Californium-252 Brachytherapy Combined With External-Beam Radiotherapy for Cervical Cancer: Long-Term Treatment Results

International Nuclear Information System (INIS)

Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu; Wang Dong

2011-01-01

Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ( 252 Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with 252 Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7–12 Gy per insertion per week, with a total dose of 29–45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16–38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44–56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of 252 Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.

Neutron reflector design with Californium 252 neutron for Boron neutron chapter therapy facility using MCNP5 simulation method

International Nuclear Information System (INIS)

Muhammad Fakhrurreza; Kusminanto; Y Sardjono

2014-01-01

In this research has made a reflector design to provide beams of Neutron for BNCT with Californium-252 radioactive source. This collimator is useful to obtain optimum epithermal neutron flux with the smallest impurity radiation (thermal neutron, fast neutron, and gamma). The design process is done using Monte Carlo N-Particle simulation version 5 (MCNP5) code to calculate the neutron flux tally form. The chosen reflector design is the reflectors which use material such as BeO ceramic with 13 cm thick. Moderator use sulfur material with the slope angle of the cone is 30°. From the calculation result, it is obtained that Reflector with 1 gram Californium-252 source can produce a neutron output thermal which has thermal neutron specification 2.23189 x 10 9 n/s.cm 2 , epithermal neutron 3.51548 x 10 9 n/s.cm 2 , and fast neutron 4.82241 x 10 9 n/s.cm 2 From the result, it needs additional collimator because the BNCT requirement. (author)

Biomedical neutron research at the Californium User Facility for neutron science

International Nuclear Information System (INIS)

Martin, R.C.; Byrne, T.E.; Miller, L.F.

1997-01-01

The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy

Biomedical neutron research at the Californium User Facility for Neutron Science

International Nuclear Information System (INIS)

Martin, R.C.; Byrne, T.E.; Miller, L.F.

1998-01-01

The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy. (author)

Neutron activation analysis of the calcium content in vivo, using a 50μg source of californium 252

International Nuclear Information System (INIS)

Guey, A.; Zech, P.Y.; Meary, M.F.; Leitienne, P.

1975-01-01

Owing to the recent commercialisation of californium 252 it is now possible to obtain neutron fluxes strong enough for precise activation of the calcium content of biological targets. After the preliminary measurements necessary to establish the most suitable conditions for irradiating 3 to 5cm thick targets, two parallel sets of experiments were developed. In the first the medium-term total calcium variation was studied in 20 rats, 16 suffering from chronic kidney deficiency. In the second the precision expected as a function of the calcium content of the irradiated target was examined, using 3 sets of tissue equivalent standards of calcium contents 5, 20 and 50g respectively. The first results obtained on calcium 49 in vivo show that a calcium content variation can be followed with a sensitivity threshold below that obtained by conventional methods [fr

A californium-252 source for radiobiological studies at Hiroshima University

International Nuclear Information System (INIS)

Kato, Kazuo; Takeoka, Seiji; Kuroda, Tokue; Tsujimura, Tomotaka; Kawami, Masaharu; Hoshi, Masaharu; Sawada, Shozo

1987-01-01

A 1.93 Ci (3.6 mg) californium-252 source was installed in the radiation facility of the Research Institute for Nuclear Medicine and Biology, Hiroshima University. This source produces fission neutrons (8.7 x 10 9 n/s at the time of its installation), which are similar to neutron spectrum of the atomic bombs. It is useful for studying biological effects of fission neutrons and neutron dosimetry. An apparatus was dosigned to accomodate this source and to apply it to such studies. It has resulted in profitable fission neutron exposures, while suppressing scattered neutrons and secondary gamma rays. This apparatus incorporates many safety systems, including one which interlocks with all of doors and an elevator serving the exposure room, so as to prevent accidents involving users. (author)

Long-term effects of an intracavitary treatment with californium-252 on normal tissue

International Nuclear Information System (INIS)

Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

1976-01-01

About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252 Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252 Cf and 7000 rad from 226 Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252 Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252 Cf and 5000 rad from 226 Ra

Measurement of californium-252 gamma photons depth dose distribution in tissue equivalent material. Vol. 4

Energy Technology Data Exchange (ETDEWEB)

Fadel, M A; El-Fiki, M A; Eissa, H M; Abdel-Hafez, A; Naguib, S H [National Institute of Standards, Cairo (Egypt)

1996-03-01

Phantom of tissue equivalent material with and without bone was used measuring depth dose distribution of gamma-rays from californium-252 source. The source was positioned at center of perspex walled phantom. Depth dose measurements were recorded for X, Y and Z planes at different distances from source. TLD 700 was used for measuring the dose distribution. Results indicate that implantation of bone in tissue equivalent medium cause changes in the gamma depth dose distribution which varies according to variation in bone geometry. 9 figs.

Hypoxic versus normoxic external-beam irradiation of cervical carcinoma combined with californium-252 neutron brachytherapy. Comparative treatment results of a 5-year randomized study

Czech Academy of Sciences Publication Activity Database

Tačev, T.; Vacek, Antonín; Ptáčková, B.; Strnad, V.

2005-01-01

Roč. 181, č. 5 (2005), s. 273-284 ISSN 0179-7158 Institutional research plan: CEZ:AV0Z50040507 Keywords : cervical carcinoma * hypoxyradiotherapy * californium-252 Subject RIV: BO - Biophysics Impact factor: 3.490, year: 2005

Use of polyethylene pellets in the design and construction of a storage safe, a transport vessel and a portable shield for californium-252

International Nuclear Information System (INIS)

Sharma, S.

1986-01-01

A storage and shielding facility for 300 μg of Californium-252 sources was designed and constructed. Though the safe was in a permanent location, the fact that it consisted of a lead bucket surrounded by polyethylene pellets made it simple, movable and inexpensive. If need be, more quantities of Cf-252 could be added without altering the basic design and sacrificing the radiation protection guidelines. The measured radiation levels from 300 μg of stored Cf-252 in and around the storage vault were lower than the expected dose rates by a factor of 5. The measured radiation levels around the occupied environs of the facility were below the maximum permissible yearly dose of 500mrem for non-occupational workers. A transport vessel was designed and constructed to carry up to 50 μg of Californium-252 sources. It consisted of a standard 55 gallon steel drum on casters containing cylindrical lead shield surrounded by polyethylene pellets. The measured maximum surface dose rates on the drum and at one meter away were within the radiation protection guidelines and were less than the expected dose rates. A portable shield was designed and constructed to protect the body in afterloading operations and handling of the sources. It consisted of polyethylene pellets in an aluminum box and an attached 10 cm thick plexiglass eye shield. The simple design, with the ease of using polyethylene pellets can be extended to construct bedside shields

Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

Energy Technology Data Exchange (ETDEWEB)

Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

1976-01-01

About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

Transport calculations of. gamma. -ray flux density and dose rate about implantable californium-252 sources

Energy Technology Data Exchange (ETDEWEB)

Shapiro, A; Lin, B I [Cincinnati Univ., Ohio (USA). Dept. of Chemical and Nuclear Engineering; Windham, J P; Kereiakes, J G

1976-07-01

..gamma.. flux density and dose rate distributions have been calculated about implantable californium-252 sources for an infinite tissue medium. Point source flux densities as a function of energy and position were obtained from a discrete-ordinates calculation, and the flux densities were multiplied by their corresponding kerma factors and added to obtain point source dose rates. The point dose rates were integrated over the line source to obtain line dose rates. Container attenuation was accounted for by evaluating the point dose rate as a function of platinum thickness. Both primary and secondary flux densities and dose rates are presented. The agreement with an independent Monte Carlo calculation was excellent. The data presented should be useful for the design of new source configurations.

Spectral investigation of neutron radiation in three-sectional concrete labyrinth from a californium-252 source

International Nuclear Information System (INIS)

Belogorlov, E.A.; Britvich, G.I.; Getmanov, V.B.

1985-01-01

Construction of labyrinths in points of communication output from the storage-ring under construction is accompanied by numerous difficulties due to a considerable number of gas and cryogenic pipelines, which require large cross sections at the minimal length of the pipelines proper for their location. It results in unfavourable for radiation attenuation ratios between cross section and length of the labyrinth separate sections. Neutron spectra in a model concrete labyrinth, at the entrance to which a neutron source with fission spectrum (californium-252) and the same source in a polyethylene moderator are located, are measured. On the basis of the spectra obtained the formation of fluence and equivalent dose along the labyrinth geometric axis is analyzed. Conditions permitting actually to reduce radiation dose in the labyrinth (dead end provision, the use of cover materials, construction of diaphragms and shielding plates) are simulated

Californium production at the transuranium processing plant

International Nuclear Information System (INIS)

King, L.J.

1976-01-01

The Transuranium Processing Plant (TRU) at ORNL, which is the production, storage, and distribution center for the ERDA heavy element research program, is described. About 0.5 percent of 252 Cf is currently being produced. TRU is a hot-cell, chemical processing facility of advanced design. New concepts have been incorporated into the facility for absolute containment, remote operation, remote equipment installation, and remote maintenance. The facilities include a battery of nine heavily shielded process cells served by master-slave manipulators and eight laboratories, four on each of two floors. Processing includes chemical dissolution of the targets followed by a series of solvent extraction, ion exchange, and precipitation steps to separate and purify the transuranium elements. The transcurium elements Bk, Cf, Es, and Fm are distributed to users. Remote techniques are used to fabricate the Am and Cm into target rods for reirradiation in the HFIR. Californium-252 that is in excess of the needs of the heavy element research program and the Cf sales program is stored at TRU and processed repeatedly to recover the daughter product 248 Cm, which is a highly desirable research material

Californium Multiplier. Part I. Design for neutron radiography

International Nuclear Information System (INIS)

Crosbie, K.L.; Preskitt, C.A.; John, J.; Hastings, J.D.

1982-01-01

The Californium Multiplier (CFX) is a subcritical assembly of enriched uranium surrounding a californium-252 neutron source. The function of the CFX is to multiply the neutrons emitted by the source to a number sufficient for neutron radiography. The CFX is designed to provide a collimated beam of thermal neutrons from which the gamma radiation is filtered, and the scattered neutrons are reduced to make it suitable for high resolution radiography. The entire system has inherent safety features, which provide for system and personnel safety, and it operates at moderate cost. In Part I, the CFX and the theory of its operation are described in detail. Part II covers the performance of the Mound Facility CFX

Californium-252 Program Equipment Evaluation

Energy Technology Data Exchange (ETDEWEB)

Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2017-12-01

To successfully continue the ²⁵²Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.

Use of californium-252 neutron irradiator for in-vivo analysis of the bone calcium content of the hand

International Nuclear Information System (INIS)

Guey, A.; Leitienne, P.; Zech, P.Y.; Traeger, J.; Doyen, J.B.; Breton, J.P.

1979-01-01

With californium-252 it is easy to obtain a high neutron flux of the order of 10 9 n/s. The mean energy of this radiation, which is close on 2 MeV, activates calcium very well. The authors describe a storage and irradiator unit with a 100 μg californium source, with which it will henceforth be possible to develop this technique of measuring the calcium of the hand in a hospital. The test programme has three distinct phases: (1) irradiation of the biological target for 10 min; (2) after a transfer period of 30 s, detection of the radiation emitted by the 49 Ca for 600 s; (3) processing of the numerical data received, which are transmitted on line to a T 1600 calculator. The weight is found by comparing the activity induced in the unknown calcium mass with that induced in a phantom chosen as the activity standard. The reproducibility of the method is of the order of 3% (5% at the worst). The gross standardized result is edited automatically. For physical and clinical reasons, the hand is chosen as the reference part of the body in 70 control subjects. The local irradiation dose is less than 2 rem. The bone calcium content is 14.3+-1.9 g in men and 10.1+-1.3 g in women. In clinical application of the technique it is necessary to differentiate between the normal calcium content and the calcium content found with a pathological state. This makes it necessary to express the measurement in the form of a volume mass (rho). The volume of the hand skeleton (V in cm 3 ) is calculated from the corresponding bone surface (S in cm 2 ) measured by planimetry with the relationship V=8.925 exp 0.0205.S, found after studying 80 hand skeletons. In our control subjects the calcium bone volume mass was 0.288 g/cm 3 in men and 0.282 g/cm 3 in women. There is a very significant difference (p<0.001) in a population of 88 subjects with chronic renal insufficiencies at the terminal stage: rho=0.233 in men and 0.235 in women

Feasibility and market potential of protein determination of wheat using californium-252

International Nuclear Information System (INIS)

Roberts, T.C. Jr.; Eckhoff, N.D.; Clack, R.W.; Roberts, T.C. Sr.

1976-01-01

To evaluate the feasibility of protein determination by capture gamma-ray analysis using californium-252 neutrons, an in-situ protein analysis system for use by grain handlers has been examined. Three 227 kilogram (approximately) lots of wheat were used to determine the amount of nitrogen present. Protein analyses by the Kjeldahl method were obtained from samples taken before and after the capture gamma-ray analyses. The 5.267-MeV gamma-ray was selected for use in this study as a compromise between efficiency and interference from other elements. The associated counting equipment was a multichannel analyzer with pulse shaping electronic and analysis computing equipment. A linear regression program was used to compare the regions of interest to the Kjeldahl protein averages. The counts composing each peak were summed and normalized using the total count of the hydrogen peak. The normalized nitrogen percentages indicate a significant correlation between the spectral regions and the Kjeldahl analyses. To a first approximation, the value of wheat is the wheat protein. At the present time, protein testing of wheat is destructive, cumbersome, and time-consuming as compared to the potential for capture gamma-ray analysis testing. Assuming that such a protein analysis unit can analyze 42 tonne of wheat per hour, over 120 units would be needed to monitor one-half the U.S. annual wheat production. A 0.5% improvement in processor realizations and grain throughput value of $167.00 per tonne will result in a projected savings of $150,000 per year per unit

Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source

International Nuclear Information System (INIS)

Cardoso, Antonio

1976-01-01

Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction 55 Mn (n.gamma) 56 Mn, high concentration of manganese in the matrix and short half - life of 56 Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions 56 Fe(n,p) 56 Mn and 59 Co (n, α) 56 were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

Californium-252 interstitial implants in carcinoma of the tongue

International Nuclear Information System (INIS)

Vtyurin, B.M.; Ivanov, V.N.; Medvedev, V.S.; Galantseva, G.F.; Abdulkadyrov, S.A.; Ivanova, L.F.; Petrovskaya, G.A.; Plichko, V.I.

1985-01-01

A clinical study using 252 Cf sources in brachytherapy of tumors began in the Research Institute of Medical Radiology of the Academy of Medical Sciences of the USSR in 1973. 252 Cf afterloading cells were utilized by the method of simple afterloading. Dosimetry and radiation protection of medical personnel were developed. To substantiate optimal therapeutic doses of 252 Cf neutrons, a correlation of dose, time, and treatment volume factors with clinical results of 252 Cf interstitial implants in carcinoma of the tongue for 47 patients with a minimum follow-up period of 1 year was studied. Forty-nine interstitial implants have been performed. Seventeen patients received 252 Cf implants alone (Group I), 17 other patients received 252 Cf implants in combination with external radiation (Group II), and 15 patients were treated with interstitial implants for recurrent or residual tumors (Groups III). Complete regression of carcinoma of the tongue was obtained in 48 patients (98%). Thirteen patients (27%) developed radiation necrosis. The therapeutic dose of neutron radiation from 252 Cf sources in interstitial radiotherapy of primary tongue carcinomas (Group I) was found to be 7 to 9 Gy. Optimal therapeutic neutron dose in combined interstitial and external radiotherapy of primary tumors (Group II) was 5 to 6 Gy with an external radiation dose of 40 Gy. For recurrent and residual tumors (Group III), favorable results were obtained with tumor doses of 6.5 to 7 Gy

Survey of potential markets for devices using Californium-252

International Nuclear Information System (INIS)

Permar, P.H.

1975-01-01

Potential applications for devices or systems containing 252 Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252 Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252 Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252 Cf, which have been two to four times greater in Europe than in the US

Experimental studies on californium bioavailability to marine benthic invertebrates

International Nuclear Information System (INIS)

Fowler, S.W.; Carvalho, F.P.; Aston, S.R.

1986-01-01

252 Cf is readily taken up by benthic invertebrates from sea water, reaching whole-body concentration factors of 763 in the polychaete Hermione hystrix, 220 in the shrimp Lysmata seticaudata, 665 in the crab Pilumnus hirtellus and 78 in the bivalve mollusc Venerupis decussata after 3 weeks exposure. Surface sorption plays a predominant role in the uptake process. Depuration in clean sea water was a relatively slow process. The shrimp Lysmata eliminated 252 Cf very rapidly due to moulting. Absorption coefficients for ingested 252 Cf were high, approx. 23% in crabs and approx. 97% in brittlestars. The absorbed fraction was excreted twice as fast from crabs as brittlestars. Exposure of organisms to labelled sediment resulted in low transfer factors that were species dependent. There is some evidence to suggest that uptake from sediments is primarily due to 252 Cf transfer from the pore water. Comparison of these results with published experimental data on other transuranic nuclides in the same or similar species suggests that californium bioavailability is roughly equivalent to that of plutonium and americium. (author)

Californium Cf-252 for pelvic radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Maruyama, Y; Feola, J M; Tai, D; Wilson, L C; Van Nagell, J R; Yoneda, J

1978-01-01

Clinical data about therapy concerning tumors of the female gynecological cancers of the cervix, vagina and uterus are reviewed. Dosimetric, laboratory and radiobiological research data form the basis for an approach to such tumors using Cf-252 as a form of boost brachytherapy. Extreme personnel hazards are a real and important consideration and indicate that maximal containment and isolation procedures should be exercised in its use.

Californium source transfer

International Nuclear Information System (INIS)

Wallace, C.R.

1995-01-01

In early 1995, the receipt of four sealed californium-252 sources from Oak Ridge National Lab was successfully accomplished by a team comprised of Radiological Engineering, Radiological Operations and Health Physics Instrumentation personnel. A procedure was developed and walked-down by the participants during a Dry Run Evolution. Several special tools were developed during the pre-planning phases of the project which reduced individual and job dose to minimal levels. These included a mobile lifting device for attachment of a transfer ball valve assembly to the undercarriage of the Cannonball Carrier, a transfer tube elbow to ensure proper angle of the source transfer tube, and several tools used during emergency response for remote retrieval and handling of an unshielded source. Lessons were learned in the areas of contamination control, emergency preparedness, and benefits of thorough pre-planning, effectiveness of locally creating and designing special tools to reduce worker dose, and methods of successfully accomplishing source receipt evolutions during extreme or inclement weather

Magnetism in californium

International Nuclear Information System (INIS)

Moore, J.R.

1988-03-01

A SQUID-based magnetic susceptometer has been constructed for studying small radioactive samples at temperatures below 350 K and in magnetic fields up to 50 kilogauss. The device has been used to study californium (element 98) in a number of solid-state forms: the dhcp metal, several oxides (Cf 2 O 3 in both the bcc and monoclinic structures, Cf 7 O 12 , CfO 2 and BaCfO 3 ), several monopnictides (CfN, CfAs and CfSb) and the trichloride (in both the hexagonal and orthorhombic structures). All of these materials were studied in polycrystalline form, and hexagonal CfCl 3 was studied in single-crystal form as well. The susceptometer has the sensitivity to measure samples containing less than 10 micrograms of californium. The magnetic susceptibilities of all of the californium materials at temperatures above about 100 K are described well by the Curie-Weiss relationship. This behavior is consistent with the assumption that the magnetic 5f electrons are localized and that the paramagnetic behavior can be interpreted in terms of the properties of the free ion. The measured values of the effective paramagnetic moment, μ/sub eff/, for all the californium materials that were studied are reasonably consistent with theoretical values based on intermediate coupling models. All of the californium materials showed some indications of cooperative magnetic effects. The dhcp metal was observed to order ferromagnetically at 52 K, and all of the californium compounds studied showed signs of antiferromagnetic ordering, mostly at temperatures below 25 K. 91 refs., 50 figs., 19 tabs

Atlantic Richfield Hanford Company californium multiplier/delayed neutron counter safety analysis

International Nuclear Information System (INIS)

Zimmer, W.H.

1976-08-01

The Californium Multiplier (CFX) is a subcritical assembly of uranium surrounding 252 Cf spontaneously fissioning neutron sources; its function is to multiply the neutron flux to a level useful for activation analysis. This document summarizes the safety analysis aspects of the CFX, DNC, pneumatic transfer system, and instrumentation and to detail all the aspects of the total facility as a starting point for the ARHCO Safety Analysis Review. Recognized hazards and steps already taken to neutralize them are itemized

Use of californium-252 sources in Hungary for teaching and research

International Nuclear Information System (INIS)

Csikai, J.

1976-01-01

An activation facility was designed to accommodate up to 50 mg of 252 Cf; it contains at present a 500 μg source. The absolute values of thermal, epithermal and fast neutron fluxes were determined by the foil activation method using In, Dy, Au, Al and Fe detectors. Cross-sections averaged for unmoderated 252 Cf neutrons were determined for 22 different reactions for elements with atomic weights lying between A=27 and 204. The sensitivity for determination of Al, Ti, Cu, As, Sr, Mo, In, Cd, Ba, Au, Hg and Pb was calculated for NaI(Tl) and Ge(Li) detectors. Average (n,2n) cross-sections for 252 Cf spectrum were calculated for 49 nuclei lying between A=14 and 204. Angular distributions and cross-sections for the fragments from 252 Cf neutron-induced fission of 232 Th and 238 U were measured. Titanium in bauxite and manganese in aluminium alloys were determined with a 252 Cf source. The applicability of solid-state track detectors for neutron dosimetry, radiography and for the determination of fuel burn-up were investigated using 252 Cf neutron and fragment sources. Characteristics of a jumping spark counter for counting fission fragments were studied with 252 Cf sources. (author)

Undergraduate experiments using the neutron radiation from californium-252

International Nuclear Information System (INIS)

Rossel, J.; Golecki, I.

1976-01-01

Three experiments designed to demonstrate and measure several properties of the neutron radiation emitted by a 3μg 252 Cf source are described. The experiments constitute a special project carried out by a third-year undergraduate student at the Institute of Physics of the University of Neuchatel. The 252 Cf source is enclosed in a shield which allows a pencil of fast neutrons to pass through a central tube, while reducing the ambient radiation below the tolerance level. The shield consists of layers of borated paraffin wax, iron and cadmium. The first experiment uses an air-alcohol diffusion cloud chamber for the demonstration of tracks of recoil protons produced by the neutrons. Semi-quantitative measurements of track lengths give the correct order of magnitude of the proton energies. In the second experiment a liquid scintillator detector is used to scan the beam profile across the radiation shield enclosing the source. A pulse-shape-discrimination system discriminates between neutrons and gamma photons. The third experiment makes use of the nuclear emulsion technique to study the neutron energy distribution of 252 Cf. Preliminary results are compared with published values. (author)

Neutron flux characterization of californium-252 Neutron Research Facility at the University of Texas - Pan American by nuclear analytical technique

Science.gov (United States)

Wahid, Kareem; Sanchez, Patrick; Hannan, Mohammad

2014-03-01

In the field of nuclear science, neutron flux is an intrinsic property of nuclear reaction facilities that is the basis for experimental irradiation calculations and analysis. In the Rio Grande Valley (Texas), the UTPA Neutron Research Facility (NRF) is currently the only neutron facility available for experimental research purposes. The facility is comprised of a 20-microgram californium-252 neutron source surrounded by a shielding cascade containing different irradiation cavities. Thermal and fast neutron flux values for the UTPA NRF have yet to be fully investigated and may be of particular interest to biomedical studies in low neutron dose applications. Though a variety of techniques exist for the characterization of neutron flux, neutron activation analysis (NAA) of metal and nonmetal foils is a commonly utilized experimental method because of its detection sensitivity and availability. The aim of our current investigation is to employ foil activation in the determination of neutron flux values for the UTPA NSRF for further research purposes. Neutron spectrum unfolding of the acquired experimental data via specialized software and subsequent comparison for consistency with computational models lends confidence to the results.

Californium loan programme

International Nuclear Information System (INIS)

1974-01-01

The offer of the United States to loan Californium-252 sources to the IAEA was made by Dr. Glenn T. Seaborg, then chairman of the USAEC, in his opening statement at the 15th. General Conference of the IAEA held in Vienna in 1971. The purpose of this loan was to make neutron emitting sources available to universities in the Member States for use in educational programmes. The sources, in the form of small needles designed for medical use in radiation therapy, were judged highly suitable for didactic applications due to their small size, limited activity and well documented radiological parameters. Subsequently, in May 1973, the Director General announced the availability of the Californium sources to the Member States. To date, numerous sources have been loaned to universities in Czechoslovakia, Costa Rica, the Federal Republic of Germany, Ghana, India, Iran, Israel, Japan, South Africa, Switzerland, the United Kingdom and Uruguay; additional applications for loans are being processed. It is anticipated that the loan programme will be terminated in 1975 once all the available sources have been distributed. n order to provide guidance for the Member States on the safe exploitation of these sources, a prototype use and storage facility was designed by IAEA staff of the Dosimetry Section of the Division of Life Sciences, and constructed at the IAEA laboratory in Seibersdorf, Austria. Figures 2-5 illustrate some of the details of this container, which is being given to the Ghana Nuclear Centre in support of a training programme for students at the university in Accra. Further advice to users of these sources will be provided by the publication of an instructional syllabus, a laboratory manual for experiments and the safety precautions inherent in the proper handling of neutron emitting radionuclides, authored by Professors Erich J. Hall and Harald H. Rossi of Columbia University. The syllabus and manual will be published as part of the IAEA Technical Series in September

Health physics aspects of 252Cf

International Nuclear Information System (INIS)

Bhagwat, A.M.

1974-01-01

After briefly describing the methods of production, radioactive, chemical and biological properties of californium-252, its health physics aspects are reviewed in detail. Its external and internal radiation hazards can be minimised through control of radiation and contamination and proper shield design. Use of various shielding materials is evaluated. The following aspects are also discussed : (1) radiation detectors for neutrons and gamma radiation (2) personnel monitoring techniques (3) bioassay and (4) storage and transportation. (M.G.B.)

Neutron activation analysis at the Californium User Facility for Neutron Science

International Nuclear Information System (INIS)

Martin, R.C.; Smith, E.H.; Glasgow, D.C.; Jerde, E.A.; Marsh, D.L.; Zhao, L.

1997-12-01

The Californium User Facility (CUF) for Neutron Science has been established to provide 252 Cf-based neutron irradiation services and research capabilities including neutron activation analysis (NAA). A major advantage of the CUF is its accessibility and controlled experimental conditions compared with those of a reactor environment The CUF maintains the world's largest inventory of compact 252 Cf neutron sources. Neutron source intensities of ≤ 10 11 neutrons/s are available for irradiations within a contamination-free hot cell, capable of providing thermal and fast neutron fluxes exceeding 10 8 cm -2 s -1 at the sample. Total flux of ≥10 9 cm -2 s -1 is feasible for large-volume irradiation rabbits within the 252 Cf storage pool. Neutron and gamma transport calculations have been performed using the Monte Carlo transport code MCNP to estimate irradiation fluxes available for sample activation within the hot cell and storage pool and to design and optimize a prompt gamma NAA (PGNAA) configuration for large sample volumes. Confirmatory NAA irradiations have been performed within the pool. Gamma spectroscopy capabilities including PGNAA are being established within the CUF for sample analysis

Californium-252: isotope for modern radiotherapy of cervix, uterine and vaginal carcinomas

International Nuclear Information System (INIS)

Maruyama, J.; Beach, J.L.; Nagell, J.R. van

1984-01-01

Cf-252 is an isotope that can easily be afterloaded into available gynecological applicators and used for bulky cervix, uterus or vaginal cancer therapy. It is economical, time and cost effective in use, and can be applied to the therapy of many patients throughout the world. It is more effective for neutron therapy than machine fast neutron therapy and is the only form of neutron therapy producing consistent complication-free 5-year cure of advanced cancers currently available. Cf-252 is an isotope for modern gynecological tumor therapy for the future. Isodose curves for Cf-252 implants revealed dose distributions conforming well to tumor. (orig.) [de

A survey of uses and users of 252Cf

International Nuclear Information System (INIS)

Bigelow, J.E.; Alexander, C.W.; King, L.J.; Knauer, J.B.; Notz, K.J.

1989-01-01

Californium-252, which is one of the transuranium-element isotopes being produced in the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL), has found many applications in service to industry and medicine. As a neutron source, 252 Cf is unique in providing a highly concentrated and extremely reliable neutron spectrum from a very small assembly. Over the past 22 years, 252 Cf has been applied with great success to cancer therapy, to neutron radiography of objects ranging from flowers to entire aircraft, to startup sources for nuclear reactors, to fission activation assay for quality control and safeguards of all commercial nuclear fuel, and to many other beneficial uses, some of which are now poised for further growth. The extensive exploitation of this highly specialized product has been made possible through 252 Sales/Loan programs sponsored by the US DOE Office of Nuclear Materials Production, initially at the Savannah River Laboratory and now at ORNL

Beyond Californium-A Neutron Generator Alternative for Dosimetry and Instrument Calibration in the U.S.

Science.gov (United States)

Piper, Roman K; Mozhayev, Andrey V; Murphy, Mark K; Thompson, Alan K

2017-09-01

Evaluations of neutron survey instruments, area monitors, and personal dosimeters rely on reference neutron radiations, which have evolved from the heavy reliance on (α,n) sources to a shared reliance on (α,n) and the spontaneous fission neutrons of californium-252 (Cf). Capable of producing high dose equivalent rates from an almost point source geometry, the characteristics of Cf are generally more favorable when compared to the use of (α,n) and (γ,n) sources or reactor-produced reference neutron radiations. Californium-252 is typically used in two standardized configurations: unmoderated, to yield a fission energy spectrum; or with the capsule placed within a heavy-water moderating sphere to produce a softened spectrum that is generally considered more appropriate for evaluating devices used in nuclear power plant work environments. The U.S. Department of Energy Cf Loan/Lease Program, a longtime origin of affordable Cf sources for research, testing and calibration, was terminated in 2009. Since then, high-activity sources have become increasingly cost-prohibitive for laboratories that formerly benefited from that program. Neutron generators, based on the D-T and D-D fusion reactions, have become economically competitive with Cf and are recognized internationally as important calibration and test standards. Researchers from the National Institute of Standards and Technology and the Pacific Northwest National Laboratory are jointly considering the practicality and technical challenges of implementing neutron generators as calibration standards in the U.S. This article reviews the characteristics of isotope-based neutron sources, possible isotope alternatives to Cf, and the rationale behind the increasing favor of electronically generated neutron options. The evaluation of a D-T system at PNNL has revealed characteristics that must be considered in adapting generators to the task of calibration and testing where accurate determination of a dosimetric quantity is

Determination of the average number of neutrons per fission event for californium-252

International Nuclear Information System (INIS)

Aleksandrov, B.M.; Belov, L.M.; Drapchinskij, L.V.

1982-01-01

By means of a separate determination of neutron yields and fission event rates, the value of #betta#-bar( 252 Cf) has been measured for a series of new high-purity sources. The improved quality of the source active layers has reduced the error in determining the fission rate to 0.35%. The value obtained for #betta#-bar( 252 Cf) is 3.747+-0.036. A description is given of the design and the parameters of a spherical manganese bath in which the work on refining the value of #betta#-bar( 252 Cf) will be continued. (author)

Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

Energy Technology Data Exchange (ETDEWEB)

Cardoso, Antonio

1976-07-01

Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

Energy Technology Data Exchange (ETDEWEB)

Cardoso, Antonio

1976-07-01

Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

Energy Technology Data Exchange (ETDEWEB)

Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: ce_delgado89@hotmail.com [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)

2015-10-15

Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

Reactor production of 252Cf and transcurium isotopes

International Nuclear Information System (INIS)

Alexander, C.W.; Halperin, J.; Walker, R.L.; Bigelow, J.E.

1990-01-01

Berkelium, californium, einsteinium, and fermium are currently produced in the High Flux Isotope Reactor (HFIR) and recovered in the Radiochemical Engineering Development Center (REDC) at the Oak Ridge National Laboratory (ORNL). All the isotopes are used for research. In addition, 252 Cf, 253 Es, and 255 Fm have been considered or are used for industrial or medical applications. ORNL is the sole producer of these transcurium isotopes in the western world. A wide range of actinide samples were irradiated in special test assemblies at the Fast Flux Test Facility (FFTF) at Hanford, Washington. The purpose of the experiments was to evaluate the usefulness of the two-group flux model for transmutations in the special assemblies with an eventual goal of determining the feasibility of producing macro amounts of transcurium isotopes in the FFTF. Preliminary results from the production of 254g Es from 252 Cf will be discussed. 14 refs., 5 tabs

Separation of 248Cm (III) from 252Cf (III) and its use in time resolved fluorescence spectroscopic (TRFS) studies

International Nuclear Information System (INIS)

Murali, M.S.; Nair, A.G.C.; Gujar, R.B.; Jain, A.; Tomar, B.S.; Godbole, S.V.; Reddy, A.V.R.; Manchanda, V.K.

2008-07-01

The present report gives a description of the methodology for the separation of 248 Cm(III) from decayed 252 Cf (III) waste solution. The waste solution was first assayed for 252 Cf content by neutron counting using a neutron well coincidence counter. The sample was subjected to the chemical separation of 248 Cm (III) from 252 Cf (III) following anion and cation exchange chromatography. The alpha spectrum of the separated curium fraction showed peaks due to 246 Cm and 248 Cm while the corresponding alpha spectrum of californium fraction showed 249,250,251,252 Cf. The gamma ray abundances of 249 Cf were determined with respect to its gamma rays of 387 keV and the data agreed well with that in literature. Separated Cm(III) was further characterized by recording its time resolved fluorescence spectrum (TRFS) in aqueous medium. (author)

Testing of ENDF/B cross section data in the Californium-252 neutron benchmark field

International Nuclear Information System (INIS)

Mannhart, W.

1979-01-01

The fission neutron field of 252 Cf presently represents one of the most well-known neutron benchmark fields. For 13 neutron reactions which are of importance in reactor metrology, measurements of spectrum-averaged cross sections, [sigma], performed in this neutron field were compared with calculated average cross sections. This comparison allows one to draw conclusions as to the quality of different sigma(E) data taken from ENDF/B-IV, from ENDF/B-V, and from recent experiments and used in the calculation of average cross sections. The comparison includes an uncertainty analysis regarding the different uncertainty contributions of [sigma], of sigma(E), and of the spectral distribution of 252 Cf fission neutrons. Additionally, in a few examples, sensitivity studies were carried out. The sensitivity of the spectrum-averaged cross sections to individual characteristics of the sigma(E) data, such as normalization factors or shifts in the energy scale, was investigated. Similarly, the sensitivity of [sigma] to the spectral distribution of 252 Cf was determined. 4 figures, 2 tables

Fabrication of 50-mg 252Cf neutron sources for the FDA [Food and Drug Administration] activation analysis facility

International Nuclear Information System (INIS)

Bigelow, J.E.; Cagle, E.B.; Knauer, J.B.

1987-01-01

The Transuranium Processing Plant (TPP) at ORNL has been requested by the Food and Drug Administration (FDA) to furnish 200 mg of 252 Cf for use in their new activation analysis facility. This paper discusses the procedure to be employed in fabricating the californium into four neutron sources, each containing a nominal 50-mg of 252 Cf. The ORNL Model LSD (Large, Stainless steel, Doubly encapsulated) neutron source consists of a 6.33-mm-diam aluminum pellet doubly encapsulated in Type 304L stainless steel. The pellet is comprised of an aluminum tube holding Cf 2 O 2 SO 4 microspheres confined by pressed aluminum powder. The microspheres are prepared in a separate vessel and then transferred into the specially designed aluminum tube prior to pressing

Automated absolute activation analysis with californium-252 sources

International Nuclear Information System (INIS)

MacMurdo, K.W.; Bowman, W.W.

1978-09-01

A 100-mg 252 Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from 17 O. Detection sensitivities of 239 Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level

A new type-B cask design for transporting 252Cf

International Nuclear Information System (INIS)

Simmons, C.M.

2000-01-01

A project to design, certify, and build a new US Department of Energy (DOE) Type B container for transporting >5 mg of 252 Cf is more than halfway to completion. This project was necessitated by the fact that the existing Oak Ridge National Laboratory (ORNL) Type B containers were designed and built many years ago and thus do not have the records and supporting data that current regulations require. Once the new cask is available, it will replace the existing Type B containers. The cask design is driven by the unique properties of 252 Cf, which is a very intense spontaneous fission neutron source and necessitates a large amount of neutron shielding. The cask is designed to contain up to 60 mg of 252 Cf in the form of californium oxide or californium oxysulfate, in pellet, wire, or sintered material forms that are sealed inside small special-form capsules. The new cask will be capable of all modes of transport (land, sea, and air). The ORNL team, composed of technical and purchasing personnel and using rigorous selection criteria, chose NAC, International (NAC), as the subcontractor for the project. In January 1997, NAC started work on developing the conceptual design and performing the analyses. The original design concept was for a tungsten alloy gamma shield surrounded by two concentric shells of NS-4-FR neutron shield material. A visit to US Nuclear Regulatory Commission (NRC) regulators in November 1997 to present the conceptual design for their comments resulted in a design modification when the question of potential straight-line cracking in the NS-4-FR neutron shield material arose. NAC's modified design includes offset, wedgelike segments of the neutron shield material. The new geometry eliminates concerns about straight-line cracking but increases the weight of the packaging and makes the fabrication more complex. NAC has now completed the cask design and performed the analyses (shielding, structural, thermal, etc.) necessary to certify the cask. The cask

Uranium standards for Californium Shuffler

International Nuclear Information System (INIS)

Gibbs, A.; Boynton, S.P.

1978-10-01

The Laboratories Department analyzed pieces of a U-Al log which were to be canned and used as a set of standards for the nondestructive Californium Shuffler instrument. Evaluation of this instrument is part of an on-going Safeguards Program and is a joint project between LASL and SRP. A U-Al casting of a nominal 30% to 70% composition was made with enriched uranium (56 wt % 235 U). The log was 6 in. in diameter and approximately 2 ft long. A 1/4-in. slice was made before and after each 1-in. slice taken for use as a standard. The 1-in. slices were scanned nondestructively by collimated gamma pulse height analysis. The 1/4-in. slices were divided into quadrants and one quadrant for each slice was destructively analyzed. Results from these tests showed an approximate 1.5% relative variation in uranium concentration from the high to the low point. Successive pieces showed less than 1% relative difference. The 1-in. pieces have been canned and shipped to LASL for testing and will be returned with the Californium Shuffler. The remaining 1/4-in. slices have been sent to NBL and LASL for destructive analysis

Trends in radioisotope development and utilization in the United States

Energy Technology Data Exchange (ETDEWEB)

Mott, W E [Energy Research and Development Administration, Washington, D.C. (USA)

1976-06-01

The current trends in radioisotope and radiation technology in the United States are overviewed with emphasis on the developments since the 1973 Conference. The comments focus primarily on the research and development activities receiving the most attention today from the various agencies of the Government. Among the many available radionuclides, technetium-99m has played the single most important role for making possible the developments in the field of nuclear medicine. Many other short lived medium-lived nuclides are applied in the fields of nuclear medicine, cardiac pacemaker, artificial heart, and blood irradiator. Radiation processing is now firmly established in the United States. The trends in sewage treatment, polymer-impregnated materials, bioengineering, and food irradiation are reviewed. The programs for californium-252, strontium-90, cesium-137, plutonium-238, and krypton-85 are also reviewed. The author concludes this paper with the acknowledgement that Japanese researchers have contributed to and have been closely involved in many of the programs discussed. Of particular note is the participation in the clinical phase of the californium-252 radiotherapy program. Several Japanese hospitals have been cooperating with the United States since the very beginning of the californium-252 program in determining the value of the californium-252 neutron therapy. The research being performed is unique, and will contribute greatly to the decisions on the ultimate future of californium-252 for therapeutic purposes.

Test and evaluation results of the 252Cf shuffler at the Savannah River Plant

International Nuclear Information System (INIS)

Crane, T.W.

1981-03-01

The 252 Cf Shuffler, a nondestructive assay instrument employing californium neutron source irradiation and delayed-neutron counting, was developed for measuring 235 U content of scrap and waste items generated at the Savannah River Plant (SRP) reactor fuel fabrication facility. The scrap and waste items include high-purity uranium-aluminum alloy ingots as well as pieces of castings, saw and lathe chips from machining operations, low-purity items such as oxides of uranium or uranium intermixed with flux materials found in recovery operations, and materials not recoverable at SRP such as floor sweepings or residues from the uranium scrap recovery operation. The uranium contains about 60% 235 U with the remaining isotopes being 236 U, 238 U, and 234 U in descending order. The test and evaluation at SRP concluded that the accuracy, safety, reliability, and ease of use made the 252 Cf Shuffler a suitable instrument for routine use in an industrial, production-oriented plant

Efficacy of brachytherapy with californium-252 neutrons versus cesium-137 photons for eradication of bulky localized cervical cancer: single-institution study

International Nuclear Information System (INIS)

Maruyama, Y.; van Nagell, J.R.; Yoneda, J.; Donaldson, E.; Gallion, H.; Higgins, R.; Powell, D.; Turner, C.; Kryscio, R.

1988-01-01

A fast-neutron-emitting radioisotope, 252 Cf, is being tested in clinical trials of neutron brachytherapy for cervical cancer. The efficacy for histological eradication of bulky stage IB cervical tumors (mean diameter, approximately 6 cm) using combined radiation and surgery was studied in 65 patients treated with 137 Cs or 252 Cf before surgery during 1983-1986. Forty-four patients were treated with 137 Cs and 21 were treated with 252 Cf at equivalent doses of radiation. Fifteen of the 44 specimens (34%) were positive after 137Cs therapy. Only one of the 21 specimens was positive after 252 Cf therapy (P = .025), and that patient was treated in a delayed schedule 21 days after the start of external-beam irradiation rather than early in the course. 252 Cf therapy required a much lower radiation dose and shorter treatment time. The study compared tumor destruction of an identically staged human cervical tumor in situ by direct histological means, using 252 Cf neutron therapy or conventional photon therapy at an identical and equivalent dose adjusted by a relative biological effectiveness of 6.0 for 252 Cf

Local Structure in Americium and Californium Hexa-cyanoferrates - Comparison with Their Lanthanide Analogues

International Nuclear Information System (INIS)

Dupouy, G.; Bonhoure, I.; Dumas, Th.; Moisy, Ph.; Petit, S.; Den Auwer, Ch.; Conradson, St.D.; Hennig, Ch.; Scheinost, A.C.; Le Naour, C.; Simoni, E.

2011-01-01

Metal hexa-cyanoferrates are well known molecular solids for a large variety of cations, although very little has been described for actinide adducts. Two new members of actinide(III) hexa-cyanoferrates were synthesized with the cations americium and californium. They were structurally characterized by infrared and X-ray absorption spectroscopy. Combined EXAFS data at the iron K edge and actinide L 3 edge provide evidence for a three-dimensional model for these two new compounds. Structural data in terms of bond lengths were compared to those reported for the parent lanthanide(III) compounds, neodymium and gadolinium hexa-cyanoferrates, respectively: the americium compound with (KNd(III)Fe(II)-Fe-III(CN) 6 .4H 2 O and the californium compound with (KGd(III)Fe(II)(CN) . 3.5H 2 O and (KGd(III)Fe(II)(CN) 6 .3H 2 O. This comparison between actinide and lanthanide homologues has been carried out on the basis of ionic radii considerations. The americium and neodymium environments appear to be very similar and are arranged in a tri-capped trigonal prism polyhedron of coordination number 9 (CN: 9), in which the americium atom is bonded to six nitrogen atoms and to three water molecules. For the californium adduct, a similar comparison and bond length and angle values derived from EXAFS studies suggest that the californium cation sits in a bi-capped trigonal prism (CN: 8) as in (KGd(III)Fe(II)(CN) 6 . 3H 2 O. This arrangement differs from that in the structure of (KGd(III)Fe(II)(CN) 6 .3.5H 2 O, in which the gadolinium atom is surrounded by 9 atoms. This is one of the rare pieces of information revealed by EXAFS spectroscopy for americium and californium in comparison to lanthanide atoms in molecular solid compounds. A discussion on the decrease in bond length and coordination number from americium to californium is also provided, on the basis of crystallographic results reported in the literature for actinide(III) and lanthanide(III) hydrate series. (authors)

4π-spectrometer technique for measurements of secondary neutron average number in nuclear fission by 252Cf neutrons

International Nuclear Information System (INIS)

Vasil'ev, Yu.A.; Barashkov, Yu.A.; Golovanov, O.A.; Sidorov, L.V.

1977-01-01

A method for determining the average number of secondary neutrons anti ν produced in nuclear fission by the neutrons of the 252 Cf fission spectra by means of a 4π time-of-flight spectrometer is described. Layers of 252 Cf and an isotope studied are placed close to each other; if the isotope layer density is 1 mg/cm 2 probability of its fission is about 10 -5 per one spontaneous fission of californium. Fission fragments of 252 Cf and the isotope investigated have been detected by two surface-barrier counters with an efficiency close to 100%. The layers and the counters are situated in a measuring chamber placed in the center of the 4π time-of-flight spectrometer. The latter is utilized as a neutron counter because of its fast response. The method has been verified by carrying out measurements for 235 U and 239 Pu. A comparison of the experimental and calculated results shows that the method suggested can apply to determine the number of secondary neutrons in fission of isotopes that have not been investigated yet

Spectrum-averaged cross-section measurement of /sup 103/Rh(n,n)/sup 103m/Rh in the /sup 252/Cf fission neutron spectrum

International Nuclear Information System (INIS)

Lamaze, G.P.; Schima, F.J.; Eisenhauer, C.M.; Spiegel, V.

1988-01-01

Because of the similarity in energy dependence of the /sup 103/Rh(n,n') differential cross section to the kerma muscle response function for neutrons, rhodium may be useful as a neutron kerma monitor. In support of its use as a neutron monitor, the spectrum-averaged cross section σ-bar has been measured for a /sup 252/Cf fission neutron spectrum. Pairs of thin rhodium samples were irradiated on opposite sides of a thinly encapsulated /sup 252/Cf neutron source. The neutron emission rate of the /sup 252/Cf source was determined by the manganous sulfate (MnSO/sub 4/) bath technique. In this method, the californium source emission rate is determined by comparison to the known emission rate of NBS-I, a standard radium-beryllium neutron source. The neutron fluence incident on the rhodium samples is determined from the californium source strength, average sample-to-source distance, and the duration of the irradiation. Corrections are made for neutron scattering saturation of activity, and attenuation of the X rays by the sample during counting. The X rays were detected with an intrinsic germanium detector designed specifically for low-energy X-ray detection. The activity was not determined by absolute counting so that the final results depend on the value of P/sub Κx/, to total Κ X-ray emission probability. The results of five separate irradiations yield a value of σ-bar . P/sub Κx/ = 62.3 +- 1.9 mb. Using the most recently published value of P/sub Κx/ gives a value of σ-bar = 739 +- 22 mb. A discussion of systematic uncertainties is given

In situ x-ray fluorescence and californium-252 neutron activation analysis for marine and terrestrial mineral exploration

International Nuclear Information System (INIS)

Wogman, N.A.

1976-12-01

Instrumentation has been designed for in situ analysis of marine and terrestrial minerals using the techniques of x-ray fluorescence and neutron activation analysis. The energy-dispersive x-ray fluorescence analyzer allows more than 20 elements to be quantitatively measured at the 10 ppM level in water depths to 300 m. The analyzer consists of a solid cryogen-cooled Si(Li) detector, a 50 mCi 109 Cd or 57 Co excitation source, and an analyzer-computer system for data storage and manipulation. The neutron activation analysis, which is designed to measure up to 30 elements at parts per hundred to ppM levels, utilizes the man-made element 252 Cf as its neutron activation source. The resulting radioelements which emit characteristic gamma radiation are then analyzed in situ during 2- to 200-s counting intervals with Ge(Li) or NaI(T1) detector systems. An extension of this latter technique, which uses a 252 Cf- 235 U fueled subcritical multiplier, is also being studied. The subcritical facility allows the neutrons from the 252 Cf source to be multiplied, thus providing greater neutron flux. Details of these in situ analysis systems, actual in situ spectra, and recorded data are discussed with respect to the detection of minerals at their varying concentration levels. The system response of each illustrates its usefulness for various rapid environmental mineral exploration studies. These techniques can be utilized on terrestrial surfaces and marine or fresh water sediments. 5 figures, 2 tables

Spectroscopic and redox properties of curium and californium ions in concentrated aqueous carbonate-bicarbonate media

International Nuclear Information System (INIS)

Hobart, D.E.; Varlashkin, P.G.; Samhoun, K.; Haire, R.G.; Peterson, J.R.

1983-01-01

Multimilligram quantities of trivalent curium-248 and californium-249 were investigated by absorption spectroscopy, cyclic voltammetry, and bulk solution electrolysis in concentrated aqueous carbonate-bicarbonate solution. Actinide concentrations between 10 -4 and 10 -2 M were studied in 2 M sodium carbonate and 5.5 M potassium carbonate solutions at pH values from 8 to 14. The solution absorption spectra of Cm(III) and Cf(III) in carbonate media are presented for the first time and compared to literature spectra of these species in noncomplexing aqueous solution. It was anticipated that carbonate complexation of the actinide ions could provide a sufficient negative shift in the formal potentials of the M(IV)/M(III) couples of Cm and Cf to permit the generation and stabilization of their tetravalent states in aqueous carbonate-bicarbonate medium. No conclusive evidence was found in the present work to indicate the existence of any higher oxidation states of curium or californium in carbonate solution. Some possible reasons for our inability to generate and detect oxidized species of curium and californium in this medium are discussed

Inverse gamma ray dose rate effect in californium-252 RBE experiment with human T-1 cells irradiated in vitro

International Nuclear Information System (INIS)

Todd, P.; Feola, J.M.

1986-01-01

Metabolically deoxygenated suspensions of human T-1 cells were used to determine the RBE in hypoxia of low dose rate (LDR) Cf-252 radiation compared to LDR gamma radiation. Based upon the initial portion of the survival curves the RBE was 5.0 ± 1.0 for all components of the Cf-252 radiation and 7.1 ± 1.7 for the neutrons alone. An inverse dose rate effect was observed for LDR gamma radiation in which greater cell sensitivity was observed at lower dose rates and longer irradiation periods. It was demonstrated that there was little or no sublethal damage repair or cell progression during LDR at 21 deg C, and the observed decrease in cell survival probability with increasing irradiation time at a given dose was attributable to reoxygenation of the cell suspensions during the course of LDR exposures. (Auth.)

X-ray-diffraction study of californium metal to 16 GPa

International Nuclear Information System (INIS)

Peterson, J.R.; Benedict, U.; Dufour, C.; Birkel, I.; Haire, R.G.

1983-01-01

The first series of measurements to determine the structural behavior of californium (Cf) metal under pressure has been carried out. The initial dhcp structure transformed sluggishly with increasing pressure to a fcc structure. A bulk modulus of 50(5) GPa was derived for dhcp Cf metal from the relative volume (V/V 0 ) data to 10 GPa

Multiplicity and correlated energy of gamma rays emitted in the spontaneous fission of Californium-252

International Nuclear Information System (INIS)

Brunson, G.S. Jr.

1982-06-01

An array of eight high-speed plastic scintillation detectors has been used to infer a mathematical model for the emission multipliciy of prompt gammas in the spontaneous fission of 252 Cf. Exceptional time resolution and coincidence capability permitted the separation of gammas from fast neutrons over a flight path of approximately 10 cm. About 20 different distribution models were tested. The average energy of the prompt gammas is inversely related to the number emitted; however, this inverse relationship is not strong and the total gamma energy does increase with increasing gamma number. An extension of the experiment incorporated a lithium-drifted germanium gamma spectrometer that resolved nearly 100 discrete gammas associated with fission. Of these gammas, some were preferentially associated with fission in which few gammas were emitted. Certain others were more frequent when many gammas were emitted. Results are presented

Application of fission track detectors to californium-252 neutron dosimetry in tissue near the radiation source

International Nuclear Information System (INIS)

Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.

1981-01-01

Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads mg -1 h -1 +- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads mg -1 h -1 . These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less

Application of fission track detectors to californium-252 neutron dosimetry in tissue near the radiation source

International Nuclear Information System (INIS)

Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.

1981-01-01

Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads micrograms-1 h-1 +/- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads micrograms-1 h-1. These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less

Extraction of Trivalent Actinides and Lanthanides from Californium Campaign Rework Solution Using TODGA-based Solvent Extraction System

Energy Technology Data Exchange (ETDEWEB)

Benker, Dennis [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dryman, Joshua Cory [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2017-07-01

This report presents the studies carried out to demonstrate the possibility of quantitatively extracting trivalent actinides and lanthanides from highly acidic solutions using a neutral ligand-based solvent extraction system. These studies stemmed from the perceived advantage of such systems over cationexchange- based solvent extraction systems that require an extensive feed adjustment to make a low-acid feed. The targeted feed solutions are highly acidic aqueous phases obtained after the dissolution of curium targets during a californium (Cf) campaign. Results obtained with actual Cf campaign solutions, but highly diluted to be manageable in a glove box, are presented, followed by results of tests run in the hot cells with Cf campaign rework solutions. It was demonstrated that a solvent extraction system based on the tetraoctyl diglycolamide molecule is capable of quantitatively extracting trivalent actinides from highly acidic solutions. This system was validated using actual feeds from a Cf campaign.

Californium Recovery from Palladium Wire

Energy Technology Data Exchange (ETDEWEB)

Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2014-08-01

The recovery of ²⁵²Cf from palladium-²⁵²Cf cermet wires was investigated to determine the feasibility of implementing it into the cermet wire production operation at Oak Ridge National Laboratory’s Radiochemical Engineering Development Center. The dissolution of Pd wire in 8 M HNO₃ and trace amounts of HCl was studied at both ambient and elevated temperatures. These studies showed that it took days to dissolve the wire at ambient temperature and only 2 hours at 60°C. Adjusting the ratio of the volume of solvent to the mass of the wire segment showed little change in the kinetics of dissolution, which ranged from 0.176 mL/mg down to 0.019 mL/mg. A successful chromatographic separation of ¹⁵³Gd, a surrogate for ²⁵²Cf, from Pd was demonstrated using AG 50x8 cation exchange resin with a bed volume of 0.5 mL and an internal diameter of 0.8 cm.

Californium oxygen system for 1.50 < O/Cf < 1.72

International Nuclear Information System (INIS)

Turcotte, R.P.; Haire, R.G.

1975-01-01

The californium-oxygen system was studied as a function of temperature, oxygen pressure, and stoichiometry by manometric and x-ray diffraction methods. The results establish rhombohedral Cf 7 O 12 as the stable compound obtained by heating Cf 2 O 3 in air. The isobaric oxidation-reduction cycles Cf 2 O 3 → Cf 7 O 12 → Cf 2 O 3 , observed in constant rate of heating (cooling) experiments, occur with large hysteresis. A close parallel to other fluorite related lanthanide and actinide oxide systems is established. (auth)

Transuranium Processing Plant semiannual report of production, status, and plans for period ending June 30, 1975

International Nuclear Information System (INIS)

King, L.J.; Bigelow, J.E.; Collins, E.D.

1976-03-01

During the period January 1, 1975, through June 30, 1975, the following amounts of transuranium elements were recovered from 22 irradiated HFIR targets: 2g 243 Am, 59 g 244 Cm, 51 mg 249 Bk, 465 mg 252 Cf, 2.5 mg 253 Es, and 1.4 pg 257 Fm. In addition, 45 mg of high-purity 248 Cm was operated from 252 Cf which had been recovered and purified during earlier periods, and 56 mg of a lower-quality 248 Cm was separated from californium purification rework solutions. Five HFIR targets, each containing approximately 9 g of actinides (predominantly curium), were fabricated. A new long-term projection showed that 252 Cf production in the TRU-HFIR complex could increase to as much as 2.5 g/year. During the next 18 months, we expect to recover totals of 46 mg of 249 Bk, 520 mg of 252 Cf, 2.0 mg of 253 Es (in a mixture of isotopes), 220 μg of high-purity 253 Es, and 1.6 pg of 257 Fm. We also expect to obtain 125 mg of high-purity 248 Cm from purified californium now in storage. There are no plans to process any of the remaining SRP Pu-Al tubes or to irradiate any plutonium targets in the HFIR; thus, we do not expect to recover any 244 Pu. Two neutron sources were fabricated, bringing the total fabricated to 77. Two sources that had been used previously in various projects were returned to the TRU inventory and are available for reassignment. In special projects, we (1) produced about 1 mg of 250 Cf by irradiation of 249 Bk in HFIR rabbits, and (2) processed some irradiated 248 Cm samples and obtained yield and isotopic composition data for use in determining the capture cross section of 249 Cm in the HFIR. The values that are currently being used for transuranium element decay data and for cross-section data in planning irradiation-processing cycles, calculating production forecasts, and assaying products are tabulated in the Appendix

Radionuclides in rodents

International Nuclear Information System (INIS)

Taylor, G.N.

1985-01-01

Studies are being conducted in mice comparing the toxicity of radium-226, plutonium-239, americium-241, californium-249 and californium-252 in C57B1/Do (albino) mice and the toxicity of americium-241, plutonium-239 and radium-226 in deer mice (Peromyscus maniculatus) and grasshopper mice (Onychomys leucogaster). These experiments will ultimately enable comparison of the toxicity of the above actinide toxicity in man to be made using radium toxicity as the baseline

[An improved method of preparing protein and peptide probes in mass spectrometry with ionization of division fragments by californium-252 (TOF-PDMS)].

Science.gov (United States)

Chivanov, V D; Zubarev, R A; Aksenov, S A; Bordunova, O G; Eremenko, V I; Kabanets, V M; Tatarinova, V I; Mishnev, A K; Kuraev, V V; Knysh, A N; Eremenko, I A

1996-08-01

The addition of organic acids (picric, oxalic, citric, or tartaric) to peptide and protein samples was found to significantly increase the yield of their quasi-molecular ions (QMI) in time-of-flight 252Cf plasma desorption mass spectrometry. The yield of the ions depended on the pKa of the acid added.

Radiological Characterization Technical Report on Californium-252 Sealed Source Transuranic Debris Waste for the Off-Site Source Recovery Project at Los Alamos National Laboratory

Energy Technology Data Exchange (ETDEWEB)

Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2014-04-24

This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.

48 CFR 53.301-252 - Standard Form 252, Architect-Engineer Contract.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Standard Form 252, Architect-Engineer Contract. 53.301-252 Section 53.301-252 Federal Acquisition Regulations System FEDERAL..., Architect-Engineer Contract. EC01MY91.035 EC01MY91.036 ...

Instrumental neutron activation determination of gold in mineral raw materials using a californium neutron source

International Nuclear Information System (INIS)

Shilo, N.A.; Ippolitov, E.G.; Ivanenko, V.V.; Kustov, B.N.; Zheleznov, V.V.; Aristov, G.N.; Kovalenko, V.V.; Kondrat'ev, N.B.

1983-01-01

A facility using a californium neutron source and a method for the neutron activation analysis of gold were developed. The sensitivity of the determination is 0.1 g/t. The causes of random and systematic errors have been studied. It is concluded that in prospection and evaluation of gold ore deposists, the traditional test tube analysis for gold may be replaced with the developed method. (author)

Radioactive materials production

International Nuclear Information System (INIS)

Anon.

1985-01-01

The Radiochemical Processing Plant (RPP) at ORNL has served as the national repository and distribution center for 233 U for > 20 years. Several hundred kilograms of uranium, containing approximately 90 to 98% 233 U, are stored there in the form of metal, oxides, and nitrate solutions. All of these uranium materials contain small, but significant, concentrations of 232 U, ranging from 2 to 225 ppm. Most of the radioactivity associated with the 233 U comes from the decay daughters of 232 U (74-year half-life). The 252 Cf Industrial Sales/Loan Program involves loans of 252 Cf neutron sources to agencies of the US Government and sales of 252 Cf as the bulk oxide and as palladium-californium alloy pellets and wires. The program has been operated since 1968 in temporary facilities at the Savannah River Laboratory (SRL). The obsolete hot-cell facilities at SRL are now being decommissioned, and the program activities are being transferred to ORNL's Californium Facility in Bldg. 7930, which is managed by the staff of the Transuranium Processing Plant

Transuranium Processing Plant semiannual report of production, status, and plans for period ending June 30, 1975

Energy Technology Data Exchange (ETDEWEB)

King, L.J.; Bigelow, J.E.; Collins, E.D.

1976-03-01

During the period January 1, 1975, through June 30, 1975, the following amounts of transuranium elements were recovered from 22 irradiated HFIR targets: 2g /sup 243/Am, 59 g /sup 244/Cm, 51 mg /sup 249/Bk, 465 mg /sup 252/Cf, 2.5 mg /sup 253/Es, and 1.4 pg /sup 257/Fm. In addition, 45 mg of high-purity /sup 248/Cm was operated from /sup 252/Cf which had been recovered and purified during earlier periods, and 56 mg of a lower-quality /sup 248/Cm was separated from californium purification rework solutions. Five HFIR targets, each containing approximately 9 g of actinides (predominantly curium), were fabricated. A new long-term projection showed that /sup 252/Cf production in the TRU-HFIR complex could increase to as much as 2.5 g/year. During the next 18 months, we expect to recover totals of 46 mg of /sup 249/Bk, 520 mg of /sup 252/Cf, 2.0 mg of /sup 253/Es (in a mixture of isotopes), 220 ..mu..g of high-purity /sup 253/Es, and 1.6 pg of /sup 257/Fm. We also expect to obtain 125 mg of high-purity /sup 248/Cm from purified californium now in storage. There are no plans to process any of the remaining SRP Pu-Al tubes or to irradiate any plutonium targets in the HFIR; thus, we do not expect to recover any /sup 244/Pu. No changes were made in the chemical processing flowsheets normally used at TRU. Two neutron sources were fabricated, bringing the total fabricated to 77. In special projects, we (1) produced about 1 mg of /sup 250/Cf by irradiation of /sup 249/Bk in HFIR rabbits, and (2) processed some irradiated /sup 248/Cm samples and obtained yield and isotopic composition data for use in determining the capture cross section of /sup 249/Cm in the HFIR. The values that are currently being used for transuranium element decay data and for cross-section data in planning irradiation-processing cycles, calculating production forecasts, and assaying products are tabulated in the Appendix.

Calibration of a Modified Californium Shuffler

International Nuclear Information System (INIS)

Sadowski, E.T.; Armstrong, F.; Oldham, R.; Ceo, R.; Williams, N.

1995-01-01

A californium shuffler originally designed to assay hollow cylindrical pieces of UA1 has been modified to assay solid cylinders. Calibration standards were characterized via chemical analysis of the molten UA1 taken during casting of the standards. The melt samples yielded much more reliable characterization data than drill samples taken from standards after the standards had solidified. By normalizing one well-characterized calibration curve to several standards at different enrichments, a relatively small number of standards was required to develop an enrichment-dependent calibration. The precision of this shuffler is 0.65%, and the typical random and systematic uncertainties are 0.53% and 0.73%, respectively, for a six minute assay of an ingot containing approximately 700 grams of 235 U. This paper will discuss (1) the discrepancies encountered when UA1 standards were characterized via melt samples versus drill samples, (2) a calibration methodology employing a small number of standards, and (3) a comparison of results from a previously unused shuffler with an existing shuffler. A small number of UA1 standards have been characterized using samples from the homogeneous molten state and have yielded enrichment-dependent and enrichment-independent calibration curves on two different shufflers

Safety Analysis Report for Packaging (SARP) of the Oak Ridge National Laboratory TRU Californium Shipping Container

International Nuclear Information System (INIS)

Box, W.D.; Shappert, L.B.; Seagren, R.D.; Klima, B.B.; Jurgensen, M.C.; Hammond, C.R.; Watson, C.D.

1980-01-01

An analytical evaluation of the Oak Ridge National Laboratory TRU Californium Shipping Container was made in order to demonstrate its compliance with the regulations governing off-site shipment of packages that contain radioactive material. The evaluation encompassed five primary categories: structural integrity, thermal resistance, radiation shielding, nuclear criticality safety, and quality assurance. The results of this evaluation demonstrate that the container complies with the applicable regulations

Neutron emission in fission of highly excited californium nuclei (E*=76 MeV)

International Nuclear Information System (INIS)

Blinov, M.V.; Bordyug, V.M.; Kozulin, Eh.M.; Mozhaev, A.N.; Levitovich, M.; Muzychka, Yu.A.; Penionzhkevich, Yu.Eh.; Pustyl'nik, B.I.

1990-01-01

The differential cross sections for neutron production in the fission of highly excited californium nuclei formed in the 238 U+ 12 C (105 MeV) reaction have been measured. From the analysis of the experimental data is follows that the number of pre-fission neutrons substantially exceeds the value obtained in the framework of the standard statistical model. The saddle-to-scission time of the excited nucleus is estimated on the basis of the neutron multiplicity. The dependences of the neutron number and neutron average energies upon the fragment mass are determined

Neutron emission in fission of highly excited californium nuclei (E* = 76 MeV)

International Nuclear Information System (INIS)

Blinov, M.V.; Bordyug, V.M.; Kozulin, E.M.; Levitovich, M.; Mozhaev, A.N.; Muzychka, Yu.A.; Penionzhkevich, Yu.E.; Pustyl'nik, B.I.

1990-01-01

Differential cross sections for neutron production have been measured in fission of excited californium nuclei produced in the reaction 238 U + 12 C (105 MeV). It follows from analysis of the experimental results that the number of neutrons emitted before fission considerably exceeds the number obtained in the framework of the standard statistical model. On the basis of the multiplicity of neutrons they authors have estimated the time of fission of the excited nucleus. The dependence of the number of neutrons and their average energies on the mass of the fragments is determined

Comparison of the Savannah River Site billet active well coincidence counter and two Californium Shufflers

International Nuclear Information System (INIS)

Sadowski, E.T.; Griffin, J.C.; Rinard, P.M.

1991-01-01

A Scrap Californium Shuffler at the Savannah River Site (SRS) was calibrated to assay the U-Al cores of billets (an intermediate step in the SRS reactor fuel fabrication cycle.) The precision of the Scrap Shuffler over several years has been approximately 0.50%. A typical total uncertainty for the assay of a core on the Scrap Shuffler is approximately 0.33% for a twelve minute assay. The precision over several months and a typical total uncertainty for the Billet Active Well (neutron) Coincidence Counter (BAWCC) are approximately 1.0% and 1.9%, respectively, for a fifteen minute assay. A new Billet Californium Shuffler specifically designed for assaying SRS billets has yielded precision (over one month) and total uncertainty results of 0.40% and 0.69%, respectively, for an eight minute assay. The introduction of a measurement point into the fuel fabrication cycle to replace estimates based upon material weight will greatly enhance material and process control in the Reactor Materials area of SRS. The use of all three instruments provides a comparison of the relative merits of Active Well (neutron) Coincidence Counters (AWCCs) and shufflers for assay of homogeneous and geometrically simple material containing 235 U. The measurement precisions, systematic and random uncertainties, as well as the procurement and operation of each instrument will be compared. 3 refs., 5 figs., 1 tab

The development and medical applications of a simple facility for partial body in vivo neutron activation analysis using californium-252 sources

International Nuclear Information System (INIS)

Boddy, K.

1978-11-01

A simple and cheap facility for partial body neutron activation analysis has been designed, based on the use of two 100 μg 252 Cf neutron sources. The results reported show that calcium can be measured in parts of the body such as the tibia with a precision as good as +- 1.6 % for a radiation dose of 2 rem. The uniformity of the thermal neutron flux density is better than +- 3 % over 10 cm. Some applications of this irradiation facility for studies of trace elements, in particular cadmium in liver and aluminium in liver or brain, have also been explored. However, the sensitivity attainable is not yet sufficient for the study of normal levels, but could be of interest in toxicological investigations

Savannah River Plant californium-252 Shuffler electronics manual

International Nuclear Information System (INIS)

Bourret, S.C.; Crane, T.W.; Eccleston, G.W.; Gallegos, E.A.; Garcia, D.L.

1980-03-01

Detailed information is presented in this report, an electronics manual for the Savannah River Plant Shuffler, about the electronics associated with the various control and data acquisition functions of the Shuffler subsystems. Circuit diagrams, interconnection information, and details about computer control and programming are included

Savannah River Plant Californium-252 Shuffler software manual

International Nuclear Information System (INIS)

Johnson, S.S.; Crane, T.W.; Eccleston, G.W.

1979-03-01

A software manual for operating the Savannah River Plant Shuffler nondestructive assay instrument is presented. The procedures for starting up the instrument, making assays, calibrating, and checking the performance of the hardware units are described. A list of the error messages with an explanation of the circumstances prompting the message and possible corrective measures is given. A summary of the software package is included showing the names and contents of the files and subroutines. The procedure for modifying the software package is outlined

Calculation of neutron and gamma-ray energy spectra in liquid air and liquid nitrogen due to 14-MeV neutron and californium-252 sources

International Nuclear Information System (INIS)

Straker, E.A.; Gritzner, M.L.; Harris, L. Jr.

1978-01-01

Calculations of neutron and gamma-ray fluences from 14-MeV neutron and 252 Cf sources in liquid air and liquid nitrogen have been performed. These calculations were made specifically for comparison with experimental data measured at Stohl, Federal Republic of Germany. The discrete-ordinates method was utilized with neutron and gamma-ray cross sections from ENDF/B-IV. One-dimensional calculational models were developed for the sources and tank. Limited comparisons are made with experimental data

Definitive Brachytherapy for Kaposi's Sarcoma

International Nuclear Information System (INIS)

Williams, A.; Ezzell, G.; Zalupski, M.; Fontanesi, J.

1996-01-01

Purpose: To assess the efficacy and possible complications in patients diagnosed with Kaposi's sarcoma and treated with definitive brachytherapy. Methods and Materials: Between January, 1995 and December, 1995, four patients with Kaposi's sarcoma (KS) were treated with brachytherapy. Three patients, all with positive HIV status were treated using Iridium 192 (Ir-192) sources via a high-dose rate remote afterloader. One patient with endemic KS was treated using the application of catheters loaded with Californium 252. Eight sites were treated and included scalp, feet, nose, penis, hand, neck, and back. Dose rate for Ir-192 was 330cGy/fx to a total dose of 990cGy. The Californium was delivered as 100nGy/b.i.d. to a total dose of 900nGy. Follow-up as ranged from 2-6 months. Results: All four patients remain alive. Seven of eight sites have had complete clinical response and each patient has reported durable pain relief that has not subsided through last follow-up of 1/96. Two of eight sites, both treated with surface mold technique with Californium 252 developed moist desquamation. The remaining six sites did not demonstrate significant toxicity. Conclusion: Brachytherapy can offer Kaposi's sarcoma patients results that are equivalent to external beam radiation therapy, with minimal complications, a shorter treatment time and potential cost effectiveness

Dicty_cDB: SLH252 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH252 (Link to dictyBase) - - - - SLH252F (Link to Original site) SLH2...52F 158 - - - - - - Show SLH252 Library SL (Link to library) Clone ID SLH252 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...52Q.Seq.d/ Representative seq. ID SLH252F (Link to Original site) R...epresentative DNA sequence >SLH252 (SLH252Q) /CSM/SL/SLH2-C/SLH252Q.Seq.d/ ACAGAATGGGTAAAGTACATGGTGGTTTGAATC

Ab initio full-potential study of mechanical properties and magnetic phase stability of californium monopnictides (CfN and CfP)

Energy Technology Data Exchange (ETDEWEB)

Amari, S., E-mail: siham_amari@yahoo.fr [Faculté des Sciences de la Nature et de la Vie, Université Hassiba Benbouali, Chlef, 02000 (Algeria); Bouhafs, B. [Laboratoire de Modélisation et Simulation en Sciences des Matériaux, Université Djillali Liabès de Sidi Bel-Abbés, Sidi Bel-Abbés, 22000 (Algeria)

2016-09-15

Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young’s modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.

15 CFR 25.2 - Definitions.

Science.gov (United States)

2010-01-01

... head means the Secretary of the Department of Commerce, or designee. Benefit means, except as the... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Definitions. 25.2 Section 25.2 Commerce and Foreign Trade Office of the Secretary of Commerce PROGRAM Fraud Civil Remedies § 25.2...

Neutron spectra from radionuclide sources for cardiac pacemakers

International Nuclear Information System (INIS)

Kluge, H.

1975-01-01

Neutron spectra from Plutonium 238 radioisotope batteries powering cardiac pacemakers are measured in the energy range above 0.7 MeV. The results are used to calculate radiation doses within a cylindrical phantom. There are only minor differences between the different types of plutonium 238-batteries and californium 252-batteries

Possible stabilization of the tetravalent oxidation state of berkelium and californium in acetonitrile with triphenylarsine oxide

International Nuclear Information System (INIS)

Payne, G.F.; Peterson, J.R.

1987-01-01

It appears that we may have prepared Bk(IV) nitrate.nTPAs0 and Bk(IV) perchlorate.nTPAs0 complexes which formed the corresponding Cf(IV) complexes through the beta decay of Bk-249. Definitive proof should come from similar experiments with quantities of Bk-249 large enough to allow spectrophotometric detection of the characteristic f→f transitions in these berkelium and californium species. It is clear, however, that TPAs0 and acetonitrile can play a pivotal role in the stabilization of lanact(IV) species

The protective cell petrus for the production of californium 252; Cellule blindee petrus pour la production et l'etude du californium 252

Energy Technology Data Exchange (ETDEWEB)

Sontag, R; Berger, R [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

1967-07-01

The alpha, beta, gamma, neutron cell which is described in the present paper is devoted to the transplutonium element production and study. It is located at the CEN in Fontenay-aux-Roses (France). The 4 feet ordinary concrete shielding made of stacked blocs allows the manipulation of radioactive sources as high as 1000 curies of 1 MeV gamma rays and with a fast neutrons flux of 10{sup 9} n.cm{sup -2}.s{sup -1}. The airtight alpha containment box is equipped with two transfer systems, one consists of a parallelepiped shaped airtight box located in a turntable, the other uses standard cylindrical containers made of polyethylene. The general equipment and the main setting up are also described. (authors) [French] La cellule alpha, beta, gamma, neutron, qui fait l'objet du present article, est destinee a la production et a l'etude des elements transplutoniens. Elle est construite au C.E.N. de Fontenay-aux-Roses (France). La protection biologique, calculee pour une activite de 1000 curies de rayonnement gamma d'energie 1 MeV accompagnee d'un flux de neutrons rapides de 10{sup 9}/cm{sup 2}s, est constituee par des parois en beton de 1,20 m d'epaisseur. L'enceinte alpha est une boite etanche qui comporte devx systemes de transferts: l'un consiste en une boite parallelepipedique etanche logee dans un barillet, l'autre fait appel a des recipients cylindriques standard en polyethylene. L'equipement general et les installations les plus importantes sont ensuite decrits. (auteurs)

7 CFR 3565.252 - Housing types.

Science.gov (United States)

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Housing types. 3565.252 Section 3565.252 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Property Requirements § 3565.252 Housing types. The property may...

Single-event burnout of power MOSFET devices for satellite application

International Nuclear Information System (INIS)

Xue Yuxiong; Tian Kai; Cao Zhou; Yang Shiyu; Liu Gang; Cai Xiaowu; Lu Jiang

2008-01-01

Single-event burnout (SEB) sensitivity was tested for power MOSFET devices, JTMCS081 and JTMCS062, which were made in Institute of Microelectronics, Chinese Academy of Sciences, using californium-252 simulation source. SEB voltage threshold was found for devices under test (DUT). It is helpful for engineers to choose devices used in satellites. (authors)

14 CFR 252.9 - Ventilation systems.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Ventilation systems. 252.9 Section 252.9... REGULATIONS SMOKING ABOARD AIRCRAFT § 252.9 Ventilation systems. Air carriers shall prohibit smoking whenever the ventilation system is not fully functioning. Fully functioning for this purpose means operating so...

Validation of the MCNP-DSP Monte Carlo code for calculating source-driven noise parameters of subcritical systems

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.

1995-01-01

This paper describes calculations performed to validate the modified version of the MCNP code, the MCNP-DSP, used for: the neutron and photon spectra of the spontaneous fission of californium 252; the representation of the detection processes for scattering detectors; the timing of the detection process; and the calculation of the frequency analysis parameters for the MCNP-DSP code

Shielding experiments in different materials with 252Cf neutron spectra

International Nuclear Information System (INIS)

Sathian, Deepa; Marathe, P.K.; Pal, Rupali; Jayalakshmi, V.; Chourasiya, G.; Mayya, Y.S.

2008-01-01

Adequate shielding for neutron sources can be determined using analytical method or by actually measuring the attenuation for the target configuration. This paper describes the measurement of Half Value Thickness (HVT), Tenth Value Thickness (TVT), Σ values for four different shielding materials, using a standard 252 Cf neutron source and comparing with the values calculated using an empirical relationship. BF 3 based REM-counter is used for measurement of neutron dose equivalent, against different thickness of the shielding material. The experimental HVT and S values are in good agreement with the calculated values. From this study, it is concluded that, among the four materials studied, high density polyethylene (HDPE) is best suitable for the shielding of a 252 Cf neutron source. (author)

The status of low dose rate and future of high dose rate Cf-252 brachytherapy

International Nuclear Information System (INIS)

Rivard, M.J.; Wierzbicki, J.G.; Van den Heuvel, F.; Chuba, P.J.; Fontanesi, J.

1997-12-01

This work describes the current status of the US low dose rate (LDR) Cf-252 brachytherapy program. The efforts undertaken towards development of a high dose rate (HDR) remotely after loaded Cf-252 source, which can accommodate 1 mg or greater Cf-252, are also described. This HDR effort is a collaboration between Oak Ridge National Laboratory (ORNL), commercial remote after loader manufactures, the Gershenson Radiation Oncology Center (ROC), and Wayne State University. To achieve this goal, several advances in isotope chemistry and source preparation at ORNL must be achieved to yield a specific material source loading of greater than or equal 1 mg Cf-252 per mm3. Development work with both radioactive and non-radioactive stand-ins for Cf-252 have indicated the feasibility of fabricating such sources. As a result, the decreased catheter diameter and computer controlled source placement will permit additional sites (e.g. brain, breast, prostate, lung, parotid, etc.) to be treated effectively with Cf-252 sources. Additional work at the Radiochemical Engineering and Development Center (REDC) remains in source fabrication, after loader modification, and safe design. The current LDR Cf-252 Treatment Suite at the ROC is shielded and licensed to hold up to 1 mg of Cf-252. This was designed to maintain cumulative personnel exposure, both external to the room and in direct isotope handling, at less than 20 microSv/hr. However, cumulative exposure may be greatly decreased if a Cf-252 HDR unit is employed which would eliminate direct isotope handling and decrease treatment times from tilde 3 hours to an expected range of 3 to 15 minutes. Such a Cf-252 HDR source will also demonstrate improved dose distributions over current LDR treatments due to the ability to step the point-like source throughout the target volume and weight the dwell time accordingly

Source storage and transfer cask: Users Guide

International Nuclear Information System (INIS)

Eccleston, G.W.; Speir, L.G.; Garcia, D.C.

1985-04-01

The storage and shield cask for the dual californium source is designed to shield and transport up to 3.7 mg (2 Ci) of 252 Cf. the cask meets Department of Transportation (DOT) license requirements for Type A materials (DOT-7A). The cask is designed to transfer sources to and from the Flourinel and Fuel Storage (FAST) facility delayed-neutron interrogator. Californium sources placed in the cask must be encapsulated in the SR-CF-100 package and attached to Teleflex cables. The cask contains two source locations. Each location contains a gear box that allows a Teleflex cable to be remotely moved by a hand crank into and out of the cask. This transfer procedure permits sources to be easily removed and inserted into the delayed-neutron interrogator and reduces personnel radiation exposure during transfer. The radiation dose rate with the maximum allowable quantity of californium (3.7 mg) in the cask is 30 mR/h at the surface and less than 2 mR/h 1 m from the cask surface. This manual contains information about the cask, californium sources, describes the method to ship the cask, and how to insert and remove sources from the cask. 28 figs

46 CFR 252.13 - Contract.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Contract. 252.13 Section 252.13 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING SUBSIDIZED VESSELS AND OPERATORS OPERATING... Contract. Upon approval by the Board of an application for ODS, the applicant and the United States may...

Solid-State Neutron Multiplicity Counting System Using Commercial Off-the-Shelf Semiconductor Detectors

Energy Technology Data Exchange (ETDEWEB)

Rozhdestvenskyy, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2017-08-09

This work iterates on the first demonstration of a solid-state neutron multiplicity counting system developed at Lawrence Livermore National Laboratory by using commercial off-the-shelf detectors. The system was demonstrated to determine the mass of a californium-252 neutron source within 20% error requiring only one-hour measurement time with 20 cm² of active detector area.

7 CFR 252.3 - Administration.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 252.3 Section 252.3 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Administration. (a) Role of FNS. The Secretary will designate those commodities which will be available under the...

48 CFR 252.231-7000 - Supplemental cost principles.

Science.gov (United States)

2010-10-01

... principles. 252.231-7000 Section 252.231-7000 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.231-7000 Supplemental cost principles. As prescribed in 231.100-70, use the following clause: Supplemental Cost Principles (DEC 1991) When the allowability of costs under...

Properties of neutron sources

International Nuclear Information System (INIS)

1987-03-01

The Conference presentations were divided into sessions devoted to the following topics: white neutron sources, primarily pulsed (6 papers); fast neutron fields (5 papers); Californium-252 prompt fission neutron spectra (14 papers); monoenergetic sources and filtered beams (11 papers); 14 MeV neutron sources (10 papers); selected special application (one paper); and a general interest session (4 papers). Individual abstracts were prepared separately for the papers

25m2 target-aligned heliostat with closed-loop control

CSIR Research Space (South Africa)

Roos, TH

2007-09-01

Full Text Available system making use of a solar tracker has been developed and tested on a 1.252m target-aligned miniheliostat. A tracking accuracy of 3.3 milliradians was obtained. A good focal spot has been obtained with the 252m target-aligned research heliostat....

Sensitivity Analysis of Cf-252 (sf) Neutron and Gamma Observables in CGMF

Energy Technology Data Exchange (ETDEWEB)

Carter, Austin Lewis [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Talou, Patrick [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Stetcu, Ionel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kiedrowski, Brian Christopher [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Jaffke, Patrick John [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-12-06

CGMF is a Monte Carlo code that simulates the decay of primary fission fragments by emission of neutrons and gamma rays, according to the Hauser-Feshbach equations. As the CGMF code was recently integrated into the MCNP6.2 transport code, great emphasis has been placed on providing optimal parameters to CGMF such that many different observables are accurately represented. Of these observables, the prompt neutron spectrum, prompt neutron multiplicity, prompt gamma spectrum, and prompt gamma multiplicity are crucial for accurate transport simulations of criticality and nonproliferation applications. This contribution to the ongoing efforts to improve CGMF presents a study of the sensitivity of various neutron and gamma observables to several input parameters for Californium-252 spontaneous fission. Among the most influential parameters are those that affect the input yield distributions in fragment mass and total kinetic energy (TKE). A new scheme for representing Y(A,TKE) was implemented in CGMF using three fission modes, S1, S2 and SL. The sensitivity profiles were calculated for 17 total parameters, which show that the neutron multiplicity distribution is strongly affected by the TKE distribution of the fragments. The total excitation energy (TXE) of the fragments is shared according to a parameter RT, which is defined as the ratio of the light to heavy initial temperatures. The sensitivity profile of the neutron multiplicity shows a second order effect of RT on the mean neutron multiplicity. A final sensitivity profile was produced for the parameter alpha, which affects the spin of the fragments. Higher values of alpha lead to higher fragment spins, which inhibit the emission of neutrons. Understanding the sensitivity of the prompt neutron and gamma observables to the many CGMF input parameters provides a platform for the optimization of these parameters.

46 CFR 252.33 - Hull and machinery insurance.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 252.33 Section 252.33... Subsidy Rates § 252.33 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery, increased value, excess general average...

48 CFR 252.217-7010 - Performance.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance. 252.217-7010... Clauses 252.217-7010 Performance. As prescribed in 217.7104(a), use the following clause: Performance (JUL..., scrap or other ship's material of the Government resulting from performance of the work as items of...

Transuranium Processing Plant semiannual report of production, status, and plans for period ending December 31, 1976

International Nuclear Information System (INIS)

King, L.J.; Bigelow, J.E.; Collins, E.D.

1977-10-01

During the period July 1, 1976, through December 31, 1976, transuranium elements were obtained from 11 irradiated HFIR targets; products recovered are 0.3 g 243 Am, 16.6 g 244 Cm, 23 g 249 Bk, 211 g 252 Cf, 1.15 mg 253 Es, and 0.4 pg 247 Fm. Two batches of high-purity 248 Cm were purified chemically for shipment, and another batch containing about 62 mg of 248 Cm was separated from 252 Cf. Thirty shipments were made from TRU during the period; recipients and the amounts of nuclides are listed in tabular form. Nine HFIR targets, each containing 8 to 9 g of curium, were fabricated. The sequence of chemical processing steps used to purify the californium product was changed; this change yielded a shorter recovery time for high-purity 253 Es, which enabled a 50% increase in the amount obtained. Eight neutron sources were fabricated during this report period, bringing the total fabricated to date to 92. Three sources that had previously been returned to TRU were reassigned; two others are also available for reassignment. The values currently being used for transuranium element decay data and for cross-section data in planning irradiation-processing cycles, calculating production forecasts, and assaying products are tabulated in the Appendix

48 CFR 252.217-7009 - Default.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Default. 252.217-7009... Clauses 252.217-7009 Default. As prescribed in 217.7104(a), use the following clause: Default (DEC 1991... of default to the Contractor, terminate the whole or any part of a job order if the Contractor fails...

The protective cell petrus for the production of californium 252

International Nuclear Information System (INIS)

Sontag, R.; Berger, R.

1967-01-01

The alpha, beta, gamma, neutron cell which is described in the present paper is devoted to the transplutonium element production and study. It is located at the CEN in Fontenay-aux-Roses (France). The 4 feet ordinary concrete shielding made of stacked blocs allows the manipulation of radioactive sources as high as 1000 curies of 1 MeV gamma rays and with a fast neutrons flux of 10 9 n.cm -2 .s -1 . The airtight alpha containment box is equipped with two transfer systems, one consists of a parallelepiped shaped airtight box located in a turntable, the other uses standard cylindrical containers made of polyethylene. The general equipment and the main setting up are also described. (authors) [fr

40 CFR 265.252 - Waste analysis.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.252 Section 265... FACILITIES Waste Piles § 265.252 Waste analysis. In addition to the waste analyses required by § 265.13, the... in the pile to which it is to be added. The analysis conducted must be capable of differentiating...

48 CFR 252.236-7000 - Modification proposals-price breakdown.

Science.gov (United States)

2010-10-01

...-price breakdown. 252.236-7000 Section 252.236-7000 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.236-7000 Modification proposals—price breakdown. As prescribed in 236.570(a), use the following clause: Modification Proposals—Price Breakdown (DEC 1991) (a) The...

48 CFR 252.217-7002 - Offering property for exchange.

Science.gov (United States)

2010-10-01

... exchange. 252.217-7002 Section 252.217-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.217-7002 Offering property for exchange. As prescribed in 217.7005, use the following provision: Offering Property for Exchange (DEC 1991) (a) The property described in item...

46 CFR 252.31 - Wages of officers and crews.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Wages of officers and crews. 252.31 Section 252.31... Subsidy Rates § 252.31 Wages of officers and crews. (a) Definitions. When used in this part: (1) Base period. The first base period under the wage index systems, as provided in section 603 of the Act, is the...

48 CFR 252.237-7011 - Preparation history.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Preparation history. 252... Provisions And Clauses 252.237-7011 Preparation history. As prescribed in 237.7003(b), use the following clause: Preparation History (DEC 1991) For each body prepared, or for each casket handled in a group...

48 CFR 252.217-7016 - Plant protection.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Plant protection. 252.217... Clauses 252.217-7016 Plant protection. As prescribed in 217.7104(a), use the following clause: Plant Protection (DEC 1991) (a) The Contractor shall provide, for the plant and work in process, reasonable...

48 CFR 252.227-7000 - Non-estoppel.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Non-estoppel. 252.227-7000... Clauses 252.227-7000 Non-estoppel. As prescribed at 227.7009-1, insert the following clause in patent releases, license agreements, and assignments: Non-Estoppel (OCT 1966) The Government reserves the right at...

Angular distributions of target fragments from the reactions of 292 MeV - 25.2 GeV 12C with 197Au and 238U

International Nuclear Information System (INIS)

Morita, Y.

1983-01-01

The angular distributions of the 197 Au target fragments were all forwardly peaked. Extensively forward peaked angular distributions were observed at the non-relativistic projectile energies (292 MeV, 1.0 GeV). No obvious differences were observed in the angular distributions at the different relativistic projectile energies of 3.0 GeV, 12.0 GeV and 25.2 GeV. The characteristic angular distribution pattern from the relativistic projectile energy experiments was also observed in the non-relativistic energy experiments. Maximum degree of forward-peaking in the angular distributions at each projectile energy was observed at the product mass number (A) around 190 from the 292 MeV projectile energy, at A = 180 from 1.0 GeV and at A =175 from 3.0 GeV and 12.0 GeV. In general, two different types of angular distributions were observed in the relativistic projectile energy experiments with the 238 U target. Isotropic angular distributions were observed for the fission product nuclides. The angular distributions of the fission products at the intermediate (292 MeV) energy showed slightly forward peaked angular distributions. Because of the long projectile-target interaction time in the primary nuclear reaction, larger momentum was transferred from the projectile to the target nucleus. Steep forward-peaked angular distributions were also observed with the 238 U target

48 CFR 252.217-7001 - Surge option.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Surge option. 252.217-7001... Clauses 252.217-7001 Surge option. As prescribed in 217.208-70(b), use the following clause: Surge Option (AUG 1992) (a) General. The Government has the option to— (1) Increase the quantity of supplies or...

48 CFR 252.225-7025 - Restriction on acquisition of forgings.

Science.gov (United States)

2010-10-01

... of forgings. 252.225-7025 Section 252.225-7025 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.225-7025 Restriction on acquisition of forgings. As prescribed in 225.7102-4, use the following clause: Restriction on Acquisition of Forgings (DEC 2009) (a...

48 CFR 252.225-7031 - Secondary Arab boycott of Israel.

Science.gov (United States)

2010-10-01

... Israel. 252.225-7031 Section 252.225-7031 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.225-7031 Secondary Arab boycott of Israel. As prescribed in 225.7605, use the following provision: Secondary Arab Boycott of Israel (JUN 2005) (a) Definitions. As used in...

24 CFR 92.252 - Qualification as affordable housing: Rental housing.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Qualification as affordable housing: Rental housing. 92.252 Section 92.252 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HOME INVESTMENT PARTNERSHIPS PROGRAM Project Requirements § 92.252...

48 CFR 252.235-7011 - Final scientific or technical report.

Science.gov (United States)

2010-10-01

... technical report. 252.235-7011 Section 252.235-7011 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.235-7011 Final scientific or technical report. As prescribed in 235.072(d), use the following clause: Final Scientific or Technical Report (NOV 2004) The Contractor...

48 CFR 252.235-7002 - Animal welfare.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Animal welfare. 252.235... Clauses 252.235-7002 Animal welfare. As prescribed in 235.072(a), use the following clause: Animal Welfare... animals only from dealers licensed by the Secretary of Agriculture under 7 U.S.C. 2133 and 9 CFR subpart A...

48 CFR 252.229-7001 - Tax relief.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the United...

Molecular weight determination of bisbenzyl-isoquinoline alkaloids by 252Cf-plasma desorption mass spectrometer

International Nuclear Information System (INIS)

Kohno, Hiroyuki; Tatsunami, Shinobu; Hiroi, Tomoko; Kouyama, Hiroshi; Taniguchi, Masashi; Yago, Nagasumi; Nakamura, Iwao

1995-01-01

Bisbenzylisoquinoline alkaloids of Stephania cepharantha have been used for various clinical purposes and recently reevaluated as stimulators of interleukin secretion in tissues. We analyzed molecular stuctures of bisbenzylisoquinoline alkaloids by determining their molecular weights using the 252 Cf-plasma desorption mass spectrometry (PDMS). The spectra were accumulated for 500 000 fission events. The acceleration voltage used here was 15 kV. Samples were analyzed using nitrocellulose-coated sample targets. Of the 5 alkaloids studied here, cepharanthine gave a main peak of molecular weight of 606.1 for the theoretical molecular weight of 606.7. The other minor peaks were considered to be demethylated fragment ions. 252 Cf-PDMS should be quite useful in studying structure, metabolism and pharmacokinetics of various drugs with extremely low coefficients of variation. (author)

Neutron beam experiments using nuclear research reactors: honoring the retirement of professor Bernard W. Wehring -II. 5. Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields

International Nuclear Information System (INIS)

Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik

2001-01-01

In recent years, Georgia Institute of Technology (Georgia Tech) has been involved in a number of neutron dosimetry research projects. Several reference neutron fields are now available for such projects. They are all based on the use of a 252 Cf source. The source can be used by itself to create a reference un-moderated 252 Cf neutron field, or it can be placed inside several different moderating assemblies. The spectra created by placing the source inside these assemblies and the un-moderated source are employed to investigate detector and dosimeter responses. Currently, the set of moderators available includes a 30-cm diam cadmium-covered D 2 O spherical shell, a 30-cm-thick iron spherical shell, a 30-cm-diam polyethylene spherical shell, an 18.3-cm-thick tungsten spherical shell, a 16-cm-thick lead spherical shell, and a 9-cm-thick tantalum spherical shell. In addition, the 252 Cf source can be placed inside a neutron howitzer recently constructed at Georgia Tech. The howitzer is a WEP cylinder loaded with boron that has a 10.16-cm-diam cylindrical opening. When the source is placed in the cylindrical penetration of the howitzer, a neutron field ∼30 cm in diameter is created at a distance of 50 cm from the californium source. Over the last few years, Bonner sphere spectrometers using LiI(Eu) scintillators and LiF thermoluminescence dosimeters have been calibrated using this facility at Georgia Tech. Recently, the Neely Nuclear Research Center (NNRC) acquired an LB 6411 neutron probe (product of EG and G Berthold). This probe is designed to measure ambient dose equivalent in accordance with International Commission on Radiological Protection Publication 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diam spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV (Ref. 5). As a test of the instrument's ability to measure ambient

48 CFR 252.222-7002 - Compliance with local labor laws (overseas).

Science.gov (United States)

2010-10-01

... labor laws (overseas). 252.222-7002 Section 252.222-7002 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7002 Compliance with local labor laws (overseas). As prescribed in 222.7201(a), use the following clause: Compliance with Local Labor Laws (Overseas) (JUN 1997...

24 CFR 252.6 - Method of payment of mortgage insurance premiums.

Science.gov (United States)

2010-04-01

... insurance premiums. 252.6 Section 252.6 Housing and Urban Development Regulations Relating to Housing and..., AND BOARD AND CARE HOMES § 252.6 Method of payment of mortgage insurance premiums. The provisions of..., DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT...

24 CFR 236.252 - First, second, and third mortgage insurance premiums.

Science.gov (United States)

2010-04-01

... insurance premiums. 236.252 Section 236.252 Housing and Urban Development Regulations Relating to Housing... insurance premiums. All of the provisions of § 207.252 of this chapter governing the first, second, and third mortgage insurance premiums shall apply to mortgages insured under this subpart, except: (a) Where...

Ternary-fragmentation-driving potential energies of 252Cf

Science.gov (United States)

Karthikraj, C.; Ren, Zhongzhou

2017-12-01

Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.

Comparative dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for brain tumors

Energy Technology Data Exchange (ETDEWEB)

Brandao, Samia de Freitas, E-mail: samiabrandao@gmail.com [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Campos, Tarcisio Passos Ribeiro de [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

2013-06-15

Objective: comparative analysis of dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for treatment of brain tumors. Materials and methods: simulations of intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT were performed with the MCNP5 code, modeling the treatment of a brain tumor on a voxel computational phantom representing a human head. Absorbed dose rates were converted into biologically weighted dose rates. Results: intracavitary balloon catheter brachytherapy with I-125 produced biologically weighted mean dose rates of 3.2E-11, 1.3E-10, 1.9E-11 and 6.9E-13 RBE.Gy.h{sup -1}.p{sup -1}.s, respectively, on the healthy tissue, on the balloon periphery and on the /{sub 1} and /{sub 2} tumor infiltration zones. On the other hand, Cf-252 brachytherapy combined with BNCT produced a biologically weighted mean dose rate of 5.2E-09, 2.3E-07, 8.7E-09 and 2.4E-09 RBE.Gy.h{sup -1}.p{sup -1}.s, respectively on the healthy tissue, on the target tumor and on the /{sub 1} and /{sub 2} infiltration zones. Conclusion: Cf-252 brachytherapy combined with BNCT delivered a selective irradiation to the target tumor and to infiltration zones, while intracavitary balloon catheter brachytherapy with I-125 delivered negligible doses on the tumor infiltration zones. (author)

Comparative dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for brain tumors

Directory of Open Access Journals (Sweden)

Samia de Freitas Brandao

2013-07-01

Full Text Available Objective Comparative analysis of dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for treatment of brain tumors. Materials and Methods Simulations of intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT were performed with the MCNP5 code, modeling the treatment of a brain tumor on a voxel computational phantom representing a human head. Absorbed dose rates were converted into biologically weighted dose rates. Results Intracavitary balloon catheter brachytherapy with I-125 produced biologically weighted mean dose rates of 3.2E-11, 1.3E-10, 1.9E-11 and 6.9E-13 RBE.Gy.h-1.p-1.s, respectively, on the healthy tissue, on the balloon periphery and on the I 1 and I 2 tumor infiltration zones. On the other hand, Cf-252 brachytherapy combined with BNCT produced a biologically weighted mean dose rate of 5.2E-09, 2.3E-07, 8.7E-09 and 2.4E-09 RBE.Gy.h-1.p-1.s, respectively on the healthy tissue, on the target tumor and on the I 1 and I 2 infiltration zones. Conclusion Cf-252 brachytherapy combined with BNCT delivered a selective irradiation to the target tumor and to infiltration zones, while intracavitary balloon catheter brachytherapy with I-125 delivered negligible doses on the tumor infiltration zones.

Graphite moderated 252Cf source

International Nuclear Information System (INIS)

Sajo B, L.; Barros, H.; Greaves, E. D.; Vega C, H. R.

2014-08-01

The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a 252 Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the 252 Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

Project Plan Remote Target Fabrication Refurbishment Project

International Nuclear Information System (INIS)

Bell, Gary L.; Taylor, Robin D.

2009-01-01

In early FY2009, the DOE Office of Science - Nuclear Physics Program reinstated a program for continued production of 252 Cf and other transcurium isotopes at the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). The FY2009 major elements of the workscope are as follows: (1) Recovery and processing of seven transuranium element targets undergoing irradiation at the High Flux Isotope Reactor (HFIR) at ORNL; (2) Development of a plan to manufacture new targets for irradiation beginning in early- to mid-FY10 to supply irradiated targets for processing Campaign 75 (TRU75); and (3) Refurbishment of the target manufacturing equipment to allow new target manufacture in early FY10 The 252 Cf product from processing Campaign 74 (recently processed and currently shipping to customers) is expected to supply the domestic demands for a period of approximately two years. Therefore it is essential that new targets be introduced for irradiation by the second quarter of FY10 (HFIR cycle 427) to maintain supply of 252 Cf; the average irradiation period is ∼10 HFIR cycles, requiring about 1.5 calendar years. The strategy for continued production of 252 Cf depends upon repairing and refurbishing the existing pellet and target fabrication equipment for one additional target production campaign. This equipment dates from the mid-1960s to the late 1980s, and during the last target fabrication campaign in 2005- 2006, a number of component failures and operations difficulties were encountered. It is expected that following the target fabrication and acceptance testing of the targets that will supply material for processing Campaign 75 a comprehensive upgrade and replacement of the remote hot-cell equipment will be required prior to subsequent campaigns. Such a major refit could start in early FY 2011 and would take about 2 years to complete. Scope and cost estimates for the repairs described herein were developed, and authorization for the work

7 CFR 766.252 - Unauthorized assistance resulting from submission of false information.

Science.gov (United States)

2010-01-01

... false information. 766.252 Section 766.252 Agriculture Regulations of the Department of Agriculture... Unauthorized Assistance § 766.252 Unauthorized assistance resulting from submission of false information. A... behalf, submits information to the Agency that the borrower knows to be false. ...

System control for the modulated 252Cf source ''Shuffler''

International Nuclear Information System (INIS)

Stephens, M.M.

1975-06-01

The design and theory of operation of the control chassis for a 252 Cf nondestructive assay system are described. This system repetitively transfers a 252 Cf source from the irradiation region to a shielded position before measuring the delayed neutrons. The design criteria for the system were: rapid movement and precise positioning of the 252 Cf source, precise positioning of the sample, and very accurate timing of the irradiate and count cycles. To achieve these results crystal oscillators were used for timing, and stepping motors were used to position the sample and the source. (U.S.)

Laboratory-scale shielded cell for 252Cf

International Nuclear Information System (INIS)

Anderl, R.A.; Cargo, C.H.

1979-01-01

A shielded-cell facility for storing and handling remotely up to 2 milligram quantities of unencapsulated 252 Cf has been built in a radiochemistry laboratory at the Test Reactor Area of the Idaho National Engineering Laboratory. Unique features of this facility are its compact bulk radiation shield of borated gypsum and transfer lines which permit the transport of fission product activity from 252 Cf fission sources within the cell to a mass separator and to a fast radiochemistry system in nearby rooms

Bacterial community shift in the coastal Gulf of Mexico salt-marsh sediment microcosm in vitro following exposure to the Mississippi Canyon Block 252 oil (MC252)

KAUST Repository

Koo, Hyunmin; Mojib, Nazia; Huang, Jonathan P.; Donahoe, Rona J.; Bej, Asim K.

2014-01-01

In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.

Bacterial community shift in the coastal Gulf of Mexico salt-marsh sediment microcosm in vitro following exposure to the Mississippi Canyon Block 252 oil (MC252)

KAUST Repository

Koo, Hyunmin

2014-07-10

In this study, we examined the responses by the indigenous bacterial communities in salt-marsh sediment microcosms in vitro following treatment with Mississippi Canyon Block 252 oil (MC252). Microcosms were constructed of sediment and seawater collected from Bayou La Batre located in coastal Alabama on the Gulf of Mexico. We used an amplicon pyrosequencing approach on microcosm sediment metagenome targeting the V3–V5 region of the 16S rRNA gene. Overall, we identified a shift in the bacterial community in three distinct groups. The first group was the early responders (orders Pseudomonadales and Oceanospirillales within class Gammaproteobacteria), which increased their relative abundance within 2 weeks and were maintained 3 weeks after oil treatment. The second group was identified as early, but transient responders (order Rhodobacterales within class Alphaproteobacteria; class Epsilonproteobacteria), which increased their population by 2 weeks, but returned to the basal level 3 weeks after oil treatment. The third group was the late responders (order Clostridiales within phylum Firmicutes; order Methylococcales within class Gammaproteobacteria; and phylum Tenericutes), which only increased 3 weeks after oil treatment. Furthermore, we identified oil-sensitive bacterial taxa (order Chromatiales within class Gammaproteobacteria; order Syntrophobacterales within class Deltaproteobacteria), which decreased in their population after 2 weeks of oil treatment. Detection of alkane (alkB), catechol (C2,3DO) and biphenyl (bph) biodegradation genes by PCR, particularly in oil-treated sediment metacommunity DNA, delineates proliferation of the hydrocarbon degrading bacterial community. Overall, the indigenous bacterial communities in our salt-marsh sediment in vitro microcosm study responded rapidly and shifted towards members of the taxonomic groups that are capable of surviving in an MC252 oil-contaminated environment.

46 CFR 252.23 - Financial and other reporting requirements.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Financial and other reporting requirements. 252.23... SERVICES Operation § 252.23 Financial and other reporting requirements. (a) Voyage report. The operator... total loss covered by a policy of insurance. (d) Financial statements. The operator shall submit, in...

48 CFR 252.204-7001 - Commercial and Government Entity (CAGE) code reporting.

Science.gov (United States)

2010-10-01

... Entity (CAGE) code reporting. 252.204-7001 Section 252.204-7001 Federal Acquisition Regulations System... Entity (CAGE) Code Reporting (AUG 1999) (a) The offeror is requested to enter its CAGE code on its offer... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.204-7001 Commercial and Government Entity...

48 CFR 252.222-7005 - Prohibition on use of nonimmigrant aliens-Guam.

Science.gov (United States)

2010-10-01

... nonimmigrant aliens-Guam. 252.222-7005 Section 252.222-7005 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7005 Prohibition on use of nonimmigrant aliens—Guam. As prescribed in 222.7302, use the following clause: Prohibition on Use of Nonimmigrant Aliens—Guam (SEP 1999...

24 CFR 207.252e - Method of payment of mortgage insurance premiums.

Science.gov (United States)

2010-04-01

... insurance premiums. 207.252e Section 207.252e Housing and Urban Development Regulations Relating to Housing... Premiums § 207.252e Method of payment of mortgage insurance premiums. In the cases that the Commissioner... mortgagees, that mortgage insurance premiums be remitted electronically. [63 FR 1303, Jan. 8, 1998] ...

Investigation of the far asymmetric region in 252Cf(sf)

International Nuclear Information System (INIS)

Hambsch, F.-J.; Oberstedt, S.

1997-01-01

A twin Frisch-gridded ionization chamber has been used to measure the fission fragment mass, kinetic-energy and angular correlations for 252 Cf(sf). In total 2.5 x 10 8 events were collected. The focus was in the far asymmetric mass region, where enhancements in the yield had been found earlier. It could be shown, that these findings are due to false events, coming from either close geometries not properly taking into account the angular-dependent energy loss in the sample and backing, from a too large angular cone selected in case of studies employing ionization chambers, or even from poor target qualities. (orig.)

Designing on-line analyzer for coal on belt conveyor using neutron activation technique

International Nuclear Information System (INIS)

Rony Djokorayono; Agus Cahyono

2014-01-01

Basic design of on-line analyzer for coal on belt conveyor using neutron activation technique has been carried out. Compared with sampling technique, this neutron activation technique has some advantages in term of analysis accuracy and time. The design activities performed include the establishment of design requirements, functional requirements, technical requirements, technical specification, detection sub-system design, data acquisition subsystem design, and operator computer console design. This program will use Nal(Tl) scintillation detector to detect gamma-rays emitted by elements in coal due to neutron activation of a neutron source, "2"5"2Cf (Californium-252). This basic design of on-line analyzer for coal on belt conveyor using neutron activation technique should be followed up with the development of detailed design, prototype construction, and field testing. (author)

Provenance and composition study on Terengganu inscribed stone using in-situ nuclear technology

International Nuclear Information System (INIS)

Jaafar Abdullah; Roslan Yahya; Hearie Hassan; Engku Mohd Fahmi Engku Chik; Mohamad Rabaie Shari; Airwan Affendi Mahmood; Abdul Quddoss Abu Bakar; Ainul Mardhiah Terry

2012-01-01

This paper focused on the analysis of trace elements and provenance study of the Inscribed Stone of Terengganu (BBPT) using Neutron-induced Prompt Gamma-Ray Techniques (NIPGAT). In this study, portable NIPGAT system was designed and developed by using volume-based measurement. It is a nondestructive testing technique for the samples. This system uses low activity of isotopic neutron radioactive source from californium-252 (Cf-252) as an irradiation source. Gamma ray spectroscopy as well as specialized computer software has been utilized to conduct the research. The study has determined that the stone was a dolerite stone based on the composition of the stone elements. Although most of the scientific data for this study have been collected, this project is still running to complete the scope of provenance study. (author)

48 CFR 252.227-7012 - Patent license and release contract.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Patent license and release contract. 252.227-7012 Section 252.227-7012 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text...

Nuclear assay of coal. Volume 1. Coal composition by prompt neutron activation analysis: basic experiments. Final report

International Nuclear Information System (INIS)

Reynolds, G.; Bozorganesh, H.; Elias, E.; Gozani, T.; Maung, T.; Orphan, V.

1979-01-01

Using californium-252 as a source of exciting neutrons, prompt gamma photons emitted by elemental nuclei in the coal have been measured using several detectors, including sodium--iodide and germanium--lithium. Several coal types, including bituminous, subbituminous lignite and anthracite were crushed to various top sizes and analyzed carefully be traditional ASTM wet chemistry techniques at two or three different laboratories. The elements (sulfur, hydrogen, carbon, aluminum, silicon, iron, calcium, sodium, nitrogen, and chlorine) were determined by prompt neutron activations and the quantities compared with those of the wet chemical analyses

Graphite moderated {sup 252}Cf source

Energy Technology Data Exchange (ETDEWEB)

Sajo B, L.; Barros, H.; Greaves, E. D. [Universidad Simon Bolivar, Nuclear Physics Laboratory, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of); Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)

2014-08-15

The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a {sup 252}Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the {sup 252}Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)

Simulation and design of an electron beam ion source charge breeder for the californium rare isotope breeder upgrade

Directory of Open Access Journals (Sweden)

Clayton Dickerson

2013-02-01

Full Text Available An electron beam ion source (EBIS will be constructed and used to charge breed ions from the californium rare isotope breeder upgrade (CARIBU for postacceleration into the Argonne tandem linear accelerator system (ATLAS. Simulations of the EBIS charge breeder performance and the related ion transport systems are reported. Propagation of the electron beam through the EBIS was verified, and the anticipated incident power density within the electron collector was identified. The full normalized acceptance of the charge breeder with a 2 A electron beam, 0.024π  mm mrad for nominal operating parameters, was determined by simulating ion injection into the EBIS. The optics of the ion transport lines were carefully optimized to achieve well-matched ion injection, to minimize emittance growth of the injected and extracted ion beams, and to enable adequate testing of the charge bred ions prior to installation in ATLAS.

Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields

International Nuclear Information System (INIS)

Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik

2001-01-01

Calibration measurements were carried out on a probe designed to measure ambient dose equivalent in accordance with ICRP Pub 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diameter spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV. The instrument was used to measure the dose rate in four separate neutron fields: unmoderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and WEP neutron howitzer with 252 Cf at its center. Dose equivalent measurements were performed at source-detector centerline distances from 50 to 200 cm. The ratio of air-scatter- and room-return-corrected ambient dose equivalent rates to ambient dose equivalent rates calculated with the code MCNP are tabulated

Californium-252 neutron activation analysis of high-level processed nuclear tank waste

International Nuclear Information System (INIS)

Troyer, G.L.; Purcell, M.A.

2000-01-01

The basis for production assessment of the vitrification of Hanford nuclear fuel reprocessing wastes will be high-precision measurements of the elemental sodium content. However, the chemical analysis of both radioactive and nonradioactive components in nuclear waste can be challenged by high radiation dose rates. The dose rates compromise many analytical techniques as well as pose personnel dosimetry risks. In many cases, reduction of dose rates through dilution compromises the precision and sensitivity for certain key components. The use of neutron activation analysis (NAA) provides a method of analysis that avoids the need for dilutions or extensive sample preparation. These waste materials also contain trace quantities of fissionable isotopes, which, through neutron activation, can be estimated by delayed neutron counting of fissioned fragments

Radiation ulcers in patients with cancer of the torgue after 252Cf therapy

International Nuclear Information System (INIS)

Galantseva, G.F.; Guseva, L.I.; Plichko, V.I.

1984-01-01

Interstitial therapy with 252 Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with 252 Cf doesn't differ sufficiently from the course of radiation injuries, occurring after γ-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with 252 Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongUe ulcers after interstitial therapy with 252 Cf

27 CFR 25.252 - Records.

Science.gov (United States)

2010-04-01

... TREASURY LIQUORS BEER Removal of Brewer's Yeast and Other Articles § 25.252 Records. (a) Production. The brewer shall keep records of the production of malt syrup, wort, and other articles which are removed... of brewer's yeast, malt and other articles from the brewery. The record shall include the quantity...

Fabrication of intense neutron sources for medical applications

International Nuclear Information System (INIS)

Boulogne, A.R.; Walker, V.W.

1975-01-01

Simulated sources containing 252 Cf equivalents of 0.1 to 1.0 milligrams were prepared. Samarium was used as the simulant in a modified chemical plating technique similar to that used to prepare palladium-californium oxide cermet for industrial applications. The length of the platinum-10 percent iridium doubly encapsulated source with its protective sheath is 0.545 in. (14.1 mm). Outside dia of the source, including its sheath, is 0.109 in. (2.8 mm). Existing ''Brachytrons'' can accommodate this source form. This capsule system will withstand internal gas pressures from helium due to alpha decay and fission gases from a 1 mg 252 Cf source after ten years if the source is subjected to a maximum temperature of 800 0 C, the theoretical temperature of an accidental fire. Under these conditions the safety factor is 3. The capsule system is being tested with tracer amounts of 252 Cf to ensure that it will withstand adverse service conditions as well as tests specified for Special Form Materials. (auth)

Neutron shielding for a 252 Cf source

International Nuclear Information System (INIS)

Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Eduardo Gallego, Alfredo Lorente

2006-01-01

To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a 252 Cf isotopic neutron source. During calculations a detailed model for the 252 Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare 252 Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

48 CFR 252.225-7044 - Balance of Payments Program-Construction Material.

Science.gov (United States)

2010-10-01

... Program-Construction Material. 252.225-7044 Section 252.225-7044 Federal Acquisition Regulations System...—Construction Material. As prescribed in 225.7503(a), use the following clause: Balance of Payments Program—Construction Material (JAN 2009) (a) Definitions. As used in this clause— Commercially available off-the-shelf...

38 CFR 3.252 - Annual income; pension; Mexican border period and later war periods.

Science.gov (United States)

2010-07-01

...; Mexican border period and later war periods. 3.252 Section 3.252 Pensions, Bonuses, and Veterans' Relief... Dependency, Income and Estate § 3.252 Annual income; pension; Mexican border period and later war periods. (a) Annual income limitations; old-law pension. Where the right to old-law pension is payable under section...

24 CFR 207.252c - Premiums-mortgages insured pursuant to section 238(c) of the Act.

Science.gov (United States)

2010-04-01

.... All of the provisions of §§ 207.252 and 207.252a governing mortgage insurance premiums shall apply to... insurance premiums due on such mortgages in accordance with §§ 207.252 and 207.252a shall be calculated on... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Premiums-mortgages insured pursuant...

50 CFR 14.252 - What definitions do I need to know?

Science.gov (United States)

2010-10-01

... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What definitions do I need to know? 14.252... PLANTS IMPORTATION, EXPORTATION, AND TRANSPORTATION OF WILDLIFE Captive Wildlife Safety Act § 14.252 What... which any individual other than an authorized keeper or caregiver may potentially touch or otherwise...

48 CFR 252.244-7000 - Subcontracts for Commercial Items and Commercial Components (DoD Contracts).

Science.gov (United States)

2010-10-01

... under this contract: (a) 252.225-7009 Restriction on Acquisition of Certain Articles Containing... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Subcontracts for Commercial Items and Commercial Components (DoD Contracts). 252.244-7000 Section 252.244-7000 Federal...

Radiation protection data sheet. Radiation protection data sheets for the use of radionuclides in unsealed sources

International Nuclear Information System (INIS)

Anon.

1999-01-01

These radiation protection data sheet are devoted to responsible persons and employees of various laboratories or medical, pharmaceutical, university and industrial departments where radionuclides are handled as well as all the persons who attend to satisfy in this field. They contain the essential radiation protection data for the use of unsealed sources: physical characteristics, risk assessment, administrative procedures, recommendations, regulations and bibliography. This new series includes the following radionuclides: californium 252, curium 244, gallium 67, indium 113m, plutonium 238, plutonium 239, polonium 210, potassium 42, radium 226, thorium 232, uranium 238 and zinc 65. (O.M.)

Moderator design studies for a new neutron reference source based on the D–T fusion reaction

International Nuclear Information System (INIS)

Mozhayev, Andrey V.; Piper, Roman K.; Rathbone, Bruce A.; McDonald, Joseph C.

2016-01-01

The radioactive isotope Californium-252 ( 252 Cf) is relied upon internationally as a neutron calibration source for ionizing radiation dosimetry because of its high specific activity. The source may be placed within a heavy-water (D 2 O) moderating sphere to produce a softened spectrum representative of neutron fields common to commercial nuclear power plant environments, among others. Due to termination of the U.S. Department of Energy loan/lease program in 2012, the expense of obtaining 252 Cf sources has undergone a significant increase, rendering high output sources largely unattainable. On the other hand, the use of neutron generators in research and industry applications has increased dramatically in recent years. Neutron generators based on deuteriumtritium (D–T) fusion reaction provide high neutron fluence rates and, therefore, could possibly be used as a replacement for 252 Cf. To be viable, the 14 MeV D–T output spectrum must be significantly moderated to approximate common workplace environments. This paper presents the results of an effort to select appropriate moderating materials and design a configuration to reshape the primary neutron field toward a spectrum approaching that from a nuclear power plant workplace. A series of Monte-Carlo (MCNP) simulations of single layer high- and low-Z materials are used to identify initial candidate moderators. Candidates are refined through a similar series of simulations involving combinations of 2–5 different materials. The simulated energy distribution using these candidate moderators are rated in comparison to a target spectrum. Other properties, such as fluence preservation and/or enhancement, prompt gamma production and other characteristics are also considered. - Highlights: • D–T generator neutron calibration field replacement for D 2 O-moderated 252 Cf. • Determination of representative nuclear power plant workplace neutron spectrum. • Simulations to assess moderating materials to soften 14

Neutron Spectra, Fluence and Dose Rates from Bare and Moderated Cf-252 Sources

Energy Technology Data Exchange (ETDEWEB)

Radev, Radoslav P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2016-04-01

A new, stronger ²⁵²Cf source (serial number SR-CF-3050-OR) was obtained from Oak Ridge National Laboratory (ORNL) in 2014 to supplement the existing ²⁵²Cf sources which had significantly decayed. A new instrument positioning track system was designed and installed by Hopewell Designs, Inc. in 2011. The neutron field from the new, stronger ²⁵²Cf source in the modified calibration environment needed to be characterized as well as the modified neutron fields produced by the new source and seven different neutron moderators. Comprehensive information about our ²⁵²Cf source, its origin, production, and isotopic content and decay characteristics needed to be compiled as well. This technical report is intended to address these issues.

K-252a, a novel microbial product, inhibits smooth muscle myosin light chain kinase

International Nuclear Information System (INIS)

Nakanishi, S.; Yamada, K.; Kase, H.; Nakamura, S.; Nonomura, Y.

1988-01-01

Effects of K-252a, purified from the culture broth of Nocardiopsis sp., on the activity of myosin (light chain kinase were investigated. 1) K-252a affected three characteristic properties of chicken gizzard myosin-B, natural actomyosin, to a similar degree: the Ca 2+ -dependent activity of ATPase, superprecipitation, and the phosphorylation of the myosin light chain. 2) K-252a inhibited the activities of the purified myosin light chain kinase and a Ca 2+ -independent form of the enzyme which was constructed by cross-linking of myosin light chain kinase and calmodulin using glutaraldehyde. The degrees of inhibition by 3 x 10 -6 M K-252a were 69 and 48% of the control activities with the purified enzyme and the cross-linked complex, respectively. Chlorpromazine (3 x 10 -4 M), a calmodulin antagonist, inhibited the native enzyme, but not the cross-linked one. These results suggested that K-252a inhibited myosin light chain kinase by direct interaction with the enzyme, whereas chlorpromazine suppressed the enzyme activation by interacting with calmodulin. 3) The inhibition by K-252a of the cross-linked kinase was affected by the concentration of ATP, a phosphate donor. The concentration causing 50% inhibition was two orders magnitude lowere in the presence of 100 μM ATP than in the presence of 2 mM ATP. 4) Kinetic analyses using [γ- 32 P]ATP indicated that the inhibitory mode of K-252a was competitive with respect to ATP. These results suggest that K-252a interacts at the ATP-binding domain of myosin light chain kinase

Operational safety at the radiometallurgy laboratory of Fontenay-aux-Roses

International Nuclear Information System (INIS)

Hayet, Lucien; Petit, Pierre; Conche, Roger.

1976-01-01

Opened in 1967, the Radiometallurgy Laboratory is responsible for the examination of plutonium 239 based nuclear fuels of breeder reactors such as Rapsodie and Phenix. Part of the same laboratory is also responsible for the manufacture of californium 252 sources. These neutron sources can have a neutron fluency yield of 2,3 10 10 n/s/4π (i.e. 10mg of 252cf). This large laboratory includes a total area of 117m 2 of hot surfaces. It also includes 14 high activity cells with a capacity of 100000Ci at 1MeV. Located only 7km from the center of Paris, it must incorporate a special design and a particularly sure safety policy. Several statistics are given: irradiations, contaminations, incidents, quantity of fissile material, solid and liquid wastes etc... The principles of safety management are outlined and an analysis given of this basic nuclear facility [fr

Radiation ulcers in patients with cancer of the tongue after /sup 252/Cf therapy

Energy Technology Data Exchange (ETDEWEB)

Galantseva, G.F.; Guseva, L.I.; Plichko, V.I. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)

1984-01-01

Interstitial therapy with /sup 252/Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with /sup 252/Cf doesn't differ sufficiently from the course of radiation injuries, occurring after ..gamma..-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with /sup 252/Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongue ulcers after interstitial therapy with /sup 252/Cf.

48 CFR 252.245-7000 - Government-furnished mapping, charting, and geodesy property.

Science.gov (United States)

2010-10-01

... mapping, charting, and geodesy property. 252.245-7000 Section 252.245-7000 Federal Acquisition Regulations..., charting, and geodesy property. As prescribed in 245.107-70, use the following clause: Government-Furnished Mapping, Charting, and Geodesy Property (DEC 1991) (a) Definition—Mapping, charting, and geodesy (MC&G...

48 CFR 53.236-2 - Architect-engineer services (SF's 252 and 330).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Architect-engineer... ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.236-2 Architect-engineer...-engineer and related services: (a) SF 252 (Rev. 10/83), Architect-Engineer Contract. SF 252 is prescribed...

Radionuclide 252Cf neutron source

International Nuclear Information System (INIS)

Kolevatov, Yu.I.; Trykov, L.A.

1979-01-01

Characteristics of radionuclide neutron sourses of 252 Cf base with the activity from 10 6 to 10 9 n/s have been investigated. Energetic distributions of neutrons and gamma-radiation have been presented. The results obtained have been compared with other data available. The hardness parameter of the neutron spectrum for the energy range from 3 to 15 MeV is 1.4 +- 0.02 MeV

Average cross sections for the 252Cf neutron spectrum

International Nuclear Information System (INIS)

Dezso, Z.; Csikai, J.

1977-01-01

A number of average cross sections have been measured for 252 Cf neutrons in (n, γ), (n,p), (n,2n), (n,α) reactions by the activation method and for fission by fission chamber. Cross sections have been determined for 19 elements and 45 reactions. The (n,γ) cross section values lie in the interval from 0.3 to 200 mb. The data as a function of target neutron number increases up to about N=60 with minimum near to dosed shells. The values lie between 0.3 mb and 113 mb. These cross sections decrease significantly with increasing the threshold energy. The values are below 20 mb. The data do not exceed 10 mb. Average (n,p) cross sections as a function of the threshold energy and average fission cross sections as a function of Zsup(4/3)/A are shown. The results obtained are summarized in tables

A pneumatic transfer system for special form 252Cf

International Nuclear Information System (INIS)

Gehrke, R.J.; Berry, S.M.; Grafwallner, E.G.; Hoggan, J.M.

1996-09-01

A pneumatic transfer system has been developed for use with series 100 Special Form 252 Cf. It was developed to reduce the exposure to personnel handling sources of 252 Cf with masses up to 150 microg by permitting remotely activated two-way transfer between the storage container and the irradiation position. The pneumatic transfer system also permits transfers for reproducible repetitive irradiation periods. In addition to the storage container equipped with quick-release fittings, the transfer system consists of an irradiation station, a control box with momentary contact switches to activate the air-pressure control valves and indicators to identify the location of the source, and connecting air hose and electrical wire. A source of 20 psig air and 110 volt electrical power are required for operation of the transfer system which can be easily moved and set up by one individual in 5 to 10 minutes. Tests have shown that rarely does a source become lodged in the transfer tubing, but two methods have been developed to handle incomplete transfers of the 252 Cf source. The first method consists of closing one air vent to allow a pressure impulse to propel the source to the opposite side. The second method applies to those 252 Cf capsules with a threaded or tapped end to which a small ferromagnetic piece can be attached; an incompletely transferred source in the transfer tube can then be guided to a position of safety by surrounding the transfer tubing containing the capsule with a horseshoe magnet attached to the end of a long pole

Neutron shielding for a {sup 252} Cf source

Energy Technology Data Exchange (ETDEWEB)

Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M. [Unidades Academicas de Estudios Nucleares e Ingenieria Electrica, Universidad Autonoma de Zacatecas, C. Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Eduardo Gallego, Alfredo Lorente [Depto. de Ingenieria Nuclear, ETS Ingenieros Industriales, Universidad Politecnica de Madrid, C. Jose Gutierrez Abascal 2, 28006 Madrid (Spain)]. e-mail: fermineutron@yahoo.com

2006-07-01

To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a {sup 252}Cf isotopic neutron source. During calculations a detailed model for the {sup 252}Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare {sup 252}Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)

24 CFR 252.2 - GNMA right to assignment.

Science.gov (United States)

2010-04-01

... COINSURANCE OF MORTGAGES COVERING NURSING HOMES, INTERMEDIATE CARE FACILITIES, AND BOARD AND CARE HOMES § 252... section, in order to allow an appropriate endorsement and necessary changes in the Commissioner's records...

Time-of-flight mass spectrometry with desorption-ionization multiprobes (UV photons and KeV and MeV particles). Cluster atoms are used as projectiles

International Nuclear Information System (INIS)

Brunelle, A.

1990-09-01

A new time-of-flight mass spectrometer, Super-Depil, is used to study secondary ion emission from solid surfaces bombarded by various kinds of primary particles. Three different desorption probes were set up on this machine: a 252 californium source, providing by spontaneous fission about 1 MeV/u energy heavy ions, a 5 to 30 keV energy pulsed caesium ion gun and a pulsed nitrogen laser, which wavelength is 337 mm. A two stages electrostatic mirror was added to the spectrometer. The time spread due to the initial kinetic energy of secondary ions leaving the surface was minimized. The mass resolution is greater than 5000. The analysis of glycosidic terpenes showed the complementarity of the three probes. The study of such metastable ions, with the electrostatic mirror, showed that some fragment ions may conserve the memory of the stereochemistry of the neutral lost. Clusters ions were used as projectiles in the energy range 5-60 keV. A strong non linear enhancement was observed in the secondary ion yield from various targets [fr

Rotation and Morphology of Comet 252P/LINEAR

Science.gov (United States)

Woodney, Laura; Schambeau, Charles A.; Fernandez, Yanga R.

2017-10-01

Comet 252P/LINEAR had an incredibly close approach early in 2016 - minimum distance 0.036 AU on March 21 - that allowed detailed investigation of its behavior. Analysis of observations of the morphology of 252P have resulted in several possible rotational periods. Knight and Schleicher found that repetition of features in narrowband imaging from April 2016 indicated a period of 7.35 +/- 0.05 hr [1]. HST broadband data obtained by Li et al. in March and April partially fit the 7.35 hr period, but found 5.5 hr was a better fit for the April 4 r’ band data [2]. Given this discrepancy, additional observations may shed light on the true rotation state, and we present here the pieces of the puzzle obtained by our group.We observed 252P with the Kitt Peak National Observatory WIYN 0.9 m telescope on 7 nights: May 2 - 5 and June 6,8,9, 2016 using a Harris R filter. An oscillating jet is clearly visible in our data. While there is insufficient phase coverage to determine a best fit period from our data alone, we will present how our observations of the morphology fit the two proposed periods.[1] Knight, M.M and D.G. Schleicher. AAS, DPS Meeting #48, id.207.02, 2016 [2] Li, J.-Y. et al. AAS, DPS Meeting #48, id. 206.03, 2016.

Phenotype abnormality: 252 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available lant flowering stage in environment of short day length regimen in environment of short day length regimen h... 252 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u758i delayed whole p

The significance of chromosome deletions in atomic-bomb survivors

International Nuclear Information System (INIS)

Tanaka, Kimio; Shigeta, Chiharu; Oguma, Nobuo; Kamada, Nanao; Deng, Z.; Niimi, Masanobu; Aisaka, Tadaichi.

1986-01-01

In 39 A-bomb survivors 40 years after exposure at ≤ 1,000 m from ground zero, the frequency and features of chromosome deletions in peripheral lymphocytes were examined using a differential staining technique. Simultaneously, in vitro irradiation experiment with Cf-252 was made to infer chromosome aberrations occuring immediately after exposure. Californium-252 with 100 rad induced dicentric and ring chromosomes in 40 % of the cells and acentric fragments in 44 %. Among the A-bomb survivors, chromosome aberrations were observed in 651 (21 %) of the total 3,136 cells. There were 146 cells with deletions (22 % of abnormal cells; 5 % of the total cells), and 10 cells with acentric fragment (0.3 % of the total cells). The figure for deletions was far higher than that reported in the literature. A large number of deletions were seen in chromosomes no.4, no.21, and no.22, and a few deletions in chromosomes no.7 and no.20. Significance of chromosome deletions is discussed. (Namekawa, K.)

Monitoring taconite process streams with thermal neutron capture-gamma ray analysis. Report of investigations/1980

International Nuclear Information System (INIS)

Woodbury, F.B.W.

1980-12-01

The Bureau of Mines is evaluating alternative technologies to treat oxidized taconites. Since process control is an essential element in the application of these process technologies, research was performed on a prototype monitoring system utilizing a californium-252 (252-Cf) neutron source and a thermal neutron capture-gamma ray spectra analysis method to measure the amount of iron and percent solids in process slurries. The prototype system was used to monitor the concentrate and tailing streams in a 900-lb/hr flotation pilot plant during continuous around-the-clock tests. The iron content of the process slurries was determined by measuring the total peak areas under the capture spectrum peaks at 7.626-7.632 MeV, the associated escape peaks at 7.136-7.122 and 6.626-6.612 MeV, and the iron doublets at 4.900 and 4.998 MeV. A potential method for determining the percent solids in process slurries using the 2.22 MeV hydrogen capture peak is discussed

General purpose nuclear irradiation chamber

International Nuclear Information System (INIS)

Nurul Fadzlin Hasbullah; Nuurul Iffah Che Omar; Nahrul Khair Alang Md Rashid; Jaafar Abdullah

2013-01-01

Nuclear technology has found a great need for use in medicine, industry, and research. Smoke detectors in our homes, medical treatments and new varieties of plants by irradiating its seeds are just a few examples of the benefits of nuclear technology. Portable neutron source such as Californium-252, available at Industrial Technology Division (BTI/ PAT), Malaysian Nuclear Agency, has a 2.645 year half-life. However, 252 Cf is known to emit gamma radiation from the source. Thus, this chamber aims to provide a proper gamma shielding for samples to distinguish the use of mixed neutron with gamma-rays or pure neutron radiation. The chamber is compatible to be used with other portable neutron sources such as 241 Am-Be as well as the reactor TRIGA PUSPATI for higher neutron dose. This chamber was designed through a collaborative effort of Kulliyyah Engineering, IIUM with the Industrial Technology Division (BTI) team, Malaysian Nuclear Agency. (Author)

48 CFR 252.225-7016 - Restriction on acquisition of ball and roller bearings.

Science.gov (United States)

2010-10-01

... of ball and roller bearings. 252.225-7016 Section 252.225-7016 Federal Acquisition Regulations System... and roller bearings. As prescribed in 225.7009-5, use the following clause: Restriction on Acquisition of Ball and Roller Bearings (MAR 2006) (a) Definitions. As used in this clause' (1) Bearing...

48 CFR 252.227-7027 - Deferred ordering of technical data or computer software.

Science.gov (United States)

2010-10-01

... technical data or computer software. 252.227-7027 Section 252.227-7027 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(b), use the following clause: Deferred Ordering of Technical Data or Computer Software (APR 1988) In addition to technical data or computer software...

48 CFR 252.227-7026 - Deferred delivery of technical data or computer software.

Science.gov (United States)

2010-10-01

... technical data or computer software. 252.227-7026 Section 252.227-7026 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(a), use the following clause: Deferred Delivery of Technical Data or Computer Software (APR 1988) The Government shall have the right to require, at...

48 CFR 252.247-7017 - Erroneous shipments.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Erroneous shipments. 252... SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of..., articles of personal property inadvertently packed with goods of other than the rightful owner. (2) Ensure...

Review of microscopic integral cross section data in fundamental reactor dosimetry benchmark neutron fields

International Nuclear Information System (INIS)

Fabry, A.; McElroy, W.N.; Kellogg, L.S.; Lippincott, E.P.; Grundl, J.A.; Gilliam, D.M.; Hansen, G.E.

1976-01-01

This paper is intended to review and critically discuss microscopic integral cross section measurement and calculation data for fundamental reactor dosimetry benchmark neutron fields. Specifically the review covers the following fundamental benchmarks: the spontaneous californium-252 fission neutron spectrum standard field; the thermal-neutron induced uranium-235 fission neutron spectrum standard field; the (secondary) intermediate-energy standard neutron field at the center of the Mol-ΣΣ, NISUS, and ITN-ΣΣ facilities; the reference neutron field at the center of the Coupled Fast Reactor Measurement Facility; the reference neutron field at the center of the 10% enriched uranium metal, cylindrical, fast critical; the (primary) Intermediate-Energy Standard Neutron Field

Development of a transportable neutron radiography system for non-destructive tests application

International Nuclear Information System (INIS)

Silva, Ademir X. da; Crispim, Verginia R.

1999-01-01

This paper presents a study of a transportable neutron radiography system utilizing californium-252. Studies about moderation, collimation and shielding are showed. A Monte Carlo Code, MCNP3b, has been used to obtain a maximum and more homogeneous thermal neutron flux in the collimator outlet next to the image plain, and an adequate radiation shielding to attend radiological protection rules. With the presented collimator, it was possible to obtain for the thermal neutron flux, at the collimator outlet and next to the image plain, a L/D ratio 7,5, for neutron flux up to 6 X 10 -6 cm -2 .s -1 per neutron source. (author)

48 CFR 252.229-7004 - Status of contractors as a direct contractor (Spain).

Science.gov (United States)

2010-10-01

... direct contractor (Spain). 252.229-7004 Section 252.229-7004 Federal Acquisition Regulations System... contractor (Spain). As prescribed in 229.402-70(d), use the following clause: Status of Contractor as a Director Contractor (Spain) (JUN 1997) (a) “Direct Contractor,” as used in this clause, means an individual...

48 CFR 252.237-7017 - Individual laundry.

Science.gov (United States)

2010-10-01

... clause: Individual Laundry (DEC 1991) (a) The Contractor shall provide laundry service under this... services. (c) Charges for individual laundry will be on a per unit bundle or a piece-rate basis. The... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Individual laundry. 252...

Production of medical radioisotopes in the ORNL High Flux Isotope Reactor (HFIR) for cancer treatment and arterial restenosis therapy after PTCA

International Nuclear Information System (INIS)

Knapp, F.F. Jr.; Beets, A.L.; Mirzadeh, S.; Alexander, C.W.; Hobbs, R.L.

1998-01-01

The High Flux Isotope Reactor (HFIR) at the Oak Ridge National Laboratory (ORNL) represents an important resource for the production of a wide variety of medical radioisotopes. In addition to serving as a key production site for californium-252 and other transuranic elements, important examples of therapeutic radioisotopes which are currently routinely produced in the HFIR for distribution include dysprosium-166 (parent of holmium-166), rhenium-186, tin-117m and tungsten-188 (parent of rhenium-188). The nine hydraulic tube (HT) positions in the central high flux region permit the insertion and removal of targets at any time during the operating cycle and have traditionally represented a major site for production of medical radioisotopes. To increase the irradiation capabilities of the HFIR, special target holders have recently been designed and fabricated which will be installed in the six Peripheral Target Positions (PTP), which are also located in the high flux region. These positions are only accessible during reactor refueling and will be used for long-term irradiations, such as required for the production of tin-117m and tungsten-188. Each of the PTP tubes will be capable of housing a maximum of eight HT targets, thus increasing the total maximum number of HT targets from the current nine, to a total of 57. In this paper the therapeutic use of reactor-produced radioisotopes for bone pain palliation and vascular brachytherapy and the therapeutic medical radioisotope production capabilities of the ORNL HFIR are briefly discussed

48 CFR 252.225-7045 - Balance of Payments Program-Construction Material Under Trade Agreements.

Science.gov (United States)

2010-10-01

.... Designated country means— (1) A World Trade Organization Government Procurement Agreement (WTO GPA) country... another country, has been substantially transformed in a Free Trade Agreement country into a new and... Program-Construction Material Under Trade Agreements. 252.225-7045 Section 252.225-7045 Federal...

DWH MC 252: Subsurface Oil Transport

Science.gov (United States)

Beegle-Krause, C. J.; Boyer, T.; Murray, D.

2010-12-01

Before reaching the ocean surface, the oil and gas released from the DWH MC 252 blowout at 1500 m moves as a buoyant plume until the trapping depth and plume transition point are reached (Zheng et al 2002). At the transition point, the oil droplets and bubbles move independently of each other, and rise at a rate related to their diameter. The oil density, droplet size distribution and currents primarily determine the distribution of the oil between: Large droplets that rise quickly and create a surface expression of the oil. Moderate size droplets that rise over the course of days, and so spread out quite differently than the surface oil, and commonly do not reach the surface in large enough quantities to create a surface sheen. These droplets separate in the currents, particularly in the strong current shear in upper 500 m currents. Very tiny droplets that rise very slowly, over the course or weeks to months, and may be removed by dissolution, biodegradation or marine snow before ever reaching the surface. Modeling and observations (Joint Analysis Group, 2010) confirm the presence of a deep layer of oil and gas between approximately 1100 and 1300 m over the release location and spreading out along the isopycnal surfaces. Later in the event, a small oxygen depression was a proxy for where oil and gas had been. The DWH MC252 well is located at intermediate depth in the Gulf of Mexico (GoM). The water mass is Antarctic Intermediate Water, which enters and exits the GoM through the Yucatan Straits. Surface influences, such as Loop Current Frontal Eddies (e.g. Berger et al 2000) can reach down to these depths, and alter the flow within De Soto Canyon. The water mass containing the deep layer of oil droplets changes depth within the GoM, but does not reach above a depth of about 900 m. There are no physical processes that could cause this deep layer of oil to reach the continental shelf or the Florida Straits. Observed and historical hydrographic data, observations

46 CFR 252.40 - Payment of subsidy.

Science.gov (United States)

2010-10-01

... Payment and Billing Procedures § 252.40 Payment of subsidy. (a) Submission of voucher. At the close of each calendar month, the subsidized operator may submit a voucher, and include for payment in such... submit an initial voucher and include for payment in such voucher a percentage of the ODS payable for the...

48 CFR 252.227-7005 - License term.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term. 252.227-7005..., DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And... referred to in the “License Grant” clause of this contract and any and all patents hereafter issued on...

48 CFR 252.225-7023 - Preference for products or services from Iraq or Afghanistan.

Science.gov (United States)

2010-10-01

... services from Iraq or Afghanistan. 252.225-7023 Section 252.225-7023 Federal Acquisition Regulations System... from Iraq or Afghanistan. As prescribed in 225.7703-5(a), use the following provision: Requirement for Products or Services from Iraq or Afghanistan (APR 2010) (a) Definitions. Product from Iraq or Afghanistan...

48 CFR 252.225-7020 - Trade Agreements Certificate.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade Agreements... of Provisions And Clauses 252.225-7020 Trade Agreements Certificate. As prescribed in 225.1101(5), use the following provision: Trade Agreements Certificate (JAN 2005) (a) Definitions. Designated...

48 CFR 252.225-7024 - Requirement for products or services from Iraq or Afghanistan.

Science.gov (United States)

2010-10-01

... or services from Iraq or Afghanistan. 252.225-7024 Section 252.225-7024 Federal Acquisition... products or services from Iraq or Afghanistan. As prescribed in 225.7703-5(b), use the following clause: Requirement for Products or Services From Iraq or Afghanistan (SEP 2008) (a) Definitions. As used in this...

48 CFR 252.235-7001 - Indemnification under 10 U.S.C. 2354-cost reimbursement.

Science.gov (United States)

2010-10-01

....S.C. 2354-cost reimbursement. 252.235-7001 Section 252.235-7001 Federal Acquisition Regulations.... 2354—cost reimbursement. As prescribed in 235.070-3, use the following clause: Indemnification Under 10 U.S.C. 2354—Cost Reimbursement (DEC 1991) (a) This clause provides for indemnification under 10 U.S...

30 CFR 250.252 - What environmental monitoring information must accompany the DPP or DOCD?

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What environmental monitoring information must accompany the DPP or DOCD? 250.252 Section 250.252 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... incidental take of marine mammals as may be necessary under the MMPA. (c) Flower Garden Banks National Marine...

50 CFR 216.252 - Permissible methods of taking.

Science.gov (United States)

2010-10-01

... ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking Marine Mammals Incidental to Conducting Precision Strike Weapon Missions in the Gulf of Mexico § 216.252 Permissible methods of taking. (a) Under Letters of Authorization issued pursuant to...

Project Plan 7930 Cell G PaR Remote Handling System Replacement

International Nuclear Information System (INIS)

Kinney, Kathryn A.

2009-01-01

For over 40 years the US Department of Energy (DOE) and its predecessors have made Californium-252 ( 252 Cf) available for a wide range of industries including medical, nuclear fuels, mining, military and national security. The Radiochemical Engineering Development Center (REDC) located within the Oak Ridge National Laboratory (ORNL) processes irradiated production targets from the High Flux Isotope Reactor (HFIR). Operations in Building 7930, Cell G provide over 70% of the world's demand for 252 Cf. Building 7930 was constructed and equipped in the mid-1960s. Current operations for 252 Cf processing in Building 7930, Cell G require use of through-the-wall manipulators and the PaR Remote Handling System. Maintenance and repairs for the manipulators is readily accomplished by removal of the manipulator and relocation to a repair shop where hands-on work can be performed in glove boxes. Contamination inside cell G does not currently allow manned entry and no provisions were created for a maintenance area inside the cell. There has been no maintenance of the PaR system or upgrades, leaving operations vulnerable should the system have a catastrophic failure. The Cell G PaR system is currently being operated in a run to failure mode. As the manipulator is now 40+ years old there is significant risk in this method of operation. In 2006 an assessment was completed that resulted in recommendations for replacing the manipulator operator control and power centers which are used to control and power the PaR manipulator in Cell G. In mid-2008 the chain for the bridge drive failed and subsequent examinations indicated several damaged links (see Figure 1). To continue operations the PaR manipulator arm is being used to push and pull the bridge as a workaround. A retrieval tool was fabricated, tested and staged inside Cell G that will allow positioning of the bridge and manipulator arm for removal from the cell should the PaR system completely fail. A fully functioning and

RBE of Cf-252 neutrons as determined by its lethal, mutagenic, and cytogenetic effects on human cells

International Nuclear Information System (INIS)

Ban, Sadayuki

1989-01-01

To assess the biological effects of neutrons, a man-made spontaneously fissioning isotope, Cf-252, is useful as an experimental model to obtain basic biological data on mixed radiation of gamma-rays and neutrons. The paper describes the lethal effect of Cf-252 radiation on human skin fibroblasts, its lethal and mutagenic effect on HeLa MR cells, and the micronuclei inducing effect on human peripheral lymphocytes. Dose-survival responses of three fibroblast cell strains exposed to Cf-252 radiation are measured. Individual difference is larger than the experimental fluctuation. D 10 values of each strain are obtained from the linear model and linear-quadratic model. Though the dose rate of X-ray is higher than that of Cf-252 radiations, the mean value of RBE(n+γ) is simply obtained as 1.86+0.31 (RBE:relative biological effectiveness). RBE(n) of Cf-252 neutrons to high-dose-rate X-rays is 2.29. After X-ray irradiation, the survival curve of HeLa MR cells gives an extrapolation number of 3.6. It is 1.3 after Cf-252 irradiation. At 50% survival, RBE(n+γ) and RBE(n) are 2.05 and 2.6, respectively. At 10% survival they are 2.05 and 2.6. The mutation frequencies after X-ray irradiation showed a significant non-linear increase with dose. Those after Cf-252 irradiation increase linearly with dose. (N.K.)

Determination of disintegration half-life of 252Cf

International Nuclear Information System (INIS)

Chen Keliang; Liu Guoxing; Wang Sufang; Zheng Jiwen

1991-01-01

The follow-up measurements have been made by using a Si(Au) detector with small solid angle geometry for α disintegration of 252 Cf. The measured half-life of disintegration is 2.638 ± 0.009 year. This value is in accordance with other previous results

48 CFR 252.225-7041 - Correspondence in English.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Correspondence in English... of Provisions And Clauses 252.225-7041 Correspondence in English. As prescribed in 225.1103(2), use the following clause: Correspondence in English (JUN 1997) The Contractor shall ensure that all...

48 CFR 252.229-7002 - Customs exemptions (Germany).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Customs exemptions... of Provisions And Clauses 252.229-7002 Customs exemptions (Germany). As prescribed in 229.402-70(b), use the following clause: Customs Exemptions (Germany) (JUN 1997) Imported products required for the...

48 CFR 252.237-7005 - Performance and delivery.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance and delivery... of Provisions And Clauses 252.237-7005 Performance and delivery. As prescribed in 237.7003(b), use the following clause: Performance and Delivery (DEC 1991) (a) The Contractor shall furnish the...

Decorporation of 241Am and 252Cf by Ca-DTPA from rat, Syrian and Chinese hamster

International Nuclear Information System (INIS)

Seidel, A.

1977-01-01

Retention and mobilization by Ca-DTPA of 241 Am and 252 Cf from rats, Syrian and Chinese hamsters are compared. Previous observations of a much longer residence time of actinides in hamsters liver than in rat liver are confirmed. Identical dose-effect functions were obtained for skeleton of rats and Syrian hamsters whereas 252 Cf removal from Chinese hamster skeleton was lower. The mobilization of 241 Am was lower than that of 252 Cf. With regard to species differences, qualitatively similar results were obtained for 241 Am as for 252 Cf. The results will be discussed with regard to the reduction by DTPA treatment of radiation risk in animal species with different biological half times of actinides in their livers. In this connection, attention will be paid to the usefulness of long-term DTPA treatment

Characteristics of polyethylene-moderated 252Cf neutron sources

International Nuclear Information System (INIS)

Alejnikov, V.E.; Beskrovnaya, L.G.; Florko, B.V.

2000-01-01

Polyethylene-moderated 252 Cf neutron sources were designed to produce neutron reference fields' spectra that simulate the spectra observed in the workplaces within nuclear reactors and accelerators. The paper describes the neutron sources and fields. Neutron spectra were calculated by Monte Carlo method and compared with experimental data

48 CFR 252.229-7005 - Tax exemptions (Spain).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax exemptions (Spain... of Provisions And Clauses 252.229-7005 Tax exemptions (Spain). As prescribed in 229.402-70(e), use the following clause: Tax Exemptions (Spain) (JUN 1997) (a) The Contractor represents that the...

Environmental assessment of the thermal neutron activation explosive detection system for concourse use at US airports

Energy Technology Data Exchange (ETDEWEB)

Jones, C.G.

1990-08-01

This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs.

Environmental assessment of the thermal neutron activation explosive detection system for concourse use at US airports

International Nuclear Information System (INIS)

Jones, C.G.

1990-08-01

This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs

Review of microscopic integral cross section data in fundamental reactor dosimetry benchmark neutron fields

International Nuclear Information System (INIS)

Fabry, A.; McElroy, W.N.; Kellogg, L.S.; Lippincott, E.P.; Grundl, J.A.; Gilliam, D.M.; Hansen, G.E.

1976-10-01

The paper is intended to review and critically discuss microscopic integral cross section measurement and calculation data for fundamental reactor dosimetry benchmark neutron fields. Specifically the review covers the following fundamental benchmarks: (1) the spontaneous californium-252 fission neutron spectrum standard field; (2) the thermal-neutron induced uranium-235 fission neutron spectrum standard field; (3) the (secondary) intermediate-energy standard neutron field at the center of the Mol-ΣΣ, NISUS, and ITN--ΣΣ facilities; (4) the reference neutron field at the center of the Coupled Fast Reactor Measurement Facility (CFRMF); (5) the reference neutron field at the center of the 10 percent enriched uranium metal, cylindrical, fast critical; and (6) the (primary) Intermediate-Energy Standard Neutron Field

48 CFR 252.225-7026 - Acquisition Restricted to Products or Services from Iraq or Afghanistan.

Science.gov (United States)

2010-10-01

... Products or Services from Iraq or Afghanistan. 252.225-7026 Section 252.225-7026 Federal Acquisition... to Products or Services from Iraq or Afghanistan. As prescribed in 225.7703-5(c), use the following clause: Acquisition Restricted to Products or Services From Iraq or Afghanistan (APR 2010) (a...

48 CFR 252.225-7036 - Buy American Act-Free Trade Agreements-Balance of Payments Program.

Science.gov (United States)

2010-10-01

... Trade Agreements-Balance of Payments Program. 252.225-7036 Section 252.225-7036 Federal Acquisition... Trade Agreements—Balance of Payments Program. As prescribed in 225.1101(11)(i), use the following clause: Buy American Act—Free Trade Agreements—Balance of Payments Program (JUL 2009) (a) Definitions. As used...

48 CFR 252.237-7007 - Termination for default.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Termination for default... of Provisions And Clauses 252.237-7007 Termination for default. As prescribed in 237.7003(b), use the following clause: Termination for Default (DEC 1991) (a) This clause supplements and is in addition to the...

Fast and efficient charge breeding of the Californium rare isotope breeder upgrade electron beam ion source

International Nuclear Information System (INIS)

Ostroumov, P. N.; Barcikowski, A.; Dickerson, C. A.; Perry, A.; Sharamentov, S. I.; Vondrasek, R. C.; Zinkann, G. P.; Pikin, A. I.

2015-01-01

The Electron Beam Ion Source (EBIS), developed to breed Californium Rare Isotope Breeder Upgrade (CARIBU) radioactive beams at Argonne Tandem Linac Accelerator System (ATLAS), is being tested off-line. A unique property of the EBIS is a combination of short breeding times, high repetition rates, and a large acceptance. Overall, we have implemented many innovative features during the design and construction of the CARIBU EBIS as compared to the existing EBIS breeders. The off-line charge breeding tests are being performed using a surface ionization source that produces singly charged cesium ions. The main goal of the off-line commissioning is to demonstrate stable operation of the EBIS at a 10 Hz repetition rate and a breeding efficiency into single charge state higher than 15%. These goals have been successfully achieved and exceeded. We have measured (20% ± 0.7%) breeding efficiency into the single charge state of 28+ cesium ions with the breeding time of 28 ms. In general, the current CARIBU EBIS operational parameters can provide charge breeding of any ions in the full mass range of periodic table with high efficiency, short breeding times, and sufficiently low charge-to-mass ratio, 1/6.3 for the heaviest masses, for further acceleration in ATLAS. In this paper, we discuss the parameters of the EBIS and the charge breeding results in a pulsed injection mode with repetition rates up to 10 Hz

Energy and angular distributions of neutrons from 252Cf spontaneous fission

International Nuclear Information System (INIS)

Vasil'ev, Yu.A.; Sidorov, L.V.; Vasil'eva, N.K.

1982-01-01

Some results from a first series of measurements of energy and angular distributions of neutrons from 252 Cf spontaneous fission using a spectrometer with high neutron detection efficiency, i.e. a 4π neutron time-of-flight spectrometer, were already presented. Subsequently, a second series of measurements was performed using a more sophisticated technique. For this second series, we used a more intense 252 Cf layer (25,000 spontaneous fissions per second). The angular resolution was improved by a factor of 2-3 by combining the hexahedral counter modules, placed at the same angle with respect to the direction of motion of the fragments, in new panoramic counters. The neutron counters were calibrated against the average 252 Cf neutron spectrum at several positions of the axis of the fragment detector with respect to the neutron counters. In the spectrum measurements and calibration work, the scattered neutron background was not determined theoretically, as in the first series of measurements, but experimentally using four extra scintillation counters with scatter cones; the counters were set up at 60 deg., 80 deg., 100 deg., and 120 deg. to the direction of separation of the fragments

Time domain measurements for fast metal assemblies with /sup 252/Cf

Energy Technology Data Exchange (ETDEWEB)

Mihalczo, J T

1975-06-01

Time correlation measurements between the pulses from an ionization counter containing a /sup 252/Cf neutron source, which provided the initiators of fission chains in a neutron multiplying assembly and from sensors that detected particles from the fission chains are reviewed for fast uranium or plutonium metal assemblies. Comparisons are made between the correlated count rate from a /sup 252/Cf measurement and that from both one and two-detector Rossi-..cap alpha.. measurements. The assemblies studied were (1) unmoderated and polyethylene-moderated uranium (93 wt percent /sup 235/U) cylinders with masses from 12 to 160 kg; prompt neutron decay constants from 3 to 10/sup 3/ to 10/sup 8/ sec/sup -1/ and (2) unmoderated plutonium spheres and parts of spheres with plutonium masses from 2.2 to 16 kg with /sup 240/Pu contents of 4.5 to 20.1 at. percent. Measurements with a delayed critical uranium metal sphere determined the effective delayed neutron fraction and served as the basis for verification of the theory of the /sup 252/Cf measurement method in the time domain within a few per cent. (auth)

Implementation of 252Cf-source-driven power spectrum density measurement system

International Nuclear Information System (INIS)

Ren Yong; Wei Biao; Feng Peng; Li Jiansheng; Ye Cenming

2012-01-01

The principle of 252 Cf-source-driven power spectrum density measurement method is introduced. A measurement system and platform is realized accordingly, which is a combination of hardware and software, for measuring nuclear parameters. The detection method of neutron pulses based on an ultra-high-speed data acquisition card (three channels, 1 GHz sampling rate, 1 ns synchronization) is described, and the data processing process and the power spectrum density algorithm on PC are designed. This 252 Cf-source-driven power spectrum density measurement system can effectively obtain the nuclear tag parameters of nuclear random processes, such as correlation function and power spectrum density. (authors)

In-situ elemental analysis of coal by neutron activation

International Nuclear Information System (INIS)

Mikesell, J.L.; Senftle, F.E.; Tanner, A.B.

1986-01-01

The U.S. Geological Survey (USGS) has worked to develop neutron techniques for the borehole measurement of the elemental composition of ores since 1969, and first demonstrated a borehole ultimate analysis of coal in 1977. Borehole measurements such as these permit real-time evaluation of coal quality without the expense of coring or the delays associated with laboratory analyses. Two technological innovations make such measurements possible: the availability, from Savannah River Operations Office, DOE, of small californium-252 (/sup 252/Cf) fission neutron sources, and the development, by USGS and Princeton Gamma-Techn, of the melting-cryogen-cooled high-purity germanium borehole gamma-ray detector. A technique of relating mass fractions to measured gamma-ray intensities, which eliminates the need for detailed knowledge of the geometry of the neutron distribution, is used to calculate elemental compositions without resorting to the test pits or computer borehole modeling. In coal, all of the major constituents (C, H, N, S, Si, Al, Fe, Ti) except oxygen can be determined quantitatively by thermal neutron capture gamma-ray spectroscopy

Glasses impregnated with lead for radiation shielding

International Nuclear Information System (INIS)

Abd El Monem, A.M.; Kansouh, W.A.; Megahid, R.M.; Ismail, A.L.; Awad, E.M.

2005-01-01

The attenuation properties of glasses with different concentration of lead have been investigated for the attenuation of gamma-rays from cesium-137 and for total gamma rays using a beam of neutrons and gamma rays emitted from californium-252 source. Measurements have been performed using a gamma-ray spectrometer with Nal(T1) detector for gamma-rays emitted from 137 Cs and a neutron/gamma spectrometer with stilbene scintillator for measurement of total gamma-rays from 252 Cf neutron source. The latter applied the pulse shape discrimination technique to distinguish between recoil proton and recoil electron pulses. The obtained results given the form displayed pulse height spectra and attenuation relations which were used to derive the linear attenuation coefficient (μ), and the mass attenuation coefficient (mu/p) of the investigated glasses. In addition, calculations were performed to determine the attenuation properties of glass shields under investigation using XCOM code given by the others. A comparison of the shielding properties of these glasses with some standard shielding materials indicated that, the investigated glasses process the shielding advantages required for different nuclear technology applications

Neutron emission during acceleration of 252Cf fission fragments

International Nuclear Information System (INIS)

Batenkov, O.I.; Blinov, M.V.; Blinov, A.B.; Smirnov, S.N.

1991-01-01

We investigate neutron emission during acceleration of fission fragments in the process of spontaneous fission of 252 Cf. Experimental angular and energy distributions of neutrons are compared with the results of calculations of neutron evaporation during fragment acceleration. (author). 8 refs, 3 figs

The Implications of the Excited Rotation of Comet 252P/2000 G1 (LINEAR)

Science.gov (United States)

Li, Jian-Yang; Samarasinha, Nalin H.; Kelley, Michael S. P.; Farnocchia, Davide; Mutchler, Max J.; Ren, Yanqiong; Lu, Xiaoping; Tholen, David J.; Lister, Tim; Micheli, Marco

2018-01-01

Jupiter Family comet (JFC) 252P/LINEAR had a close encounter to Earth on 2016 March 21. We imaged the comet with the Hubble Space Telescope Wide Field Camera 3 UVIS channel through the V- and r’-band filters spanning ~8 hours on 2016 April 4. The pixel scale of 2.7 km/pixel allowed us to study the structure of the cometary coma at scales of a few kilometers to a few hundred kilometers from the nucleus, a characteristic that is unique to our data. The dust coma of 252P showed a strong, well defined, narrow and nearly linear feature in the sunward direction, and its projected position angle moved about the nucleus for ~60 deg in 8 hours, consistent with an apparent periodicity of ~7.24 hours. On the other hand, the lightcurve measured in both V- and r’-band images from a 13 km radius aperture, after corrected for color term, showed a variability of >0.14 mag that is consistent with an apparent periodicity of ~5.4 hours or its multiples. We suggest that the two different periodicities derived from coma morphology and the lightcurve is a strong indication that the nucleus of 252P is in a non-principal axis (NPA) rotation, joining two other confirmed NPA rotators (1P/Halley and 103P/Hartley 2) and comets that are potentially in NPA rotational states (e.g., 2P/Encke). However, this apparition has been unusual for 252P. In the past three perihelion passages since discovery, the comet was very weakly active compared to other JFCs. Meteor evidence also exists that it probably has been very weakly active for a few hundred years. But in our data, we saw a very active comet in this 2016 apparition with an active fraction of 40% to >100%, representing an increase of 100x with respect to its recent past. Based on our observations, 252P has a small nucleus with a radius of ~0.3 km, which suggests that its rotational state could be relatively easily changed by torques caused by outgassing. Since the very weak outgassing in the past is not likely to change the rotational state

48 CFR 252.225-7035 - Buy American Act-Free Trade Agreements-Balance of Payments Program Certificate.

Science.gov (United States)

2010-10-01

... Trade Agreements-Balance of Payments Program Certificate. 252.225-7035 Section 252.225-7035 Federal... Trade Agreements—Balance of Payments Program Certificate. As prescribed in 225.1101(10), use the following provision: Buy American Act—Free Trade Agreements—Balance of Payments Program Certificate (DEC...

NAA using Cf-252 after preconcentration

International Nuclear Information System (INIS)

Panyo, O.; Moebius, S.; Keller, C.

1988-01-01

Neutron activation analysis (NAA) with thermal neutron using Cf-252 sources was applied to elemental analysis of elements in water samples. A high-resolution Ge(Li) detector was employed for gamma-radiation detection. Both suspended particulate matter and liquid fraction were investigated after filtration. Preconcentration method by co-precipitation using iron (III) hydroxide and oxine were chosen for use. Elements which were considered to be able to detect in the present study are Al, As, Cl, K, Mg, Mn, Na, Sr, Ti, U, V and Zn

Determination of kinetics parameters using stochastic methods in a 252Cf system

International Nuclear Information System (INIS)

Difilippo, F.C.

1988-01-01

Safety analysis and control system design of nuclear systems require the knowledge of neutron kinetics related parameters like effective delayed neutron fraction, neutron lifetime, time between neutron generations and subcriticality margins. Many methods, deterministic and stochastic, are being used, some since the beginning of nuclear power, to measure these important parameters. The method based on the use of the 252 Cf neutron source has been under intense study at the Oak Ridge National Laboratory, both experimentally and theoretically, during the last years. The increasing demand for this isotope in industrial and medical applications and new designs of advanced high flux reactors to produce it make the isotope available as neutron source (only few micrograms are necessary). A thin layer of 252 Cf is deposited in one of the electrodes of a fission chamber which produces pulses each time the 252 Cf disintegrates via α or spontaneous fission decay; the smaller pulses associated with the α decay can be easily discriminated with the important result that we known the time when v/sub c/ neutrons are injected into the system (number of neutrons per fission of 252 Cf). Thus, a small (few cm 3 ) and nonintrusive device can be used as a random pulsed neutron source with known natural properties that do no depend on biases associated with more complex interrogating devices like accelerators. This paper presents a general formalism that relates the kinetics parameters with stochastic descriptors that naturally appear because of the random nature of the production and transport of neutrons

A YOUNG ECLIPSING BINARY AND ITS LUMINOUS NEIGHBORS IN THE EMBEDDED STAR CLUSTER Sh 2-252E

Energy Technology Data Exchange (ETDEWEB)

Lester, Kathryn V.; Gies, Douglas R.; Guo, Zhao, E-mail: lester@chara.gsu.edu, E-mail: gies@chara.gsu.edu, E-mail: guo@chara.gsu.edu [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 5060, Atlanta, GA 30302-5060 (United States)

2016-12-01

We present a photometric and light curve analysis of an eccentric eclipsing binary in the K2 Campaign 0 field, which resides in Sh 2-252E, a young star cluster embedded in an H ii region. We describe a spectroscopic investigation of the three brightest stars in the crowded aperture to identify which is the binary system. We find that none of these stars are components of the eclipsing binary system, which must be one of the fainter nearby stars. These bright cluster members all have remarkable spectra: Sh 2-252a (EPIC 202062176) is a B0.5 V star with razor sharp absorption lines, Sh 2-252b is a Herbig A0 star with disk-like emission lines, and Sh 2-252c is a pre-main-sequence star with very red color.

Analysis of geological material and especially ores by means of a 252Cf source

International Nuclear Information System (INIS)

Barrandon, J.N.; Borderie, B.; Melky, S.; Halfon, J.; Marce, A.

1976-01-01

Tests were made on the possibilities for analysis by 252 Cf activation in the earth sciences and mining research. The results obtained show that while 252 Cf activation can only resolve certain very specific geochemical research problems, it does allow the exact and rapid determination of numerous elements whose ores are of great economic importance such as fluorine, titanium, vanadium, manganese, copper, antimony, barium, and tungsten. The utilization of activation analysis methods in the earth sciences is not a recent phenomenon. It has generally been limited to the analysis of traces in relatively small volumes by means of irradiation in nuclear reactors. Traditional neutron sources were little used and were not very applicable. The development of 252 Cf isotopic sources emitting more intense neutron fluxes make it possible to consider carrying out more sensitive determinations without making use of a nuclear reactor. In addition, this technique can be adapted for in situ analysis in mines and mine borings. Our work which is centered upon the possibilities of instrumental laboratory analyses of geological materials through 252 Cf activation is oriented in two principal directions: the study of the experimental sensitivities of the various elements in different rocks with the usual compositions; and the study of the possibilities for routine ore analyses

8 CFR 252.5 - Special procedures for deserters from Spanish or Greek ships of war.

Science.gov (United States)

2010-01-01

... Spanish or Greek ships of war. 252.5 Section 252.5 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY... Greek ships of war. (a) General. Under E.O. 11267 of January 19, 1966 (31 FR 807) and 28 CFR 0.109, and... a ship of war of that government, while in any port of the United States, and on proof by the...

48 CFR 252.232-7005 - Reimbursement of subcontractor advance payments-DoD pilot mentor-protege program.

Science.gov (United States)

2010-10-01

... subcontractor advance payments-DoD pilot mentor-protege program. 252.232-7005 Section 252.232-7005 Federal... subcontractor advance payments—DoD pilot mentor-protege program. As prescribed in 232.412-70(c), use the following clause: Reimbursement of Subcontractor Advance Payments—DoD Pilot Mentor-Protege Program (SEP 2001...

48 CFR 252.234-7002 - Earned Value Management System.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Earned Value Management... of Provisions And Clauses 252.234-7002 Earned Value Management System. As prescribed in 234.203(2), use the following clause: Earned Value Management System (APR 2008) (a) In the performance of this...

48 CFR 252.227-7007 - License term-running royalty.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term-running... of Provisions And Clauses 252.227-7007 License term—running royalty. As prescribed at 227.7009-4(b), insert the following clause in patent releases, license agreements, and assignments: License Term—Running...

Neutron activation analysis detection limits using 252Cf sources

International Nuclear Information System (INIS)

DiPrete, D.P.; Sigg, R.A.

2000-01-01

The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes

Calculation of dose distribution for 252Cf fission neutron source in tissue equivalent phantoms using Monte Carlo method

International Nuclear Information System (INIS)

Ji Gang; Guo Yong; Luo Yisheng; Zhang Wenzhong

2001-01-01

Objective: To provide useful parameters for neutron radiotherapy, the author presents results of a Monte Carlo simulation study investigating the dosimetric characteristics of linear 252 Cf fission neutron sources. Methods: A 252 Cf fission source and tissue equivalent phantom were modeled. The dose of neutron and gamma radiations were calculated using Monte Carlo Code. Results: The dose of neutron and gamma at several positions for 252 Cf in the phantom made of equivalent materials to water, blood, muscle, skin, bone and lung were calculated. Conclusion: The results by Monte Carlo methods were compared with the data by measurement and references. According to the calculation, the method using water phantom to simulate local tissues such as muscle, blood and skin is reasonable for the calculation and measurements of dose distribution for 252 Cf

Evaluation of mass distribution data from 252Cf spontaneous fission

International Nuclear Information System (INIS)

Liu Tingjin

2003-01-01

The mass distribution data of 252 Cf spontaneous fission were evaluated based on 7 sets of available experimental data. The measured data were corrected for the standards and γ intensity used by using the new evaluated ones. The errors were made necessary adjusting. The evaluated experimental data were fitted with spline function without any restriction and with symmetric restriction. These two sets of fit data were recommended as reference data of the mass distribution of 252 Cf spontaneous fission. The errors of the recommended data were considerably reduced comparing with the measured ones. The light and heavy peaks are not completely symmetric. Also there are fine structures on the right side of the light peak at A=109-111 and left side of the heavy peak at A=137-139. These should be paid attention and studied further. (author)

Effective source size as related to 252Cf neutron radiography

International Nuclear Information System (INIS)

Wada, Nobuo; Enomoto, Shigemasa; Tachikawa, Noboru; Nojiri, Toshiaki.

1977-01-01

The effective source size in 252 Cf thermal neutron radiography, relating to its geometrical unsharpness in image formation, is experimentally studied. A neutron radiographic system consists of a 160 μg 252 Cf neutron source, water moderator and divergent cadmium lined collimator. Thermal neutron image detection is performed with using a LiF scintillator and a high speed X-ray film to employ direct exposure method. The modulation transfer function, used for describing image quality, is derived from radiographic image corresponding to a cadmium plate with sharp edge. The modulation transfer function for the system is expressed by the product of the function for both geometrical and inherent unsharpness, and allows isolation of geometrical unsharpness as related to the effective size of the thermal neutron source. It is found to be 80 -- 90% of the collimator inlet diameter. (auth.)

48 CFR 252.227-7006 - License grant-running royalty.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License grant-running... of Provisions And Clauses 252.227-7006 License grant—running royalty. As prescribed at 227.7009-4(a...—Running Royalty (AUG 1984) (a) The Contractor hereby grants to the Government, as represented by the...

48 CFR 252.227-7033 - Rights in shop drawings.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in shop drawings... of Provisions And Clauses 252.227-7033 Rights in shop drawings. As prescribed in 227.7107-(1)(c), use the following clause: Rights in Shop Drawings (APR 1966) (a) Shop drawings for construction means...

Interactive effects between Lymphotoxin α +252 polymorphism and habits of substance use on risk of hepatocellular carcinoma

Directory of Open Access Journals (Sweden)

Jung-Fa Tsai

2017-07-01

Full Text Available This case–control study aimed to assess the interactive effect between polymorphisms of lymphotoxin (LT α +252 and habitual substance use on risk of hepatocellular carcinoma (HCC. We enrolled 150 pairs of sex- and age-matched HCC patients and unrelated healthy controls. LTα genotypes were detected with polymerase-chain reaction and restrictive fragment length polymorphisms. Information about habits of substance use was obtained through personal interview. Multivariate analysis indicated that LTα +252 G/G genotypes [odds ratio (OR = 3.36], Hepatitis B surface antigen (OR = 16.68, antibodies to hepatitis C virus (OR = 34.88 and having at least two habits of substance use (OR = 2.50 were independent risk factors for HCC. There were additive interactions among LTα +252 G/G genotype, chronic viral hepatitis, and habit of each substance use. In conclusion: There are independent and additive interactions between LTα +252 G/G genotype, chronic viral hepatitis, and habits of substance use on risk of HCC.

Microarray analysis of DNA damage repair gene expression profiles in cervical cancer cells radioresistant to 252Cf neutron and X-rays

International Nuclear Information System (INIS)

Qing, Yi; Wang, Ge; Wang, Dong; Yang, Xue-Qin; Zhong, Zhao-Yang; Lei, Xin; Xie, Jia-Yin; Li, Meng-Xia; Xiang, De-Bing; Li, Zeng-Peng; Yang, Zhen-Zhou

2010-01-01

The aim of the study was to obtain stable radioresistant sub-lines from the human cervical cancer cell line HeLa by prolonged exposure to 252 Cf neutron and X-rays. Radioresistance mechanisms were investigated in the resulting cells using microarray analysis of DNA damage repair genes. HeLa cells were treated with fractionated 252 Cf neutron and X-rays, with a cumulative dose of 75 Gy each, over 8 months, yielding the sub-lines HeLaNR and HeLaXR. Radioresistant characteristics were detected by clone formation assay, ultrastructural observations, cell doubling time, cell cycle distribution, and apoptosis assay. Gene expression patterns of the radioresistant sub-lines were studied through microarray analysis and verified by Western blotting and real-time PCR. The radioresistant sub-lines HeLaNR and HeLaXR were more radioresisitant to 252 Cf neutron and X-rays than parental HeLa cells by detecting their radioresistant characteristics, respectively. Compared to HeLa cells, the expression of 24 genes was significantly altered by at least 2-fold in HeLaNR cells. Of these, 19 genes were up-regulated and 5 down-regulated. In HeLaXR cells, 41 genes were significantly altered by at least 2-fold; 38 genes were up-regulated and 3 down-regulated. Chronic exposure of cells to ionizing radiation induces adaptive responses that enhance tolerance of ionizing radiation and allow investigations of cellular radioresistance mechanisms. The insights gained into the molecular mechanisms activated by these 'radioresistance' genes will lead to new therapeutic targets for cervical cancer

48 CFR 252.228-7001 - Ground and flight risk.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Ground and flight risk... of Provisions And Clauses 252.228-7001 Ground and flight risk. As prescribed in 228.370(b), use the following clause: Ground and Flight Risk (JUN 2010) (a) Definitions. As used in this clause— (1) Aircraft...

48 CFR 252.227-7020 - Rights in special works.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in special works... of Provisions And Clauses 252.227-7020 Rights in special works. As prescribed in 227.7105-3, 227.7106(a) or 227.7205(a), use the following clause: Rights in Special Works (JUN 1995) (a) Applicability...

Monte Carlo simulation using MCNP4B for an optimal shielding design of a 252 Cf source

International Nuclear Information System (INIS)

Silva, Ademir X. da; Crispim, Verginia R.

2001-01-01

This study aim to investigate an optimum shielding design against neutrons and gamma-rays from a source of 252 Cf, using Monte Carlo simulation. The shielding materials studied were: borated polyethylene, borated-lead polyethylene and stainless steel. The Monte Carlo code MCNP, version 4B, was used to design shielding for 252 Cf based neutron irradiator systems. By normalizing the dose equivalent rate values presented to the neutron production rate of the source, the resulting calculations are independents of the intensity of actual 252 Cf source. The results shown what the total dose equivalent rates were reduced significantly by the shielding system optimization. (author)

48 CFR 252.225-7008 - Restriction on Acquisition of Specialty Metals.

Science.gov (United States)

2010-10-01

... CLAUSES Text of Provisions And Clauses 252.225-7008 Restriction on Acquisition of Specialty Metals. As... more of the following limits: Manganese, 1.65 percent; silicon, 0.60 percent; or copper, 0.60 percent...

Cf-252 based neutron radiography using real-time image processing system

International Nuclear Information System (INIS)

Mochiki, Koh-ichi; Koiso, Manabu; Yamaji, Akihiro; Iwata, Hideki; Kihara, Yoshitaka; Sano, Shigeru; Murata, Yutaka

2001-01-01

For compact Cf-252 based neutron radiography, a real-time image processing system by particle counting technique has been developed. The electronic imaging system consists of a supersensitive imaging camera, a real-time corrector, a real-time binary converter, a real-time calculator for centroid, a display monitor and a computer. Three types of accumulated NR image; ordinary, binary and centroid images, can be observed during a measurement. Accumulated NR images were taken by the centroid mode, the binary mode and ordinary mode using of Cf-252 neutron source and those images were compared. The centroid mode presented the sharpest image and its statistical characteristics followed the Poisson distribution, while the ordinary mode showed the smoothest image as the averaging effect by particle bright spots with distributed brightness was most dominant. (author)

48 CFR 252.216-7000 - Economic price adjustment-basic steel, aluminum, brass, bronze, or copper mill products.

Science.gov (United States)

2010-10-01

...-basic steel, aluminum, brass, bronze, or copper mill products. 252.216-7000 Section 252.216-7000 Federal... adjustment—basic steel, aluminum, brass, bronze, or copper mill products. As prescribed in 216.203-4-70(a... Mill Products (JUL 1997) (a) Definitions. As used in this clause— Established price means a price which...

Chromatographic cation exchange separation of decigram quantities of californium and other transplutonium elements

Energy Technology Data Exchange (ETDEWEB)

Benker, D.E.; Chattin, F.R.; Collins, E.D.; Knauer, J.B.; Orr, P.B.; Ross, R.G.; Wiggins, J.T.

1980-01-01

Decigram quantities of highly radioactive transplutonium elements are routinely partitioned at TRU by chromatographic elution from cation resin using AHIB eluent. By using two high-pressure ion exchange columns, a small one for the initial loading of the feed and a large one for the elution, batch runs containing up to 200 mg of /sup 252/Cf can be made in about 5 hours (2 hours to load the feed and 3 hours for the elution). The number of effluent product fractions and the amount of actinides that must be collected in intermediate fractions are minimized by monitoring response from a flow-through alpha-detector. This process has been reliable and relatively easy to operate, and will continue to be used for partitioning transplutonium elements at TRU.

48 CFR 252.242-7004 - Material management and accounting system.

Science.gov (United States)

2010-10-01

... CLAUSES Text of Provisions And Clauses 252.242-7004 Material management and accounting system. As prescribed in 242.7204, use the following caluse: Material Management and Accounting System (JUL 2009) (a) Definitions. As used in this clause— (1) Material management and accounting system (MMAS) means the Contractor...

Activation analysis of stainless steel flux monitors using 252Cf neutron sources

International Nuclear Information System (INIS)

Williams, J.G.; Newton, T.H. Jr.; Cogburn, C.O.

1984-01-01

Activation analysis was performed on stainless steel beads from a chain which is used in reactor pressure vessel surveillance experiments at the Arkansas Power and Light Company reactors. The beads allow monitoring of two fast and three thermal neutron induced reactions: 58 Ni(n,p) 58 Co, 54 Fe(n,p) 54 Mn, 58 Fe(n,γ) 59 Fe, 59 Co(n,γ) 60 Co and 50 Cr(n,γ) 51 Cr. The analysis was performed using 12 beads from various positions along 5 different batches of chain and standard materials in an H 2 O moderator tank using two intense californium sources which had a total neutron emission rate of 3.97 x 10 10 /s. Semiconductor gamma spectrometers were used to count the products of the above reactions in the specimens. The percentage by weight of the iron, chromium and cobalt in the beads were found to be 62.1%, 20.2% and 0.120%, respectively. The excellent uniformity found in the bead compositions demonstrates the reproducibility of the experimental techniques and enhances considerably the value of the beads as neutron flux montitors

Functional design criteria for project W-252, phase II liquid effluent treatment and disposal. Revision 2

International Nuclear Information System (INIS)

Hatch, C.E.

1995-05-01

This document is the Functional Design Criteria for Project W-252. Project W-252 provides the scope to provide BAT/AKART (best available technology...) to 200 Liquid Effluent Phase II streams (B-Plant). This revision (Rev. 2) incorporates a major descoping of the project. The descoping was done to reflect a combination of budget cutting measures allowed by a less stringent regulatory posture toward the Phase II streams

48 CFR 252.228-7000 - Reimbursement for war-hazard losses.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reimbursement for war... CLAUSES Text of Provisions And Clauses 252.228-7000 Reimbursement for war-hazard losses. As prescribed in 228.370(a), use the following clause: Reimbursement for War-Hazard Losses (DEC 1991) (a) Costs for...

Termocoagulación facetaria lumbar: Experiencia en 252 pacientes Thermocoagulation of lumbar facet joints: Experience in 252 patients

OpenAIRE

J. E. Martínez-Suárez; L. Camblor; S. Salva; W. A. de Jongh

2005-01-01

Se presentan 252 pacientes con el diagnóstico de dolor lumbar facetario a los que se le realizó la técnica quirúrgica de termocoagulación percutánea de la faceta articular. Nuestro propósito principal fue aliviar el dolor en estos pacientes, evaluamos la eficacia de la técnica con un 74,7% de resultados quirúrgicos satisfactorios, así como la descripción de diferentes aspectos como: edad, sexo, causas y la topografía segmentaria del dolor.Two hundred fifty two patients with diagnosis of lumba...

48 CFR 252.227-7019 - Validation of asserted restrictions-Computer software.

Science.gov (United States)

2010-10-01

..., creates or implies privity of contract between the Government and the Contractor's subcontractors or... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7019 Validation of asserted restrictions..., unless otherwise specifically indicated, the term “Contractor” means the Contractor and its...

Clinicopathological study of 252 jaw bone periapical lesions from a private pathology laboratory.

Science.gov (United States)

Lin, Hung-Pin; Chen, Hsin-Ming; Yu, Chuan-Hang; Kuo, Ru-Cheng; Kuo, Ying-Shiung; Wang, Yi-Ping

2010-11-01

Periapical lesions are common sequelae of pulp diseases. This retrospective study evaluated the clinical and histopathological features of periapical lesions sent to a private pathology laboratory by dentists in private clinics. Two hundred and fifty-two consecutive cases of periapical lesions were collected from September 2005 to October 2009. Clinical data and histopathological features of these periapical lesions were reviewed and analyzed. The 252 periapical lesions consisted of 128 periapical granulomas, 117 periapical cysts, and seven periapical scars. These 252 lesions were taken from 252 patients (92 men and 160 women; mean age = 43.6 years; range, 9-81 years). Of the 252 periapical lesions, 186 were found in the maxilla and 66 in the mandible. The most common site for periapical lesions was the maxillary anterior region (134 cases, including 73 granulomas, 54 cysts and 7 scars), and the most frequently involved tooth was the maxillary lateral incisor (64 cases, including 29 granulomas, 31 cysts and 4 scars). Of the 117 periapical cysts, 116 were lined by stratified squamous epithelium and one by mucoepidermoid epithelium. Hyaline bodies were discovered in the lining epithelium of four periapical cysts. Odontogenic epithelial rest, cholesterol cleft, foamy histiocytes, hemosiderin-laden macrophages, dystrophic calcification, foreign bodies, and bacterial clumps were found in five, three, nine, two, 28, 10 and one periapical granulomas, respectively, as well as in six, 11, eight, seven, 19, nine and eight periapical cysts, respectively. Granulomas and cysts were the two most common periapical lesions. Periapical lesions occurred more frequently in female patients and in those in their fourth to fifth decades. The most commonly affected site for periapical lesions was the maxillary anterior region, and the most frequently involved tooth was the maxillary lateral incisor. Copyright © 2010 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All

Cf-252 neutron brachytherapy: an advance for bulky localized cancer therapy

International Nuclear Information System (INIS)

Maruyama, Y.

1984-01-01

The physical and radiobiogical basis as well as the rationale for neutron brachytherapy, using Cf-252, in human cancer therapy is reviewed. Cf-252 brachytherapy represents an economical and effective form of neutron radiotherapy that is readily and safely applied clinically. It can be used anywhere in the world without unusual personnel, equipment or facilities, or prohibitive expenses or maintenance costs. Used on bulky head and neck, thoracic, abdominal, pelvic, brain and appendage cancers, it overcomes hypoxic radioresistance and produces remarkable rates of tumor clearance. It is easily combined with photon radiotherapy and in proper schedules and doses, it can control advanced but still localized regional cancers to produce tumor cure. It will clear the local manifestations of recurrent or metastatic tumors or advanced stages of primary tumors and therefore in conjunction with other adjuvant therapies offers much more effective tumor control and palliation than present conventional therapy. (Auth.)

Neutron radiography for nondestructive testing

International Nuclear Information System (INIS)

John, J.

1979-01-01

Neutron radiography is similar to X-ray inspection in that both depend upon use of radiation that penetrates some materials and is absorbed by others to provide a contrast image of conditions not readily available for visual inspection. X-rays are absorbed by dense materials, such as metals, whereas neutrons readily penetrate metals, but are absorbed by materials containing hydrogen. The neutron radiography has been successfully applied to a number of inspection situations. These include the inspection of explosives, advanced composites, adhesively bonded structures and a number of aircraft engine components. With the availability of Californium-252, it has become feasible to construct mobile neutron radiography systems suitable for field use. Such systems have been used for in-situ inspection of flight line aircraft, particularly to locate and measure hidden corrosion

Reliability of semiconductor and gas-filled diodes for over-voltage protection exposed to ionizing radiation

Directory of Open Access Journals (Sweden)

Stanković Koviljka

2009-01-01

Full Text Available The wide-spread use of semiconductor and gas-filled diodes for non-linear over-voltage protection results in a variety of possible working conditions. It is therefore essential to have a thorough insight into their reliability in exploitation environments which imply exposure to ionizing radiation. The aim of this paper is to investigate the influence of irradiation on over-voltage diode characteristics by exposing the diodes to californium-252 combined neutron/gamma radiation field. The irradiation of semiconductor over-voltage diodes causes severe degradation of their protection characteristics. On the other hand, gas-filled over-voltage diodes exhibit a temporal improvement of performance. The results are presented with the accompanying theoretical interpretations of the observed changes in over-voltage diode behaviour, based on the interaction of radiation with materials constituting the diodes.

Nuclear assay of coal. Volume 8. Continuous nuclear assay of coal (CONAC). Final report

International Nuclear Information System (INIS)

Lagarias, J.; Irminger, P.; Dodson, W.

1979-01-01

Using californium-252 as a source of exciting neutrons, prompt gamma photons emitted by elemental nuclei in the coal have been measured using several detectors, including sodium-iodide and germanium-lithium. Several coal types, including bituminous, subbituminous lignite and anthracite were crushed to various top sizes and analyzed carefully by traditional ASTM wet chemistry techniques at two or three different laboratories. The elements (sulfur, hydrogen, carbon, aluminum, silicon, iron, calcium, sodium, nitrogen, and chlorine) were determined by prompt neutron activations and the quantities compared with those of the wet chemical analyses. Since satisfactory correlation has been obtained at bench-scale level using 100 to 200 kG samples, an apparatus has been designed to analyze a coal stream of up to 50 ton/hour, at an electric power generating station

Neutron dosimetry and spectrometry with Bonner spheres. Working out a log-normal reference matrix

International Nuclear Information System (INIS)

Zaborowski, Henrick.

1981-11-01

From the experimental and theoretical studies made upon the BONNER's spheres System with a I 6 Li(Eu) crystal and with a miniaturized 3 He counter we get the normalized energy response functions R*sub(i)(E). This normalization is obtained by the mathematization of the Resolution Function R*(i,E) in the Log-Normal distribution hypothesis to mono energetic neutrons given in April 1976 to the International Symposium on Californium 252. The fit of the Log-Normal Hypothesis with the experimental and Theoretical data is very satisfactory. The parameter's tabulated values allow a precise interpolation, at all energies between 0.4 eV and 15 MeV and for all spheres diameters between 2 and 12 inches, of the discretized R*sub(ij) Reference Matrix for the applications to neutron dosimetry and spectrometry [fr

48 CFR 252.227-7021 - Rights in data-existing works.

Science.gov (United States)

2010-10-01

... of Provisions And Clauses 252.227-7021 Rights in data—existing works. As prescribed at 227.7105-2(a), use the following clause: Rights in Data—Existing Works (MAR 1979) (a) The term works as used herein... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Rights in data-existing...

48 CFR 252.219-7004 - Small business subcontracting plan (test program).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7004 Small business subcontracting plan (test program). As prescribed in 219.708(b)(1)(B), use the following clause: Small Business...

The application of n-γ discrimination in 252Cf spontaneous neutron TOF spectra measurement

International Nuclear Information System (INIS)

Zhou Haojun; Zhang Yi; Li Jiansheng; Jin Yu; Wang Jie; Li Chunyuan

2004-01-01

The BC501 scintillator is used as a fast neutron detector. The effect that the pulse rise time method was used to discriminate γ from 252 Cf spontaneous neutron TOF spectra is studied in the experiment. A pulse rise time separation spectra of γ and 252 Cf spontaneous neuron upon 1 MeV is obtained, the n-γ separation function reaches to 4.6. When the result of pulse rise time separation coincides with the time-of-flight spectra in which the neutron energy is upon 0.5 MeV, 0.8 MeV and 1.0 MeV, comparing with the anticoincidence, γ was eliminated 99.90% at least. (authors)

Frequency spectrum analysis of 252Cf neutron source based on LabVIEW

International Nuclear Information System (INIS)

Mi Deling; Li Pengcheng

2011-01-01

The frequency spectrum analysis of 252 Cf Neutron source is an extremely important method in nuclear stochastic signal processing. Focused on the special '0' and '1' structure of neutron pulse series, this paper proposes a fast-correlation algorithm to improve the computational rate of the spectrum analysis system. And the multi-core processor technology is employed as well as multi-threaded programming techniques of LabVIEW to construct frequency spectrum analysis system of 252 Cf neutron source based on LabVIEW. It not only obtains the auto-correlation and cross correlation results, but also auto-power spectrum,cross-power spectrum and ratio of spectral density. The results show that: analysis tools based on LabVIEW improve the fast auto-correlation and cross correlation code operating efficiency about by 25% to 35%, also verify the feasibility of using LabVIEW for spectrum analysis. (authors)

A new facility for non-destructive assay using a 252Cf source

International Nuclear Information System (INIS)

Stevanato, L.; Caldogno, M.; Dima, R.; Fabris, D.; Hao, Xin; Lunardon, M.; Moretto, S.; Nebbia, G.; Pesente, S.; Pino, F.; Sajo-Bohus, L.; Viesti, G.

2013-01-01

A new laboratory facility for non-destructive analysis (NDA) using a time-tagged 252 Cf source is presented. The system is designed to analyze samples having maximum size of about 20×25 cm 2 , the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. - Highlights: ► Tagged 252 Cf source setup. ► Material recognition and sample imaging with measurements of gamma ray and neutron transmission. ► Material identification via energy dependent neutron and gamma ray transmission measurements. ► Identification of layered material. ► Effects due to the sample thickness on the above identification techniques

48 CFR 252.229-7009 - Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom).

Science.gov (United States)

2010-10-01

... and value added tax on fuel (passenger vehicles) (United Kingdom). 252.229-7009 Section 252.229-7009... Relief from customs duty and value added tax on fuel (passenger vehicles) (United Kingdom). As prescribed in 229.402-70(i), use the following clause: Relief from Customs Duty and Value Added Tax on Fuel...

48 CFR 252.239-7016 - Telecommunications security equipment, devices, techniques, and services.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Telecommunications... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.239-7016 Telecommunications... clause: Telecommunications Security Equipment, Devices, Techniques, and Services (DEC 1991) (a...

Understanding the different rotational behaviors of $^{252}$No and $^{254}$No in terms of high-order deformation

CERN Document Server

Liu, H L; Walker, P M

2012-01-01

Total Routhian surface calculations have been performed to investigate rapidly rotating transfermium nuclei, the heaviest nuclei accessible by detailed spectroscopy experiments. The observed fast alignment in $^{252}$No and slow alignment in $^{254}$No are well reproduced by the calculations incorporating high-order deformations. The different rotational behaviors of $^{252}$No and $^{254}$No can be understood for the first time in terms of $\\beta_6$ deformation that decreases the energies of the $\

Design of a setup for {sup 252}Cf neutron source for storage and analysis purpose

Energy Technology Data Exchange (ETDEWEB)

Hei, Daqian [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Zhuang, Haocheng [Xi’an Middle School of Shanxi Province, Xi’an 710000 (China); Jia, Wenbao, E-mail: jiawenbao@163.com [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China); Cheng, Can; Jiang, Zhou; Wang, Hongtao [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Chen, Da [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China)

2016-11-01

{sup 252}Cf is a reliable isotopic neutron source and widely used in the prompt gamma ray neutron activation analysis (PGNAA) technique. A cylindrical barrel made by polymethyl methacrylate contained with the boric acid solution was designed for storage and application of a 5 μg {sup 252}Cf neutron source. The size of the setup was optimized with Monte Carlo code. The experiments were performed and the results showed the doses were reduced with the setup and less than the allowable limit. The intensity and collimating radius of the neutron beam could also be adjusted through different collimator.

INAA using 252Cf neutron source at University of Pune

International Nuclear Information System (INIS)

Rajurkar, N.S.

2006-01-01

The review presents the work done over last two decades on Instrumental Neutron Activation Analysis (INAA) by our research group at University of Pune using 252 Cf spontaneous fission neutron source. The technique has been applied in different fields viz. numismatics, industry, agriculture, ayurveda, environmental and health sciences and diffusion studies. A brief discussion of the work is presented in this article. (author)

48 CFR 252.228-7006 - Compliance with Spanish laws and insurance.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Compliance with Spanish... CLAUSES Text of Provisions And Clauses 252.228-7006 Compliance with Spanish laws and insurance. As prescribed at 228.370(e), use the following clause: Compliance with Spanish Laws and Insurance (DEC 1998) (a...

48 CFR 252.229-7006 - Value added tax exclusion (United Kingdom).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Value added tax exclusion... CLAUSES Text of Provisions And Clauses 252.229-7006 Value added tax exclusion (United Kingdom). As prescribed in 229.402-70(f), use the following clause: Value Added Tax Exclusion (United Kingdom) (JUN 1997...

Physical and biological dosimetries of Cf-252 radiation

International Nuclear Information System (INIS)

Yamashita, Hisao; Wada, Tadashi; Dokiya, Takushi; Hashimoto, Shozo

1986-01-01

Recently Cf-252 sources containing 300 μg have become available in a size identical to 1 Ci of Cs-137 and with the use of remotely controlled afterloading apparatus, safe therapy with little exposure to the therapist is now possible. Radiation leakage from the Cf-252 apparatus and from the treatment room was measured with REM-meter and it was possible to reduce the leakage from the treatment room to less than 1 mrem/h (gamma rays) and 0.5 mrem/h (neutrons). Measurement of fast neutrons was made with a twin chamber composed of a tissue equivalent ionization chamber and a carbon ionization chamber. The neutron dose in air and the absorbed dose in tissue equivalent water tank were measured, which showed that in air, neutrons were 70% and photons were 30% of dose. In water, greater distances from the source, neutrons attenuate and gamma rays increase in dose. The results of studies on the skin reaction of mice and sperm cleavage delay time of sea urchins indicated that the RBE ranges from 1.5 to 3.0 using the high dose rate system. Neutrons are remarkably affected by a time factor. With the use of high dose rate sources, the dose rate has become higher, but the overall time has been extended through dose fractionation and it was considered advisable to employ an RBE of 3-4 in these studies. (Auth.)

A 252Cf based nondestructive assay system for fissile material

International Nuclear Information System (INIS)

Menlove, H.O.; Crane, T.W.

1978-01-01

A modulated 252 Cf source assay system 'Shuffler' based on fast-or-thermal-neutron interrogation combined with delayed-neutron counting has been developed for the assay of fissile material. The 252 Cf neutron source is repetitively transferred from the interrogation position to a shielded position while the delayed neutrons are counted in a high efficiency 3 He neutron well-counter. For samples containing plutonium, this well-counter is also used in the passive coincidence mode to assay the effective 240 Pu content. The design of an optimized neutron tailoring assembly for fast-neutron interrogation using a Monte Carlo Neutron Computer Code is described. The Shuffler system has been applied to the assay of fuel pellets, inventory samples, irradiated fuel and plutonium mixed-oxide fuel. The system can assay samples with fissile contents from a few milligrams up to several kilograms using thermal-neutron interrogation for the low mass samples and fast-neutron interrogation for the high mass samples. Samples containing 235 U- 238 U, or 233 U-Th, or UO 2 -PuO 2 fuel mixtures have been assayed with the Shuffler system. (Auth.)

Validation of IRDFF in 252Cf Standard and IRDF-2002 Reference Neutron Fields

Directory of Open Access Journals (Sweden)

Simakov Stanislav

2016-01-01

Full Text Available The results of validation of the latest release of International Reactor Dosimetry and Fusion File, IRDFF-1.03, in the standard 252Cf(s.f. and reference 235U(nth,f neutron benchmark fields are presented. The spectrum-averaged cross sections were shown to confirm IRDFF-1.03 in the 252Cf standard spontaneous fission spectrum; that was not the case for the current recommended spectra for 235U(nth,f. IRDFF was also validated in the spectra of the research reactor facilities ISNF, Sigma-Sigma and YAYOI, which are available in the IRDF-2002 collection. The ISNF facility was re-simulated to remove unphysical oscillations in the spectrum. IRDFF-1.03 was shown to reproduce reasonably well the spectrum-averaged data measured in these fields except for the case of YAYOI.

Prompt neutron energy spectrum for the spontaneous fission of Cf-252

International Nuclear Information System (INIS)

Blinov, M.V.; Boykov, G.S.; Vitenko, V.A.

1985-06-01

The prompt neutron spectrum for the spontaneous fission of Cf-252 has been measured in 0.01-10 MeV region by the time-of-flight technique using a fast ionization chamber with U-235 layers as the neutron detector. Numerical data for the spectrum are presented, with an error file. (author)

48 CFR 252.227-7037 - Validation of restrictive markings on technical data.

Science.gov (United States)

2010-10-01

.... However, this clause neither creates nor implies privity of contract between the Government and... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.227-7037 Validation of restrictive markings on... following clause: Validation of Restrictive Markings on Technical Data (SEP 1999) (a) Definitions. The terms...

Approaches for the generation of a covariance matrix for the Cf-252 fission-neutron spectrum

International Nuclear Information System (INIS)

Mannhart, W.

1983-01-01

After a brief retrospective glance is cast at the situation, the evaluation of the Cf-252 neutron spectrum with a complete covariance matrix based on the results of integral experiments is proposed. The different steps already taken in such an evaluation and work in progress are reviewed. It is shown that special attention should be given to the normalization of the neutron spectrum which must be reflected in the covariance matrix. The result of the least-squares adjustment procedure applied can easily be combined with the results of direct spectrum measurements and should be regarded as the first step in a new evaluation of the Cf-252 fission-neutron spectrum. (author)

Californium interrogation prompt neutron (CIPN) instrument for non-destructive assay of spent nuclear fuel—Design concept and experimental demonstration

International Nuclear Information System (INIS)

Henzlova, D.; Menlove, H.O.; Rael, C.D.; Trellue, H.R.; Tobin, S.J.; Park, Se-Hwan; Oh, Jong-Myeong; Lee, Seung-Kyu; Ahn, Seong-Kyu; Kwon, In-Chan; Kim, Ho-Dong

2016-01-01

This paper presents results of the first experimental demonstration of the Californium Interrogation Prompt Neutron (CIPN) instrument developed within a multi-year effort launched by the Next Generation Safeguards Initiative Spent Fuel Project of the United States Department of Energy. The goals of this project focused on developing viable non-destructive assay techniques with capabilities to improve an independent verification of spent fuel assembly characteristics. For this purpose, the CIPN instrument combines active and passive neutron interrogation, along with passive gamma-ray measurements, to provide three independent observables. This paper describes the initial feasibility demonstration of the CIPN instrument, which involved measurements of four pressurized-water-reactor spent fuel assemblies with different levels of burnup and two initial enrichments. The measurements were performed at the Post-Irradiation Examination Facility at the Korea Atomic Energy Institute in the Republic of Korea. The key aim of the demonstration was to evaluate CIPN instrument performance under realistic deployment conditions, with the focus on a detailed assessment of systematic uncertainties that are best evaluated experimentally. The measurements revealed good positioning reproducibility, as well as a high degree of insensitivity of the CIPN instrument's response to irregularities in a radial burnup profile. Systematic uncertainty of individual CIPN instrument signals due to assembly rotation was found to be <4.5%, even for assemblies with fairly extreme gradients in the radial burnup profile. These features suggest that the CIPN instrument is capable of providing a good representation of assembly average characteristics, independent of assembly orientation in the instrument.

Californium interrogation prompt neutron (CIPN) instrument for non-destructive assay of spent nuclear fuel—Design concept and experimental demonstration

Energy Technology Data Exchange (ETDEWEB)

Henzlova, D., E-mail: henzlova@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Menlove, H.O.; Rael, C.D.; Trellue, H.R.; Tobin, S.J. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Park, Se-Hwan; Oh, Jong-Myeong; Lee, Seung-Kyu; Ahn, Seong-Kyu; Kwon, In-Chan; Kim, Ho-Dong [Korea Atomic Energy Research Institute, Daejeong (Korea, Republic of)

2016-01-11

This paper presents results of the first experimental demonstration of the Californium Interrogation Prompt Neutron (CIPN) instrument developed within a multi-year effort launched by the Next Generation Safeguards Initiative Spent Fuel Project of the United States Department of Energy. The goals of this project focused on developing viable non-destructive assay techniques with capabilities to improve an independent verification of spent fuel assembly characteristics. For this purpose, the CIPN instrument combines active and passive neutron interrogation, along with passive gamma-ray measurements, to provide three independent observables. This paper describes the initial feasibility demonstration of the CIPN instrument, which involved measurements of four pressurized-water-reactor spent fuel assemblies with different levels of burnup and two initial enrichments. The measurements were performed at the Post-Irradiation Examination Facility at the Korea Atomic Energy Institute in the Republic of Korea. The key aim of the demonstration was to evaluate CIPN instrument performance under realistic deployment conditions, with the focus on a detailed assessment of systematic uncertainties that are best evaluated experimentally. The measurements revealed good positioning reproducibility, as well as a high degree of insensitivity of the CIPN instrument's response to irregularities in a radial burnup profile. Systematic uncertainty of individual CIPN instrument signals due to assembly rotation was found to be <4.5%, even for assemblies with fairly extreme gradients in the radial burnup profile. These features suggest that the CIPN instrument is capable of providing a good representation of assembly average characteristics, independent of assembly orientation in the instrument.

Fast neutron therapy with high intensity Cf-252 sources by remotely controlled afterloading and clinical experiences in the treatment of gynaecological cancers

International Nuclear Information System (INIS)

Yamashita, H.; Hashimoto, S.; Wada, M.; Dokiya, T.

1986-01-01

Cf-252 fast neutron therapy with high intensity Cf-252 sources was tested for the treatment of advanced gynaecological cancers using a remotely controlled afterloading machine designed by the author and manufactured by Toshiba. Using high intensity sources and short treatment times in a special treatment room, personnel or environment exposure to radiation was at a safe level, i.e. almost nil. During 1978-1983 18 stage III cases of cancer of the uterine cervix were treated with complete response in 78% and 44% 5 year survivals. The types of acute and delayed effects of Cf-252 were the same as Co-60 or Cs-137 but the rectum was found sensitive in this system of brachytherapy. A dose of 1,000-1,500 cGy/6-10 F in 10-22 days of Cf-252 radiation was tolerated and produced tumor cure

48 CFR 252.219-7003 - Small business subcontracting plan (DoD contracts).

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Small business... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.219-7003 Small business subcontracting plan (DoD contracts). As prescribed in 219.708(b)(1)(A), use the following clause: Small Business...

Utilization of radiation facilities at TNRC for shielding researches and related topics

Energy Technology Data Exchange (ETDEWEB)

Akki, T S [Physics Department, Nuclear Physics and Radiation Shielding Division Tajura Nuclear Research Center, Tripoli (Libyan Arab Jamahiriya)

1997-12-31

This paper presents the running shielding research activities at Tajura Nuclear research center. The main area of researches are concentrated on the investigation of different types of concrete made from local materials such as conventional concrete, Magnetite-Limonite concrete, and heat resistant concrete. The measuring techniques used were neutron-gamma spectrometry, and activation foils. The measurements were performed using collimated beam of reactor neutrons emitted from one of the horizontal channels, as well as from californium-252 neutron source. The transmitted neutron spectra through concrete barriers of different thicknesses were measured by a scintillation spectrometer with NE-213 liquid organic scintillator. A non-destructive testing of some reactor materials were also carried out using neutron and gamma ray computerized tomography technique (CT). Some experiments were also carried out related to measurements of neutron depth dose distributions inside tissue equivalent materials. 10 figs.

Development of neutron induced prompt γ-ray spectroscopy system using 252Cf

International Nuclear Information System (INIS)

Park, Yong-Joon; Song, Byung-Chul; Jee, Kwang-Yong

2003-01-01

For the design and set-up of neutron induced prompt γ-ray spectroscopy system using 252 Cf neutron source, the effects of shielding and moderator materials have been examined. The 252 Cf source being used for TLD badge calibration in Korea Atomic Energy Research Institute was utilized for this preliminary experiment. The γ-ray background and prompt γ-ray spectrum of the sample containing Cl were measured using HPGe (GMX 69% relative efficiency) located at the inside of the system connected to notebook PC at the outside of the system (about 20 meter distance). The background activities of neutron and γ-rays were measured with neutron survey meter as well as γ-ray survey meters, respectively and the system was designed to minimize the activities. Prompt γ-ray spectrum was measured using γ-γ coincident system for reduce the background and the continuum spectrum. The optimum system was designed and set up using the experimental data obtained

Determining {sup 252}Cf source strength by absolute passive neutron correlation counting

Energy Technology Data Exchange (ETDEWEB)

Croft, S. [Oak Ridge National Laboratory, Oak Ridge, TN 37831-6166 (United States); Henzlova, D., E-mail: henzlova@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

2013-06-21

Physically small, lightly encapsulated, radionuclide sources containing {sup 252}Cf are widely used for a vast variety of industrial, medical, educational and research applications requiring a convenient source of neutrons. For many quantitative applications, such as detector efficiency calibrations, the absolute strength of the neutron emission is needed. In this work we show how, by using a neutron multiplicity counter the neutron emission rate can be obtained with high accuracy. This provides an independent and alternative way to create reference sources in-house for laboratories such as ours engaged in international safeguards metrology. The method makes use of the unique and well known properties of the {sup 252}Cf spontaneous fission system and applies advanced neutron correlation counting methods. We lay out the foundation of the method and demonstrate it experimentally. We show that accuracy comparable to the best methods currently used by national bodies to certify neutron source strengths is possible.

Simultaneous investigation of fission fragments and neutrons in 252Cf(s,f)

International Nuclear Information System (INIS)

Budtz-Joergensen, C.; Knitter, H.H.

1986-01-01

The gridded twin ion chamber developed at CBNM is used to measure the kinetic energy-, mass- and angular distributions of the fission fragments of 252 Cf in an advantageous 4π-geometry. Together with a neutron time-of-flight detector this experimental arrangement permits to measure the correlation between neutron emission, fragment angle, mass and energy in the spontaneous fission of 252 Cf. With the present experimental set-up a mass resolution for fission fragments of 0.5 a.m.u., an angular resolution of Δcosθ = 0.05 and a timing resolution of 0.7 ns FWHM were observed. Preliminary evaluations of the raw experimental data are presented for the fission fragment mass distribution, the average total kinetic energy and their variance as function of mass, the angular distribution between fragments and neutrons, the number of neutrons emitted per fragment as function of fragment mass, the average neutron emission energies as function of mass, and the prompt fission neutron spectrum averaged over all fragments. (author)

Brachytherapy of carcinoma of vulva with 252Cf

International Nuclear Information System (INIS)

Spikalovas, V.; Sinkevicius, V.; Drulia, E.; Kurtinaitis, J.

1996-01-01

Thirty patients with carcinoma of vulva were treated with interstitial neutron radiotherapy with 252 Cf. Age of patients was from 32 to 83 years. Stage I was in I patient, stage II - in 12, stage III was in 10 patients. The diagnosis of vulvar cancer was made for the first time in 11 cases, 19 patients had recurrences after the initial treatment. Most of these patients also received external irradiation for cancer of vulva and bilateral inguinal sites with a single fraction dose of 2 Gy to a total dose 30-50 Gy. Enlarged inguinal lymph nodes were irradiated additionally to 60 Gy with reduced field of irradiation. When radiotherapy was used repeatedly interstitial brachytherapy comprised the major part of irradiation dose or the therapy was used alone delivering 35-55 iGy. We used 252 Cf sources with increased activity at the ends 20-30 mm long. A number of inserted sources varied from 2 to 10, irradiation dose rate from 20.3 to 236.7 cGy/h, time of irradiation from 10.2 to 12. hours, RBE from 4.6 to 6.33. Special template device made it possible to implant sources in strictly pre-set geometry. Analysis of survival of patients showed that 2 years survival was 66%, 3 years - 60%, and 5 years survival was 49%. In two cases necrotic epithelitis developed with following radiation ulcer which were cured in 3-4 months. Clinical data showed great effectiveness of interstitial neutron therapy having in mind that 19 patients were treated for recurrences of vulvar cancer after previuos treatment

{sup 5}He ternary fission yields of {sup 252}Cf and {sup 235}U(n,f)

Energy Technology Data Exchange (ETDEWEB)

Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Ramayya, A. V. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Hamilton, J. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Beyer, C. J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Kormicki, J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Zhang, X. Q. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Rodin, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Formichev, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Kliman, J. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Krupa, L. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation)] (and others)

2000-04-01

The relative {sup 4}He and {sup 5}He ternary fission yields were determined from a careful analysis of the energy distribution of {alpha} spectra from a new measurement with a {sup 252}Cf source and from published data on {sup 252}Cf and {sup 235}U(n,f). The kinetic energies of the {sup 5}He and {sup 4}He ternary particles were found to be approximately 11 and 16 MeV, respectively. {sup 5}He particles contribute 10-20 % to the total alpha yield with the remainder originating from {sup 4}He accompanied fission. (c) 2000 The American Physical Society.

The fast neutron emission spectrum of 252-Cf

International Nuclear Information System (INIS)

Bensch, F.

1979-07-01

The aim of this work was a new measurement of the neutron emission spectrum of 252-Cf neutron standard sources as the IAEA is offering to users. The main feature was the application of gas-filled proton-recoil spectrometers and no TOF technique. The special interest of this document was in the temperature parameter of the Maxwellian distribution and in its relative deviations. In this connection, special measurements with high energy resolution were carried out in a search for fine structure neutron groups, which have been observed in some TOF measurements, but could not be reproduced during this measurement

Dosimetric evaluation of 252Cf beam for use in radiobiology studies at Hiroshima University

International Nuclear Information System (INIS)

Hoshi, M.; Takeoka, S.; Tsujimura, T.; Kuroda, T.; Kawami, M.; Sawada, S.

1988-01-01

This report provides reliable tissue kerma in free air data by characterising the 252 Cf irradiating system and by comparing three dosimetry methods, paired chambers (ICRU 1977, 1978), Fricke and thermoluminescence dosemeter. (author)

Crystal structure of the tyrosine kinase domain of the hepatocyte growth factor receptor c-Met and its complex with the microbial alkaloid K-252a.

Science.gov (United States)

Schiering, Nikolaus; Knapp, Stefan; Marconi, Marina; Flocco, Maria M; Cui, Jean; Perego, Rita; Rusconi, Luisa; Cristiani, Cinzia

2003-10-28

The protooncogene c-met codes for the hepatocyte growth factor receptor tyrosine kinase. Binding of its ligand, hepatocyte growth factor/scatter factor, stimulates receptor autophosphorylation, which leads to pleiotropic downstream signaling events in epithelial cells, including cell growth, motility, and invasion. These events are mediated by interaction of cytoplasmic effectors, generally through Src homology 2 (SH2) domains, with two phosphotyrosine-containing sequence motifs in the unique C-terminal tail of c-Met (supersite). There is a strong link between aberrant c-Met activity and oncogenesis, which makes this kinase an important cancer drug target. The furanosylated indolocarbazole K-252a belongs to a family of microbial alkaloids that also includes staurosporine. It was recently shown to be a potent inhibitor of c-Met. Here we report the crystal structures of an unphosphorylated c-Met kinase domain harboring a human cancer mutation and its complex with K-252a at 1.8-A resolution. The structure follows the well established architecture of protein kinases. It adopts a unique, inhibitory conformation of the activation loop, a catalytically noncompetent orientation of helix alphaC, and reveals the complete C-terminal docking site. The first SH2-binding motif (1349YVHV) adopts an extended conformation, whereas the second motif (1356YVNV), a binding site for Grb2-SH2, folds as a type II Beta-turn. The intermediate portion of the supersite (1353NATY) assumes a type I Beta-turn conformation as in an Shc-phosphotyrosine binding domain peptide complex. K-252a is bound in the adenosine pocket with an analogous binding mode to those observed in previously reported structures of protein kinases in complex with staurosporine.

47 CFR 51.807 - Arbitration and mediation of agreements by the Commission pursuant to section 252(e)(5) of the Act.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 3 2010-10-01 2010-10-01 false Arbitration and mediation of agreements by the Commission pursuant to section 252(e)(5) of the Act. 51.807 Section 51.807 Telecommunication FEDERAL... Implementation of Section 252 of the Act § 51.807 Arbitration and mediation of agreements by the Commission...

Optimization of in situ prompt gamma-ray analysis using a HPGe-252Cf probe

International Nuclear Information System (INIS)

Chien Chung; Jiunnhsing Chao

1991-01-01

Application of in situ measurements by the neutron-induced prompt gamma-ray activation analysis (PGAA) technique to geochemical analysis and mineral survey have been investigated. An in situ survey of water pollutants by PGAA techniques was first proposed in the authors' previous study, where a 2.7-μg 252 Cf neutron source used in connection with a gamma-ray detecting system to determine water pollutants was described. In this paper the authors describe a modified detection probe designed and constructed to look for the optimum conditions of various-intensity 252 Cf neutron sources in measurement of some elements in lake water. Detecting efficiencies at high-energy regions and detection limits for elements commonly found in polluted lakes were evaluated and predicted to investigate the potential application of the probe for in situ measurements

Power spectral density measurements with 252Cf for a light water moderated research reactor

International Nuclear Information System (INIS)

King, W.T.; Mihalczo, J.T.

1979-01-01

A method of determining the reactivity of far subcritical systems from neutron noise power spectral density measurements with 252 Cf has previously been tested in fast reactor critical assemblies: a mockup of the Fast Flux Test Facility reactor and a uranium metal sphere. Calculations indicated that this measurement was feasible for a pressurized water reactor (PWR). In order to evaluate the ability to perform these measurements with moderated reactors which have long prompt neutron lifetimes, measurements were performed with a small plate-type research reactor whose neutron lifetime (57 microseconds) was about a factor of three longer than that of a PWR and approx. 50% longer than that of a boiling water reactor. The results of the first measurements of power spectral densities with 252 Cf for a water moderated reactor are presented

Study of biological effects of varying mixtures of Cf-252 and gamma radiation on the acute radiation syndromes: Relevance to clinical radiotherapy of radioresistant cancer

International Nuclear Information System (INIS)

Maruyama, Y.; Wierzbicki, J.; Feola, J.M.

1993-01-01

Data for the 30 day bone marrow syndrome (BM-50) and the 6-10 day gastrointestinal (GI-50) syndrome for a one and two fraction schedule and acute and low dose rate irradiation using pure and mixed Cf-252 and photon radiation are presented. The radiation of Cf-252 is a mixture of neutrons and gamma rays. Balb/c mice of both sexes were total body irradiated with acute Co-60, low dose rate Cs-137 and Cf-252 using a 1 x and 2 x schedule. For low linear energy transfer radiations of Co-60 or Cs-137 there was expected to be an increase in the dose to produce the gastrointestinal and bone marrow syndromes with minimal change for Cf-252 neutrons. The proportion of photons in the Cf-252 radiation field were further altered by mixing Cs-137 with the Cf-252 sources and mice were total body irradiated with different proportions of photons to determine the effect on the radiation syndromes. The effects of mixing Cf-252 neutrons with different proportions of photons on the syndromes was determined. There was increase in BM-50 and GI-50 doses with fractionated or low dose rate photon irradiations and the dose modifying factors were 1.3-1.4 for the GI syndrome and 1.2 for the bone marrow syndrome. For Cf-252 there was minimal fractionation effect for the GI-50 syndrome, which increased by 1.1 for x 1 vs. x 2 fractions; for the BM-50 syndrome it rose by a 1.1 factor. For LDR Cs-137 the dose for the GI-50 syndrome rose 2.2-fold. For mixed neutron-photon radiation of 0%, 15%, 35%, and 65% η/γ mixtures, the dose to produce the BM-50 and GI-50 endpoints dropped sharply from 0 to 35% neutrons and remained flat thereafter. For major tissues such as the bone marrow and GI tract, Cf-252 behaved as high linear energy transfer for mixtures of neutrons and gamma rays when the radiations were delivered simultaneously at the low dose rates studied. 35 refs., 3 figs., 2 tabs

Group Representation of the Prompt Fission Neutron Spectrum of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Croft, S.; Miller, K. A. [Safeguards Science and Technology Group (N-1), Nuclear Nonproliferation Division, Los Alamos National Laboratory, Los Alamos(United States)

2011-12-15

We review the spectral representation used for the prompt fission neutron spectrum of 252Cf in the International Organization for Standardization document ISO 8529-1. We find corrections to Table A.2, the discrete group structure form, of this report are needed. We describe the approach to generating replacement values and provide a new tabulation.

48 CFR 252.225-7022 - Trade agreements certificate-inclusion of Iraqi end products.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade agreements... PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.225-7022 Trade agreements certificate—inclusion of Iraqi end products. As prescribed in 225.1101(7), use the following provision: Trade Agreements...

Relative biological effectiveness (R.B.E.) of Cf-252 vs. acute Co-60 and low dose rate Cs-137 irradiation by spleen weight loss

International Nuclear Information System (INIS)

Maruyama, Y.; Feola, J.M.; Magura, C.; Beach, J.L.

1986-01-01

R.B.E. of Cf-252 on lymphoid tissue was assessed by radiation study of spleen weight loss following acute Co-60, and low dose rate (L.D.R.) Cs-137 and Cf-252 irradiations. Acute Co-60 and L.D.R. Cs-137 dose-response followed two component exponential curves with a 1.3-fold greater effect of L.D.R. Cs-137 vs. acute Co-60 on the first slope and 1.9-fold greater effect for the 2nd slope. L.D.R. Cf-252 response was 1.3 x greater than acute Co-60 but was 1.0 vs. L.D.R. Cs-137 for the first slope indicating a similar effect of Cf-252 mixed neutron/gamma radiation to L.D.R. gamma radiation in producing spleen shrinkage. There was no effect of different sequences and schedules of mixing acute Co-60 with Cf-252 irradiation observed by endogenous CFU-S survival. The R.B.E. of 1.0 - 1.9 indicates that lymphohemopoietic in vivo, presumably well oxygenated, does not respond acutely or as sensitively as hypoxic tumor where R.B.E. is 5 - 7. (author)

Dispersions and correlations of the distributions of products of 252Cf spontaneous fission

International Nuclear Information System (INIS)

Vidyakin, G.S.; Vyrodov, V.N.; Gurevich, I.I.; Kirillov, B.F.; Kozlov, Y.V.; Martem'yanov, V.P.; Sukhotin, S.V.; Tarasenkov, V.G.; Khakimov, S.K.

1982-01-01

We report the results of two experiments on study of the dispersions and correlations of the distributions of products of the spontaneous fission of 252 Cf. In each experiment about 10 8 fissions were recorded with simultaneous measurement of the number of neutrons produced and in one case the fragment kinetic energy and in the other case the energy of the prompt #betta# rays. The quantities obtained were the probabilities of production of a given number of neutrons per fission, the dispersions of the distributions of the number of neutrons produced and of the fragment kinetic energy, and the dependence of the average #betta#-ray energy and the average fragment kinetic energy on the number of neutrons produced. A calculation is made of the spectrum of the total energy carried away by fragments and neutrons, and its dispersion is determined. An estimate of the total energy release in the 252 Cf fission process is made

An evaluation of the spontaneous fission prompt neutron spectrum of 252Cf

International Nuclear Information System (INIS)

Bojkov, G.S.; Yurevich, V.I.

1987-01-01

An evaluation of the spontaneous fission prompt neutron spectrum of 252 Cf from 1 keV to 20 MeV is described. Variance-covariance matrices for a number of recent experimental data sets were constructed and used to evaluate the neutron spectrum following a Bayesian procedure. The evaluated spectrum is compared with various experimental and theoretical representations. (author)

48 CFR 252.222-7004 - Compliance with Spanish social security laws and regulations.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Compliance with Spanish... PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.222-7004 Compliance with Spanish social... Spanish Social Security Laws and Regulations (JUN 1997) (a) The Contractor shall comply with all Spanish...

Ground Target Modeling and Validation Conference (10th) Held in Houghton, Michigan, on 17-19 August 1999

Science.gov (United States)

1999-08-01

photoreceptor cells respond to iight,@ Sc. Am., 256 (4): 40-47 (1987). 252 A Model to Evaluate the Decision-Making Process in a Target Acquisition Task Masha ...PO BOX 5 FILTON BRISTOL BS34 7QW UK GILMORE, MARILYN DERA ROOM G007, BUILDING A2 FARNBOROUGH HAMPSHIRE GU14 0LX UK MALTZ, MASHA BEN-GURION

Validating criticality calculations for spent fuel with 252Cf-source-driven noise measurements

International Nuclear Information System (INIS)

Mihalczo, J.T.; Krass, A.W.; Valentine, T.E.

1992-01-01

The 252 Cf-Source-driven noise analysis method can be used for measuring the subcritical neutron multiplication factor k of arrays of spent light water reactor (LWR) fuel. This type of measurement provides a parameter that is directly related to the criticality state of arrays of LWR fuel. Measurements of this parameter can verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. The practicality of a measurement depends on the ability to install the hardware required to perform the measurement. Source chambers containing the 252 Cf at the required source intensity for this application have been constructed and have operated successfully for ∼10 years and can be fabricated to fit into control rod guide tubes of PWR fuel elements. Fission counters especially developed for spent-fuel measurements are available that would allow measurements of a special 3 x 3 spent fuel array and a typical burnup credit rail cask with spent fuel in unborated water. Adding a moderator around these fission counters would allow measurements with the typical burnup credit rail cask with borated water and the special 3 x 3 array with borated water. The recent work of Ficaro on modifying the KENO Va code to calculate by the Monte Carlo method the time sequences of pulses at two detectors near a fissile assembly from the fission chain multiplication process, initiated by a 252 Cf source in the assembly allows a direct computer calculation of the noise analysis data from this measurement method

Dosimetric analysis of BNCT - Boron Neutron Capture Therapy - coupled to 252Cf brachytherapy

International Nuclear Information System (INIS)

Brandao, Samia F.; Campos, Tarcisio P.R.

2009-01-01

The incidence of brain tumors is increasing in world population; however, the treatments employed in this type of tumor have a high rate of failure and in some cases have been considered palliative, depending on histology and staging of tumor. Its necessary to achieve the control tumor dose without the spread irradiation cause damage in the brain, affecting patient neurological function. Stereotactic radiosurgery is a technique that achieves this; nevertheless, other techniques that can be used on the brain tumor control must be developed, in order to guarantee lower dose on health surroundings tissues other techniques must be developing. The 252 Cf brachytherapy applied to brain tumors has already been suggested, showing promising results in comparison to photon source, since the active source is placed into the tumor, providing greater dose deposition, while more distant regions are spared. BNCT - Boron Neutron Capture Therapy - is another technique that is in developing to brain tumors control, showing theoretical superiority on the rules of conventional treatments, due to a selective irradiation of neoplasics cells, after the patient receives a borate compound infusion and be subjected to a epithermal neutrons beam. This work presents dosimetric studies of the coupling techniques: BNCT with 252 Cf brachytherapy, conducted through computer simulation in MCNP5 code, using a precise and well discretized voxel model of human head, which was incorporated a representative Glioblastoma Multiform tumor. The dosimetric results from MCNP5 code were exported to SISCODES program, which generated isodose curves representing absorbed dose rate in the brain. Isodose curves, neutron fluency, and dose components from BNCT and 252 Cf brachytherapy are presented in this paper. (author)

Correlation studies of neutron multiplicities in the 252Cf spontaneous fission

International Nuclear Information System (INIS)

Alkhazov, I.D.; Dmitriev, V.D.; Kovalenko, S.S.; Kuznetsov, A.V.; Malkin, L.Z.; Petrzhak, K.A.; Petrov, B.F.; Shpakov, V.I.

1988-01-01

Correlations between the numbers of neutrons emitted by the 252 Cf spontaneous fission fragments have been studied as a function of the fragment mass and total kinetic energy. Behaviour of the neutron number dispersions and covariances was studied for the region of symmetric fission. Parameters of the complementary fragment excitation energy distribution (mean values, dispersions, covariances) were determined. Various factors describing correlations between the complementary fragment excitation energies are considered

Mass spectrometry with ionization induced by 252Cf fission fragments

International Nuclear Information System (INIS)

Sysoev, A.A.; Artaev, V.B.

1991-01-01

The review deals with mass-spectrometry with ionization induced by 252 Cf fission fragments. Equipment and technique of the analysis, analytic possibilities of the method are considered. The method permits to determine molecular masses of large nonvolatile biological molecules. The method is practically nondestructive, it possesses a high resolution over the depth and surface, which permits to use it for the analysis of surface of semiconductors, dielectrics, catalysts, for the study of formation kinetics of complex unstable molecules on the surface

Operation manual for the INEL on-line mass-separator facility

International Nuclear Information System (INIS)

Anderl, R.A.

1984-06-01

This report is an operation manual for an on-line mass-separator facility which is located in Building 661 at the Test Reactor Area of the Idaho National Engineering Laboratory. The facility provides mass-separated sources of short-lived fission-product radionuclides whose decay properties can be studied using a variety of nuclear spectroscopic techniques. This facility is unique in that it utilizes the gas-jet technique to transport fission products from a 252 Cf source located in a hot cell to the ion source of the mass separator. This document includes the following: (a) a detailed description of the facility, (b) identification of equipment hazards and safety controls, (c) detailed operating procedures for startup, continuous operation and shutdown, (d) operating procedures for the californium hot cell, and (e) an operator's manual for the automated moving tape collector/data acquisition system. 7 references, 16 figures, 8 tables

Analysis of linear energy transfers and quality factors of charged particles produced by spontaneous fission neutrons from 252Cf and 244Pu in the human body

International Nuclear Information System (INIS)

Endo, A.; Sato, T.

2013-01-01

Absorbed doses, linear energy transfers (LETs) and quality factors of secondary charged particles in organs and tissues, generated via the interactions of the spontaneous fission neutrons from. 252 Cf and. 244 Pu within the human body, were studied using the Particle and Heavy Ion Transport Code System (PHITS) coupled with the ICRP Reference Phantom. Both the absorbed doses and the quality factors in target organs generally decrease with increasing distance from the source organ. The analysis of LET distributions of secondary charged particles led to the identification of the relationship between LET spectra and target-source organ locations. A comparison between human body-averaged mean quality factors and fluence-averaged radiation weighting factors showed that the current numerical conventions for the radiation weighting factors of neutrons, updated in ICRP103, and the quality factors for internal exposure are valid. (authors)

48 CFR 252.229-7011 - Reporting of Foreign Taxes-U.S. Assistance Programs.

Science.gov (United States)

2010-10-01

... all value added taxes and customs duties imposed by the recipient country. This exemption is in... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reporting of Foreign Taxes... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.229-7011 Reporting of Foreign Taxes—U.S...

In situ prompt gamma-ray activation analysis of water pollutants using a shallow 252Cf-HPGe probe

International Nuclear Information System (INIS)

Chung Chien; Tseng Tzucheng

1988-01-01

A shallow 252 Cf-HPGe probe used for in situ prompt γ-ray activation of water pollutants is described. A 2.7 μg 252 Cf neutron source and a 10% HPGe detector are inserted into a waterproof stainless steel probe, which is designed to be submerged and recovered in field operation. A laboratory test is performed to obtain the neutron flux distribution and prompt γ-ray contribution to the HPGe detector counts from around the submerged probe. The concentrations of toxic cadmium and chlorine in water are determined in the prompt γ-ray spectrum. The detection limit of industrial pollutants and some improvements of the current design are discussed. (orig.)

A Phase I/II Protocol Using 252Cf for the Treatment of Cervical Carcinoma

International Nuclear Information System (INIS)

Anita Mahajan; Mark J. Rivard; Evelyn R. Nunez; David E. Wazer

2000-01-01

For this clinical study, external photon beam irradiation will be given in a standard fashion with intravenous cisplatinum (CDDP) every week as a radiosensitizing agent. We will incorporate 252 Cf as the brachytherapy source replacing 192 Ir, theoretically improving patient outcomes with its lack of cell cycle and oxygen dependence, and a therapeutic ratio possibly greater than unity. Local tumor control and control of systemic disease are potentially feasible using 252 Cf to initially debulk and destroy local bulky tumor with CDDP and X rays to enhance treatment efficacy and treat minimal microscopic and distant micrometastases. The initial 22 Cf dose will be 1 Gy per weekly fraction with 0.25-Gy increments toward a 2.5-Gy limit. Patients will be stratified according to their stage, toxicities and outcomes will be monitored closely, and the study will be halted if undo morbidities are noted

Thermocoagulation of lumbar facet joints: Experience in 252 patients

OpenAIRE

Martínez-Suárez, J. E.; Camblor, L.; Salva, S.; Jongh, W. A. de

2005-01-01

Se presentan 252 pacientes con el diagnóstico de dolor lumbar facetario a los que se le realizó la técnica quirúrgica de termocoagulación percutánea de la faceta articular. Nuestro propósito principal fue aliviar el dolor en estos pacientes, evaluamos la eficacia de la técnica con un 74,7% de resultados quirúrgicos satisfactorios, así como la descripción de diferentes aspectos como: edad, sexo, causas y la topografía segmentaria del dolor. Two hundred fifty two patients with diagnosis of l...

Neutron dose rate for {sup 252} Cf AT source in medical applications

Energy Technology Data Exchange (ETDEWEB)

Paredes, L.; Balcazar, M. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Azorin, J. [UAM-I, 09340 Mexico D.F. (Mexico); Francois, J.L. [FI-UNAM, 04510 Mexico D.F. (Mexico)

2006-07-01

The AAPM TG-43 modified protocol was used for the calculation of the neutron dose rate of {sup 252}Cf sources for two tissue substitute materials, five normal tissues and six tumours. The {sup 252}Cf AT source model was simulated using the Monte Carlo MCNPX code in spherical geometry for the following factors: a) neutron air kerma strength conversion factor, b) dose rate constant, c) radial dose function, d) geometry factor, e) anisotropy function and f) neutron dose rate. The calculated dose rate in water at 1 cm and 90 degrees from the source long axis, using the Watt fission spectrum, was D{sub n}(r{sub 0}, {theta}{sub 0})= 1.9160 cGy/h-{mu}g. When this value is compared with Rivard et al. calculation using MCNP4B code, 1.8730 cGy/h-{mu}g, a difference of 2.30% is obtained. The results for the reference neutron dose rate in other media show how small variations in the elemental composition between the tissues and malignant tumours, produce variations in the neutron dose rate up to 12.25%. (Author)

Correlated spins of complementary fragment pairs in the spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Smith, A. G.; Simpson, G. S.; Billowes, J.; Dagnall, P. J.; Durell, J. L.; Freeman, S. J.; Leddy, M.; Phillips, W. R.; Roach, A. A.; Smith, J. F.

1999-01-01

A study of the γ-ray decay of low-lying excited states in fragments produced in the spontaneous fission of 252 Cf has revealed a significant correlation between the angles of emission of the 2 1 + →0 1 + transitions of complementary fragment pairs. Calculations of the amount of dealignment that is needed to reproduce the measured a 2 values, and a comparison with the results of previous fragment-γ angular distribution measurements, suggests that at scission there may be significant population of m≠0 substates associated with the projection of the fragment spin vector on the fission axis. Fragments from the spontaneous fission of 248 Cm emit 2 1 + →0 1 + γ rays that show markedly reduced interfragment correlations, suggesting that either a larger role is played by the relative angular momentum of the fragments, or that the dealignment introduced by the neutron emission and statistical γ decay to the 2 1 + state is larger in 248 Cm than 252 Cf fission. (c) 1999 The American Physical Society

252Cf-source-driven noise analysis measurements for characterization of concrete highly enriched uranium (HEU) storage vaults

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.

1993-01-01

The 252 Cf-source-driven noise analysis method has been used in measurements for subcritical configurations of fissile systems for a variety of applications. Measurements of 25 fissile systems have been performed with a wide variety of materials and configurations. This method has been applied to measurements for (1) initial fuel loading of reactors, (2) quality assurance of reactor fuel elements, (3) fuel preparation facilities, (4) fuel processing facilities, (5) fuel storage facilities, (6) zero-power testing of reactors, and (7) verification of calculational methods for assemblies with the neutron k 252 Cf source and commercially available detectors was feasible and to determine if the measurement could characterize the ability of the concrete to isolate the fissile material

Fresnel zone plate imaging of a 252Cf spontaneous fission source

International Nuclear Information System (INIS)

Stalker, K.T.; Hessel, K.R.

1976-11-01

The feasibility of coded aperture imaging for nuclear fuel motion monitoring is shown using Cf 252 spontaneous fission source. The theory of coded aperture imaging for Fresnel zone plate apertures is presented and design considerations for zone plate construction are discussed. Actual images are obtained which demonstrate a transverse resolution of 1.7 mm and a tomographic resolution of 1.5 millimeters. The capability of obtaining images through 12.7 mm of stainless steel is also shown

Oxidation-reduction properties of americium, curium, berkelium, californium, einsteinium and fermium, and thermodynamic consequences for the 5f series

International Nuclear Information System (INIS)

Samhoun, K.

1976-01-01

The amalgamation of 5f elements from Am to Fm has been studied by using 241 Am, 244 Cm, 249 Bk, 249 Cf, 252 Cf, 253 Es, 254 Es, 252 Fm and 255 Fm with two electrochemical methods, radiocoulometry and radiopolarography, perfectly adapted to investigate extremely diluted solutions when the concentration of electroactive species is as low as 10 -16 M. The theory of radiocoulometry has been developed in the general cases of reversible and irreversible electrode process. It has been used to interpret the experimental data on the kinetic curves of amalgamation, and to estimate the standard rate constant of the electrode process in complexing medium (citric). On the other hand the radiopolarographic method has been applied to study the mechanism of reduction at the dropping mercury electrode of cations M 3+ in aqueous medium to the metal M with formation of amalgam. The results are exploited into two directions: 1- Acquisition of some data concerning the oxidation-reduction properties of elements from Am to Fm. Therefore the standard electrode E 0 [M(III-0)] potentials for Bk, Cf and Es, and the standard electrode E 0 [M(II-0)] potential for Fm are estimated and the relative stability of each oxidation state (from II to VII) of 5f elements is discussed; 2- Acquisition of unknown thermodynamic data on transcalifornium elements. Correlations between 4f and 5f elements are precised and some divergences appear for the second half of 4f and 5f series (i.e. for 65 [fr

Comparison Of ²⁵²Cf Time Correlated Induced Fisssion With AmLi Induced Fission On Fresh MTR Research Reactor Fuel

Energy Technology Data Exchange (ETDEWEB)

Joshi, Jay Prakash [Los Alamos National Laboratory

2017-03-30

The effective application of international safeguards to research reactors requires verification of spent fuel as well as fresh fuel. To accomplish this goal various nondestructive and destructive assay techniques have been developed in the US and around the world. The Advanced Experimental Fuel Counter (AEFC) is a nondestructive assay (NDA) system developed at Los Alamos National Laboratory (LANL) combining both neutron and gamma measurement capabilities. Since spent fuel assemblies are stored in water, the system was designed to be watertight to facilitate underwater measurements by inspectors. The AEFC is comprised of six ³He detectors as well as a shielded and collimated ion chamber. The ³He detectors are used for active and passive neutron coincidence counting while the ion chamber is used for gross gamma counting. Active coincidence measurement data is used to measure residual fissile mass, whereas the passive coincidence measurement data along with passive gamma measurement can provide information about burnup, cooling time, and initial enrichment. In the past, most of the active interrogation systems along with the AEFC used an AmLi neutron interrogation source. Owing to the difficulty in obtaining an AmLi source, a ²⁵²Cf spontaneous fission (SF) source was used during a 2014 field trail in Uzbekistan as an alternative. In this study, experiments were performed to calibrate the AEFC instrument and compare use of the ²⁵²Cf spontaneous fission source and the AmLi (α,n) neutron emission source. The ²⁵²Cf source spontaneously emits bursts of time-correlated prompt fission neutrons that thermalize in the water and induce fission in the fuel assembly. The induced fission (IF) neutrons are also time correlated resulting in more correlated neutron detections inside the ³He detector, which helps reduce the statistical errors in doubles when using the ²⁵²Cf interrogation source instead of

Toward achieving flexible and high sensitivity hexagonal boron nitride neutron detectors

Science.gov (United States)

Maity, A.; Grenadier, S. J.; Li, J.; Lin, J. Y.; Jiang, H. X.

2017-07-01

Hexagonal boron nitride (h-BN) detectors have demonstrated the highest thermal neutron detection efficiency to date among solid-state neutron detectors at about 51%. We report here the realization of h-BN neutron detectors possessing one order of magnitude enhancement in the detection area but maintaining an equal level of detection efficiency of previous achievement. These 3 mm × 3 mm detectors were fabricated from 50 μm thick freestanding and flexible 10B enriched h-BN (h-10BN) films, grown by metal organic chemical vapor deposition followed by mechanical separation from sapphire substrates. Mobility-lifetime results suggested that holes are the majority carriers in unintentionally doped h-BN. The detectors were tested under thermal neutron irradiation from californium-252 (252Cf) moderated by a high density polyethylene moderator. A thermal neutron detection efficiency of ˜53% was achieved at a bias voltage of 200 V. Conforming to traditional solid-state detectors, the realization of h-BN epilayers with enhanced electrical transport properties is the key to enable scaling up the device sizes. More specifically, the present results revealed that achieving an electrical resistivity of greater than 1014 Ωṡcm and a leakage current density of below 3 × 10-10 A/cm2 is needed to fabricate large area h-BN detectors and provided guidance for achieving high sensitivity solid state neutron detectors based on h-BN.

Clinical measurements of part-body calcium using neutron activation analysis

International Nuclear Information System (INIS)

Tothill, P.; Smith, M.A.; Simpson, J.D.; Chew, I.; MacPherson, J.N.; Winney, R.J.; Strong, J.A.

1979-01-01

Californium-252 sources have been used in a clinical environment for neutron activation analysis studies for a period of 2 1/2 years. During this period, changes in bone calcium in response to different treatment regimes have been measured in patients suffering from primary or secondary bone disease. The first measurements were performed on peripheral bone, in particular the forearm, using two sources of 252 Cf, minimum total activity 56mCi, for bilateral irradiation and two 15cmx10cm NaI crystals for detection. Optimization of the irradiation geometry and the patient irradiation programme enabled measurements to be performed with a precision of 1.6% and a dose of 3 rem. The precision estimate was based on 64 sets of repeated patient measurements and included errors due to patient movement. Apparatus was also developed to measure changes of calcium in the lumbar spine, particular attention being devoted to obtaining uniformity of sensitivity in the vertebrae. Unilateral irradiation with two 252 Cf sources, activity 100mCi each, separated by 20cm, and detection in whole-body counter with four 15cmx10cm NaI detectors gave a precision of 2% based on repeated measurements of 10 patients, with a dose of 1.3 rem to the spine and 10 rem to the skin surface. The following studies were undertaken: the effect of 1 α-hydroxycholecalciferol on 19 patients undergoing chronic haemodialysis, the use of vitamin D 2 and vitamin D 3 in the treatment of 33 patients with potential anticonvulsant osteomalacia, the effect of lithium carbonate in 20 patients with manic depression and the efficacy of conventional treatments in combating thyrotoxic osteodystrophy. (author)

The magnetic properties of oxide spinel Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} solid solutions

Energy Technology Data Exchange (ETDEWEB)

Masrour, R., E-mail: rachidmasrour@hotmail.com [Laboratory of Materials, Processes, Environment and Quality, Cady Ayyed University, National School of Applied Sciences, Sidi bouzid, Safi (Morocco); LMPHE, Faculte des Sciences, Universite Mohamed V, Rabat (Morocco); Hamedoun, M. [Institute for Nanomaterials and Nanotechnologies, MaScIR, Rabat (Morocco); Academie Hassan II des Sciences et Techniques, Rabat (Morocco); Benyoussef, A. [LMPHE, Faculte des Sciences, Universite Mohamed V, Rabat (Morocco); Institute for Nanomaterials and Nanotechnologies, MaScIR, Rabat (Morocco); Academie Hassan II des Sciences et Techniques, Rabat (Morocco)

2012-04-01

The exchange interactions (J{sub BB} and J{sub AB} are the intra and the inter-sublattice exchange interactions between neighbouring spins, respectively) are obtained by using the general expressions of canting angle and critical temperature obtained by mean field theory of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4}. The expression of magnetic energy of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} is obtained for different spin configurations and dilution x. The saturation magnetisation of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} is obtained with different values of dilution x. The magnetic phase diagram of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} materials is obtained by high temperature series expansions (HTSEs). The critical exponent associated with the magnetic susceptibility of Li{sub 0.5}Fe{sub 2.5-2x}Al{sub x}Cr{sub x}O{sub 4} is deduced.

Freeze drying method for preparing radiation source material

International Nuclear Information System (INIS)

Mosley, W.C.; Smith, P.K.

1976-01-01

Fabrication of a neutron source is specifically claimed. A palladium/californium solution is freeze dried to form a powder which, through conventional powder metallurgy, is shaped into a source containing the californium evenly distributed through a palladium metal matrix. (E.C.B.)

Regularities in dose field formation for fixation of 252Cf and 60Co sources on the same plane

International Nuclear Information System (INIS)

Ivanov, V.N.; Vtyurin, B.M.; Ivanova, L.F.; Kondzhariya, Yu.R.

1983-01-01

A computerized study was made of a change in the correlation between the sizes of an irradiated volume and the distribution of sources. Criteria have been established for the utilization of 252 Cf and 60 Co sources of different active length and design placed on the same plane. Reference dose rate and its derivatives have been chosen as the main parameters that characterize a dose field. A dosimetric analysis was performed using the data for an adsorbed dose of neutrons in the tissue, taking account of high RBE of 252 Cf fast neutrons that equals 6-7, and a slight change of the local RBE value near the source resulting from a change of the effective spectrum of neutrons in combination with the growth of a contribution of #betta#-radiation into the summary dose with the removal from the source. The irradiated volume was evaluated by introducing 3 linear parameters - length, thickness and width. It has been shown that the ratio of the length of an irradiated volume to the active length of 252 Cf sources with radionuclide regular linear density changes from 0.7 with the isodose value of 85% up to 0.97 with the isodose value of 60%. For 60 Co sources with a higher linear density of the radionuclide on the edges the lower limit of this value equals 1. Intervals of changes in the rest of parameters have also been defined. The results obtained are presented graphically. The results of the study are used for a dosimetric control of the clinical trials of 252 Cf and 60 Co sources in the treatment of patients with tumors of the tongue, oral cavity fundus, lip and other sites

True ternary fission of 252Cf

International Nuclear Information System (INIS)

Vijayaraghavan, K.R.; Balasubramaniam, M.; Oertzen, W. von

2014-01-01

Splitting of heavy radioactive nucleus into three fragments is known as ternary fission. If the size of the fragments are almost equal it is referred to as true ternary fission. Recently, Yu. V. Pyatkov et al observed/reported the experimental observation of true ternary fission in 252 Cf. In this work, the possibilities of different true ternary fission modes of 252 Cf through potential energy surface (PES) calculations based on three cluster model (TCM) are discussed. In TCM a condition on the mass numbers of the fission fragments is implied as A 1 ≥ A 2 ≥ A 3 in order to avoid repetition of combinations. Due to this condition, the values of Z 3 vary from 0 to 36 and Z 2 vary from 16 to 51. Of the different pairs having similar (Z 2 , Z 3 ) with different potential energy, a pair possessing minimum potential energy is chosen. Thus identified favourable combinations are plotted. For the PES calculations the arrangement of the fragments is considered in the order of A 1 +A 2 +A 3 . i.e. the heavy and the lightest fragments are kept at the ends. It is seen that the deepest minimum in the PES occurs for Z 3 =2 labelled as (Z 2 ; 2) indicating He accompanied breakup as the most favourable one. Of which, the breakup with Z 2 around 46 to 48 is the least (shown by dashed (Z 1 = 50) and dotted (Z 1 = 52) lines indicating a constant Z 1 value). The other notable minima in the PES are labelled and they correspond to the (Z 2 , Z 3 ) pairs viz., (20, 20), (28, 20), (28, 28) and (32, 32). Of these four minima, the first three are associated with the magic numbers 20 and 28. For Z 3 =20, there are two minimums at (20,20) and (28,20) among them (28,20) is the lowest minimum through which the minimum-path passes, and it is the ternary decay observed by Yu. V. Pyatkov et al. The fourth minima is the most interesting due to the fact that it corresponds to true ternary fission mode with Z 2 =32, Z 3 =32 and Z 1 =34. The minimum potential energy path also goes through this true

Identification of new neutron-rich rare-earth nuclei produced in /sup 252/Cf spontaneous fission

CERN Document Server

Greenwood, R C; Gehrke, R J; Meikrantz, D H

1981-01-01

A program of systematic study of the decay properties of neutron-rich rare-earth nuclei with 30 s252/Cf spontaneous fission, is currently underway using the Idaho ESOL (Elemental Separation On Line) Facility. The chemistry system used for the rare-earth elemental separations consists of two high-performance chromatography columns connected in series and coupled to the /sup 252 /Cf fission source via a helium gas-jet transport arrangement. The time delay for separation and initiation of gamma -ray counting with results which have been obtained to date with this system include the identification of a number of new neutron-rich rare-earth isotopes including /sup 155/Pm (t/sub 1/2/=48+or-4 s) and /sup 163/Gd (t/sub 1 /2/=68+or-3 s), in addition to 5.51 min /sup 158/Sm which was identified in an earlier series of experiments. (11 refs).

Discrepancies in the half-lives of 90Sr, 137Cs and 252Cf

International Nuclear Information System (INIS)

Rajput, M.U.; Mac Mahon, T.D.

1990-01-01

Recent reports have pointed out that significant discrepancies exist in published half-life data for 90 Sr, 137 Cs and 252 Cr, amongst others. These discrepancies make the estimation of evaluated half-lives for these isotopes difficult and contentious. This paper reviews the current situation, takes into account recently available data and attempts to derive recommended half-lives and associated uncertainties for the three isotopes. 37 refs, 3 tabs

Trajectory calculations for the ternary cold fission of 252Cf

International Nuclear Information System (INIS)

Misicu, S.

1998-01-01

We compute the final kinetic energies of the fragments emitted in the light charged particle accompanied by cold fission of 252 Cf taking into account the deformation and the finite-size effects of the fragments and integrating the equations of motion for a three-body system subjected only to Coulomb forces. The initial conditions for the trajectory calculations were derived in the framework of a deformed cluster model which includes also the effect due to the absorbative nuclear part. Although the distributions of initial kinetic energies are rather broad we show that in cold fission the initial conditions can be better determined than in the usual spontaneous fission

X-Ray Measurements Of A Thermo Scientific P385 DD Neutron Generator

International Nuclear Information System (INIS)

Wharton, C. J.; Seabury, E. H.; Chichester, D. L.; Caffrey, A. J.; Simpson, J.; Lemchak, M.

2011-01-01

Idaho National Laboratory is experimenting with electrical neutron generators, as potential replacements for californium-252 radioisotopic neutron sources in its PINS prompt gamma-ray neutron activation analysis (PGNAA) system for the identification of military chemical warfare agents and explosives. In addition to neutron output, we have recently measured the x-ray output of the Thermo Scientific P385 deuterium-deuterium neutron generator. X rays are a normal byproduct from neutron generators, but depending on their intensity and energy, x rays can interfere with gamma rays from the object under test, increase gamma-spectrometer dead time, and reduce PGNAA system throughput. The P385 x-ray energy spectrum was measured with a high-purity germanium (HPGe) detector, and a broad peak is evident at about 70 keV. To identify the source of the x rays within the neutron generator assembly, it was scanned by collimated scintillation detectors along its long axis. At the strongest x-ray emission points, the generator also was rotated 60 deg. between measurements. The scans show the primary source of x-ray emission from the P385 neutron generator is an area 60 mm from the neutron production target, in the vicinity of the ion source. Rotation of the neutron generator did not significantly alter the x-ray count rate, and its x-ray emission appears to be axially symmetric. A thin lead shield, 3.2 mm (1/8 inch) thick, reduced the 70-keV generator x rays to negligible levels.

High energy {gamma} emission in the spontaneous fission of {sup 252}Cf; Emission {gamma} de grande energie dans la fission spontanee de {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Thiesen, Ch. [Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee, CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Belier, G.; Meot, M.V. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Inst.de Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)

1997-06-01

The prompt {gamma} emission in the spontaneous fission of {sup 252}Cf is characterized by an energy spectrum which extends up to 20 MeV. It was established that the spectrum presents in the neighbourhood of symmetric fission an intensity bump in the 3-8 MeV {gamma} energy interval. The origin of this phenomenon is still not well understood, so that it was found interesting to carry out new measurements. The spectrum of the {gamma} rays emitted in spontaneous fission of {sup 252}Cf has been measurement in the EUROGAM II multidetector using photovoltaic cells to detect fragments. The aim of the experiment was to investigate the {gamma} yield enhancement which appears for mass fragment ratio near 132/120. This enhancement was found to be composed of two peaks located at 4 MeV and 5.5 MeV respectively. The results obtained confirm the intensity bound in the 3-8 MeV region but this augmentation reaches the maximum when the heavy fragment is near the mass 132. Beyond mass 140 the phenomenon diminish and the {gamma} spectrum regains the behaviour expected for a statistic emission. The additional structure at 5.5 MeV does not vary with excitation energy while the excitation function of the 4 MeV structure is more structured and presents a maximum when the excitation energy is near 8 MeV. It is likely that all or part of this observed phenomenon is due to a particular excitation mode of this isotope associated for instance with a low energy dipole resonance. A theoretical study of this collective effect is under way 3 refs.

Application of modular neutron spectrometer to measure neutron spectra from fission of 252Cf

International Nuclear Information System (INIS)

Szeflinski, Z.; Osuch, S.; Popkiewicz, M.; Wilhelmi, Z.; Zelazny, Z.

1996-01-01

The neutron spectrometer MONA (Modular Neutron Array) and its test has been described. The spectrometers consist of eight BC-501A liquid scintillator detectors of BICRON which allow one to distinguish between the pulses from gamma quanta and neutrons using pulse shape discrimination (PSD) method. The electronic equipment for the PSD and the test result using the 252 Cf radioactive source are presented

An absolute measurement of 252Cf prompt fission neutron spectrum at low energy range

International Nuclear Information System (INIS)

Lajtai, A.; Dyachenko, P.P.; Kutzaeva, L.S.; Kononov, V.N.; Androsenko, P.A.; Androsenko, A.A.

1983-01-01

Prompt neutron energy spectrum at low energies (25 keV 252 Cf spontaneous fission has been measured with a time-of-flight technique on a 30 cm flight-path. Ionization chamber and lithium-glass were used as fission fragment and neutron detectors, respectively. Lithium glasses of NE-912 (containing 6 Li) and of NE-913 (containing 7 Li) 45 mm in diameter and 9.5 mm in thickness have been employed alternatively, for the registration of fission neutrons and gammas. For the correct determination of the multiscattering effects - the main difficulty of the low energy neutron spectrum measurements - a special geometry for the neutron detector was used. Special attention was paid also to the determination of the absolute efficiency of the neutron detector. The real response function of the spectrometer was determined by a Monte-Carlo calculation. The scattering material content of the ionization chamber containing a 252 Cf source was minimized. As a result of this measurement a prompt fission neutron spectrum of Maxwell type with a T=1.42 MeV parameter was obtained at this low energy range. We did not find any neutron excess or irregularities over the Maxwellian. (author)

Subcriticality determination by a new time-domain correlation experiment with a 252Cf neutron source

International Nuclear Information System (INIS)

Nishina, K.; Yamane, Y.; Ishiguro, S.; Miyoshi, Y.; Suzaki, T.; Kobayahi, I.

1985-01-01

As a candidate for the on-site subcriticality-monitoring method, a new time-domain correlation experiment is proposed. Hinted by the Cf-252 detector method of Mihalczo, three covariances are taken between the count of three detectors; namely an ionization chamber with Cf-252 coating, and two He-3 proportional counters. A ratio Q is formed from the three quantities such that it does not depend either on detector efficiencies or counting gate duration T, and then related to reactivity. A formulation is given deriving a theoretical expression for this Q, with the effect of higher spatial modes included. Experiments were carried out with a loading at Tank-type Critical Assembly of Japan Atomic Energy Research Institute, which is a slightly-enriched, and light-water moderated system. With fundamental mode approximation adopted in the data processing, reasonable agreements are observed between the present method and the reactivity scale that has been calibrated by water-level variety. The possibility of the present method is to be investigated further beyond the range of 7$ reported

7 CFR 1726.252 - Prior approved contract modification related to liability for special and consequential damages.

Science.gov (United States)

2010-01-01

... consequential damages on account of breach of this contract shall not exceed in total an amount equal to... 7 Agriculture 11 2010-01-01 2010-01-01 false Prior approved contract modification related to... CONSTRUCTION POLICIES AND PROCEDURES Modifications to RUS Standard Contract Forms § 1726.252 Prior approved...

A new facility for non-destructive assay using a 252Cf source.

Science.gov (United States)

Stevanato, L; Caldogno, M; Dima, R; Fabris, D; Hao, Xin; Lunardon, M; Moretto, S; Nebbia, G; Pesente, S; Pino, F; Sajo-Bohus, L; Viesti, G

2013-03-01

A new laboratory facility for non-destructive analysis (NDA) using a time-tagged (252)Cf source is presented. The system is designed to analyze samples having maximum size of about 20 × 25 cm(2), the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. Copyright © 2012 Elsevier Ltd. All rights reserved.

A review of neutron scattering correction for the calibration of neutron survey meters using the shadow cone method

Energy Technology Data Exchange (ETDEWEB)

Kim, Sang In; Kim, Bong Hwan; Kim, Jang Lyul; Lee, Jung Il [Health Physics Team, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2015-12-15

The calibration methods of neutron-measuring devices such as the neutron survey meter have advantages and disadvantages. To compare the calibration factors obtained by the shadow cone method and semi-empirical method, 10 neutron survey meters of five different types were used in this study. This experiment was performed at the Korea Atomic Energy Research Institute (KAERI; Daejeon, South Korea), and the calibration neutron fields were constructed using a {sup 252}Californium ({sup 252}Cf) neutron source, which was positioned in the center of the neutron irradiation room. The neutron spectra of the calibration neutron fields were measured by a europium-activated lithium iodide scintillator in combination with KAERI's Bonner sphere system. When the shadow cone method was used, 10 single moderator-based survey meters exhibited a smaller calibration factor by as much as 3.1 - 9.3% than that of the semi-empirical method. This finding indicates that neutron survey meters underestimated the scattered neutrons and attenuated neutrons (i.e., the total scatter corrections). This underestimation of the calibration factor was attributed to the fact that single moderator-based survey meters have an under-ambient dose equivalent response in the thermal or thermal-dominant neutron field. As a result, when the shadow cone method is used for a single moderator-based survey meter, an additional correction and the International Organization for Standardization standard 8529-2 for room-scattered neutrons should be considered.

A review of neutron scattering correction for the calibration of neutron survey meters using the shadow cone method

International Nuclear Information System (INIS)

Kim, Sang In; Kim, Bong Hwan; Kim, Jang Lyul; Lee, Jung Il

2015-01-01

The calibration methods of neutron-measuring devices such as the neutron survey meter have advantages and disadvantages. To compare the calibration factors obtained by the shadow cone method and semi-empirical method, 10 neutron survey meters of five different types were used in this study. This experiment was performed at the Korea Atomic Energy Research Institute (KAERI; Daejeon, South Korea), and the calibration neutron fields were constructed using a 252 Californium ( 252 Cf) neutron source, which was positioned in the center of the neutron irradiation room. The neutron spectra of the calibration neutron fields were measured by a europium-activated lithium iodide scintillator in combination with KAERI's Bonner sphere system. When the shadow cone method was used, 10 single moderator-based survey meters exhibited a smaller calibration factor by as much as 3.1 - 9.3% than that of the semi-empirical method. This finding indicates that neutron survey meters underestimated the scattered neutrons and attenuated neutrons (i.e., the total scatter corrections). This underestimation of the calibration factor was attributed to the fact that single moderator-based survey meters have an under-ambient dose equivalent response in the thermal or thermal-dominant neutron field. As a result, when the shadow cone method is used for a single moderator-based survey meter, an additional correction and the International Organization for Standardization standard 8529-2 for room-scattered neutrons should be considered

252Cf-source-driven neutron noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; King, W.T.; Blakeman, E.D.

1985-01-01

The 252 Cf-source-driven neutron noise analysis method has been tested in a a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor, k/sub eff/ has been satisfactorily determined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments and the development of theoretical methods to predict the experimental observables

252Cf-source-driven neutron noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; King, W.T.; Blakeman, E.D.

1985-01-01

The 252 Cf-source-driven neutron noise analysis method has been tested in a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor k/sub eff/ has been satisfactorily detemined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments oriented toward particular applications including dynamic experiments and the development of theoretical methods to predict the experimental observables

Study of reproducibility of measurements with the spectrometer of Bonner multispheres

International Nuclear Information System (INIS)

Azevedo, G.A.; Pereira, W.W.; Patrao, K.C.S.; Fonseca, E.S.

2013-01-01

This work aims to study the metrological behavior of the Bonner Multisphere Spectrometer (BMS) of the LN / LNMRI / IRD - Laboratorio Metrologia de Neutrons / Laboratorio Nacional de Metrologia e Radiacao Ionizante / Instituto de Radioprotecao e Dosimetria, for measurements in repeatability and reproducibility conditions. Initially, a simulation was done by applying the Monte Carlo method, using the MCNP code and respecting the ISO 8529-1 (2001), using the sources of Californium ( 252 Cf), Americium-Beryllium ( 241 AmBe) and californium in heavy water (Cf + D 2 O), all located at a distance of 100 cm from the neutron detector ( 6 Li (Eu) - crystal scintillator). In this program, the counting of neutrons that are captured by the detector was made. The source is located in the center of a sphere of radius 300 cm. Analyzes the impact of these neutrons in a point of the sphere wall, which in this case acted as a neutron detector and from there, it is estimated the number of neutrons that collide in the whole sphere. The purpose is to obtain the neutron count for different energy bands in a solid field of neutrons, since they have a spectrum ranging from a low to a high energy that can also vary within a particular environment. Wishes to obtain new fields with different sources and moderators materials to be used as new reference fields. Measurements are being conducted for these fields, with the aim of analyzing the variability conditions of the measurement (repeatability and reproducibility) in LEN - Laboratorio de Espectrometria de Neutrons of the LN/LMNRI/IRD. Thus, the spectrometer will be used to improve both the knowledge of the spectrum as the standard of neutrons of the lab, proving that a spectrometry is essential for correct measurement

Determination of 114Pd cumulative yield and investigation of the fine-structure at light peak in mass distribution of 252Cf spontaneous fission

International Nuclear Information System (INIS)

Yu Runlan; Li Xueliang; Cui Anzhi; Guo Jingru; Yan Shuhen; Tang Peijia; Liu Daming

1991-07-01

A rapid radiochemical procedure for Pd separation was developed. It was the first time to use radiochemical techniques to determine 114 Pd cumulative yield (2.50 ± 0.14)% in 252 Cf spontaneous fission. The cumulative yields of (3.50 ± 0.13)% and (3.70 ± 0.11)% for 112 Pd and 113g Ag were also obtained. These are in agreement with Skovorodkin's results. The cumulative yields determined show that there is a fine-structure at light peak of mass number A = 113 in the mass distribution of 252 Cf spontaneous fission

The temperature of fission fragments from spontaneous fission of 252Cf measured by time-of-flight spectrometer

International Nuclear Information System (INIS)

Popkiewicz, M.; Osuch, S.; Szeflinski, Z.; Sztampke, A.; Wilhelmi, Z.; Wolinska, M.; Zaganczyk, R.

1997-01-01

The detection system MONA (Modular Neutron Array) consisting of eight large BC-501A liquid scintillators, was applied to determine the temperature of fission fragments emitted in spontaneous fission of 252 Cf. The determination of the temperature was based on the measurement of the neutron spectra

Quantum mechanical/molecular mechanical calculated reactivity networks reveal how cytochrome P450cam and Its T252A mutant select their oxidation pathways.

Science.gov (United States)

Wang, Binju; Li, Chunsen; Dubey, Kshatresh Dutta; Shaik, Sason

2015-06-17

Quantum mechanical/molecular mechanical calculations address the longstanding-question of a "second oxidant" in P450 enzymes wherein the proton-shuttle, which leads to formation of the "primary-oxidant" Compound I (Cpd I), was severed by mutating the crucial residue (in P450cam: Threonine-252-to-Alanine, hence T252A). Investigating the oxidant candidates Cpd I, ferric hydroperoxide, and ferric hydrogen peroxide (Fe(III)(O2H2)), and their reactions, generates reactivity networks which enable us to rule out a "second oxidant" and at the same time identify an additional coupling pathway that is responsible for the epoxidation of 5-methylenylcamphor by the T252A mutant. In this "second-coupling pathway", the reaction starts with the Fe(III)(O2H2) intermediate, which transforms to Cpd I via a O-O homolysis/H-abstraction mechanism. The persistence of Fe(III)(O2H2) and its oxidative reactivity are shown to be determined by interplay of substrate and protein. The substrate 5-methylenylcamphor prevents H2O2 release, while the protein controls the Fe(III)(O2H2) conversion to Cpd I by nailing-through hydrogen-bonding interactions-the conformation of the HO(•) radical produced during O-O homolysis. This conformation prevents HO(•) attack on the porphyrin's meso position, as in heme oxygenase, and prefers H-abstraction from Fe(IV)OH thereby generating H2O + Cpd I. Cpd I then performs substrate oxidations. Camphor cannot prevent H2O2 release and hence the T252A mutant does not oxidize camphor. This "second pathway" transpires also during H2O2 shunting of the cycle of wild-type P450cam, where the additional hydrogen-bonding with Thr252 prevents H2O2 release, and contributes to a successful Cpd I formation. The present results lead to a revised catalytic cycle of Cytochrome P450cam.

Angular momenta of fission fragments in the {alpha}-accompanied fission of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Jandel, M.; Kliman, J.; Krupa, L.; Morhac, M. [Slovak Academy of Sciences, Department of Nuclear Physics, Bratislava (Slovakia); Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Hamilton, J.H.; Kormicki, J.; Ramayya, A.V.; Hwang, J.K.; Luo, Y.X.; Fong, D.; Gore, P. [Vanderbilt University, Department of Physics, Nashville, TN (United States); Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Rodin, A.M.; Fomichev, A.S.; Popeko, G.S. [Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Daniel, A.V. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O.; Macchiavelli, A.O.; Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R.; Cole, J.D.

2005-06-01

For the first time, average angular momenta of the ternary fission fragments {sup 100,102}Zr, {sup 106}Mo, {sup 144,146}Ba and {sup 138,140,142}Xe from the {alpha}-accompanied fission of {sup 252}Cf were obtained from relative intensities of prompt {gamma}-ray transitions with the use of the statistical model calculation. Average values of the angular momenta were compared with the corresponding values for the same fission fragments from the binary fission of {sup 252}Cf. Results indicate the presence of a decreasing trend in the average values of angular momenta induced in ternary fission fragments compared to the same binary fission fragments. On the average, the total angular momentum extracted for ternary fission fragments is {proportional_to}1.4{Dirac_h} lower than in binary fission. Consequently, results indicate that the mechanism of the ternary {alpha}-particles emission may directly effect an induction of angular momenta of fission fragments, and possible scenarios of such mechanisms are discussed. Further, the dependence of the angular momenta of {sup 106}Mo and {sup 140}Xe on the number of emitted neutrons from correlated pairs of primary fragments was obtained also showing a decreasing dependence of average angular momenta with increasing number of emitted neutrons. Consequences are briefly discussed. (orig.)

Gamma-ray multiplicity measurement of the spontaneous fission decay of 252Cf in a segmented HPGe/BGO detector array

Energy Technology Data Exchange (ETDEWEB)

Bleuel, D L; Bernstein, L A; Burke, J T; Gibelin, J; Heffner, M D; Mintz, J; Norman, E B; Phair, L; Scielzo, N D; Sheets, S A; Snyderman, N J; Stoyer, M A; Wiedeking, M

2008-04-23

Coincident {gamma} rays from a {sup 252}Cf source were measured using an array of six segmented high-purity germanium (HPGe) Clover detectors each enclosed by 16 bismuth-germanate (BGO) detectors. The detectors were arranged in a cubic pattern around a 1 {micro}Ci {sup 252}Cf source to cover a large solid angle for {gamma}-ray measurement with a reasonable reconstruction of the multiplicity. Neutron multiplicity was determined in certain cases by identifying the prompt {gamma} rays from individual fission fragment pairs. Multiplicity distributions from previous experiments and theoretical models were convolved with the response function of the array and compared to the present results. These results suggest a {gamma}-ray multiplicity spectrum broader than previous measurements and models, and provide no evidence of correlation with neutron multiplicity.

Matrix effects correction on 252Cf shufflers by application of the alternating conditional expectation to neutron flux monitor data

International Nuclear Information System (INIS)

Pickrell, M.M.

1992-01-01

The 252 Cf shuffler assays fissile uranium and plutonium using active neutron interrogation and then counting the induced delayed neutrons. Using the shuffler, we conducted over 1700 assays of 55-gal. drums with 28 different matrices and several different fissionable materials. We measured the drums to diagnose the matrix and position effects on 252 Cf shuffler assays. The matrices incorporated metals, neutron poisons, and hydrogen in densities ranging from 0≤ pH ≤ 0.086 g/cm 3 , a range of cases more extreme than typically found in routine plant use. We used several neutron flux monitors during irradiation and kept statistics on the count rates of individual detector banks. The intent of these measurements was to gauge the effect of the matrix independently from the uranium assay

Advanced conceptual design report. Phase II. Liquid effluent treatment and disposal Project W-252

International Nuclear Information System (INIS)

1995-01-01

This Advanced Conceptual Design Report (ACDR) provides a documented review and analysis of the Conceptual Design Report (CDR), WHC-SD-W252-CDR-001, June 30, 1993. The ACDR provides further design evaluation of the major design approaches and uncertainties identified in the original CDR. The ACDR will provide a firmer basis for the both the design approach and the associated planning for the performance of the Definitive Design phase of the project

Complement factor 5 (C5) p.A252T mutation is prevalent in, but not restricted to, sub-Saharan Africa: implications for the susceptibility to meningococcal disease.

Science.gov (United States)

Franco-Jarava, C; Comas, D; Orren, A; Hernández-González, M; Colobran, R

2017-08-01

Complement C5 deficiency (C5D) is a rare primary immunodeficiency associated with recurrent infections, particularly meningitis, by Neisseria species. To date, studies to elucidate the molecular basis of hereditary C5D have included fewer than 40 families, and most C5 mutations (13 of 17) have been found in single families. However, the recently described C5 p.A252T mutation is reported to be associated with approximately 7% of meningococcal disease cases in South Africa. This finding raises the question of whether the mutation may be prevalent in other parts of Africa or other continental regions. The aim of this study was to investigate the prevalence of C5 p.A252T in Africa and other regions and discuss the implications for prophylaxis against meningococcal disease. In total, 2710 samples from healthy donors within various populations worldwide were analysed by quantitative polymerase chain reaction (qPCR) assay to detect the C5 p.A252T mutation. Eleven samples were found to be heterozygous for p.A252T, and nine of these samples were from sub-Saharan African populations (allele frequency 0·94%). Interestingly, two other heterozygous samples were from individuals in populations outside Africa (Israel and Pakistan). These findings, together with data from genomic variation databases, indicate a 0·5-2% prevalence of the C5 p.A252T mutation in heterozygosity in sub-Saharan Africa. Therefore, this mutation may have a relevant role in meningococcal disease susceptibility in this geographical area. © 2017 British Society for Immunology.

Importance of the neutrons kerma coefficient in the planning of Brachytherapy treatments with Cf-252 sources; Importancia del coeficiente de kerma de neutrones en la planeacion de tratamientos de Braquiterapia con fuentes de Cf-252

Energy Technology Data Exchange (ETDEWEB)

Paredes G, L.; Balcazar G, M. [ININ, 52045 Ocoyocac, Estado de Mexico (Mexico); Azorin N, J. [Universidad Autonoma Metropolitana, 09000 Mexico D.F. (Mexico); Francois L, J.L. [UNAM, 04500 Mexico D.F. (Mexico)]. e-mail: lpg@nuclear.inin.mx

2006-07-01

The Cf-252 is a fast neutrons emitting radioisotope by spontaneous fission that can be used as sealed source in medicine applications, industry and research. Commercially its offer sources of different sizes, compact and with a fast neutrons emission of the order of 10{sup 6} n/s-{mu}g and an energy spectra that presents respectively maxim and average energy in 2.1 MeV and 0.7 MeV. In medicine new applications are being developed for the treatment of patient with hypoxic and voluminous tumors, where the therapy with photons has not given positive results, as well as for the protocols of therapy treatment by boron neutron capture, where very small sources of Cf-252 will be used with the interstitial brachytherapy technique of high and low dose rate. In this work an analysis of how the small differences that exist in the elementary composition of 4 wicked tumors, 4 ICRU healthy tissues and 3 substitute materials of ICRU tissue used in dosimetry are presented, its generate changes in the neutrons kerma coefficient in function of the energy and consequently in the absorbed dose in the interval of 11 eV to 29 MeV. These differences can produce maximum variations of the neutron kerma coefficients ratio for E{sub n} > 1 keV of the one: 15% tumor/ICRU guest healthy tissue, 12% ICRU tumor/muscle, 12% ICRU healthy tissues ICRU/ICRU muscle, 22% substitutes tissue/tumor and 22% ICRU substitutes tissue/muscle. Also, it was found that the average value of the neutrons kerma coefficient for the 4 wicked tumors is from 6% to 7% smaller that the average value for the soft tissue in the interval energy of interest for therapy with fast neutrons with E{sub n} > 1 MeV. These results have a special importance during the planning process of brachytherapy treatments with sources of {sup 252}Cf, to optimize and to individualize the patients treatments. (Author)

48 CFR 252.225-7007 - Prohibition on Acquisition of United States Munitions List Items from Communist Chinese Military...

Science.gov (United States)

2010-10-01

... of United States Munitions List Items from Communist Chinese Military Companies. 252.225-7007 Section... Chinese Military Companies. As prescribed in 225.1103(4), use the following clause: Prohibition On Acquisition of United States Munitions List Items From Communist Chinese Military Companies (SEP 2006) (a...

HeLa cell tumor response to 60Co, Cs-137, Cf-252 radiations and cisplatin chemotherapy in nude mice

International Nuclear Information System (INIS)

Maruyama, Y.; Feola, J.M.; Beach, J.L.

1984-01-01

HeLa cells were implanted into athymic nude mice from tissue culture and solid tumors established (HeLa cell tumor or HCT). Large cell numbers of 1 X 10 7 were required to obtain consistent and progressive growth, and tumor growth followed a Gompertzian mode. Irradiation studies were carried out using acute Cobalt-60 (60Co), low-dose-rate (LDR) Cs-137 and LDR Cf-252. Cf-252, a neutron-emitting radioisotope, produced an immediate tumor shrinkage and regression response after a dose of 279 cGy. Acute 60Co or LDR Cs-137 irradiation with 1000 cGy had little effect on the HCT. After a dose of 2000 cGy of 60Co radiation tumor shrinkage followed a latent period of approximately 5 days. Cisplatin had no effect on the HCT in nude mice in stationary or late exponential growth

A computational approach to finding novel targets for existing drugs.

Directory of Open Access Journals (Sweden)

Yvonne Y Li

2011-09-01

Full Text Available Repositioning existing drugs for new therapeutic uses is an efficient approach to drug discovery. We have developed a computational drug repositioning pipeline to perform large-scale molecular docking of small molecule drugs against protein drug targets, in order to map the drug-target interaction space and find novel interactions. Our method emphasizes removing false positive interaction predictions using criteria from known interaction docking, consensus scoring, and specificity. In all, our database contains 252 human protein drug targets that we classify as reliable-for-docking as well as 4621 approved and experimental small molecule drugs from DrugBank. These were cross-docked, then filtered through stringent scoring criteria to select top drug-target interactions. In particular, we used MAPK14 and the kinase inhibitor BIM-8 as examples where our stringent thresholds enriched the predicted drug-target interactions with known interactions up to 20 times compared to standard score thresholds. We validated nilotinib as a potent MAPK14 inhibitor in vitro (IC50 40 nM, suggesting a potential use for this drug in treating inflammatory diseases. The published literature indicated experimental evidence for 31 of the top predicted interactions, highlighting the promising nature of our approach. Novel interactions discovered may lead to the drug being repositioned as a therapeutic treatment for its off-target's associated disease, added insight into the drug's mechanism of action, and added insight into the drug's side effects.

Burnout and gate rupture of power MOS transistors with fission fragments of 252Cf

International Nuclear Information System (INIS)

Tang Benqi; Wang Yanping; Geng Bin; Chen Xiaohua; He Chaohui; Yang Hailiang

2000-01-01

A study to determine the single event burnout (SEB) and single event gate rupture (SEGR) sensitivities of power MOSFET devices is carried out by exposure to fission fragments from 252 Cf source. The test method, test results, a description of observed burnout current waveforms and a discussion of a possible failure mechanism are presented. The test results include the observed dependence upon applied drain or gate to source bias and effect of external capacitors and limited resistors

Viability of neutron brachytherapy technique using Cf252 for tumors of salivary glands therapy

International Nuclear Information System (INIS)

Andrade, Lidia M.; Campos, Tarcisio P.R.

2000-01-01

Gland salivary tumors, although uncommon, present significant characteristics such as distant metastasis, recurrence and average survive of five year for treated patients. Those tumors presents low response to a conventional radiotherapy, photon and electron therapy; thus, this modality is associated with surgery. Fast neutron therapy has been presented better results in controlling the local tumor in comparison with conventional radiotherapy. Brachytherapy with Cf-252 presents an alternative treatment for tumors. Those radiotherapy technique are discussed and analyzed. (author)

Fast neutron tomography with real-time pulse-shape discrimination in organic scintillation detectors

Energy Technology Data Exchange (ETDEWEB)

Joyce, Malcolm J., E-mail: m.joyce@lancaster.ac.uk [Department of Engineering, Lancaster University, Lancaster, Lancashire LA1 4YW (United Kingdom); Agar, Stewart [Department of Engineering, Lancaster University, Lancaster, Lancashire LA1 4YW (United Kingdom); Aspinall, Michael D. [Hybrid Instruments Ltd., Gordon Manley Building, Lancaster Environment Centre, Lancaster University, Lancaster LA1 4YW (United Kingdom); Beaumont, Jonathan S.; Colley, Edmund; Colling, Miriam; Dykes, Joseph; Kardasopoulos, Phoevos; Mitton, Katie [Department of Engineering, Lancaster University, Lancaster, Lancashire LA1 4YW (United Kingdom)

2016-10-21

A fast neutron tomography system based on the use of real-time pulse-shape discrimination in 7 organic liquid scintillation detectors is described. The system has been tested with a californium-252 source of dose rate 163 μSv/h at 1 m and neutron emission rate of 1.5×10{sup 7} per second into 4π and a maximum acquisition time of 2 h, to characterize two 100×100×100 mm{sup 3} concrete samples. The first of these was a solid sample and the second has a vertical, cylindrical void. The experimental data, supported by simulations with both Monte Carlo methods and MATLAB®, indicate that the presence of the internal cylindrical void, corners and inhomogeneities in the samples can be discerned. The potential for fast neutron assay of this type with the capability to probe hydrogenous features in large low-Z samples is discussed. Neutron tomography of bulk porous samples is achieved that combines effective penetration not possible with thermal neutrons in the absence of beam hardening.

Measurement of neutron dose and spectra at light-water reactors

International Nuclear Information System (INIS)

Soldat, K.L.; Endres, G.W.R.; Cummings, F.M.

1982-08-01

In choosing one dosimeter over another, both sensitivity and precision must be addressed. It has been determined that dosimeters employing NTA film lack adequate sensitivity for use inside containment of nuclear plants. From this study, it is apparent that CR-39 and polycarbonate track etch films used without radiators are also inadequate. The rest of the dosimeters tested displayed adequate sensitivity. The two general types of dosimeters which comprise that group are: (1) TLDs and (2) the polycarbonate track etch which was used in conjunction with (n, α) radiators. The precision of the TLD dosimeter depends on the calibration technique and response correction technique. TLD dosimeters calibrated to D 2 O-moderated californium-252 or corrected based on 9- to 3-in. sphere response rates seemed to function best inside reactor containment. Polycarbonate track etch film with (n, α) radiators was found to be sensitive enough for use inside reactor containment; however, the standard deviation for the results was roughly twice the value of the most precise TLD albedo dosimeters. Also, several of the polycarbonate dosimeters saturated, rendering any evaluation impossible

Development of an analytical theory to describe the PNAR and CIPN nondestructive assay techniques

International Nuclear Information System (INIS)

Bolind, Alan Michael

2014-01-01

Highlights: • Neutron albedo is modeled by a discrete and iterative reflection process. • The theory enables the PNAR and CIPN NDA techniques to be compared quantitatively. • Improvements to the data analysis and to the CIPN instrument design are suggested. • A correction to translate real no-reflection PNAR data into ideal data is provided. - Abstract: This paper develops an analytical theory to describe how neutron albedo (reflection) increases the multiplication of neutrons by a used fuel assembly. With this theory, the two nondestructive assay (NDA) techniques of Passive Neutron Albedo Reactivity (PNAR) and Californium-252 Interrogation with Prompt Neutron Detection (CIPN) can be compared directly. Specifically, the theory derives expressions for the PNAR and CIPN metrics in terms of the physical properties of the used fuel assembly, such as the neutron multiplications and fate probabilities. The theory thus clarifies the interpretation of these two NDA techniques and suggests ways to improve both the design of the NDA instruments and the algorithms for analyzing the measurement results

Efficiency of interaction between various radiation and chemicals

International Nuclear Information System (INIS)

Kim, Jin Kyu; Song, H. S.; Kim, J. S.; Chun, K. J.; Lee, Y. K.; Lee, B. H.; Shin, H. S.; Lee, K. H.; Petin, Vladislav G.

2002-01-01

KAERI and INP (Poland) have been carried out parallel study and joint experiments on the major topics according to MOU about their cooperative project. Major experimental techniques were TSH assay, comet assay, and synergism assay. The research consisted of the following workscopes. 1) Application of TSH bioindicator for studying the biological efficiency of radiation, 2) Relative biological efficiency of californium-252 neutrons in the induction of gene and lethal mutations in TSH cells normal and enriched with boron compound, 3) Effect of pesticide on radiation-induced mutations in TSH cells, 4) Interaction of radiation with pesticide on DNA damage in human peripheral blood lymphocytes, 5) Radiomodifying effect of boron and gadolinium compounds in human peripheral blood lymphocytes, 6) Mathematical description of synergistic interactions, 7) General regularities of synergistic interactions, and 8) Determinant of synergistic interaction between radiation, heat and chemicals in cell killing. Both institutes have established wide variety of research techniques applicable to various radiation research through the cooperation. The results of research can make the role of fundamental basis for the better relationship between Korea and Poland

Test and evaluation of infrared detectors and arrays; Proceedings of the Meeting, Orlando, FL, Mar. 27-29, 1989

Science.gov (United States)

Hoke, Forney M.

Papers on the testing and evaluation of IR detectors and arrays are presented, covering topics such as a short wavelength IR test system, pulse height analysis, the use of an expert system for IR detector testing, low-background IR focal plane testing, electron beam testing, high performance silicide Schottky photodiodes, the SDI organization focal plane test program, the absorption cross section of arsenic in silicon, and long wavelength IR hybrids. Other topics include low background radiometric detector measurements, an ultralow background dewar for IR detector characterization studies, a computer assisted mosaic array test station, a configurable detector array test station, automated detector material characterization capabilities, and a test system for mercury cadmium telluride photoconductor arrays. Additional topics include ionization dosimetry measurements inside a dewar for linac electron and californium-252 neutron environments, a radiation test facility using a variable-flux electron beam source, automated visual inspection of IR focal plane arrays, a titanium cryostat for low temperature radiation effects studies, a low dose rate gamma test facility, and the test and evaluation of stability in IR staring focal plane arrays after nonuniformity correction.

Branching ratios of α-decay to ground and excited states of Fm, Cf, Cm and Pu

Science.gov (United States)

Hassanabadi, H.; Hosseini, S. S.

2018-06-01

We use the well-known Wentzel-Kramers-Brillouin (WKB) barrier penetration probability to calculate α-decay branching ratios for ground and excited states of heavy even-even nuclei of Fermium (248-254Fm), Californium (244-252Cf), Curium (238-248Cm) and Plutonium (234-244Pu) with 94 ≤Zp ≤100. We obtained the branching ratios for the excited states of daughter nucleus by the α-decay energy (Qα), the angular momentum of α-particle (ℓα), and the excitation probability of the daughter nucleus with the excitation energy of state ℓ in the daughter nucleus (i.e. Eℓ*). α-Decay half-lives have been evaluated by using the proximity potential model for the heavy even-even nuclei. We have reported the half-lives and compared the results with the experimental data. The theoretical branching ratios of α-transitions in our calculation are found to agree with the available experimental data well for 0+→ 0+, 0+→ 2+, 0+→ 4+, 0+→ 6+ and 0+ → 8+α-transitions.

Cross-sections of 197Au(n,α)198Au and 63Cu(n,α)64Cu induced by 252Cf neutrons

International Nuclear Information System (INIS)

Mandal, Ranjita; Sengupta, D.; Roy, Malobika; Naik, Mamta; Bhoraskar, V.N.

2014-01-01

Analytical work, employing nuclear techniques, is normally carried out through (n,α) reaction because of the availability of neutrons either from reactors or laboratory sources such as Sb-Be, Am-Be, Ra-Be, Po-Be, 252 Cf, etc. The laboratory neutron sources are though portable and adaptable to a particular experimental arrangement, suffer from the disadvantage of slow neutron yield (except 252 Cf). In this set up since the neutrons available are monoenergetic, it was thought appropriate to initiate a program to measure cross-sections of a few nuclear reactions which have practical applications. Earlier studies on cross-section measurement of the reaction 197 Au(n,α) 198 Au and 63 Cu(n,α) 64 Cu has been carried out using different sources, monitors and techniques

Photon contributions from the 252Cf and 241Am–Be neutron sources at the PSI Calibration Laboratory

International Nuclear Information System (INIS)

Hoedlmoser, H.; Boschung, M.; Meier, K.; Stadtmann, H.; Hranitzky, C.; Figel, M.; Mayer, S.

2012-01-01

At the accredited PSI Calibration Laboratory neutron reference fields traceable to the national standards of the Physikalisch-Technische Bundesanstalt (PTB) in Germany are available for the calibration of ambient and personal dose equivalent (rate) meters and passive dosimeters. The photon contribution to the ambient dose equivalent in the neutron fields of the 252 Cf and 241 Am–Be sources was measured using various photon dose rate meters and active and passive dosimeters. Measuring photons from a neutron source usually involves considerable uncertainties due to the presence of neutron induced photons in the room, due to a non-zero neutron sensitivity of the photon detector, and last but not least due to the energy response of the photon detectors. Therefore eight independent detectors and methods were used to obtain a reliable estimate for the photon contribution of the two sources as an average of the individual methods. For the 241 Am–Be source a photon contribution of approximately 4.9% was determined and for the 252 Cf source a contribution of 3.6%.

Study the Possibility of measuring Heavy Metals Arising from Gold Mining Sample using 252Cf Neutron Source

International Nuclear Information System (INIS)

Soliman, N.F.

2012-01-01

Mining activities contribute immensely to trace element pollution .The present work studied the possibility of measuring heavy metals arising from gold mining areas Eastern Desert in Egypt using the isotopic 252 Cf neutron source. 38.5 g of the sample is irradiated in a neutron field of 252 Cf for 36.75 days and 0.3 mg of the sample is irradiated at the Pneumatic Irradiation Rabbit System (PIRS) built in the vertical thermal column of the ET-RR-2 reactor . The induced activities in the samples are measured using two high resolution f ray spectrometry systems (including two calibrated HPGe detectors). The kο standardization neutron activation analysis (kο-NAA) method was used to analyze the sample under investigation. Thermal to epithermal flux ratio fat the two irradiation positions are measured. The obtained results indicated that the values of the suspected heavy metals such as sodium, magnesium, potassium, manganese, arsenic, ruthenium and tantalum were higher than the background values, signifying accumulation of these heavy metals due to gold mining activities .The accuracy and precision of the method has been evaluated

Development of the neutron reference calibration field using a 252Cf standard source surrounded with PMMA moderators

International Nuclear Information System (INIS)

Yoshida, T.; Kanai, K.; Tsujimura, N.

2002-01-01

The authors developed the neutron reference calibration fields using a 252 Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the 252 Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO 2 -UO 2 mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments

Equilibration in the reaction of 175 and 252 MeV 20Ne with 197Au

International Nuclear Information System (INIS)

Moulton, J.B.

1978-06-01

The highly inelastic nuclear reaction of 197 Au with 20 Ne at 175 and 252 MeV laboratory energies is studied. Energy-, elemental-, and angular- distributions for atomic numbers 5 to 30 (175 MeV) or 34 (252 MeV) are presented. The means and widths of the kinetic energy spectra for detected elements are compared with a theoretical calculation. The calculation postulates thermalization of the incident projectile kinetic energy, and includes one sha(e-vibrational degree of freedom and rigid rotation of the reaction complex. The effect of particle evaporation is considered. Good agreement of the expurimental mean energies with the theory is obtained. Poorer agreement of the kinetic energy widths with the theory may be due to a low-temperature quantal effect. The relative elemental yields are analyzed for their degree of equilibration, based on a model of diffusive nucleon exchange as described by the master equation. A similar degree of equilibration is observed for both reaction energies. The absolute elemental yields are reproduced qualitatively by employing an advanced diffusion code, coupled with calculation of the subsequent fission of heavy reaction products, including the compound nucleus. The angular distributions are analyzed with a simple model, to estimate the reaction lifetime of selected elements

48 CFR 252.247-7026 - Evaluation Preference for Use of Domestic Shipyards-Applicable to Acquisition of Carriage by...

Science.gov (United States)

2010-10-01

... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.247-7026 Evaluation Preference for Use of... Noncontiguous Trade. As prescribed in 247.574(e), use the following provision: Evaluation Preference For Use of... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Evaluation Preference for...

Feasibility of subcriticality and NDA measurements for spent fuel by frequency analysis techniques with 252Cf

International Nuclear Information System (INIS)

Mihalczo, J.T.; Valentine, T.E.; Mattingly, J.K.

1996-01-01

The 252 Cf-source-driven frequency analysis method can be used for measuring the subcritical neutron multiplication factor of arrays of LWR fuel and as little as a single PWR fuel assembly. These measurements can be used to verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. In addition, the data can be used to validate calculational methods for criticality safety. These measurements provide parameters that have a higher sensitivity to changes in fissile mass than neutron multiplication factor and thus serve as a better test of calculational methods. The analysis have also shown that measurement of the cross power spectral density (CPSD) between detectors on one side of a single fuel assembly and an internal or external 252 Cf source driving the fission chain multiplication process can be used for nondestructive assay of fissile mass along the length of the assembly. This CPSD is a smooth function of fissile mass and does not depend on the varying inherent source in the fuel assembly and thus is ideal for fissile mass assay

Detection alpha particles and Cf-252 fission fragments with track solid detectors and with surface barrier detectors: efficiency determination

International Nuclear Information System (INIS)

Khouri, M.T.F.C.; Koskinas, M.F.; Andrade, C. de; Vilela, E.C.; Hinostroza, H.; Kaschiny, J.R.A.; Costa, M.S. da; Rizzo, P.; Santos, W.M.S.

1990-01-01

The technique of particle detection by solid track detectors, types of developing and analysis of results are presented. Efficiency measurements of alpha particle detection with Makrofol e and surface barrier detector are made. Detection of Cf-252 fission fragments is shown. (L.C.)

The legacy of Cf-252 operations at Savannah River Technology Center: Continuous releases of radioiodine to the atmosphere

International Nuclear Information System (INIS)

Kantelo, M.V.; Crandall, B.S.

1992-01-01

The iodine isotopes I-132, 1-133, I-134, and I-135, which have half-lives ranging from 53 minutes to 21 hours, are measured in the atmospheric effluent from the Savannah River Technology Center (SRTC) at the Savannah River Site (SRS) near Aiken, South Carolina. SRS is operated by Westinghouse Savannah River Company for the US Department of Energy (DOE). The isotopes' release rates range from 10 to 300 microcuries per week compared to the rate. The resulting annual dose from all iodine isotopes is minor; it comprises 0.01 percent of the total offsite dose due to atmospheric releases from SRS in 1990. Circumstantial evidence indicates the radioiodine originates from traces of unencapsulated Cf-252. The determination that spontaneous fission of Cf-252 is the source of the radioiodine has several ramifications. Radioactive fission-product isotopes of the noble gas elements krypton and xenon must also be released. Noble gases are more volatile and mobile than iodine. Also, the released iodine isotopes decay to xenon isotopes. The noble gases decay to non-gaseous elements that are transported along with radioiodine to the terrestrial environment by deposition from the SRTC plume. Only Sr-89 is believed to accumulate sufficiently in the environment to approach detectable levels. Given similar conditions in earlier years, releases of short-lived radioiodine have occurred undetected in routine monitoring since the early 1970s. Release rates 20 years ago would have been 200 times greater than current release rates. This report documents preliminary experiments conducted by SRTC and Environmental Monitoring Section (EMS) scientists. The release process and the environmental impact of fission products from Cf-252 should be thoroughly researched

Metronidazole in the treatment of cervical cancer using Cf-252 neutron brachytherapy

International Nuclear Information System (INIS)

Maruyama, Y.

1986-01-01

Metronidazole was tested for its possible use in the Cf-252 brachytherapy of cervical cancer as a radiosensitizer and to deal with anaerobic pelvic infection. 15 patients were treated by only 14 were evaluable. All stages from stage IB-IVB were treated and complete local tumor regression was noted in all cases although it could take place very slowly. 5/14 (36%) are 1.5-3 year survivors but only among the patients with stage I-II disease. No unusual radio-enhancing action was observed but metronidazole appeared to be useful to treat the vaginal, cervix and uterine infections often associated with high stage disease and bulky, ulcerative or necrotic tumors

Shielding evaluation of a medical linear accelerator vault in preparation for installing a high-dose rate 252Cf remote after-loader

International Nuclear Information System (INIS)

Melhus, C. S.; Rivard, M. J.; KurKomelis, J.; Liddle, C. B.; Masse, F. X.

2005-01-01

In support of the effort to begin high-dose rate 252 Cf brachytherapy treatments at Tufts-New England Medical Center, the shielding capabilities of a clinical accelerator vault against the neutron and photon emissions from a 1.124 mg 252 Cf source were examined. Outside the clinical accelerator vault, the fast neutron dose equivalent rate was below the lower limit of detection of a CR-39 etched track detector and below 0.14 ± 0.02 μSv h -1 with a proportional counter, which is consistent, within the uncertainties, with natural background. The photon dose equivalent rate was also measured to be below background levels (0.1 μSv h -1 ) using an ionisation chamber and an optically stimulated luminescence dosemeter. A Monte Carlo simulation of neutron transport through the accelerator vault was performed to validate measured values and determine the thermal-energy to low-energy neutron component. Monte Carlo results showed that the dose equivalent rate from fast neutrons was reduced by a factor of 100,000 after attenuation through the vault wall, and the thermal-energy neutron dose equivalent rate would be an additional factor of 1000 below that of the fast neutrons. Based on these findings, the shielding installed in this facility is sufficient for the use of at least 5.0 mg of 252 Cf. (authors)

The temperature of fission fragments from spontaneous fission of {sup 252}Cf measured by time-of-flight spectrometer

Energy Technology Data Exchange (ETDEWEB)

Popkiewicz, M.; Osuch, S.; Szeflinski, Z.; Sztampke, A.; Wilhelmi, Z.; Wolinska, M.; Zaganczyk, R. [Warsaw Univ., Inst. of Experimental Physics, Nuclear Physics Div., Warsaw (Poland)

1997-12-31

The detection system MONA (Modular Neutron Array) consisting of eight large BC-501A liquid scintillators, was applied to determine the temperature of fission fragments emitted in spontaneous fission of {sup 252}Cf. The determination of the temperature was based on the measurement of the neutron spectra. 5 refs, 2 figs.

Importance of the neutrons kerma coefficient in the planning of Brachytherapy treatments with Cf-252 sources

International Nuclear Information System (INIS)

Paredes G, L.; Balcazar G, M.; Azorin N, J.; Francois L, J.L.

2006-01-01

The Cf-252 is a fast neutrons emitting radioisotope by spontaneous fission that can be used as sealed source in medicine applications, industry and research. Commercially its offer sources of different sizes, compact and with a fast neutrons emission of the order of 10 6 n/s-μg and an energy spectra that presents respectively maxim and average energy in 2.1 MeV and 0.7 MeV. In medicine new applications are being developed for the treatment of patient with hypoxic and voluminous tumors, where the therapy with photons has not given positive results, as well as for the protocols of therapy treatment by boron neutron capture, where very small sources of Cf-252 will be used with the interstitial brachytherapy technique of high and low dose rate. In this work an analysis of how the small differences that exist in the elementary composition of 4 wicked tumors, 4 ICRU healthy tissues and 3 substitute materials of ICRU tissue used in dosimetry are presented, its generate changes in the neutrons kerma coefficient in function of the energy and consequently in the absorbed dose in the interval of 11 eV to 29 MeV. These differences can produce maximum variations of the neutron kerma coefficients ratio for E n > 1 keV of the one: 15% tumor/ICRU guest healthy tissue, 12% ICRU tumor/muscle, 12% ICRU healthy tissues ICRU/ICRU muscle, 22% substitutes tissue/tumor and 22% ICRU substitutes tissue/muscle. Also, it was found that the average value of the neutrons kerma coefficient for the 4 wicked tumors is from 6% to 7% smaller that the average value for the soft tissue in the interval energy of interest for therapy with fast neutrons with E n > 1 MeV. These results have a special importance during the planning process of brachytherapy treatments with sources of 252 Cf, to optimize and to individualize the patients treatments. (Author)

Design, Construction, and Modeling of a 252Cf Neutron Irradiator

Directory of Open Access Journals (Sweden)

Blake C. Anderson

2016-01-01

Full Text Available Neutron production methods are an integral part of research and analysis for an array of applications. This paper examines methods of neutron production, and the advantages of constructing a radioisotopic neutron irradiator assembly using 252Cf. Characteristic neutron behavior and cost-benefit comparative analysis between alternative modes of neutron production are also examined. The irradiator is described from initial conception to the finished design. MCNP modeling shows a total neutron flux of 3 × 105 n/(cm2·s in the irradiation chamber for a 25 μg source. Measurements of the gamma-ray and neutron dose rates near the external surface of the irradiator assembly are 120 μGy/h and 30 μSv/h, respectively, during irradiation. At completion of the project, total material, and labor costs remained below $50,000.

Neutron-neutron angular correlations in spontaneous fission of 252Cf and 240Pu

Science.gov (United States)

Verbeke, J. M.; Nakae, L. F.; Vogt, R.

2018-04-01

Background: Angular anisotropy has been observed between prompt neutrons emitted during the fission process. Such an anisotropy arises because the emitted neutrons are boosted along the direction of the parent fragment. Purpose: To measure the neutron-neutron angular correlations from the spontaneous fission of 252Cf and 240Pu oxide samples using a liquid scintillator array capable of pulse-shape discrimination. To compare these correlations to simulations combining the Monte Carlo radiation transport code MCNPX with the fission event generator FREYA. Method: Two different analysis methods were used to study the neutron-neutron correlations with varying energy thresholds. The first is based on setting a light output threshold while the second imposes a time-of-flight cutoff. The second method has the advantage of being truly detector independent. Results: The neutron-neutron correlation modeled by FREYA depends strongly on the sharing of the excitation energy between the two fragments. The measured asymmetry enabled us to adjust the FREYA parameter x in 240Pu, which controls the energy partition between the fragments and is so far inaccessible in other measurements. The 240Pu data in this analysis was the first available to quantify the energy partition for this isotope. The agreement between data and simulation is overall very good for 252Cf(sf ) and 240Pu(sf ) . Conclusions: The asymmetry in the measured neutron-neutron angular distributions can be predicted by FREYA. The shape of the correlation function depends on how the excitation energy is partitioned between the two fission fragments. Experimental data suggest that the lighter fragment is disproportionately excited.

Young stellar population and ongoing star formation in the H II complex Sh2-252

Science.gov (United States)

Jose, Jessy; Pandey, A. K.; Samal, M. R.; Ojha, D. K.; Ogura, K.; Kim, J. S.; Kobayashi, N.; Goyal, A.; Chauhan, N.; Eswaraiah, C.

2013-07-01

In this paper, an extensive survey of the star-forming complex Sh2-252 has been undertaken with an aim to explore its hidden young stellar population as well as to understand the structure and star formation history for the first time. This complex is composed of five prominent embedded clusters associated with the subregions A, C, E, NGC 2175s and Teu 136. We used Two Micron All Sky Survey-near-infrared and Spitzer-Infrared Array Camera, Multiband Imaging Photometer for Spitzer photometry to identify and classify the young stellar objects (YSOs) by their infrared (IR) excess emission. Using the IR colour-colour criteria, we identified 577 YSOs, of which, 163 are Class I, 400 are Class II and 14 are transition disc YSOs, suggesting a moderately rich number of YSOs in this complex. Spatial distribution of the candidate YSOs shows that they are mostly clustered around the subregions in the western half of the complex, suggesting enhanced star formation activity towards its west. Using the spectral energy distribution and optical colour-magnitude diagram-based age analyses, we derived probable evolutionary status of the subregions of Sh2-252. Our analysis shows that the region A is the youngest (˜0.5 Myr), the regions B, C and E are of similar evolutionary stage (˜1-2 Myr) and the clusters NGC 2175s and Teu 136 are slightly evolved (˜2-3 Myr). Morphology of the region in the 1.1 mm map shows a semicircular shaped molecular shell composed of several clumps and YSOs bordering the western ionization front of Sh2-252. Our analyses suggest that next generation star formation is currently under way along this border and that possibly fragmentation of the matter collected during the expansion of the H II region as one of the major processes is responsible for such stars. We observed the densest concentration of YSOs (mostly Class I, ˜0.5 Myr) at the western outskirts of the complex, within a molecular clump associated with water and methanol masers and we suggest that it

Prompt neutron fission spectrum mean energies for the fissile nuclides and 252Cf

International Nuclear Information System (INIS)

Holden, N.E.

1985-01-01

The international standard for a neutron spectrum is that produced from the spontaneous fission of 252 Cf, while the thermal neutron induced fission neutron spectra for the four fissile nuclides, 233 U, 235 U, 239 Pu, and 241 Pu are of interest from the standpoint of nuclear reactors. The average neutron energies of these spectra are tabulated. The individual measurements are recorded with the neutron energy range measured, the method of detection as well as the average neutron energy for each author. Also tabulated are the measurements of the ratio of mean energies for pairs of fission neutron spectra. 75 refs., 9 tabs

Detection of alpha particles and Cf-252 fission fragments with solid track detectors and surface barrier detector. Efficiency calculation

International Nuclear Information System (INIS)

Khouri, M.T.F.C.; Koskinas, M.F.; Andrade, C. de; Vilela, E.C.; Hinostroza, H.; Kaschiny, J.E.A.; Costa, M.S. da; Rizzo, P.; Santos, W.M.S.

1990-01-01

A technique for particle detection by using track solid detector and also types of revealing and result analysis are presented concerned to Cf-252 fission fragments detection. Measurements of alpha particles detection efficiency using Makrofol E and surface barrier detector are performed. (L.C.J.A.)

Estimation of the LET threshold of single event upset of microelectronics in experiments with Cf-252

International Nuclear Information System (INIS)

Kuznetsov, N.V.; Nymmik, R.A.

1996-01-01

A method is proposed for analyzing single event upsets (SEU) in large scale integration circuits of random access memory (RAM) when exposed to Cf-252 fission fragments. The method makes is possible to find the RAM linear energy transfer (LET) threshold to be used for estimations of RAM SEU rates in space. The method is illustrated by analyzing experimental data for the 2 x 8 kbit CMOS/bulk RAM. (author)

Development of the neutron reference calibration field using a {sup 252}Cf standard source surrounded with PMMA moderators

Energy Technology Data Exchange (ETDEWEB)

Yoshida, T.; Kanai, K.; Tsujimura, N. [Japan Nuclear Cycle Development Institute, Ibaraki-ken (Japan)

2002-07-01

The authors developed the neutron reference calibration fields using a {sup 252} Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the {sup 252} Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO{sub 2}-UO{sub 2} mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments.

Bias in calculated keff from subcritical measurements by the 252Cf-source-driven noise analysis method

International Nuclear Information System (INIS)

Mihalczo, J.T.; Valentine, T.E.

1995-01-01

The development of MCNP-DSP, which allows direct calculation of the measured time and frequency analysis parameters from subcritical measurements using the 252 Cf-source-driven noise analysis method, permits the validation of calculational methods for criticality safety with in-plant subcritical measurements. In addition, a method of obtaining the bias in the calculations, which is essential to the criticality safety specialist, is illustrated using the results of measurements with 17.771-cm-diam, enriched (93.15), unreflected, and unmoderated uranium metal cylinders. For these uranium metal cylinders the bias obtained using MCNP-DSP and ENDF/B-V cross-section data increased with subcriticality. For a critical experiment [height (h) = 12.629 cm], it was -0.0061 ± 0.0003. For a 10.16-cm-high cylinder (k ∼ 0.93), it was 0.0060 ± 0.0016, and for a subcritical cylinder (h = 8.13 cm, k ∼ 0.85), the bias was -0.0137 ± 0.0037, more than a factor of 2 larger in magnitude. This method allows the nuclear criticality safety specialist to establish the bias in calculational methods for criticality safety from in-plant subcritical measurements by the 252 Cf-source-driven noise analysis method

Physics of the 252Cf-source-driven noise analysis measurement

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.; Perez, R.B.; Mattingly, J.K.

1997-01-01

The 252 Cf-source-driven noise analysis method is a versatile measurements tool that has been applied to measurements for initial loading of reactors, quality assurance of reactor fuel elements, fuel processing facilities, fuel reprocessing facilities, fuel storage facilities, zero-power testing of reactors, verification of calculational methods, process monitoring, characterization of storage vaults, and nuclear weapons identification. This method's broad range of application is due to the wide variety of time- and frequency domain signatures, each with unique properties, obtained from the measurement. The following parameters are obtained from this measurement: average detector count rates, detector multiplicities, detector autocorrelations, cross-correlation between detectors, detector autopower spectral densities, cross-power spectral densities between detectors, coherences, and ratios of spectral densities. All of these measured parameters can also be calculated using the MCNP-DSP Monte Carlo code. This paper presents a review of the time-domain signatures obtained from this measurement

A new type of active actinide target for studying fission and (n,xn) reactions

International Nuclear Information System (INIS)

Belier, G.; Aupiais, J.; Varignon, C.; Vayre, S.

2011-01-01

A new type of active target for the detection of fission of actinides has been developed, it is based on α spectrometry through liquid scintillation. The target uses the liquid-liquid extraction in order to mix the actinide with the liquid organic scintillator. The actinide to be detected is inside the detector itself which maximises the efficiency of the detector. The use of an organic scintillator allows the identification of the particles emitted. Indeed, the time delay for the transfer of the energy deposited in the solvent towards the scintillating molecules depends on the type of the energy deposits: instantaneous fluorescence is obtained for direct excitation while delayed fluorescence is obtained for energy deposits through ionization. By discriminating the different slow and quick components of the photomultiplier signal it is then possible to identify the particle: beta, alpha or fission products. This target has been tested with Cf 252 irradiated with 18 MeV neutrons, the experimental data show different peaks corresponding to alpha decay (97%), spontaneous fission (3%), beta decay and recoil protons due to neutron emissions. (A.C.)

Methods for Cf-252 cervix cancer therapy and treatment planning for GYN malignancies in Lexington

International Nuclear Information System (INIS)

Coffey, C.W.; Yoneda, J.; Beach, J.L.; Maruyama, Y.

1986-01-01

This paper presents the clinical physics methods and treatment planning techniques used in both the external beam and brachytherapy treatment of GYN malignancies in the Radiotherapy Department of the University of Kentucky Medical Center. Specific description of the departmental implant suite and brachytherapy procedures are included. The optimization of brachytherapy applicator placement, source arrangement, and normal and tumor total dose and dose distributions are presented. Quality assurance protocols for teletherapy and brachytherapy and patient and staff safety procedures with Cf-252 are discussed

Parameters for several plutonium nuclides and 252Cf of safeguards interest

International Nuclear Information System (INIS)

Zucker, M.S.; Holden, N.E.

1984-01-01

Sets of the neutron emission multiplicity distribution gleaned from the literature for plutonium nuclides and 252 Cf are considered. A methodology for rendering the different sets comparable is presented and used to convert the sets to a common basis such that the differences can be evaluated objectively and that allows realistic estimate of the uncertainties. This in turn permits development of a canonical consensus set in certain instances. Evaluated data on the average neutron multiplicity, the total half-lives, and the half-lives for spontaneous fission are also given. A careful search of the literature reveals that the data on neutron multiplicity distributions for many nuclides is surprisingly sparse, considering that almost thirty years has elapsed since the original pioneering work, which in some cases, yield the only reported value. 93 references, 26 tables

State Waste Discharge Permit application for industrial discharge to land: 200 East Area W-252 streams

International Nuclear Information System (INIS)

1993-12-01

This document constitutes the WAC 173-216 State Waste Discharge Permit application for six W-252 liquid effluent streams at the Hanford Site. Appendices B through H correspond to Section B through H in the permit application form. Within each appendix, sections correspond directly to the respective questions on the application form. The appendices include: Product or service information; Plant operational characteristics; Water consumption and waterloss; Wastewater information; Stormwater; Other information; and Site assessment

Design of a thermal neutron field by 252Cf source for measurement of 10B concentrations in the blood samples for BNCT

International Nuclear Information System (INIS)

Naito, H.; Sakurai, Y.; Maruhashi, A.

2006-01-01

10 B concentrations in the blood samples for BNCT has been estimated due to amounts of prompt gamma rays from 10 B in the fields of thermal neutrons from a special guide tube attached to research reactor. A system using radioisotopes as the source of thermal neutron fields has advantages that are convenient and low cost because it doesn't need running of a reactor or an accelerator. The validity of 252 Cf as a neutron source for 10 B concentrations detection system was investigated. This system is composed of D 2 O moderator, Pb reflector/filter, C reflector, and LiF filter. A thermal neutron field with low background gamma-rays is obtained. A large source of 252 Cf is required to obtain a sufficient flux. (author)

About the first experiment on investigation of 129I, 237Np, 238Pu and 239Pu transmutation at the nuclotron 2.52 GeV deuteron beam in neutron field generated in U/Pb-assembly 'Energy plus transmutation'

International Nuclear Information System (INIS)

Krivopustov, M.I.; Pavliouk, A.V.; Malakhov, A.I.

2008-01-01

Preliminary results of the first experiment with energy 2.52 GeV at the electronuclear setup which consists of Pb-target (diameter 8.4 cm, length 45.6 cm) and nat U-blanket (206.4 kg), transmutation samples of 129 I, 237 Np, 238 Pu and 239 Pu (radioecological aspect) are described. Hermetically sealed samples in notable amounts are gathered in atomic reactors and setups of industries which use nuclear materials and nuclear technologies were irradiated in the field of neutrons produced in the Pb-target and propagated in the nat U-blanket. Estimates of transmutations were obtained as a result of measurements of gamma activities of the samples. The information about the space and energy distribution of neutrons in the volume of the lead target and the uranium blanket was obtained with the help of sets of activation threshold detectors (Al, Co, Y, I, Au, Bi and others), solid-state nuclear track detectors, 3 He neutron detectors and nuclear emulsion. Comparison of the experimental data with the results of simulation with the MCNPX program was performed

Comparison of 252Cf time correlated induced fission with AmLi induced fission on fresh MTR reserach reactor fuel

Energy Technology Data Exchange (ETDEWEB)

Joshi, Jay Prakash [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-05-01

The objectives of this project are to calibrate the Advanced Experimental Fuel Counter (AEFC), benchmark MCNP simulations using experimental results, investigate the effects of change in fuel assembly geometry, and finally to show the boost in doubles count rates with 252Cf active soruces due to the time correlated induced fission (TCIF) effect.

Evaluation of the 252Cf-source-driven neutron noise analysis method for measuring the subcriticality of LWR fuel storage casks

International Nuclear Information System (INIS)

Mihalczo, J.T.

1987-01-01

The 252 Cf-source-driven neutron noise analysis method was evaluated to determine if it could be used to measure the subcriticality of storage casks of burnt LWR fuel submerged in fuel storage pools, fully loaded and as they are being loaded. The motivation for this evaluation was that measurements of k/sub eff/ would provide the parameter most directly related to the criticality safety of storage cask configurations of LWR fuel and could allow proper credit for fuel burnup without reliance on calculations. This in turn could lead to more cost-effective cask designs. Evaluation of the method for this application was based on (1) experiments already completed at a critical experiments facility using arrays of PWR fuel pins typical of the size of storage cask configurations, (2) the existence of neutron detectors that can function in shipping cask environments, and (3) the ability to construct ionization chambers containing 252 Cf of adequate intensity for these measurements. These three considerations are discussed

Spectroscopy of neutron-rich nuclei populated in the spontaneous fission of 252Cf and 248Cm

International Nuclear Information System (INIS)

Smith, A. G.; Simpson, G. S.; Billowes, J.; Durell, J. L.; Phillips, W. R.; Dagnall, P. J.; Freeman, S. J.; Leddy, M.; Roach, A. A.; Smith, J. F.

1999-01-01

In this paper we present research that has been carried out using the Euroball and Eurogam arrays to detect γ rays emitted from spontaneously fissioning 248 Cm and 252 Cf. The paper focuses on three sub-areas of current activity, namely, the measurement of yields of secondary fragment pairs, the measurement of state lifetimes at around spin 10, and recent measurements of g-factors of excited states in fission fragments. (c) 1999 American Institute of Physics

Sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to neutrons emitted by a 252Cf source

International Nuclear Information System (INIS)

Spurny, Frantisek; Medioni, Roger; Chapuis, A.; Portal, Guy.

1975-07-01

The specific sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to the neutron spectrum of a 252 Cf source was measured and the effect of the size and composition of the containers in which they might be put was investigated. PB33 radiophotoluminescent glasses, radiothermoluminescent alumina and calcium sulfate were less sensitive to fission neutrons whereas photographic emulsions were more sensitive. The former should be used for γ detection in mixed fields of photons and fission neutrons [fr

Abscesso pulmonar de aspiração: análise de 252 casos consecutivos estudados de 1968 a 2004 Lung abscess: analysis of 252 consecutive cases diagnosed between 1968 and 2004

Directory of Open Access Journals (Sweden)

José da Silva Moreira

2006-04-01

Full Text Available OBJETIVO: Apresentar a experiência de um serviço especializado em doenças respiratórias no manejo de casos de abscesso pulmonar de aspiração. MÉTODOS: Descrevem-se aspectos diagnósticos e resultados terapêuticos de 252 casos consecutivos de pacientes com abscesso de pulmão, hospitalizados de 1968 a 2004. RESULTADOS: Dos 252 casos, 209 ocorreram em homens e 43 em mulheres, com média de idade de 41,4 anos. Eram alcoolistas 70,2% dos pacientes. Tosse, expectoração, febre e comprometimento do estado geral ocorreram em mais de 97% dos casos, 64% tinham dor torácica, 30,2% hipocratismo digital, 82,5% apresentavam dentes em mau estado de conservação, 78,6% tiveram episódio de perda de consciência e 67,5% apresentavam odor fétido de secreções broncopulmonares. Em 85,3% dos casos as lesões localizavam-se nos segmentos posterior de lobo superior ou superior de lobo inferior, 96,8% delas unilateralmente. Em 24 pacientes houve associação de empiema pleural (9,5%. Flora mista foi identificada em secreções broncopulmonares ou pleurais em 182 pacientes (72,2 %. Todos os doentes foram inicialmente tratados com antibióticos (principalmente penicilina ou clindamicina e 98,4 % deles foram submetidos à drenagem postural. Procedimentos cirúrgicos foram efetuados em 52 (20,6% pacientes (24 drenagens de empiema, 22 ressecções pulmonares e 6 pneumostomias. Cura foi obtida em 242 pacientes (96,0% e 10 faleceram (4,0%. CONCLUSÃO: O abscesso pulmonar de aspiração ocorreu predominantemente em indivíduos adultos masculinos com doença dentária e episódio antecedente de perda de consciência (especialmente por alcoolismo. A maioria dos pacientes foi tratada clinicamente (antibióticos e drenagem postural. Um quinto deles submeteu-se a algum procedimento cirúrgico.OBJECTIVE: To relate the experience of the staff at a health care facility specializing in the management of patients with aspiration lung abscess. METHODS: Diagnostic aspects

Application of TSH bioindicator for studying the biological efficiency of radiation

International Nuclear Information System (INIS)

Cebulska-Wasilewska, A.; Rekas, K.; Kim, J.K.

1999-01-01

The effectiveness of neutrons from a californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH assay) was studied. Special attention was paid to check whether any enhancement in effects caused by the process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescences, normal or prepared with chemicals containing boron, were irradiated in the air with neutrons from the 252 Cf source at KOREI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) of the boron under the study, Tradescantia inflorescences without chemical pretreatment were irradiated with various doses of X-rays. The ranges of radiation doses for neutrons were 0-0.1Gy and for X-rays 0-0.5 Gy. After time needed to complete the postirradiation repair tradescantia cuttings were transported to Cracow were screening of gene and lethal mutations in somatic cells of stamen hairs have been done and dose response relationships were plotted. In two independent experimental studies an alternation of dose-response curves was observed, probably due to slight changes in the postexposure plant treatment. However, it has not results in the change of the maximal RBE values, which for the induction of gene mutations were estimated as 5.6 in the pilot studies and 5.8 one year later. Inflorescences pretreated with borax and BSH responded to neutrons differently. The values of RBE have changed from 5.6 to 7.9 in the case of plants pretreated with 240 ppm of B-10 from borax, and 5.8 to 7.2 in the case of 400 ppm of B-10 from BSH. The results showed an increase, although statistically insignificant, in biological efficiency of radiation from the 252 Cf source in the samples pretreated with boron containing chemicals. (author)

Quantum-chemical consideration of extermal valent forms of actinides

International Nuclear Information System (INIS)

Ionova, G.V.; Pershina, V.G.; Spitsyn, V.I.

1982-01-01

Stability of valent forms of actinides that has not yet studied experimentally, is considered within the framework of quantum-chemical considerations. Oxidizing potentials E 0 for actinide elements are determined theoretically. A dependence of the definite valent state stability on relativistic effect is shown. A conclusion is made that oxidizing potential E 0 (4-5) for americium should be higher than E 0 (4-5) for plutonium. A relatively small oxidizing potential E 0 (4-5) for curium speaks about principle possibility of production of five-valent curium in solution, though it is less stable than the six-valent one. Oxidizing potential corresponding to transition of three-valent californium into the four-valent state should be less than the value adopted in literature. A relatively small oxidizing potential of californium E 0 (4-5) speaks about possible existence of five-valent californium in solution

New isomeric states in 152,154,156Nd produced by spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Phan, X.H.; Theisen, C.; Belier, G.; Girod, M.; Meot, V.; Peru, S.; Astier, A.; Ducroux, L.; Meyer, M.; Redon, N.

1998-01-01

Isomeric states have been observed in fission-fragments produced by spontaneous fission of 252 Cf. These states are found in neutron rich nuclei of different structure and deformations. About 50 isomeric nuclei have been observed using coincidences between γ-rays identified in EUROGAM II and fission fragments detected in photovoltaic cells (SAPhIR). Lifetimes in the range from 20 ns to 2μs have been measured. Presented calculations based on HFB+D1S force on new measured isomeric states in the 152,154,156 Nd show evidence for K-isomers. (orig.)

MRI-Targeted or Standard Biopsy for Prostate-Cancer Diagnosis.

Science.gov (United States)

Kasivisvanathan, Veeru; Rannikko, Antti S; Borghi, Marcelo; Panebianco, Valeria; Mynderse, Lance A; Vaarala, Markku H; Briganti, Alberto; Budäus, Lars; Hellawell, Giles; Hindley, Richard G; Roobol, Monique J; Eggener, Scott; Ghei, Maneesh; Villers, Arnauld; Bladou, Franck; Villeirs, Geert M; Virdi, Jaspal; Boxler, Silvan; Robert, Grégoire; Singh, Paras B; Venderink, Wulphert; Hadaschik, Boris A; Ruffion, Alain; Hu, Jim C; Margolis, Daniel; Crouzet, Sébastien; Klotz, Laurence; Taneja, Samir S; Pinto, Peter; Gill, Inderbir; Allen, Clare; Giganti, Francesco; Freeman, Alex; Morris, Stephen; Punwani, Shonit; Williams, Norman R; Brew-Graves, Chris; Deeks, Jonathan; Takwoingi, Yemisi; Emberton, Mark; Moore, Caroline M

2018-05-10

Multiparametric magnetic resonance imaging (MRI), with or without targeted biopsy, is an alternative to standard transrectal ultrasonography-guided biopsy for prostate-cancer detection in men with a raised prostate-specific antigen level who have not undergone biopsy. However, comparative evidence is limited. In a multicenter, randomized, noninferiority trial, we assigned men with a clinical suspicion of prostate cancer who had not undergone biopsy previously to undergo MRI, with or without targeted biopsy, or standard transrectal ultrasonography-guided biopsy. Men in the MRI-targeted biopsy group underwent a targeted biopsy (without standard biopsy cores) if the MRI was suggestive of prostate cancer; men whose MRI results were not suggestive of prostate cancer were not offered biopsy. Standard biopsy was a 10-to-12-core, transrectal ultrasonography-guided biopsy. The primary outcome was the proportion of men who received a diagnosis of clinically significant cancer. Secondary outcomes included the proportion of men who received a diagnosis of clinically insignificant cancer. A total of 500 men underwent randomization. In the MRI-targeted biopsy group, 71 of 252 men (28%) had MRI results that were not suggestive of prostate cancer, so they did not undergo biopsy. Clinically significant cancer was detected in 95 men (38%) in the MRI-targeted biopsy group, as compared with 64 of 248 (26%) in the standard-biopsy group (adjusted difference, 12 percentage points; 95% confidence interval [CI], 4 to 20; P=0.005). MRI, with or without targeted biopsy, was noninferior to standard biopsy, and the 95% confidence interval indicated the superiority of this strategy over standard biopsy. Fewer men in the MRI-targeted biopsy group than in the standard-biopsy group received a diagnosis of clinically insignificant cancer (adjusted difference, -13 percentage points; 95% CI, -19 to -7; Pprostate cancer who had not undergone biopsy previously. (Funded by the National Institute for

A monocrystal of 59Co as a nuclear orientation thermometer in neutron experiments with oriented targets

International Nuclear Information System (INIS)

Fasoli, U.; Galeazzi, G.; Pavan, P.; Toniolo, D.; Zago, G.; Zannoni, R.

1980-01-01

An apparatus for measuring temperatures in the millikelvin region is described based on the 'deformation effect' on fast neutron transmission through an aligned 59 Co monocrystal, employing a 252 Cf pill as the neutron source. A statistical accuracy of a few percent in a few minutes is obtainable with a heat input of some tens of pW. The apparatus is suitable in neutron experiments with oriented targets when the gamma-ray background hinders the use of gamma-ray anisotropy thermometers. In these and similar cases, in which the temperature must be held constant for long periods, the large heat capacity of the cobalt sample is not a drawback. (orig.)

Neutron activation determination of gold in technogenic raw materials with different mineral composition

Directory of Open Access Journals (Sweden)

Yudakov Aleksandr A.

2015-01-01

Full Text Available The methods used to determine the gold content in the technogenic objects of gold mining were analyzed regarding their non-homogeneity and complexity of chemical and mineral compositions. A possible application of the neutron activation analysis with the use of the californium source of neutrons for determining the content of fine-grained and extra-fine-grained gold in the technogenic objects, including the bottom-ash waste of energy providers, is considered. It was demonstrated that the chemical composition of the sample affects the neuron flux distribution in the sample, which can essentially distort the results of the neutron activation analysis. In order to eliminate possible systematic errors investigations of the effect of the sample mineral composition on the results of the gold determination using the neutron activation analysis were carried out. Namely, a large mass of rock (3-5 kg was loaded into an activation zone using four matrix types such as silicate, carbon-containing, iron-containing, and titanium magnetite. It was shown that there wereno significant difference between the dispersal of the fluxes of thermal and resonance neutrons emitted from 252Cf during activation of the gold-containing technogenic samples with different mineral compositions.

Interface detection by neutron scattering

International Nuclear Information System (INIS)

De Monchy, A.R.; Kok, C.A.; Dorrepaal, J.

1979-01-01

A method and apparatus for detecting an interface of materials having different hydrogen content present in a metal vessel or pipe eg. made of steel, are described. Steel walls of columns, reactors, pipelines etc can be monitored. It is very suitable for detection of liquid water or hydrocarbons present in gas pipelines and also for the detection of a liquid hydrocarbon in a vessel or column. A series of measurements of the hydrogen density of the contents of a vessel or pipe are made using at least one californium-252 neutron source located near the outer side of the pipe. Neutrons are emitted and are scattered by the contents of the pipe. At least one neutron detector is located near the outer side of the metal wall. The detectors have a higher sensitivity for scattered neutrons (from the light hydrogen nuclei present in water or hydrocarbons). A source of 0.1 - 1 micrograms produces enough neutrons for most technical applications so the handling is relatively safe although shielding is advocated. The detectors contain helium-3 at a pressure of about 10 bar. Current pulses from the detector are counted. (U.K.)

Design of active-neutron fuel rod scanner

International Nuclear Information System (INIS)

Griffith, G.W.; Menlove, H.O.

1996-01-01

An active-neutron fuel rod scanner has been designed for the assay of fissile materials in mixed oxide fuel rods. A 252 Cf source is located at the center of the scanner very near the through hole for the fuel rods. Spontaneous fission neutrons from the californium are moderated and induce fissions within the passing fuel rod. The rod continues past a combined gamma-ray and neutron shield where delayed gamma rays above 1 MeV are detected. We used the Monte Carlo code MCNP to design the scanner and review optimum materials and geometries. An inhomogeneous beryllium, graphite, and polyethylene moderator has been designed that uses source neutrons much more efficiently than assay systems using polyethylene moderators. Layers of borated polyethylene and tungsten are used to shield the detectors. Large NaI(Tl) detectors were selected to measure the delayed gamma rays. The enrichment zones of a thermal reactor fuel pin could be measured to within 1% counting statistics for practical rod speeds. Applications of the rod scanner include accountability of fissile material for safeguards applications, quality control of the fissile content in a fuel rod, and the verification of reactivity potential for mixed oxide fuels. (orig.)

Sources of Radioactive Isotopes for Dirty Bombs

Science.gov (United States)

Lubenau, Joel

2004-05-01

From the security perspective, radioisotopes and radioactive sources are not created equal. Of the many radioisotopes used in industrial applications, medical treatments, and scientific research, only eight, when present in relatively large amounts in radioactive sources, pose high security risks primarily because of their prevalence and physical properties. These isotopes are americium-241, californium-252, cesium-137, cobalt-60, iridium-192, radium-226, plutonium-238, and strontium-90. Except for the naturally occurring radium-226, nuclear reactors produce the other seven in bulk commercial quantities. Half of these isotopes emit alpha radiation and would, thus, primarily pose internal threats to health; the others are mainly high-energy gamma emitters and would present both external and internal health hazards. Therefore, the response to a "dirty bomb" event depends on what type of radioisotope is chosen and how it is employed. While only a handful of major corporations produce the reactor-generated radioisotopes, they market these materials to thousands of smaller companies and users throughout the world. Improving the security of the high-risk radioactive sources will require, among other efforts, cooperation among source suppliers and regulatory agencies.

In situ prompt gamma-ray measurement of river water salinity in northern Taiwan using HPGe-252Cf probe

International Nuclear Information System (INIS)

Jiunnhsing Chao; Chien Chung

1991-01-01

A portable HPGe- 252 Cf probe dedicated to in situ survey of river water salinity was placed on board a fishing boat to survey the Tamsui River in northern Taiwan. The variation of water salinity is surveyed by measuring the 6111 keV chlorine prompt photopeak along the river. Results indicate that the probe can be used as a salinometer for rapid, in situ measurement in polluted rivers or sea. (author)

Watermelon germplasm lines USVL246-FR2 and USVL252-FR2 tolerant to fusarium oxysporum f. sp. niveum race 2

Science.gov (United States)

Two improved germplasm lines of wild watermelon (Citrullus lanatus var. citroides) designated USVL246-FR2 and USVL252-FR2 were released in 2012 by the Agricultural Research Service of the U.S. Department of Agriculture (Wechter et al. 2012). These lines are each highly uniform for growth characteri...

Investigation of short-living fission products from the spontaneous fission of Cf-252

International Nuclear Information System (INIS)

Klonk, H.

1976-01-01

In this paper, a method of separating and measuring fission products of Cf-252 is presented. The measurement was achieved by means of γ-spectrometry and thus provides a quantitative analysis with a good separation of the fission products with respect to both atomic number Z and mass number A. The separation of the fission products from the fission source was achieved by means of solid traps. An automatic changing apparatus made it possible to keep irradiation and measuring times short, so even very short-lived fission products could be registered. The quantitative evaluation of primary fission products was made possible by correction according to Bateman equations. With that, the yields of single nuclides and the dispersion of charge can be determined. (orig./WL) [de

Influence of paternal 252Cf neutron exposure on abnormal sperm, embryonal lethality, and liver tumorigenesis in the F1 offspring of mice

International Nuclear Information System (INIS)

Watanabe, Hiromitsu; Takahashi, Tadateru; Lee, Juing-Yi

1996-01-01

Experiments were conducted to determine whether neutron-induced genetic damage in parental germline cells can lead to the development of cancer in the offspring. Seven-week-old C3H male mice were irradiated with 252 Cf neutrons at a dose of 0, 50, 100, or 200 cGy. Two weeks or 3 months after irradiation, the male mice were mated with virgin 9-week-old C57BL females. Two weeks after irradiation, the irradiated male mice showed an increased incidence of sperm abnormalities, which led to embryo lethalities in a dose-dependent manner when they were mated with unirradiated female mice. Furthermore, liver tumors in male offspring of male mice in the 50 cGy group were significantly increased in 19 of 44 (43.2%) animals, in clear contrast to the unirradiated group (1 of 31; 3.2%) (P 1 generation may be caused by genetic transmission of hepatoma-associated trait (s) induced by 252 Cf neutron irradiation. (author)

Neutron calibration field of bare {sup 252}Cf source in Vietnam

Energy Technology Data Exchange (ETDEWEB)

Le, Ngoc Thiem; Tran, Hoai Nam; Nguyen, Khai Tuan [Institute for Nuclear Science and Technology, Hanoi (Viet Nam); Trinh, Glap Van [Institute of Research and Development, Duy Tan University, Da Nang (Viet Nam)

2017-02-15

This paper presents the establishment and characterization of a neutron calibration field using a bare {sup 252}Cf source of low neutron source strength in Vietnam. The characterization of the field in terms of neutron flux spectra and neutron ambient dose equivalent rates were performed by Monte Carlo simulations using the MCNP5 code. The anisotropy effect of the source was also investigated. The neutron ambient dose equivalent rates at three reference distances of 75, 125, and 150 cm from the source were calculated and compared with the measurements using the Aloka TPS-451C neutron survey meters. The discrepancy between the calculated and measured values is found to be about 10%. To separate the scattered and the direct components from the total neutron flux spectra, an in-house shadow cone of 10% borated polyethylene was used. The shielding efficiency of the shadow cone was estimated using the MCNP5 code. The results confirmed that the shielding efficiency of the shadow cone is acceptable.

Exclusive radiation therapy of endometrial carcinoma using HDR Co-60 and Cf-252 sources

International Nuclear Information System (INIS)

Inciura, A.; Janulionis, E.; Atkocius, V.

2000-01-01

Although the main treatment of endometrial cancer is surgery, the gross spread of carcinoma in pelvis, elderly age of the patients and serious therapeutical diseases do not allow to operate 20% of the patients. For these patients only radical treatment decision is the combined radiation therapy. However, using various modalities of combined radiotherapy, the treatment results are not satisfying: only 52% of patients survive 5 years. There was implemented a new method of combined radiotherapy, using a three-channel applicator with two-positional locating of HDR Co-60 radioactive sources (group I). A new method of brachytherapy for endometrial carcinoma using a HDR Cf 252 sources (group II) was implemented too. For group I the medium total dose of the point A was 77.6 Gy, point I - 69.6 Gy. point 2 - 84.2 Gy, point B - 52.6 Gy, For group II the medium total dose the points A, 3 and 4 was 50 iGy. For group I 1 year overaII survival rate was 85%, 3 year - 73%. The 3 year survival rate for stage I was 79%, for stage II - 89%, for stage III - 33%. 3 year survival for highly virulent tumours - 56% and for low virulent (adenocarcinoma) - 82% was statistically different. The loss of tumour differentiation correlated with the worse prognosis: 3 year survival for G1 and G2 tumours was 92%, for G3 - 45%. Low hemoglobin level was also associated with low survival rate: 2 year survival for Hb≥120g/l was 85% and Hb<120g/l - 23%. 1 year survival rate was 87%, 3 year - 66%, 5 year - 58% for group II, treated with Cf-252. Radiation complications occurred for 13.8% of the patients for group I and 6.2% for group II. Good survival rates and a small number of complications sufficiently proofed treatment method. (author)

A search for back-to-back e+e- pairs in the spontaneous-fission disintegration of 252Cf

International Nuclear Information System (INIS)

Tsunoda, T.; Nakamura, S.; Orito, S.; Minowa, M.

1995-01-01

A back-to-back electron-positron pair is searched for in spontaneous-fission disintegration of 252 Cf. The emission of such a pair, if observed, might be a manifestation of production and prompt decay of a heretofore unknown neutral particle. The emission rate of such a pair is found to be less than (2.5-5.5) . 10 -10 per fission at the 95% confidence level depending on the mass of the hypothetical particle which is between 40 and 200 MeV/c 2 . (orig.)

The use of polyimide foils to prevent contamination from self-sputtering of {sup 252}Cf deposits in high-accuracy fission counting

Energy Technology Data Exchange (ETDEWEB)

Gilliam, David M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)], E-mail: david.gilliam@nist.gov; Yue, Andrew [Department of Physics and Astronomy, University of Tennessee, Knoxville, TN (United States); Scott Dewey, M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)

2008-06-01

It is demonstrated that a thin polyimide foil can be employed to prevent contamination from the self-sputtering of a {sup 252}Cf source under vacuum, with small energy loss of the emitted fission fragments, with very small effect on the efficiency of counting the fission fragments, and with a long lifetime of the plastic foils.

Gamma ray transitions in de-excitation of 252Cf spontaneous fission fragments

International Nuclear Information System (INIS)

Khan, N.A.; Rashid, K.; Ahmad, M.; Qureshi, I.E.; Alam, G.D.; Ali, A.; Bhatti, N.; Horsch, F.

1983-11-01

Gamma rays in the range from 60 keV to 730 keV have been observed following the spontaneous fission of 252 Cf, with high resolution Ge(Li) detector, full width at half maximum (FWHM) of 700 eV at 122 keV, in coincidence with the two fission fragments observed with surface barrier detectors. A total number of 18, 636, 549 events were recorded over a run period of about 150 hours stretching over three weeks. The events were sorted to generate gamma ray spectra belonging to 2 amu intervals gamma of the fragment masses and 6 MeV intervals of the total kinetic energy released. Some of the prominent gamma lines belonging to various masses of the fission fragments have been identified. For some gamma lines, the intensities have been evaluated as a function of the total kinetic energy of the fission fragments. (authors)

Fragment angular momentum and descent dynamics in {sup 252}Cf spontaneous fission

Energy Technology Data Exchange (ETDEWEB)

Popeko, G.S.; Ter-Akopian, G.M.; Daniel, A.V.; Oganessian, Y.T.; Kliman, J. [JINR, Dubna, 141980 (Russia); Ter-Akopian, G.M.; Hamilton, J.H.; Kormicki, J.; Daniel, A.V.; Ramayya, A.V.; Hwang, J.K.; Sandulescu, A.; Florescu, A.; Greiner, W. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Ter-Akopian, G.M.; Daniel, A.V.; Florescu, A.; Greiner, W. [JIHIR, Oak Ridge, Tennessee 37831 (United States); Greiner, W. [ITP, J.W. Goethe University, D-60054, Frankfurt am Main (Germany); Florescu, A. [IAP, Bucharest, P.O. Box MG-6, (Russian Federation); Kliman, J.; Morhac, M. [IP SASc, Bratislava (Slovak Republic); Rasmussen, J.O. [LBNL, Berkeley, California 94720 (United States); Stoyer, M.A. [LLNL, Livermore , California 94550 (United States); Cole, J.D. [INEL, Idaho Falls, Idaho 83415 (United States)

1998-12-01

Fragment angular momenta as a function of neutron multiplicity were extracted for the first time for the Mo-Ba and Zr-Ce charge splits of {sup 252}Cf by studying prompt coincident {gamma}-rays. The obtained primary fragment angular momenta do not continuously rise with the increase in the number of neutrons evaporated. In frame of the scission point bending oscillation model such regularity is explained due the decrease of the bending temperature. Adiabatic bending oscillations (T=0) are obtained at large ({nu}{sub tot}{gt}5) and small ({nu}{sub tot}=0) scission point elongation. These oscillations are excited to the temperature of 2{endash}3 MeV for the most probable scission configurations indicating a weak coupling between collective and internal degrees of freedom. A strong coupling between the collective bending and dipole oscillations was found. {copyright} {ital 1998 American Institute of Physics.}

Generation of the V4.2m5 and AMPX and MPACT 51 and 252-Group Libraries with ENDF/B-VII.0 and VII.1

Energy Technology Data Exchange (ETDEWEB)

Kim, Kang Seog [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States). Consortium for Advanced Simulation of LWRs (CASL)

2016-12-12

The evaluated nuclear data file (ENDF)/B-7.0 v4.1m3 MPACT 47-group library has been used as a main library for the Consortium for Advanced Simulation of Light Water Reactors (CASL) neutronics simulator in simulating pressurized water reactor (PWR) problems. Recent analysis for the high void boiling water reactor (BWR) fuels and burnt fuels indicates that the 47-group library introduces relatively large reactivity bias. Since the 47- group structure does not match with the SCALE 6.2 252-group boundaries, the CASL Virtual Environment for Reactor Applications Core Simulator (VERA-CS) MPACT library must be maintained independently, which causes quality assurance concerns. In order to address this issue, a new 51-group structure has been proposed based on the MPACT 47- g and SCALE 252-g structures. In addition, the new CASL library will include a 19-group structure for gamma production and interaction cross section data based on the SCALE 19- group structure. New AMPX and MPACT 51-group libraries have been developed with the ENDF/B-7.0 and 7.1 evaluated nuclear data. The 19-group gamma data also have been generated for future use, but they are only available on the AMPX 51-g library. In addition, ENDF/B-7.0 and 7.1 MPACT 252-g libraries have been generated for verification purposes. Various benchmark calculations have been performed to verify and validate the newly developed libraries.

Generation of the V4.2m5 and AMPX and MPACT 51 and 252-Group Libraries with ENDF/B-VII.0 and VII.1

International Nuclear Information System (INIS)

Kim, Kang Seog

2016-01-01

The evaluated nuclear data file (ENDF)/B-7.0 v4.1m3 MPACT 47-group library has been used as a main library for the Consortium for Advanced Simulation of Light Water Reactors (CASL) neutronics simulator in simulating pressurized water reactor (PWR) problems. Recent analysis for the high void boiling water reactor (BWR) fuels and burnt fuels indicates that the 47-group library introduces relatively large reactivity bias. Since the 47- group structure does not match with the SCALE 6.2 252-group boundaries, the CASL Virtual Environment for Reactor Applications Core Simulator (VERA-CS) MPACT library must be maintained independently, which causes quality assurance concerns. In order to address this issue, a new 51-group structure has been proposed based on the MPACT 47- g and SCALE 252-g structures. In addition, the new CASL library will include a 19-group structure for gamma production and interaction cross section data based on the SCALE 19- group structure. New AMPX and MPACT 51-group libraries have been developed with the ENDF/B-7.0 and 7.1 evaluated nuclear data. The 19-group gamma data also have been generated for future use, but they are only available on the AMPX 51-g library. In addition, ENDF/B-7.0 and 7.1 MPACT 252-g libraries have been generated for verification purposes. Various benchmark calculations have been performed to verify and validate the newly developed libraries.

Study of scission shapes in spontaneous ternary fission of 252Cf

International Nuclear Information System (INIS)

Singer, P.; Schwalm, D.; Thirolf, P.; Goennenwein, F.; Hesse, M.

1995-06-01

A new kinematic study on the ternary fission of 252 Cf has been conducted by registering prompt neutrons and fission γ rays coincidence with light charged particles (LCP) and fission fragments. The aim is to investigate changes in fragment deformation energy between the binary and ternary fission modes from measured prompt neutron angular distributions and multiplicities, and to explore the influence of light particle emission on the energy distribution, multiplicity and angular anisotropy of γ rays emitted during fragment de-excitation. The experiment was performed at the MPI Heidelberg using the Darmstadt-Heidelberg crystal ball spectrometer as γ-ray and neutron detector. Fragments were identified by a double-E measurement with an angular sensitive twin ionization chamber (IC). Light charged particles from fission were measured by ΔE-E telescopes composed of ΔE ICs and silicon PIN diodes. The telescopes enable to identify various LCPs which are emitted much more rarely than ternary α particles. The parameters of the experiment and the method of data analysis are described and first results presented. (orig.)

Measurement of Neutron Energy Spectrum Emitted by Cf-252 Source Using Time-of-Flight Method

Energy Technology Data Exchange (ETDEWEB)

Lee, Cheol Ho; Son, Jaebum; Kim, Tae Hoon; Lee, Sangmin; Kim, Yong-Kyun [Hanyang University, Seoul (Korea, Republic of)

2016-10-15

The techniques proposed to detect the neutrons usually require the detection of a secondary recoiling nucleus in a scintillator (or other type of detector) to indicate the rare collision of a neutron with a nucleus. This is the same basic technique, in this case detection of a recoil proton that was used by Chadwick in the 1930 s to discover and identify the neutron and determine its mass. It is primary technique still used today for detection of fast neutron, which typically involves the use of a hydrogen based organic plastic or liquid scintillator coupled to a photo-multiplier tube. The light output from such scintillators is a function of the cross section and nuclear kinematics of the n + nucleus collision. With the exception of deuterated scintillators, the scintillator signal does not necessarily produce a distinct peak in the scintillator spectrum directly related to the incident neutron energy. Instead neutron time-of-flight (TOF) often must be utilized to determine the neutron energy, which requires generation of a prompt start signal from the nuclear source emitting the neutrons. This method takes advantage of the high number of prompt gamma rays. The Time-of-Flight method was used to measure neutron energy spectrum emitted by the Cf-252 neutron source. Plastic scintillator that has a superior discrimination ability of neutron and gamma-ray was used as a stop signal detector and liquid scintillator was used as a stat signal detector. In experiment, neutron and gamma-ray spectrum was firstly measured and discriminated using the TOF method. Secondly, neutron energy spectrum was obtained through spectrum analysis. Equation of neutron energy spectrum that was emitted by Cf-252 source using the Gaussian fitting was obtained.

Light localization with low-contrast targets in a patient implanted with a suprachoroidal-transretinal stimulation retinal prosthesis.

Science.gov (United States)

Endo, Takao; Fujikado, Takashi; Hirota, Masakazu; Kanda, Hiroyuki; Morimoto, Takeshi; Nishida, Kohji

2018-04-20

To evaluate the improvement in targeted reaching movements toward targets of various contrasts in a patient implanted with a suprachoroidal-transretinal stimulation (STS) retinal prosthesis. An STS retinal prosthesis was implanted in the right eye of a 42-year-old man with advanced Stargardt disease (visual acuity: right eye, light perception; left eye, hand motion). In localization tests during the 1-year follow-up period, the patient attempted to touch the center of a white square target (visual angle, 10°; contrast, 96, 85, or 74%) displayed at a random position on a monitor. The distance between the touched point and the center of the target (the absolute deviation) was averaged over 20 trials with the STS system on or off. With the left eye occluded, the absolute deviation was not consistently lower with the system on than off for high-contrast (96%) targets, but was consistently lower with the system on for low-contrast (74%) targets. With both eyes open, the absolute deviation was consistently lower with the system on than off for 85%-contrast targets. With the system on and 96%-contrast targets, we detected a shorter response time while covering the right eye, which was being implanted with the STS, compared to covering the left eye (2.41 ± 2.52 vs 8.45 ± 3.78 s, p trial: Feb. 20, 2014 Date of registration: Jan. 4, 2014 Trial registration number: UMIN000012754 Registration site: UMIN Clinical Trials Registry (UMIN-CTR) http://www.umin.ac.jp/ctr/index.htm.

Measurement and model description of differential neutron spectra of the californium 252 spontaneous fission depending on THETA, Msub(T), Esub(kin sum)

International Nuclear Information System (INIS)

Vasil'ev, Yu.A.; Sidorov, L.V.; Vasil'eva, N.K.; Barashkov, Yu.A.; Golovanov, O.A.; Kopalkin, N.V.; Nemudrov, N.I.; Surin, V.M.; Khachaturov, Yu.F.

1984-01-01

The results of the 4π-spectrometer mesurement of the neutron spectra in the 26-154 deg angle range for seven groups of fragments with different masses and total kinetic energies are given. Experimental spectra have been analyzed for consistency with the evaporation model of neutrons from moving fragments. The results of an analysis of differential neutron spectra shows that the main reason of the ''yearly'' neutron emission is a neutron evaporation from fragments with large excitation energy and from fragments with neutron number N>82 during the time as compared with the time of fragment acceleration

Neutron gauging applications using a small 252Cf source

International Nuclear Information System (INIS)

Helf, S.

1975-01-01

The use of a small 252 Cf source, in the 3 to 4 μg range, for neutron gauging applications is described. Emphasis is placed on determination of low concentrations of moisture in homogeneous media, e.g., solvents, explosives, dried food products, etc. and on measurement of charge or fill weight of hydrogenous materials in sealed items, e.g., propellant in a cartridge case. Both moderation of fast neutrons and attenuation of thermalized neutrons have been explored for these applications. Parameters related to the attainment of optimum sensitivity for each method are discussed. Fast neutron moderation is superior for low level moisture measurement whereas thermal neutron attenuation is more sensitive for ''neutron weighing'' applications. Under optimum conditions, sensitivity for moisture measurement approaches 0.1 weight percent whereas ''neutron weighing'' can detect changes in hydrogeneous material content as little as a fraction of a gram. Examples are given for each technique. A number of different thermal neutron detectors are compared for neutron gauging measurements. A 6 LiI (Eu) scintillation detector is judged to be superior with regard to high thermal neutron detection efficiency and low fast neutron and gamma ray response. In this study, emphasis is placed on the use of simple, portable equipment easily adaptable to field or plant use and for on-line process or quality control. (U.S.)

Project 252Cf-D2O. The multisphere system of neutron dosimetry and spectrometry (M.S.-N.D.S.). Studies of applications to health physics

International Nuclear Information System (INIS)

Zaborowski, H.L.

1976-10-01

The project 252 Cf-D 2 O is articulated upon the utilization of a 200μg nominal 252 Cf spontaneous neutron fission source, used bare and under D 2 O spherical moderators, giving leakage neutron spectra experimentally known and/or calculated. This project has for objective the applications of those sources to Health Physics, in dosimetry (calibration of ''rad'' and ''rem-meters'') and in spectrometry, associated with the experimental system of measurements made by the generalization of the BONNER Spheres, known as ''the Multisphere System''. This communication describes the normalization method used and the results obtained leading to the adoption of a reference matrix called ''the Log-Normal Multisphere Matrix'' (LN-MM) giving the energies response functions of the generalized system for all the spheres diameters between 40 and 400 millimeters and for all the energies between 0.4eV and 15MeV [fr

Optical and near-infrared survey of the stellar contents associated with the star-forming complex Sh2-252

Science.gov (United States)

Jose, Jessy; Pandey, A. K.; Ogura, K.; Samal, M. R.; Ojha, D. K.; Bhatt, B. C.; Chauhan, N.; Eswaraiah, C.; Mito, H.; Kobayashi, N.; Yadav, R. K.

2012-08-01

We present the analyses of the stellar contents associated with the extended H II region Sh2-252 using deep optical UBVRI photometry, slit and slitless spectroscopy along with the near-infrared (NIR) data from Two-Micron All-Sky Survey (2MASS) for an area ˜ 1 × 1 deg2. We have studied the sub-regions of Sh2-252, which includes four compact-H II (CH II ) regions, namely A, B, C and E, and two clusters, NGC 2175s and Teutsch 136 (Teu 136). Of the 15 spectroscopically observed bright stars, eight have been identified as massive members of spectral class earlier than B3. From the spectrophotometric analyses, we derived the average distance of the region as 2.4 ± 0.2 kpc, and the reddening E(B - V) of the massive members is found to vary between 0.35 and 2.1 mag. We found that NGC 2175s and Teu 136, located towards the eastern edge of the complex, are the sub-clusters of Sh2-252. The stellar surface density distribution in K band shows clustering associated with the regions A, C, E, NGC 2175s and Teu 136. We have also identified the candidate ionizing sources of the CH II regions. 61 Hα emission sources are identified using slitless spectroscopy. The distribution of the Hα emission sources and candidate young stellar objects (YSOs) with IR excess on the V/(V - I) colour-magnitude diagram (CMD) shows that a majority of them have approximate ages between 0.1 and 5 Myr and masses in the range of 0.3-2.5 M⊙. The optical CMDs of the candidate pre-main-sequence (PMS) sources in the individual regions also show an age spread of 0.1-5 Myr for each of them. We calculated the K-band luminosity functions (KLFs) for the sub-regions A, C, E, NGC 2175s and Teu 136. Within errors, the KLFs for all the sub-regions are found to be similar and comparable to that of young clusters of age <5 Myr. We also estimated the mass function of the PMS sample of the individual regions in the mass range of 0.3-2.5 M⊙. In general, the slopes of the MFs of all the sub-regions are found

High sensitivity isotope analysis with a 252Cf--235U fueled subcritical multiplier and low background photon detector systems

International Nuclear Information System (INIS)

Wogman, N.A.; Rieck, H.G. Jr.; Laul, J.C.; MacMurdo, K.W.

1976-09-01

A 252 Cf activation analysis facility has been developed for routine multielement analysis of a wide variety of solid and liquid samples. The facility contains six sources of 252 Cf totaling slightly over 100 mg. These sources are placed in a 93 percent 235 U-enriched uranium core which is subcritical with a K effective of 0.985 (multiplication factor of 66). The system produces a thermal flux on the order of 10 +1 neutrons per square centimeter per second. A pneumatic rabbit system permits automatic irradiation, decay, and counting regimes to be performed unattended on the samples. The activated isotopes are analyzed through their photon emissions with state-of-the-art intrinsic Ge detectors, Ge(Li) detectors, and NaI(Tl) multidimensional gamma ray spectrometers. High efficiency (25 percent), low background, anticoincidence shielded Ge(Li) gamma ray detector systems have been constructed to provide the lowest possible background, yet maintain a peak to Compton ratio of greater than 1000 to 1. The multidimensional gamma ray spectrometer systems are composed of 23 cm diameter x 20 cm thick NaI(Tl) crystals surrounded by NaI(Tl) anticoincidence shields. The detection limits for over 65 elements have been determined for this system. Over 40 elements are detectable at the 1 part per million level at a precision of +-10 percent

SU-E-J-252: A Motion Algorithm to Extract Physical and Motion Parameters of a Mobile Target in Cone-Beam Computed Tomographic Imaging Retrospective to Image Reconstruction

Energy Technology Data Exchange (ETDEWEB)

Ali, I; Ahmad, S [University of Oklahoma Health Sciences, Oklahoma City, OK (United States); Alsbou, N [Department of Electrical and Computer Engineering, Ada, OH (United States)

2014-06-01

Purpose: A motion algorithm was developed to extract actual length, CT-numbers and motion amplitude of a mobile target imaged with cone-beam-CT (CBCT) retrospective to image-reconstruction. Methods: The motion model considered a mobile target moving with a sinusoidal motion and employed three measurable parameters: apparent length, CT number level and gradient of a mobile target obtained from CBCT images to extract information about the actual length and CT number value of the stationary target and motion amplitude. The algorithm was verified experimentally with a mobile phantom setup that has three targets with different sizes manufactured from homogenous tissue-equivalent gel material embedded into a thorax phantom. The phantom moved sinusoidal in one-direction using eight amplitudes (0–20mm) and a frequency of 15-cycles-per-minute. The model required imaging parameters such as slice thickness, imaging time. Results: This motion algorithm extracted three unknown parameters: length of the target, CT-number-level, motion amplitude for a mobile target retrospective to CBCT image reconstruction. The algorithm relates three unknown parameters to measurable apparent length, CT-number-level and gradient for well-defined mobile targets obtained from CBCT images. The motion model agreed with measured apparent lengths which were dependent on actual length of the target and motion amplitude. The cumulative CT-number for a mobile target was dependent on CT-number-level of the stationary target and motion amplitude. The gradient of the CT-distribution of mobile target is dependent on the stationary CT-number-level, actual target length along the direction of motion, and motion amplitude. Motion frequency and phase did not affect the elongation and CT-number distributions of mobile targets when imaging time included several motion cycles. Conclusion: The motion algorithm developed in this study has potential applications in diagnostic CT imaging and radiotherapy to extract

New isomeric states in {sup 152,154,156}Nd produced by spontaneous fission of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Phan, X.H.; Theisen, C. [Commissariat l`Energie Atomique de Saclay, Gif sur Yvette (France). DSM/DAPINA/SPhN; Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires de Bordeaux-Gradignan, Domaine du Haut Vigneau, F-33175 Gradignan (France); Belier, G.; Girod, M.; Meot, V.; Peru, S. [Commissariat a l`Energie Atomique de Bruyeres-le-Chatel, DAM/SPN, BP12, F-91680 Bruyeres-le-Chatel (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Institut de Physique Nucleaire de Lyon, F-69622 Villeurbanne Cedex (France)

1998-04-01

Isomeric states have been observed in fission-fragments produced by spontaneous fission of {sup 252}Cf. These states are found in neutron rich nuclei of different structure and deformations. About 50 isomeric nuclei have been observed using coincidences between {gamma}-rays identified in EUROGAM II and fission fragments detected in photovoltaic cells (SAPhIR). Lifetimes in the range from 20 ns to 2{mu}s have been measured. Presented calculations based on HFB+D1S force on new measured isomeric states in the {sup 152,154,156}Nd show evidence for K-isomers. (orig.) With 8 figs., 27 refs.

Analysis of the boron pile measurement of the average neutron yield per fission of 252Cf: (AWBA development program)

International Nuclear Information System (INIS)

Ullo, J.J.

1977-08-01

The Harwell Boron Pile measurement of the average number of prompt neutrons emitted per fission, ν-bar/sub p/, of 252 Cf was analyzed in detail by a Monte Carlo method. From the calculated energy dependence of the neutron detection efficiency a value of ν-bar/sub p/ = 3.733 +- 0.022 was obtained. This value is 0.76 percent higher than the original reported value of 3.705 +- 0.015. Possible causes for this increase are discussed. 3 figures, 6 tables

Charge distribution in the ternary fragmentation of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Senthil Kannan, M.T.; Balasubramaniam, M. [Bharathiar University, Department of Physics, Coimbatore (India)

2017-08-15

We present here, for the first time, a study on ternary fragmentation charge distribution of {sup 252}Cf using the convolution integral method and the statistical theory. The charge distribution for all possible charge combinations of a ternary breakup are grouped as a bin containing different mass partitions. Different bins corresponding to various third fragments with mass numbers from A{sub 3} = 16 to 84 are identified with the available experimental masses. The corresponding potential energy surfaces are calculated using the three cluster model for the two arrangements A{sub 1} + A{sub 2} + A{sub 3} and A{sub 1} + A{sub 3} + A{sub 2}. The ternary fragmentation yield values are calculated for the ternary combination from each bin possessing minimum potential energy. The yields of the resulting ternary combinations as a function of the charge numbers of the three fragments are analyzed for both the arrangements. The calculations are carried out at different excitation energies of the parent nucleus. For each excitation energy the temperature of the three fragments are iteratively computed conserving the total energy. The distribution of fragment temperatures corresponding to different excitation energies for some fixed third fragments are discussed. The presence of the closed shell nucleus Sn in the favourable ternary fragmentation is highlighted. (orig.)

Time-of-flight mass spectrometer with 252Cf surface ionisation coupled with high-pressure liquid chromatography for determining pharmaceutical substances in the blood

International Nuclear Information System (INIS)

Danigel, H.

1983-01-01

Cf-252 PDMS is well suited for routine applications and can be combined with HPLC. This combined analytical system can be used for measuring the concentrations of pharmaceutical substances in body fluids on the basis of an internal standard. The results (pharmacokinetics, metabolism) indicate the necessary therapeutical dose and the efficacy of the substance applied. (DG) [de

Fission-fragment attachment to aerosols and their transport through capillary tubes

International Nuclear Information System (INIS)

Novick, V.J.; Alvarez, J.L.; Greenwood, R.C.

1981-01-01

The transport of radioactive aerosols was studied using equipment, collectively called the Helium jet, that has been constructed to provide basic nuclear physics data on fission product nuclides. The transport of the fission products in the system depends on their attachment to aerosol particles. The system consists of 1) a tube furnace which generates aerosols by the sublimation or evaporation of source material, 2) a helium stream used to transport the aerosols, 3) a 25 m settling tube to eliminate the larger aerosols and smaller aerosols that would deposit in the capillary, 4) a Californium-252 self-fissioning source of fission product nuclides, and 5) a small capillary to carry the radioactive aerosols from the hot cell to the laboratory. Different source materials were aerosolized but NaCl is generally used because it yielded the highest transport efficiencies through the capillary. Particle size measurments were made with NaCl aerosols by using a cascade impactor, an optical light scattering device, and the capillary itself as a diffusion battery by performing radiation measurements and/or electrical conductivity measurements. Both radioactive and nonradioactive aerosols were measured in order to investigate the possibility of a preferential size range for fission product attachment. The measured size distributions were then used to calculate attachment coefficients and finally an attachment time

Investigation of Workplace-like Calibration Fields via a Deuterium-Tritium (D-T) Neutron Generator.

Science.gov (United States)

Mozhayev, Andrey V; Piper, Roman K; Rathbone, Bruce A; McDonald, Joseph C

2017-04-01

Radiation survey meters and personal dosimeters are typically calibrated in reference neutron fields based on conventional radionuclide sources, such as americium-beryllium (Am-Be) or californium-252 (Cf), either unmodified or heavy-water moderated. However, these calibration neutron fields differ significantly from the workplace fields in which most of these survey meters and dosimeters are being used. Although some detectors are designed to yield an approximately dose-equivalent response over a particular neutron energy range, the response of other detectors is highly dependent upon neutron energy. This, in turn, can result in significant over- or underestimation of the intensity of neutron radiation and/or personal dose equivalent determined in the work environment. The use of simulated workplace neutron calibration fields that more closely match those present at the workplace could improve the accuracy of worker, and workplace, neutron dose assessment. This work provides an overview of the neutron fields found around nuclear power reactors and interim spent fuel storage installations based on available data. The feasibility of producing workplace-like calibration fields in an existing calibration facility has been investigated via Monte Carlo simulations. Several moderating assembly configurations, paired with a neutron generator using the deuterium tritium (D-T) fusion reaction, were explored.

Review of the accomplishments and promise of US transplutonium research, 1940-1981

International Nuclear Information System (INIS)

Keller, O.L.; Wymer, R.G.

1982-01-01

It has been just over 40 years since the identification of plutonium by Seaborg, McMillan, Kennedy, and Wahl at the University of California, Berkeley. This discovery, and the isolation of plutonium-239 a year later by Kennedy, Seaborg, Segre, and Wahl, laid the cornerstone of one of the most exciting and productive eras of research in American history - research on the transplutonium elements. This research was to span all fields of natural science, and indeed was to have many implications and applications in the biological sciences. In this brief document, we have attempted to touch on only some of the many achievements of the US heavy element program. Many of those whose work has been at the heart of this research have contributed to this report. They have summarized some of what was scientifically important and exciting and they have suggested some of the topics of important research remaining to be done. The following topics are covered in this review: historical account; plutonium; synthesis of transplutonium isotopes; nuclear fission and stability, heavy ion reactions and nuclear structure; chemistry of the transplutonium elements; optical and magnetic properties; electronic structure and solid state properties; environmental and biological behavior of transplutonium elements; heavy element production; application of californium-252

Shielding of radiation fields generated by 252Cf in a concrete maze. Part 2 -- Simulation

International Nuclear Information System (INIS)

Fasso, A.; Ipe, N.E.; Reyna, A.

1998-03-01

A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare 252 Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation

{sup 252}Cf spontaneous prompt fission neutron spectrum measured at 0 degree and 180 degree relative to the fragment motion

Energy Technology Data Exchange (ETDEWEB)

Shanglian, Bao; Jinquan, Liu [Beijing Univ., BJ (China); Batenkov, O I; Blinov, M V; Smirnov, S N [V.G. Khlopin Radium Institute, ST. Petersburg (Russian Federation)

1994-09-01

The {sup 252}Cf spontaneous prompt fission neutron spectrum at 0 degree and 180 degree relative to the motion direction of corresponding fission fragments was measured. High angular resolution for fragment measurements and high energy resolution for neutron measurements were obtained using multi-parameter TOF spectrometer. The results showed that there is a symmetric distribution of `forward` and `backward` for low energy in C.M.S. neutrons, which was an evidence of nonequilibrium neutrons existed in fission process.

Study of ternary and quaternary spontaneous fission of 252Cf with the NESSI detector

International Nuclear Information System (INIS)

Tishchenko, V.G.; Jahnke, U.; Herbach, C.M.; Hilscher, D.

2002-11-01

Ternary and quaternary spontaneous decay of 252 Cf was studied with the NESSI detector, a combination of two 4π detectors for charged particles, neutrons and γ-rays. The applied method of particle identification by measuring the energies and relative time-of-flights of the decay products is shown to be very effective for the study of rare decay modes. The energy and angular distributions of the decay products, the associated neutron multiplicities, the total energy of the prompt γ-radiation as well as correlations between the various observables were measured for the first time in a single full-scale experiment. The characteristics of ternary fission known from previous investigations are confirmed in the frame of a methodically independent experiment. Preliminary estimates of the quaternary fission yield are presented. An attempt is made to determine the mechanism of quaternary fission. (orig.)

Characterization of neutron spectra using sources of {sup 241}AmBe, {sup 238}PuBe e {sup 252}Cf moderated in water; Caracterização de espectros neutrônicos com fontes de {sup 241}AmBe, {sup 238}PuBe e {sup 252}Cf moderados em água

Energy Technology Data Exchange (ETDEWEB)

Gonçalves, A.S.; Silva, F.S.; Patrão, K.C.S.; Fonseca, E.S. da; Pereira, W.W., E-mail: angela.souzagon@gmail.com [Instituto de Radioproteção e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Laboratório de Metrologia de Nêutrons

2017-07-01

Recent studies have demonstrated the importance of characterizing the spectrum of neutron sources for various energies in order to make the understanding of neutron interaction closer to reality they work with. This work presents the determination of neutron energy flux from the source of {sup 241}AmBe (0.6 TBq), {sup 238}PuBe (1.8 TBq) and {sup 252}Cf (120 μg) free in the air and inserted into spheres of various diameters containing distilled water. The determination of the spectrum is based on the measurement and simulation by the Monte Carlo computational method, using the sources under study, with the Bonner multisphere spectrometer containing readings with the detector without sphere and covered with polyethylene balls of diameters: 5,08 cm (2 ″), 7.62 cm (3″), 12.70 cm (5 ″), 20.32 cm (8 ″), 25.40 cm (10 ″) and 30.48 cm (12 ″). It is sought to characterize a new moderate spectrum in water using the sources of {sup 241}AmBe, {sup 238}PuBe and {sup 252}Cf that may be useful for testing, calibration and irradiation of individual and area monitors for neutrons.

Absolute measurement of ν/sub p/-bar for 252Cf by the large liquid scintillator tank technique

International Nuclear Information System (INIS)

Spencer, R.R.

1979-01-01

A vigorous effect to dispel the scandal of the approx. 2% dispersion in reported experimental values of 252 Cf ν-bar, the average number of neutrons emitted in spontaneous fission, has been underway over the past 5 years. The goal is to reduce the uncertainty in this fundamental parameter to the +- 0.25% level needed for reactor physics applications. Both new measurements and revaluation of older measurements are involved. At ORNL a new measurement is being carried out using the leage liquid scintillator neutron detector. Findings of the most recent experiment, incorporating improvements suggested in a preliminary study are discussed. 6 figures, 2 tables

Possibilities of activation analysis with 252Cf sources in the area of earth sciences and mining prospection

International Nuclear Information System (INIS)

Melky, Sami.

1975-01-01

The 252 Cf neutron activation experimental set-up is composed of four sources of 225μg each, symmetrically disposed with regard to the sample axis. This installation permits the irradiation of 5 to 40cm 3 of ores, so that the analysis is done on sample weighing about 100g. This method allows, not only the determination of major and minor constituents in the sample, but also the determination of some trace elements. The experimental sensitivity of some important elements are given in mining prospection and it is shown that direct gamma spectrometry after activation permits a fast and precise determination of many elements in ores [fr

Targeted MRI-guided prostate biopsy: are two biopsy cores per MRI-lesion required?

Energy Technology Data Exchange (ETDEWEB)

Schimmoeller, L.; Quentin, M.; Blondin, D.; Dietzel, F.; Schleich, C.; Thomas, C.; Antoch, G. [University Dusseldorf, Medical Faculty, Department of Diagnostic and Interventional Radiology, Dusseldorf (Germany); Hiester, A.; Rabenalt, R.; Albers, P.; Arsov, C. [University Dusseldorf, Medical Faculty, Department of Urology, Dusseldorf (Germany); Gabbert, H.E. [University Dusseldorf, Medical Faculty, Department of Pathology, Dusseldorf (Germany)

2016-11-15

This study evaluates the feasibility of performing less than two core biopsies per MRI-lesion when performing targeted MR-guided in-bore prostate biopsy. Retrospectively evaluated were 1545 biopsy cores of 774 intraprostatic lesions (two cores per lesion) in 290 patients (66 ± 7.8 years; median PSA 8.2 ng/ml) regarding prostate cancer (PCa) detection, Gleason score, and tumor infiltration of the first (FBC) compared to the second biopsy core (SBC). Biopsies were acquired under in-bore MR-guidance. For the biopsy cores, 491 were PCa positive, 239 of 774 (31 %) were FBC and 252 of 771 (33 %) were SBC (p = 0.4). Patient PCa detection rate based on the FBC vs. SBC were 46 % vs. 48 % (p = 0.6). For clinically significant PCa (Gleason score ≥4 + 3 = 7) the detection rate was 18 % for both, FBC and SBC (p = 0.9). Six hundred and eighty-seven SBC (89 %) showed no histologic difference. On the lesion level, 40 SBC detected PCa with negative FBC (7.5 %). Twenty SBC showed a Gleason upgrade from 3 + 3 = 6 to ≥3 + 4 = 7 (2.6 %) and 4 to ≥4 + 3 = 7 (0.5 %). The benefit of a second targeted biopsy core per suspicious MRI-lesion is likely minor, especially regarding PCa detection rate and significant Gleason upgrading. Therefore, a further reduction of biopsy cores is reasonable when performing a targeted MR-guided in-bore prostate biopsy. (orig.)

Targeted MRI-guided prostate biopsy: are two biopsy cores per MRI-lesion required?

International Nuclear Information System (INIS)

Schimmoeller, L.; Quentin, M.; Blondin, D.; Dietzel, F.; Schleich, C.; Thomas, C.; Antoch, G.; Hiester, A.; Rabenalt, R.; Albers, P.; Arsov, C.; Gabbert, H.E.

2016-01-01

This study evaluates the feasibility of performing less than two core biopsies per MRI-lesion when performing targeted MR-guided in-bore prostate biopsy. Retrospectively evaluated were 1545 biopsy cores of 774 intraprostatic lesions (two cores per lesion) in 290 patients (66 ± 7.8 years; median PSA 8.2 ng/ml) regarding prostate cancer (PCa) detection, Gleason score, and tumor infiltration of the first (FBC) compared to the second biopsy core (SBC). Biopsies were acquired under in-bore MR-guidance. For the biopsy cores, 491 were PCa positive, 239 of 774 (31 %) were FBC and 252 of 771 (33 %) were SBC (p = 0.4). Patient PCa detection rate based on the FBC vs. SBC were 46 % vs. 48 % (p = 0.6). For clinically significant PCa (Gleason score ≥4 + 3 = 7) the detection rate was 18 % for both, FBC and SBC (p = 0.9). Six hundred and eighty-seven SBC (89 %) showed no histologic difference. On the lesion level, 40 SBC detected PCa with negative FBC (7.5 %). Twenty SBC showed a Gleason upgrade from 3 + 3 = 6 to ≥3 + 4 = 7 (2.6 %) and 4 to ≥4 + 3 = 7 (0.5 %). The benefit of a second targeted biopsy core per suspicious MRI-lesion is likely minor, especially regarding PCa detection rate and significant Gleason upgrading. Therefore, a further reduction of biopsy cores is reasonable when performing a targeted MR-guided in-bore prostate biopsy. (orig.)

Multielemental nondestructive neutron activation analysis of Dy, Mn, Eu, Na, Ga, W, La and Sm involving cyclic irradiations with 252Cf

International Nuclear Information System (INIS)

Narkhede, S.S.; Turel, Z.R.

1995-01-01

Dy, Mn, Eu, Na, Ga, W, La and Sm respond very well to INAA technique because of their favourable nuclear properties such as high thermal neutron cross-section or abundance. In the present work a method has been developed for the determination of these elements employing cycle irradiation with 252 Cf thermal neutron source. Radioassaying of the irradiated sample and standard was done employing HPGe detector in conjunction with a PC based MCA units. (author). 2 tabs

Shielding of radiation fields generated by {sup 252}Cf in a concrete maze. Part 2 -- Simulation

Energy Technology Data Exchange (ETDEWEB)

Fasso, A.; Ipe, N.E.; Reyna, A. [Stanford Univ., CA (US). Stanford Linear Accelerator Center; McCall, R.C. [McCall Associates, Woodside, CA (US)

1998-03-01

A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare {sup 252}Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation.

Gamma-ray multiplicity distribution in ternary fission of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Jandel, M [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Kliman, J [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Krupa, L [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Morhac, M [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Hamilton, J H [Department of Physics, Vanderbilt University, Nashville, TN (United States); Kormicki, J [Department of Physics, Vanderbilt University, Nashville, TN (United States); Ramayya, A V [Department of Physics, Vanderbilt University, Nashville, TN (United States); Hwang, J K [Department of Physics, Vanderbilt University, Nashville, TN (United States); Luo, Y X [Department of Physics, Vanderbilt University, Nashville, TN (United States); Fong, D [Department of Physics, Vanderbilt University, Nashville, TN (United States); Gore, P [Department of Physics, Vanderbilt University, Nashville, TN (United States); Akopian, G M Ter; Oganessian, Yu Ts; Rodin, A M; Fomichev, A S; Popeko, G S; Daniel, A V [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna (Russian Federation); Rasmussen, J O; Macchiavelli, A O [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Stoyer, M A [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R [Instituto de Fisica, Universidade Federal do Rio de Janeiro, 21945-970 Rio de Janeiro (Brazil); Cole, J D [Idaho National Engineering and Environmental Laboratory, Idaho Falls, ID (United States)

2002-12-01

From multiparameter data obtained at Lawrence Berkeley National Laboratory, the integral characteristics of the prompt {gamma}-ray emission were extracted for tripartition of {sup 252}Cf with He, Be and C being the third light charged particle. We used multifold {gamma}-ray coincidence spectra for the determination of {gamma}-ray multiplicities assuming a Gaussian distribution for {gamma}-ray multiplicity. The multiplicity distribution characteristics, i.e. mean multiplicity and its dispersion were obtained by minimizing with respect to the calculated values of probabilities of multifold {gamma}-ray coincidences using a combinatoric method. Comparison with the known experimental data from binary fission was made. Further, we investigated dependencies of the mean {gamma}-ray multiplicity on the kinetic energy of the light charged particle. The mean {gamma}-ray multiplicity for He ternary fission is found to increase rapidly with increasing kinetic energy of He in the region less than 11 MeV and then decrease slowly with increasing kinetic energy of He. The anomalous behaviour of {gamma}-ray emission is discussed. The mean {gamma}-ray multiplicity was determined for the first time for Be and C ternary fission. For Be, the {gamma}-ray multiplicity as a function of kinetic energy was obtained as well.

Particle and heavy ion transport code system, PHITS, version 2.52

International Nuclear Information System (INIS)

Sato, Tatsuhiko; Matsuda, Norihiro; Hashimoto, Shintaro; Iwamoto, Yosuke; Noda, Shusaku; Ogawa, Tatsuhiko; Nakashima, Hiroshi; Fukahori, Tokio; Okumura, Keisuke; Kai, Tetsuya; Niita, Koji; Iwase, Hiroshi; Chiba, Satoshi; Furuta, Takuya; Sihver, Lembit

2013-01-01

An upgraded version of the Particle and Heavy Ion Transport code System, PHITS2.52, was developed and released to the public. The new version has been greatly improved from the previously released version, PHITS2.24, in terms of not only the code itself but also the contents of its package, such as the attached data libraries. In the new version, a higher accuracy of simulation was achieved by implementing several latest nuclear reaction models. The reliability of the simulation was improved by modifying both the algorithms for the electron-, positron-, and photon-transport simulations and the procedure for calculating the statistical uncertainties of the tally results. Estimation of the time evolution of radioactivity became feasible by incorporating the activation calculation program DCHAIN-SP into the new package. The efficiency of the simulation was also improved as a result of the implementation of shared-memory parallelization and the optimization of several time-consuming algorithms. Furthermore, a number of new user-support tools and functions that help users to intuitively and effectively perform PHITS simulations were developed and incorporated. Due to these improvements, PHITS is now a more powerful tool for particle transport simulation applicable to various research and development fields, such as nuclear technology, accelerator design, medical physics, and cosmic-ray research. (author)

Distinct difference in relative biological effectiveness of 252Cf neutrons for the induction of mitotic crossing over and intragenic reversion of the white-ivory allele in Drosophila melanogaster

International Nuclear Information System (INIS)

Yoshikawa, Isao; Hoshi, Masaharu; Ikenaga, Mituo

1996-01-01

The relative biological effectiveness (RBE) of 252 Cf neutrons was determined for two different types of somatic mutations, i.e., loss of heterozygosity for wing-hair mutations and reversion of the mutant white-ivory eye-color, in Drosophila melanogaster. Loss of heterozygosity for wing-hair mutations results predominantly from mitotic crossing over induced in wing anlage cells of larvae, while the reverse mutation of eye-color is due to an intragenic structural change in the white locus on the X-chromosome. For a quantitative comparison of RBE values for these events, we have constructed a combined mutation assay system so that induced mutant wing-hair clones as well as revertant eye-color clones can be detected simultaneously in the same individuals. Larvae were irradiated at the age of 80±4 h post-oviposition with 252 Cf neutrons or 137 Cs γ-rays, and male adult flies were examined under the microscope for the presence of the two types of clonal mosaic spots appearing. The induction of wing-hair spots per dose unit was much greater for 252 Cf neutrons than for 137 Cs γ -rays, whereas the frequencies of eye-color reversion were similar for neutrons and γ-rays. The estimated RBE values of neutrons were 8.5 and 1.2 for the induction of mutant wing-hair spots and revertant eye-color spots, respectively. These results indicate that the RBE of neutrons is much greater for mitotic crossing over in comparison to the intragenic white-ivory reversion events. Possible causes for the difference in RBE are discussed

A search for fine structure of the time-of-flight spectrum of the fission neutrons of 252Cf

International Nuclear Information System (INIS)

Scobie, J.; Scott, R.D.; Feather, N.; Vass, D.G.

1977-01-01

A standard time-of-flight arrangement, in which start pulses were supplied by fission fragments and stop pulses by neutrons, has been employed in an attempt to check recent claims of the existence of fine structures in the time-of-flight spectrum of the fission neutrons of 252 Cf. This structure, in the form of spikes with tails towards longer times, has been attributed to the emission of neutrons of short delay (with half-lives of a few to a hundred or so nanoseconds) in the fission process. It has not been possible to find any convincing evidence for the existence of such structure. (author)

Resistive plate chamber neutron and gamma sensitivity measurement with a {sup 252}Cf source

Energy Technology Data Exchange (ETDEWEB)

Abbrescia, M.; Altieri, S.; Baratti, V.; Barnaba, O.; Belli, G.; Bruno, G.; Colaleo, A.; DeVecchi, C.; Guida, R. E-mail: roberto.guida@pv.infn.it; Iaselli, G.; Imbres, E.; Loddo, F.; Maggi, M.; Marangelli, B.; Musitelli, G.; Nardo, R.; Natali, S.; Nuzzo, S.; Pugliese, G.; Ranieri, A.; Ratti, S.; Riccardi, C.; Romano, F.; Torre, P.; Vicini, A.; Vitulo, P.; Volpe, F

2003-06-21

A bakelite double gap Resistive Plate Chamber (RPC), operating in avalanche mode, has been exposed to the radiation emitted from a {sup 252}Cf source to measure its neutron and gamma sensitivity. One of the two gaps underwent the traditional electrodes surface coating with linseed oil. RPC signals were triggered by fission events detected using BaF{sub 2} scintillators. A Monte Carlo code, inside the GEANT 3.21 framework with MICAP interface, has been used to identify the gamma and neutron contributions to the total number of collected RPC signals. A neutron sensitivity of (0.63{+-}0.02)x10{sup -3} (average energy 2 MeV) and a gamma sensitivity of (14.0{+-}0.5)x10{sup -3} (average energy 1.5 MeV) have been measured in double gap mode. Measurements done in single gap mode have shown that both neutron and gamma sensitivity are independent of the oiling treatment.

Structures of the neutron-rich nuclei observed in fission of {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Ramayya, A. V.; Hamilton, J. H.; Goodin, C. J.; Brewer, N. T.; Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Luo, Y. X. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 USA and Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Liu, S. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 USA and UNRIB/Oak Ridge Associated Universities, Oak Ridge, Tennessee 37831 (United States); Rasmussen, J. O.; Lee, I. Y. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Stone, N. J. [Department of Physics, Oxford University, Oxford OX1 3PU (United Kingdom); Daniel, A. V. [Flerov Laboratory of Nuclear Reactions, JINR, Dubna (Russian Federation); Zhu, S. J. [Department of Physics, Tsinghua University, Beijing 100084 (China)

2014-08-14

Analysis of high statistics triple coincidence fission γ data from {sup 252}Cf at Gammasphere including angular correlations yielded well-expanded high-spin level schemes with more complete and reliable spin/parity assignments for {sup 82}Ge, {sup 118,120,122}Cd and {sup 114,115}Rh. Both the quasi-particle/hole couplings and quasi-rotational degrees of freedom are implied to play roles in these Cd isotopes. Evidence for triaxial shapes and octupole components in the Cd isotopes is presented. These Cd isotopes may have triaxial deformations. High-spin level schemes of {sup 114,115}Rh have been established for the first time. The existence of a relatively large signature splitting and an yrare band shows typical features of a triaxially deformed nucleus. Possible excited deformed rotational bands are observed, for the first time, in {sup 82}Ge. From the multipole mixing ratio measurement, the ground state configurations of {sup 109,111}Ru, as well as excited states in {sup 103,107}Mo and {sup 111}Ru were determined.

Transport-level description of the 252Cf-source method using the Langevin technique

International Nuclear Information System (INIS)

Stolle, A.M.; Akcasu, A.Z.

1991-01-01

The fluctuations in the neutron number density and detector outputs in a nuclear reactor can be analyzed conveniently by using the Langevin equation approach. This approach can be implemented at any level of approximation to describe the time evolution of the neutron population, from the most complete transport-level description to the very basic point reactor analysis of neutron number density fluctuations. In this summary, the complete space- and velocity-dependent transport-level formulation of the Langevin equation approach is applied to the analysis of the 252 Cf-source-driven noise analysis (CSDNA) method, an experimental technique developed by J.T. Mihalczo at Oak Ridge National Laboratory, which makes use of noise analysis to determine the reactivity of subcritical media. From this analysis, a theoretical expression for the subcritical multiplication factor is obtained that can then be used to interpret the experimental data. Results at the transport level are in complete agreement with an independent derivation performed by Sutton and Doub, who used the probability density method to interpret the CSDNA experiment, but differed from other expressions that have appeared in the literature

Legionella pneumophila Carbonic Anhydrases: Underexplored Antibacterial Drug Targets

Directory of Open Access Journals (Sweden)

Claudiu T. Supuran

2016-06-01

Full Text Available Carbonic anhydrases (CAs, EC 4.2.1.1 are metalloenzymes which catalyze the hydration of carbon dioxide to bicarbonate and protons. Many pathogenic bacteria encode such enzymes belonging to the α-, β-, and/or γ-CA families. In the last decade, enzymes from some of these pathogens, including Legionella pneumophila, have been cloned and characterized in detail. These enzymes were shown to be efficient catalysts for CO2 hydration, with kcat values in the range of (3.4–8.3 × 105 s−1 and kcat/KM values of (4.7–8.5 × 107 M−1·s−1. In vitro inhibition studies with various classes of inhibitors, such as anions, sulfonamides and sulfamates, were also reported for the two β-CAs from this pathogen, LpCA1 and LpCA2. Inorganic anions were millimolar inhibitors, whereas diethyldithiocarbamate, sulfamate, sulfamide, phenylboronic acid, and phenylarsonic acid were micromolar ones. The best LpCA1 inhibitors were aminobenzolamide and structurally similar sulfonylated aromatic sulfonamides, as well as acetazolamide and ethoxzolamide (KIs in the range of 40.3–90.5 nM. The best LpCA2 inhibitors belonged to the same class of sulfonylated sulfonamides, together with acetazolamide, methazolamide, and dichlorophenamide (KIs in the range of 25.2–88.5 nM. Considering such preliminary results, the two bacterial CAs from this pathogen represent promising yet underexplored targets for obtaining antibacterials devoid of the resistance problems common to most of the clinically used antibiotics, but further studies are needed to validate them in vivo as drug targets.

Analysis of existing data and specification of an experiment to determine the 252Cf half-life to the required degree of accuracy

International Nuclear Information System (INIS)

Lorenz, A.; Kharitonov, I.A.

1994-02-01

The methods used and the results obtained in measurements of the 252 Cf half-life are analyzed. In calculating the weighted mean value, additional error components as well as those given by the authors are taken into account. In order to reduce the error in the weighted mean value to less than 0.1%, the need and the requirements for an exact measurement are specified. A half-life of 2.6473±0.0028 years is recommended. (author). 16 refs, 3 tabs

Measurements of gamma-ray dose from a moderated 252Cf source

International Nuclear Information System (INIS)

McDonald, J.C.; Griffith, R.V.; Plato, P.; Miklos, J.

1983-06-01

The gamma-ray dose fraction from a moderated 252 Cf source was determined by using three types of dosimetry systems. Measurements were carried out in air at a distance of 35 cm from the surface of the moderating sphere (50 cm from the source which is at the center of the sphere) to the geometrical center of each detector. The moderating sphere is 0.8-mm-thick stainless steel shell filled with D 2 O and covered with 0.5 mm of cadmium. Measurements were also carried out with instruments and dosimeters positioned at the surface of a 40 cm x 40 cm x 15 cm plexiglass irradiation phantom whose front surface was also 35 cm from the surface of the moderating sphere. A-150 tissue-equivalent (TE) plastic ionization chambers and a TE proportional counter (TEPC) were used to measure tissue dose, from which the neutron dose equivalent was computed. The ratio of gamma-ray dose to the neutron dose equivalent was determined by using a relatively neutron-insensitive Geiger-Mueller (GM) counter and thermoluminescent dosimeters (TLD). In addition, the event-size spectrum measured by the TEPC was also used to compute the gamma-ray dose fraction. The average value for the ratio of gamma-ray dose to neutron dose equivalent was found to be 0.18 with an uncertainty of about +-18%

Rapid Evolution to Blast Crisis Associated with a Q252H ABL1 Kinase Domain Mutation in e19a2 BCR-ABL1 Chronic Myeloid Leukaemia

Directory of Open Access Journals (Sweden)

Sarah L. McCarron

2013-01-01

Full Text Available A minority of chronic myeloid leukaemia (CML patients express variant transcripts of which the e19a2 BCR-ABL1 fusion is the most common. Instances of tyrosine kinase inhibitor (TKI resistance in e19a2 BCR-ABL1 CML patients have rarely been reported. A case of e19a2 BCR-ABL1 CML is described in whom imatinib resistance, associated with a Q252H ABL1 kinase domain mutation, became apparent soon after initiation of TKI therapy. The patient rapidly transformed to myeloid blast crisis (BC with considerable bone marrow fibrosis and no significant molecular response to a second generation TKI. The clinical course was complicated by comorbidities with the patient rapidly succumbing to advanced disease. This scenario of Q252H-associated TKI resistance with rapid BC transformation has not been previously documented in e19a2 BCR-ABL1 CML. This case highlights the considerable challenges remaining in the management of TKI-resistant BC CML, particularly in the elderly patient.

Nuclear isomerism in fission fragments produced by the spontaneous fission of {sup 252}Cf; Isomerisme nucleaire dans les fragments de fission produits dans la fission spontanee du {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Gautherin, C

1997-09-01

This thesis is devoted to the study of the nuclear structure of neutron-rich nuclei, via the search of isomeric nuclear states. Neutron-rich nuclei were produced in the spontaneous fission of {sup 252}Cf. The experimental study of isomeric states in these nuclei was performed with the {gamma}-array EUROGAM II, coupled to an additional and original fission fragment detector composed by photovoltaic cells, SAPhIR. The photovoltaic cells are well adapted to detect low energy heavy ions and have good energy and time resolutions to obtain a good fission fragment detection. This experiment led to the discovery of new isomeric states in {sup 135}Xe, {sup 104}Mo, {sup 146,147,148}Ce and {sup 152,154,156}Nd, with lifetimes between 60 ns and 2 {mu}s. Level schemes of these nuclei have been completed. An interpretation of the isomeric states in the nuclei {sup 154,156}Nd and {sup 156,158}Sm was performed by Hartree-Fock-Bogolyubov calculations using the DIS Gogny force with two quasi-particles excitations. The confrontation with the experimental results led to an interpretation of these isomeric states as K-isomers. (author)

Thermal neutron imaging with rare-earth-ion-doped LiCaAlF6 scintillators and a sealed 252Cf source

International Nuclear Information System (INIS)

Kawaguchi, Noriaki; Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei; Fukuda, Kentaro; Suyama, Toshihisa; Watanabe, Kenichi; Yamazaki, Atsushi; Chani, Valery; Yoshikawa, Akira

2011-01-01

Thermal neutron imaging with Ce-doped LiCaAlF 6 crystals has been performed. The prototype of the neutron imager using a Ce-doped LiCaAlF 6 scintillating crystal and a position sensitive photomultiplier tube (PSPMT) which had 64 multi-channel anode was developed. The Ce-doped LiCaAlF 6 single crystal was grown by the Czochralski method. A plate with dimensions of a diameter of 50x2 mm 2 was cut from the grown crystal, polished, and optically coupled to PSPMT by silicone grease. The 252 Cf source ( 6 .

Deepwater Horizon MC252 incident wellhead location and bathymetry data from the Environmental Resource Management Application (ERMA) collected between 2010-06-01 to 2010-07-31 in the Northern Gulf of Mexico (NCEI Accession 0163804)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — This Archival Information Package (AIP) contains three Environmental Resource Management Application (ERMA) GIS layers that depict the Mississippi Canyon 252...

Macrocluster desorption effect caused by single MCI: charges of gold clusters (2-20 nm) desorbed due to electronic processes induced by fission fragment bombardment in nanodispersed gold targets

International Nuclear Information System (INIS)

Baranov, I.; Jarmiychuk, S.; Kirillov, S.; Novikov, A.; Obnorskii, V.; Pchelintsev, A.; Wien, K.; Reimann, C.

1999-01-01

In this work the charge state of the negatively charged gold nanocluster ions (2-20 nm) that were desorbed from nanodispersed gold islet targets by 252 Cf fission fragments via electronic processes is studied. Mean cluster charge was calculated as a ratio of mean cluster mass to mean mass-to-charge ratio . Cluster masses were measured by means of a collector technique employing transmission electron microscopy and scanning force microscopy, while m/q was measured by means of a tandem TOF-spectrometer. It is shown that the nanocluster ions are mostly multiply charged (2-16e) and the charge increases non-linearly with the cluster size. The results are discussed

Reprocessing of nuclear fuels at the Savannah River Plant

International Nuclear Information System (INIS)

Gray, L.W.

1986-01-01

For more than 30 years, the Savannah River Plant (SRP) has been a major supplier of nuclear materials such as plutonium-239 and tritium-3 for nuclear and thermonuclear weapons, plutonium-238 for space exploration, and isotopes of americium, curium, and californium for use in the nuclear research community. SRP is a complete nuclear park, providing most of the processes in the nuclear fuel cycle. Key processes involve fabrication and cladding of the nuclear fuel, target, and control assemblies; rework of heavy water for use as reactor moderator; reactor loading, operation, and unloading; chemical recovery of the reactor transmutation products and spent fuels; and management of the gaseous, liquid, and solid nuclear and chemical wastes; plus a host of support operations. The site's history and the key processes from fabrication of reactor fuels and targets to finishing of virgin plutonium for use in the nuclear weapons complex are reviewed. Emphasis has been given to the chemistry of the recovery and purification of weapons grade plutonium from irradiated reactor targets

Experimental research on specific activity of 24Na using Chinese reference man phantom irradiated by 252Cf neutrons source

International Nuclear Information System (INIS)

Wang Yuexing; Yang Yifang; Lu Yongjie; Zhang Jianguo; Xing Hongchuan

2011-01-01

Objective: To investigate the specific activity of '2 4 Na per unit neutron fluence, A B/Φ ,in blood produced for Chinese reference man irradiated by 252 Cf neutron source,and to analyze the effects of scattering neutrons from ground,wall,and ceiling in irradiation site on it.Methods: A 252 Cf neutron source of 3×10 8 n/s and the anthropomorphic phantom were used for experiments. The phantom was made from 4 mm thick of outer covering by perspex and the liquid tissue-equivalent substitute in it. The data of phantom dimensions fit into Chinese reference man.The weight ratios of H, N, O and C in substitute equal from source to long axis of phantom were 1.1, 2.1, 3.1 and 4.1 m, respectively. Both the neutron source and the position of xiphisternum of the phantom were 1.6 m above the floor. Results: The average specific activity of 24 Na per unit neutron fluence was related to the irradiation-distances, d, and its maximum value, A B/ΦM , deduced by experimental data was about 1.85×10 -7 Bq·cm 2 ·g -1 . Conclusions: The A B/ΦM corresponds to that of phantom irradiated by plane-parallel beams, and the value is about more 3% than that by BOMAB phantom reported in literature. It has shown that floor-(wall-)scattered neutrons in irradiation site have significant contribution to the specific activity of 24 Na, but they contributed relatively little to the induced neutron doses. Consequently,using the specific activity of 24 Na for assessing accidental neutron doses received by an individual, the contribution of scattered neutrons in accident site will lead dose to be overestimated, and need to be correct. (authors)

Comparative analysis of bacterial community-metagenomics in coastal Gulf of Mexico sediment microcosms following exposure to Macondo oil (MC252)

KAUST Repository

Koo, Hyunmin

2014-09-10

The indigenous bacterial communities in sediment microcosms from Dauphin Island (DI), Petit Bois Island (PB) and Perdido Pass (PP) of the coastal Gulf of Mexico were compared following treatment with Macondo oil (MC252) using pyrosequencing and culture-based approaches. After quality-based trimming, 28,991 partial 16S rRNA sequence reads were analyzed by rarefaction, confirming that analyses of bacterial communities were saturated with respect to species diversity. Changes in the relative abundances of Proteobacteria, Bacteroidetes and Firmicutes played an important role in structuring bacterial communities in oil-treated sediments. Proteobacteria were dominant in oil-treated samples, whereas Firmicutes and Bacteroidetes were either the second or the third most abundant taxa. Tenericutes, members of which are known for oil biodegradation, were detected shortly after treatment, and continued to increase in DI and PP sediments. Multivariate statistical analyses (ADONIS) revealed significant dissimilarity of bacterial communities between oil-treated and untreated samples and among locations. In addition, a similarity percentage analysis showed the contribution of each species to the contrast between untreated and oil-treated samples. PCR amplification using DNA from pure cultures of Exiguobacterium,  Pseudoalteromonas,  Halomonas and Dyadobacter, isolated from oil-treated microcosm sediments, produced amplicons similar to polycyclic aromatic hydrocarbon-degrading genes. In the context of the 2010 Macondo blowout, the results from our study demonstrated that the indigenous bacterial communities in coastal Gulf of Mexico sediment microcosms responded to the MC252 oil with altered community structure and species composition. The rapid proliferation of hydrocarbonoclastic bacteria suggests their involvement in the degradation of the spilt oil in the Gulf of Mexico ecosystem.

A Monte Carlo Study on the Effect of Various Neutron Capturers on Dose Distribution in Brachytherapy with 252Cf Source

Directory of Open Access Journals (Sweden)

Firoozabadi M. M.

2017-03-01

Full Text Available Background: In neutron interaction with matter and reduction of neutron energy due to multiple scatterings to the thermal energy range, increasing the probability of thermal neutron capture by neutron captures makes dose enhancement in the tumors loaded with these materials. Objective: The purpose of this study is to evaluate dose distribution in the presence of 10B, 157Gd and 33S neutron capturers and to determine the effect of these materials on dose enhancement rate for 252Cf brachytherapy source. Methods: Neutron-ray flux and energy spectra, neutron and gamma dose rates and dose enhancement factor (DEF are determined in the absence and presence of 10B, 157Gd and 33S using Monte Carlo simulation. Results: The difference in the thermal neutron flux rate in the presence of 10B and 157Gd is significant, while the flux changes in the fast and epithermal energy ranges are insensible. The dose enhancement factor has increased with increasing distance from the source and reached its maximum amount equal to 258.3 and 476.1 cGy/h/µg for 157Gd and 10B, respectively at about 8 cm distance from the source center. DEF for 33S is equal to one. Conclusion: Results show that the magnitude of dose augmentation in tumors containing 10B and 157Gd in brachytherapy with 252Cf source will depend not only on the capture product dose level, but also on the tumor distance from the source. 33S makes dose enhancement under specific conditions that these conditions depend on the neutron energy spectra of source, the 33S concentration in tumor and tumor distance from the source.

Study of fission mechanism with the reactions 230Th, 231Pa, 235U, 237Np(n,f) and 252Cf(fs)

International Nuclear Information System (INIS)

Benfoughal, T.

1983-01-01

In this work, the different stages of the nuclear fission process have been investigated. The analysis of fission cross-section and fission fragment angular distribution measurements are made using the hypothesis of asymmetrically deformed states. From the correlation between fissioning nucleus excitation energy and fragment total kinetic energy measurement for several fissioning systems, it is shown that the nuclear viscosity is relatively strong during the saddle-point to scission-point transition. The study of the spontaneous fission of 252 Cf shows that the fragment mass and kinetic energy distributions are mainly determinated by the nucleon shell effects and pairing correlations [fr

A retrospective study of external beam radiation, neutron brachytherapy, and concurrent chemotherapy for patients with localized advanced carcinoma of the esophagus

International Nuclear Information System (INIS)

Ma, Kai; Wang, Qifeng; Li, Tao; Liu, Huiming; Liu, Bo; Jia, Xitang; Li, Shufeng; Lang, Junyuan; Zhang, Mingzhi

2014-01-01

The aim of this study was to retrospectively observe and analyze the long-term treatment outcomes of a total of 140 esophageal cancer patients who were treated with californium-252 ( 252 Cf) neutron brachytherapy (NBT) in combination with external beam radiotherapy (EBRT) and concurrent chemotherapy (CCT). From January 2002 to November 2012, 140 patients with esophageal cancer underwent NBT in combination with EBRT and CCT. The distribution of the patient numbers over the various cancer stages of IIA, IIB, and III were 43, 7, and 90, respectively. The total radiation dose to the reference point via NBT was 8–25 Gy-eq in two to five fractions with one fraction per week. The total dose via EBRT was 50–60 Gy, which was delivered over a period of five to six weeks with normal fractionation. Fifty-four and 86 patients received tegafur suppositories (TS) and continuous infusion of fluorouracil (5-Fu) with cisplatin (CDDP), respectively. The median follow-up time was 42 months. The minimum follow-up was three months, and the maximum was 106 months. The overall median survival including death from all causes was 29.5 months. The five-year overall survival rate (OS) and local control (LC) were 33.4% and 55.9%, respectively. The chemotherapy regimen was a factor that was significantly associated with OS (p = 0.025) according to univariate analysis. The five-year OSs were 27.4% and 44.3% for the PF and TS chemotherapy regimens, respectively. Regarding acute toxicity, no incidences of fistula or massive bleeding were observed during this treatment period. The incidence of severe, late complications was related to the PF chemotherapy regimen (p = 0.080). The clinical data indicated that NBT in combination with EBRT and CRT produced favorable local control and long-term survival rates for patients with esophageal cancer and that the side effects were tolerable. A reasonable CRT regimen can decrease the rate of severe, late complications

Transuranium processing plant report of production, status, and plans for the period October 1, 1978-September 30, 1980

International Nuclear Information System (INIS)

King, L.J.; Bigelow, J.E.; Collins, E.D.

1981-08-01

During this period, transuranium elements were obtained from 26 irradiated HFIT targets. The products included 86 mg of 249 Bk, 686 mg of 252 Cf, 3.1 mg of 253 Es, and an estimated 1.4 pg of 257 Fm. In addition, about 326 mg of high-purity 248 Cm was separated from previously purified 252 Cf. One hundred seven product shipments were made from TRU; recipients and the amounts of nuclides shipped are listed in a table. Forty-two standard and two special HFIR targets were fabricated. During the next 18 months, production totals of 110 mg of 249 Bk, 1200 mg of 252 Cf, 5.5 mg of 253 Es, and 2 pg of 257 Fm are anticipated. Also, a total of 225 mg of 248 Cm is expected to be made available. During this report period, a charcoal adsorber system for radioiodine removal was installed, tested, and placed in service. This system serves as a backup to the Hopcalite-charcoal system for adsorption of 131 I from the VOG stream. Seven 252 Cf neutron sources were fabricated during this report period. A total of 100 neutron sources have been fabricated previously at TRU. The original and current contents ( 252 Cf and 248 Cm) of the existing sources and the individuals to whom the sources are currently loaned are listed in a table. In addition to neutron sources, nine fission sources were prepared by electroplating 252 Cf onto platinum disks or foils.Special projects during this report period included (1) purification of two batches of isotopically pure 240 Pu, (2) fabrication of two special HFIR targets, (3) repurification of the residues of the einsteinium product from Campaign 56, (4) production of approx. 235 μg of 250 Cf by irradiation of 249 Bk, (5) radiography of 28 irradiated, stainless steel alloy, fracture-strain specimens, and (6) preparations for the production of 40 μg of 245 Es by irradiation of 253 Es

Design and construction of an explosive detection system by Tna methods, using 252Cf radioisotope source

International Nuclear Information System (INIS)

Tavakkoli Farsouli, A.

1999-01-01

Bombs concealed in luggage have threatened human life and property throughout the world's traffic. The plastic explosives could not checked by the X-ray detecting device. Thermal Neutron Activation method has been tested in the present work for non-destructive detection of explosives. A radioisotope neutron source 252 Cf and two gamma spectroscopy systems have been used as a tool to find explosives, regardless of the bomb's shape and the packing materials. The MCNP code has been used to design the neutronic section of the system. The measured thermal neutron fluxes by the gold foils in some location of the system were in good agreement with those data obtained by the MCNP code. Also, detection limits for nitrogen in various counting times were measured. The measurements show that the system is capable to detect 417 gr of HMX explosive material (158 gr nitrogen) by 10 minutes of counting time. To modify the system and to decrease the detection limits some opinions are given

Calculation of neutron spectra for a 252Cf transport cask using ANISN running on a PC

International Nuclear Information System (INIS)

West, L.; Akin, B.P.; Lemley, E.C.

1995-01-01

Neutron spectra have been calculated using the ANISN one-dimensional discrete ordinates code for the case of a 152 Cf source in a transport cask of a particular design. All computations were done on personal computers (PCs) (mostly 486 models) with the ANISN-ORNL (486 version) computer code. With a source of 252 Cf fission neutrons, the neutron flux spectrum in the cask cannot be characterized as open-quotes moderated.close quotes Concern about an appropriate choice for the cross-section data set has led to a comparison, for this application, of three different cross-section libraries: DABL, HILO, and BUGLE-80. Although the cross-section sets were not originally designed for PC use, the libraries have been successfully employed for PC computations. Work with yet another data library, BUGLE-93, is incomplete at this stage. From neutron flux spectra on the surface of the cask, personnel dosimetric quantities (such as dose equivalent) have been determined for the DABL, HILO, and BUGLE-80 ANISN calculations

48 CFR 252.217-7027 - Contract definitization.

Science.gov (United States)

2010-10-01

...., fixed-price or cost-and-fee) proposal and cost or pricing data supporting its proposal. (b) The schedule for definitizing this contract is as follows (insert target date for definitization of the contract... of the make-or-buy and subcontracting plans and cost or pricing data). (c) If agreement on a...

Some characteristics of two azoreductase systems in rat liver. Relevance to the activity of 2-[4'-di(2"-bromopropyl)-aminophenylazo]benzoic acid (CB10-252), a compound possessing latent cytotoxic activity

DEFF Research Database (Denmark)

Autrup, Herman; Warwick, Gerald P.

1975-01-01

-azoreductase was reduced by menadione (vitamin K3), cyanide and propylgallate. A diaphorase preparation from pig heart reduced both CB10-252 and methylred with both NADPH- and NADH-generating systems. The properties listed above and dependency of enzyme activity on both NADH and NADPH indicate a similarity of CB-10...

Automated box/drum waste assay (252Cf shuffler) through the material access and accountability boundary

International Nuclear Information System (INIS)

Horley, E.C.; Bjork, C.W.; Bourret, S.C.; Polk, P.J.; Schneider, C.J.; Studley, R.V.

1992-01-01

For the first time, a shuffler waste-assay system has been made a part of material access and accountability boundary (MAAB). A 252 Cf Pass-Thru shuffler integrated with a conveyor handling system, will process box or drum waste across the MAAB. This automated system will significantly reduce personnel operating costs because security forces will not be required at the MAAB during waste transfer. Further, the system eliminates the chance of a mix-up between measured and nonmeasured waste. This Pass-Thru shuffler is to be installed in the Westinghouse Savannah River Company 321M facility to screen waste boxes and drums for 235 U. An automated conveyor will load waste containers into the shuffler, and upon verification, will transfer the containers across the MAAB. Verification will consist of a weight measurement followed by active neutron interrogation. Containers that pass low-level waste criteria will be conveyed to an accumulator section outside the MAAB. If a container fails to meet the waste criteria, it will be rejected and sent back to the load station for manual inspection and repackaging

Measurements of the prompt neutron spectra in 233U, 235U, 239Pu thermal neutron fission in the energy range of 0.01-5 MeV and in 252Cf spontaneous fission in the energy range of 0.01-10 MeV

International Nuclear Information System (INIS)

Starostov, B.I.; Semenov, A.F.; Nefedov, V.N.

1978-01-01

The measurement results on the prompt neutron spectra in 233 U, 235 U, 239 Pu thermal neutron fission in the energy range of 0.01-5 MeV and in 252 Cf spontaneous fission in the energy range of 0.01-10 MeV are presented. The time-of-flight method was used. The exceeding of the spectra over the Maxwell distributions is observed at E 252 Cf neutron fission spectra. The spectra analysis was performed after normalization of the spectra and corresponding Maxwell distributions for one and the same area. In the range of 0.05-0.22 MeV the yield of 235 U + nsub(t) fission neutrons is approximately 8 and approximately 15 % greater than the yield of 252 Cf and 239 Pu + nsub(t) fission neutrons, respectively. In the range of 0.3-1.2 MeV the yield of 235 U + nsub(t) fission neutrons is 8 % greater than the fission neutron yield in case of 239 Pu + nsub(t) fission. The 235 U + nsub(t) and 233 U + nsub(t) fission neutron spectra do not differ from one another in the 0.05-0.6 MeV range

A fast neutron and dual-energy gamma-ray absorption method (NEUDEG) for investigating materials using a 252Cf source

International Nuclear Information System (INIS)

Bartle, C. Murray

2014-01-01

DEXA (dual-energy X-ray absorption) is widely used in airport scanners, industrial scanners and bone densitometers. DEXA determines the properties of materials by measuring the absorption differences of X-rays from a bremsstrahlung tube source with and without filtering. Filtering creates a beam with a higher mean energy, which causes lower material absorption. The absorption difference between measurements (those with a filter subtracted from those without a filter) is a positive number that increases with the effective atomic number of the material. In this paper, the concept of using a filter to create a dual beam and an absorption difference in materials is applied to radiation from a 252 Cf source, called NEUDEG (neutron and dual-energy gamma absorption). NEUDEG includes absorptions for fast neutrons as well as the dual photon beams and thus an incentive for developing the method is that, unlike DEXA, it is inherently sensitive to the hydrogen content of materials. In this paper, a model for the absorption difference and absorption sum in NEUDEG is presented using the combined gamma ray and fast neutron mass attenuation coefficients. Absorption differences can be either positive or negative in NEUDEG, increasing with increases in the effective atomic number and decreasing with increases in the hydrogen content. Sample sets of absorption difference curves are calculated for materials with typical gamma-ray and fast neutron mass attenuation coefficients. The model, which uses tabulated mass attenuated coefficients, agrees with experimental data for porcelain tiles and polyethylene sheets. The effects of “beam hardening” are also investigated. - Highlights: • Creation of a dual neutron/gamma beam from 252 Cf is described. • An absorption model is developed using mass attenuation coefficients. • A graphical method is used to show sample results from the model. • The model is successfully compared with experimental results. • The importance of

Calculated NWIS signatures for enriched uranium metal

International Nuclear Information System (INIS)

Valentine, T.E.; Mihalczo, J.T.; Koehler, P.E.

1995-01-01

Nuclear Weapons Identification System (NWIS) signatures have been calculated using a Monte Carlo transport code for measurement configurations of a 252 Cf source, detectors, and a uranium metal casting. NWIS signatures consist of a wide variety of time-and frequency-analysis signatures such as the time distribution of neutrons after californium fission, the time distribution of counts in a detector after a previous count, the number of times n pulses occur in a time interval, and various frequency-analysis signatures, such as auto-power and cross-power spectral densities, coherences, and a ratio of spectral densities. This ratio is independent of detection efficiency. The analysis presented here, using the MCNP-DSP code, evaluates the applicability of this method for measurement of the 235 U content of 19-kg castings of depleted uranium and uranium with enrichments of 20, 40, 60, 80, 90, and 93.2 wt % 235 U. The dependence of the wide variety of NWIS signatures on 235 U content and possible configurations of a measurement system are presented. These preliminary calculations indicate short measurement times. Additional calculations are being performed to optimize the source-detector-moderator-casting configuration for the shortest measurement time. Although the NWIS method was developed for nuclear weapons identification, the development of a small processor now allows it to be also applied in a practical way to subcriticality measurements, nuclear fuel process monitoring and qualitative nondestructive assay of special nuclear material

Attachment and spreadout study of 3T3 cells onto PP track etched films

International Nuclear Information System (INIS)

Smolko, Eduardo; Mazzei, Ruben; Tadey, Daniel; Lombardo, Daniel

2001-01-01

Polymer surface modifications are obtained by the application of radiation treatments and other physico-chemical methods: fission fragment (ff) irradiation and etching. The biocompatibility of the surface is then observed by cell seeding and cell adhesion experiments. Approaches to improvement of the cell adhesion are obtained by different methods: for example, in PS, cell adhesion is improved after ion implantation; in PMMA, after bombarding the polymer, the surface is reconditioned with surfactants and proteins and in PVDF, cell adhesion is assayed on nuclear tracks membranes. In this work, we obtained important cell adhesion improvements in PP films by irradiation with swift heavy ions and subsequent etching of the nuclear tracks. We use BOPP (isotactic -25 μm thickness). Irrradiations were performed with a Cf-252 californium ff source. The source has a heavy ff and a light one, with 160-200 MeV energy divided among them corresponding to ff energies between 1 and 2 MeV/amu. A chemical etching procedure consisting of a solution of sulphuric acid and chromium three oxide at 85 deg. C was used. The 3T3 NIH fibroblast cell line was used for the cell adhesion experiment. Here we report for the first time, the results of a series of experiments by varying the ff fluence and the etching time showing that attachment and spreadout of cells are very much improved in this cell line according to the number of pores and the pore size

Induction of external abnormalities in offspring of male mice irradiated with 252Cf neutron

International Nuclear Information System (INIS)

Kurishita, Akihiro; Ono, Tetsuya; Mori, Yuriko; Okada, Shigefumi; Sawada, Syozo

1992-01-01

To assess the genetic effects of fission neutron, the induction of external malformations was studied in F 1 fetuses after F 0 male mice were irradiated. Male mice of the ICR:MCH strain were irradiated with 252 Cf neutron at doses of 0.238, 0.475, 0.95 and 1.9 Gy. They were mated with non-irradiated female mice at 71-120 days after irradiation. Pregnant females were autopsied on day 18 of gestation and their fetuses were examined for deaths and external abnormalities. No increases of pre- and post-implantation losses were noted at any dose. External abnormalities were observed at rates of 1.40% in the 0.238 Gy, 2.23% in the 0.475 Gy, 3.36% in the 0.95 and 3.26% in the 1.9 Gy groups; the rate in the control group was 1.65%. The dose-response curve was linear up to 0.95 Gy, and then flattened out; the induction rate of external abnormalities was 2.7x10 -4 /gamete/cGy based on the linear regression. These results indicated that fission neutron effectively induces external abnormalities in F 1 fetuses after spermatogonial irradiation. (author). 29 refs.; 1 fig.; 2 tabs

252Cf-source-driven neutron noise measurements of subcriticality for a slab tank containing aqueous Pu-U nitrate

International Nuclear Information System (INIS)

Mihalczo, J.T.; Blakeman, E.D.; Ragan, G.E.; Kryter, R.C.; Robinson, R.C.; Seino, H.

1987-08-01

In order to study nuclear criticality safety related to the development of fast breeder technology, 252 Cf-source-driven neutron noise analysis measurements were performed with a Pu-U nitrate solution in a slab tank of various heights and thickness varying 11.43 cm to 19.05 cm. The results and conclusions of these experiments are (1) a capability to measure the subcriticality of a multiplying system of slab geometry to a k/sub eff/ as low as 0.7 was demonstrated, (2) calculated neutron multiplication factors agreed with those from the experiments within ∼0.02, and (3) the applicability of the method for plutonium solution systems was demonstrated. This paper describes measurements in which the height of the slab was varied for a fixed thickness and the thickness varied for a fixed height, which are the first applications of this measurement method to slab geometry

Transuranium processing plant semiannual report of production, status, and plans for period ending December 31, 1974

International Nuclear Information System (INIS)

King, L.J.; Bigelow, J.E.; Collins, E.D.

1975-07-01

During the period July 1, 1974, through December 31, 1974, the following amounts of transuranium elements were recovered from 11 irradiated HFIR targets: 1.5 g 243 Am, 45 g 244 Cm, 24 mg 249 Bk, 252 mg 252 Cf, 1.25 mg 253 Es, and 0.5 pg 257 Fm. In addition, 34 mg of high-purity 248 Cm was separated from 252 Cf which had been recovered and purified during earlier periods. Nine HFIR targets, each containing 8 to 9 g of actinides (predominantly curium), were fabricated. Some of the chemical processing steps used for processing HFIR targets were added, deleted, or rearranged in order to reduce processing time and increase product yields. One cubicle equipment rack was replaced and the out-of-cell piping and equipment associated with the remotely operated valves in the TRU cubicles was revised. One neutron source was fabricated. Three sources that had been used previously in various projects and returned to TRU were reloaned. A special project was begun to recover 126 Sn from TRU process solutions. The values currently in use for transuranium element decay data and for cross-section data in planning irradiation-processing cycles, calculating production forecasts, and assaying products are tabulated in the Appendix. (U.S.)

The observation of quasi-molecular ions from a tiger snake venom component (Msub(r) 13309) using 252Cf-plasma desorption mass spectrometry

International Nuclear Information System (INIS)

Kamensky, I.; Haakansson, P.; Kjellberg, J.; Sundqvist, B.; Fohlman, J.; Peterson, P.A.

1983-01-01

A method involving fast heavy-ion bombardment of a solid sample called 252 Cf-plasma desorption mass spectrometry has been used to study a non-enzymatic, non-toxic phospholipase homolog from Australian tiger snake (Notechis scutatus) venom. The protein consists of 119 amino acids in a single polypeptide chain cross-linked by 7 disulfide bridges. The isotopically averaged molecular mass as determined by protein sequence analysis is 13309 atomic mass units (amu). The mass distributions were studied by means of time-of-flight measurements. Quasi-molecular ions associated to the molecule and its dimer were observed. The mass of the quasi-molecular ion corresponding to the molecule was determined to be 13285 +- 25 amu. (Auth.)

Determination of the multiplication factor and its bias by the 252Cf-source technique: A method for code benchmarking with subcritical configurations

International Nuclear Information System (INIS)

Perez, R.B.; Valentine, T.E.; Mihalczo, J.T.; Mattingly, J.K.

1997-01-01

A brief discussion of the Cf-252 source driven method for subcritical measurements serves as an introduction to the concept and use of the spectral ratio, Γ. It has also been shown that the Monte Carlo calculation of spectral densities and effective multiplication factors have as a common denominator the transport propagator. This commonality follows from the fact that the Neumann series expansion of the propagator lends itself to the Monte Carlo method. On this basis a linear relationship between the spectral ratio and the effective multiplication factor has been shown. This relationship demonstrates the ability of subcritical measurements of the ratio of spectral densities to validate transport theory methods and cross sections

Study of the isomer nuclei produced in the spontaneous fission of {sup 252}Cf; Etude des noyaux isomeriques produits dans la fission spontanee de {sup 252}Cf

Energy Technology Data Exchange (ETDEWEB)

Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Thiesen, Ch. [Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee, CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Belier, G.; Girod, M.; Meot, M.V. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, G.; Meot, V.; Peru, S. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Inst.de Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)

1997-06-01

Isomeric states have been studied in fission fragments produced by spontaneous fission of {sup 252}Cf. 34 isomeric nuclei have been identified by using coincidences between {gamma}-rays detected in EUROGAM II and fission fragments detected in photovoltaic cells. Lifetimes from 20 ns up to 2 {mu}s have been measured. Microscopic interpretation of the isomeric levels discovered has been tried by means of the Hartree-Fock-Bogolyubov procedure using Gogny force. It was found that the {sup 152,154,156}Nd nuclei have prolate deformation in their ground state; the rotational band built on this ground state is well reproduced by the calculation. For these nuclei the 2 quasi-particle excited states energies are above 1 MeV in agreement with the experiment. The computation confirms the similitude of the {sup 156}Nd and {sup 158}Sm isomeric states associated to neutron 2 quasi-particles of J{sup {pi}} K{sup {pi}} = 5{sup -} ({nu} 5/2 (642) x {nu} 5/2 (523)) while such similitude does not occur for the isotone nuclei {sup 154}Nd and {sup 156}Sm. The computation predicts a proton 2 quasi-particle excited states of J{sup {pi}} = 5{sup -}, near the isomeric level measured in {sup 156}Sm but not for that of {sup 154}Nd. Concerning the {sup 152}Nd the calculated level density is very near that of the states measured in the 1.6 to 2.3 MeV interval. However, the lack of precise information on spins and parities of the measured levels does make not possible a confrontation with the calculations. An up-graded equipment implying 32 photovoltaic cells instead of 2 cells is to be developed and installed by the EUROGAM 3 refs.

Corrective Action Investigation Plan for Corrective Action Unit 252: Area 25 Engine Test Stand 1 Decontamination Pad, Nevada Test Site, Nevada

Energy Technology Data Exchange (ETDEWEB)

U.S. Department of Energy, Nevada Operations Office

1999-08-20

This Corrective Action Investigation Plan contains the U.S. Department of Energy, Nevada Operations Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit 252 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 252 consists of Corrective Action Site (CAS) 25-07-02, Engine Test Stand-1 (ETS-1) Decontamination Pad. Located in Area 25 at the intersection of Road H and Road K at the Nevada Test Site, ETS-1 was designed for use as a mobile radiation checkpoint and for vehicle decontamination. The CAS consists of a concrete decontamination pad with a drain, a gravel-filled sump, two concrete trailer pads, and utility boxes. Constructed in 1966, the ETS-1 facility was part of the Nuclear Rocket Development Station (NRDS) complex and used to test nuclear rockets. The ETS-1 Decontamination Pad and mobile radiation check point was built in 1968. The NRDS complex ceased primary operations in 1973. Based on site history, the focus of the field investigation activities will be to determine if any primary contaminants of potential concern (COPCs) (including radionuclides, total volatile organic compounds, total semivolatile organic compounds, total petroleum hydrocarbons as diesel-range organics, Resource Conservation and Recovery Act metals, total pesticides, and polychlorinated biphenyls) are present at this site. Vertical extent of migration of suspected vehicle decontamination effluent COPCs is expected to be less than 12 feet below ground surface. Lateral extent of migration of COPCs is expected to be limited to the sump area or near the northeast corner of the decontamination pad. Using a biased sampling approach, near-surface and subsurface sampling will be conducted at the suspected worst-case areas including the sump and soil near the northeast corner of the decontamination pad. The results of this field investigation will support a defensible e

Measurement of the average number of prompt neutrons emitted per fission of 235U relative to 252Cf for the energy region 500 eV to 10 MeV

International Nuclear Information System (INIS)

Gwin, R.; Spencer, R.R.; Ingle, R.W.; Todd, J.H.; Weaver, H.

1980-01-01

The average number of prompt neutrons emitted per fission ν/sub p/-bar(E), was measured for 235 U relative to ν/sub p/-bar for the spontaneous fission of 252 Cf over the neutron energy range from 500 eV to 10 MeV. The samples of 235 U and 252 Cf were contained in fission chambers located in the center of a large liquid scintillator. Fission neutrons were detected by the large liquid scintillator. The present values of ν/sub p/-bar(E) for 235 U are about 0.8% larger than those measured by Boldeman. In earlier work with the present system, it was noted that Boldeman's value of ν/sub p/-bar(E) for thermal energy neutrons was about 0.8% lower than obtained at ORELA. It is suggested that the thickness of the fission foil used in Boldeman's experiment may cause some of the discrepancy between his and the present values of ν/sub p/-bar(E). For the energy region up to 700 keV, the present values of ν/sub p/-bar(E) for 235 U agree, within the uncertainty, with those given in ENDF/B-V. Above 1 MeV the present results for ν/sub p/-bar(E) range about the ENDF/B-V values with differences up to 1.3%. 6 figures, 1 table

Nonmosaic tetrasomy 15q25.2 → qter identified with SNP microarray in a patient with characteristic facial appearance and review of the literature.

Science.gov (United States)

Xu, Huihui; Xiao, Bing; Ji, Xing; Hu, Qin; Chen, Yingwei; Qiu, Wenjuan

2014-07-01

Tetrasomy for the distal chromosome 15q is rare, and only 22 patients (including 6 cases without detailed information) have been described to date in the literature. Here we report on another patient with nonmosaic tetrasomy 15q25.2-qter resulted from an inverted duplication of distal chromosome 15. This patient presents with features of development delay, arachnodactyly, joint contractures and typical facial dysmorphism including frontal bossing, short palpebral fissures, long philtrum, low-set ears, high-arched palate and retrognathia. Unlike most of the related patients, abdominal ultrasound test and brain MRI showed normal. Karyotyping analysis revealed a supernumerary marker chromosome presented in all metaphase cells examined. Parental karyotyping analysis was normal, indicating a de novo chromosome aberration of the patient. SNP microarray analysis found a two copy gain of 17.7 Mb from the distal long arm of chromosome 15 (15q25.2-qter). Further FISH analysis using SureFISH 15q26.3 IGF1R probe proved an inverted duplication of distal long arm of chromosome 15. The segmental duplications which lie in the hotspots of 15q24-26 might increase the susceptibility of chromosome rearrangement. Compared with the George-Abraham' study [2012], ADAMTSL3 might be more related to the cardiac disorders in tetrasomy 15q patients. Considering all patients reported in the literature, different mosaic degrees and segmental sizes don't correlate to the severity of phenotypes. A clear delineation on tetrasomy for distal chromosome 15q could still be investigated. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Localized increase of tissue oxygen tension by magnetic targeted drug delivery

Science.gov (United States)

Liong, Celine; Ortiz, Daniel; Ao-ieong, Eilleen; Navati, Mahantesh S.; Friedman, Joel M.; Cabrales, Pedro

2014-07-01

Hypoxia is the major hindrance to successful radiation therapy of tumors. Attempts to increase the oxygen (O2) tension (PO2) of tissue by delivering more O2 have been clinically disappointing, largely due to the way O2 is transported and released by the hemoglobin (Hb) within the red blood cells (RBCs). Systemic manipulation of O2 transport increases vascular resistance due to metabolic autoregulation of blood flow to prevent over oxygenation. This study investigates a new technology to increase O2 delivery to a target tissue by decreasing the Hb-O2 affinity of the blood circulating within the targeted tissue. As the Hb-O2 affinity decreases, the tissue PO2 to satisfy tissue O2 metabolic needs increases without increasing O2 delivery or extraction. Paramagnetic nanoparticles (PMNPs), synthetized using gadolinium oxide, were coated with the cell permeable Hb allosteric effector L35 (3,5-trichlorophenylureido-phenoxy-methylpropionic acid). L35 decreases Hb affinity for O2 and favors the release of O2. The L35-coated PMNPs (L35-PMNPs) were intravenously infused (10 mg kg-1) to hamsters instrumented with the dorsal window chamber model. A magnetic field of 3 mT was applied to localize the effects of the L35-PMNPs to the window chamber. Systemic O2 transport characteristics and microvascular tissue oxygenation were measured after administration of L35-PMNPs with and without magnetic field. The tissue PO2 in untreated control animals was 25.2 mmHg. L35-PMNPs without magnetic field decreased tissue PO2 to 23.4 mmHg, increased blood pressure, and reduced blood flow, largely due to systemic modification of Hb-O2 affinity. L35-PMNPs with magnetic field increased tissue PO2 to 27.9 mmHg, without systemic or microhemodynamic changes. These results indicate that localized modification of Hb-O2 affinity can increase PO2 of target tissue without affecting systemic O2 delivery or triggering O2 autoregulation mechanisms. This technology can be used to treat local hypoxia and to

[Target volume margins for lung cancer: internal target volume/clinical target volume].

Science.gov (United States)

Jouin, A; Pourel, N

2013-10-01

The aim of this study was to carry out a review of margins that should be used for the delineation of target volumes in lung cancer, with a focus on margins from gross tumour volume (GTV) to clinical target volume (CTV) and internal target volume (ITV) delineation. Our review was based on a PubMed literature search with, as a cornerstone, the 2010 European Organisation for Research and Treatment of Cancer (EORTC) recommandations by De Ruysscher et al. The keywords used for the search were: radiotherapy, lung cancer, clinical target volume, internal target volume. The relevant information was categorized under the following headings: gross tumour volume definition (GTV), CTV-GTV margin (first tumoural CTV then nodal CTV definition), in field versus elective nodal irradiation, metabolic imaging role through the input of the PET scanner for tumour target volume and limitations of PET-CT imaging for nodal target volume definition, postoperative radiotherapy target volume definition, delineation of target volumes after induction chemotherapy; then the internal target volume is specified as well as tumoural mobility for lung cancer and respiratory gating techniques. Finally, a chapter is dedicated to planning target volume definition and another to small cell lung cancer. For each heading, the most relevant and recent clinical trials and publications are mentioned. Copyright © 2013. Published by Elsevier SAS.

5He, 7He, and 8Li (E*=2.26 MeV) intermediate ternary particles in the spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Kopatch, Yu.N.; Mutterer, M.; Schwalm, D.; Thirolf, P.; Goennenwein, F.

2002-01-01

The neutron-unstable odd-N isotopes 5 He, 7 He, and 8 Li (in its excited state of E*=2.26 MeV) were measured to show up as short-lived (τ≅10 -21 -10 -20 s) intermediate light charged particles (LCPs) in ternary fission of 252 Cf. For the study a high-efficiency angular correlation measurement between neutrons, LCPs, and main fission fragments has been performed. The evidence for the ternary 5 He and 7 He particles (lifetimes: 1x10 -21 s, and 4x10 -21 s, respectively) was disclosed from the measured angular distributions of their decay neutrons focused by the emission in flight towards the direction of motion of 4 He and 6 He ternary particles. Similarly, neutrons observed to be peaked around Li-particle motion could be attributed to the decay of the second excited state at E*=2.26 MeV (lifetime: 2x10 -20 s) of 8 Li. The fractional yields of the intermediate 5 He and 7 He ternary fission modes relative to the 'true' ternary 4 He and 6 He modes, respectively, were determined to be 0.21(5) for both cases. The mean energy of the 4 He residues resulting from the 5 He decay was determined to be 12.4(3) MeV, compared to 15.7(2) MeV for all ternary α particles registered, and to 16.4(3) MeV for the true ternary α particles. The mean energy of the 6 He residues from the 7 He decay is 11.0(15) MeV, compared to 12.3(5) MeV for all ternary 6 He particles. The population of 8 Li* was deduced to be 0.06(2) relative to Li ternary fission, and 0.33(20) relative to the yield of particle stable 8 Li. The perspective of using the observed intermediate LCPs for probing the ternary scission configuration in 252 Cf fission with the aid of trajectory calculations is briefly discussed

5He, 7He and 8Li (E=2.26 MeV) intermediate ternary particles in the spontaneous fission of 252Cf

International Nuclear Information System (INIS)

Kopatch, Yu. N.; Goennenwein, F.

2002-02-01

The neutron-unstable odd-N isotopes 5 He, 7 He and 8 Li (in its excited state of E * = 2.26 MeV) were measured to show up as short-lived intermediate light-charged-particles (LCP) in ternary fission of 252 Cf. For the study a high-efficiency angular correlation measurement between neutrons, LCPs and main fission fragments has been performed. The evidence for the ternary 5 He and 7 He particles (lifetimes: 1 x 10 -21 s, and 4 x 10 -21 s, respectively) was disclosed from the measured angular distributions of their decay neutrons focused by the emission in flight towards the direction of motion of 4 He and 6 He ternary particles. Similarly, neutrons observed to be peaked around Li-particle motion could be attributed to the decay of the second excited state at E * = 2.26 MeV (lifetime: 2 x 10 -20 s) of 8 Li. The fractional yields of the intermediate 5 He and 7 He ternary fission modes relative to the ''true'' ternary 4 He and 6 He modes, respectively, were determined to be 0.21(5) for both cases. The mean energy of the 4 He residues resulting from the 5 He decay was determined to be 12.4(3) MeV, compared to 15.7(2) MeV for all ternary α-particles registered, and to 16.4(3) MeV for the true ternary α-particles. The mean energy of the 6 He residues from the 7 He decay is 11.0(15) MeV, compared to 12.3(5) MeV for all ternary 6 He particles. The population of 8 Li * was deduced to be 0.06(2) relative to Li ternary fission, and 0.33(20) relative to the yield of particle stable 8 Li. The perspective of using the observed intermediate LCPs for probing the ternary scission configuration in 252 Cf fission with the aid of trajectory calculations is briefly discussed. (orig.)

Testing for moisture content in foods by neutron gaging

International Nuclear Information System (INIS)

Helf, S.

1976-01-01

Neutron gaging was applied to the testing for moisture content in bulk powdered foods and in canned Army field rations. The technique is based on the moderation or thermalization of fast neutrons by hydrogenous matter and the measurement of thermal neutron intensity as a function of moisture content. A small californium-252 capsule, of approximate output 10 7 neutrons per second, was used as the source of fast neutrons. It is concluded that a fast neutron moderation technique is feasible for the nondestructive measurement or control of moisture or both in near-dry bulk powdered foods. Samples must be measured under identical geometric conditions, that is, uniform bulk density and volume using a standard metal container or cell. For canned or otherwise prepacked rations, measurement of moisture is interfered with by variations in fill weight among cans or packages of the same product. A gamma-ray attenuation gaging method proved to be of insufficient sensitivity to correct for fill weight variation and was further complicated by nonuniformity in can wall dimensions. Neutron gaging, however, appears to be quite useful for monitoring a standard packaged item for fill weight since the neutron signal is virtually unaffected by variations in container dimensions. The radiation dose imparted to a sample or package of food subjected to such a test is judged to pose no threat to humans from subsequent consumption of the food. An estimate is given for the cost range of a commercial neutron gage and of encapsulated radioisotopic neutron sources

Radiation sources and process

International Nuclear Information System (INIS)

Honious, H.B.; Janzow, E.F.; Malson, H.A.; Moyer, S.E.

1980-01-01

The invention relates to radiation sources comprising a substrate having an electrically-conductive non-radioactive metal surface, a layer of a metal radioactive isotope of the scandium group, which in addition to scandium, yttrium, lanthanum and actinium, includes all the lanthanide and actinide series of elements, with the actinide series usually being preferred because of the nature of the radioactive isotopes therein, particularly americium-241, curium-244, plutonium-238, californium-252 and promethium-147, and a non-radioactive bonding metal codeposited on the surface by electroplating the isotope and bonding metal from an electrolytic solution, the isotope being present in the layer in minor amount as compared to the bonding metal, and with or without a non-radioactive protective metal coating covering the isotoype and bonding metal on the surface, the coating being sufficiently thin to permit radiation to pass through the coating. The invention also relates to a process for providing radiation sources comprising codepositing a layer of the metal radioactive isotope with a non-radioactive bonding metal from an electrolytic solution in which the isotope is present in minor molar amount as compared to the bonding metal such that the codeposited layer contains a minor molar amount of the isotope compared to the bonding metal by electroplating on an electrically-conductive non-radioactive metal surface of a cathode substrate, and with or without depositing a nonradioactive protective metal coating over the isotope and bonding metal on the surface, the coating being sufficiently thin to permit radiation to pass through the coating

The cross sections of fusion-evaporation reactions: the most promising route to superheavy elements beyond Z=118

Directory of Open Access Journals (Sweden)

Jadambaa Khuyagbaatar

2017-01-01

Full Text Available The synthesis of superheavy elements beyond oganesson (Og, which has atomic number Z = 118, is currently one of the main topics in nuclear physics. An absence of sufficient amounts of target material with atomic numbers heavier than californium (Z = 98 forces the use of projectiles heavier than 48Ca (Z = 20, which has been successfully used for the discoveries of elements with Z = 114 - 118 in complete fusion reactions. Experimental cross sections of 48Ca with actinide targets behave very differently to “cold” and “hot” fusion-evaporation reactions, where doubly-magic lead and deformed actinides are used as targets, respectively. The known cross sections of these reactions have been analysed compared to calculated fission barriers. It has been suggested that observed discrepancies between the cross sections of 48Ca-induced and other fusionevaporation reactions originate from the shell structure of the compound nucleus, which lies in the island of the stability. Besides scarcely known data on other reactions involving heavier projectiles, the most promising projectile for the synthesis of the elements beyond Og seems to be 50Ti. However, detailed studies of 50Ti, 54Cr, 58Fe and 64Ni-induced reactions are necessary to be performed in order to fully understand the complexities of superheavy element formation.