in three test soils ranged from 4.91 to 18.26 indicating moderate to high adsorption. Among the three test soils, adsorption was the highest in Ultisol (Kd 18.26), followed by Vertisol (Kd 9.87) and Inceptisol (Kd 4.91). KF value was also highest for Ultisol soil (66.21), followed by Vertisol (40.88) and Inceptisol (8.59). S-type adsorption isotherms were observed in all the three test soils. Kd values in organic carbon-removed soil and clay-removed soil were 3.57 and 2.83 respectively, indicating lower adsorption than normal Inceptisol. Desorption studies were carried out at initial concentrations of 0.5, 1 and 1.5 μg mL(-1). Desorption was the greatest in Inceptisol, followed by Vertisol and Ultisol. Amounts of pyraclostrobin desorbed in three desorption cycles for different concentrations were 23.1-25.3%, 9.4-20.7% and 8.1-13.6% in Inceptisol, Vertisol and Ultisol respectively. Desorption was higher in clay fraction-removed and organic carbonremoved soils than normal Inceptisol. Desorption was slower than adsorption in all the test soils, indicating hysteresis effect (with hysteresis coefficient values varying from 0.05 to 0.20). Low values of hysteresis coefficient suggest high hysteresis effect indicating easy and strong adsorption, and slow
Adsorption and desorption dynamics of citric acid anions in soil
Oburger, E.
2011-07-26
The functional role of organic acid anions in soil has been intensively investigated, with special focus on (i) microbial respiration and soil carbon dynamics, (ii) nutrient solubilization or (iii) metal detoxification and reduction of plant metal uptake. Little is known about the interaction dynamics of organic acid anions with the soil matrix and the potential impact of adsorption and desorption processes on the functional significance of these effects. The aim of this study was to characterize experimentally the adsorption and desorption dynamics of organic acid anions in five agricultural soils differing in iron and aluminium oxide contents and using citrate as a model carboxylate. Results showed that both adsorption and desorption processes were fast in all soils, reaching a steady state within approximately 1 hour. However, for a given total soil citrate concentration (ct) the steady state was critically dependent on the starting conditions of the experiment, whether most of the citrate was initially present in solution (cl) or held on the solid phase (cs). Specifically, desorption-led processes resulted in significantly smaller steady-state solution concentrations than adsorption-led processes, indicating that hysteresis occurred. As it is not possible to distinguish between different adsorption and desorption pools in soil experimentally, a new dynamic hysteresis model that relies only on measured soil solution concentrations was developed. The model satisfactorily explained experimental data and was able to predict dynamic adsorption and desorption behaviour. To demonstrate its use, we applied the model to two relevant situations involving exudation and microbial degradation. The study highlighted the complex nature of citrate adsorption and desorption dynamics in soil. We conclude that existing models need to incorporate both temporal and hysteresis components to describe realistically the role and fate of organic acids in soil processes. © 2011 The
Desorption of absorbed iron in bean root and leaf tissues
International Nuclear Information System (INIS)
Jooste, J.H.; De Bruyn, J.A.
1979-01-01
The effect of different desorption media on the amount of absorbed Fe (from a solution of FeCl 3 in 0,5 mM CaCl 2 ) retained by leaf discs and excised root tips of bean plants was investigated. Attempts were also made to determine the effect of desorption on the intracellular distribution of Fe. Desorption in water or an FeCl 3 solution had no pronounced effect on the amount of absorbed Fe retained by either the leaf or root tissues. However, Na 2 -EDTA was able to desorb a considerable portion of the absorbed Fe, especially in root tissue. This applies to Fe absorbed from solutions of FeCl 3 and Fe-EDDHA. Desorption by the chelate removed Fe from practically all the different particulate fractions of both root and leaf tissues, but desorption following the longer absorption periods resulted in an increase in the Fe content of the 'soluble' fraction. The possibility that Na 2 -EDTA causes an increased permeability of cell membranes seems likely. The view that removal of Ca by the chelate causes this increase in permeability could not be confirmed [af
Laser desorption mass spectrometry for biomolecule detection and its applications
Winston Chen, C. H.; Sammartano, L. J.; Isola, N. R.; Allman, S. L.
2001-08-01
During the past few years, we developed and used laser desorption mass spectrometry for biomolecule detections. Matrix-assisted laser desorption/ionization (MALDI) was successfully used to detect DNA fragments with the size larger than 3000 base pairs. It was also successfully used to sequence DNA with both enzymatic and chemical degradation methods to produce DNA ladders. We also developed MALDI with fragmentation for direct DNA sequencing for short DNA probes. Since laser desorption mass spectrometry for DNA detection has the advantages of fast speed and no need of labeling, it has a great potential for molecular diagnosis for disease and person identification by DNA fingerprinting. We applied laser desorption mass spectrometry to succeed in the diagnosis of cystic fibrosis and several other nerve degenerative diseases such as Huntington's disease. We also succeeded in demonstrating DNA typing for forensic applications.
Laser desorption mass spectrometry for biomolecule detection and its applications
International Nuclear Information System (INIS)
Winston Chen, C.H.; Allman, S.L.; Sammartano, L.J.; Isola, N.R.
2001-01-01
During the past few years, we developed and used laser desorption mass spectrometry for biomolecule detections. Matrix-assisted laser desorption/ionization (MALDI) was successfully used to detect DNA fragments with the size larger than 3000 base pairs. It was also successfully used to sequence DNA with both enzymatic and chemical degradation methods to produce DNA ladders. We also developed MALDI with fragmentation for direct DNA sequencing for short DNA probes. Since laser desorption mass spectrometry for DNA detection has the advantages of fast speed and no need of labeling, it has a great potential for molecular diagnosis for disease and person identification by DNA fingerprinting. We applied laser desorption mass spectrometry to succeed in the diagnosis of cystic fibrosis and several other nerve degenerative diseases such as Huntington's disease. We also succeeded in demonstrating DNA typing for forensic applications
48 CFR 252.225-7045 - Balance of Payments Program-Construction Material Under Trade Agreements.
2010-10-01
.... Designated country means— (1) A World Trade Organization Government Procurement Agreement (WTO GPA) country... another country, has been substantially transformed in a Free Trade Agreement country into a new and... Program-Construction Material Under Trade Agreements. 252.225-7045 Section 252.225-7045 Federal...
Positron-annihilation-induced ion desorption from TiO2(110)
Tachibana, T.; Hirayama, T.; Nagashima, Y.
2014-05-01
We have investigated the positron-stimulated desorption of ions from a TiO2(110) surface. Desorbed O+ ions were detected in coincidence with the emission of annihilation γ rays. The energy dependence of the ion yields shows that the O+ ions were detected at energies much lower than the previously reported threshold for electron impact desorption corresponding to the excitation energy of Ti(3p) core electrons. These results provide evidence that core-hole creation by positron annihilation with electrons in the core levels leads to ion desorption.
Inelastic surface collisions and the desorption of massive molecular ions
Energy Technology Data Exchange (ETDEWEB)
Macfarlane, R D [Texas A and M Univ., College Station (USA). Dept. of Chemistry
1983-01-01
The interaction of high energy ions in the region of electronic stopping (1 MeV u/sup -1/) stimulates the desorption of massive molecular ions of biomolecules such as insulin. The experimental details of the measurements are given with some examples of application for analytical mass spectrometry. Studies on the role of the incident ion (accelerator beam experiments) are reviewed as well as the contribution of the matrix to the desorption-ionization process. How the electronic relaxation process couples to desorption-ionization is a central question in understanding the overall mechanism of the process.
Catalitic effect of Co on hydrogen desorption form nanostucturated magnesium hydride
Directory of Open Access Journals (Sweden)
Matović Ljiljana Lj.
2008-01-01
Full Text Available To study the influence of 3d transition metal addition on desorption kinetics of MgH2 ball milling of MgH2-Co blends was performed under Ar. Microstructural and morphological characterization, performed by XRD and SEM, show a huge correlation with thermal stability and hydrogen desorption properties investigated by DSC. A complex desorption behavior is correlated with the dispersion of the metal additive particles on hydride matrix. The activation energy for H2 desorption from MgH2-Co composite was calculated from both non-isothermal and isothermal methods to be 130 kJ/mol which means that mutually diffusion and nucleation and growth of new phase control the dehydration process.
DWH MC 252: Subsurface Oil Transport
Beegle-Krause, C. J.; Boyer, T.; Murray, D.
2010-12-01
Before reaching the ocean surface, the oil and gas released from the DWH MC 252 blowout at 1500 m moves as a buoyant plume until the trapping depth and plume transition point are reached (Zheng et al 2002). At the transition point, the oil droplets and bubbles move independently of each other, and rise at a rate related to their diameter. The oil density, droplet size distribution and currents primarily determine the distribution of the oil between: Large droplets that rise quickly and create a surface expression of the oil. Moderate size droplets that rise over the course of days, and so spread out quite differently than the surface oil, and commonly do not reach the surface in large enough quantities to create a surface sheen. These droplets separate in the currents, particularly in the strong current shear in upper 500 m currents. Very tiny droplets that rise very slowly, over the course or weeks to months, and may be removed by dissolution, biodegradation or marine snow before ever reaching the surface. Modeling and observations (Joint Analysis Group, 2010) confirm the presence of a deep layer of oil and gas between approximately 1100 and 1300 m over the release location and spreading out along the isopycnal surfaces. Later in the event, a small oxygen depression was a proxy for where oil and gas had been. The DWH MC252 well is located at intermediate depth in the Gulf of Mexico (GoM). The water mass is Antarctic Intermediate Water, which enters and exits the GoM through the Yucatan Straits. Surface influences, such as Loop Current Frontal Eddies (e.g. Berger et al 2000) can reach down to these depths, and alter the flow within De Soto Canyon. The water mass containing the deep layer of oil droplets changes depth within the GoM, but does not reach above a depth of about 900 m. There are no physical processes that could cause this deep layer of oil to reach the continental shelf or the Florida Straits. Observed and historical hydrographic data, observations
46 CFR 252.40 - Payment of subsidy.
2010-10-01
... Payment and Billing Procedures § 252.40 Payment of subsidy. (a) Submission of voucher. At the close of each calendar month, the subsidized operator may submit a voucher, and include for payment in such... submit an initial voucher and include for payment in such voucher a percentage of the ODS payable for the...
48 CFR 252.227-7005 - License term.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term. 252.227-7005..., DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And... referred to in the “License Grant” clause of this contract and any and all patents hereafter issued on...
A new facility for studying plasma interacting with flowing liquid lithium surface
International Nuclear Information System (INIS)
Cao, X.; Ou, W.; Tian, S.; Wang, C.; Zhu, Z.; Wang, J.; Gou, F.; Yang, D.; Chen, S.
2014-01-01
A new facility to study plasmas interacting with flowing liquid lithium surface was designed and is constructing in Sichuan University. The integrated setup includes the liquid lithium circulating part and linear high density plasma generator. The circulating part is consisted of main loop, on-line monitor system, lithium purification system and temperature programmed desorption system. In our group a linear high density plasma generator was built in 2012. Three coils were mounted along the vessel to produce an axial magnetic field inside. The magnetic field strength is up to 0.45 T and work continuously. Experiments on plasmas interacting with free flowing liquid lithium surface will be performed
Desorption of radioactive cesium by seawater from the suspended particles in river water.
Onodera, Masaki; Kirishima, Akira; Nagao, Seiya; Takamiya, Kouichi; Ohtsuki, Tsutomu; Akiyama, Daisuke; Sato, Nobuaki
2017-10-01
In 2011, the accident at the Fukushima-Daiichi nuclear power plant dispersed radioactive cesium throughout the environment, contaminating the land, rivers, and sea. Suspended particles containing clay minerals are the transportation medium for radioactive cesium from rivers to the ocean because cesium is strongly adsorbed between the layers of clay minerals, forming inner sphere complexes. In this study, the adsorption and desorption behaviors of radioactive cesium from suspended clay particles in river water have been investigated. The radioactive cesium adsorption and desorption experiments were performed with two kinds of suspended particulate using a batch method with 137 Cs tracers. In the cesium adsorption treatment performed before the desorption experiments, simulated river water having a total cesium concentration ([ 133+137 Cs + ] total ) of 1.3 nM (10 -9 mol/L) was used. The desorption experiments were mainly conducted at a solid-to-liquid ratio of 0.17 g/L. The desorption agents were natural seawater collected at 10 km north of the Fukushima-Daiichi nuclear power plant, artificial seawater, solutions of NaCl, KCl, NH 4 Cl, and 133 CsCl, and ultrapure water. The desorption behavior, which depends on the preloaded cesium concentration in the suspended particles, was also investigated. Based on the cesium desorption experiments using suspended particles, which contained about 1000 ng/g loaded cesium, the order of cesium desorption ratios for each desorption agent was determined as 1 M NaCl (80%) > 470 mM NaCl (65%) > 1 M KCl (30%) ≈ seawater (natural seawater and Daigo artificial seawater) > 1 M NH 4 Cl (20%) > 1 M 133 CsCl (15%) ≫ ultrapure water (2%). Moreover, an interesting result was obtained: The desorption ratio in the 470 mM NaCl solution was much higher than that in seawater, even though the Na + concentrations were identical. These results indicate that the cesium desorption mechanism is not a simple ion exchange reaction
Plasma surface functionalization and dyeing kinetics of Pan-Pmma copolymers
Labay, C.; Canal, C.; Rodríguez, C.; Caballero, G.; Canal, J.M.
2013-01-01
Fiber surface modification with air corona plasma has been studied through dyeing kinetics under isothermal conditions at 30 °C on an acrylic-fiber fabric with a cationic dye (CI Basic Blue 3) analyzing the absorption, desorption and fixing on the surface of molecules having defined cationic character. The initial dyeing rate in the first 60 s indicates an increase of 58.3% in the dyeing rate due to the effect of corona plasma on the acrylic fiber surface. At the end of the dyeing process...
48 CFR 252.225-7023 - Preference for products or services from Iraq or Afghanistan.
2010-10-01
... services from Iraq or Afghanistan. 252.225-7023 Section 252.225-7023 Federal Acquisition Regulations System... from Iraq or Afghanistan. As prescribed in 225.7703-5(a), use the following provision: Requirement for Products or Services from Iraq or Afghanistan (APR 2010) (a) Definitions. Product from Iraq or Afghanistan...
Study of the mechanisms of heavy-ion induced desorption on accelerator-relevant materials
International Nuclear Information System (INIS)
Bender, Markus
2008-01-01
The ion beam loss induced desorption is a performance limitation for low charge state heavy ion accelerators. If charge exchanged projectile ions get lost onto the beam pipe, desorption of gas is stimulated resulting in a pressure increase inside of the synchrotron and thus, a dramatically reduction of the beam life time. To minimize the amount of desorbed gas an experimental program has been started to measure the desorption yields (released gas molecules per incident ion) of various materials and different projectile ions. The present work is a contribution to the understanding of the physical processes behind the ion beam loss induced desorption. The yield measurements by the pressure rise method have been combined for the rst time with in situ ion beam analysis technologies such as ERDA and RBS. With this unique method the desorption behavior of a sample can be correlated to its surface and bulk properties. The performed experiments with 1,4 MeV/u Xenon-Ions show that the ion induced desorption is mainly a surface effect. Sputtered oxide layers or impurities do not contribute to the desorbed gas significantly. Nevertheless bulk properties play an important role in the desorption strength. Pure metallic samples desorb less gas than isolating materials under swift heavy ion irradiation. From the experimental results it was possible to estimate the desorption yields of various materials under ion bombardment by means of an extended inelastic thermal-spike-model. The extension is the combination of the thermal-spike's temperature map with thermal desorption. Within this model the ion induced desorption can be regarded as the release of adsorbates from a transient overheated spot on the samples surface around the ion impact. Finally a copper substrate with a gold coated surface was developed and proposed as a suitable material for a beam loss collimator with minimum desorption to ensure the performance of GSI's SIS18 in high current beam operation. (orig.)
48 CFR 252.225-7020 - Trade Agreements Certificate.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade Agreements... of Provisions And Clauses 252.225-7020 Trade Agreements Certificate. As prescribed in 225.1101(5), use the following provision: Trade Agreements Certificate (JAN 2005) (a) Definitions. Designated...
Saha, Subhrakanti; Mandal, Mridul Kanti; Chen, Lee Chuin; Ninomiya, Satoshi; Shida, Yasuo; Hiraoka, Kenzo
2013-01-01
The present paper demonstrates the detection of explosives in solution using thermal desorption technique at a temperature higher than Leidenfrost temperature of the solvent in combination with low temperature plasma (LTP) ionization. Leidenfrost temperature of a solvent is the temperature above which the solvent droplet starts levitation instead of splashing when placed on a hot metallic surface. During this desorption process, slow and gentle solvent evaporation takes place, which leads to the pre-concentration of less-volatile explosive molecules in the droplet and the explosive molecules are released at the last moment of droplet evaporation. The limits of detection for explosives studied by using this thermal desorption LTP ionization method varied in a range of 1 to 10 parts per billion (ppb) using a droplet volume of 20 μL (absolute sample amount 90-630 fmol). As LTP ionization method was applied and ion-molecule reactions took place in ambient atmosphere, various ion-molecule adduct species like [M+NO2](-), [M+NO3](-), [M+HCO3](-), [M+HCO4](-) were generated together with [M-H](-) peak. Each peak was unambiguously identified using 'Exactive Orbitrap' mass spectrometer in negative ionization mode within 3 ppm deviation compared to its exact mass. This newly developed technique was successfully applied to detect four explosives contained in the pond water and soil sample with minor sample pre-treatment and the explosives were detected with ppb levels. The present method is simple, rapid and can detect trace levels of explosives with high specificity from solutions.
48 CFR 252.225-7024 - Requirement for products or services from Iraq or Afghanistan.
2010-10-01
... or services from Iraq or Afghanistan. 252.225-7024 Section 252.225-7024 Federal Acquisition... products or services from Iraq or Afghanistan. As prescribed in 225.7703-5(b), use the following clause: Requirement for Products or Services From Iraq or Afghanistan (SEP 2008) (a) Definitions. As used in this...
48 CFR 252.235-7001 - Indemnification under 10 U.S.C. 2354-cost reimbursement.
2010-10-01
....S.C. 2354-cost reimbursement. 252.235-7001 Section 252.235-7001 Federal Acquisition Regulations.... 2354—cost reimbursement. As prescribed in 235.070-3, use the following clause: Indemnification Under 10 U.S.C. 2354—Cost Reimbursement (DEC 1991) (a) This clause provides for indemnification under 10 U.S...
30 CFR 250.252 - What environmental monitoring information must accompany the DPP or DOCD?
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What environmental monitoring information must accompany the DPP or DOCD? 250.252 Section 250.252 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... incidental take of marine mammals as may be necessary under the MMPA. (c) Flower Garden Banks National Marine...
50 CFR 216.252 - Permissible methods of taking.
2010-10-01
... ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking Marine Mammals Incidental to Conducting Precision Strike Weapon Missions in the Gulf of Mexico § 216.252 Permissible methods of taking. (a) Under Letters of Authorization issued pursuant to...
Sorption and desorption of indaziflam degradates in several agricultural soils
Directory of Open Access Journals (Sweden)
Diego Gonçalves Alonso
2016-04-01
Full Text Available ABSTRACT Processes regulating pesticide fate in the environment are influenced by the physicochemical properties of pesticides and soils. Sorption and desorption are important processes as they regulate the movement of pesticides in soil. Although sorption-desorption is widely studied for herbicides, studies involving their metabolites in soil are scarce. Sorption and desorption of indaziflam metabolites (indaziflam-triazinediamine (FDAT, indaziflam-triazine-indanone (ITI and indaziflam-carboxilic acid (ICA were investigated in six Brazilian (BRA soils and three United States (USA soils with different physicochemical properties. The Freundlich equation described sorption of the metabolites for all soils (R2 > 0.98; 1/n ~ 1. Sorption order (Kf was ITI > ICA > FDAT. Mean values of Kf,oc were 453, 289, and 81 (BRA and 444, 48, and 48 (USA for metabolites ITI, ICA, and FDAT respectively. Desorption was hysteretic for all metabolites in all soils. These results suggest that these metabolites fall in the classification range of mobile to moderately mobile in soils.
Adsorption/desorption properties of vacuum materials for the 6 GeV synchrotron
International Nuclear Information System (INIS)
Krauss, A.R.
1985-01-01
Considerable attention must be paid to the vacuum and adsorption/desorption properties of all materials installed inside the vacuum envelope if the design goals of the 6 GeV synchrotron are to be met. Unfortunately, the data is very sparse in several key areas. Additionally, some procedures normally associated with good vacuum practice, such as air baking, may prove to be totally unsuitable on the basis of desorption properties. We present here a brief discussion of the adsorption, outgassing, electron-stimulated desorption (ESD), and photon-stimulated desorption (PSD) properties of vacuum materials as they relate to the design of a 6 GeV synchrotron
International Nuclear Information System (INIS)
Ban, Sadayuki
1989-01-01
To assess the biological effects of neutrons, a man-made spontaneously fissioning isotope, Cf-252, is useful as an experimental model to obtain basic biological data on mixed radiation of gamma-rays and neutrons. The paper describes the lethal effect of Cf-252 radiation on human skin fibroblasts, its lethal and mutagenic effect on HeLa MR cells, and the micronuclei inducing effect on human peripheral lymphocytes. Dose-survival responses of three fibroblast cell strains exposed to Cf-252 radiation are measured. Individual difference is larger than the experimental fluctuation. D 10 values of each strain are obtained from the linear model and linear-quadratic model. Though the dose rate of X-ray is higher than that of Cf-252 radiations, the mean value of RBE(n+γ) is simply obtained as 1.86+0.31 (RBE:relative biological effectiveness). RBE(n) of Cf-252 neutrons to high-dose-rate X-rays is 2.29. After X-ray irradiation, the survival curve of HeLa MR cells gives an extrapolation number of 3.6. It is 1.3 after Cf-252 irradiation. At 50% survival, RBE(n+γ) and RBE(n) are 2.05 and 2.6, respectively. At 10% survival they are 2.05 and 2.6. The mutation frequencies after X-ray irradiation showed a significant non-linear increase with dose. Those after Cf-252 irradiation increase linearly with dose. (N.K.)
Desorption of uranium from titanium-activated carbon composite adsorbent with acidic eluent, 1
International Nuclear Information System (INIS)
Hirotsu, Takahiro; Fujii, Ayako; Sakane, Kohji; Katoh, Shunsaku; Sugasaka, Kazuhiko
1984-01-01
An investigation was carried out on the desorption of uranium from titanium-activated carbon composite adsorbent with acidic eluent by the batch process. The rate of desorption of uranium with acidic eluent depended on temperature, showing an increase as the temperature was raised. But the rate of desorption with acidic eluent was less dependent on temperature than that obtained when mixed eluent of sodium carbonate-sodium hydrogencarbonate was used. The rate of desorption of uranium did not vary in the range of concentration from 0.3 to 0.5 N, and the rate of desorption with sulfuric acid was slightly higher than that obtained when hydrochloric acid was used. The amount of dissolved titanium decreased as the ratio of adsorbent to eluent (RAE) was increased. At RAE of 10 %, the percentage of dissolved titanium (DTI) was below 0.38 % with sulfuric acid, below 0.7 % with hydrochloric acid. These values were found to be higher than the ones with the carbonate eluent. The elements except uranium, which were adsorbed on the adsorbent, were eluted simultaneously with acidic eluent. The regeneration of the adsorbent after desorption, therefore, was found to be unnecessary. In a repeated test of adsorption-desorption treatment up to five times, the percentage of uranium adsorbed from natural sea water was approximately constant of 85 %. From these results, the application of column process to the desorption of uranium with acidic eluent at room temperature was proposed to be feasible. (author)
Desorption of uranium from titanium-activated carbon composite adsorbent with acidic eluent, (1)
International Nuclear Information System (INIS)
Hirotsu, Takahiro; Fujii, Ayako; Sakane, Kohji; Katoh, Shunsaku; Sugasaka, Kazuhiko
1983-01-01
An investigation was carried out on the desorption of uranium from titanium-activated carbon composite adsorbent with acidic eluent by the batch process. The rate of desorption of uranium with acidic eluent depended on temperature, showing an increase as the temperature was raised. But the rate of desorption with acidic eluent was less dependent on temperature than that obtained when mixed eluent of sodium carbonate-sodium hydrogencarbonate was used. The difference of the rate of desorption of uranium in the range of concentration from 0.3 to 0.5N was not found, and the rate of desorption with sulfuric acid was slightly higher than that obtained when hydrochloric acid was used. The amount of dissolved titanium decreased as the ratio of adsorbent to eluent (RAE) was increased. At RAE of 10%, the percentage of dissolved titanium (DTI) was below 0.38% with sulfuric acid, below 0.7% with hydrochloric acid. These values were found to be higher than the ones with the carbonate eluent. The elements except uranium, which were adsorbed on the adsorbent, were eluted simultaneously with acidic eluent. The regeneration of the adsorbent after desorption, therefore, was found to be unnecessary. In a repeated test of adsorption-desorption treatment up to five times, the percentage of uranium adsorbed from natural sea water was approximately constant of 85%. From these results, the application of column process to the desorption of uranium with acidic eluent at room temperature was proposed to be feasible. (author)
Determination of disintegration half-life of 252Cf
International Nuclear Information System (INIS)
Chen Keliang; Liu Guoxing; Wang Sufang; Zheng Jiwen
1991-01-01
The follow-up measurements have been made by using a Si(Au) detector with small solid angle geometry for α disintegration of 252 Cf. The measured half-life of disintegration is 2.638 ± 0.009 year. This value is in accordance with other previous results
48 CFR 252.225-7041 - Correspondence in English.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Correspondence in English... of Provisions And Clauses 252.225-7041 Correspondence in English. As prescribed in 225.1103(2), use the following clause: Correspondence in English (JUN 1997) The Contractor shall ensure that all...
48 CFR 252.229-7002 - Customs exemptions (Germany).
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Customs exemptions... of Provisions And Clauses 252.229-7002 Customs exemptions (Germany). As prescribed in 229.402-70(b), use the following clause: Customs Exemptions (Germany) (JUN 1997) Imported products required for the...
48 CFR 252.237-7005 - Performance and delivery.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance and delivery... of Provisions And Clauses 252.237-7005 Performance and delivery. As prescribed in 237.7003(b), use the following clause: Performance and Delivery (DEC 1991) (a) The Contractor shall furnish the...
Decorporation of 241Am and 252Cf by Ca-DTPA from rat, Syrian and Chinese hamster
International Nuclear Information System (INIS)
Seidel, A.
1977-01-01
Retention and mobilization by Ca-DTPA of 241 Am and 252 Cf from rats, Syrian and Chinese hamsters are compared. Previous observations of a much longer residence time of actinides in hamsters liver than in rat liver are confirmed. Identical dose-effect functions were obtained for skeleton of rats and Syrian hamsters whereas 252 Cf removal from Chinese hamster skeleton was lower. The mobilization of 241 Am was lower than that of 252 Cf. With regard to species differences, qualitatively similar results were obtained for 241 Am as for 252 Cf. The results will be discussed with regard to the reduction by DTPA treatment of radiation risk in animal species with different biological half times of actinides in their livers. In this connection, attention will be paid to the usefulness of long-term DTPA treatment
Investigations on ion-beam induced desorption from cryogenic surfaces
International Nuclear Information System (INIS)
Maurer, Christoph
2017-01-01
A central component of FAIR, the Facility for Antiproton and Ion Research, will be the superconducting heavy ion synchrotron SIS100, which is supposed to provide reliable, high intensity beams for various applications. Its beam intensity is governed by the space charge limit, while the maximum energy is determined by the machine's magnetic rigidity. That means, ions with higher charge state can be accelerated to a higher energy, but with less intensity. For highest intensity beams, intermediate charge states have to be used instead of high charge state ions. This alleviates the issue of space charge but gives rise to dynamic vacuum effects, which also limit beam intensity: beam particles collide with residual gas particles, which leads to charge exchange and their subsequent loss. Impacting on the chamber wall, these ions release adsorbed gas particles. This process is called desorption and leads to a localized increase in pressure, which in turn causes more charge exchange. After a few rounds of self amplification, this can lead to total beam loss. This ''runaway-desorption'' is typically the main beam intensity limiting process for intermediate charge state (heavy) ion beams. The extent of this phenomenon is governed by two factors: the initial beam intensity and the desorption yield. The latter is examined within the scope of this thesis. Special emphasis is placed on the influence of the target's temperature, since the SIS100 will be a superconducting machine with cryogenic vacuum chamber walls. In order to investigate this topic, an experimental setup has been devised, built at the SIS18 and taken into commission. Based on the experience gained during operation, it has been continuously improved and extended. Another central innovation presented in this thesis is the use of gas dynamics simulations for an improved method of data analysis. Using this technique, environmental conditions like the chamber geometry and the connected
Characteristics of polyethylene-moderated 252Cf neutron sources
International Nuclear Information System (INIS)
Alejnikov, V.E.; Beskrovnaya, L.G.; Florko, B.V.
2000-01-01
Polyethylene-moderated 252 Cf neutron sources were designed to produce neutron reference fields' spectra that simulate the spectra observed in the workplaces within nuclear reactors and accelerators. The paper describes the neutron sources and fields. Neutron spectra were calculated by Monte Carlo method and compared with experimental data
48 CFR 252.229-7005 - Tax exemptions (Spain).
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax exemptions (Spain... of Provisions And Clauses 252.229-7005 Tax exemptions (Spain). As prescribed in 229.402-70(e), use the following clause: Tax Exemptions (Spain) (JUN 1997) (a) The Contractor represents that the...
Energy Technology Data Exchange (ETDEWEB)
Jones, C.G.
1990-08-01
This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs.
International Nuclear Information System (INIS)
Jones, C.G.
1990-08-01
This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs
International Nuclear Information System (INIS)
Fabry, A.; McElroy, W.N.; Kellogg, L.S.; Lippincott, E.P.; Grundl, J.A.; Gilliam, D.M.; Hansen, G.E.
1976-10-01
The paper is intended to review and critically discuss microscopic integral cross section measurement and calculation data for fundamental reactor dosimetry benchmark neutron fields. Specifically the review covers the following fundamental benchmarks: (1) the spontaneous californium-252 fission neutron spectrum standard field; (2) the thermal-neutron induced uranium-235 fission neutron spectrum standard field; (3) the (secondary) intermediate-energy standard neutron field at the center of the Mol-ΣΣ, NISUS, and ITN--ΣΣ facilities; (4) the reference neutron field at the center of the Coupled Fast Reactor Measurement Facility (CFRMF); (5) the reference neutron field at the center of the 10 percent enriched uranium metal, cylindrical, fast critical; and (6) the (primary) Intermediate-Energy Standard Neutron Field
Desorption by Femtosecond Laser Pulses : An Electron-Hole Effect?
D. M., NEWNS; T. F., HEINZ; J. A., MISEWICH; IBM Research Division, T. J. Watson Research Center; IBM Research Division, T. J. Watson Research Center; IBM Research Division, T. J. Watson Research Center
1992-01-01
Desorption of molecules from metal surfaces induced by femtosecond visible laser pulses has been reported. Since the lattice temperature rise is insufficient to explain desorption, an electronic mechanism is clearly responsible. It is shown that a theory based on direct coupling between the center-of-mass degree of freedom of the adsorbate and the electron-hole excitations of the substrate provides a satisfactory explanation of the various experimental findings.
R.J.W. Meesters (Roland); R. Cornelissen (Robin); R.J. van Klaveren (Rob); R. de Jonge (Robert); E. den Boer (Ethan); J. Lindemans (Jan); T.M. Luider (Theo)
2010-01-01
textabstractAn analytical assay has been developed and validated for ultrafast and high-throughput mass spectrometric determination of pemetrexed concentrations in plasma using matrix assisted laser desorption/ionization-triple quadrupole-tandem mass spectrometry. Patient plasma samples spiked with
48 CFR 252.225-7026 - Acquisition Restricted to Products or Services from Iraq or Afghanistan.
2010-10-01
... Products or Services from Iraq or Afghanistan. 252.225-7026 Section 252.225-7026 Federal Acquisition... to Products or Services from Iraq or Afghanistan. As prescribed in 225.7703-5(c), use the following clause: Acquisition Restricted to Products or Services From Iraq or Afghanistan (APR 2010) (a...
48 CFR 252.225-7036 - Buy American Act-Free Trade Agreements-Balance of Payments Program.
2010-10-01
... Trade Agreements-Balance of Payments Program. 252.225-7036 Section 252.225-7036 Federal Acquisition... Trade Agreements—Balance of Payments Program. As prescribed in 225.1101(11)(i), use the following clause: Buy American Act—Free Trade Agreements—Balance of Payments Program (JUL 2009) (a) Definitions. As used...
Gas desorption properties of ammonia borane and metal hydride composites
International Nuclear Information System (INIS)
Matin, M.R.
2009-01-01
'Full text': Ammonia borane (NH 3 BH 3 ) has been of great interest owing to its ideal combination of low molecular weight and high H 2 storage capacity of 19.6 mass %, which exceeds the current capacity of gasoline. DOE's year 2015 targets involve gravimetric as well as volumetric energy densities. In this work, we have investigated thermal decomposition of ammonia borane and calcium hydride composites at different molar ratio. The samples were prepared by planetary ball milling under hydrogen gas atmosphere pressure of 1Mpa at room temperature for 2, and 10 hours. The gas desorption properties were examined by thermal desorption mass spectroscopy (TDMS). The identification of phases was carried out by X-ray diffraction. The results obtain were shown in fig (a),(b),and (c). Hydrogen desorption properties were observed at all molar ratios, but the desorption temperature is significantly lower at around 70 o C at molar ratio 1:1 as shown in fig (c), and unwanted gas (ammonia) emissions were remarkably suppressed by mixing with the calcium hydride. (author)
Deuterium depth profiles in metals using imaging field desorption
International Nuclear Information System (INIS)
Panitz, J.A.
1976-01-01
Depth profiles of 80 eV deuterium ions implanted in-situ into (110) tungsten have been measured by Imaging, Field-Desorption Mass Spectrometry. The relative abundance of deuterium was measured from the surface to a depth of 300A with less than 3A depth resolution by controlled field-evaporation of the specimen, and time-of-flight mass spectroscopy. The position of the depth distribution maximum (57 +- 3A from the surface) is shown to be in close agreement with that predicted theoretically for low energy deuterium implants using an amorphous-solid model. Structure in the distribution is attributed to surface morphology and channeling phenomena in the near surface region. Implanted impurity species from the ion source and tungsten surface have also been observed. For C + , C 2+ and 0 + , penetration is limited to less than 30A, with abundance decreasing exponentially from the surface. These results are interpreted in the context of the CTR first-wall impurity problem, and are used to suggest a novel method for in-situ characterization of low energy plasma species in operating CTR devices
Plasma surface functionalization and dyeing kinetics of Pan-Pmma copolymers
Labay, C.; Canal, C.; Rodríguez, C.; Caballero, G.; Canal, J. M.
2013-10-01
Fiber surface modification with air corona plasma has been studied through dyeing kinetics under isothermal conditions at 30 °C on an acrylic-fiber fabric with a cationic dye (CI Basic Blue 3) analyzing the absorption, desorption and fixing on the surface of molecules having defined cationic character. The initial dyeing rate in the first 60 s indicates an increase of 58.3% in the dyeing rate due to the effect of corona plasma on the acrylic fiber surface. At the end of the dyeing process, the plasma-treated fabrics absorb 24.7% more dye, and the K/S value of the acrylic fabric increases by 8.8%. With selected dyestuff molecules, new techniques can be designed to amplify the knowledge about plasma-treated surface modifications of macromolecules.
Deterministic dynamics of plasma focus discharges
International Nuclear Information System (INIS)
Gratton, J.; Alabraba, M.A.; Warmate, A.G.; Giudice, G.
1992-04-01
The performance (neutron yield, X-ray production, etc.) of plasma focus discharges fluctuates strongly in series performed with fixed experimental conditions. Previous work suggests that these fluctuations are due to a deterministic ''internal'' dynamics involving degrees of freedom not controlled by the operator, possibly related to adsorption and desorption of impurities from the electrodes. According to these dynamics the yield of a discharge depends on the outcome of the previous ones. We study 8 series of discharges in three different facilities, with various electrode materials and operating conditions. More evidence of a deterministic internal dynamics is found. The fluctuation pattern depends on the electrode materials and other characteristics of the experiment. A heuristic mathematical model that describes adsorption and desorption of impurities from the electrodes and their consequences on the yield is presented. The model predicts steady yield or periodic and chaotic fluctuations, depending on parameters related to the experimental conditions. (author). 27 refs, 7 figs, 4 tabs
48 CFR 252.237-7007 - Termination for default.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Termination for default... of Provisions And Clauses 252.237-7007 Termination for default. As prescribed in 237.7003(b), use the following clause: Termination for Default (DEC 1991) (a) This clause supplements and is in addition to the...
Plasma-surface interaction in negative hydrogen ion sources
Wada, Motoi
2018-05-01
A negative hydrogen ion source delivers more beam current when Cs is introduced to the discharge, but a continuous operation of the source reduces the beam current until more Cs is added to the source. This behavior can be explained by adsorption and ion induced desorption of Cs atoms on the plasma grid surface of the ion source. The interaction between the ion source plasma and the plasma grid surface of a negative hydrogen ion source is discussed in correlation to the Cs consumption of the ion source. The results show that operation with deuterium instead of hydrogen should require more Cs consumption and the presence of medium mass impurities as well as ions of the source wall materials in the arc discharge enlarges the Cs removal rate during an ion source discharge.
Low energy electron stimulated desorption from DNA films dosed with oxygen
Energy Technology Data Exchange (ETDEWEB)
Mirsaleh-Kohan, Nasrin; Bass, Andrew D.; Cloutier, Pierre; Massey, Sylvain; Sanche, Leon [Groupe en sciences des radiations, Faculte de medecine et des sciences de la sante, Universite de Sherbrooke, Sherbrooke, Quebec J1H 5N4 (Canada)
2012-06-21
Desorption of anions stimulated by 1-18 eV electron impact on self-assembled monolayer (SAM) films of single DNA strands is measured as a function of film temperature (50-250 K). The SAMs, composed of 10 nucleotides, are dosed with O{sub 2}. The OH{sup -} desorption yields increase markedly with exposure to O{sub 2} at 50 K and are further enhanced upon heating. In contrast, the desorption yields of O{sup -}, attributable to dissociative electron attachment to trapped O{sub 2} molecules decrease with heating. Irradiation of the DNA films prior to the deposition of O{sub 2} shows that this surprising increase in OH{sup -} desorption, at elevated temperatures, arises from the reaction of O{sub 2} with damaged DNA sites. These results thus appear to be a manifestation of the so-called 'oxygen fixation' effect, well known in radiobiology.
International Nuclear Information System (INIS)
Ostroumov, P. N.; Barcikowski, A.; Dickerson, C. A.; Perry, A.; Sharamentov, S. I.; Vondrasek, R. C.; Zinkann, G. P.; Pikin, A. I.
2015-01-01
The Electron Beam Ion Source (EBIS), developed to breed Californium Rare Isotope Breeder Upgrade (CARIBU) radioactive beams at Argonne Tandem Linac Accelerator System (ATLAS), is being tested off-line. A unique property of the EBIS is a combination of short breeding times, high repetition rates, and a large acceptance. Overall, we have implemented many innovative features during the design and construction of the CARIBU EBIS as compared to the existing EBIS breeders. The off-line charge breeding tests are being performed using a surface ionization source that produces singly charged cesium ions. The main goal of the off-line commissioning is to demonstrate stable operation of the EBIS at a 10 Hz repetition rate and a breeding efficiency into single charge state higher than 15%. These goals have been successfully achieved and exceeded. We have measured (20% ± 0.7%) breeding efficiency into the single charge state of 28+ cesium ions with the breeding time of 28 ms. In general, the current CARIBU EBIS operational parameters can provide charge breeding of any ions in the full mass range of periodic table with high efficiency, short breeding times, and sufficiently low charge-to-mass ratio, 1/6.3 for the heaviest masses, for further acceleration in ATLAS. In this paper, we discuss the parameters of the EBIS and the charge breeding results in a pulsed injection mode with repetition rates up to 10 Hz
Study on hydrogen absorption/desorption properties of uranium alloys
Energy Technology Data Exchange (ETDEWEB)
Ito, Hiroshi; Yamaguchi, Kenji; Yamawaki, Michio [Tokyo Univ., Tokai, Ibaraki (Japan). Nuclear Engineering Research Lab.
1996-10-01
Hydrogen absorption/desorption properties of two U-Mn intermetallic compounds, U{sub 6}Mn and UMn{sub 2}, were investigated. U{sub 6}Mn absorbed hydrogen and the hydrogen desorption pressure of U{sub 6}Mn obtained from this experiment was higher than that of U, which was considered to be the effect of alloying, whereas UMn{sub 2} was not observed to absorb hydrogen up to 50 atm at room temperature. (author)
Shielding experiments in different materials with 252Cf neutron spectra
International Nuclear Information System (INIS)
Sathian, Deepa; Marathe, P.K.; Pal, Rupali; Jayalakshmi, V.; Chourasiya, G.; Mayya, Y.S.
2008-01-01
Adequate shielding for neutron sources can be determined using analytical method or by actually measuring the attenuation for the target configuration. This paper describes the measurement of Half Value Thickness (HVT), Tenth Value Thickness (TVT), Σ values for four different shielding materials, using a standard 252 Cf neutron source and comparing with the values calculated using an empirical relationship. BF 3 based REM-counter is used for measurement of neutron dose equivalent, against different thickness of the shielding material. The experimental HVT and S values are in good agreement with the calculated values. From this study, it is concluded that, among the four materials studied, high density polyethylene (HDPE) is best suitable for the shielding of a 252 Cf neutron source. (author)
Energy and angular distributions of neutrons from 252Cf spontaneous fission
International Nuclear Information System (INIS)
Vasil'ev, Yu.A.; Sidorov, L.V.; Vasil'eva, N.K.
1982-01-01
Some results from a first series of measurements of energy and angular distributions of neutrons from 252 Cf spontaneous fission using a spectrometer with high neutron detection efficiency, i.e. a 4π neutron time-of-flight spectrometer, were already presented. Subsequently, a second series of measurements was performed using a more sophisticated technique. For this second series, we used a more intense 252 Cf layer (25,000 spontaneous fissions per second). The angular resolution was improved by a factor of 2-3 by combining the hexahedral counter modules, placed at the same angle with respect to the direction of motion of the fragments, in new panoramic counters. The neutron counters were calibrated against the average 252 Cf neutron spectrum at several positions of the axis of the fragment detector with respect to the neutron counters. In the spectrum measurements and calibration work, the scattered neutron background was not determined theoretically, as in the first series of measurements, but experimentally using four extra scintillation counters with scatter cones; the counters were set up at 60 deg., 80 deg., 100 deg., and 120 deg. to the direction of separation of the fragments
Time domain measurements for fast metal assemblies with /sup 252/Cf
Energy Technology Data Exchange (ETDEWEB)
Mihalczo, J T
1975-06-01
Time correlation measurements between the pulses from an ionization counter containing a /sup 252/Cf neutron source, which provided the initiators of fission chains in a neutron multiplying assembly and from sensors that detected particles from the fission chains are reviewed for fast uranium or plutonium metal assemblies. Comparisons are made between the correlated count rate from a /sup 252/Cf measurement and that from both one and two-detector Rossi-..cap alpha.. measurements. The assemblies studied were (1) unmoderated and polyethylene-moderated uranium (93 wt percent /sup 235/U) cylinders with masses from 12 to 160 kg; prompt neutron decay constants from 3 to 10/sup 3/ to 10/sup 8/ sec/sup -1/ and (2) unmoderated plutonium spheres and parts of spheres with plutonium masses from 2.2 to 16 kg with /sup 240/Pu contents of 4.5 to 20.1 at. percent. Measurements with a delayed critical uranium metal sphere determined the effective delayed neutron fraction and served as the basis for verification of the theory of the /sup 252/Cf measurement method in the time domain within a few per cent. (auth)
Sorption and desorption of diuron in Oxisol under biochar application
Directory of Open Access Journals (Sweden)
Fabiano André Petter
Full Text Available ABSTRACT The objective of this study was to verify the kinetics of sorption and desorption of diuron in an Oxisol under application of biochar. The samples were collected in a field experiment conducted in randomized design blocks consisted of 2 base fertilization levels (0 and 400 kg∙ha−1 NPK 00-20-20 fertilizer formula and 3 doses of biochar (0, 8 and 16 Mg∙ha−1. In the evaluation of sorption and desorption, Batch Equilibrium method was used. The kinetics of sorption and desorption of diuron, total organic carbon, fulvic acid, humic acid and humin, pH and partition coefficient to organic carbon were evaluated. The Freundlich isotherm was adjusted appropriately to describe diuron sorption kinetics in all the studied treatments. The application of biochar provided increment in the sorption (Kf and reduction in the desorption of diuron in 64 and 44%, respectively. This effect is attributed to the biochar contribution to the total organic carbon and C-humin and of these to diuron through hydrophobic interactions and hydrogen bonds. The positive correlation between the partition coefficient to organic carbon and Kf confirms the importance of soil organic compartment in the sorption of diuron. There was no competition of NPK fertilizer for the same sorption site of diuron. The increase and reduction in sorption and desorption, respectively, show that the application of biochar is an important alternative for the remediation of soil leaching of diuron, especially in sandy soils.
The impact of vegetation on sedimentary organic matter composition and PAH desorption
Energy Technology Data Exchange (ETDEWEB)
Nichols, Elizabeth Guthrie [North Carolina State University, Department of Forestry and Environmental Resources, 2800 Faucette Drive, Raleigh, NC 27695 (United States)], E-mail: elizabeth_nichols@ncsu.edu; Gregory, Samuel T.; Musella, Jennifer S. [North Carolina State University, Department of Forestry and Environmental Resources, 2800 Faucette Drive, Raleigh, NC 27695 (United States)
2008-12-15
Relationships between sedimentary organic matter (SOM) composition and PAH desorption behavior were determined for vegetated and non-vegetated refinery distillate waste sediments. Sediments were fractionated into size, density, and humin fractions and analyzed for their organic matter content. Bulk sediment and humin fractions differed more in organic matter composition than size/density fractions. Vegetated humin and bulk sediments contained more polar organic carbon, black carbon, and modern (plant) carbon than non-vegetated sediment fractions. Desorption kinetics of phenanthrene, pyrene, chrysene, and C{sub 3}-phenanthrene/anthracenes from humin and bulk sediments were investigated using Tenax beads and a two-compartment, first-order kinetic model. PAH desorption from distillate waste sediments appeared to be controlled by the slow desorbing fractions of sediment; rate constants were similar to literature values for k{sub slow} and k{sub veryslow}. After several decades of plant colonization and growth (Phragmites australis), vegetated sediment fractions more extensively desorbed PAHs and had faster desorption kinetics than non-vegetated sediment fractions. - Plants alter sediment organic matter composition and PAH desorption behavior.
The impact of vegetation on sedimentary organic matter composition and PAH desorption
International Nuclear Information System (INIS)
Nichols, Elizabeth Guthrie; Gregory, Samuel T.; Musella, Jennifer S.
2008-01-01
Relationships between sedimentary organic matter (SOM) composition and PAH desorption behavior were determined for vegetated and non-vegetated refinery distillate waste sediments. Sediments were fractionated into size, density, and humin fractions and analyzed for their organic matter content. Bulk sediment and humin fractions differed more in organic matter composition than size/density fractions. Vegetated humin and bulk sediments contained more polar organic carbon, black carbon, and modern (plant) carbon than non-vegetated sediment fractions. Desorption kinetics of phenanthrene, pyrene, chrysene, and C 3 -phenanthrene/anthracenes from humin and bulk sediments were investigated using Tenax beads and a two-compartment, first-order kinetic model. PAH desorption from distillate waste sediments appeared to be controlled by the slow desorbing fractions of sediment; rate constants were similar to literature values for k slow and k veryslow . After several decades of plant colonization and growth (Phragmites australis), vegetated sediment fractions more extensively desorbed PAHs and had faster desorption kinetics than non-vegetated sediment fractions. - Plants alter sediment organic matter composition and PAH desorption behavior
International Nuclear Information System (INIS)
Ohno, Yuichi; Matsushima, Tatsuo; Tanaka, Shin-ichiro; Kamada, Masao
1993-01-01
The desorption, dissociation and orientation of oxygen admolecules on a reconstructed Pt(110)(1x2) were studied by means of TDS combined with isotope tracer, NEXAFS, and angle-resolved TDS. The admolecules below half a monolayer lie on the bottom of the trough, being oriented along it. The molecules adsorbed additionally are lying on declining terraces. The desorption flux of the former species shows a simple cosine distribution, suggesting that the molecule is not localized on the bottom in the desorption event. (author)
Plasma proteome analysis of patients with type 1 diabetes with diabetic nephropathy
DEFF Research Database (Denmark)
Overgaard, Anne Julie; Hansen, Henning Gram; Lajer, Maria
2010-01-01
patients was investigated with the goal of finding improved candidate biomarkers to predict diabetic nephropathy. In order to reach lower concentration proteins in plasma a pre-fractionation step, either hexapeptide bead-based libraries or anion exchange chromatography, was performed prior to surface...... enhanced laser desorption/ionization time-of-flight mass spectrometry analysis....
A Holistic Approach to Understanding the Desorption of Phosphorus in Soils.
Menezes-Blackburn, Daniel; Zhang, Hao; Stutter, Marc; Giles, Courtney D; Darch, Tegan; George, Timothy S; Shand, Charles; Lumsdon, David; Blackwell, Martin; Wearing, Catherine; Cooper, Patricia; Wendler, Renate; Brown, Lawrie; Haygarth, Philip M
2016-04-05
The mobility and resupply of inorganic phosphorus (P) from the solid phase were studied in 32 soils from the UK. The combined use of diffusive gradients in thin films (DGT), diffusive equilibration in thin films (DET) and the "DGT-induced fluxes in sediments" model (DIFS) were adapted to explore the basic principles of solid-to-solution P desorption kinetics in previously unattainable detail. On average across soil types, the response time (Tc) was 3.6 h, the desorption rate constant (k-1) was 0.0046 h(-1), and the desorption rate was 4.71 nmol l(-1) s(-1). While the relative DGT-induced inorganic P flux responses in the first hour is mainly a function of soil water retention and % Corg, at longer times it is a function of the P resupply from the soil solid phase. Desorption rates and resupply from solid phase were fundamentally influenced by P status as reflected by their high correlation with P concentration in FeO strips, Olsen, NaOH-EDTA and water extracts. Soil pH and particle size distribution showed no significant correlation with the evaluated mobility and resupply parameters. The DGT and DET techniques, along with the DIFS model, were considered accurate and practical tools for studying parameters related to soil P desorption kinetics.
Implementation of 252Cf-source-driven power spectrum density measurement system
International Nuclear Information System (INIS)
Ren Yong; Wei Biao; Feng Peng; Li Jiansheng; Ye Cenming
2012-01-01
The principle of 252 Cf-source-driven power spectrum density measurement method is introduced. A measurement system and platform is realized accordingly, which is a combination of hardware and software, for measuring nuclear parameters. The detection method of neutron pulses based on an ultra-high-speed data acquisition card (three channels, 1 GHz sampling rate, 1 ns synchronization) is described, and the data processing process and the power spectrum density algorithm on PC are designed. This 252 Cf-source-driven power spectrum density measurement system can effectively obtain the nuclear tag parameters of nuclear random processes, such as correlation function and power spectrum density. (authors)
Film growth, adsorption and desorption kinetics of indigo on SiO{sub 2}
Energy Technology Data Exchange (ETDEWEB)
Scherwitzl, Boris, E-mail: b.scherwitzl@tugraz.at; Resel, Roland; Winkler, Adolf [Institute of Solid State Physics, Graz University of Technology, Petersgasse 16, A-8010 Graz (Austria)
2014-05-14
Organic dyes have recently been discovered as promising semiconducting materials, attributable to the formation of hydrogen bonds. In this work, the adsorption and desorption behavior, as well as thin film growth was studied in detail for indigo molecules on silicon dioxide with different substrate treatments. The material was evaporated onto the substrate by means of physical vapor deposition under ultra-high vacuum conditions and was subsequently studied by Thermal Desorption Spectroscopy (TDS), Auger Electron Spectroscopy, X-Ray Diffraction, and Atomic Force Microscopy. TDS revealed initially adsorbed molecules to be strongly bonded on a sputter cleaned surface. After further deposition a formation of dimers is suggested, which de-stabilizes the bonding mechanism to the substrate and leads to a weakly bonded adsorbate. The dimers are highly mobile on the surface until they get incorporated into energetically favourable three-dimensional islands in a dewetting process. The stronger bonding of molecules within those islands could be shown by a higher desorption temperature. On a carbon contaminated surface no strongly bonded molecules appeared initially, weakly bonded monomers rather rearrange into islands at a surface coverage that is equivalent to one third of a monolayer of flat-lying molecules. The sticking coefficient was found to be unity on both substrates. The desorption energies from carbon covered silicon dioxide calculated to 1.67 ± 0.05 eV for multilayer desorption from the islands and 0.84 ± 0.05 eV for monolayer desorption. Corresponding values for desorption from a sputter cleaned surface are 1.53 ± 0.05 eV for multilayer and 0.83 ± 0.05 eV for monolayer desorption.
Efremov, Mikhail Yu.; Nealey, Paul F.
2018-05-01
An environmental chamber equipped with an in situ spectroscopic ellipsometer, programmatic vapor pressure control, and variable temperature substrate holder has been designed for studying polymer coating behavior during an exposure to a solvent vapor and also for probing the residual solvent in the film afterwards. Both sorption-desorption cycle at a constant temperature and temperature programmed desorption (TPD) of the residual solvent manifest themselves as a change of the film thickness. Monitoring of ellipsometric angles of the coating allows us to determine the thickness as a function of the vapor pressure or sample temperature. The solvent vapor pressure is precisely regulated by a computer-controlled pneumatics. TPD spectra are recorded during heating of the film in an oil-free vacuum. The vapor pressure control system is described in detail. The system has been tested on 6-170 nm thick polystyrene, poly(methyl methacrylate), and poly(2-vinyl pyridine) films deposited on silicon substrates. Liquid toluene, water, ethanol, isopropanol, cyclohexane, 1,2-dichloroethane, and chlorobenzene were used to create a vapor atmosphere. Typical sorption-desorption and TPD curves are shown. The instrument achieves sub-monolayer sensitivity for adsorption studies on flat surfaces. Polymer-solvent vapor systems with strong interaction demonstrate characteristic absorption-desorption hysteresis spanning from vacuum to the glass transition pressure. Features on the TPD curves can be classified as either glass transition related film contraction or low temperature broad contraction peak. Typical absorption-desorption and TPD dependencies recorded for the 6 nm thick polystyrene film demonstrate the possibility to apply the presented technique for probing size effects in extremely thin coatings.
Confinement properties of high energy density plasmas in the Wisconsin levitated octupole
International Nuclear Information System (INIS)
Twichell, J.C.
1984-08-01
The confinement of particles and energy is critically dependent on the plasma-wall interaction. Results of a study detailing this interaction are presented. High power ICRF heated and gun afterglow plasmas were studied to detail the mechanisms determining particle and energy confinement. An extensive zero-D simulation code is used to assist in interpreting the experimental data. Physically reasonable models for plasma surface interactions, time dependent coronal treatment of impurities and multiple region treatment of neutrals are used in modeling the plasma. Extensive diagnostic data are used to verify the model. Non-heated plasmas decay from 28 to 3 eV allowing clear identification of wall impact energy thresholds for desorption and particle reflection. The charge state distribution of impurities verifies the reflux to plasma diffusion rate ratio. Close agreement between the simulation and experimental data is found
DEFF Research Database (Denmark)
Nielsen, Jimmi; Skou, Eivind M.; Jacobsen, Torben
2015-01-01
Temperature‐programmed desorption (TPD) with a carrier gas was used to study the oxygen sorption and desorption properties of oxidation catalysts and solid‐oxide fuel cell (SOFC) cathode materials (La0.85Sr0.15)0.95MnO3+δ (LSM) and La0.60Sr0.40Fe0.80Mn0.20O3‐δ (LSFM). The powders were characterized...... by X‐ray diffractometry, atomic force microscopy (AFM), and BET surface adsorption. Sorbed oxygen could be distinguished from oxygen originating from stoichiometry changes. The results indicated that there is one main site for oxygen sorption/desorption. The amount of sorbed oxygen was monitored over...... time at different temperatures. Furthermore, through data analysis it was shown that the desorption peak associated with oxygen sorption is described well by second‐order desorption kinetics. This indicates that oxygen molecules dissociate upon adsorption and that the rate‐determining step...
Study of adsorption and desorption of water on Li4SiO4
International Nuclear Information System (INIS)
Schauer, V.; Schumacher, G.; Kernforschungszentrum Karlsruhe GmbH
1989-01-01
Lithium orthosilicate is one of the candidate materials for tritium breeding in a fusion reactor blanket. The release of tritium from this material depens on diffusion in the bulk and on desorption from the surface of the material which is usually covered by adsorbed water. Adsorption and desorption of water was examined to gain an insight into the release of tritium from the surface. Temperature controlled desorption experiments with lithium orthosilicate powder show desorption peaks which are assigned to the desorption of physisorbed water. At temperatures above 390 K and partial pressures up to 1.6 mbar water is absorbed in the first layer on the surface only. Immersion experiments gave much too high values of the heat of immersion for spray dried powder but reasonable 82 kJ/mol of water for spheres of 0.5 mm diameter produced from molten orthosilicate. (orig.)
Mixed plasma-facing materials research at INEEL
International Nuclear Information System (INIS)
Anderl, R.A.; Longhurst, G.R.; Pawelko, R.J.
2001-01-01
Mixed-materials research at the Idaho National Engineering and Environmental Laboratory (INEEL) has focused on Be-C and W-C systems. The purpose of this work was to investigate hydrogen isotope retention in these systems. Plasma-mixed material layers using carbon coated Be and W specimens that were heat-treated and tungsten carbide specimens prepared by chemical vapor deposition (CVD) were simulated. Hydrogen isotope retention was investigated by means of thermal desorption spectroscopy (TDS) measurements on deuterium implanted samples
In-situ elemental analysis of coal by neutron activation
International Nuclear Information System (INIS)
Mikesell, J.L.; Senftle, F.E.; Tanner, A.B.
1986-01-01
The U.S. Geological Survey (USGS) has worked to develop neutron techniques for the borehole measurement of the elemental composition of ores since 1969, and first demonstrated a borehole ultimate analysis of coal in 1977. Borehole measurements such as these permit real-time evaluation of coal quality without the expense of coring or the delays associated with laboratory analyses. Two technological innovations make such measurements possible: the availability, from Savannah River Operations Office, DOE, of small californium-252 (/sup 252/Cf) fission neutron sources, and the development, by USGS and Princeton Gamma-Techn, of the melting-cryogen-cooled high-purity germanium borehole gamma-ray detector. A technique of relating mass fractions to measured gamma-ray intensities, which eliminates the need for detailed knowledge of the geometry of the neutron distribution, is used to calculate elemental compositions without resorting to the test pits or computer borehole modeling. In coal, all of the major constituents (C, H, N, S, Si, Al, Fe, Ti) except oxygen can be determined quantitatively by thermal neutron capture gamma-ray spectroscopy
Glasses impregnated with lead for radiation shielding
International Nuclear Information System (INIS)
Abd El Monem, A.M.; Kansouh, W.A.; Megahid, R.M.; Ismail, A.L.; Awad, E.M.
2005-01-01
The attenuation properties of glasses with different concentration of lead have been investigated for the attenuation of gamma-rays from cesium-137 and for total gamma rays using a beam of neutrons and gamma rays emitted from californium-252 source. Measurements have been performed using a gamma-ray spectrometer with Nal(T1) detector for gamma-rays emitted from 137 Cs and a neutron/gamma spectrometer with stilbene scintillator for measurement of total gamma-rays from 252 Cf neutron source. The latter applied the pulse shape discrimination technique to distinguish between recoil proton and recoil electron pulses. The obtained results given the form displayed pulse height spectra and attenuation relations which were used to derive the linear attenuation coefficient (μ), and the mass attenuation coefficient (mu/p) of the investigated glasses. In addition, calculations were performed to determine the attenuation properties of glass shields under investigation using XCOM code given by the others. A comparison of the shielding properties of these glasses with some standard shielding materials indicated that, the investigated glasses process the shielding advantages required for different nuclear technology applications
Neutron emission during acceleration of 252Cf fission fragments
International Nuclear Information System (INIS)
Batenkov, O.I.; Blinov, M.V.; Blinov, A.B.; Smirnov, S.N.
1991-01-01
We investigate neutron emission during acceleration of fission fragments in the process of spontaneous fission of 252 Cf. Experimental angular and energy distributions of neutrons are compared with the results of calculations of neutron evaporation during fragment acceleration. (author). 8 refs, 3 figs
Thermal desorption of deuterium implanted into beryllium
International Nuclear Information System (INIS)
Markin, A.V.; Chernikov, V.N.; Zakharov, A.P.
1995-01-01
By means of TDS measurements it is shown that the desorption of deuterium from Be implanted with 5 keV D ions to fluences, Φ, from 1x10 20 D/m 2 to 1x10 21 D/m 2 proceeds in one high temperature stage B, while at Φ ≥ 1.2x10 21 D/m 2 one more stage A is added. The desorption maximum A is narrow and consists of two peaks A 1 and A 2 at about 460 K and 490 K, respectively. Peak A 1 is attributed to the desorption of deuterium from the walls of opened channels formed under D ion implantation. Peak A 2 is a consequence of the opening of a part of closed bubbles/channels to the outer surface. The position of maximum B shifts noticeably and nonsteadily on the fluence in a range from 850 to 1050 K. The origin of this maximum is the liberation of D atoms bound at vacancy complexes discussed previously by Wampler. The dependence of Tm(B) on the fluence is governed by the interaction of freely migrating D atoms with partly opened or fully closed gas cavity arrangements which are created under temperature ramping, but differently in specimens implanted with D ions to different fluences
The Implications of the Excited Rotation of Comet 252P/2000 G1 (LINEAR)
Li, Jian-Yang; Samarasinha, Nalin H.; Kelley, Michael S. P.; Farnocchia, Davide; Mutchler, Max J.; Ren, Yanqiong; Lu, Xiaoping; Tholen, David J.; Lister, Tim; Micheli, Marco
2018-01-01
Jupiter Family comet (JFC) 252P/LINEAR had a close encounter to Earth on 2016 March 21. We imaged the comet with the Hubble Space Telescope Wide Field Camera 3 UVIS channel through the V- and r’-band filters spanning ~8 hours on 2016 April 4. The pixel scale of 2.7 km/pixel allowed us to study the structure of the cometary coma at scales of a few kilometers to a few hundred kilometers from the nucleus, a characteristic that is unique to our data. The dust coma of 252P showed a strong, well defined, narrow and nearly linear feature in the sunward direction, and its projected position angle moved about the nucleus for ~60 deg in 8 hours, consistent with an apparent periodicity of ~7.24 hours. On the other hand, the lightcurve measured in both V- and r’-band images from a 13 km radius aperture, after corrected for color term, showed a variability of >0.14 mag that is consistent with an apparent periodicity of ~5.4 hours or its multiples. We suggest that the two different periodicities derived from coma morphology and the lightcurve is a strong indication that the nucleus of 252P is in a non-principal axis (NPA) rotation, joining two other confirmed NPA rotators (1P/Halley and 103P/Hartley 2) and comets that are potentially in NPA rotational states (e.g., 2P/Encke). However, this apparition has been unusual for 252P. In the past three perihelion passages since discovery, the comet was very weakly active compared to other JFCs. Meteor evidence also exists that it probably has been very weakly active for a few hundred years. But in our data, we saw a very active comet in this 2016 apparition with an active fraction of 40% to >100%, representing an increase of 100x with respect to its recent past. Based on our observations, 252P has a small nucleus with a radius of ~0.3 km, which suggests that its rotational state could be relatively easily changed by torques caused by outgassing. Since the very weak outgassing in the past is not likely to change the rotational state
2010-10-01
... Trade Agreements-Balance of Payments Program Certificate. 252.225-7035 Section 252.225-7035 Federal... Trade Agreements—Balance of Payments Program Certificate. As prescribed in 225.1101(10), use the following provision: Buy American Act—Free Trade Agreements—Balance of Payments Program Certificate (DEC...
Chang, Ni-Bin; Houmann, Cameron; Lin, Kuen-Song; Wanielista, Martin
2016-07-01
Multiple adsorption and desorption cycles are required to achieve the reliable operation of copper removal and recovery. A green sorption media mixture composed of recycled tire chunk, expanded clay aggregate, and coconut coir was evaluated in this study for its desorptive characteristics as a companion study of the corresponding adsorption process in an earlier publication. We conducted a screening of potential desorbing agents, batch desorption equilibrium and kinetic studies, and batch tests through 3 adsorption/desorption cycles. The desorbing agent screening revealed that hydrochloric acid has good potential for copper desorption. Equilibrium data fit the Freundlich isotherm, whereas kinetic data had high correlation with the Lagergren pseudo second-order model and revealed a rapid desorption reaction. Batch equilibrium data over 3 adsorption/desorption cycles showed that the coconut coir and media mixture were the most resilient, demonstrating they could be used through 3 or more adsorption/desorption cycles. FE-SEM imaging, XRD, and EDS analyses supported the batch adsorption and desorption results showing significant surface sorption of CuO species in the media mixture and coconut coir, followed by partial desorption using 0.1 M HCl as a desorbing agent. Copyright © 2016 Elsevier Ltd. All rights reserved.
Photo-stimulated desorption from water and methane clusters on the surface of solid neon
International Nuclear Information System (INIS)
Arakawa Ichiri; Matsumoto Dairo; Takekuma Shinichi; Tamura Reimi; Miura Takashi
2012-01-01
Photo-stimulated desorption of ions from methane and water heterocluster on the surface of solid neon was studied. The desorption yields of the variety of photo-desorbed species showed strong dependence on the composition and the size of the mother cluster. It was found that the presence of a water molecule in the cluster significantly enhanced, or was almost essential for, the desorption of any species observed. Systematic investigation of the correlation between the cluster size and the desorption yield of each ion has revealed the mother cluster which yields the each desorbed ion.
International Nuclear Information System (INIS)
Wu, Qier
2014-01-01
In the framework of French radioactive waste management and storage, the durability evaluation and prediction of concrete structures requires the knowledge of desorption isotherm of concrete. The aim of the present study is to develop an accelerated experimental method to obtain desorption isotherm of cementitious materials more quickly and to estimate the Representative Volume Element (RVE) size related to the desorption isotherm of concrete. In order to ensure that experimental results can be statistically considered representative, a great amount of sliced samples of cementitious materials with three different thicknesses (1 mm, 2 mm and 3 mm) have been de-saturated. The effect of slice thickness and the saturation condition on the mass variation kinetics and the desorption isotherms is analyzed. The influence of the aggregate distribution on the water content and the water saturation degree is also analyzed. A method based on statistical analysis of water content and water saturation degree is proposed to estimate the RVE for water desorption experiment of concrete. The evolution of shrinkage with relative humidity is also followed for each material during the water desorption experiment. A protocol of cycle of rapid desaturation-re-saturation is applied and shows the existence of hysteresis between desorption and adsorption. (author)
NAA using Cf-252 after preconcentration
International Nuclear Information System (INIS)
Panyo, O.; Moebius, S.; Keller, C.
1988-01-01
Neutron activation analysis (NAA) with thermal neutron using Cf-252 sources was applied to elemental analysis of elements in water samples. A high-resolution Ge(Li) detector was employed for gamma-radiation detection. Both suspended particulate matter and liquid fraction were investigated after filtration. Preconcentration method by co-precipitation using iron (III) hydroxide and oxine were chosen for use. Elements which were considered to be able to detect in the present study are Al, As, Cl, K, Mg, Mn, Na, Sr, Ti, U, V and Zn
International Nuclear Information System (INIS)
Ishikawa, Kenji; Hori, Masaru
2014-01-01
Mechanisms of plasma-surface interaction are required to understand in order to control the reactions precisely. Recent progress in atmospheric pressure plasma provides to apply as a tool of sterilization of contaminated foodstuffs. To use the plasma with safety and optimization, the real time in situ detection of free radicals - in particular dangling bonds by using the electron-spin-resonance (ESR) technique has been developed because the free radical plays important roles for dominantly biological reactions. First, the kinetic analysis of free radicals on biological specimens such as fungal spores of Penicillium digitatum interacted with atomic oxygen generated plasma electric discharge. We have obtained information that the in situ real time ESR signal from the spores was observed and assignable to semiquinone radical with a g-value of around 2.004 and a line width of approximately 5G. The decay of the signal was correlated with a link to the inactivation of the fungal spore. Second, we have studied to detect chemical modification of edible meat after the irradiation. Using matrix-assisted laser desorption/ionization time-of-flight mass spectroscopy (MALDI-TOF-MS) and ESR, signals give qualification results for chemical changes on edible liver meat. The in situ real-time measurements have proven to be a useful method to elucidate plasma-induced surface reactions on biological specimens. (author)
Determination of kinetics parameters using stochastic methods in a 252Cf system
International Nuclear Information System (INIS)
Difilippo, F.C.
1988-01-01
Safety analysis and control system design of nuclear systems require the knowledge of neutron kinetics related parameters like effective delayed neutron fraction, neutron lifetime, time between neutron generations and subcriticality margins. Many methods, deterministic and stochastic, are being used, some since the beginning of nuclear power, to measure these important parameters. The method based on the use of the 252 Cf neutron source has been under intense study at the Oak Ridge National Laboratory, both experimentally and theoretically, during the last years. The increasing demand for this isotope in industrial and medical applications and new designs of advanced high flux reactors to produce it make the isotope available as neutron source (only few micrograms are necessary). A thin layer of 252 Cf is deposited in one of the electrodes of a fission chamber which produces pulses each time the 252 Cf disintegrates via α or spontaneous fission decay; the smaller pulses associated with the α decay can be easily discriminated with the important result that we known the time when v/sub c/ neutrons are injected into the system (number of neutrons per fission of 252 Cf). Thus, a small (few cm 3 ) and nonintrusive device can be used as a random pulsed neutron source with known natural properties that do no depend on biases associated with more complex interrogating devices like accelerators. This paper presents a general formalism that relates the kinetics parameters with stochastic descriptors that naturally appear because of the random nature of the production and transport of neutrons
Sorption and desorption of carbamazepine from water by smectite clays.
Zhang, Weihao; Ding, Yunjie; Boyd, Stephen A; Teppen, Brian J; Li, Hui
2010-11-01
Carbamazepine is a prescription anticonvulsant and mood stabilizing pharmaceutical administered to humans. Carbamazepine is persistent in the environment and frequently detected in water systems. In this study, sorption and desorption of carbamazepine from water was measured for smectite clays with the surface negative charges compensated with K+, Ca2+, NH4+, tetramethylammonium (TMA), trimethylphenylammonium (TMPA) and hexadecyltrimethylammonium (HDTMA) cations. The magnitude of sorption followed the order: TMPA-smectite≥HDTMA-smectite>NH4-smectite>K-smectite>Ca-smectite⩾TMA-smectite. The greatest sorption of carbamazepine by TMPA-smectite is attributed to the interaction of conjugate aromatic moiety in carbamazepine with the phenyl ring in TMPA through π-π interaction. Partitioning process is the primary mechanism for carbamazepine uptake by HDTMA-smectite. For NH4-smectite the urea moiety in carbamazepine interacts with exchanged cation NH4+ by H-bonding hence demonstrating relatively higher adsorption. Sorption by K-, Ca- and TMA-smectites from water occurs on aluminosilicate mineral surfaces. These results implicate that carbamazepine sorption by soils occurs primarily in soil organic matter, and soil mineral fractions play a secondary role. Desorption of carbamazepine from the sorbents manifested an apparent hysteresis. Increasing irreversibility of desorption vs. sorption was observed for K-, Ca-, TMA-, TMPA- and HDTMA-clays as aqueous carbamazepine concentrations increased. Desorption hysteresis of carbamazepine from K-, Ca-, NH4-smectites was greater than that from TMPA- and HDTMA-clays, suggesting that the sequestrated carbamazepine molecules in smectite interlayers are more resistant to desorption compared to those sorbed by organic phases in smectite clays. Copyright © 2010 Elsevier Ltd. All rights reserved.
Reactive Desorption of CO Hydrogenation Products under Cold Pre-stellar Core Conditions
Chuang, K.-J.; Fedoseev, G.; Qasim, D.; Ioppolo, S.; van Dishoeck, E. F.; Linnartz, H.
2018-02-01
The astronomical gas-phase detection of simple species and small organic molecules in cold pre-stellar cores, with abundances as high as ∼10‑8–10‑9 n H, contradicts the generally accepted idea that at 10 K, such species should be fully frozen out on grain surfaces. A physical or chemical mechanism that results in a net transfer from solid-state species into the gas phase offers a possible explanation. Reactive desorption, i.e., desorption following the exothermic formation of a species, is one of the options that has been proposed. In astronomical models, the fraction of molecules desorbed through this process is handled as a free parameter, as experimental studies quantifying the impact of exothermicity on desorption efficiencies are largely lacking. In this work, we present a detailed laboratory study with the goal of deriving an upper limit for the reactive desorption efficiency of species involved in the CO–H2CO–CH3OH solid-state hydrogenation reaction chain. The limit for the overall reactive desorption fraction is derived by precisely investigating the solid-state elemental carbon budget, using reflection absorption infrared spectroscopy and the calibrated solid-state band-strength values for CO, H2CO and CH3OH. We find that for temperatures in the range of 10 to 14 K, an upper limit of 0.24 ± 0.02 for the overall elemental carbon loss upon CO conversion into CH3OH. This corresponds with an effective reaction desorption fraction of ≤0.07 per hydrogenation step, or ≤0.02 per H-atom induced reaction, assuming that H-atom addition and abstraction reactions equally contribute to the overall reactive desorption fraction along the hydrogenation sequence. The astronomical relevance of this finding is discussed.
Desorption of Furfural from Bimetallic Pt-Fe Oxides/Alumina Catalysts
Gloria Lourdes Dimas-Rivera; Javier Rivera de la Rosa; Carlos J. Lucio-Ortiz; José Antonio De los Reyes Heredia; Virgilio González González; Tomás Hernández
2014-01-01
In this work, the desorption of furfural, which is a competitive intermediate during the production of biofuel and valuable aromatic compounds, was studied using pure alumina, as well as alumina impregnated with iron and platinum oxides both individually and in combination, using thermogravimetric analysis (TGA). The bimetallic sample exhibited the lowest desorption percentage for furfural. High-resolution transmission electron microscopy (HRTEM) imaging revealed the intimate connection betwe...
International Nuclear Information System (INIS)
Bakir, Adil; Rowland, Steven J.; Thompson, Richard C.
2014-01-01
Microplastics have the potential to uptake and release persistent organic pollutants (POPs); however, subsequent transfer to marine organisms is poorly understood. Some models estimating transfer of sorbed contaminants to organisms neglect the role of gut surfactants under differing physiological conditions in the gut (varying pH and temperature), examined here. We investigated the potential for polyvinylchloride (PVC) and polyethylene (PE) to sorb and desorb 14 C-DDT, 14 C-phenanthrene (Phe), 14 C-perfluorooctanoic acid (PFOA) and 14 C-di-2-ethylhexyl phthalate (DEHP). Desorption rates of POPs were quantified in seawater and under simulated gut conditions. Influence of pH and temperature was examined in order to represent cold and warm blooded organisms. Desorption rates were faster with gut surfactant, with a further substantial increase under conditions simulating warm blooded organisms. Desorption under gut conditions could be up to 30 times greater than in seawater alone. Of the POP/plastic combinations examined Phe with PE gave the highest potential for transport to organisms. Highlights: • PVC and PE (200–250 μm) were able to sorb phenanthrene, DDT, PFOA and DEHP. • Desorption rates were faster using a gut surfactant compared to seawater alone. • Desorption rates were further enhanced at lower pH and higher temperature. • Plastic-POPs were ranked according to their potential to cause “harm”. -- Desorption rates of sorbed POPs from plastics were substantially enhanced under gut conditions specific of warm blooded organisms, suggesting potential transfer following ingestion
A YOUNG ECLIPSING BINARY AND ITS LUMINOUS NEIGHBORS IN THE EMBEDDED STAR CLUSTER Sh 2-252E
Energy Technology Data Exchange (ETDEWEB)
Lester, Kathryn V.; Gies, Douglas R.; Guo, Zhao, E-mail: lester@chara.gsu.edu, E-mail: gies@chara.gsu.edu, E-mail: guo@chara.gsu.edu [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 5060, Atlanta, GA 30302-5060 (United States)
2016-12-01
We present a photometric and light curve analysis of an eccentric eclipsing binary in the K2 Campaign 0 field, which resides in Sh 2-252E, a young star cluster embedded in an H ii region. We describe a spectroscopic investigation of the three brightest stars in the crowded aperture to identify which is the binary system. We find that none of these stars are components of the eclipsing binary system, which must be one of the fainter nearby stars. These bright cluster members all have remarkable spectra: Sh 2-252a (EPIC 202062176) is a B0.5 V star with razor sharp absorption lines, Sh 2-252b is a Herbig A0 star with disk-like emission lines, and Sh 2-252c is a pre-main-sequence star with very red color.
Measurements of VOC adsorption/desorption characteristics of typical interior building materials
Energy Technology Data Exchange (ETDEWEB)
An, Y.; Zhang, J.S.; Shaw, C.Y.
2000-07-01
The adsorption/desorption of volatile organic compounds (VOCs) on interior building material surfaces (i.e., the sink effect) can affect the VOC concentrations in a building, and thus need to be accounted for an indoor air quality (IAQ) prediction model. In this study, the VOC adsorption/desorption characteristics (sink effect) were measured for four typical interior building materials including carpet, vinyl floor tile, painted drywall, and ceiling tile. The VOCs tested were ethylbenzene, cyclohexanone, 1,4-dichlorobenzene, benzaldehyde, and dodecane. These five VOCs were selected because they are representative of hydrocarbons, aromatics, ketones, aldehydes, and chlorine substituted compounds. The first order reversible adsorption/desorption model was based on the Langmuir isotherm was used to analyze the data and to determine the equilibrium constant of each VOC-material combination. It was found that the adsorption/desorption equilibrium constant, which is a measure of the sink capacity, increased linearly with the inverse of the VOC vapor pressure. For each compound, the adsorption/desorption equilibrium constant, and the adsorption rate constant differed significantly among the four materials tested. A detailed characterization of the material structure in the micro-scale would improve the understanding and modeling of the sink effect in the future. The results of this study can be used to estimate the impact of sink effect on the VOC concentrations in buildings.
Study of the mechanisms of matrix assisted laser desorption / ionization
International Nuclear Information System (INIS)
Manuelli, Pascal
1995-01-01
This research thesis aims at a better knowledge of some aspects of a complex mechanism: the matrix-assisted laser desorption/ionization (MALDI). The author first proposes a comparative analysis of results obtained by time-of-flight (TOF) mass spectrometry and by Fourier transform mass spectrometry. He reports the study of the matrix role (notably a polymeric matrix) as a matter submitted to laser desorption. In this respect, the influence of the incident wavelength has been studied. The author also reports a comparative of ions produced by matrix laser desorption (study performed by Fourier transform mass spectrometry) and of neutral molecules (study performed by flash pyrolysis coupled with gas chromatography and with mass spectrometry). Finally, results obtained on derivatives and complexes based on beta-cyclodextrins highlight benefits as well as limitations of this technique [fr
Site Specificity in Femtosecond Laser Desorption of Neutral H Atoms from Graphite(0001)
DEFF Research Database (Denmark)
Frigge, R.; Hoger, T.; Siemer, B.
2010-01-01
Femtosecond laser excitation and density functional theory reveal site and vibrational state specificity in neutral atomic hydrogen desorption from graphite induced by multiple electronic transitions. Multimodal velocity distributions witness the participation of ortho and para pair states...... of chemisorbed hydrogen in the desorption process. Very slow velocities of 700 and 400 ms-1 for H and D atoms are associated with the desorption out of the highest vibrational state of a barrierless potential....
Analysis of geological material and especially ores by means of a 252Cf source
International Nuclear Information System (INIS)
Barrandon, J.N.; Borderie, B.; Melky, S.; Halfon, J.; Marce, A.
1976-01-01
Tests were made on the possibilities for analysis by 252 Cf activation in the earth sciences and mining research. The results obtained show that while 252 Cf activation can only resolve certain very specific geochemical research problems, it does allow the exact and rapid determination of numerous elements whose ores are of great economic importance such as fluorine, titanium, vanadium, manganese, copper, antimony, barium, and tungsten. The utilization of activation analysis methods in the earth sciences is not a recent phenomenon. It has generally been limited to the analysis of traces in relatively small volumes by means of irradiation in nuclear reactors. Traditional neutron sources were little used and were not very applicable. The development of 252 Cf isotopic sources emitting more intense neutron fluxes make it possible to consider carrying out more sensitive determinations without making use of a nuclear reactor. In addition, this technique can be adapted for in situ analysis in mines and mine borings. Our work which is centered upon the possibilities of instrumental laboratory analyses of geological materials through 252 Cf activation is oriented in two principal directions: the study of the experimental sensitivities of the various elements in different rocks with the usual compositions; and the study of the possibilities for routine ore analyses
Hydrogen Temperature-Programmed Desorption (H2 TPD) of Supported Platinum Catalysts.
Koningsberger, D.C.; Miller, J.T.; Meyers, B.L.; Modica, F.S.; Lane, G.S.; Vaarkamp, M.
1993-01-01
Hydrogen temperature-programmed desorption (TPD) of supported platinum catalysts, Pt/KLTL, Pt/H-LTL, Pt/K-MAZ, Pt/H-MAZ, Pt/-Al2O3, and Pt/SiO2, was performed after hydrogen reduction at 300, 450, or 650°C. For all catalysts, reversible desorption of chemisorbed hydrogen occurred at approximately
Desorption of Ba and 226Ra from river-borne sediments in the Hudson estuary
International Nuclear Information System (INIS)
Li, Y.-H.
1979-01-01
The pronounced desorption of Ba and 226 Ra from river-borne sediments in the Hudson estuary can be explained quantitatively by the drastic decrease in the distribution coefficients of both elements from a fresh to a salty water medium. The desorption in estuaries can augment, at least, the total global river fluxes of dissolved Ba and 226 Ra by one and nine times, respectively. The desorption flux of 226 Ra from estuaries accounts for 17-43% of the total 226 Ra flux from coastal sediments. Two mass balance models depicting mixing and adsorption-desorption processes in estuaries are discussed. (Auth.)
A new theoretical approach to adsorption desorption behavior of Ga on GaAs surfaces
Kangawa, Y.; Ito, T.; Taguchi, A.; Shiraishi, K.; Ohachi, T.
2001-11-01
We propose a new theoretical approach for studying adsorption-desorption behavior of atoms on semiconductor surfaces. The new theoretical approach based on the ab initio calculations incorporates the free energy of gas phase; therefore we can calculate how adsorption and desorption depends on growth temperature and beam equivalent pressure (BEP). The versatility of the new theoretical approach was confirmed by the calculation of Ga adsorption-desorption transition temperatures and transition BEPs on the GaAs(0 0 1)-(4×2)β2 Ga-rich surface. This new approach is feasible to predict how adsorption and desorption depend on the growth conditions.
8 CFR 252.5 - Special procedures for deserters from Spanish or Greek ships of war.
2010-01-01
... Spanish or Greek ships of war. 252.5 Section 252.5 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY... Greek ships of war. (a) General. Under E.O. 11267 of January 19, 1966 (31 FR 807) and 28 CFR 0.109, and... a ship of war of that government, while in any port of the United States, and on proof by the...
2010-10-01
... subcontractor advance payments-DoD pilot mentor-protege program. 252.232-7005 Section 252.232-7005 Federal... subcontractor advance payments—DoD pilot mentor-protege program. As prescribed in 232.412-70(c), use the following clause: Reimbursement of Subcontractor Advance Payments—DoD Pilot Mentor-Protege Program (SEP 2001...
Langmuir probe measurement of the bismuth plasma plume formed by an extreme-ultraviolet pulsed laser
International Nuclear Information System (INIS)
Pira, P; Burian, T; Kolpaková, A; Tichý, M; Kudrna, P; Daniš, S; Wild, J; Juha, L; Lančok, J; Vyšín, L; Civiš, S; Zelinger, Z; Kubát, P
2014-01-01
Properties of the plasma plume produced on a bismuth (Bi) target irradiated by a focused extreme-ultraviolet (XUV) capillary-discharge laser beam were investigated. Langmuir probes were used in both single- and double-probe arrangements to determine the electron temperature and the electron density, providing values of 1–3 eV and ∼10 13 –10 14 m −3 , respectively. Although the temperatures seem to be comparable with values obtained in ablation plasmas produced by conventional, long-wavelength lasers, the density is significantly lower. This finding indicates that the desorption-like phenomena are responsible for the plume formation rather than the ablation processes. A very thin Bi film was prepared on an MgO substrate by pulsed XUV laser deposition. The non-uniform, sub-monolayer character of the deposited bismuth film confirms the Langmuir probe's observation of the desorption-like erosion induced by the XUV laser on the primary Bi target. (paper)
The desorptivity model of bulk soil-water evaporation
Clapp, R. B.
1983-01-01
Available models of bulk evaporation from a bare-surfaced soil are difficult to apply to field conditions where evaporation is complicated by two main factors: rate-limiting climatic conditions and redistribution of soil moisture following infiltration. Both factors are included in the "desorptivity model', wherein the evaporation rate during the second stage (the soil-limiting stage) of evaporation is related to the desorptivity parameter, A. Analytical approximations for A are presented. The approximations are independent of the surface soil moisture. However, calculations using the approximations indicate that both soil texture and soil moisture content at depth significantly affect A. Because the moisture content at depth decreases in time during redistribution, it follows that the A parameter also changes with time. Consequently, a method to calculate a representative value of A was developed. When applied to field data, the desorptivity model estimated cumulative evaporation well. The model is easy to calculate, but its usefulness is limited because it requires an independent estimate of the time of transition between the first and second stages of evaporation. The model shows that bulk evaporation after the transition to the second stage is largely independent of climatic conditions.
WATER ADSORPTION AND DESORPTION ISOTHERMS ON MILK POWDER: II. WHOLE MILK
Directory of Open Access Journals (Sweden)
Edgar M. Soteras
2014-03-01
Full Text Available The aim of this research was the determination of adsorption and desorption isotherms of cow whole milk powder. The experiments have been carried out at 15, 25 and 40 ºC, in ranges of moisture and water activity characteristic of normal conditions in which the processes of drying, packaging and storage are developed. By studying the influence of the temperature on the experimental plots, the isosteric adsorption heat was determined. Experimental data were correlated to the referential model of Guggenheim, Anderson and Boer (GAB. For both, adsorption and desorption, a good model fit was observed. The isotherms showed very similar shapes between them and, by comparing adsorption and desorption isotherms, the phenomenon of hysteresis was confirmed.
48 CFR 252.234-7002 - Earned Value Management System.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Earned Value Management... of Provisions And Clauses 252.234-7002 Earned Value Management System. As prescribed in 234.203(2), use the following clause: Earned Value Management System (APR 2008) (a) In the performance of this...
48 CFR 252.227-7007 - License term-running royalty.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term-running... of Provisions And Clauses 252.227-7007 License term—running royalty. As prescribed at 227.7009-4(b), insert the following clause in patent releases, license agreements, and assignments: License Term—Running...
Bulk-mediated surface diffusion: non-Markovian desorption dynamics
International Nuclear Information System (INIS)
Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S
2005-01-01
Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations
GaN CVD Reactions: Hydrogen and Ammonia Decomposition and the Desorption of Gallium
International Nuclear Information System (INIS)
Bartram, Michael E.; Creighton, J. Randall
1999-01-01
Isotopic labeling experiments have revealed correlations between hydrogen reactions, Ga desorption, and ammonia decomposition in GaN CVD. Low energy electron diffraction (LEED) and temperature programmed desorption (TPD) were used to demonstrate that hydrogen atoms are available on the surface for reaction after exposing GaN(0001) to deuterium at elevated temperatures. Hydrogen reactions also lowered the temperature for Ga desorption significantly. Ammonia did not decompose on the surface before hydrogen exposure. However, after hydrogen reactions altered the surface, N 15 H 3 did undergo both reversible and irreversible decomposition. This also resulted in the desorption of N 2 of mixed isotopes below the onset of GaN sublimation, This suggests that the driving force of the high nitrogen-nitrogen bond strength (226 kcal/mol) can lead to the removal of nitrogen from the substrate when the surface is nitrogen rich. Overall, these findings indicate that hydrogen can influence G-aN CVD significantly, being a common factor in the reactivity of the surface, the desorption of Ga, and the decomposition of ammonia
SPS Ion Induced Desorption Experiment
Maximilien Brice
2003-01-01
This experiment will give a study about the induced desorption from heavy ion (Indium ion run from week 45 in SPS T4-H8 area) impacting LHC type graphite collimator. 4 different samples are located in the 4 chambers 90° one to each other: pure graphite, graphite with copper coating, graphite with NEG coating, 316LN stainless steal (reference).
International Nuclear Information System (INIS)
Ji Gang; Guo Yong; Luo Yisheng; Zhang Wenzhong
2001-01-01
Objective: To provide useful parameters for neutron radiotherapy, the author presents results of a Monte Carlo simulation study investigating the dosimetric characteristics of linear 252 Cf fission neutron sources. Methods: A 252 Cf fission source and tissue equivalent phantom were modeled. The dose of neutron and gamma radiations were calculated using Monte Carlo Code. Results: The dose of neutron and gamma at several positions for 252 Cf in the phantom made of equivalent materials to water, blood, muscle, skin, bone and lung were calculated. Conclusion: The results by Monte Carlo methods were compared with the data by measurement and references. According to the calculation, the method using water phantom to simulate local tissues such as muscle, blood and skin is reasonable for the calculation and measurements of dose distribution for 252 Cf
Effects of an electron beam on adsorption and desorption of ammonia on ruthenium (0001)
International Nuclear Information System (INIS)
Danielson, L.R.; Dresser, M.J.; Donaldson, E.E.; Sandstrom, D.R.
1978-01-01
The effects of an electron beam on ammonia adsorption and desorption on Ru(0001) have been investigated by Auger electron spectroscopy, low-energy electron diffraction, and thermal flash desorption. Appreciable adsorption at room temperature occurred only on the area of the Ru crystal which had been bombarded by an electron beam during dosing. The adsorption rate was a function of beam current density and ammonia pressure, and an apparent (2x2) diffraction pattern appeared in the area bombarded by the electron beam. Electron bombardment of the molecular γ states of ammonia followed by flash desorption showed that less ammonia and more hydrogen and nitrogen were desorbed as the bombardment time increased. An analysis of this process based on electron-induced dissociation of the ammonia molecule yielded an effective initial dissociation cross section of 3x10 -6 cm 2 . Hydrogen flash desorption spectra after bombardment of the γ states obeying first order kinetics with desorption energies of 0.78 and 1.0 eV. Electron bombardment of the γ states for short times produced the same effects on the ammonia flash desorption spectra as preadsorption of hydrogen. (Auth.)
Stable Isotope Systematics of Coalbed Gas during Desorption and Production
Directory of Open Access Journals (Sweden)
Martin Niemann
2017-06-01
Full Text Available The stable carbon isotope ratios of coalbed methane (CBM demonstrate diagnostic changes that systematically vary with production and desorption times. These shifts can provide decisive, predictive information on the behaviour and potential performance of CBM operations. Samples from producing CBM wells show a general depletion in 13C-methane with increasing production times and corresponding shifts in δ13C-CH4 up to 35.8‰. Samples from canister desorption experiments show mostly enrichment in 13C for methane with increasing desorption time and isotope shifts of up to 43.4‰. Also, 13C-depletion was observed in some samples with isotope shifts of up to 32.1‰. Overall, the magnitudes of the observed isotope shifts vary considerably between different sample sets, but also within samples from the same source. The δ13C-CH4 values do not have the anticipated signature of methane generated from coal. This indicates that secondary processes, including desorption and diffusion, can influence the values. It is also challenging to deconvolute these various secondary processes because their molecular and isotope effects can have similar directions and/or magnitudes. In some instances, significant alteration of CBM gases has to be considered as a combination of secondary alteration effects.
Evaluation of mass distribution data from 252Cf spontaneous fission
International Nuclear Information System (INIS)
Liu Tingjin
2003-01-01
The mass distribution data of 252 Cf spontaneous fission were evaluated based on 7 sets of available experimental data. The measured data were corrected for the standards and γ intensity used by using the new evaluated ones. The errors were made necessary adjusting. The evaluated experimental data were fitted with spline function without any restriction and with symmetric restriction. These two sets of fit data were recommended as reference data of the mass distribution of 252 Cf spontaneous fission. The errors of the recommended data were considerably reduced comparing with the measured ones. The light and heavy peaks are not completely symmetric. Also there are fine structures on the right side of the light peak at A=109-111 and left side of the heavy peak at A=137-139. These should be paid attention and studied further. (author)
Effective source size as related to 252Cf neutron radiography
International Nuclear Information System (INIS)
Wada, Nobuo; Enomoto, Shigemasa; Tachikawa, Noboru; Nojiri, Toshiaki.
1977-01-01
The effective source size in 252 Cf thermal neutron radiography, relating to its geometrical unsharpness in image formation, is experimentally studied. A neutron radiographic system consists of a 160 μg 252 Cf neutron source, water moderator and divergent cadmium lined collimator. Thermal neutron image detection is performed with using a LiF scintillator and a high speed X-ray film to employ direct exposure method. The modulation transfer function, used for describing image quality, is derived from radiographic image corresponding to a cadmium plate with sharp edge. The modulation transfer function for the system is expressed by the product of the function for both geometrical and inherent unsharpness, and allows isolation of geometrical unsharpness as related to the effective size of the thermal neutron source. It is found to be 80 -- 90% of the collimator inlet diameter. (auth.)
Desorption of Furfural from Bimetallic Pt-Fe Oxides/Alumina Catalysts
Directory of Open Access Journals (Sweden)
Gloria Lourdes Dimas-Rivera
2014-01-01
Full Text Available In this work, the desorption of furfural, which is a competitive intermediate during the production of biofuel and valuable aromatic compounds, was studied using pure alumina, as well as alumina impregnated with iron and platinum oxides both individually and in combination, using thermogravimetric analysis (TGA. The bimetallic sample exhibited the lowest desorption percentage for furfural. High-resolution transmission electron microscopy (HRTEM imaging revealed the intimate connection between the iron and platinum oxide species on the alumina support. The mechanism of furfural desorption from the Pt-Fe/Al2O3 0.5%-0.5% sample was determined using physisorbed furfural instead of chemisorbed furfural; this mechanism involved the oxidation of the C=O group on furfural by the catalyst. The oxide nanoparticles on γ-Al2O3 support helped to stabilize the furfural molecule on the surface.
Temperature suppression of STM-induced desorption of hydrogen on Si(100) surfaces
DEFF Research Database (Denmark)
Thirstrup, C.; Sakurai, M.; Nakayama, T.
1999-01-01
The temperature dependence of hydrogen (H) desorption from Si(100) H-terminated surfaces by a scanning tunneling microscope (STM) is reported for negative sample bias. It is found that the STM induced H desorption rate (R) decreases several orders of magnitude when the substrate temperature...
First-principles calculations of helium and neon desorption from cavities in silicon
International Nuclear Information System (INIS)
Eddin, A Charaf; Pizzagalli, L
2012-01-01
Combining density functional theory, the nudged elastic band technique, and the ultradense fluid model, we investigated the desorption process of He and Ne in silicon. Our results show that the internal surfaces of gas-filled bubbles are not a limiting factor during desorption experiments, since the surface reconstruction opens diffusion paths easier than in the bulk. We show that the vibrational contribution to the energy of helium in the bulk has to be considered in order to determine realistic pressures in the bubbles, when comparing experiments and simulations. At the maximum of desorption, an average pressure of 1-2 GPa is computed. (paper)
Thomas, J P; Nsouli, B; Darwish, T; Fallavier, M; Khoury, R; Wehbé, N
2005-01-01
The assessment of the plasma desorption time-of-flight mass spectrometry (PD-TOFMS) technique as a tool for direct characterization of pesticides adsorbed on agricultural soil is made for the first time in this study. Pellets of soils impregnated by solutions of three pesticides, namely norflurazon, malathion and oxyfluorfen, as well as deposits of these solutions onto aluminum surfaces, were investigated to this end. The yield values of the most characteristic peaks of the negative ion mass spectra were used to determine both the lowest concentrations detected on soils and limits of detection from thin films. The lowest values on soils are for malathion (1000 ppm range), and the largest for norflurazon (20,000 ppm), which is close to the limit of detection (LOD) found for the pesticide on the aluminum substrate (approximately 0.2 microg . cm(-2)). Different behaviors were observed as a function of time of storage in the ambient atmosphere or under vacuum; norflurazon adsorbed on soil exhibited high stability for a long period of time, and a rapid degradation of malathion with the elapsed time was clearly observed. The behavior of oxyfluorfen was also investigated but segregation processes seem to occur after several days. Although by far less sensitive than conventional methods based on extraction processes and used for real-world analytical applications, this technique is well suited to the study of the transformations occurring at the sample surface. A discussion is presented of the future prospects of such experiments in degradation studies. Copyright (c) 2005 John Wiley & Sons, Ltd.
Heavy-Ion-Induced Electronic Desorption of Gas from Metals
Molvik, A W; Mahner, E; Kireeff Covo, M; Bellachioma, M C; Bender, M; Bieniosek, F M; Hedlund, E; Krämer, A; Kwan, J; Malyshev, O B; Prost, L; Seidl, P A; Westenskow, G; Westerberg, L
2007-01-01
During heavy-ion operation in several particle accelerators worldwide, dynamic pressure rises of orders of magnitude were triggered by lost beam ions that bombarded the vacuum chamber walls. This ion-induced molecular desorption, observed at CERN, GSI, and BNL, can seriously limit the ion beam lifetime and intensity of the accelerator. From dedicated test stand experiments we have discovered that heavy-ion-induced gas desorption scales with the electronic energy loss (dEe/dx) of the ions slowing down in matter; but it varies only little with the ion impact angle, unlike electronic sputtering.
Counterion adsorption and desorption rate of a charged macromolecule
Shi, Yu; Yang, Jingfa; Zhao, Jiang
The rate constant of counterion adsorption to and desorption from a synthetic polyelectrolyte, polystyrene sulfonate (PSS-), is measured in aqueous solution by single molecule fluorescence spectroscopy. The results show that both adsorption and desorption rate of counterions have strong dependence on polymer concentration, salt concentration as well as the molecular weight of polyelectrolytes. The results clearly demonstrate that the contribution of electrostatic interaction and the translational entropy to the distribution of counterions of a polyelectrolyte molecule. The information is helpful to the understanding of polyelectrolyte physics. National Natural Science Foundation of China.
Unconventional resource's production under desorption-induced effects
Directory of Open Access Journals (Sweden)
S. Sina Hosseini Boosari
2016-06-01
We have developed a numerical model to study the effect of changes in porosity, permeability and compaction on four major U.S. shale formations considering their Langmuir isotherm desorption behavior. These resources include; Marcellus, New Albany, Barnett and Haynesville Shales. First, we introduced a model that is a physical transport of single-phase gas flow in shale porous rock. Later, the governing equations are implemented into a one-dimensional numerical model and solved using a fully implicit solution method. It is found that the natural gas production is substantially affected by desorption-induced porosity/permeability changes and geomechancis. This paper provides valuable insights into accurate modeling of unconventional reservoirs that is more significant when an even small correction to the future production prediction can enormously contribute to the U.S. economy.
48 CFR 252.227-7006 - License grant-running royalty.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License grant-running... of Provisions And Clauses 252.227-7006 License grant—running royalty. As prescribed at 227.7009-4(a...—Running Royalty (AUG 1984) (a) The Contractor hereby grants to the Government, as represented by the...
48 CFR 252.227-7033 - Rights in shop drawings.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in shop drawings... of Provisions And Clauses 252.227-7033 Rights in shop drawings. As prescribed in 227.7107-(1)(c), use the following clause: Rights in Shop Drawings (APR 1966) (a) Shop drawings for construction means...
Thermal desorption of formamide and methylamine from graphite and amorphous water ice surfaces
Chaabouni, H.; Diana, S.; Nguyen, T.; Dulieu, F.
2018-04-01
Context. Formamide (NH2CHO) and methylamine (CH3NH2) are known to be the most abundant amine-containing molecules in many astrophysical environments. The presence of these molecules in the gas phase may result from thermal desorption of interstellar ices. Aims: The aim of this work is to determine the values of the desorption energies of formamide and methylamine from analogues of interstellar dust grain surfaces and to understand their interaction with water ice. Methods: Temperature programmed desorption (TPD) experiments of formamide and methylamine ices were performed in the sub-monolayer and monolayer regimes on graphite (HOPG) and non-porous amorphous solid water (np-ASW) ice surfaces at temperatures 40-240 K. The desorption energy distributions of these two molecules were calculated from TPD measurements using a set of independent Polanyi-Wigner equations. Results: The maximum of the desorption of formamide from both graphite and ASW ice surfaces occurs at 176 K after the desorption of H2O molecules, whereas the desorption profile of methylamine depends strongly on the substrate. Solid methylamine starts to desorb below 100 K from the graphite surface. Its desorption from the water ice surface occurs after 120 K and stops during the water ice sublimation around 150 K. It continues to desorb from the graphite surface at temperatures higher than160 K. Conclusions: More than 95% of solid NH2CHO diffuses through the np-ASW ice surface towards the graphitic substrate and is released into the gas phase with a desorption energy distribution Edes = 7460-9380 K, which is measured with the best-fit pre-exponential factor A = 1018 s-1. However, the desorption energy distribution of methylamine from the np-ASW ice surface (Edes = 3850-8420 K) is measured with the best-fit pre-exponential factor A = 1012 s-1. A fraction of solid methylamine monolayer of roughly 0.15 diffuses through the water ice surface towards the HOPG substrate. This small amount of methylamine
Thermal desorption spectroscopy of boron/carbon films after keV deuterium irradiation
International Nuclear Information System (INIS)
Yamaki, T.; Gotoh, Y.; Ando, T.; Jimbou, R.; Ogiwara, N.; Saidoh, M.
1994-01-01
Thermal desorption spectroscopy (TDS) of D 2 and CD 4 was done on boron/carbon films (B/(B+C)=0-74%), after 3 keV D 3 + irradiation to 4.5x10 17 D/cm 2 at 473 K. The D 2 desorption peaks were observed at 1050, 850 and 650 K. For a sputter B/C film (0%), only the 1050 K peak was observed. With increasing boron concentration to 3%, a sharp peak appeared at 850 K, the intensity of which was found to increase with increasing boron concentration to 23%, and then to decrease at 74%. The 650 K shoulder, which was observed for high boron concentration specimens, was speculated to be deuterium trapped by boron atoms in the boron clusters. The relative amount of CD 4 desorption was found to decrease with increasing boron concentration, which was attributed to the decrease in the trapped deuterium concentration in the implantation layer at temperatures at which CD 4 desorption proceeds. ((orig.))
Kinetics Study of Gas Pollutant Adsorption and Thermal Desorption on Silica Gel
Directory of Open Access Journals (Sweden)
Rong A
2017-06-01
Full Text Available Silica gel is a typical porous desiccant material. Its adsorption performance for gaseous air pollutants was investigated to determine its potential contribution to reducing such pollutants. Three gaseous air pollutants, toluene, carbon dioxide, and methane, were investigated in this paper. A thermogravimetric analyzer was used to obtain the equilibrium adsorption capacity of gases on single silica gel particles. The silica gel adsorption capacity for toluene is much higher than that for carbon dioxide and methane. To understand gas pollutant thermal desorption from silica gel, the thermogravimetric analysis of toluene desorption was conducted with 609 ppm toluene vapor at 313 K, 323 K, and 333 K. The overall regeneration rate of silica gel was strongly dependent on temperature and the enthalpy of desorption. The gas pollutant adsorption performance and thermal desorption on silica gel material may be used to estimate the operating and design parameters for gas pollutant adsorption by desiccant wheels.
Temperature dependence of CO desorption kinetics at a novel Pt-on-Au/C PEM fuel cell anode
DEFF Research Database (Denmark)
Pitois, A.; Pilenga, A.; Pfrang, A.
2010-01-01
techniques. The temperature dependence of the CO desorption process on this system has been investigated using isotopic exchange experiments. The CO desorption kinetics have been studied as a function of temperature and flow rate. Desorption rate constants have been measured for a temperature range between...... degrees C. The dependence in temperature of the desorption rate constants for the novel Pt-on-Au/C system is however much lower than that observed for the Pt/C system. This suggests that the nature of the substrate has a significant influence on the catalyst surface properties. It shows that, in surface...... 25 and 150 degrees C. These desorption rate constants have been compared with the benchmarking desorption rate data obtained for the commercial Pt/C catalyst under similar experimental conditions. A comparable desorption rate constant for the Pt-on-Au/C and Pt/C systems has been obtained at 25...
Oxygen plasma treatment of HKUST-1 for porosity retention upon exposure to moisture.
Bae, Jaeyeon; Jung, Jin-Woo; Park, Hyo Yul; Cho, Chang-Hee; Park, Jinhee
2017-11-07
Despite their remarkable properties, metal-organic frameworks (MOFs) present vulnerable structures that are sensitive to moisture; therefore, their application to real field situations is challenging. Herein, an O 2 plasma technique was introduced as a new method for the activation and protection of porosity in HKUST-1. In an unprecedented manner, O 2 plasma-treated HKUST-1 retains its porosity after a long exposure to moisture as compared to pristine HKUST-1. Porosity retention was examined by N 2 adsorption/desorption measurements of non-activated HKUST-1 after exposure to moisture.
Directory of Open Access Journals (Sweden)
Jung-Fa Tsai
2017-07-01
Full Text Available This case–control study aimed to assess the interactive effect between polymorphisms of lymphotoxin (LT α +252 and habitual substance use on risk of hepatocellular carcinoma (HCC. We enrolled 150 pairs of sex- and age-matched HCC patients and unrelated healthy controls. LTα genotypes were detected with polymerase-chain reaction and restrictive fragment length polymorphisms. Information about habits of substance use was obtained through personal interview. Multivariate analysis indicated that LTα +252 G/G genotypes [odds ratio (OR = 3.36], Hepatitis B surface antigen (OR = 16.68, antibodies to hepatitis C virus (OR = 34.88 and having at least two habits of substance use (OR = 2.50 were independent risk factors for HCC. There were additive interactions among LTα +252 G/G genotype, chronic viral hepatitis, and habit of each substance use. In conclusion: There are independent and additive interactions between LTα +252 G/G genotype, chronic viral hepatitis, and habits of substance use on risk of HCC.
The feasibility of desorption on Zeolite-water pair using dry gas
Oktariani, E.; Nakashima, K.; Noda, A.; Xue, B.; Tahara, K.; Nakaso, K.; Fukai, J.
2018-04-01
The increase in temperature, reduction in partial pressure, reduction in concentration, purging with an inert fluid, and displacement with a more strongly adsorbing species are the basic things that occur in the practical method of desorption. In this study, dry gas at constant temperature and pressure was employed as the aid to reduce the partial pressure in the water desorption on the zeolite 13X. The objective of this study is to confirm the feasibility of desorption using dry gas experimentally and numerically. The implication of heat and mass transfers were numerically investigated to find the most influential. The results of numerical simulation agree with the experimental ones for the distribution of local temperature and average water adsorbed in the packed bed.
48 CFR 252.228-7001 - Ground and flight risk.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Ground and flight risk... of Provisions And Clauses 252.228-7001 Ground and flight risk. As prescribed in 228.370(b), use the following clause: Ground and Flight Risk (JUN 2010) (a) Definitions. As used in this clause— (1) Aircraft...
48 CFR 252.227-7020 - Rights in special works.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in special works... of Provisions And Clauses 252.227-7020 Rights in special works. As prescribed in 227.7105-3, 227.7106(a) or 227.7205(a), use the following clause: Rights in Special Works (JUN 1995) (a) Applicability...
Rapid decompression and desorption induced energetic failure in coal
Directory of Open Access Journals (Sweden)
Shugang Wang
2015-06-01
Full Text Available In this study, laboratory experiments are conducted to investigate the rapid decompression and desorption induced energetic failure in coal using a shock tube apparatus. Coal specimens are recovered from Colorado at a depth of 610 m. The coal specimens are saturated with the strong sorbing gas CO2 for a certain period and then the rupture disc is suddenly broken on top of the shock tube to generate a shock wave propagating upwards and a rarefaction wave propagating downwards through the specimen. This rapid decompression and desorption has the potential to cause energetic fragmentation in coal. Three types of behaviors in coal after rapid decompression are found, i.e. degassing without fragmentation, horizontal fragmentation, and vertical fragmentation. We speculate that the characteristics of fracture network (e.g. aperture, spacing, orientation and stiffness and gas desorption play a role in this dynamic event as coal can be considered as a dual porosity, dual permeability, dual stiffness sorbing medium. This study has important implications in understanding energetic failure process in underground coal mines such as coal gas outbursts.
Sorption and desorption of tritiated water vapor on piping materials of nuclear fusion reactor
Energy Technology Data Exchange (ETDEWEB)
Tanaka, Satoru; Ohmori, Rumi [Tokyo Univ. (Japan). Faculty of Engineering
1996-10-01
Sorption and desorption of D{sub 2}O on Cr{sub 2}O{sub 3}, NiO, SS316 powders were studied at ambient temperature. When D{sub 2}O were contacted with samples after drying at 303K, broad peak was observed at 2100-2700cm{sup -1} on Cr{sub 2}O{sub 3} and NiO. Sorption and desorption rate depended on wave numbers. Isotope exchange rate with H{sub 2}O vapor was faster than dry desorption rate. By heating pretreatment, sorption amount and desorption rate for Cr{sub 2}O{sub 3} and NiO decreased. For SS316, broad peak was observed only after heating pretreatment at 673K. (author)
Study of defects near molybdenum surface using thermal desorption spectrometer
International Nuclear Information System (INIS)
Naik, P.K.
1980-01-01
Thermal desorption spectrometry is utilized to study the migration of atoms and defects near molybdenum surface. The thermal desorption spectra of inert gas ions (neon, argon and krypton) injected with various energies (430-1950 eV) into a polycrystalline molybdenum target with various dosages (6.4 x 10sup(12) - 3.9 x 10sup(14) ions/cmsup(2)) are investigated. Four different states of binding of the trapped atoms corresponding to the activation energies for desorption have been revealed from the spectra. The activation energies are found to be relatively insensitive to the species of the bombarding ion, incident ion energy and the dosage. The patterns of the spectra are strongly influenced by the mean projected range of the ions into the solid. The activation energies deduced are in good agreement with those reported for the migration of atoms and defects in molybdenum. (auth.)
Electron stimulated desorption of gases at technological surfaces of aluminium
International Nuclear Information System (INIS)
Ding, M.Q.; Williams, E.M.
1989-01-01
The release of gas by electron bombardment at aluminium alloy surfaces in vacuum -9 torr has been investigated for a range of treatments including bakeout and glow discharge cleaning. Particular attention has been given to the role of continuous electron bombardment, with current densities and electron energies of up to 1.5 mA cm -2 and 2.0 keV, respectively, over the 10 cm 2 of surface area under irradiation. The observations of desorption efficiency, defined as the number of desorbed molecules per incident electron, conform to a model involving a dynamic balance between adsorption and desorption, with contributions to adsorption from both surface and sub-surface gas. Continuous electron bombardment promotes a surface with low desorption efficiency, -5 mol/electron, however, the conditioning cycle is accelerated significantly by glow discharge treatment. There is evidence of some short-term memory when the samples are exposed to air. (author)
Adsorption and desorption of phosphorus in ceramic capsules
International Nuclear Information System (INIS)
Almeida, J.R.F. de.
1983-01-01
Experiments were carried out in order to analyse the capacity of adsorving P from water using ceramic capsules with 32P, in the presence and absence of water flow through the capsule. Also studied was the desorption of 32 P from the capsule in water, with and without water flow. The desorption of residual 32 P was analysed by isotopic exchange with 31 P, also with and without water flow. It was observed that, in the presence of a flow, the capsule retained 32 P from the solution, which was weakly desorbed by water but was isotopically exchanged with 31 P. In the absence of a flow, the capsule was not an efficient P adsorber. (Author) [pt
Deuterium inventory in tungsten after plasma exposure. A microstructural survey
International Nuclear Information System (INIS)
Manhard, Armin
2012-09-01
to highly reproducible exposure conditions, exposing all four types of specimens to the plasma simultaneously ensured that their retention behaviour could be directly compared. After two months of storage in a vacuum exsiccator, the long-term deuterium inventory of the specimens was analysed by depth-resolved nuclear reaction analysis and thermal desorption spectroscopy. Modifications of the specimen surfaces, in particular the formation of subsurface cracks and gas-filled subsurface cavities called blisters, were studied by a variety of optical and electron microscopy techniques, including in situ cross-sectioning with a focused ion beam. This extensive survey allowed finding a clear correlation between the initial dislocation density of the material and the observed deuterium retention, whereas the grain size, and therefore the density of grain boundaries, appeared to play a minor role. The binding energy of the dominant binding site, which is consequently assigned to dislocations, was determined by a detailed thermal desorption spectroscopy study of the specimen type with the highest dislocation density. It was also shown that defects capable of trapping significant amounts of deuterium can be produced during plasma exposure. Within the ion range of several nanometres, the tungsten surface is practically amorphised, which leads to observed local deuterium concentrations in the per cent range. Far beyond the ion range, blisters and cracks do not only retain deuterium in the form of molecular gas, but also produce a high density of defects in the surrounding tungsten lattice, most likely dislocations emitted near crack tips. A one-dimensional rate equation model was adapted to include these defect production mechanisms by an empirical term. By that, it was able to reproduce the fluence dependence of the deuterium retention as well as the shift of the main desorption peak for varying heating rates during thermal desorption spectroscopy.
Studies of iodine adsorption and desorption on HTGR coolant circuit materials
International Nuclear Information System (INIS)
Osborne, M.F.; Compere, E.L.; de Nordwall, H.J.
1976-04-01
Safety studies of the HTGR system indicate that radioactive iodine, released from the fuel to the helium coolant, may pose a problem of concern if no attenuation of the amount of iodine released occurs in the coolant circuit. Since information on iodine behavior in this system was incomplete, iodine adsorption on HTGR materials was studied in vacuum as a function of iodine pressure and of adsorber temperature. Iodine coverages on Fe 3 O 4 and Cr 2 O 3 approached maxima of about 2 x 10 14 and 1 x 10 14 atoms/cm 2 , respectively, whereas the iodine coverage on graphite under similar conditions was found to be less by a factor of about 100. Iodine desorption from the same materials into vacuum or flowing helium was investigated, on a limited basis, as a function of iodine coverage, of adsorber temperature, and of dry vs wet helium. The rate of vacuum desorption from Fe 3 O 4 was related to the spectrum of energies of the adsorption sites. A small amount of water vapor in the helium enhanced desorption from iron powder but appeared to have less effect on desorption from the metal oxides
Sorption – desorption of imidacloprid insecticide on Indian soils of five different locations
Directory of Open Access Journals (Sweden)
Shailendra Singh Chauhan
2013-07-01
Full Text Available Sorption-desorption processes govern the movement of all chemicals including pesticides in soils. The present investigation was undertaken to study the sorption-desorption of imidacloprid, using a batch method, on soils of five different location of India. Sorption data were fitted to Freundlich isotherm. The log K value was the highest for loam type soil (1.830 and the lowest for clay type soil (1.661. The value of 1/n was the maximum for silt loam soil (0.909 but minimum for loam soil (0.723. Simple correlation analysis indicated that among soil properties only electrical conductivity showed a higher but marginally non-significant negative correlation with log K (r = -0.826 indicating that higher concentration of solutes solutes are conducive to low sorption capacity of soil. The desorption data conformed to two surfaces Freundlich desorption isotherm. The values of 1/n1' corresponding to easily desorbed fraction of imidacloprid showed significant negative correlation with soil pH (r = -0.886, significant at p ≤0.05 but significant positive correlation with clay content (r = 0.980, significant at p ≤0.01. The desorption index for easily desorbed fraction of imidacloprid (n1’/n also had significant negative correlation with soil pH (r = 0.953, significant at p ≤0.05. From cumulative desorption data, it appeared that bioavailability of imidacloprid would be lower in neutral soil than acidic or alkaline soils.
Sekuła, Justyna; Nizioł, Joanna; Rode, Wojciech; Ruman, Tomasz
2015-09-21
Silver nanoparticles have been successfully applied as a matrix replacement for the laser desorption/ionization time-of-flight mass spectrometry (LDI-ToF-MS). Nanoparticles, producing spectra with highly reduced chemical background in the low m/z region, are perfectly suited for low-molecular weight compound analysis and imaging. Silver nanoparticles (AgNPs) can efficiently absorb ultraviolet laser radiation, transfer energy to the analyte and promote analyte desorption, but also constitute a source of silver ions suitable for analyte cationisation. This review provides an overview of the literature on silver nanomaterials as non-conventional desorption and ionization promoters in LDI-MS and mass spectrometry imaging.
International Nuclear Information System (INIS)
Marchal, Geoffrey; Smith, Kilian E.C.; Rein, Arno; Winding, Anne; Wollensen de Jonge, Lis; Trapp, Stefan; Karlson, Ulrich G.
2013-01-01
Sorption of PAHs to carbonaceous soil amendments reduces their dissolved concentrations, limiting toxicity but also potentially biodegradation. Therefore, the maximum abiotic desorption of freshly sorbed phenanthrene (≤5 mg kg −1 ) was measured in three soils amended with activated carbon (AC), biochar or compost. Total amounts of phenanthrene desorbed were similar between the different soils, but the amendment type had a large influence. Complete desorption was observed in the unamended and compost amended soils, but this reduced for biochar (41% desorbed) and AC (8% desorbed). Cumulative amounts mineralized were 28% for the unamended control, 19% for compost, 13% for biochar and 4% for AC. Therefore, the effects of the amendments in soil in reducing desorption were also reflected in the extents of mineralization. Modeling was used to analyze key processes, indicating that for the AC and charcoal treatments bacterial activity did not limit mineralization, but rather desorption into the dissolved phase. -- Highlights: •Phenanthrene desorption and mineralization compared in soils with activated carbon, charcoal or compost. •Only activated charcoal and biochar hindered both desorption and mineralization. •A linear relationship was found between the extents desorbed and mineralized. •Modelling indicated that bacterial activity was not limiting but that desorption was. -- Extraction into an exhaustive silicone sink measures the maximum phenanthrene desorption from soils with amendments, and this is reflected in the extent of mineralization
Monte Carlo simulation using MCNP4B for an optimal shielding design of a 252 Cf source
International Nuclear Information System (INIS)
Silva, Ademir X. da; Crispim, Verginia R.
2001-01-01
This study aim to investigate an optimum shielding design against neutrons and gamma-rays from a source of 252 Cf, using Monte Carlo simulation. The shielding materials studied were: borated polyethylene, borated-lead polyethylene and stainless steel. The Monte Carlo code MCNP, version 4B, was used to design shielding for 252 Cf based neutron irradiator systems. By normalizing the dose equivalent rate values presented to the neutron production rate of the source, the resulting calculations are independents of the intensity of actual 252 Cf source. The results shown what the total dose equivalent rates were reduced significantly by the shielding system optimization. (author)
Radiotracer experiments on the desorption of iodine from paddy soil with and without rice plants
International Nuclear Information System (INIS)
Muramatsu, Yasuyuki; Uchida, Shigeo; Yoshida, Satoshi
1991-01-01
In order to assess the behavior of radioiodine in rice fields, we have performed laboratory experiments, using 125 I tracer, on the desorption phenomena of iodine from soil during rice cultivation. Most of the 125 I added to the soil was adsorbed by the soil solid phase at the beginning of the experiment. However, the iodine started to desorb into the soil solution with the growth of rice plants. The highest desorption rate of iodine was found around the flowering period, i.e. nearly 30% of the 125 I was desorbed from Ando soil into the soil solution. In contrast to this, no particular increase in the iodine desorption was observed from the uncultivated flooded soil. It was suggested that rice plants had some influence upon iodine desorption from soil and the desorption also depended on the soil types. (author)
Desorption of H atoms from graphite (0001) using XUV free electron laser pulses
DEFF Research Database (Denmark)
Siemer, B.; Olsen, Thomas; Hoger, T.
2010-01-01
The desorption of neutral H atoms from graphite with femtosecond XUV pulses is reported. The velocity distribution of the atoms peaks at extremely low kinetic energies. A DFT-based electron scattering calculation traces this distribution to desorption out of specific adsorption sites on graphite......, and identifies the highest vibrational state in the adsorbate potential as a major source for the slow atoms. It is evident that multiple electron scattering processes are required for this desorption. A direct electronic excitation of a repulsive hydrogen-carbon bond seems not to be important....
Desorption isotherms and isosteric heat of 'cajuzinho-do-cerrado' achenes
Directory of Open Access Journals (Sweden)
Karine F. Barbosa
2016-05-01
Full Text Available ABSTRACT The objective of this study was to determine the desorption isotherms of 'cajuzinho-do-cerrado' achenes (Anacardium humile St. Hil. in various conditions of temperature and water activity, as well as to select the one that best represents the phenomenon and to determine the isosteric heat of desorption. The fruits were collected at the Emas National Park, in the municipality of Mineiros-GO, Brazil, pulped and then subjected to drying in silica gel at temperature of 25 ± 2 °C until the moisture contents of 17.6, 13.6, 11.1, 8.7 and 5.3 (d.b.%. After drying, the desorption isotherms were determined by the indirect static method. The water activity (Aw was determined at different temperatures, and the achenes were placed in a B.O.D. chamber, regulated at 10, 20, 30 and 40 °C. Data of hygroscopic equilibrium moisture content were fitted to different mathematical models through non-linear regression analysis, using the Gauss-Newton method. The Copace model was the one that best represented the hygroscopicity of 'cajuzinho-do-cerrado' achenes, while the integral isosteric heat of desorption of 'cajuzinho-do-cerrado' achenes for the moisture content range of 4.51 to 13.40 (% d.b. varied from 2,734.82 to 2,548.49 kJ kg-1.
Guinan, Taryn; Kirkbride, Paul; Pigou, Paul E; Ronci, Maurizio; Kobus, Hilton; Voelcker, Nicolas H
2015-01-01
Matrix-assisted laser desorption ionization (MALDI) mass spectrometry (MS) is an excellent analytical technique for the rapid and sensitive analysis of macromolecules (>700 Da), such as peptides, proteins, nucleic acids, and synthetic polymers. However, the detection of smaller organic molecules with masses below 700 Da using MALDI-MS is challenging due to the appearance of matrix adducts and matrix fragment peaks in the same spectral range. Recently, nanostructured substrates have been developed that facilitate matrix-free laser desorption ionization (LDI), contributing to an emerging analytical paradigm referred to as surface-assisted laser desorption ionization (SALDI) MS. Since SALDI enables the detection of small organic molecules, it is rapidly growing in popularity, including in the field of forensics. At the same time, SALDI also holds significant potential as a high throughput analytical tool in roadside, work place and athlete drug testing. In this review, we discuss recent advances in SALDI techniques such as desorption ionization on porous silicon (DIOS), nano-initiator mass spectrometry (NIMS) and nano assisted laser desorption ionization (NALDI™) and compare their strengths and weaknesses with particular focus on forensic applications. These include the detection of illicit drug molecules and their metabolites in biological matrices and small molecule detection from forensic samples including banknotes and fingerprints. Finally, the review highlights recent advances in mass spectrometry imaging (MSI) using SALDI techniques. © 2014 Wiley Periodicals, Inc.
48 CFR 252.225-7008 - Restriction on Acquisition of Specialty Metals.
2010-10-01
... CLAUSES Text of Provisions And Clauses 252.225-7008 Restriction on Acquisition of Specialty Metals. As... more of the following limits: Manganese, 1.65 percent; silicon, 0.60 percent; or copper, 0.60 percent...
Modelling deuterium release during thermal desorption of D{sup +}-irradiated tungsten
Energy Technology Data Exchange (ETDEWEB)
Poon, M. [University of Toronto Institute for Aerospace Studies, Toronto, ON, M3H 5T6 (Canada); Haasz, A.A. [University of Toronto Institute for Aerospace Studies, Toronto, ON, M3H 5T6 (Canada)], E-mail: tonyhaasz@utias.utoronto.ca; Davis, J.W. [University of Toronto Institute for Aerospace Studies, Toronto, ON, M3H 5T6 (Canada)
2008-03-15
Thermal desorption profiles were modelled based on SIMS measurements of implantation profiles and using the multi-trap diffusion code TMAP7 [G.R. Longhurst, TMAP7: Tritium Migration Analysis Program, User Manual, Idaho National Laboratory, INEEL/EXT-04-02352 (2004)]. The thermal desorption profiles were the result of 500 eV/D{sup +} irradiations on single crystal tungsten at 300 and 500 K to fluences of 10{sup 22}-10{sup 24} D{sup +}/m{sup 2}. SIMS depth profiling was performed after irradiation to obtain the distribution of trapped D within the top 60 nm of the surface. Thermal desorption spectroscopy (TDS) was performed subsequently to obtain desorption profiles and to extract the total trapped D inventory. The SIMS profiles were calibrated to give D concentrations. To account for the total trapped D inventory measured by TDS, SIMS depth distributions were used in the near-surface (surface to 30 nm), NRA measurements [V.Kh. Alimov, J. Roth, M. Mayer, J. Nucl. Mater. 337-339 (2005) 619] were used in the range 1-7 {mu}m, and a linear drop in the D distribution was assumed in the intermediate sub-surface region ({approx}30 nm to 1 {mu}m). Traps were assumed to be saturated so that the D distribution also represented the trap distribution. Three trap energies, 1.07 {+-} 0.03, 1.34 {+-} 0.03 and 2.1 {+-} 0.05 eV were required to model the 520, 640 and 900 K desorption peaks, respectively. The 1.34 and 1.07 eV traps correspond to trapping of a first and second D atom at a vacancy, respectively, while the 2.1 eV trap corresponds to atomic D trapping at a void. A fourth trap energy of 0.65 eV was used to fit the 400 K desorption peak observed by Quastel et al. [A.D. Quastel, J.W. Davis, A.A. Haasz, R.G. Macaulay-Newcombe, J. Nucl. Mater. 359 (2006) 8].
Modelling of Convective Process of Water Desorption from Polystyrene
International Nuclear Information System (INIS)
Stakic, M.; Nikolic, A.
2008-01-01
This study presents a mathematical model developed to evaluate the influence of structural and operational factors on convective dehydration process (desorption of liquid phase from capillary-porous material), as well as the possibility to utilize this model for the case of water desorption from polystyrene cation resin CG-8. The model accounts for unsteady one-dimensional simultaneous heat and mass transfer between the gas (air) and the solid phase (resin). The identification of effective transport properties for the considered fixed bed of material (resin CG 8) is discussed. To this purpose available data from the literature are used. (author)
Anomalous low-temperature desorption from preirradiated rare gas solids
International Nuclear Information System (INIS)
Savchenko, E.V.; Gumenchuk, G.B.; Yurtaeva, E.M.; Belov, A.G.; Khyzhniy, I.V.; Frankowski, M.; Beyer, M.K.; Smith-Gicklhorn, A.M.; Ponomaryov, A.N.; Bondybey, V.E.
2005-01-01
The role for the exciton-induced defects in the stimulation of anomalous low-temperature desorption of the own lattice atoms from solid Ar and Ne preirradiated by an electron beam is studied. The free electrons from shallow traps-structural defects-was monitored by the measurements of a yield of the thermally induced exoelectron emission (TSEE). The reaction of recombination of self-trapped holes with electrons is considered as a source of energy needed for the desorption of atoms from the surface of preirradiated solids. A key part of the exciton-induced defects in the phenomenon observed is demonstrated
Cf-252 based neutron radiography using real-time image processing system
International Nuclear Information System (INIS)
Mochiki, Koh-ichi; Koiso, Manabu; Yamaji, Akihiro; Iwata, Hideki; Kihara, Yoshitaka; Sano, Shigeru; Murata, Yutaka
2001-01-01
For compact Cf-252 based neutron radiography, a real-time image processing system by particle counting technique has been developed. The electronic imaging system consists of a supersensitive imaging camera, a real-time corrector, a real-time binary converter, a real-time calculator for centroid, a display monitor and a computer. Three types of accumulated NR image; ordinary, binary and centroid images, can be observed during a measurement. Accumulated NR images were taken by the centroid mode, the binary mode and ordinary mode using of Cf-252 neutron source and those images were compared. The centroid mode presented the sharpest image and its statistical characteristics followed the Poisson distribution, while the ordinary mode showed the smoothest image as the averaging effect by particle bright spots with distributed brightness was most dominant. (author)
Lee, Hwang; Byun, Da-Eun; Kim, Ju Min; Kwon, Jung-Hwan
2018-01-01
To evaluate rate of migration from plastic debris, desorption of model hydrophobic organic chemicals (HOCs) from polyethylene (PE)/polypropylene (PP) films to water was measured using PE/PP films homogeneously loaded with the HOCs. The HOCs fractions remaining in the PE/PP films were compared with those predicted using a model characterized by the mass transfer Biot number. The experimental data agreed with the model simulation, indicating that HOCs desorption from plastic particles can generally be described by the model. For hexachlorocyclohexanes with lower plastic-water partition coefficients, desorption was dominated by diffusion in the plastic film, whereas desorption of chlorinated benzenes with higher partition coefficients was determined by diffusion in the aqueous boundary layer. Evaluation of the fraction of HOCs remaining in plastic films with respect to film thickness and desorption time showed that the partition coefficient between plastic and water is the most important parameter influencing the desorption half-life. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sorption-desorption of samarium in Febex bentonite
International Nuclear Information System (INIS)
Ramirez-Guinart, O.; Rigol, A.; Vidal, M.; Fernandez-Poyatos, P.; Alba, M. D.
2012-01-01
Document available in extended abstract form only. The chemical and physical nature of the clay is a key issue in the design of engineered barriers. The FEBEX bentonite is one of the clays candidates to be used in engineered barriers in deep geology repositories (DGR). Here, its performance was tested with respect to the sorption-desorption of samarium, which is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in high level radioactive waste in the form of the radioactive isotope 151 Sm. FEBEX bentonite was used in this study. This is a di-octahedral smectite, with isomorphic substitutions in tetrahedral and octahedral sheets. Its theoretical cation exchange capacity value is 1500 meq kg -1 . Sorption isotherms were obtained for Sm in the range of initial concentrations of 0.01 and 9 meq l -1 . Tests were carried out in deionized water and in a medium simulating the composition of interstitial water. Sorption tests were performed equilibrating 30 ml of the Sm solution with 0.2 g of clay. After a contact time of 24 hours, supernatants were decanted off after centrifugation. The quantification of the concentration of Sm in the initial and final solutions allowed us to quantify the Sm equilibrium concentration (C eq ), the fraction sorbed in the FEBEX bentonite (C sorb ) and to derive the sorption K d data. Desorption tests were applied to determine the desorption K d and the percentage of Sm reversibly sorbed. Desorption tests were performed with the bentonite residue from the sorption step, under the same experimental conditions, but without Sm. Powder X-ray diffractograms were obtained from 3 to 70 deg. 2θ with a step of 0.05 deg. and a counting time of 3 s. The crystalline phases were identified using the computer program X'Pert HighScore. The morphology of the samples was analyzed by SEM at 20 kV. An EDX system was fitted to the SEM equipment to perform chemical analyses of the samples using a Si/Li detector
Sorption and desorption of diuron in Oxisol under biochar application
Petter,Fabiano André; Ferreira,Tamara Santos; Sinhorin,Adilson Paulo; Lima,Larissa Borges de; Morais,Leidimar Alves de; Pacheco,Leandro Pereira
2016-01-01
ABSTRACT The objective of this study was to verify the kinetics of sorption and desorption of diuron in an Oxisol under application of biochar. The samples were collected in a field experiment conducted in randomized design blocks consisted of 2 base fertilization levels (0 and 400 kg∙ha−1 NPK 00-20-20 fertilizer formula) and 3 doses of biochar (0, 8 and 16 Mg∙ha−1). In the evaluation of sorption and desorption, Batch Equilibrium method was used. The kinetics of sorpti...
2010-10-01
...-basic steel, aluminum, brass, bronze, or copper mill products. 252.216-7000 Section 252.216-7000 Federal... adjustment—basic steel, aluminum, brass, bronze, or copper mill products. As prescribed in 216.203-4-70(a... Mill Products (JUL 1997) (a) Definitions. As used in this clause— Established price means a price which...
Energy Technology Data Exchange (ETDEWEB)
Fohlman, J; Peterson, P A [Uppsala Univ. (Sweden). Dept. of Cell Research; Kamensky, I; Hakansson, P; Sundqvist, B [Tandemacceleratorlaboratoriet, Uppsala (Sweden)
1982-07-01
D-vitamin metabolites have been isolated from human serum employing chromatographic techniques. The serum carrier protein for vitamin D (DBP) was first isolated by immunosorbent chromatography. Lipid ligands associated with DBP were then extracted with hexane and separated by high pressure liquid chromatography (HPLC). Detection of vitamin D metabolites by their absorbance of ultraviolet light is not sufficiently sensitive to monitor all vitamin D derivatives from a few millilitres of serum. Therefore, further analyses are necessary to quantitative these compounds. We have begun to develop a mass spectrometric method to achieve a reliable, quantitative procedure. As a first step towards this goal a number of pure samples of vitamin D compounds have been studied in a time-of-flight mass spectrometer based on fast heavy ion induced desorption. All vitamin D compounds examined could be detected and identified by their molecular ion and fragment spectra.
International Nuclear Information System (INIS)
Fohlman, J.; Peterson, P.A.
1982-01-01
D-vitamin metabolites have been isolated from human serum employing chromatographic techniques. The serum carrier protein for vitamin D (DBP) was first isolated by immunosorbent chromatography. Lipid ligands associated with DBP were then extracted with hexane and separated by high pressure liquid chromatography (HPLC). Detection of vitamin D metabolites by their absorbance of ultraviolet light is not sufficiently sensitive to monitor all vitamin D derivatives from a few millilitres of serum. Therefore, further analyses are necessary to quantitative these compounds. We have begun to develop a mass spectrometric method to achieve a reliable, quantitative procedure. As a first step towards this goal a number of pure samples of vitamin D compounds have been studied in a time-of-flight mass spectrometer based on fast heavy ion induced desorption. All vitamin D compounds examined could be detected and identified by their molecular ion and fragment spectra. (orig.)
International Nuclear Information System (INIS)
Njikam, Eloh; Schiewer, Silke
2012-01-01
Graphical abstract: Cadmium was completely and quickly desorbed from grapefruit peels using 0.01 M HNO 3 . The kinetics followed a novel 1st or 2nd order kinetic model, related to the remaining metal bound as the rate-determining reactant concentration. For 0.001 M HNO 3 , desorption was incomplete and the model fit less perfect. Highlights: ► Metal desorption was over 90% complete within 50 min for most desorbents. ► Models for biosorbent desorption kinetics were developed. ► Desorption kinetics best fit a novel first-order model related to remaining metal bound. ► Cd uptake after desorption by HNO 3 was similar to the original uptake. ► The optimal desorbent was 0.1 or 0.01 M acid, being fast, efficient and cheap. - Abstract: Citrus peel biosorbents are efficient in removing heavy metals from wastewater. Heavy metal recovery and sorbent regeneration are important for the financial competitiveness of biosorption with other processes. The desorbing agents HNO 3 , NaNO 3 , Ca(NO 3 ) 2 , EDTA, S, S-EDDS, and Na-Citrate were studied at different concentrations to optimize cadmium elution from orange or grapefruit peels. In most cases, desorption was fast, being over 90% complete within 50 min. However sodium nitrate and 0.001 M nitric acid were less efficient. Several new models for desorption kinetics were developed. While zero-, first- and second-order kinetics are commonly applied for modeling adsorption kinetics, the present study adapts these models to describe desorption kinetics. The proposed models relate to the number of metal-filled binding sites as the rate-determining reactant concentration. A model based on first order kinetics with respect to the remaining metal bound performed best. Cd bound in subsequent adsorption after desorption was similar to the original amount bound for desorption by nitric acid, but considerably lower for calcium nitrate as the desorbent. While complexing agents were effective desorbents, their cost is higher than that
New perspectives in vacuum high voltage insulation. II. Gas desorption
Diamond, W T
1998-01-01
An examination has been made of gas desorption from unbaked electrodes of copper, niobium, aluminum, and titanium subjected to high voltage in vacuum. It has been shown that the gas is composed of water vapor, carbon monoxide, and carbon dioxide, the usual components of vacuum outgassing, plus an increased yield of hydrogen and light hydrocarbons. The gas desorption was driven by anode conditioning as the voltage was increased between the electrodes. The gas is often desorbed as microdischarges-pulses of a few to hundreds of microseconds-and less frequently in a more continuous manner without the obvious pulsed structure characteristic of microdischarge activity. The quantity of gas released was equivalent to many monolayers and consisted mostly of neutral molecules with an ionic component of a few percent. A very significant observation was that the gas desorption was more dependent on the total voltage between the electrodes than on the electric field. It was not triggered by field-emitted electrons but oft...
A study of the process of desorption of hexavalent chromium
Directory of Open Access Journals (Sweden)
W.B. Amorim
2003-09-01
Full Text Available In this work the process of desorption of hexavalent chromium, a toxic metal ion, from the marine algae Sargassum sp, following biosorption experiments 2³ factorial design was studied. A technique was applied to three eluents: HCl, H2SO4 and EDTA. Three factors of importance were evaluated: concentration of eluent, the ratio between mass of biosorbent and volume of eluent (S/L and process time. A statistical analysis of the experimental results showed that the three variables evaluated are significant for all three eluents. The models for chromium desorption were validated, as the results agreed well with the observed values. Through use of the response surface methodology, a factorial design based optimization technique; it was possible to identify the most suitable eluent and the interval of values for the process variables that resulted in the most significant desorption of chromium, which is relevant information for work aiming at process optimization.
Energy Technology Data Exchange (ETDEWEB)
Benker, D.E.; Chattin, F.R.; Collins, E.D.; Knauer, J.B.; Orr, P.B.; Ross, R.G.; Wiggins, J.T.
1980-01-01
Decigram quantities of highly radioactive transplutonium elements are routinely partitioned at TRU by chromatographic elution from cation resin using AHIB eluent. By using two high-pressure ion exchange columns, a small one for the initial loading of the feed and a large one for the elution, batch runs containing up to 200 mg of /sup 252/Cf can be made in about 5 hours (2 hours to load the feed and 3 hours for the elution). The number of effluent product fractions and the amount of actinides that must be collected in intermediate fractions are minimized by monitoring response from a flow-through alpha-detector. This process has been reliable and relatively easy to operate, and will continue to be used for partitioning transplutonium elements at TRU.
Effects of chemical oxidation on sorption and desorption of PAHs in typical Chinese soils
International Nuclear Information System (INIS)
Chen Wei; Hou Lei; Luo Xiaoli; Zhu Lingyan
2009-01-01
In situ chemical oxidation is a commonly applied soil and groundwater remediation technology, but can have significant effects on soil properties, which in turn might affect fate and transport of organic contaminants. In this study, it was found that oxidation treatment resulted mainly in breakdown of soil organic matter (SOM) components. Sorption of naphthalene and phenanthrene to the original soils and the KMnO 4 -treated soils was linear, indicating that hydrophobic partitioning to SOM was the predominant mechanism for sorption. Desorption from the original and treated soils was highly resistant, and was well modeled with a biphasic desorption model. Desorption of residual naphthalene after treating naphthalene-contaminated soils with different doses of KMnO 4 also followed the biphasic desorption model very well. It appears that neither changes of soil properties caused by chemical oxidation nor direct chemical oxidation of contaminated soils had a noticeable effect on the nature of PAH-SOM interactions. - Chemical oxidation of soils had little effect on the mechanisms controlling sorption and desorption of PAHs.
The Absorption-Desorption of Hydrogen by 1.5 g Depleted Uranium
Energy Technology Data Exchange (ETDEWEB)
Kim, Sunmi; Paek, Seungwoo; Lee, Minsoo; Kim, Si-Hyung; Kim, Kwang-Rag; Ahn, Do-Hee [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Sohn, Soon Hwan; Song, Kyu Min [Korea Electric Power Research Institute, Daejeon (Korea, Republic of)
2008-10-15
The form of metal tritides is one of the most popular methods for the storage of hydrogen isotopes. Particularly when metal is in a powder form, the storage capacity of hydrogen isotopes become the maximum value. Here, a 1.5g depleted uranium metal was decrepitated into a powder upon an absorption and desorption of hydrogen gas. The conditions for an activation, absorption-desorption of the hydrogen were defined.
The Absorption-Desorption of Hydrogen by 1.5 g Depleted Uranium
International Nuclear Information System (INIS)
Kim, Sunmi; Paek, Seungwoo; Lee, Minsoo; Kim, Si-Hyung; Kim, Kwang-Rag; Ahn, Do-Hee; Sohn, Soon Hwan; Song, Kyu Min
2008-01-01
The form of metal tritides is one of the most popular methods for the storage of hydrogen isotopes. Particularly when metal is in a powder form, the storage capacity of hydrogen isotopes become the maximum value. Here, a 1.5g depleted uranium metal was decrepitated into a powder upon an absorption and desorption of hydrogen gas. The conditions for an activation, absorption-desorption of the hydrogen were defined
48 CFR 252.242-7004 - Material management and accounting system.
2010-10-01
... CLAUSES Text of Provisions And Clauses 252.242-7004 Material management and accounting system. As prescribed in 242.7204, use the following caluse: Material Management and Accounting System (JUL 2009) (a) Definitions. As used in this clause— (1) Material management and accounting system (MMAS) means the Contractor...
Activation analysis of stainless steel flux monitors using 252Cf neutron sources
International Nuclear Information System (INIS)
Williams, J.G.; Newton, T.H. Jr.; Cogburn, C.O.
1984-01-01
Activation analysis was performed on stainless steel beads from a chain which is used in reactor pressure vessel surveillance experiments at the Arkansas Power and Light Company reactors. The beads allow monitoring of two fast and three thermal neutron induced reactions: 58 Ni(n,p) 58 Co, 54 Fe(n,p) 54 Mn, 58 Fe(n,γ) 59 Fe, 59 Co(n,γ) 60 Co and 50 Cr(n,γ) 51 Cr. The analysis was performed using 12 beads from various positions along 5 different batches of chain and standard materials in an H 2 O moderator tank using two intense californium sources which had a total neutron emission rate of 3.97 x 10 10 /s. Semiconductor gamma spectrometers were used to count the products of the above reactions in the specimens. The percentage by weight of the iron, chromium and cobalt in the beads were found to be 62.1%, 20.2% and 0.120%, respectively. The excellent uniformity found in the bead compositions demonstrates the reproducibility of the experimental techniques and enhances considerably the value of the beads as neutron flux montitors
Desorption dynamics of deuterium molecules from the Si(100)-(3×1) dideuteride surface
Niida, T; Tsurumaki, Hiroshi; Namiki, Akira
2006-01-01
We measured polar angle ()-resolved time-of-flight spectra of D2 molecules desorbing from the Si(100)-(3×1) dideuteride surface. The desorbing D2 molecules exhibit a considerable translational heating with mean desorption kinetic energies of 0.25 eV, which is mostly independent of the desorption angles for 0°30°. The observed desorption dynamics of deuterium was discussed along the principle of detailed balance to predict their adsorption dynamics onto the monohydride Si surface.
International Nuclear Information System (INIS)
Liu, Chongxuan; Shi, Zhenqing; Zachara, John M.
2009-01-01
Stirred-flow cell experiments were performed to investigate the kinetics of uranyl (U(VI)) desorption from a contaminated sediment collected from the Hanford 300 Area at the US Department of Energy (DOE) Hanford Site, Washington. Three influent solutions of variable pH, Ca and carbonate concentrations that affected U(VI) aqueous and surface speciation were used under dynamic flow conditions to evaluate the effect of geochemical conditions on the rate of U(VI) desorption. The measured rate of U(VI) desorption varied with solution chemical composition that evolved as a result of thermodynamic and kinetic interactions between the influent solutions and sediment. The solution chemical composition that led to a lower equilibrium U(VI) sorption to the solid phase yielded a faster desorption rate. The experimental results were used to evaluate a multi-rate, surface complexation model (SCM) that has been proposed to describe U(VI) desorption kinetics in the Hanford sediment that contained complex sorbed U(VI) species in mass transfer limited domains. The model was modified and supplemented by including multi-rate, ion exchange reactions to describe the geochemical interactions between the solutions and sediment. With the same set of model parameters, the modified model reasonably well described the evolution of major ions and the rates of U(VI) desorption under variable geochemical and flow conditions, implying that the multi-rate SCM is an effective way to describe U(VI) desorption kinetics in subsurface sediments
Characterization of human exposure to mineral sands dust in a brazilian village
International Nuclear Information System (INIS)
Cunha, K. Dias da; Santos, M.S.; Medeiros, G.; Dalia, K.C.; Lima, C.; Leite, Barros C. V.
2008-01-01
The aim of this study was to characterize human exposure to mineral dust particles using PIXE (Particle Induced X rays Emission) and 252 Cf-PDMS (Plasma Desorption Mass Spectrometry) techniques. The dust particles were generated during the separation process of mineral sands to obtain rutile, ilmenite, zircon and monazite concentrates. The aerosol samples were collected at the village and during the process to concentrate ilmenite. A cascade impactor with six stages was used to collect mineral dust particles with aerodynamic diameter in the range of 0.64 to 19.4 μm. The particles impacted on each stage of the cascade impactor were analyzed by PIXE (Particle Induced X ray Emission) and the elemental mass concentration and the MMAD (Mass Median Aerodynamic Diameter) were determined. Employing the 252 Cf-PDMS technique the chemical compound present in aerosols particles and in urine samples were identified. The mass spectra ( 252 Cf-PDMS technique) of dust samples showed the presence of the thorium silicate, thorite and zircon in the fine fraction of aerosol. The 252 Cf-PDMS technique was, also, used to characterize urine sample from a inhabitant of the village. The results show that Buena village inhabitants inhale mineral sands dust particles. Based on the results from the lichen samples it could be concluded that at least during the last 15 years the inhabitants of the village have been exposed to monazite particles. Results suggest that the there is natural source of aerosol particles containing 226 Ra and 210 Pb (probably the swamp) besides the mineral sands dust. (author)
Sorption and desorption of glyphosate in Mollisols and Ultisols soils of Argentina.
Gómez Ortiz, Ana Maria; Okada, Elena; Bedmar, Francisco; Costa, José Luis
2017-10-01
In Argentina, glyphosate use has increased exponentially in recent years as a result of the widespread adoption of no-till management combined with genetically modified glyphosate-resistant crops. This massive use of glyphosate has created concern about its potential environmental impact. Sorption-desorption of glyphosate was studied in 3 Argentinean soils with contrasting characteristics. Glyphosate sorption isotherms were modeled using the Freundlich equation to estimate the sorption coefficient (K f ). Glyphosate sorption was high, and the K f varied from 115.6 to 1612 mg 1-1/n L 1/n /kg. Cerro Azul soil had the highest glyphosate sorption capacity as a result of a combination of factors such as higher clay content, cation exchange capacity, total iron, and aluminum oxides, and lower available phosphorus and pH. Desorption isotherms were also modeled using the Freundlich equation. In general, desorption was very low (glyphosate strongly sorbs to the soils and that it is almost an irreversible process. Anguil soil had a significantly higher desorption coefficient (K fd ) than the other soils, associated with its lower clay content and higher pH and phosphorus. Glyphosate high sorption and low desorption to the studied soils may prevent groundwater contamination. However, it may also affect its bioavailability, increasing its persistence and favoring its accumulation in the environment. The results of the present study contribute to the knowledge and characterization of glyphosate retention in different soils. Environ Toxicol Chem 2017;36:2587-2592. © 2017 SETAC. © 2017 SETAC.
The Design and Development of Enhanced Thermal Desorption Products
Directory of Open Access Journals (Sweden)
R. Humble
2005-01-01
Full Text Available This research study is based on a knowledge-transfer collaboration between The National Centre for Product Design and Development Research (PDR and Markes International Ltd. The aim of the two-year collaboration has been to implement design tools and techniques for the development of enhanced thermal desorption products. Thermal desorption is a highly-specialised technique for the analysis of trace-level volatile organic compounds. This technique allows minute quantities of these compounds to be measured; however, there is an increasing demand from customers for greater sensitivity over a wider range of applications, which means new design methodologies need to be evaluated. The thermal desorption process combines a number of disparate chemical, thermal and mechanical disciplines, and the major design constraints arise from the need to cycle the sample through extremes in temperature. Following the implementation of a comprehensive product design specification, detailed design solutions have been developed using the latest 3D CAD techniques. The impact of the advanced design techniques is assessed in terms of improved product performance and reduced development times, and the wider implications of new product development within small companies are highlighted.
X-ray induced gas desorption within a prototype LEP vacuum chamber
International Nuclear Information System (INIS)
Williams, E.M.; Le Normand, F.; Hilleret, N.; Dominichini, G.
1982-12-01
The present report is concerned with an experimental simulation of the process of photon induced desorption within an aluminium vacuum chamber of the same basic form as proposed for the LEP accelerator. The objectives in the work can be described in the following three-fold manner: Firstly, to establish the levels of photon induced desorption efficiency for identified gas species. Secondly, to examine the contribution of surface treatments as bakeout and glow discharge cleaning, and to correlate these responses with changes in surface activity induced by beam cleaning. Thirdly, to gain insight into the energy dependence of the desorption process so as to provide a reasonable basis for predicting conditions at the levels of critical energy in excess of 100 keV which are applicable at the full design energy of the LEP accelerator. (orig./HSI)
Experimental Study on Methane Desorption from Lumpy Coal under the Action of Hydraulic and Thermal
Directory of Open Access Journals (Sweden)
Dong Zhao
2018-01-01
Full Text Available Moisture and thermal are the key factors for influencing methane desorption during CBM exploitation. Using high-pressure water injection technology into coalbed, new fractures and pathways are formed to transport methane. A phenomenon of water-inhibiting gas flow existed. This study is focused on various water pressures impacted on gas-adsorbed coal samples, and then the desorption capacity could be revealed under different conditions. And the results are shown that methane desorption capacity was decreased with the increase in water pressure at room temperature and the downtrend would be steady until water pressure was large enough. Heating could promote gas desorption capacity effectively, with the increasing of water injection pressures, and the promotion of thermal on desorption became more obvious. These results are expected to provide a clearer understanding of theoretical efficiency of heat water or steam injection into coalbed, and they can provide some theoretical and experimental guidance on CBM production and methane control.
Beneficial effect of carbon on hydrogen desorption kinetics from Mg–Ni–In alloy
International Nuclear Information System (INIS)
Cermak, J.; Kral, L.
2013-01-01
Highlights: ► Beneficial effect of graphitic carbon was observed. ► The effect is optimal up to c opt . ► Above c opt , phase decomposition occurs. ► Indium in studied Mg–Ni-based alloys prevents oxidation. - Abstract: In the present paper, hydrogen desorption kinetics from hydrided Mg–Ni–In–C alloys was investigated. A chemical composition that substantially accelerates hydrogen desorption was found. It was observed that carbon improves the hydrogen desorption kinetics significantly. Its beneficial effect was found to be optimum close to the carbon concentration of about c C ≅ 5 wt.%. With this composition, stored hydrogen can be desorbed readily at temperatures down to about 485 K, immediately after hydrogen charging. This can substantially shorten the hydrogen charging/discharging cycle of storage tanks using Mg–Ni-based alloys as hydrogen storage medium. For higher carbon concentrations, unwanted phases precipitated, likely resulting in deceleration of hydrogen desorption and lower hydrogen storage capacity.
Kinetic behaviour of the adsorption and desorption of phosphorus-32 on aluminium hydroxide
International Nuclear Information System (INIS)
Ribeiro, E.M.G.
1993-01-01
Great amount of phosphate fertilizers are used in agriculture. Soil fertility have been studied using fertilizer labelled with phosphorus 32 to improve agronomic practices by increasing the efficient use of phosphate fertilizer. Previous research work have been published suggesting the potential use of kinetics parameters to characterize phosphorus in soil and to diagnosis the phosphate level. In this work the kinetic behaviour of the absorption and desorption of phosphorus-32 on a synthetic aluminium hydroxide was studied attempting to detect the formation of a precipitated phase on the hydroxide surface. The kinetic data for adsorption was adjusted with the Elovich and Fardeau equations for isotopic exchange. It was verified a change in the kinetic behaviour when the surface was approximately 80% saturated. This change suggested the formation of a precipitate. The kinetic data for desorption was fitted with the Fardeau equation, and it was verified the desorption kinetics slower than the desorption. (B.C.A.). 40 refs, 17 figs, 5 tabs
International Nuclear Information System (INIS)
Hatch, C.E.
1995-05-01
This document is the Functional Design Criteria for Project W-252. Project W-252 provides the scope to provide BAT/AKART (best available technology...) to 200 Liquid Effluent Phase II streams (B-Plant). This revision (Rev. 2) incorporates a major descoping of the project. The descoping was done to reflect a combination of budget cutting measures allowed by a less stringent regulatory posture toward the Phase II streams
Equilibrium moisture content (EMC) in Norway spruce during the first and second desorptions
DEFF Research Database (Denmark)
Hoffmeyer, Preben; Engelund, Emil Tang; Thygesen, Lisbeth G.
2011-01-01
It is a commonly accepted notion that the equilibrium moisture content (EMC) of wood at a given relative humidity (RH) is highest during initial desorption of green wood due to an irreversible loss of hygroscopicity during the 1st desorption. The basis for this notion is investigated by assessing...
Nuclear stimulated desorption as a potential tool for surface study
International Nuclear Information System (INIS)
Nir, Dror.
1993-03-01
The described research work constitutes a base for an experimental method to be implemented in the study of solid surfaces. Nuclear Stimulated Desorption (NSD) is a new mode of experimentation in thin film and surface physics. It Is based on the interplay between nuclear phenomena (reactions and spontaneous decays), and atomic - scale induced effects on surfaces and very thin films. One may distinguish between two generically different relationships between the two. First, the dynamics of the nuclear reaction -primarily the recoil of the nucleus - may effect the position of the atom or molecule containing it. Second, the nuclear reaction (or decay) may serve as an analytical indicator of the whereabouts of the atom, or molecule, in question. In nuclear stimulated desorption, both thee aspects combine in an essential way. Namely, one employs a series of two consecutive decays (normally weak decays or isomeric transition) . The first of these decays causes the nucleus to desorb from a surface onto which it had been placed; the second serves to determine the position of the daughter and thereby the characteristics of the primary desorption . The essential feature in NSD is that it occurs almost exclusively from the outermost surface layer. This is because we choose to work with nuclei whose recoil energy Is of the same order of magnitude of the binding energy of the atom to the surface . Furthermore, the desorption probability and its angular (and temporal) characteristics, depend on the features (topology, morphology) of its immediate neighborhood. This work describes experiments which were designed to give relevant, phenomenological information about the outgoing flux of the radioactive daughters (for specifically chosen nuclear species) , and in particular the magnitude of the flux, its time dependence and its charged state. In addition. the basic phenomena itself is being distinguished from competing processes (thermal desorption, in particular). We will now
Gas desorption during friction of amorphous carbon films
International Nuclear Information System (INIS)
Rusanov, A; Fontaine, J; Martin, J-M; Mogne, T L; Nevshupa, R
2008-01-01
Gas desorption induced by friction of solids, i.e. tribodesorption, is one of the numerous physical and chemical phenomena, which arise during friction as result of thermal and structural activation of material in a friction zone. Tribodesorption of carbon oxides, hydrocarbons, and water vapours may lead to significant deterioration of ultra high vacuum conditions in modern technological equipment in electronic, optoelectronic industries. Therefore, knowledge of tribodesorption is crucial for the performance and lifetime of vacuum tribosystems. Diamond-like carbon (DLC) coatings are interesting materials for vacuum tribological systems due to their high wear resistance and low friction. Highly hydrogenated amorphous carbon (a-C:H) films are known to exhibit extremely low friction coefficient under high vacuum or inert environment, known as 'superlubricity' or 'superlow friction'. However, the superlow friction period is not always stable and then tends to spontaneous transition to high friction. It is supposed that hydrogen supply from the bulk to the surface is crucial for establishing and maintaining superlow friction. Thus, tribodesorption can serve also as a new technique to determine the role of gases in superlow friction mechanisms. Desorption of various a-C:H films, deposited by PECVD, ion-beam deposition and deposition using diode system, has been studied by means of ultra-high vacuum tribometer equipped with a mass spectrometer. It was found that in superlow friction period desorption rate was below the detection limit in the 0-85 mass range. However, transition from superlow friction to high friction was accompanied by desorption of various gases, mainly of H 2 and CH 4 . During friction transition, surfaces were heavily damaged. In experiments with DLC films with low hydrogen content tribodesorption was significant during the whole experiment, while low friction was not observed. From estimation of maximum surface temperature during sliding contact it
Sorption and desorption kinetics of diuron, fluometuron, prometryn and pyrithiobac sodium in soils.
Baskaran, S; Kennedy, I R
1999-11-01
The sorption and desorption characteristics of four herbicides (diuron, fluometuron, prometryn and pyrithiobac-sodium) in three different cotton growing soils of Australia was investigated. Kinetics and equilibrium sorption and desorption isotherms were determined using the batch equilibrium technique. Sorption was rapid (> 80% in 2 h) and sorption equilibrium was achieved within a short period of time (ca 4 h) for all herbicides. Sorption isotherms of the four herbicides were described by Freundlich equation with an r2 value > 0.98. The herbicide sorption as measured by the distribution coefficient (Kd) values ranged from 3.24 to 5.71 L/kg for diuron, 0.44 to 1.13 L/kg for fluometuron, 1.78 to 6.04 L/kg for prometryn and 0.22 to 0.59 L/kg for pyrithiobac-sodium. Sorption of herbicides was higher in the Moree soil than in Narrabri and Wee Waa soils. When the Kd values were normalised to organic carbon content of the soils (Koc), it suggested that the affinity of the herbicides to the organic carbon increased in the order: pyrithiobac-sodium diuron. The desorption isotherms were also adequately described by the Freundlich equation. For desorption, all herbicides exhibited hysteresis and the hysteresis was stronger for highly sorbed herbicides (diuron and prometryn) than the weakly sorbed herbicides (fluometuron and pyrithiobac-sodium). Hysteresis was also quantified as the percentage of sorbed herbicides which is not released during the desorption step (omega = [nad/nde - 1] x 100). Soil type and initial concentration had significant effect on omega. The effect of sorption and desorption properties of these four herbicides on the off-site transport to contaminate surface and groundwater are also discussed in this paper.
Quantitative lipidomic analysis of plasma and plasma lipoproteins using MALDI-TOF mass spectrometry.
Serna, Jorge; García-Seisdedos, David; Alcázar, Alberto; Lasunción, Miguel Ángel; Busto, Rebeca; Pastor, Óscar
2015-07-01
Knowledge of the plasma lipid composition is essential to clarify the specific roles of different lipid species in various pathophysiological processes. In this study, we developed an analytical strategy combining high-performance liquid chromatography with evaporative light scattering detection (HPLC-ELSD) and off-line coupling with matrix-assisted laser desorption/ionization with time-of-flight mass spectrometry (MALDI-TOF/MS) to determine the composition of plasma and major lipoproteins at two levels, lipid classes and lipid species. We confirmed the suitability of MALDI-TOF/MS as a quantitative measurement tool studying the linearity and repeatability for triglycerides (TG), phosphatidylethanolamine (PE) and phosphatidylcholine (PC). Moreover, data obtained with this method were correlated with other lipid classes and species measurements using currently available technologies. To establish the potential utility of our approach, human plasma very low density- (VLDL), low density- (LDL) and high density- (HDL) lipoproteins from 10 healthy donors were separated using ultracentrifugation, and compositions of nine lipid classes, cholesteryl esters (CE), TG, free cholesterol (FC), PE, phosphatidylinositol (PI), sulfatides (S), PC, lysophosphatidylcholine (LPC) and sphingomyelin (SM), analyzed. In total, 157 lipid species in plasma, 182 in LDL, 171 in HDL, and 148 in VLDL were quantified. The lipidomic profile was consistent with known differences in lipid classes, but also revealed unexpected differences in lipid species distribution of lipoproteins, particularly for LPC and SM. In summary, the methodology developed in this study constitutes a valid approach to determine the lipidomic composition of plasma and lipoproteins. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
48 CFR 252.228-7000 - Reimbursement for war-hazard losses.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reimbursement for war... CLAUSES Text of Provisions And Clauses 252.228-7000 Reimbursement for war-hazard losses. As prescribed in 228.370(a), use the following clause: Reimbursement for War-Hazard Losses (DEC 1991) (a) Costs for...
J. E. Martínez-Suárez; L. Camblor; S. Salva; W. A. de Jongh
2005-01-01
Se presentan 252 pacientes con el diagnóstico de dolor lumbar facetario a los que se le realizó la técnica quirúrgica de termocoagulación percutánea de la faceta articular. Nuestro propósito principal fue aliviar el dolor en estos pacientes, evaluamos la eficacia de la técnica con un 74,7% de resultados quirúrgicos satisfactorios, así como la descripción de diferentes aspectos como: edad, sexo, causas y la topografía segmentaria del dolor.Two hundred fifty two patients with diagnosis of lumba...
Czech Academy of Sciences Publication Activity Database
Čada, Martin; Virostko, Petr; Kment, Štěpán; Hubička, Zdeněk
2009-01-01
Roč. 6, S1 (2009), S247-S252 ISSN 1612-8850. [International Conference on Plasma Surface Engineering /11./. Garmisch Partenkirchen, 15.09.2008-19.09.2008] R&D Projects: GA AV ČR KAN301370701; GA AV ČR KJB100100707; GA AV ČR KJB100100805; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : calorimeter probe * floating substrate * magnetron * plasma jet * pulsed discharge Subject RIV: BH - Optics, Masers, Lasers Impact factor: 4.037, year: 2009
Desorption of Water from Distinct Step Types on a Curved Silver Crystal
Directory of Open Access Journals (Sweden)
Jakrapan Janlamool
2014-07-01
Full Text Available We have investigated the adsorption of H2O onto the A and B type steps on an Ag single crystal by temperature programmed desorption. For this study, we have used a curved crystal exposing a continuous range of surface structures ranging from [5(111 × (100] via (111 to [5(111 × (110]. LEED and STM studies verify that the curvature of our sample results predominantly from monoatomic steps. The sample thus provides a continuous array of step densities for both step types. Desorption probed by spatially-resolved TPD of multilayers of H2O shows no dependence on the exact substrate structure and thus confirms the absence of thermal gradients during temperature ramps. In the submonolayer regime, we observe a small and linear dependence of the desorption temperature on the A and B step density. We argue that such small differences are only observable by means of a single curved crystal, which thus establishes new experimental benchmarks for theoretical calculation of chemically accurate binding energies. We propose an origin of the observed behavior based on a “two state” desorption model.
DNA adsorption and desorption on mica surface studied by atomic force microscopy
Energy Technology Data Exchange (ETDEWEB)
Sun Lanlan [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhao Dongxu [Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhang Yue; Xu Fugang [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Li Zhuang, E-mail: zli@ciac.jl.cn [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China)
2011-05-15
The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/{mu}L. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.
DNA adsorption and desorption on mica surface studied by atomic force microscopy
International Nuclear Information System (INIS)
Sun Lanlan; Zhao Dongxu; Zhang Yue; Xu Fugang; Li Zhuang
2011-01-01
The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/μL. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.
Plasma exposure behavior of re-deposited tungsten on structural materials of fusion reactors
Energy Technology Data Exchange (ETDEWEB)
Xu, Yu-Ping; Wang, Jing [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Science Island Branch of Graduate School, University of Science & Technology of China, Hefei 230031 (China); Zhou, Hai-Shan, E-mail: haishanzhou@ipp.ac.cn [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Liu, Feng [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Li, Zeng-De [General Research Institute for Nonferrous Metals, Beijing 100088 (China); Li, Xiao-Chun; Lu, Tao [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Liu, Hao-Dong [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Science Island Branch of Graduate School, University of Science & Technology of China, Hefei 230031 (China); Ding, Fang; Mao, Hong-Min; Zhao, Ming-Zhong [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Lin, Chen-Guang [General Research Institute for Nonferrous Metals, Beijing 100088 (China); Luo, Guang-Nan [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Science Island Branch of Graduate School, University of Science & Technology of China, Hefei 230031 (China); Hefei Center for Physical Science and Technology, Hefei 230031 (China); Hefei Science Center of Chinese Academy of Science, Hefei 230027 (China)
2017-05-15
To evaluate the effects of re-deposited tungsten (W) on the surface modification and hydrogen isotope retention behavior of fusion structural materials, the plasma exposure behavior of re-deposited W samples prepared by magnetron sputtering on the F82H steel, the V-5Cr-5Ti alloy as well as bare substrate samples was investigated. All the samples were exposed to 367 shots of deuterium plasmas in the 2015 spring EAST campaign. After the plasma exposure, large area of W layer was exfoliated, while big blisters were found at the interface between the remaining W layer and the substrate materials. The deuterium retention behavior of the samples with re-deposited W layer was characterized by thermal desorption spectroscopy and compared with the bare substrate samples.
Wang, Xiaoming; Rytting, Erik; Abdelrahman, Doaa R.; Nanovskaya, Tatiana N.; Hankins, Gary D.V.; Ahmed, Mahmoud S.
2013-01-01
The liquid chromatography with electrospray ionization mass spectrometry for the quantitative determination of famotidine in human urine, maternal and umbilical cord plasma was developed and validated. The plasma samples were alkalized with ammonium hydroxide and extracted twice with ethyl acetate. The extraction recovery of famotidine in maternal and umbilical cord plasma ranged from 53% to 64% and 72% to 79%, respectively. Urine samples were directly diluted with the initial mobile phase then injected into the HPLC system. Chromatographic separation of famotidine was achieved by using a Phenomenex Synergi™ Hydro-RP™ column with a gradient elution of acetonitrile and 10 mM ammonium acetate aqueous solution (pH 8.3, adjusted with ammonium hydroxide). Mass Spectrometric detection of famotidine was set in the positive mode and used a selected ion monitoring method. Carbon-13-labeled famotidine was used as internal standard. The calibration curves were linear (r2> 0.99) in the concentration ranges of 0.631-252 ng/mL for umbilical and maternal plasma samples, and of 0.075-30.0 μg/mL for urine samples. The relative deviation of method was less than 14% for intra- and inter-day assays, and the accuracy ranged between 93% and 110%. The matrix effect of famotidine in human urine, maternal and umbilical cord plasma is less than 17%. PMID:23401067
Lisowski, W.F.; Keim, Enrico G.; van den Berg, A.H.J.; Smithers, Mark A.; Smithers, M.A.
2006-01-01
The process of deuterium desorption from single-wall carbon nanotubes (SWNTs) modified by atomic (D) and molecular (D2) deuterium treatment was investigated in an ultrahigh vacuum environment using thermal desorption mass spectroscopy (TDMS). Microstructural and chemical analyses of SWNT material,
Spectrum of reflected light by self-focusing of light in a laser plasma
International Nuclear Information System (INIS)
Gorbunov, L.M.
1983-01-01
The spectrum of the radiation reflected by a laser-produced plasma is considered. In this situation, self-focusing occurs and a region of low density (caviton) is formed. It is shown that the process leads to a considerable broadening of the spectrum on the ''red'' side, and to the appearance of a line structure in the spectrum. The results can explain data for the reflected light spectrum [L. M. Gorbunov et al., FIAN Preprint No. 126 (1979)] as being due to the nonstationary self-focusing of light in a laser-produced plasma that has recently been observed [V. L. Artsimovich et al., FIAN Preprint No. 252 (1981); Sov. Phys. Doklady 27, 618 (1982)
48 CFR 252.227-7019 - Validation of asserted restrictions-Computer software.
2010-10-01
..., creates or implies privity of contract between the Government and the Contractor's subcontractors or... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7019 Validation of asserted restrictions..., unless otherwise specifically indicated, the term “Contractor” means the Contractor and its...
Clinicopathological study of 252 jaw bone periapical lesions from a private pathology laboratory.
Lin, Hung-Pin; Chen, Hsin-Ming; Yu, Chuan-Hang; Kuo, Ru-Cheng; Kuo, Ying-Shiung; Wang, Yi-Ping
2010-11-01
Periapical lesions are common sequelae of pulp diseases. This retrospective study evaluated the clinical and histopathological features of periapical lesions sent to a private pathology laboratory by dentists in private clinics. Two hundred and fifty-two consecutive cases of periapical lesions were collected from September 2005 to October 2009. Clinical data and histopathological features of these periapical lesions were reviewed and analyzed. The 252 periapical lesions consisted of 128 periapical granulomas, 117 periapical cysts, and seven periapical scars. These 252 lesions were taken from 252 patients (92 men and 160 women; mean age = 43.6 years; range, 9-81 years). Of the 252 periapical lesions, 186 were found in the maxilla and 66 in the mandible. The most common site for periapical lesions was the maxillary anterior region (134 cases, including 73 granulomas, 54 cysts and 7 scars), and the most frequently involved tooth was the maxillary lateral incisor (64 cases, including 29 granulomas, 31 cysts and 4 scars). Of the 117 periapical cysts, 116 were lined by stratified squamous epithelium and one by mucoepidermoid epithelium. Hyaline bodies were discovered in the lining epithelium of four periapical cysts. Odontogenic epithelial rest, cholesterol cleft, foamy histiocytes, hemosiderin-laden macrophages, dystrophic calcification, foreign bodies, and bacterial clumps were found in five, three, nine, two, 28, 10 and one periapical granulomas, respectively, as well as in six, 11, eight, seven, 19, nine and eight periapical cysts, respectively. Granulomas and cysts were the two most common periapical lesions. Periapical lesions occurred more frequently in female patients and in those in their fourth to fifth decades. The most commonly affected site for periapical lesions was the maxillary anterior region, and the most frequently involved tooth was the maxillary lateral incisor. Copyright © 2010 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All
Multisample matrix-assisted laser desorption source for molecular beams of neutral peptides
International Nuclear Information System (INIS)
Lupulescu, C.; Abd El Rahim, M.; Antoine, R.; Barbaire, M.; Broyer, M.; Dagany, X.; Maurelli, J.; Rayane, D.; Dugourd, Ph.
2006-01-01
We developed and tested a multisample laser desorption source for producing stable molecular beams of neutral peptides. Our apparatus is based on matrix-assisted laser desorption technique. The source consists of 96 different targets which may be scanned by a software control procedure. Examples of molecular beams of neutral peptides are presented, as well as the influence of the different source parameters on the jet
Investigation of edge plasmas in the anchor cell region of GAMMA 10
International Nuclear Information System (INIS)
Islam, Khairul; Nakashima, Yousuke; Yatsu, Kiyoshi
2000-01-01
The first results of Langmuir probe measurements at the outer transition region of the anchor cell of GAMMA 10 are given. A probe current asymmetry in vertical direction is found in this region. It is also found that the asymmetry of probe current increases in outward direction and the direction of the asymmetry is independent on movable limiter position. A relation of the plasma asymmetry with the main magnetic field configuration is investigated. Plasma flow through the non-asymmetric magnetic field configuration region is thought to be the source of plasma asymmetry in this region, i.e., ∇B and curvature drifts are responsible for the asymmetry. Possibility of cold plasma formation in the anchor cell region is obtained during plug electron cyclotron resonance heating (ECRH) and can be explained with the desorption of particles due to the collision of the drifted out particles with the wall. (author)
Cf-252 neutron brachytherapy: an advance for bulky localized cancer therapy
International Nuclear Information System (INIS)
Maruyama, Y.
1984-01-01
The physical and radiobiogical basis as well as the rationale for neutron brachytherapy, using Cf-252, in human cancer therapy is reviewed. Cf-252 brachytherapy represents an economical and effective form of neutron radiotherapy that is readily and safely applied clinically. It can be used anywhere in the world without unusual personnel, equipment or facilities, or prohibitive expenses or maintenance costs. Used on bulky head and neck, thoracic, abdominal, pelvic, brain and appendage cancers, it overcomes hypoxic radioresistance and produces remarkable rates of tumor clearance. It is easily combined with photon radiotherapy and in proper schedules and doses, it can control advanced but still localized regional cancers to produce tumor cure. It will clear the local manifestations of recurrent or metastatic tumors or advanced stages of primary tumors and therefore in conjunction with other adjuvant therapies offers much more effective tumor control and palliation than present conventional therapy. (Auth.)
Electron-stimulated desorption of lithium ions from lithium halide thin films
International Nuclear Information System (INIS)
Markowski, Leszek
2007-01-01
Electron-stimulated desorption of positive lithium ions from thin layers of lithium halides deposited onto Si(1 1 1) are investigated by the time-of-flight technique. The determined values of isotope effect of the lithium ( 6 Li + / 7 Li + ) are 1.60 ± 0.04, 1.466 ± 0.007, 1.282 ± 0.004, 1.36 ± 0.01 and 1.33 ± 0.01 for LiH, LiF, LiCl, LiBr and LiI, respectively. The observed most probable kinetic energies of 7 Li + are 1.0, 1.9, 1.1, 0.9 and 0.9 eV for LiH, LiF, LiCl, LiBr and LiI, respectively, and seem to be independent of the halide component mass. The values of lithium ion emission yield, lithium kinetic energy and lithium isotope effect suggest that the lattice relaxation is only important in the lithium ion desorption process from the LiH system. In view of possible mechanisms and processes involved into lithium ion desorption the obtained results indicate that for LiH, LiCl, LiBr and LiI the ions desorb in a rather classical way. However, for LiF, ion desorption has a more quantum character and the modified wave packet squeezing model has to be taken into account
Plasma fluorination of vertically aligned carbon nanotubes: functionalization and thermal stability.
Struzzi, Claudia; Scardamaglia, Mattia; Hemberg, Axel; Petaccia, Luca; Colomer, Jean-François; Snyders, Rony; Bittencourt, Carla
2015-01-01
Grafting of fluorine species on carbon nanostructures has attracted interest due to the effective modification of physical and chemical properties of the starting materials. Various techniques have been employed to achieve a controlled fluorination yield; however, the effect of contaminants is rarely discussed, although they are often present. In the present work, the fluorination of vertically aligned multiwalled carbon nanotubes was performed using plasma treatment in a magnetron sputtering chamber with fluorine diluted in an argon atmosphere with an Ar/F2 ratio of 95:5. The effect of heavily diluted fluorine in the precursor gas mixture is investigated by evaluating the modifications in the nanotube structure and the electronic properties upon plasma treatment. The existence of oxygen-based grafted species is associated with background oxygen species present in the plasma chamber in addition to fluorine. The thermal stability and desorption process of the fluorine species grafted on the carbon nanotubes during the fluorine plasma treatment were evaluated by combining different spectroscopic techniques.
Plasma fluorination of vertically aligned carbon nanotubes: functionalization and thermal stability
Directory of Open Access Journals (Sweden)
Claudia Struzzi
2015-12-01
Full Text Available Grafting of fluorine species on carbon nanostructures has attracted interest due to the effective modification of physical and chemical properties of the starting materials. Various techniques have been employed to achieve a controlled fluorination yield; however, the effect of contaminants is rarely discussed, although they are often present. In the present work, the fluorination of vertically aligned multiwalled carbon nanotubes was performed using plasma treatment in a magnetron sputtering chamber with fluorine diluted in an argon atmosphere with an Ar/F2 ratio of 95:5. The effect of heavily diluted fluorine in the precursor gas mixture is investigated by evaluating the modifications in the nanotube structure and the electronic properties upon plasma treatment. The existence of oxygen-based grafted species is associated with background oxygen species present in the plasma chamber in addition to fluorine. The thermal stability and desorption process of the fluorine species grafted on the carbon nanotubes during the fluorine plasma treatment were evaluated by combining different spectroscopic techniques.
Field desorption and field ion surface studies of samples exposed to the plasmas of PLT and ISX
International Nuclear Information System (INIS)
Kellogg, G.L.; Panitz, J.A.
1978-01-01
Modifications to the surface of field-ion specimens exposed to plasma discharges in PLT and ISX determined by Imaging Probe, Field Ion Microscope, and Transmission Electron Microscope analysis have in the past shown several consistent features. Surface films consisting primarily of limiter material with trapped plasma and impurity species have been found to reside on samples with direct line of sight exposure to the plasma during the discharges. Control specimens placed in the tokamak, but shielded from the plasma, on the other hand, remained free of deposits. When exposed to only high power plasma discharges, samples placed at the wall position in PLT and ISX have survived the exposures with no evidence of damage or implantation. In this paper we describe the results of a recent exposure in PLT in which for the first time samples of stainless steel were included for High-Field Surface Analysis. Tokamak operating conditions, including stainless-steel limiters, titanium gettering between discharges, and the occurrence of a disruption, also distinguished this exposure from those carried out previously. Surprisingly, even with stainless-steel limiters, carbon films were found to be deposited on the samples at a rate
2013-09-01
quantum effects by incorporating Zero- Point Energy ( ZPE ) in the initial conditions [19; 108]. Desorption calculations, in order to be incorporated...TST Transition State Theory TTPD Threshold Temperature-Programmed Desorption UHV Ultra-High Vacuum XHV Extreme-High Vacuum ZPE Zero-Point Energy 141
Probing the crossover in CO desorption from single crystal to nanoparticulate Ru model catalysts
DEFF Research Database (Denmark)
Murphy, Shane; Strebel, Christian Ejersbo; Vendelbo, Søren Bastholm
2011-01-01
Crossover in CO desorption behavior and nanoscale structure probed with STM from ruthenium single crystals to PVD and mass-selected nanoparticles.......Crossover in CO desorption behavior and nanoscale structure probed with STM from ruthenium single crystals to PVD and mass-selected nanoparticles....
Neutron radiography for nondestructive testing
International Nuclear Information System (INIS)
John, J.
1979-01-01
Neutron radiography is similar to X-ray inspection in that both depend upon use of radiation that penetrates some materials and is absorbed by others to provide a contrast image of conditions not readily available for visual inspection. X-rays are absorbed by dense materials, such as metals, whereas neutrons readily penetrate metals, but are absorbed by materials containing hydrogen. The neutron radiography has been successfully applied to a number of inspection situations. These include the inspection of explosives, advanced composites, adhesively bonded structures and a number of aircraft engine components. With the availability of Californium-252, it has become feasible to construct mobile neutron radiography systems suitable for field use. Such systems have been used for in-situ inspection of flight line aircraft, particularly to locate and measure hidden corrosion
Directory of Open Access Journals (Sweden)
Stanković Koviljka
2009-01-01
Full Text Available The wide-spread use of semiconductor and gas-filled diodes for non-linear over-voltage protection results in a variety of possible working conditions. It is therefore essential to have a thorough insight into their reliability in exploitation environments which imply exposure to ionizing radiation. The aim of this paper is to investigate the influence of irradiation on over-voltage diode characteristics by exposing the diodes to californium-252 combined neutron/gamma radiation field. The irradiation of semiconductor over-voltage diodes causes severe degradation of their protection characteristics. On the other hand, gas-filled over-voltage diodes exhibit a temporal improvement of performance. The results are presented with the accompanying theoretical interpretations of the observed changes in over-voltage diode behaviour, based on the interaction of radiation with materials constituting the diodes.
Nuclear assay of coal. Volume 8. Continuous nuclear assay of coal (CONAC). Final report
International Nuclear Information System (INIS)
Lagarias, J.; Irminger, P.; Dodson, W.
1979-01-01
Using californium-252 as a source of exciting neutrons, prompt gamma photons emitted by elemental nuclei in the coal have been measured using several detectors, including sodium-iodide and germanium-lithium. Several coal types, including bituminous, subbituminous lignite and anthracite were crushed to various top sizes and analyzed carefully by traditional ASTM wet chemistry techniques at two or three different laboratories. The elements (sulfur, hydrogen, carbon, aluminum, silicon, iron, calcium, sodium, nitrogen, and chlorine) were determined by prompt neutron activations and the quantities compared with those of the wet chemical analyses. Since satisfactory correlation has been obtained at bench-scale level using 100 to 200 kG samples, an apparatus has been designed to analyze a coal stream of up to 50 ton/hour, at an electric power generating station
Neutron dosimetry and spectrometry with Bonner spheres. Working out a log-normal reference matrix
International Nuclear Information System (INIS)
Zaborowski, Henrick.
1981-11-01
From the experimental and theoretical studies made upon the BONNER's spheres System with a I 6 Li(Eu) crystal and with a miniaturized 3 He counter we get the normalized energy response functions R*sub(i)(E). This normalization is obtained by the mathematization of the Resolution Function R*(i,E) in the Log-Normal distribution hypothesis to mono energetic neutrons given in April 1976 to the International Symposium on Californium 252. The fit of the Log-Normal Hypothesis with the experimental and Theoretical data is very satisfactory. The parameter's tabulated values allow a precise interpolation, at all energies between 0.4 eV and 15 MeV and for all spheres diameters between 2 and 12 inches, of the discretized R*sub(ij) Reference Matrix for the applications to neutron dosimetry and spectrometry [fr
Desorption of organophosphorous pesticides from soil with wastewater and surfactant solutions
International Nuclear Information System (INIS)
Hernandez-Soriano, M. C.; Mingorance, M. D.; Pena, A.
2009-01-01
Surfactants can be introduced in the environment by wastewater discharge, point-charge pollution or deliberate action, e. g. to remediate contaminated soil or groundwater. The irrigation of soil with wastewater containing surfactants may modify pesticide desorption from soil, thus affecting their affecting their environmental fate. Desorption from soil of the plain of Granada (South-eastern Spain) of two organophosphorous pesticides, diazinon and dimethoate, differing in solubility and hydrophobicity, has been evaluated in the presence of different surfactant aqueous solutions and municipal wastewater. (Author)
Effect of equilibration time on Pu desorption from goethite
International Nuclear Information System (INIS)
Wong, Jennifer C.; Powell, Brian A.; Zavarin, Mavrik; Begg, James D.; Kersting, Annie B.
2015-01-01
It has been suggested that strongly sorbing ions such as plutonium may become irreversibly bound to mineral surfaces over time which has implications for near- and far-field transport of Pu. Batch adsorption-desorption data were collected as a function of time and pH to study the surface stability of Pu on goethite. Pu(IV) was adsorbed to goethite over the pH range 4.2 to 6.6 for different periods of time (1, 6, 15, 34 and 116 d). Following adsorption, Pu was leached from the mineral surface with desferrioxamine B (DFOB), a complexant capable of effectively competing with the goethite surface for Pu. The amount of Pu desorbed from the goethite was found to vary as a function of the adsorption equilibration time, with less Pu removed from the goethite following longer adsorption periods. This effect was most pronounced at low pH. Logarithmic desorption distribution ratios for each adsorption equilibration time were fit to a pH-dependent model. Model slopes decreased between 1 and 116 d adsorption time, indicating that overall Pu(IV) surface stability on goethite surfaces becomes less dependent on pH with greater adsorption equilibration time. The combination of adsorption and desorption kinetic data suggest that non-redox aging processes affect Pu sorption behavior on goethite.
48 CFR 252.227-7021 - Rights in data-existing works.
2010-10-01
... of Provisions And Clauses 252.227-7021 Rights in data—existing works. As prescribed at 227.7105-2(a), use the following clause: Rights in Data—Existing Works (MAR 1979) (a) The term works as used herein... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in data-existing...
Desorption behaviors of BDE-28 and BDE-47 from natural soils with different organic carbon contents
International Nuclear Information System (INIS)
Liu Wenxin; Cheng Fangfang; Li Weibo; Xing Baoshan; Tao Shu
2012-01-01
Desorption kinetic and isothermal characteristics of BDE-28 and BDE-47 were investigated using natural soils with different organic carbon fractions. The results indicated that a two-compartment first-order model with dominant contribution of slow desorption could adequately describe the released kinetics of studied PBDEs. Desorption isotherms of different samples could be fitted well by linear distribution model or nonlinear Freundlich model. Moreover, most desorption procedures roughly exhibited hysteresis with respect to preceding sorption ones. At the statistically significant level of 0.05 or 0.1, total organic carbon content (f OC ) exhibited significant correlations with the fitted parameters by the isothermal models. The correlations of f OC and SOM fractions (e.g., fulvic acid and humin) with the single point desorption coefficients at lower aqueous concentrations of studied PBDEs were significant; while at higher aqueous concentrations, the relationships were less significant or insignificant. Our findings may facilitate a comprehensive understanding on behaviors of PBDEs in soil systems. - Highlights: ► A two-compartment first-order kinetic model for the PBDEs studied was established. ► Isotherm was fitted well by a linear distribution or a nonlinear Freundlich model. ► Desorption commonly exhibited somewhat hysteresis relative to sorption. ► Soil organic carbon fractions showed close correlations with the model parameters. - Two-compartment first-order model, and linear distribution model or nonlinear Freundlich model could well elucidate desorption kinetics and isotherms of PBDEs in natural soils, respectively.
Modelling of discrete TDS-spectrum of hydrogen desorption
Rodchenkova, Natalia I.; Zaika, Yury V.
2015-12-01
High concentration of hydrogen in metal leads to hydrogen embrittlement. One of the methods to evaluate the hydrogen content is the method of thermal desorption spectroscopy (TDS). As the sample is heated under vacuumization, atomic hydrogen diffuses inside the bulk and is desorbed from the surface in the molecular form. The extraction curve (measured by a mass-spectrometric analyzer) is recorded. In experiments with monotonous external heating it is observed that background hydrogen fluxes from the extractor walls and fluxes from the sample cannot be reliably distinguished. Thus, the extraction curve is doubtful. Therefore, in this case experimenters use discrete TDS-spectrum: the sample is removed from the analytical part of the device for the specified time interval, and external temperature is then increased stepwise. The paper is devoted to the mathematical modelling and simulation of experimental studies. In the corresponding boundary-value problem with nonlinear dynamic boundary conditions physical- chemical processes in the bulk and on the surface are taken into account: heating of the sample, diffusion in the bulk, hydrogen capture by defects, penetration from the bulk to the surface and desorption. The model aimed to analyze the dynamics of hydrogen concentrations without preliminary artificial sample saturation. Numerical modelling allows to choose the point on the extraction curve that corresponds to the initial quantity of the surface hydrogen, to estimate the values of the activation energies of diffusion, desorption, parameters of reversible capture and hydride phase decomposition.