
Sample records for californium 251

  1. Californium-252 progress, report No. 7, April 1971

    Energy Technology Data Exchange (ETDEWEB)


    This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.

  2. Historical review of californium-252 discovery and development (United States)

    Stoddard, D. H.

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving (252)Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed.

  3. Californium-252: a remarkable versatile radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Osborne-Lee, I.W.; Alexander, C.W.


    A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

  4. Production, Distribution, and Applications of Californium-252 Neutron Sources

    Energy Technology Data Exchange (ETDEWEB)

    Balo, P.A.; Knauer, J.B.; Martin, R.C.


    The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10{sup 11} neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6- year half-life. A source the size of a person's little finger can emit up to 10 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory(ORNL). DOE sells {sup 252}Cf to commercial

  5. Unusual structure, bonding and properties in a californium borate

    Energy Technology Data Exchange (ETDEWEB)

    Polinski, Matthew J.; Garner, Edward B.; Maurice, Rémi; Planas, Nora; Stritzinger, Jared T.; Parker, T. Gannon; Cross, Justin N.; Green, Thomas D.; Alekseev, Evgeny V.; Van Cleve, Shelley M.; Depmeier, Wulf; Gagliardi, Laura; Shatruk, Michael; Knappenberger, Kenneth L.; Liu, Guokui; Skanthakumar, S.; Soderholm, Lynda; Dixon, David A.; Albrecht-Schmitt, Thomas E.


    The participation of the valence orbitals of actinides in bonding has been debated for decades. Recent experimental and computational investigations demonstrated the involvement of 6p, 6d and/or 5f orbitals in bonding. However, structural and spectroscopic data, as well as theory, indicate a decrease in covalency across the actinide series, and the evidence points to highly ionic, lanthanide-like bonding for late actinides. Here we show that chemical differentiation between californium and lanthanides can be achieved by using ligands that are both highly polarizable and substantially rearrange on complexation. A ligand that suits both of these desired properties is polyborate. We demonstrate that the 5f, 6d and 7p orbitals are all involved in bonding in a Cf(III) borate, and that large crystal-field effects are present. Synthetic, structural and spectroscopic data are complemented by quantum mechanical calculations to support these observations.

  6. Biomedical neutron research at the Californium User Facility for neutron science

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R.C. [Oak Ridge National Lab., TN (United States); Byrne, T.E. [Roane State Community College, Harriman, TN (United States); Miller, L.F. [Univ. of Tennessee, Knoxville, TN (United States)


    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact {sup 252}Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with {sup 252}Cf sources. Three projects at the CUF that demonstrate the versatility of {sup 252}Cf for biological and biomedical neutron-based research are described: future establishment of a {sup 252}Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded {sup 252}Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy.

  7. 36 CFR 251.86 - Parties. (United States)


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Parties. 251.86 Section 251.86 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE LAND USES Appeal of Decisions Relating to Occupancy and Use of National Forest System Lands § 251.86 Parties. Only the following...

  8. 7 CFR 251.6 - Distribution plan. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Distribution plan. 251.6 Section 251.6 Agriculture... GENERAL REGULATIONS AND POLICIES-FOOD DISTRIBUTION THE EMERGENCY FOOD ASSISTANCE PROGRAM § 251.6 Distribution plan. Link to an amendment published at 74 FR 62474, Nov. 30, 2009. (a) Contents of the plan. The...

  9. 36 CFR 251.96 - Intervention. (United States)


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Intervention. 251.96 Section... of Decisions Relating to Occupancy and Use of National Forest System Lands § 251.96 Intervention. (a... discretionary review level (§ 251.87(d)) shall be denied. (b) To request intervention in a first-level appeal...

  10. 20 CFR 704.251 - DCCA endorsement. (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false DCCA endorsement. 704.251 Section 704.251... Columbia Workmen's Compensation Act § 704.251 DCCA endorsement. The following form of endorsement... reversed by appropriate appellate authority as provided for by said Act. This endorsement shall not be...

  11. 14 CFR 29.251 - Vibration. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Vibration. 29.251 Section 29.251... STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Flight Miscellaneous Flight Requirements § 29.251 Vibration. Each part of the rotorcraft must be free from excessive vibration under each appropriate speed and power...

  12. 14 CFR 27.251 - Vibration. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Vibration. 27.251 Section 27.251... STANDARDS: NORMAL CATEGORY ROTORCRAFT Flight Miscellaneous Flight Requirements § 27.251 Vibration. Each part of the rotorcraft must be free from excessive vibration under each appropriate speed and power...

  13. 42 CFR 2.51 - Medical emergencies. (United States)


    ... and time of the disclosure; and (4) The nature of the emergency (or error, if the report was to FDA... 42 Public Health 1 2010-10-01 2010-10-01 false Medical emergencies. 2.51 Section 2.51 Public... OF ALCOHOL AND DRUG ABUSE PATIENT RECORDS Disclosures Without Patient Consent § 2.51 Medical...

  14. 48 CFR 251.205 - Contract clause. (United States)


    ... Fleet Management System (IFMS) Vehicles 251.205 Contract clause. Use the clause at 252.251-7001, Use of Interagency Fleet Management System (IFMS)Vehicles and Related Services, in solicitations and contracts which include the clause at FAR 52.251-2, Interagency Fleet Management System (IFMS) Vehicles and Related...

  15. 49 CFR 234.251 - Standby power. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Standby power. 234.251 Section 234.251 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Inspections and Tests § 234.251 Standby power. Standby power shall be tested at least...

  16. Apparatus for the measurement of total body nitrogen using prompt neutron activation analysis with californium-252. (United States)

    Mackie, A; Hannan, W J; Smith, M A; Tothill, P


    Details of clinical apparatus designed for the measurement of total body nitrogen (as an indicator of body protein), suitable for the critically ill, intensive-care patient are presented. Californium-252 radio-isotopic neutron sources are used, enabling a nitrogen measurement by prompt neutron activation analysis to be made in 40 min with a precision of +/- 3.2% for a whole body dose equivalent of 0.145 mSv. The advantages of Californium-252 over alternative neutron sources are discussed. A comparison between two irradiation/detection geometries is made, leading to an explanation of the geometry adopted for the apparatus. The choice of construction and shielding materials to reduce the count rate at the detectors and consequently to reduce the pile-up contribution to the nitrogen background is discussed. Salient features of the gamma ray spectroscopy system to reduce spectral distortion from pulse pile-up are presented.

  17. Safety Analysis Report for Packaging (SARP) of the Oak Ridge National Laboratory TRU Californium Shipping Container

    Energy Technology Data Exchange (ETDEWEB)

    Box, W.D.; Shappert, L.B.; Seagren, R.D.; Klima, B.B.; Jurgensen, M.C.; Hammond, C.R.; Watson, C.D.


    An analytical evaluation of the Oak Ridge National Laboratory TRU Californium Shipping Container was made in order to demonstrate its compliance with the regulations governing off-site shipment of packages that contain radioactive material. The evaluation encompassed five primary categories: structural integrity, thermal resistance, radiation shielding, nuclear criticality safety, and quality assurance. The results of this evaluation demonstrate that the container complies with the applicable regulations.

  18. 36 CFR 251.121 - Definitions. (United States)


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Definitions. 251.121 Section... Revenue-Producing Visitor Services in Alaska § 251.121 Definitions. In addition to the definitions in... partnership, limited partnership, joint venture, or individual entrepreneurship, a beneficial ownership of or...

  19. 7 CFR 251.2 - Administration. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 251.2 Section 251.2 Agriculture... Administration. (a) Food and Nutrition Service. Within the United States Department of Agriculture (the... this section, any information on changes in program administration, including any changes resulting...

  20. 37 CFR 2.51 - Drawing required. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Drawing required. 2.51... COMMERCE RULES OF PRACTICE IN TRADEMARK CASES Drawing § 2.51 Drawing required. (a) In an application under section 1(a) of the Act, the drawing of the mark must be a substantially exact representation of the mark...

  1. 36 CFR 251.57 - Rental fees. (United States)


    ... covering more than one year. (3) A base cabin user fee for a recreation residence use shall be 5 percent of... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Rental fees. 251.57 Section... Uses § 251.57 Rental fees. (a) Except as otherwise provided in this part or when specifically...

  2. 40 CFR 25.1 - Introduction. (United States)


    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Introduction. 25.1 Section 25.1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN PROGRAMS UNDER THE... Introduction. This part sets forth minimum requirements and suggested program elements for public participation...

  3. 48 CFR 251.202 - Authorization. (United States)


    ... OF DEFENSE CONTRACT MANAGEMENT USE OF GOVERNMENT SOURCES BY CONTRACTORS Contractor Use of Interagency Fleet Management System (IFMS) Vehicles 251.202 Authorization. (a)(2)(A) See FAR 28.307-2(c) for policy...

  4. Dicty_cDB: SLJ251 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLJ251 (Link to dictyBase) - - - Contig-U13343-1 | Contig-U15969-1 SLJ...251P (Link to Original site) SLJ251F 186 SLJ251Z 244 SLJ251P 430 - - Show SLJ251 Library SL (Link to library) Clone ID SLJ...43-1 | Contig-U15969-1 Original site URL Representative seq. ID SLJ251P (Link to Original site) Representative DNA sequence >SLJ251 (SLJ...251Q) /CSM/SL/SLJ2-C/SLJ251Q.Seq.d/ AAAGCAATATTTATTTAATTTTTTAAAAAAAAAGAATCAAATAAAATAGAGTAACAATAT

  5. 29 CFR 1910.251 - Definitions. (United States)


    ... Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR OCCUPATIONAL SAFETY AND HEALTH STANDARDS Welding, Cutting and Brazing § 1910.251 Definitions. As used in this subpart: (a) Welder and welding operator mean any operator of electric or gas welding and cutting...

  6. 48 CFR 2452.251-70 - Contractor employee travel. (United States)


    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Contractor employee travel. 2452.251-70 Section 2452.251-70 Federal Acquisition Regulations System DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 2452.251-70 Contractor employee travel...

  7. 37 CFR 251.23 - FOIA and Privacy Act. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false FOIA and Privacy Act. 251.23 Section 251.23 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT... Access to and Inspection of Records § 251.23 FOIA and Privacy Act. Freedom of Information Act and Privacy...

  8. 27 CFR 25.1 - Production and removal of beer. (United States)


    ... beer. 25.1 Section 25.1 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Scope of Regulations § 25.1 Production and removal of beer. The regulations in this part relate to beer and cereal beverages and cover the location, construction, equipment...

  9. 37 CFR 251.30 - Basic obligations of arbitrators. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Basic obligations of arbitrators. 251.30 Section 251.30 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS... arbitrators may accept gifts of nominal value or gifts from friends and family as specified in § 251.34(b). (5...

  10. 38 CFR 17.251 - The Subcommittee on Academic Affairs. (United States)


    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false The Subcommittee on Academic Affairs. 17.251 Section 17.251 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Grants for Exchange of Information § 17.251 The Subcommittee on Academic Affairs. There is...

  11. 20 CFR 632.251 - Eligibility for funds. (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Eligibility for funds. 632.251 Section 632.251 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR INDIAN AND NATIVE AMERICAN EMPLOYMENT AND TRAINING PROGRAMS Summer Youth Employment and Training Programs § 632.251...

  12. Application of TSH bioindicator for studying the biological efficiency of neutrons from californium-252 source

    Energy Technology Data Exchange (ETDEWEB)

    Cebulska-Wasilewska, A.; Rekas, K. [Institute of Nuclear Physics, Cracow (Poland); Kim, J.K. [Korea Atomic Energy Research Inst., Taejon (Korea, Republic of)


    The effectiveness of neutrons from a Californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH-assay) was studied. The special attention was paid to check whether any enhancement in effects caused by process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescence, normal or pretreated with chemicals containing boron, were irradiated in the air with neutrons from a Cf-252 source at KAERI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) in the induction of gene mutations of the neutron beam under the study, Tradescantia inflorescences, without any chemical pretreatment, were irradiated with various doses of X-rays. The ranges of radiation doses used were 0-0.1 Gy in neutrons and 0-0.5 Gy in X-rays. After the time needed to complete the postirradiation repair Tradescantia cuttings were transferred to Cracow, where screening of gene and lethal; mutations, cell cycle alterations in somatic cells have been done, and dose response relationships were figured. The maximal RBE values were estimated in the range of 4.6-6.8. Alterations of RBE value were observed; from 6.8 to 7.8 in the case of plants pretreated with 240 ppm of B-10 from borax, and 4.6 to 6.1 in the case of 400 ppm of B-10 from BSH. Results showed a slight, although statistically insignificant increase in biological efficacy of radiation from the Cf-252 source in samples pretreated with boron containing chemicals. (author)

  13. 48 CFR 952.251-70 - Contractor employee travel discounts. (United States)


    ... discounts. 952.251-70 Section 952.251-70 Federal Acquisition Regulations System DEPARTMENT OF ENERGY CLAUSES... Contractor employee travel discounts. As prescribed in 951.7002, insert the following clause: Contractor Employee Travel Discounts (AUG 2009) (a) The Contractor shall take advantage of travel discounts offered to...

  14. 14 CFR 23.251 - Vibration and buffeting. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Vibration and buffeting. 23.251 Section 23... Requirements § 23.251 Vibration and buffeting. There must be no vibration or buffeting severe enough to result in structural damage, and each part of the airplane must be free from excessive vibration, under any...

  15. 40 CFR 265.251 - Protection from wind. (United States)


    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Protection from wind. 265.251 Section... FACILITIES Waste Piles § 265.251 Protection from wind. The owner or operator of a pile containing hazardous waste which could be subject to dispersal by wind must cover or otherwise manage the pile so that wind...

  16. 37 CFR 251.35 - Outside employment and other activities. (United States)


    ... activities. 251.35 Section 251.35 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS... the arbitrator's knowledge and acquiescence to the arbitrator's parent, sibling, spouse, child, or..., including any charitable organization, on the basis of designation, recommendation, or other specification...

  17. 36 CFR 251.83 - Decisions not appealable. (United States)


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Decisions not appealable. 251.83 Section 251.83 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE LAND... such as wildfires, severe wind, earthquakes, and flooding when the Regional Forester or, in situations...

  18. 8 CFR 251.2 - Notification of illegal landings. (United States)


    ... the United States shall inform the immigration officer in charge of the port where the illegal landing... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Notification of illegal landings. 251.2 Section 251.2 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS ARRIVAL AND...

  19. Study of the shielding for spontaneous fission sources of Californium-252; Estudio de blindaje para fuentes de fision espontanea de Californio-252

    Energy Technology Data Exchange (ETDEWEB)

    Davila R, I


    A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)

  20. Protein engineering of cyclodextrin glycosyltransferase from Bacillus circulans strain 251

    NARCIS (Netherlands)

    Penninga, Dirk


    An enormous diversity of molecular functions in living organisms is carried out by proteins. Our studies have focussed on the functional analysis of a starch-converting enzyme, cyclodextrin glycosyltransferase (CGTase) from Bacillus circulans strain 251. Zie: Summary

  1. Simulation and design of an electron beam ion source charge breeder for the californium rare isotope breeder upgrade

    Directory of Open Access Journals (Sweden)

    Clayton Dickerson


    Full Text Available An electron beam ion source (EBIS will be constructed and used to charge breed ions from the californium rare isotope breeder upgrade (CARIBU for postacceleration into the Argonne tandem linear accelerator system (ATLAS. Simulations of the EBIS charge breeder performance and the related ion transport systems are reported. Propagation of the electron beam through the EBIS was verified, and the anticipated incident power density within the electron collector was identified. The full normalized acceptance of the charge breeder with a 2 A electron beam, 0.024π  mm mrad for nominal operating parameters, was determined by simulating ion injection into the EBIS. The optics of the ion transport lines were carefully optimized to achieve well-matched ion injection, to minimize emittance growth of the injected and extracted ion beams, and to enable adequate testing of the charge bred ions prior to installation in ATLAS.

  2. Extraction of Trivalent Actinides and Lanthanides from Californium Campaign Rework Solution Using TODGA-based Solvent Extraction System

    Energy Technology Data Exchange (ETDEWEB)

    Benker, Dennis [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dryman, Joshua Cory [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)


    This report presents the studies carried out to demonstrate the possibility of quantitatively extracting trivalent actinides and lanthanides from highly acidic solutions using a neutral ligand-based solvent extraction system. These studies stemmed from the perceived advantage of such systems over cationexchange- based solvent extraction systems that require an extensive feed adjustment to make a low-acid feed. The targeted feed solutions are highly acidic aqueous phases obtained after the dissolution of curium targets during a californium (Cf) campaign. Results obtained with actual Cf campaign solutions, but highly diluted to be manageable in a glove box, are presented, followed by results of tests run in the hot cells with Cf campaign rework solutions. It was demonstrated that a solvent extraction system based on the tetraoctyl diglycolamide molecule is capable of quantitatively extracting trivalent actinides from highly acidic solutions. This system was validated using actual feeds from a Cf campaign.

  3. Beyond Californium-A Neutron Generator Alternative for Dosimetry and Instrument Calibration in the U.S. (United States)

    Piper, Roman K; Mozhayev, Andrey V; Murphy, Mark K; Thompson, Alan K


    Evaluations of neutron survey instruments, area monitors, and personal dosimeters rely on reference neutron radiations, which have evolved from the heavy reliance on (α,n) sources to a shared reliance on (α,n) and the spontaneous fission neutrons of californium-252 (Cf). Capable of producing high dose equivalent rates from an almost point source geometry, the characteristics of Cf are generally more favorable when compared to the use of (α,n) and (γ,n) sources or reactor-produced reference neutron radiations. Californium-252 is typically used in two standardized configurations: unmoderated, to yield a fission energy spectrum; or with the capsule placed within a heavy-water moderating sphere to produce a softened spectrum that is generally considered more appropriate for evaluating devices used in nuclear power plant work environments. The U.S. Department of Energy Cf Loan/Lease Program, a longtime origin of affordable Cf sources for research, testing and calibration, was terminated in 2009. Since then, high-activity sources have become increasingly cost-prohibitive for laboratories that formerly benefited from that program. Neutron generators, based on the D-T and D-D fusion reactions, have become economically competitive with Cf and are recognized internationally as important calibration and test standards. Researchers from the National Institute of Standards and Technology and the Pacific Northwest National Laboratory are jointly considering the practicality and technical challenges of implementing neutron generators as calibration standards in the U.S. This article reviews the characteristics of isotope-based neutron sources, possible isotope alternatives to Cf, and the rationale behind the increasing favor of electronically generated neutron options. The evaluation of a D-T system at PNNL has revealed characteristics that must be considered in adapting generators to the task of calibration and testing where accurate determination of a dosimetric quantity is

  4. Californium-252 Brachytherapy Combined With External-Beam Radiotherapy for Cervical Cancer: Long-Term Treatment Results

    Energy Technology Data Exchange (ETDEWEB)

    Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu [Cancer Center, Research Institute of Surgery and Daping Hospital, Third Military Medical University, Chongqing (China); Wang Dong, E-mail: [Cancer Center, Research Institute of Surgery and Daping Hospital, Third Military Medical University, Chongqing (China)


    Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ({sup 252}Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with {sup 252}Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7-12 Gy per insertion per week, with a total dose of 29-45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16-38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44-56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of {sup 252}Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.

  5. 36 CFR 251.102 - Applicability and effective date. (United States)


    ... administration of written instruments authorizing occupancy and use of National Forest System lands made on or... AGRICULTURE LAND USES Appeal of Decisions Relating to Occupancy and Use of National Forest System Lands § 251... authorizing occupancy and use of National Forest System lands shall be subject to appeal under the provisions...

  6. 14 CFR 25.251 - Vibration and buffeting. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Vibration and buffeting. 25.251 Section 25... Vibration and buffeting. (a) The airplane must be demonstrated in flight to be free from any vibration and... airplane must be demonstrated in flight to be free from excessive vibration under any appropriate speed and...

  7. 36 CFR 251.9 - Management of Municipal Watersheds. (United States)


    ... LAND USES Miscellaneous Land Uses Natural Resources Control § 251.9 Management of Municipal Watersheds... forth in subpart B of this part. (e) Any municipal watershed management agreements, special use... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Management of Municipal...

  8. Phenotype abnormality: 251 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available lant flowering stage in environment of long day length regimen in environment of long day length regimen htt... 251 delayed whole p

  9. 37 CFR 251.45 - Discovery and prehearing motions. (United States)


    ... than overnight express mail on the same day the pleading is filed. (ii) Subject to § 251.64, the... section, designate a 45-day period for precontroversy discovery and exchange of documents. The period will... proceeding must effect actual delivery of a complete copy of its written direct case on each of the other...

  10. 28 CFR 25.1 - Purpose and authority. (United States)


    ... Instant Criminal Background Check System § 25.1 Purpose and authority. The purpose of this subpart is to... Instant Criminal Background Check System (NICS) to be contacted by any licensed importer, licensed... procedures for persons who have been denied the right to obtain a firearm as a result of a NICS background...

  11. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.


    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  12. 7 CFR 1726.251 - Prior approved contract modification related to price escalation on transmission equipment... (United States)


    ... escalation on transmission equipment, generation equipment, and generation construction contracts. 1726.251 Section 1726.251 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES... escalation on transmission equipment, generation equipment, and generation construction contracts. (a...

  13. 46 CFR 251.11 - Applications under Title VI, Merchant Marine Act, 1936, as amended. (United States)


    ... 46 Shipping 8 2010-10-01 2010-10-01 false Applications under Title VI, Merchant Marine Act, 1936, as amended. 251.11 Section 251.11 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION... AID § 251.11 Applications under Title VI, Merchant Marine Act, 1936, as amended. (a) Applications...

  14. 37 CFR 251.72 - Declaration of controversy: Initiation of arbitration proceeding. (United States)


    ...: Initiation of arbitration proceeding. 251.72 Section 251.72 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT ARBITRATION ROYALTY PANEL RULES OF PROCEDURE Royalty Fee Distribution Proceedings § 251.72 Declaration of...

  15. 37 CFR 251.64 - Disposition of petition; initiation of arbitration proceeding. (United States)


    ...; initiation of arbitration proceeding. 251.64 Section 251.64 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT ARBITRATION ROYALTY PANEL RULES OF PROCEDURE Rate Adjustment Proceedings § 251.64 Disposition of petition...

  16. 38 CFR 3.251 - Income of parents; dependency and indemnity compensation. (United States)


    ...; dependency and indemnity compensation. 3.251 Section 3.251 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation Dependency, Income and Estate § 3.251 Income of parents; dependency and indemnity compensation. (a) Annual...

  17. 37 CFR 251.54 - Assessment of costs of arbitration panels. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Assessment of costs of arbitration panels. 251.54 Section 251.54 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF... OF PROCEDURE Procedures of Copyright Arbitration Royalty Panels § 251.54 Assessment of costs of...

  18. Ab initio full-potential study of mechanical properties and magnetic phase stability of californium monopnictides (CfN and CfP)

    Energy Technology Data Exchange (ETDEWEB)

    Amari, S., E-mail: [Faculté des Sciences de la Nature et de la Vie, Université Hassiba Benbouali, Chlef, 02000 (Algeria); Bouhafs, B. [Laboratoire de Modélisation et Simulation en Sciences des Matériaux, Université Djillali Liabès de Sidi Bel-Abbés, Sidi Bel-Abbés, 22000 (Algeria)


    Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young’s modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.

  19. Low-Dose-Rate Californium-252 Neutron Intracavitary Afterloading Radiotherapy Combined With Conformal Radiotherapy for Treatment of Cervical Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Min [Department of Oncology, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Xu Hongde [Cancer Center, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Pan Songdan; Lin Shan; Yue Jianhua [Department of Oncology, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Liu Jianren, E-mail: [Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang Province (China)


    Purpose: To study the efficacy of low-dose-rate californium-252 ({sup 252}Cf) neutron intracavitary afterloading radiotherapy (RT) combined with external pelvic RT for treatment of cervical cancer. Methods and Materials: The records of 96 patients treated for cervical cancer from 2006 to 2010 were retrospectively reviewed. For patients with tumors {<=}4 cm in diameter, external beam radiation was performed (1.8 Gy/day, five times/week) until the dose reached 20 Gy, and then {sup 252}Cf neutron intracavitary afterloading RT (once/week) was begun, and the frequency of external beam radiation was changed to four times/week. For patients with tumors >4 cm, {sup 252}Cf RT was performed one to two times before whole-pelvis external beam radiation. The tumor-eliminating dose was determined by using the depth limit of 5 mm below the mucosa as the reference point. In all patients, the total dose of the external beam radiation ranged from 46.8 to 50 Gy. For {sup 252}Cf RT, the dose delivered to point A was 6 Gy/fraction, once per week, for a total of seven times, and the total dose was 42 Gy. Results: The mean {+-} SD patient age was 54.7 {+-} 13.7 years. Six patients had disease assessed at stage IB, 13 patients had stage IIA, 49 patients had stage IIB, 3 patients had stage IIIA, 24 patients had stage IIIB, and 1 patient had stage IVA. All patients obtained complete tumor regression (CR). The mean {+-} SD time to CR was 23.5 {+-} 3.4 days. Vaginal bleeding was fully controlled in 80 patients within 1 to 8 days. The mean {+-} SD follow-up period was 27.6 {+-} 12.7 months (range, 6-48 months). Five patients died due to recurrence or metastasis. The 3-year survival and disease-free recurrence rates were 89.6% and 87.5 %, respectively. Nine patients experienced mild radiation proctitis, and 4 patients developed radiocystitis. Conclusions: Low-dose-rate {sup 252}Cf neutron RT combined with external pelvic RT is effective for treating cervical cancer, with a low incidence of

  20. Cannabinoid receptor antagonists AM251 and AM630 activate TRPA1 in sensory neurons (United States)

    Patil, Mayur; Patwardhan, Amol; Salas, Margaux M.; Hargreaves, Kenneth M.; Akopian, Armen N.


    Cannabinoid receptor antagonists have been utilized extensively in vivo as well as in vitro, but their selectivity has not been fully examined. We investigated activation of sensory neurons by two cannabinoid antagonists – AM251 and AM630. AM251 and AM630 activated trigeminal (TG) sensory neurons in a concentration-dependent fashion (threshold 1 μM). AM251 and AM630 responses are mediated by the TRPA1 channel in a majority (90–95%) of small-to-medium TG sensory neurons. AM630 (1–100 μM), but not AM251, was a significantly more potent agonist in cells co-expressing both TRPA1 and TRPV1 channels. We next evaluated AM630 and AM251 effects on TRPV1- and TRPA1-mediated responses in TG neurons. Capsaicin (CAP) effects were inhibited by pre-treatment with AM630, but not AM251. Mustard oil (MO) and WIN55,212-2 (WIN) TRPA1 mediated responses were also inhibited by pre-treatment with AM630, but not AM251 (25uM each). Co-treatment of neurons with WIN and either AM630 or AM251 had opposite effects: AM630 sensitized WIN responses, whereas AM251 inhibited WIN responses. WIN-induced inhibition of CAP responses in sensory neurons was reversed by AM630 pre-treatment and AM251 co-treatment (25μM each), as these conditions inhibit WIN responses. Hindpaw injections of AM630 and AM251 did not produce nocifensive behaviors. However, both compounds modulated CAP-induced thermal hyperalgesia in wild-type mice and rats, but not TRPA1 null-mutant mice. AMs also partially regulate WIN inhibition of CAP-induced thermal hyperalgesia in a TRPA1-dependent fashion. In summary, these findings demonstrate alternative targets for the cannabinoid antagonists, AM251 and AM630, in peripheral antihyperalgesia which involve certain TRP channels. PMID:21645531

  1. 36 CFR 251.123 - Most directly affected Native Corporation determination. (United States)


    ... Corporations may submit such additional information as they consider relevant. (b) Upon receipt of all... Corporation determination. 251.123 Section 251.123 Parks, Forests, and Public Property FOREST SERVICE... affected Native Corporation determination. (a) Before issuance of the first special use authorization for a...

  2. 37 CFR 251.36 - Pre-arbitration and post-arbitration employment restrictions. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Pre-arbitration and post-arbitration employment restrictions. 251.36 Section 251.36 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT...

  3. Impact of pEGFP mediated ING4 gene on growth of glioma U251 ...

    African Journals Online (AJOL)

    To investigate the impact of the inhibitor of growth family 4 (ING4) on growth of glioma cells (U251 cells) and its potential molecular mechanism, total RNA was extracted from the embryonic tissues and ING4 was amplified by RT-PCR and cloned into pEGFP-C2 vector. U251 cells were transfected with eukaryotic expression ...

  4. 37 CFR 251.6 - Composition and selection of Copyright Arbitration Royalty Panels. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Composition and selection of Copyright Arbitration Royalty Panels. 251.6 Section 251.6 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT...

  5. 37 CFR 251.2 - Purpose of Copyright Arbitration Royalty Panels. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Purpose of Copyright Arbitration Royalty Panels. 251.2 Section 251.2 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT ARBITRATION ROYALTY...

  6. 37 CFR 251.7 - Actions of Copyright Arbitration Royalty Panels. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Actions of Copyright Arbitration Royalty Panels. 251.7 Section 251.7 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT ARBITRATION ROYALTY...

  7. 7 CFR 2.51 - Deputy Under Secretary for Food Safety. (United States)


    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Deputy Under Secretary for Food Safety. 2.51 Section 2... Safety § 2.51 Deputy Under Secretary for Food Safety. Pursuant to § 2.18, and subject to policy guidance... Secretary for Food Safety to the Deputy Under Secretary for Food Safety, to be exercised only during the...

  8. 7 CFR 58.251 - Dry buttermilk and dry buttermilk product. (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Dry buttermilk and dry buttermilk product. 58.251 Section 58.251 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS...


    Bellenot, S. F.


    The Time Warp Operating System (TWOS) is a special-purpose operating system designed to support parallel discrete-event simulation. TWOS is a complete implementation of the Time Warp mechanism, a distributed protocol for virtual time synchronization based on process rollback and message annihilation. Version 2.5.1 supports simulations and other computations using both virtual time and dynamic load balancing; it does not support general time-sharing or multi-process jobs using conventional message synchronization and communication. The program utilizes the underlying operating system's resources. TWOS runs a single simulation at a time, executing it concurrently on as many processors of a distributed system as are allocated. The simulation needs only to be decomposed into objects (logical processes) that interact through time-stamped messages. TWOS provides transparent synchronization. The user does not have to add any more special logic to aid in synchronization, nor give any synchronization advice, nor even understand much about how the Time Warp mechanism works. The Time Warp Simulator (TWSIM) subdirectory contains a sequential simulation engine that is interface compatible with TWOS. This means that an application designer and programmer who wish to use TWOS can prototype code on TWSIM on a single processor and/or workstation before having to deal with the complexity of working on a distributed system. TWSIM also provides statistics about the application which may be helpful for determining the correctness of an application and for achieving good performance on TWOS. Version 2.5.1 has an updated interface that is not compatible with 2.0. The program's user manual assists the simulation programmer in the design, coding, and implementation of discrete-event simulations running on TWOS. The manual also includes a practical user's guide to the TWOS application benchmark, Colliding Pucks. TWOS supports simulations written in the C programming language. It is designed

  10. Pharmacokinetics and metabolism of the staurosporine analogue CGP 41 251 in mice. (United States)

    van Gijn, R; van Tellingen, O; Haverkate, E; Kettenes-van den Bosch, J J; Bult, A; Beijnen, J H


    Studies with CGP 41 251 (I), an N-benzoylstaurosporine derivative and PKC-alpha inhibitor, revealed that oral administration of 400 microg/day of the compound to wild type mice on four successive days reversed multi drug resistance (Killion et al. Oncology Research 7: 453-459, 1995). In our study, the same regimen of administration was followed with the primary objective to establish the pharmacokinetics and metabolism of the compound and to substantiate at which plasma concentrations of CGP 41 251 multi drug resistance (MDR) reversal can be expected. Concentrations of CGP 41 251 and metabolites in plasma were determined by a validated high performance liquid chromatography (HPLC) method with fluorescence detection. Structural characterization of the metabolites was performed with HPLC and mass spectrometric detection. In our experiment extensive metabolism of CGP 41 251 was found. The presence of five hydroxylated metabolites of CGP 41 251 (I) was confirmed and two metabolites were structurally elucidated as CGP 50 750 (III) and CGP 52 421 (V). Maximal concentrations of 73 ng/ml, 1.9 ng/ml and 126 ng/ml for CGP 41 251 (I), III and V were found, respectively. The mass spectra of the other three metabolites indicate that these are oxidized nitrogens or hydroxylated compounds. As yet, the oxidation or hydroxylation sites have not been established. This study has revealed new information about CGP 41 251 pharmacokinetics and metabolism. Target levels between 10-100 ng/ml may be important to achieve in further clinical trials with CGP 41 251 as MDR modulator.

  11. 29 CFR 779.251 - Goods that have lost their out-of-State identity. (United States)


    ... 29 Labor 3 2010-07-01 2010-07-01 false Goods that have lost their out-of-State identity. 779.251... Coverage Interstate Inflow Test Under Prior Act § 779.251 Goods that have lost their out-of-State identity... been processed or manufactured so as to have lost their identity as out-of-State goods before they are...

  12. AM251 Suppresses Epithelial-Mesenchymal Transition of Renal Tubular Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Tomoyo Yoshinaga

    Full Text Available Epithelial-mesenchymal transition (EMT of renal tubular epithelial cells is one of the causative mechanisms of kidney fibrosis. In our study, we screened lipophilic compounds using a lipid library including approximately 200 lipids to identify those that suppressed EMT induced by a transforming growth factor (TGF-β1 stimulus. Initial screening was performed with the immortalized HK-2 renal tubule epithelial cell line. The most promising compounds were further tested in RPTEC primary renal tubule epithelial cells. We found that the synthetic lipid AM251 suppressed two hallmark events associated with EMT, the upregulation of collagen 1A1 (COL1A1 and downregulation of E-cadherin. Though AM251 is known to act as an antagonist for the cannabinoid receptor type 1 (CB1 and an agonist for the G protein-coupled receptor 55 (GRP55, the suppression of EMT by AM251 was not mediated through either receptor. Microarray analyses revealed that AM251 inhibited induction of several EMT transcription factors such as SNAIL1, which is the key inducer of EMT, and the AP-1 transcription factors FOSB and JUNB. Activation of SMAD2/3 and p38 mitogen-activated protein kinase (MAPK was inhibited by AM251, with greater inhibition of the latter, indicating that AM251 acted upstream of SMAD/p38 MAPK in the TGF-β signaling pathway. Our findings regarding the effects of AM251 on the TGF-β signaling pathway may inform development of a novel therapeutic agent suppressing EMT, thus preventing kidney fibrosis.

  13. Downregulation of HIF-1a sensitizes U251 glioma cells to the temozolomide (TMZ) treatment

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jun-Hai [Department of Neurosurgery, Xinqiao Hospital, Third Military Medical University, Chongqing 400037 (China); Ma, Zhi-Xiong [National Institute of Biological Sciences, Beijing 102206 (China); Huang, Guo-Hao; Xu, Qing-Fu; Xiang, Yan [Department of Neurosurgery, Xinqiao Hospital, Third Military Medical University, Chongqing 400037 (China); Li, Ningning; Sidlauskas, Kastytis [Division of Neuropathology and Department of Neurodegenerative Disease, Institute of Neurology, University College London, London WC1N 3BG (United Kingdom); Zhang, Eric Erquan [National Institute of Biological Sciences, Beijing 102206 (China); Lv, Sheng-Qing, E-mail: [Department of Neurosurgery, Xinqiao Hospital, Third Military Medical University, Chongqing 400037 (China)


    Purpose: The aim of this study was to investigate the effect of downregulation of HIF-1α gene on human U251 glioma cells and examine the consequent changes of TMZ induced effects and explore the molecular mechanisms. Methods: U251 cell line stably expressing HIF-1α shRNA was acquired via lentiviral vector transfection. The mRNA and protein expression alterations of genes involved in our study were determined respectively by qRT-PCR and Western blot. Cell proliferation was measured by MTT assay and colony formation assay, cell invasion/migration capacity was determined by transwell invasion assay/wound healing assay, and cell apoptosis was detected by flow cytometry. Results: We successfully established a U251 cell line with highly efficient HIF-1α knockdown. HIF-1a downregulation sensitized U251 cells to TMZ treatment and enhanced the proliferation-inhibiting, invasion/migration-suppressing, apoptosis-inducing and differentiation-promoting effects exerted by TMZ. The related molecular mechanisms demonstrated that expression of O{sup 6}-methylguanine DNA methyltransferase gene (MGMT) and genes of Notch1 pathway were significantly upregulated by TMZ treatment. However, this upregulation was abrogated by HIF-1α knockdown. We further confirmed important regulatory roles of HIF-1α in the expression of MGMT and activation of Notch1 pathways. Conclusion: HIF-1α downregulation sensitizes U251 glioma cells to the temozolomide treatment via inhibiting MGMT expression and Notch1 pathway activation. - Highlights: • TMZ caused more significant proliferation inhibition and apoptosis in U251 cells after downregulating HIF-1α. • Under TMZ treatment, HIF-1 downregulated U251 cells exhibited weaker mobility and more differentiated state. • TMZ caused MGMT over-expression and Notch1 pathway activation, which could be abrogated by HIF-1α downregulation.

  14. Pengaruh Bionematisida Berbahan Aktif Jamur Paecilomyces lilacinus Strain 251 terhadap Serangan Pratylenchus coffeae pada Kopi Robusta

    Directory of Open Access Journals (Sweden)

    Soekadar Wiryadiputra


    Full Text Available Experiment on the effect of P. lilacinus on the infestation of P. coffeae on robusta coffee was conducted in Sumber Asin Experimental Garden, Malang. The treatments were dosages of bionematicide i.e. : 0 (control, 0.25, 0.50, 1.00, 2.00, and 4.00 g; carbofuran (3 % active ingredient 50 g/plant and organic soil treatment (OST at 100 g/plant. Each treatment was replicated four times, and each replication consists of five coffee trees. The results in second year observation revealed that the population of P. coffeae in the roots on PL 251 treatments was not significantly different compared to the control, whereas in soil samples the population of both P. coffeae and Rotylenchulus reniformis inclined to be lower than the control, although they were not statistically significant. The lowest infestation was observed on PL 251 treatment at a dosage level of 4.00 g/tree. On nematode infestation, no significant difference on treatments of carbofuran and OST compared to the control. The yield of green coffee (market coffee was the highest on the treatment of PL 251 at a dosage of 4.00 g/tree and significantly higher than the control and carbofuran treatments, with increasing levels of 225.3 and 198.9%, respectively. Keywords: bionematicide Paecilomyces lilacinus strain 251 (PL 251, Pratylenchus coffeae, Rotylenchulus reniformis

  15. All-trans retinoic acid influences viability, migration and adhesion of U251 glioblastoma cells

    Directory of Open Access Journals (Sweden)

    Marjanović-Vićentić Jelena


    Full Text Available Glioblastoma (GBM is one of the most aggressive and deadly forms of cancer. Literature data reveals that all-trans retinoic acid (ATRA has anticancer effects on different types of tumor cells. However, data about the effects of ATRA on glioblastoma cells are contradictory. In this study, we examined whether ATRA treatment affects features of human glioblastoma U251 cells. To that end, the cells were treated with different concentrations of ATRA. Results obtained by MTT and the crystal violet assays imply that ATRA affected the viability of U251 glioblastoma cells in a dose- and time-dependent manner. Fluorescence staining of microtubule cytoskeleton protein α-tubulin revealed that ATRA induced changes in cell morphology. Using semi-quantitative RT-PCR we found that the expression of SOX3 and GFAP genes, as markers of neural differentiation, was not changed upon ATRA treatment. Thus, the observed changes in cell morphology after ATRA treatment are not associated with neural differentiation of U251 glioblastoma cells. The scratch-wound healing assay revealed that ATRA changed the mode of U251 cell migration from collective to single cell motility. The cell-matrix adhesion assay demonstrated that the pharmacologically relevant concentration of ATRA lowered the cell-matrix adhesion capability of U251 cells. In conclusion, our results imply that further studies are needed before ATRA could be considered for the treatment of glioblastoma. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. 173051

  16. Californium-252 neutron intracavity brachytherapy alone for T1N0 low-lying rectal adenocarcinoma: A definitive anal sphincter-preserving radiotherapy (United States)

    Xiong, Yanli; Shan, Jinlu; Liu, Jia; Zhao, Kewei; Chen, Shu; Xu, Wenjing; Zhou, Qian; Yang, Mei; Lei, Xin


    This study evaluated the 4-year results of 32 patients with T1N0 low-lying rectal adenocarcinoma treated solely with californium-252 (Cf-252) neutron intracavity brachytherapy (ICBT). Patients were solicited into the study from January 2008 to June 2011. All the patients had refused surgery or surgery was contraindicated. The patients were treated with Cf-252 neutron ICBT using a novel 3.5-cm diameter off-axis 4-channel intrarectal applicator designed by the authors. The dose reference point was defined on the mucosa surface, with a total dose of 55–62 Gy-eq/4 f (13–16 Gy-eq/f/wk). All the patients completed the radiotherapy in accordance with our protocol. The rectal lesions regressed completely, and the acute rectal toxicity was mild (≤G2). The 4-year local control, overall survival, disease-free survival, and late complication (≥G2) rates were 96.9%, 90.6%, 87.5% and 15.6%, respectively. No severe late complication (≥G3) occurred. The mean follow-up was 56.1 ± 16.0 months. At the end of last follow-up, 29 patients remained alive. The mean survival time was 82.1 ± 2.7 months. Cf-252 neutron ICBT administered as the sole treatment (without surgery) for patients with T1N0 low-lying rectal adenocarcinoma is effective with acceptable late complications. Our study and method offers a definitive anal sphincter-preserving radiotherapy for T1N0 low-lying rectal adenocarcinoma patients. PMID:28094790

  17. NF-κB inhibitor reverses temozolomide resistance in human glioma TR/U251 cells. (United States)

    Wang, Xuan; Jia, Lili; Jin, Xiaohua; Liu, Qian; Cao, Wei; Gao, Xiangdong; Yang, Mingfeng; Sun, Baoliang


    Glioblastoma multiforme (GBM) demonstrates an unsatisfactory clinical prognosis due to the intrinsic or acquired resistance to temozolomide (TMZ) exhibited by the tumors. One possible cause of TMZ resistance in GBM is the overexpression of O6-methylguanine-DNA methyltransferase (MGMT), which can repair the TMZ-induced guanine damage in DNA. Additionally, excessive activated NF-κB is reported to be a component of the major inflammatory transcription pathway that is associated with TMZ resistance in GBM. However, the association between the NF-κB pathway and MGMT expression in GBM cells is unknown. Therefore, in the present study, the TMZ resistant (TR) U251 cell line (TR/U251) was successfully constructed to detect how the TR/U251 cell line and the parental U251 cell line each interact with TMZ in vitro. The TR/U251 cells were approximately five times more resistant to TMZ compared with the parental cells. Furthermore, it was found that the NF-κB inhibitor BAY 11-7082 suppressed the expression of MGMT in TR/U251 cells and enhanced TMZ-induced cytotoxicity and apoptosis, thereby indicating that the NF-κB pathway and MGMT interact to promote TMZ resistance. The inhibition of NF-κB may be a promising strategy to reverse drug resistance in TR glioma cells. The present results propose a potential mechanism for using the NF-κB inhibitor BAY 11-7082 as a potential therapy for the treatment of TR glioma. Although BAY 11-7082 is a well-known NF-κB inhibitor, the present study further investigated its underlying mechanisms through a series of new experiments.

  18. Rational Design of Cyclodextrin Glycosyltransferase from Bacillus circulans Strain 251 to Increase α-Cyclodextrin Production

    NARCIS (Netherlands)

    Veen, Bart A. van der; Uitdehaag, Joost C.M.; Penninga, Dirk; Alebeek, Gert-Jan W.M. van; Smith, Loraine M.; Dijkstra, Bauke W.; Dijkhuizen, Lubbert


    Cyclodextrin glycosyltransferases (CGTase) (EC are extracellular bacterial enzymes that generate cyclodextrins from starch. All known CGTases produce mixtures of α, β, and γ-cyclodextrins. A maltononaose inhibitor bound to the active site of the CGTase from Bacillus circulans strain 251

  19. 37 CFR 251.73 - Deduction of costs of distribution proceedings. (United States)


    ... PANEL RULES OF PROCEDURE Royalty Fee Distribution Proceedings § 251.73 Deduction of costs of... distributions of royalty fees are made, deduct the reasonable costs incurred by the Library of Congress and the... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Deduction of costs of...

  20. [Apoptosis of glioma cell line U251 induced by small interfering RNA targeting survivin]. (United States)

    Xu, Ru-xiang; Tu, Yan-yang; Jiang, Xiao-dan; Feng, Jiang-nan; Huang, Jun


    To construct recombinant expression vectors of small interfering RNA (siRNA) targeting survivin and investigate apoptosis of glioma cell line U251 mediated by the survivin-targeting siRNA. According to the sequence of the coding region of survivin gene, two strings of 19 nucleotides of inverted sequence flanking the loop sequence of two complementary 9-base oligonucleotides were designed and synthesized to form hairpin construct as the DNA templates for the target siRNA. The siRNA templates were cloned into siRNA expression vector pGenesil-1, and the resulted vector pGenesil-1/survivin was transfected into U251 cells using Metafectene following the standard protocols. Real-time PCR and Western blotting were performed to evaluate survivin gene silencing induced by siRNA transfection at the RNA and protein levels, respectively. Flow cytometry analysis with Annexin-V/PI double staining was used to determine the cell apoptosis. Real-time RT-PCR and Western blotting revealed significantly lowered survivin expression at both RNA and protein levels in transfected U251 cells, which exhibited a significantly higher apoptosis rate after transfection as shown by flow cytometry analysis. RNA interference mediated by the siRNA expression vector pGenesi-l/survivin can significantly reduce survivin expression and induce remarkable apoptosis in U251 cells.

  1. 48 CFR 52.251-2 - Interagency Fleet Management System Vehicles and Related Services. (United States)


    ... CLAUSES Text of Provisions and Clauses 52.251-2 Interagency Fleet Management System Vehicles and Related Services. As prescribed in 51.205, insert the following clause: Interagency Fleet Management System... to obtain interagency fleet management system vehicles and related services for use in the...

  2. 30 CFR 251.7 - Test drilling activities under a permit. (United States)


    ... opportunity to participate in the test drilling through a signed agreement on a cost-sharing basis. You may... original share cost. (3) Providing opportunity for participation in a shallow test drilling project. When... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Test drilling activities under a permit. 251.7...

  3. 5 CFR 251.301 - Associations of management officials and/or supervisors. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Associations of management officials and... ORGANIZATIONS Dues Withholding § 251.301 Associations of management officials and/or supervisors. Dues withholding for associations of management officials and/or supervisors is covered in 5 CFR 550.331. ...

  4. Risk modification of colorectal cancer susceptibility by interleukin-8 -251T>A polymorphism in Malaysians (United States)

    Mustapha, Mohd Aminudin; Shahpudin, Siti Nurfatimah Mohd; Aziz, Ahmad Aizat Abdul; Ankathil, Ravindran


    AIM: To investigate the allele and genotype frequencies and associated risk of interleukin (IL)-8 -251T>A polymorphism on colorectal cancer (CRC) susceptibility risk. METHODS: Peripheral blood samples of 255 normal controls and 255 clinically and histopathologically confirmed CRC patients were genotyped for IL-8 -251T>A polymorphism employing allele-specific polymerase chain reaction. The relative association of variant allele and genotypes with CRC susceptibility risk was determined by calculating the odds ratios (ORs). Corresponding χ2 tests on the CRC patients and controls were carried out and 95% confidence intervals (CIs) were determined using Fisher’s exact test. The allele frequencies and its risk association were calculated using FAMHAP, haplotype association analysis software. RESULTS: On comparing the frequencies of genotypes of patients and controls, the homozygous variant AA was significantly higher in CRC patients (P = 0.002) compared to controls. Investigation on the association of the polymorphic genotypes with CRC susceptibility risk, showed that the homozygous variant IL-8 -251AA had a significantly increased risk with OR 3.600 (95% CI: 1.550-8.481, P = 0.001). In the case of allele frequencies, variant allele A of IL-8 -251 showed a significantly increased risk of CRC predisposition with OR 1.32 (95% CI: 1.03-1.69, P = 0.003). CONCLUSION: Variant allele and genotype of IL-8 (-251T>A) was significantly associated with CRC susceptibility risk and could be considered as a high-risk variant for CRC predisposition. PMID:22690076

  5. 78 FR 14633 - Sequestration Order for Fiscal Year 2013 Pursuant to Section 251A of the Balanced Budget and... (United States)


    ... Management and Budget in its report to the Congress of March 1, 2013. Pursuant to sections 250(c)(6), 251A... authority, and obligation limitations. All sequestrations shall be made in strict accordance with the requirements of section 251A of the Act and the specifications of the Office of Management and Budget's report...

  6. 78 FR 22407 - Sequestration Order for Fiscal Year 2014 Pursuant to Section 251A of the Balanced Budget and... (United States)


    ... Management and Budget in its report to the Congress of April 10, 2013. All sequestrations shall be made in strict accordance with the requirements of section 251A of the Act and the specifications of the Office of Management and Budget's report of April 10, 2013, prepared pursuant to section 251A(11) of the Act...

  7. 36 CFR 251.10 - Prohibition of location of mining claims within certain areas in the Norbeck Wildlife Preserve... (United States)


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Prohibition of location of mining claims within certain areas in the Norbeck Wildlife Preserve, South Dakota. 251.10 Section 251.10... areas in the Norbeck Wildlife Preserve, South Dakota. The location of mining claims in such areas within...

  8. A mutation of cdc-25.1 causes defects in germ cells but not in somatic tissues in C. elegans. (United States)

    Kim, Jiyoung; Lee, Ah-Reum; Kawasaki, Ichiro; Strome, Susan; Shim, Yhong-Hee


    By screening C. elegans mutants for severe defects in germline proliferation, we isolated a new loss-of-function allele of cdc-25.1, bn115. bn115 and another previously identified loss-of-function allele nr2036 do not exhibit noticeable cell division defects in the somatic tissues but have reduced numbers of germ cells and are sterile, indicating that cdc-25.1 functions predominantly in the germ line during postembryonic development, and that cdc-25.1 activity is probably not required in somatic lineages during larval development. We analyzed cell division of germ cells and somatic tissues in bn115 homozygotes with germline-specific anti-PGL-1 immunofluorescence and GFP transgenes that express in intestinal cells, in distal tip cells, and in gonadal sheath cells, respectively. We also analyzed the expression pattern of cdc-25.1 with conventional and quantitative RT-PCR. In the presence of three other family members of cdc-25 in C. elegans defects are observed only in the germ line but not in the somatic tissues in cdc-25.1 single mutants, and cdc-25.1 is expressed predominantly, if not exclusively, in the germ line during postembryonic stages. Our findings indicate that the function of cdc-25.1 is unique in the germ line but likely redundant with other members in the soma.

  9. Californium-252 Program Equipment Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)


    To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.

  10. Synergistic Effects of the in cis T251I and P587L Mitochondrial DNA Polymerase γ Disease Mutations. (United States)

    DeBalsi, Karen L; Longley, Matthew J; Hoff, Kirsten E; Copeland, William C


    Human mitochondrial DNA (mtDNA) polymerase γ (Pol γ) is the only polymerase known to replicate the mitochondrial genome. The Pol γ holoenzyme consists of the p140 catalytic subunit (POLG) and the p55 homodimeric accessory subunit (POLG2), which enhances binding of Pol γ to DNA and promotes processivity of the holoenzyme. Mutations within POLG impede maintenance of mtDNA and cause mitochondrial diseases. Two common POLG mutations usually found in cis in patients primarily with progressive external ophthalmoplegia generate T251I and P587L amino acid substitutions. To determine whether T251I or P587L is the primary pathogenic allele or whether both substitutions are required to cause disease, we overproduced and purified WT, T251I, P587L, and T251I + P587L double variant forms of recombinant Pol γ. Biochemical characterization of these variants revealed impaired DNA binding affinity, reduced thermostability, diminished exonuclease activity, defective catalytic activity, and compromised DNA processivity, even in the presence of the p55 accessory subunit. However, physical association with p55 was unperturbed, suggesting intersubunit affinities similar to WT. Notably, although the single mutants were similarly impaired, a dramatic synergistic effect was found for the double mutant across all parameters. In conclusion, our analyses suggest that individually both T251I and P587L substitutions functionally impair Pol γ, with greater pathogenicity predicted for the single P587L variant. Combining T251I and P587L induces extreme thermal lability and leads to synergistic nucleotide and DNA binding defects, which severely impair catalytic activity and correlate with presentation of disease in patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Further studies on pumiliotoxin 251D and hydroquinone content of the skin secretion of Melanophryniscus species (Anura, Bufonidae) from Uruguay. (United States)

    Mebs, Dietrich; Maneyro, Raúl; Pogoda, Werner


    In whole animal ethanolic extracts from adult specimens of Melanophryniscus atroluteus (27 specimens) and M. devincenzii (16 specimens) as well as of two egg clutches and four tadpole samples from the latter species, the major alkaloid pumiliotoxin (PTX) 251D and hydroquinone were assayed quantitatively by gas chromatography/mass spectrometry. All toad extracts contained high concentrations of PTX 251D and hydroquinone and exhibited considerable variation in the content of these compounds among individual specimens. The extracts of the eggs and tadpoles were entirely free of alkaloids as well as hydroquinone, pointing to a dietary origin of these compounds.

  12. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Antonio


    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  13. Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

    Energy Technology Data Exchange (ETDEWEB)

    Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)


    Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

  14. 40 CFR 147.251 - EPA-administered program-Class I, III, IV and V wells and Indian lands. (United States)


    ... INJECTION CONTROL PROGRAMS California § 147.251 EPA-administered program—Class I, III, IV and V wells and Indian lands. (a) Contents. The UIC program in the State of California for Class I, III, IV and V wells... 40 Protection of Environment 22 2010-07-01 2010-07-01 false EPA-administered program-Class I, III...

  15. 48 CFR 252.251-7001 - Use of Interagency Fleet Management System (IFMS) vehicles and related services. (United States)


    ... Fleet Management System (IFMS) vehicles and related services. As prescribed in 251.205, use the following clause: Use of Interagency Fleet Management System (IFMS) Vehicles and Related Services (DEC 1991... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Use of Interagency Fleet...

  16. 46 CFR 251.21 - Applications under sections 803, 804, 805 (a) and (d), and 605 (b), Merchant Marine Act, 1936. (United States)


    ...), and 605 (b), Merchant Marine Act, 1936. 251.21 Section 251.21 Shipping MARITIME ADMINISTRATION... (b), Merchant Marine Act, 1936. Form VI-B of instructions is the required form for the preparation of... chapter (General Order 86)) and (d), and 605(b), Merchant Marine Act, 1936 (49 Stat. 2012, 2013, 2003; 46...

  17. Quantitative Proteomic Profiling of Tachyplesin I Targets in U251 Gliomaspheres

    Directory of Open Access Journals (Sweden)

    Xuan Li


    Full Text Available Tachyplesin I is a cationic peptide isolated from hemocytes of the horseshoe crab and its anti-tumor activity has been demonstrated in several tumor cells. However, there is limited information providing the global effects and mechanisms of tachyplesin I on glioblastoma multiforme (GBM. Here, by using two complementary proteomic strategies (2D-DIGE and dimethyl isotope labeling-based shotgun proteomics, we explored the effect of tachyplesin I on the proteome of gliomaspheres, a three-dimensional growth model formed by a GBM cell line U251. In total, the expression levels of 192 proteins were found to be significantly altered by tachyplesin I treatment. Gene ontology (GO analysis revealed that many of them were cytoskeleton proteins and lysosomal acid hydrolases, and the mostly altered biological process was related to cellular metabolism, especially glycolysis. Moreover, we built protein–protein interaction network of these proteins and suggested the important role of DNA topoisomerase 2-alpha (TOP2A in the signal-transduction cascade of tachyplesin I. In conclusion, we propose that tachyplesin I might down-regulate cathepsins in lysosomes and up-regulate TOP2A to inhibit migration and promote apoptosis in glioma, thus contribute to its anti-tumor function. Our results suggest tachyplesin I is a potential candidate for treatment of glioma.

  18. Molecular profiling of MPS1 gene silencing in U251 glioma cell line

    Directory of Open Access Journals (Sweden)

    Uma Shankavaram


    Full Text Available Aneuploidy has been recognized as a common characteristic of cancers. Aneuploidy frequently results from errors of the mitotic checkpoint, the major cell cycle control mechanism that acts to prevent chromosome missegregation. Mutation of the genes that control chromosome segregation during mitosis may explain the high rate of chromosomal instability and aneuploidy, a characteristic of most solid tumors, including glioblastoma (GBM (Gordon et al., 2012 [1]; Singh et al., 2012 [2]. Monopolar spindle 1 (MPS1 is an essential spindle assembly checkpoint kinase that is overexpressed in several human cancers (Kilpinen et al., 2010 [3]; Mills et al., 1992 [4]; Yuan et al., 2006 [5]. In our previous publication, we have shown the role of MPS1 kinase in DNA repair and enhanced radiosensitivity in GBM (Maachani et al., 2015 [6]. Here, we provide methodological and analytical details of that study, to compare mRNA expression profile of siMPS1-silenced U251 cells with untransfected control, and siRNA control (siNeg at 6, 24, and 48 h after transfection. The raw data of this study is deposited in Gene Expression Omnibus under the accession number GSE57091.

  19. Downregulation of ROCK2 through nanocomplex sensitizes the cytotoxic effect of temozolomide in U251 glioma cells.

    Directory of Open Access Journals (Sweden)

    Xiaojun Wen

    Full Text Available Rho-associated coiled-coil kinase 2 (ROCK2 is an attractive therapeutic target because it is overexpressed in many malignancies, including glioma. Therefore, we designed the current study to determine whether the downregulation of ROCK2 would sensitize the cytotoxic effect of temozolomide (TMZ in U251 cells.Glycol-polyethyleneimine (PEG-PEI was used to deliver siROCK2 to U251 cells, and the physical characteristics of the PEG-PEI/siROCK2 complex (referred to as the siROCK2 complex were investigated. The transfection efficiency and cell uptake were determined by flow cytometry (FCM and confocal laser microscopy (CLSM, respectively. U251 cells were then treated with 100 μM TMZ, siROCK2 complexes or their combination. The apoptosis rate and cell migration were measured by FCM and wound-healing assay, respectively. The levels of Bax, Bcl-2, cleaved caspase-3, MMP-2, and MMP-9 were detected to analyze the degrees of apoptosis and migration.Our results revealed that the characteristics of the siROCK2 complexes depended closely on the N/P ratios. PEG-PEI served as a good vector for siROCK2 and exhibited low cytotoxicity toward U251 cells. The CLSM assay showed that the siROCK2 complexes were successfully uptaken and that both the protein and mRNA levels of ROCK2 were significantly suppressed. Furthermore, the combination treatment induced a higher apoptosis rate and markedly increased the gap distance of U251 cells in the wound-healing assay. Levels of the proapoptotic proteins Bax and cleaved caspase-3 were significantly increased, whereas levels of the antiapoptotic protein Bcl-2 and the migration-related proteins MMP-2 and MMP-9 were significantly reduced by the combination treatment compared with either treatment alone.In conclusion, our results demonstrate that the combination of TMZ and siROCK2 effectively induces apoptosis and inhibits the migration of U251 cells. Therefore, the combination of TMZ and siROCK2 complex is a potential therapeutic

  20. Variants in 6q25.1 Are Associated with Mammographic Density in Malaysian Chinese Women. (United States)

    Mariapun, Shivaani; Ho, Weang Kee; Kang, Peter Choon Eng; Li, Jingmei; Lindström, Sara; Yip, Cheng Har; Teo, Soo Hwang


    Mammographic density is an established risk factor for breast cancer and has a strong heritable component. Genome-wide association studies (GWAS) for mammographic density conducted in women of European descent have identified several genetic associations, but none of the studies have been tested in Asians. We sought to investigate whether these genetic loci, and loci associated with breast cancer risk and breast size, are associated with mammographic density in an Asian cohort. We conducted genotyping by mass spectrometry in 1,189 women (865 Chinese, 187 Indian, and 137 Malay). Quantitative measurements of mammographic density were performed using ImageJ, a fully automated thresholding technique. The associations of SNPs to densities were analyzed using linear regression models. We successfully evaluated the associations of 36 SNPs with mammographic densities. After adjusting for age, body mass index, parity, and menopausal status, we found that in our cohort of 865 Malaysian Chinese, three SNPs in the 6q25.1 region near ESR1 (rs2046210, rs12173570, and rs10484919) that were associated with mammographic density, breast cancer risk, or breast size in previous GWAS were significantly associated with both percentage density and absolute dense area. We could not replicate the most significant association found previously in European women (rs10995190, ZNF365 gene) because the minor allele was absent for Asian women. We found that the directions of genetic associations were similar to those reported in Caucasian women. Our results show that even in Asian women with lower population risk to breast cancer, there is shared heritability between mammographic density and breast cancer risk. ©2015 American Association for Cancer Research.

  1. VLBA 24 and 43 GHz observations of massive binary black hole candidate PKS 1155 + 251 (United States)

    Yang, Xiaolong; Liu, Xiang; Yang, Jun; Mi, Ligong; Cui, Lang; An, Tao; Hong, Xiaoyu; Ho, Luis C.


    PKS 1155+251 is a radio-loud quasar source at z = 0.203. Observations using very long baseline interferometry (VLBI) at ∼2, 5, 8 and 15 GHz show that the structure of the radio source is quite complicated on parsec scales and that the outer hotspots are apparently undergoing a significant contraction. Because these results cannot be fully explained based on the compact symmetric object (CSO) scenario with a radio core located between the northern and southern complexes, we made observations with the Very Long Baseline Array (VLBA) at 24 and 43 GHz to search for compact substructures and alternative interpretations. The results show that the radio core revealed in the previous VLBI observations remains compact with a flat spectrum in our sub-milli-arcsecond-resolution images; the northern lobe emission becomes faint at 24 GHz and is mostly resolving out at 43 GHz; the southern complex is more bright but has been resolved into the brightest southern-end (S1) and jet or tail alike components westwards. Explaining the southern components aligned westward with a standard CSO scenario alone remains a challenge. As for the flatter spectral index of the southern-end component S1 between 24 and 43 GHz in our observations and the significant 15 GHz VLBA flux variability of S1, an alternative scenario is that the southern complex may be powered by a secondary black hole residing at S1. But more sensitive and high-resolution VLBI monitoring is required to discriminate the CSO and the binary black hole scenarios.

  2. Functionalized nano-graphene oxide particles for targeted fluorescence imaging and photothermy of glioma U251 cells. (United States)

    Li, Zhong-Jun; Li, Chao; Zheng, Mei-Guang; Pan, Jia-Dong; Zhang, Li-Ming; Deng, Yue-Fei


    This study was to prepare the functionalized nano-graphene oxide (nano-GO) particles, and observe targeted fluorescence imaging and photothermy of U251 glioma cells under near infrared (NIR) exposure. The functionalized nano-GO-Tf-FITC particles were prepared and then were incubated with U251 glioma cells. Estimation of CCK8 cell activity was adopted for measurement of cytotoxicity. The effect of fluorescein imaging was detected by fluorescence microscope with anti-CD71-FITC as a control. Finally, we detected the killing efficacy with flow cytometry after an 808 nm NIR exposure. Both nano-GO-Tf-FITC group and CD71-FITC group exhibited green-yellow fluorescence, while the control group without the target molecule nano-GO-FITC was negative. The nano-GO-Tf-FITC was incubated with U251 cells at 0.1 mg/ml, 1.0 mg/ml, 3.0 mg/ml and 5.0 mg/ml. After 48 h of incubation, the absorbance was 0.747 ± 0.031, 0.732 ± 0.043, 0.698 ± 0.051 and 0.682 ± 0.039, while the absorbance of control group is 0.759 ± 0.052. There is no significant difference between the nano-GO-FITC groups and control group. In addition, the apoptosis and death index of nano-GO-Tf-FITC group was significantly higher than that of nano-GO-FITC and blank control group (P nano-GO-Tf-FITC particles with good biological compatibility and low cytotoxicity are successfully made, which have an observed effect of target imaging and photothermal therapy on glioma U251 cells.

  3. Preparation of iodine-123 labeled AM251: a potential SPECT radioligand for the brain cannabinoid CB1 receptor

    Energy Technology Data Exchange (ETDEWEB)

    Lan, Ruoxi; Makriyannis, Alexandros [Connecticut Univ., Molecular and Cell Biology Dept., Storrs, CT (United States); Gatley, S.J. [Brookhaven National Lab., Medical Dept., Upton, NY (United States)


    We report the synthesis and labeling with iodine-123 of N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2, 4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251). This compound is an analog of the recently described cannabinoid receptor antagonist, SR141716A, in which a 4-chlorophenyl group is replaced by 4-iodophenyl. Labeling in good yield (62%) and radiochemical purity (> 95%), and high specific activity (> 2500 Ci/mmol) was achieved by an iododestannylation reaction using the tributyltin precursor, no carrier added I-123 iodide, and chloramine-T. (author).

  4. CDC-25.1 controls the rate of germline mitotic cell cycle by counteracting WEE-1.3 and by positively regulating CDK-1 in Caenorhabditis elegans. (United States)

    Yoon, Sunghee; Kawasaki, Ichiro; Shim, Yhong-Hee


    In Caenorhabditis elegans, cdc-25.1 loss-of-function mutants display a lack of germline proliferation. We found that the proliferation defect of cdc-25.1 mutants was suppressed by wee-1.3 RNAi. Further, among the seven cdk and seven cyclin homologs examined, cdk-1 and cyb-3 RNAi treatment caused the most severe germline proliferation defects in an rrf-1 mutant background, which were similar to those of the cdc-25.1 mutants. In addition, while RNAi of cyd-1 and cye-1 caused significant germline proliferation defects, RNAi of cdk-2 and cdk-4 did not. Compared with the number of germ nuclei in wee-1.3(RNAi) worms, the number in wee-1.3(RNAi);cdk-1(RNAi) and wee-1.3(RNAi);cyb-3(RNAi) worms further decreased to the level of cdk-1(RNAi) and cyb-3(RNAi) worms, respectively, indicating that cdk-1 and cyb-3 are epistatic and function downstream of cdc-25.1 and wee-1.3 in the control of the cell cycle. BrdU labeling of adult worms showed that, while 100% of the wild-type germ nuclei in the mitotic region incorporated BrdU when labeled for more than 12 h at 20°C, a small fraction of the cdc-25.1 mutant germ nuclei failed to incorporate BrdU even when labeled for 68 h. These results indicate that CDC-25.1 is required for maintaining proper rate of germline mitotic cell cycle. We propose that CDC-25.1 regulates the rate of germline mitotic cell cycle by counteracting WEE-1.3 and by positively controlling CDK-1, which forms a complex primarily with CYB-3, but also possibly with CYD-1 and CYE-1.

  5. Effect of plant resistance and BioAct WG (Purpureocillium lilacinum strain 251) on Meloidogyne incognita in a tomato-cucumber rotation in a greenhouse. (United States)

    Giné, Ariadna; Sorribas, Francisco J


    The effectiveness of combining resistant tomato with BioAct WG (Purpureocillium lilacinum strain 251, Pl251) against Meloidogyne incognita was assessed in a tomato-cucumber rotation in a greenhouse over 2 years. Additionally, the enzymatic activity of the fungus, the percentage of fungal egg and juvenile parasitism, cardinal temperatures and the effect of water potential on mycelial growth and the soil receptivity to Pl251 were determined in vitro. Plant resistance was the only factor that suppressed nematode and crop yield losses. Percentage of egg parasitism in plots treated with BioAct WG was less than 2.6%. However, under in vitro conditions, Pl251 showed protease, lipase and chitinase activities and parasitised 94.5% of eggs, but no juveniles. Cardinal temperatures were 14.2, 24-26 and 35.4 °C. The maximum Pl251 mycelial growth was at -0.25 MPa and 25 °C. Soil temperatures and water potential in the greenhouse were in the range of the fungus. However, soil receptivity was lower in greenhouse soil, irrespective of sterilisation, than in sterilised sand. Plant resistance was the only factor able to suppress nematode densities, disease severity and yield losses, and to protect the following cucumber crop. Environmental factors involved in soil receptivity could have negatively affected fungus effectiveness. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  6. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    NARCIS (Netherlands)

    A.C. Antoniou (Antonis); C. Kartsonaki (Christiana); O. Sinilnikova (Olga); P. Soucy (Penny); L. McGuffog (Lesley); S. Healey (Sue); A. Lee (Andrew); P. Peterlongo (Paolo); S. Manoukian (Siranoush); B. Peissel (Bernard); D. Zaffaroni (D.); E. Cattaneo (Elisa); M. Barile (Monica); V. Pensotti (Valeria); B. Pasini (Barbara); R. Dolcetti (Riccardo); G. Giannini (Giuseppe); A.L. Putignano; L. Varesco (Liliana); P. Radice (Paolo); P.L. Mai (Phuong); M.H. Greene (Mark); I.L. Andrulis (Irene); G. Glendon (Gord); H. Ozcelik (Hilmi); M. Thomassen (Mads); A-M. Gerdes (Anne-Marie); T.A. Kruse (Torben); U.B. Jensen; D. Cruger (Dorthe); M.A. Caligo (Maria); Y. Laitman (Yael); R. Milgrom (Roni); B. Kaufman (Bella); S. Paluch-Shimon (Shani); E. Friedman (Eitan); N. Loman (Niklas); K. Harbst (Katja); A. Lindblom (Annika); B. Melin (Beatrice); K.L. Nathanson (Katherine); S.M. Domchek (Susan); R. Rebbeck (Timothy); A. Jakubowska (Anna); J. Lubinski (Jan); J. Gronwald (Jacek); T. Huzarski (Tomasz); T. Byrski (Tomasz); C. Cybulski (Cezary); B. Górski (Bohdan); A. Osorio (Ana); T.R. Cajal; F. Fostira (Florentia); R. Andres (Raquel); J. Benitez (Javier); U. Hamann (Ute); F.B.L. Hogervorst (Frans); M.A. Rookus (Matti); M.J. Hooning (Maartje); M.R. Nelen (Marcel); R.B. van der Luijt (Rob); T.A.M. van Os (Theo); C.J. van Asperen (Christi); P. Devilee (Peter); H. Meijers-Heijboer (Hanne); E.B.G. Garcia; S. Peock (Susan); M. Cook (Margaret); D. Frost; R. Platte (Radka); J. Leyland (Jean); D.G. Evans (Gareth); F. Lalloo (Fiona); R. Eeles (Rosalind); L. Izatt (Louise); R. Davidson (Rosemarie); D. Eccles (Diana); K.-R. Ong; F. Douglas (Fiona); J. Paterson (Joan); M.J. Kennedy (John); Z. Miedzybrodzka (Zosia); A.K. Godwin (Andrew); D. Stoppa-Lyonnet (Dominique); B. Buecher (Bruno); M. Belotti (Muriel); C. Tirapo (Carole); S. Mazoyer (Sylvie); L. Barjhoux (Laure); C. Lasset (Christine); D. Leroux (Dominique); L. Faivre (Laurence); M. Bronner (Myriam); F. Prieur (Fabienne); C. Nogues (Catherine); E. Rouleau (Etienne); P. Pujol (Pascal); I. Coupier (Isabelle); M. Frenay (Marc); J. Hopper (John); M.J. Daly (Mark); M-B. Terry (Mary-beth); E.M. John (Esther); S.S. Buys (Saundra); Y. Yassin (Yosuf); A. Miron (Alexander); D. Goldgar (David); C.F. Singer (Christian); M.-K. Tea; G. Pfeiler (Georg); C. Dressler (Catherina); T.V.O. Hansen (Thomas); L. Jønson (Lars); B. Ejlertsen (Bent); R.B. Barkardottir (Rosa); T. Kircchoff (Tomas); K. Offit (Kenneth); M. Piedmonte (Marion); G.C. Rodriguez (Gustavo); L. Small (Laurie); J.F. Boggess (John); S.V. Blank (Stephanie); J. Basil (Jack); M. Azodi (Masoud); A.E. Toland (Amanda); M. Montagna (Marco); S. Tognazzo (Silvia); S. Agata (Simona); E.N. Imyanitov (Evgeny); R. Janavicius (Ramunas); C. Lazaro (Conxi); I. Blanco (Ignacio); P.D.P. Pharoah (Paul); L. Sucheston (Lara); B.Y. Karlan (Beth); C.S. Walsh (Christine); E. Olah (Edith); A. Bozsik (Aniko); S.-H. Teo; J.L. Seldon (Joyce); M.S. Beattie (Mary); E.J. van Rensburg (Elizabeth); M.D. Sluiter (Michelle); O. Diez (Orland); R.K. Schmutzler (Rita); B. Wapenschmidt (Barbara); C.W. Engel (Christoph); A. Meindl (Alfons); I. Ruehl (Ina); R. Varon-Mateeva (Raymonda); K. Kast (Karin); H. Deissler (Helmut); D. Niederacher (Dieter); N. Arnold (Norbert); D. Gadzicki (Dorothea); I. Schönbuchner (Ines); T. Caldes (Trinidad); M. de La Hoya (Miguel); H. Nevanlinna (Heli); K. Aittomäki (Kristiina); M. Dumont (Martine); J. Chiquette (Jocelyne); M. Tischkowitz (Marc); G. Chenevix-Trench (Georgia); J. Beesley (Jonathan); A.B. Spurdle (Amanda); S.L. Neuhausen (Susan); Y.C. Ding (Yuan); Z. Fredericksen (Zachary); X. Wang (Xing); V.S. Pankratz (Shane); F.J. Couch (Fergus); J. Simard (Jacques); D.F. Easton (Douglas); G. Chenevix-Trench (Georgia); P. Karlsson (Per); M. Nordling (Margareta); A. Bergman (Annika); Z. Einbeigi (Zakaria); M. Stenmark-Askmalm (M.); S. Liedgren (Sigrun); Å. Borg (Åke); H. Olsson (Hans); U. Kristoffersson (Ulf); H. Jernström (H.); K. Henriksson (Karin); A. von Wachenfeldt (Anna); A. Liljegren (Annelie); G. Barbany-Bustinza (Gisela); J. Rantala (Johanna); H. Grönberg (Henrik); E.-L. Stattin; M. Emanuelsson (Monica); R.R. Brandell; N. Dahl (Niklas); S. Verhoef; M. Verheus (Martijn); L.J. van 't Veer (Laura); F.E. van Leeuwen; J.M. Collee (Margriet); A.M.W. van den Ouweland (Ans); A. Jager (Agnes); M.M.A. Tilanus-Linthorst (Madeleine); C.M. Seynaeve (Caroline); J.T. Wijnen (Juul); M.P. Vreeswijk (Maaike); R.A.E.M. Tollenaar (Rob); M.J. Ligtenberg (Marjolijn); N. Hoogerbrugge (Nicoline); M.G.E.M. Ausems (Margreet); C.M. Aalfs (Cora); J.J.P. Gille (Jan); Q. Waisfisz (Quinten); E.B. Gómez García (Encarna); C.E. van Roozendaal (Cees); M.J. Blok (Marinus); B. Caanen; J.C. Oosterwijk; A.H. van der Hout (Annemarie); M.J. Mourits; H.F. Vasen (Hans); H. Gregory (Helen); P.J. Morrison (Patrick); L. Jeffers (Lisa); T.J. Cole (Trevor); C. McKeown (Carole); J. Hoffman (Jonathan); A. Donaldson (Alan); S. Downing (Sarah); A. Taylor (Amy); A. Murray (Alexandra); M.T. Rogers (Mark); E. McCann (Emma); M.E. Porteous (Mary); S. Drummond (Sarah); C. Brewer (Carole); E. Kivuva (Emma); A. Searle (Anne); S. Goodman (Selina); K. Hill (Kathryn); V. Murday (Victoria); N. Bradshaw (Nicola); L. Snadden (Lesley); M. Longmuir (Mark); C. Watt (Catherine); S. Gibson (Sarah); E. Haque (Eshika); E. Tobias (Ed); A. Duncan (Alexis); C. Jacobs (Chris); C. Langman (Caroline); A. Whaite (Anna); H. Dorkins (Huw); J. Barwell (Julian); C. Chu (Chengbin); J. Miller (Julie); I.O. Ellis (Ian); C. Houghton (Catherine); L. Side (Lucy); A. Male (Alison); C. Berlin (Cheryl); J. Eason (Jacqueline); R. Collier (Rebecca); O. Claber (Oonagh); I. Jobson (Irene); L.J. Walker (Lisa); D. McLeod (Diane); D. Halliday (Dorothy); S. Durell (Sarah); B. Stayner (Barbara); S. Shanley (Susan); N. Rahman (Nazneen); R. Houlston (Richard); E. Bancroft (Elizabeth); L. D'Mello (Lucia); E. Page (Elizabeth); A. Ardern-Jones (Audrey); K. Kohut (Kelly); J. Wiggins (Jennifer); E. Castro (Elena); A. Mitra (Anita); L. Robertson (Lisa); O. Quarrell (Oliver); C. Bardsley (Cathryn); H. Ehrencrona (Hans); S.V. Hodgson (Shirley); D.E. Barton (David); S. Goff (Sheila); G. Brice (Glen); L. Winchester (Lizzie); C. Eddy (Charlotte); V. Tripathi (Vishakha); V. Attard (Virginia); A. Lucassen (Anneke); G. Crawford (Gillian); D. McBride (Donna); S. Smalley (Sarah); J.W. Adlard (Julian); B. Arver (Brita Wasteson)


    textabstractTwo single nucleotide polymorphisms (SNPs) at 6q25.1, near the ESR1 gene, have been implicated in the susceptibility to breast cancer for Asian (rs2046210) and European women (rs9397435). A genome-wide association study in Europeans identified two further breast cancer susceptibility

  7. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    NARCIS (Netherlands)

    Antoniou, Antonis C.; Kartsonaki, Christiana; Sinilnikova, Olga M.; Soucy, Penny; McGuffog, Lesley; Healey, Sue; Lee, Andrew; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Cattaneo, Elisa; Barile, Monica; Pensotti, Valeria; Pasini, Barbara; Dolcetti, Riccardo; Giannini, Giuseppe; Putignano, Anna Laura; Varesco, Liliana; Radice, Paolo; Mai, Phuong L.; Greene, Mark H.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A.; Birk Jensen, Uffe; Crüger, Dorthe G.; Caligo, Maria A.; Laitman, Yael; Milgrom, Roni; Kaufman, Bella; Paluch-Shimon, Shani; Friedman, Eitan; Loman, Niklas; Harbst, Katja; Lindblom, Annika; Arver, Brita; Ehrencrona, Hans; Melin, Beatrice; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy; Jakubowska, Ania; Lubinski, Jan; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Gorski, Bohdan; Osorio, Ana; Ramón Y Cajal, Teresa; Fostira, Florentia; Andrés, Raquel; Benitez, Javier; Hamann, Ute; Hogervorst, Frans B.; Rookus, Matti A.; Hooning, Maartje J.; Nelen, Marcel R.; van der Luijt, Rob B.; van Os, Theo A. M.; van Asperen, Christi J.; Devilee, Peter; Meijers-Heijboer, Hanne E. J.; Gómez Garcia, Encarna B.; Peock, Susan; Cook, Margaret; Frost, Debra; Platte, Radka; Leyland, Jean; Evans, D. Gareth; Lalloo, Fiona; Eeles, Ros; Izatt, Louise; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Ong, Kai-Ren; Cook, Jackie; Douglas, Fiona; Paterson, Joan; Kennedy, M. John; Miedzybrodzka, Zosia; Godwin, Andrew; Stoppa-Lyonnet, Dominique; Buecher, Bruno; Belotti, Muriel; Tirapo, Carole; Mazoyer, Sylvie; Barjhoux, Laure; Lasset, Christine; Leroux, Dominique; Faivre, Laurence; Bronner, Myriam; Prieur, Fabienne; Nogues, Catherine; Rouleau, Etienne; Pujol, Pascal; Coupier, Isabelle; Frénay, Marc; Hopper, John L.; Daly, Mary B.; Terry, Mary B.; John, Esther M.; Buys, Saundra S.; Yassin, Yosuf; Miron, Alexander; Goldgar, David; Singer, Christian F.; tea, Muy-Kheng; Pfeiler, Georg; Dressler, Anne Catharina; Hansen, Thomas v O.; Jønson, Lars; Ejlertsen, Bent; Barkardottir, Rosa Bjork; Kirchhoff, Tomas; Offit, Kenneth; Piedmonte, Marion; Rodriguez, Gustavo; Small, Laurie; Boggess, John; Blank, Stephanie; Basil, Jack; Azodi, Masoud; Toland, Amanda Ewart; Montagna, Marco; Tognazzo, Silvia; Agata, Simona; Imyanitov, Evgeny; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Pharoah, Paul D. P.; Sucheston, Lara; Karlan, Beth Y.; Walsh, Christine S.; Olah, Edith; Bozsik, Aniko; teo, Soo-Hwang; Seldon, Joyce L.; Beattie, Mary S.; van Rensburg, Elizabeth J.; Sluiter, Michelle D.; Diez, Orland; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ruehl, Ina; Varon-Mateeva, Raymonda; Kast, Karin; Deissler, Helmut; Niederacher, Dieter; Arnold, Norbert; Gadzicki, Dorothea; Schönbuchner, Ines; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Dumont, Martine; Chiquette, Jocelyne; Tischkowitz, Marc; Chen, Xiaoqing; Beesley, Jonathan; Spurdle, Amanda B.; Neuhausen, Susan L.; Chun Ding, Yuan; Fredericksen, Zachary; Wang, Xianshu; Pankratz, Vernon S.; Couch, Fergus; Simard, Jacques; Easton, Douglas F.; Chenevix-Trench, Georgia; Gregory, Helen; Morrison, Patrick; Jeffers, Lisa; Cole, Trevor; McKeown, Carole; Hoffman, Jonathan; Donaldson, Alan; Downing, Sarah; Taylor, Amy; Murray, Alexandra; Rogers, Mark T.; McCann, Emma; John Kennedy, M.; Barton, David; East, South; Porteous, Mary; Drummond, Sarah; Brewer, Carole; Kivuva, Emma; Searle, Anne; Goodman, Selina; Hill, Kathryn; Murday, Victoria; Bradshaw, Nicola; Snadden, Lesley; Longmuir, Mark; Watt, Catherine; Gibson, Sarah; Haque, Eshika; Tobias, Ed; Duncan, Alexis; Jacobs, Chris; Langman, Caroline; Whaite, Anna; Dorkins, Huw; Barwell, Julian; Chu, Carol; Miller, Julie; Ellis, Ian; Gareth Evans, D.; Taylor, Jane; Thames, N. E.; Side, Lucy; Male, Alison; Berlin, Cheryl; Eason, Jacqueline; Collier, Rebecca; Claber, Oonagh; Jobson, Irene; Walker, Lisa; McLeod, Diane; Halliday, Dorothy; Durell, Sarah; Stayner, Barbara; Shanley, Susan; Rahman, Nazneen; Houlston, Richard; Bancroft, Elizabeth; D'Mello, Lucia; Page, Elizabeth; Ardern-Jones, Audrey; Kohut, Kelly; Wiggins, Jennifer; Castro, Elena; Mitra, Anita; Robertson, Lisa; Quarrell, Oliver; Bardsley, Cathryn; Hodgson, Shirley; Goff, Sheila; Brice, Glen; Winchester, Lizzie; Eddy, Charlotte; Tripathi, Vishakha; Attard, Virginia; Lucassen, Anneke; Crawford, Gillian; McBride, Donna; Smalley, Sarah; Sutter, Christian; Preisler-Adams, Sabine; Fiebig, Britta; Heinritz, Wolfram; Schäfer, Dieter; Köhler, Juliane; Bérard, Léon; Sinilnikova, Olga; Verny-Pierre, Carole; Giraud, Sophie; Léone, Mélanie; Gauthier-Villars, Marion; Houdayer, Claude; Moncoutier, Virginie; de Pauw, Antoine; Bressac-de-Paillerets, Brigitte; Remenieras, Audrey; Byrde, Véronique; Caron, Olivier; Lenoir, Gilbert; Bignon, Yves-Jean; Uhrhammer, Nancy; Bonadona, Valérie; Hardouin, Agnés; Berthet, Pascaline; Sobol, Hagay; Bourdon, Violaine; Noguchi, Tetsuro; Eisinger, François; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Peyrat, Jean-Philippe; Fournier, Joëlle; Révillion, Françoise; Vennin, Philippe; Adenis, Claude; Lidereau, Rosette; Demange, Liliane; Muller, Daniéle; Fricker, Jean-Pierre; Longy, Michel; Sevenet, Nicolas; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Dreyfus, Hélène; Rebischung, Christine; Coron, Fanny; Lebrun, Marine; Ferrer, Sandra Fert; Vénat-Bouvet, Laurence; Delnatte, Capucine; Mortemousque, Isabelle; Lynch, Henry T.; Snyder, Carrie L.; Hogervorst, F. B. L.; Verhoef, S.; Verheus, M.; van ‘t Veer, L. J.; van Leeuwen, F. E.; Rookus, M. A.; Collée, M.; van den Ouweland, A. M. W.; Jager, A.; Hooning, M. J.; Tilanus-Linthorst, M. M. A.; Seynaeve, C.; van Asperen, C. J.; Wijnen, J. T.; Vreeswijk, M. P.; Tollenaar, R. A.; Devilee, P.; Ligtenberg, M. J.; Hoogerbrugge, N.; Ausems, M. G.; van der Luijt, R. B.; Aalfs, C. M.; Gille, J. J. P.; Waisfisz, Q.; Gomez-Garcia, E. B.; van Roozendaal, C. E.; Blok, Marinus J.; Caanen, B.; Oosterwijk, J. C.; van der Hout, A. H.; Mourits, M. J.; Vasen, H. F.; Karlsson, Per; Nordling, Margareta; Bergman, Annika; Einbeigi, Zakaria; Stenmark-Askmalm, Marie; Liedgren, Sigrun; Borg, Åke; Olsson, Håkan; Kristoffersson, Ulf; Jernström, Helena; Henriksson, Karin; von Wachenfeldt, Anna; Liljegren, Annelie; Barbany-Bustinza, Gisela; Rantala, Johanna; Grönberg, Henrik; Stattin, Eva-Lena; Emanuelsson, Monica; Brandell, Richard Rosenquist; Dahl, Niklas


    Two single nucleotide polymorphisms (SNPs) at 6q25.1, near the ESR1 gene, have been implicated in the susceptibility to breast cancer for Asian (rs2046210) and European women (rs9397435). A genome-wide association study in Europeans identified two further breast cancer susceptibility variants:

  8. Modulation of voltage-gated Na+ and K+ channels by pumiliotoxin 251D: a "joint venture" alkaloid from arthropods and amphibians. (United States)

    Vandendriessche, Thomas; Abdel-Mottaleb, Yousra; Maertens, Chantal; Cuypers, Eva; Sudau, Alexander; Nubbemeyer, Udo; Mebs, Dietrich; Tytgat, Jan


    Certain amphibians provide themselves with a chemical defense by accumulating lipophilic alkaloids into skin glands from dietary arthropods. Examples of such alkaloids are pumiliotoxins (PTXs). In general, PTXs are known as positive modulators of voltage-gated sodium channels (VGSCs). Unlike other PTXs, PTX 251D does not share this characteristic. However, mice and insect studies showed that PTX 251D is highly toxic and to date the basis of its toxicity remains unknown. In this work, we searched for the possible target of PTX 251D. The toxin was therefore made synthetically and tested on four VGSCs (mammalian rNa(v)1.2/beta(1), rNa(v)1.4/beta(1), hNa(v)1.5/beta(1) and insect Para/tipE) and five voltage-gated potassium channels (VGPCs) (mammalian rK(v)1.1-1.2, hK(v)1.3, hK(v)11.1 (hERG) and insect Shaker IR) expressed heterologously in Xenopus laevis oocytes, using the two-electrode voltage clamp technique. PTX 251D not only inhibited the Na(+) influx through the mammalian VGSCs but also affected the steady-state activation and inactivation. Interestingly, in the insect ortholog, the inactivation process was dramatically affected. Additionally, PTX 251D inhibited the K(+) efflux through all five tested VGPCs and slowed down the deactivation kinetics of the mammalian VGPCs. hK(v)1.3 was the most sensitive channel, with an IC(50) value 10.8+/-0.5 microM. To the best of our knowledge this is the first report of a PTX affecting VGPCs.

  9. Spectroscopy of odd Z trans-fermium nuclei: the nuclear structure of Md{sup 251}; Spectroscopie des transfermiums impairs en proton: la structure du noyau de {sup 251}Md

    Energy Technology Data Exchange (ETDEWEB)

    Chatillon, A


    The objective of this thesis was to determine the structure of trans-fermium nuclei (Z 100) with odd proton number, which remained largely unexplored. These nuclei were produced in fusion-evaporation reactions with small cross sections below 1 {mu}b. The experimental methods of Recoil-Tagging and Recoil-Decay-Tagging were used for their identification. In order to identify the active orbitals in this mass region, {sup 255}Lr, {sup 251}M1d and {sup 247}Es nuclei have been studied by decay spectroscopy at the University of Jyvaskyla and at GANIL with the LISE spectrometer and the {alpha}-electron detector BEST coupled to four CLover detectors from the EXOGAM array. New states have been observed in each of the isotopes, and their configuration has been proposed. The collective properties were also studied in two experiments using prompt {gamma} and electron spectroscopy, combining the JUROGAM and SACRED arrays, respectively, with the recoil separator RITU and the GREAT spectrometer at its focal plane. A rotational band has been observed for the first time in a proton-odd trans-fermium nucleus. The interpretation of this collective structure is based on the theoretical HFB calculations. (author)

  10. Biological function analysis of monoclonal antibodies against human granulins in vitro using U251 cells as a model. (United States)

    Li, Yanqing; Li, Ya; Ye, Mingfu; Wang, Dongyang; Zhao, Junli; Sun, Xiaohong; Mao, Qinwen; Xia, Haibin


    Progranulin (PGRN), a highly glycosylated, secreted 593 amino acid precursor protein, is a multifunctional molecule that is critical for early embryogenesis, wound repair, inflammatory and tumorigenesis. PGRN can be proteolytically cleaved into seven cysteine-rich granulin (Grn) peptides: G, F, B, A, C, D and E. Both PGRN and its constituent Grn peptides have been implicated in a wide variety of biological activities. However, their functions are far from clear, and the lack of granulin domain-specific antibodies has hindered the progress of the functional study of PGRN and Grns. Monoclonal antibodies against GrnB, GrnA, GrnC and GrnF have been previously developed by our laboratory. In this study, we generated monoclonal antibodies (MAbs) against GrnD, GrnG and GrnE by using recombinant proteins HSA-GrnG, HSA-GrnD and HSA-GrnE as immunogens, and characterized them by indirect ELISA, Western blot and immunocytochemistry. Furthermore, the neutralizing activities of the MAbs against seven Grns were tested in vitro using the U251 cell line. This full antibody panel of MAbs against seven Grns will be a valuable tool for elucidating the biological roles of PGRN and Grns in different physiopathological processes, which will further promote the development of PGRN-based clinical diagnosis and therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Autosomal recessive spastic paraplegia (SPG45) with mental retardation maps to 10q24.3-q25.1. (United States)

    Dursun, Umut; Koroglu, Cigdem; Kocasoy Orhan, Elif; Ugur, Sibel Aylin; Tolun, Aslihan


    Hereditary spastic paraplegias (HSPs) are characterized by progressive spasticity in the lower limbs. They are clinically heterogeneous, and pure forms as well as complicated forms with other accompanying clinical findings are known. HSPs are also genetically heterogeneous. We performed clinical and genetic studies in a consanguineous family with five affected members. A genome scan using 405 microsatellite markers for eight members of the family identified candidate gene loci, and subsequent fine mapping in 16 members identified the gene locus responsible for the HSP. The clinical manifestations were very early onset spastic paraplegia (SPG) accompanied by mental retardation and ocular signs. The gene locus was identified as the interval 102.05-106.64 Mbp on chromosome 10. Gene MRPL43 was analyzed in the patients. No mutation but high levels of mRNA were detected. We have mapped a novel autosomal recessive complicated form of HSP (SPG45) to a 4.6-Mbp region at 10q24.3-q25.1 with multipoint logarithm of odds scores >4.5.

  12. Low dose rectal inoculation of rhesus macaques by SIV smE660 or SIVmac251 recapitulates

    Energy Technology Data Exchange (ETDEWEB)

    Hraber, Peter [Los Alamos National Laboratory; Giorgi, Elena E [Los Alamos National Laboratory; Keele, Brandon [UNIV OF ALABAMA; Li, Hui [UNIV OF ALABAMA; Learn, Gerald [UNIV OF ALABAMA


    We recently developed a novel strategy to identify transmitted HIV-1 genomes in acutely infected humans using single-genome amplification and a model of random virus evolution. Here, we used this approach to determine the molecular features of simian immunodeficiency virus (SIV) transmission in 18 experimentally infected Indian rhesus macaques. Animals were inoculated intrarectally (i.r.) or intravenously (i.v.) with stocks of SIVmac251 or SIVsmE660 that exhibited sequence diversity typical of early-chronic HIV-1 infection. 987 full-length SIV env sequences (median of 48 per animal) were determined from plasma virion RNA 1--5 wk after infection. i.r. inoculation was followed by productive infection by one or a few viruses (median 1; range 1--5) that diversified randomly with near starlike phylogeny and a Poisson distribution of mutations. Consensus viral sequences from ramp-up and peak viremia were identical to viruses found in the inocula or differed from them by only one or a few nucleotides, providing direct evidence that early plasma viral sequences coalesce to transmitted/founder viruses. i.v. infection was >2,000-fold more efficient than i.r. infection, and viruses transmitted by either route represented the full genetic spectra of the inocula. These findings identify key similarities in mucosal transmission and early diversification between SIV and HIV-1, and thus validate the SIV-macaque mucosal infection model for HIV-1 vaccine and microbicide research.

  13. The effects of intracerebroventricular AM-251, a CB1-receptor antagonist, and ACEA, a CB1-receptor agonist, on penicillin-induced epileptiform activity in rats. (United States)

    Kozan, Ramazan; Ayyildiz, Mustafa; Agar, Erdal


    Several results support the conclusion that the cannabinoid system has a role in generation and cessation of epileptic seizures. The aim of this study was to evaluate the effects of intracerebroventricular AM-251 [N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide], a CB1-receptor antagonist, and ACEA (arachidonyl-2-chloroethylamide), a CB1-receptor agonist, on penicillin-induced epileptiform activity in rats. In the first set of experiments, 30 min after penicillin injection, AM-251, at doses of 0.125, 0.25, 0.5, and 1 μg, was administered intracerebroventricularly (i.c.v.). In the second set of experiments, 30 min after penicillin injection, ACEA, at doses of 2.5, 5, 7.5, and 15 μg (i.c.v.), was administered. In the third set of experiments, AM-251, at doses of 0.125 and 0.25 μg (i.c.v.), was administered 10 min before ACEA (7.5 μg, i.c.v.) injection. ACEA, at a dose of 7.5 μg, significantly decreased the frequency of penicillin-induced epileptiform activity without changing the amplitude. ACEA, at doses of 2.5, 5, and 15 μg, had no impact on either frequency or amplitude of epileptiform activity. AM-251, at doses of 0.25 and 0.50 μg, significantly increased the frequency of epileptiform activity. AM-251, at a dose of 0.25 μg (i.c.v.), was the most effective in changing the frequency of penicillin-induced epileptiform activity, and it also caused status epilepticus-like activity. AM-251, at doses of 0.125 and 0.25 μg, 10 min before ACEA (7.5 μg), reversed the anticonvulsant action of ACEA. The results of the present study provide electrophysiologic evidence for the role of CB1 receptors in regulating the frequency of epileptiform activity in the model of penicillin-induced epilepsy. To elucidate the precise mechanism of cannabinoid action in the brain during seizure, more advanced electrophysiologic and neurochemical studies are required.

  14. A clinical epidemiological study of 251 cases of amyotrophic lateral sclerosis in the south of Brazil Estudo clínico epidemiológico de 251 casos de esclerose lateral amiotrófica no sul do Brasil

    Directory of Open Access Journals (Sweden)

    Lineu Cesar Werneck


    Full Text Available OBJECTIVE: To study the clinical forms of amyotrophic lateral sclerosis (ALS and the possible presence of risk factors in order to verify if there is any difference between cases in Paraná, Brazil. METHOD: We studied 251 cases, all of which fulfilled the diagnosis criteria proposed in El Escorial (WFN. Between 1977 and 2004, 157 male and 94 female patients were examined. RESULTS: 220 cases were classified as ALS-Spinal Onset (ALS-SO, 24 as ALS-Bulbar Onset (ALS-BO and 7 as Familial ALS. The mean age at time of evaluation was 54.4±12.3 years, and symptoms had started 17.9±15.7months previously. In the group studied, statistical relationships were found between heavy occupations and males; previous surgeries and females; ALS-BO and dysphagia and dysarthria in females; and ALS-SO and males, cramps, weakness, muscle atrophy, hypertonia, increased deep tendon reflex and abnormal gait. CONCLUSION: The average age at time of evaluation was lower than that registered in the literature but similar to the Brazilian series. Domestic work and heavy occupations appear to be related to precocious perception of the symptoms by interference with daily functions. The socioeconomically higher classes seek medical care early. There was no relationship with exposure to toxic agents or trauma.OBJETIVO: Estudar as formas clínicas de esclerose lateral amiotrófica (ELA e possíveis fatores de risco, a fim de verificar se existem diferenças entre os casos do Paraná, Brasil. MÉTODO: Estudamos 251 casos entre 1977 e 2004, que preencheram os critérios propostos em El Escorial (WFN, sendo 157 do sexo masculino e 94 do feminino. RESULTADOS: Foram classificados como ELA de início espinhal (ELA-IE 220 casos, ELA de início bulbar (ELA-IB 24 casos e 7 casos como ELA familiar. A idade média na avaliação foi 54,4±12,3 anos cujos sintomas iniciaram 17,9 ±15,7 meses antes. Foram encontradas relações estatísticas entre ocupação que demandam esforços físicos com

  15. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    DEFF Research Database (Denmark)

    Antoniou, Antonis C; Kartsonaki, Christiana; Sinilnikova, Olga M


    Two single nucleotide polymorphisms (SNPs) at 6q25.1, near the ESR1 gene, have been implicated in the susceptibility to breast cancer for Asian (rs2046210) and European women (rs9397435). A genome-wide association study in Europeans identified two further breast cancer susceptibility variants: rs...... is currently unknown. To address this, we genotyped these SNPs in BRCA1 and BRCA2 mutation carriers from 42 studies from the Consortium of Investigators of Modifiers of BRCA1/2. In the analysis of 14 123 BRCA1 and 8053 BRCA2 mutation carriers of European ancestry, the 6q25.1 SNPs (r(2) = 0.14) were...... to a better understanding of the biology of tumour development in these women....

  16. PDF 25(1)

    African Journals Online (AJOL)


    Evaluation du comportement de nouvelles variétés de riz au Gabon. Nizigiyimana A. 1993. Détermination et carac- térisation des phases de sensibilité aux basses températures chez le riz (Oryza sativa L.).Thèse de doctorat en sciences,. UCL. Louvain-la-Neuve. 131 p. Nwilene F. E., Nwanze K. F. and O. Okhidievbie. 2006.

  17. PDF 25(1)

    African Journals Online (AJOL)


    2003). Par ailleurs leur commercialisation fait l'objet généralement de circuits courts (Moustier et Fleury, 2003), aux conditions d'accès nécessitant peu de moyens, et générant de fait de nombreux emplois pour des populations marginalisées des villes. Les revenus générés par la vente contribuent à la sécurité alimentaire.

  18. Neonatal Caffeine Treatment and Respiratory Function at 11 Years in Children under 1,251 g at Birth. (United States)

    Doyle, Lex W; Ranganathan, Sarath; Cheong, Jeanie L Y


    Caffeine in the newborn period shortens the duration of assisted ventilation and reduces the incidence of bronchopulmonary dysplasia, but its effects on respiratory function in later childhood are unknown. To determine if children born with birth weight less than 1,251 g who were treated with neonatal caffeine had improved respiratory function at 11 years of age compared with children treated with placebo. Children enrolled in the CAP (Caffeine for Apnea of Prematurity) randomized controlled trial and assessed at the Royal Women's Hospital in Melbourne at 11 years of age had expiratory flow rates measured according to the standards of the American Thoracic Society. Values were converted to z-scores predicted for age, height, ethnicity, and sex. Parents completed questionnaires related to their child's respiratory health. A total of 142 children had expiratory flows measured. Expiratory flows were better in the caffeine group, by approximately 0.5 SD for most variables (e.g., FEV 1 ; mean z-score, -1.00 vs. -1.53; mean difference, 0.54; 95% confidence interval, 0.14-0.94; P = 0.008). Fewer children in the caffeine group had values for FVC below the fifth centile (11% vs. 28%; odds ratio, 0.31; 95% confidence interval, 0.12-0.77; P = 0.012). When adjusted for bronchopulmonary dysplasia, the difference in flow rates between groups diminished. Caffeine treatment in the newborn period improves expiratory flow rates in midchildhood, which seems to be achieved by improving respiratory health in the newborn period. Follow-up lung function testing in adulthood is vital for these individuals. Future placebo-controlled randomized trials of neonatal caffeine are unlikely. Clinical trial registered with (NCT00182312).

  19. Risk Factors for Pedicle Flap Complications in 251 Elderly Chinese Patients Who Underwent Oral and Maxillofacial Reconstruction. (United States)

    Fang, Zao; Tian, Zhuowei; Zhang, Chenping; Sun, Jian; Hu, Jingzhou; He, Yue


    To determine risk factors for pedicle flap complications in elderly patients undergoing oral and maxillofacial reconstruction. The authors designed and implemented a retrospective cohort study and enrolled a sample of patients at least 75 years old who underwent resection of oral and maxillofacial tumors and pedicle flap reconstruction from January 2004 through December 2013. The primary predictor variable was reconstructive technique grouped into 5 types of pedicle flap. The difference among groups was tested with the χ(2) test and t test. The primary outcome variable was the presence of flap complication, which was divided into minor and major groups. Other variables were grouped into the following sets: demographic, operative, and adjuvant treatments. Univariate, bivariate, and regression statistics were computed and statistical significance was set at a P value less than .05. The study sample was composed of 251 patients with a mean age of 78 years and 62.95% were men. Of these, 68.13% had various preoperative systemic diseases. With regard to flap type, 120 underwent reconstruction with a pectoralis major myocutaneous flap, 5 with a submental island flap, 4 with a submandibular gland flap, 13 with a platysma myocutaneous flap, and 109 with a sternocleidomastoid flap. TNM stage (negative correlation) and smoking (positive correlation) correlated with flap type. There were 48 complications, of which 32 were minor and 16 were major; flap failure was observed in only 1 patient. Risk factors associated with complications were types of pedicle flap, age, heart score, hypertension, diabetes, postoperative hypoproteinemia, and drug-induced liver injury. The pedicle flap is suitable and safe for the reconstruction of defects caused by the ablation of oral and maxillofacial tumors in elderly patients. Preoperative evaluation of positive risk factors, including type of surgery and systemic conditions, is very important for the selection of an appropriate flap for such

  20. A limited number of simian immunodeficiency virus (SIV) env variants are transmitted to rhesus macaques vaginally inoculated with SIVmac251. (United States)

    Stone, Mars; Keele, Brandon F; Ma, Zhong-Min; Bailes, Elizabeth; Dutra, Joseph; Hahn, Beatrice H; Shaw, George M; Miller, Christopher J


    Single-genome amplification (SGA) and sequencing of HIV-1 RNA in plasma of acutely infected humans allows the identification and enumeration of transmitted/founder viruses responsible for productive systemic infection. Use of this strategy as a means for identifying transmitted viruses suggested that intrarectal simian immunodeficiency virus (SIV) inoculation of macaques recapitulates key features of human rectal infection. However, no studies have used the SGA strategy to identify vaginally transmitted virus(es) in macaques or to determine how early SIV diversification in vaginally infected animals compares with HIV-1 in humans. We used SGA to amplify 227 partial env sequences from a SIVmac251 challenge stock and from seven rhesus macaques at the earliest plasma viral RNA-positive time point after low- and high-dose intravaginal inoculation. Sequences were analyzed phylogenetically to determine the relationship of transmitted/founder viruses within and between each animal and the challenge stock. In each animal, discrete low-diversity env sequence lineages were evident, and these coalesced phylogenetically to identical or near-identical env sequences in the challenge stock, thus confirming the validity of the SGA sequencing and modeling strategy for identifying vaginally transmitted SIV. Between 1 and 10 viruses were responsible for systemic infection, similar to humans infected by sexual contact, and the set of viruses transmitted to the seven animals studied represented the full genetic constellation of the challenge stock. These findings recapitulate many of the features of sexual HIV-1 transmission in women. Furthermore, the SIV rhesus macaque model can be used to understand the factors that influence the transmission of single versus multiple SIV variants.

  1. Multiple Independent Loci at Chromosome 15q25.1 Affect Smoking Quantity: a Meta-Analysis and Comparison with Lung Cancer and COPD


    Saccone, Nancy L.; Culverhouse, Robert C.; Schwantes-An, Tae-Hwi; Cannon, Dale S.; Chen, Xiangning; Cichon, Sven; Giegling, Ina; Han, Shizhong; Han, Younghun; Keskitalo-Vuokko, Kaisu; Kong, Xiangyang; Landi, Maria Teresa; Ma, Jennie Z.; Short, Susan E.; Stephens, Sarah H.


    Recently, genetic association findings for nicotine dependence, smoking behavior, and smoking-related diseases converged to implicate the chromosome 15q25.1 region, which includes the CHRNA5-CHRNA3-CHRNB4 cholinergic nicotinic receptor subunit genes. In particular, association with the nonsynonymous CHRNA5 SNP rs16969968 and correlates has been replicated in several independent studies. Extensive genotyping of this region has suggested additional statistically distinct signals for nicotine de...

  2. Identifying involvement of Lys251/Asp252 pair in electron transfer and associated proton transfer at the quinone reduction site of Rhodobacter capsulatus cytochrome bc1. (United States)

    Kuleta, Patryk; Sarewicz, Marcin; Postila, Pekka; Róg, Tomasz; Osyczka, Artur


    Describing dynamics of proton transfers in proteins is challenging, but crucial for understanding processes which use them for biological functions. In cytochrome bc1, one of the key enzymes of respiration or photosynthesis, proton transfers engage in oxidation of quinol (QH2) and reduction of quinone (Q) taking place at two distinct catalytic sites. Here we evaluated by site-directed mutagenesis the contribution of Lys251/Asp252 pair (bacterial numbering) in electron transfers and associated with it proton uptake to the quinone reduction site (Qi site). We showed that the absence of protonable group at position 251 or 252 significantly changes the equilibrium levels of electronic reactions including the Qi-site mediated oxidation of heme bH, reverse reduction of heme bH by quinol and heme bH/Qi semiquinone equilibrium. This implicates the role of H-bonding network in binding of quinone/semiquinone and defining thermodynamic properties of Q/SQ/QH2 triad. The Lys251/Asp252 proton path is disabled only when both protonable groups are removed. With just one protonable residue from this pair, the entrance of protons to the catalytic site is sustained, albeit at lower rates, indicating that protons can travel through parallel routes, possibly involving water molecules. This shows that proton paths display engineering tolerance for change as long as all the elements available for functional cooperation secure efficient proton delivery to the catalytic site. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.


    Sink, KS; Segovia, KN; Sink, J; Randall, PA; Collins, LE; Correa, M; Markus, EJ; Vemuri, VK; Makriyannis, A; Salamone, JD


    Cannabinoid CB1 inverse agonists suppress food-motivated behaviors, but may also induce psychiatric effects such as depression and anxiety. To evaluate behaviors potentially related to anxiety, the present experiments assessed the CB1 inverse agonist AM251 (2.0 – 8.0 mg/kg), the CB1 antagonist AM4113 (3.0 – 12.0 mg/kg), and the benzodiazepine inverse agonist FG-7142 (10.0 – 20.0 mg/kg), using the open field test and the elevated plus maze. Although all three drugs affected open field behavior, these effects were largely due to actions on locomotion. In the elevated plus maze, FG-7142 and AM251 both produced anxiogenic effects. FG-7142 and AM251 also significantly increased c-Fos activity in the amygdala and nucleus accumbens shell. In contrast, AM4113 failed to affect performance in the plus maze, and did not induce c-Fos immunoreactivity. The weak effects of AM4113 are consistent with biochemical data showing that AM4113 induces little or no intrinsic cellular activity. This research may lead to the development of novel appetite suppressants with reduced anxiogenic effects. PMID:20015619

  4. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene. (United States)

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying


    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  5. MiR-133b contributes to arsenic-induced apoptosis in U251 glioma cells by targeting the hERG channel. (United States)

    Wang, Jian; Li, Yongli; Jiang, Chuanlu


    Substantial evidence indicates that the human ether-a-go-go-related gene potassium channel (hERG, Kv11.1, KCNH2) is overexpressed in human glioblastoma multiforme (GBM) specimens and plays an essential role in the malignant proliferation of glioma cells. However, its upstream regulator in glioma cells is not fully elucidated. The present study was designed to determine whether the expression of hERG gene is regulated by miR-133b or miR-34a, thereby contributing to the anti-proliferation effect of arsenic trioxide (ATO) in U251 human glioma cells. Real-time polymerase chain reactions (qRT-PCR) and Western blot results demonstrated that hERG mRNA and protein levels were dramatically upregulated in clinical GBM specimens. Conversely, both miR-133b and miR-34a were markedly downregulated in clinical GBM specimens by qRT-PCR. The hERG gene was a direct target of miR-133b and miR-34a by bioinformatics analyses and luciferase reporter assays. Moreover, ATO, which is an emerging chemotherapy drug for glioma disease, remarkably elevated the level of miR-133b, but not miR-34a in U251 glioma cells. The level of miR-133b upstream transactivator serum response factor (SRF) was also suppressed by ATO. The transfection of anti-miR-133b oligonucleotide (AMO-133b) remarkably prevented the decrease of hERG protein by 5 μM ATO treatment for 24 h in U251 cells, whereas anti-miR-34a oligonucleotide (AMO-34a) did not exhibit recuperated effect. Finally, the transient overexpression by miR-133b mimics and treatment with the hERG channel-specific blocker E4031 markedly facilitated the ATO inhibition of proliferation of and induced apoptosis in U251 cells, whereas AMO-miR-133b attenuated these changes. Our study provided the evidence for the pathological role of miR-133b and miR-34a in the development of GBM and thus expanded our understanding of the hERG gene expression and ATO chemotherapeutic roles of miRNAs. Targeting miR-133b/hERG pathway may be a new strategy for chemotherapy of

  6. Spectroscopic and structural elucidation of merocyanine dye 2,5-[1-metyl-4-[2-(4-hydroxyphenyl)ethenyl)]piridinium]-hexane tetraphenylborate. Aggregation processes (United States)

    Koleva, Bojidarka B.; Stoyanov, Stanimir; Kolev, Tsonko; Petkov, Ivan; Spiteller, Michael


    Structural and spectroscopic elucidation of merocyanine dye, 2,5-[1-metyl-4-[2-(4-hydroxyphenyl)ethenyl)]piridinium]-hexane tetraphenylborate, is performed in gas and condense phase by means of solution and solid-state conventional and linear-polarized IR-spectroscopy of oriented colloids in nematic liquid crystal suspension, UV-vis and fluorescence methods, HPLC MS/MS tandem and ESI mass spectrometry, 1H, 13C and 1H- 1H COSY NMR, TGV and DSC methods. Quantum chemical DFT calculations are performed for structural optimization and spectroscopic properties prediction.

  7. Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251

    Directory of Open Access Journals (Sweden)

    Dormont Dominique


    Full Text Available Abstract Background The aim of this study was to evaluate gene therapy for AIDS based on the transduction of circulating lymphocytes with a retroviral vector giving low levels of constitutive macaque interferon β production in macaques chronically infected with a pathogenic isolate of SIVmac251. Results Two groups of three animals infected for more than one year with a pathogenic primary isolate of SIVmac251 were included in this study. The macaques received three infusions of their own lymphocytes transduced ex vivo with the construct encoding macaque IFN-β (MaIFN-β or with a vector carrying a version of the MaIFN-β gene with a deletion preventing translation of the mRNA. Cellular or plasma viremia increased transiently following injection in most cases, regardless of the retroviral construct used. Transduced cells were detected only transiently after each infusion, among the peripheral blood mononuclear cells of all the animals, with copy numbers of 10 to 1000 per 106 peripheral mononuclear cells. Conclusion Long-term follow-up indicated that the transitory presence of such a small number of cells producing such small amounts of MaIFN-β did not prevent animals from the progressive decrease in CD4+ cell count typical of infection with simian immunodeficiency virus. These results reveal potential pitfalls for future developments of gene therapy strategies of HIV infection.

  8. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers (United States)

    Antoniou, Antonis C; Kartsonaki, Christiana; Sinilnikova, Olga M.; Soucy, Penny; McGuffog, Lesley; Healey, Sue; Lee, Andrew; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Cattaneo, Elisa; Barile, Monica; Pensotti, Valeria; Pasini, Barbara; Dolcetti, Riccardo; Giannini, Giuseppe; Laura Putignano, Anna; Varesco, Liliana; Radice, Paolo; Mai, Phuong L.; Greene, Mark H.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A.; Birk Jensen, Uffe; Crüger, Dorthe G.; Caligo, Maria A.; Laitman, Yael; Milgrom, Roni; Kaufman, Bella; Paluch-Shimon, Shani; Friedman, Eitan; Loman, Niklas; Harbst, Katja; Lindblom, Annika; Arver, Brita; Ehrencrona, Hans; Melin, Beatrice; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy; Jakubowska, Ania; Lubinski, Jan; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Gorski, Bohdan; Osorio, Ana; Ramón y Cajal, Teresa; Fostira, Florentia; Andrés, Raquel; Benitez, Javier; Hamann, Ute; Hogervorst, Frans B.; Rookus, Matti A.; Hooning, Maartje J.; Nelen, Marcel R.; van der Luijt, Rob B.; van Os, Theo A.M.; van Asperen, Christi J.; Devilee, Peter; Meijers-Heijboer, Hanne E.J.; Gómez Garcia, Encarna B.; Peock, Susan; Cook, Margaret; Frost, Debra; Platte, Radka; Leyland, Jean; Gareth Evans, D.; Lalloo, Fiona; Eeles, Ros; Izatt, Louise; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Ong, Kai-ren; Cook, Jackie; Douglas, Fiona; Paterson, Joan; John Kennedy, M.; Miedzybrodzka, Zosia; Godwin, Andrew; Stoppa-Lyonnet, Dominique; Buecher, Bruno; Belotti, Muriel; Tirapo, Carole; Mazoyer, Sylvie; Barjhoux, Laure; Lasset, Christine; Leroux, Dominique; Faivre, Laurence; Bronner, Myriam; Prieur, Fabienne; Nogues, Catherine; Rouleau, Etienne; Pujol, Pascal; Coupier, Isabelle; Frénay, Marc; Hopper, John L.; Daly, Mary B.; Terry, Mary B.; John, Esther M.; Buys, Saundra S.; Yassin, Yosuf; Miron, Alexander; Goldgar, David; Singer, Christian F.; Tea, Muy-Kheng; Pfeiler, Georg; Catharina Dressler, Anne; Hansen, Thomas v.O.; Jønson, Lars; Ejlertsen, Bent; Bjork Barkardottir, Rosa; Kirchhoff, Tomas; Offit, Kenneth; Piedmonte, Marion; Rodriguez, Gustavo; Small, Laurie; Boggess, John; Blank, Stephanie; Basil, Jack; Azodi, Masoud; Ewart Toland, Amanda; Montagna, Marco; Tognazzo, Silvia; Agata, Simona; Imyanitov, Evgeny; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Pharoah, Paul D.P.; Sucheston, Lara; Karlan, Beth Y.; Walsh, Christine S.; Olah, Edith; Bozsik, Aniko; Teo, Soo-Hwang; Seldon, Joyce L.; Beattie, Mary S.; van Rensburg, Elizabeth J.; Sluiter, Michelle D.; Diez, Orland; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ruehl, Ina; Varon-Mateeva, Raymonda; Kast, Karin; Deissler, Helmut; Niederacher, Dieter; Arnold, Norbert; Gadzicki, Dorothea; Schönbuchner, Ines; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Dumont, Martine; Chiquette, Jocelyne; Tischkowitz, Marc; Chen, Xiaoqing; Beesley, Jonathan; Spurdle, Amanda B.; Neuhausen, Susan L.; Chun Ding, Yuan; Fredericksen, Zachary; Wang, Xianshu; Pankratz, Vernon S.; Couch, Fergus; Simard, Jacques; Easton, Douglas F.; Chenevix-Trench, Georgia


    Two single nucleotide polymorphisms (SNPs) at 6q25.1, near the ESR1 gene, have been implicated in the susceptibility to breast cancer for Asian (rs2046210) and European women (rs9397435). A genome-wide association study in Europeans identified two further breast cancer susceptibility variants: rs11249433 at 1p11.2 and rs999737 in RAD51L1 at 14q24.1. Although previously identified breast cancer susceptibility variants have been shown to be associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers, the involvement of these SNPs to breast cancer susceptibility in mutation carriers is currently unknown. To address this, we genotyped these SNPs in BRCA1 and BRCA2 mutation carriers from 42 studies from the Consortium of Investigators of Modifiers of BRCA1/2. In the analysis of 14 123 BRCA1 and 8053 BRCA2 mutation carriers of European ancestry, the 6q25.1 SNPs (r2 = 0.14) were independently associated with the risk of breast cancer for BRCA1 mutation carriers [hazard ratio (HR) = 1.17, 95% confidence interval (CI): 1.11–1.23, P-trend = 4.5 × 10−9 for rs2046210; HR = 1.28, 95% CI: 1.18–1.40, P-trend = 1.3 × 10−8 for rs9397435], but only rs9397435 was associated with the risk for BRCA2 carriers (HR = 1.14, 95% CI: 1.01–1.28, P-trend = 0.031). SNP rs11249433 (1p11.2) was associated with the risk of breast cancer for BRCA2 mutation carriers (HR = 1.09, 95% CI: 1.02–1.17, P-trend = 0.015), but was not associated with breast cancer risk for BRCA1 mutation carriers (HR = 0.97, 95% CI: 0.92–1.02, P-trend = 0.20). SNP rs999737 (RAD51L1) was not associated with breast cancer risk for either BRCA1 or BRCA2 mutation carriers (P-trend = 0.27 and 0.30, respectively). The identification of SNPs at 6q25.1 associated with breast cancer risk for BRCA1 mutation carriers will lead to a better understanding of the biology of tumour development in these women. PMID:21593217

  9. Chronic Δ(9)-Tetrahydrocannabinol Administration Reduces IgE(+)B Cells but Unlikely Enhances Pathogenic SIVmac251 Infection in Male Rhesus Macaques of Chinese Origin. (United States)

    Wei, Qiang; Liu, Li; Cong, Zhe; Wu, Xiaoxian; Wang, Hui; Qin, Chuan; Molina, Patricia; Chen, Zhiwei


    Delta9-tetrahydrocannabinol (Δ(9)-THC) is the major psychoactive component of the cannabis plant. Δ(9)-THC has been used in the active ingredient of Marinol as an appetite stimulant for AIDS patients. Its impact on progression of HIV-1 infection, however, remains debatable. Previous studies indicated that Δ(9)-THC administration enhanced HIV-1 infection in huPBL-SCID mice but seemingly decreased early mortality in simian immunodeficiency virus (SIV) infected male Indian-derived rhesus macaques. Here, we determine the chronic effect of Δ(9)-THC administration using 0.32 mg/kg or placebo (PBO), i.m., twice daily for 428 days on SIVmac251 infected male Chinese-derived rhesus macaques. Sixteen animals were divided into four study groups: Δ(9)-THC(+)SIV(+), Δ(9)-THC(+)SIV(-), PBO/SIV(+) and PBO/SIV(-) (n = 4/group). One-month after daily Δ(9)-THC or PBO administrations, macaques in groups one and three were challenged intravenously with pathogenic SIVmac251/CNS, which was isolated from the brain of a Chinese macaque with end-staged neuroAIDS. No significant differences in peak and steady state plasma viral loads were seen between Δ(9)-THC(+)SIV(+) and PBO/SIV(+) macaques. Regardless of Δ(9)-THC, all infected macaques displayed significant drop of CD4/CD8 T cell ratio, loss of CD4(+) T cells and higher persistent levels of Ki67(+)CD8(+) T cells compared with uninfected animals. Moreover, long-term Δ(9)-THC treatment reduced significantly the frequency of circulating IgE(+)B cells. Only one Δ(9)-THC(+)SIV(+) macaque died of simian AIDS with paralyzed limbs compared with two deaths in the PBO/SIV(+) group during the study period. These findings indicate that chronic Δ(9)-THC administration resulted in reduction of IgE(+)B cells, yet it unlikely enhanced pathogenic SIVmac251/CNS infection in male Rhesus macaques of Chinese origin.

  10. Chronic Δ9-tetrahydrocannabinol administration reduces IgE+B cells but unlikely enhances pathogenic SIVmac251 infection in male Rhesus macaques of Chinese origin (United States)

    Wu, Xiaoxian; Wang, Hui; Qin, Chuan; Molina, Patricia; Chen, Zhiwei


    Delta9-tetrahydrocannabinol (Δ9-THC) is the major psychoactive component of the cannabis plant. Δ9-THC has been used in the active ingredient of Marinol as an appetite stimulant for AIDS patients. Its impact on progression of HIV-1 infection, however, remains debatable. Previous studies indicated that Δ9-THC administration enhanced HIV-1 infection in huPBL-SCID mice but seemingly decreased early mortality in simian immunodeficiency virus (SIV) infected male Indian-derived rhesus macaques. Here, we determine the chronic effect of Δ9-THC administration (0.32mg/kg or placebo-PBO, i.m., twice daily for 428 days) on SIVmac251 infected male Chinese-derived rhesus macaques. Sixteen animals were divided into four study groups: Δ9-THC+SIV+, Δ9-THC+SIV−, placebo (PBO)/SIV+ and PBO/SIV− (n=4/group). One-month after daily Δ9-THC or PBO administrations, macaques in groups one and three were challenged intravenously with pathogenic SIVmac251/CNS, which was isolated from the brain of a Chinese macaque with end-staged neuroAIDS. No significant differences in peak and steady state plasma viral loads were seen between Δ9-THC and PBO infected macaques. Regardless of Δ9-THC, all infected macaques displayed significant drop of CD4/CD8 T cell ratio, loss of CD4+ T cells and higher persistent levels of Ki67+CD8+ T cells when compared to uninfected animals. Moreover, long-term Δ9-THC treatment reduced significantly the frequency of circulating IgE+B cells. Only one infected macaque in the Δ9-THC+SIV+ group died of simian AIDS with paralyzed limbs as compared with two deaths in the PBO/SIV+ group during the study period. These findings indicate that chronic Δ9-THC administration resulted in reduction of IgE+B cells, yet it unlikely enhanced pathogenic SIVmac251/CNS infection in male Rhesus macaques of Chinese origin. PMID:27109234

  11. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    DEFF Research Database (Denmark)

    Antoniou, Antonis C; Kartsonaki, Christiana; Sinilnikova, Olga M


    11249433 at 1p11.2 and rs999737 in RAD51L1 at 14q24.1. Although previously identified breast cancer susceptibility variants have been shown to be associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers, the involvement of these SNPs to breast cancer susceptibility in mutation carriers......% CI: 0.92-1.02, P-trend = 0.20). SNP rs999737 (RAD51L1) was not associated with breast cancer risk for either BRCA1 or BRCA2 mutation carriers (P-trend = 0.27 and 0.30, respectively). The identification of SNPs at 6q25.1 associated with breast cancer risk for BRCA1 mutation carriers will lead...

  12. Noradrenaline increases intracellular glutathione in human astrocytoma U-251 MG cells by inducing glutamate-cysteine ligase protein via β3-adrenoceptor stimulation. (United States)

    Yoshioka, Yasuhiro; Kadoi, Hisatsugu; Yamamuro, Akiko; Ishimaru, Yuki; Maeda, Sadaaki


    Glutathione (GSH) plays a critical role in protecting cells from oxidative damage. Since neurons rely on the supply of GSH from astrocytes to maintain optimal intracellular GSH concentrations, the GSH concentration of astrocytes is important for the survival of neighboring neurons against oxidative stress. The neurotransmitter noradrenaline is known to modulate the functions of astrocytes and has been suggested to have neuroprotective properties in neurodegenerative diseases. To elucidate the mechanisms underlying the neuroprotective properties of noradrenaline, in this study, we investigated the effect of noradrenaline on the concentrations of intracellular GSH in human U-251 malignant glioma (MG; astrocytoma) cells. Treatment of the cells with noradrenaline for 24h concentration-dependently increased their intracellular GSH concentration. This increase was inhibited by a non-selective β-adrenoceptor antagonist propranolol and by a selective β3-adrenoceptor antagonist SR59230A, but not by a non-selective α-adrenoceptor antagonist phenoxybenzamine, or by a selective β1-adrenoceptor antagonist atenolol or by a selective β2-adrenoceptor antagonist butoxamine. In addition, the selective β3-adrenoceptor agonist CL316243 increased the intracellular GSH in U-251 MG cells. Treatment of the cells with noradrenaline (10μM) for 24h increased the protein level of the catalytic subunit of glutamate-cysteine ligase (GCLc), the rate-limiting enzyme of GSH synthesis; and this increase was inhibited by SR59230A. These results thus suggest that noradrenaline increased the GSH concentration in astrocytes by inducing GCLc protein in them via β3-adrenoceptor stimulation. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Racial differences in the association between SNPs on 15q25.1, smoking behavior, and risk of non-small cell lung cancer. (United States)

    Schwartz, Ann G; Cote, Michele L; Wenzlaff, Angela S; Land, Susan; Amos, Christopher I


    Three genome-wide association studies identified a region on chromosome 15q25.1 associated with lung cancer and measures of nicotine addiction. This region includes nicotinic acetylcholine receptor subunit genes CHRNA3 and CHRNA5. These studies were conducted in European or European American populations and do not provide risk estimates for African Americans. The goal of this study was to determine whether recently identified genetic variation in 3 SNPs (rs1051730, rs931794, rs8034191) on chromosome 15q25.1 contributes to risk of lung cancer in African Americans. Data were derived from three case-control studies. Participants included 1058 population-based non-small cell lung cancer cases selected from the Detroit area SEER registry and 1314 controls matched within study by age, race, and sex. Thirty-nine percent of participants were African American. Risk associated with rs1051730 (odds ratio 1.59; 95% confidence interval 1.16-2.19) and rs931794 (odds ratio 1.39; 95% confidence interval 1.09-1.78) increased in ever smoking African Americans adjusting for cigarettes smoked per day. Among white cases, the number of cigarettes smoked varied by genotype at all three SNPs, and when smoking quantity was included in the models, risk was not significantly associated with any of the three SNPs. These findings suggest that SNPs in the CHRNA3 and CHRNA5 region contribute to lung cancer risk, and while variant alleles are less frequent in African Americans, risk in this group may be greater than in whites and less likely to reflect an indirect effect on lung cancer risk through nicotine dependence.

  14. Prevention of drug priming- and cue-induced reinstatement of MDMA-seeking behaviors by the CB1 cannabinoid receptor antagonist AM251. (United States)

    Nawata, Yoko; Kitaichi, Kiyoyuki; Yamamoto, Tsuneyuki


    3,4-Methylenedioxymethamphetamine (MDMA), a methamphetamine (METH) derivative, exhibits METH-like actions at monoamine transporters and positive reinforcing effects in rodents and primates. The purposes of the present study were to determine whether cross-reinstatement would be observed between MDMA and METH and if the cannabinoid receptor, a receptor known to play critical roles in the brain reward system, could modulate MDMA craving. Rats were trained to press a lever for intravenous MDMA (0.3mg/infusion) or METH (0.02mg/infusion) infusions under a fixed ratio 1 schedule paired with drug-associated cues (light and tone). Following drug self-administration acquisition training, rats underwent extinction training (an infusion of saline). Reinstatement tests were performed once the extinction criteria were achieved. In MDMA-trained rats, the MDMA-priming injection (3.2mg/kg, i.p.) or re-exposure to MDMA-associated cues reinstated MDMA-seeking behavior. Additionally, a priming injection of METH (1.0mg/kg, i.p.) also reinstated MDMA-seeking behavior. In contrast, none of the MDMA doses reinstated METH-seeking behavior in the METH-trained rats. The CB1 cannabinoid receptor antagonist AM251 markedly attenuated the MDMA-seeking behaviors induced by MDMA-priming injection or re-exposure to MDMA-associated cues in a dose-dependent manner. These findings show that MDMA has obvious addictive potential for reinstating drug-seeking behavior and that METH can be an effective stimulus for reinstating MDMA-seeking behaviors. Furthermore, based on the attenuating effect of AM251 in the reinstatement of MDMA-seeking behaviors, drugs that suppress CB1 receptors may be used in treatment of MDMA dependence. Copyright © 2016. Published by Elsevier Ireland Ltd.

  15. Radiobiological response of U251MG, CHO-K1 and V79 cell lines to accelerator-based boron neutron capture therapy. (United States)

    Sato, Eisuke; Zaboronok, Alexander; Yamamoto, Tetsuya; Nakai, Kei; Taskaev, Sergey; Volkova, Olga; Mechetina, Ludmila; Taranin, Alexander; Kanygin, Vladimir; Isobe, Tomonori; Mathis, Bryan J; Matsumura, Akira


    In the current article, we provide in vitro efficacy evaluation of a unique accelerator-based neutron source, constructed at the Budker Institute of Nuclear Physics (Novosibirsk, Russian Federation), for boron neutron capture therapy (BNCT), which is particularly effective in the case of invasive cancers. U251MG, CHO-K1 and V79 cells were incubated and irradiated in various concentrations of boric acid with epithermal neutrons for 2-3 h in a plexiglass phantom, using 2.0 MeV proton energy and 1.5-3.0 mA proton current, resulting in a neutron fluence of 2.16 × 1012 cm-2. The survival curves of cells loaded with boron were normalized to those irradiated without boron (to exclude the influence of the fast neutron and gamma dose components) and fit to the linear-quadratic (LQ) model. Colony formation assays showed the following cell survival rates (means ± SDs): CHO-K1: 0.348 ± 0.069 (10 ppm), 0.058 ± 0.017 (20 ppm), 0.018 ± 0.005 (40 ppm); V79: 0.476 ± 0.160 (10 ppm), 0.346 ± 0.053 (20 ppm), 0.078 ± 0.015 (40 ppm); and U251MG: 0.311 ± 0.061 (10 ppm), 0.131 ± 0.022 (20 ppm), 0.020 ± 0.010 (40 ppm). The difference between treated cells and controls was significant in all cases (P BNCT into the clinical phase. © The Author(s) 2017. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  16. Extreme event archived in the geological record of the Japan Trench: New results from R/V Sonne Cruise SO-251 towards establishing J-TRACK paleoseismology (United States)

    Strasser, Michael; Kopf, Achim; Kanamatsu, Toshyia; Moernaut, Jasper; Ikehara, Ken; McHugh, Cecila


    Our perspective of subduction zonés earthquake magnitude and recurrence is limited by short historical records. Examining prehistoric extreme events preserved in the geological record is essential towards understanding large earthquakes and assessing the geohazard potential associated with such rare events. The research field of "subaquatic paleoseismology" is a promising approach to investigate deposits from the deep sea, where earthquakes leave traces preserved in stratigraphic succession. However, at present we lack comprehensive data set that allow conclusive distinctions between quality and completeness of the paleoseismic archives as they may relate to different sediment transport, erosion and deposition processes vs. variability of intrinsic seismogenic behavior across different segments. Initially building on what sedimentary deposits were generated from the 2011 Magnitude 9 Tohoku-oki earthquake, the Japan Trench is a promising study area to investigate earthquake-triggered sediment remobilization processes and how they become embedded in the stratigraphic record. Here we present new results from the recent R/V Sonne expedition SO251 that acquired a complete high-resolution bathymetric map of the trench axis and nearly 2000 km of subbottom Parasound profiles, covering the entire along-strike extent of the Japan Trench from 36° to 40.3° N, and groundtruthed by several nearly 10m long piston cores retrieved from the very deep waters (7 to 8 km below sea level): Several smaller submarine landslide (up to several 100's m of lateral extent) can be identified along the trench axis in the new bathymetric data set. These features were either not yet present, or not resolved in the lower-resolution bathymetric dataset acquired before 2011. Sub-bottom acoustic reflection data reveals striking, up to several meter thick, acoustically transparent bodies interbedded in the otherwise parallel reflection pattern of the trench fill basins, providing a temporal and

  17. Replication and functional genomic analyses of the breast cancer susceptibility locus at 6q25.1 generalize its importance in women of chinese, Japanese, and European ancestry. (United States)

    Cai, Qiuyin; Wen, Wanqing; Qu, Shimian; Li, Guoliang; Egan, Kathleen M; Chen, Kexin; Deming, Sandra L; Shen, Hongbing; Shen, Chen-Yang; Gammon, Marilie D; Blot, William J; Matsuo, Keitaro; Haiman, Christopher A; Khoo, Ui Soon; Iwasaki, Motoki; Santella, Regina M; Zhang, Lina; Fair, Alecia Malin; Hu, Zhibin; Wu, Pei-Ei; Signorello, Lisa B; Titus-Ernstoff, Linda; Tajima, Kazuo; Henderson, Brian E; Chan, Kelvin Y K; Kasuga, Yoshio; Newcomb, Polly A; Zheng, Hong; Cui, Yong; Wang, Furu; Shieh, Ya-Lan; Iwata, Hiroji; Le Marchand, Loic; Chan, Sum Yin; Shrubsole, Martha J; Trentham-Dietz, Amy; Tsugane, Shoichiro; Garcia-Closas, Montserrat; Long, Jirong; Li, Chun; Shi, Jiajun; Huang, Bo; Xiang, Yong-Bing; Gao, Yu-Tang; Lu, Wei; Shu, Xiao-Ou; Zheng, Wei


    We evaluated the generalizability of a single nucleotide polymorphism (SNP), rs2046210 (A/G allele), associated with breast cancer risk that was initially identified at 6q25.1 in a genome-wide association study conducted among Chinese women. In a pooled analysis of more than 31,000 women of East-Asian, European, and African ancestry, we found a positive association for rs2046210 and breast cancer risk in Chinese women [ORs (95% CI) = 1.30 (1.22-1.38) and 1.64 (1.50-1.80) for the AG and AA genotypes, respectively, P for trend = 1.54 × 10⁻³⁰], Japanese women [ORs (95% CI) = 1.31 (1.13-1.52) and 1.37 (1.06-1.76), P for trend = 2.51 × 10⁻⁴], and European-ancestry American women [ORs (95% CI) = 1.07 (0.99-1.16) and 1.18 (1.04-1.34), P for trend = 0.0069]. No association with this SNP, however, was observed in African American women [ORs (95% CI) = 0.81 (0.63-1.06) and 0.85 (0.65-1.11) for the AG and AA genotypes, respectively, P for trend = 0.4027]. In vitro functional genomic studies identified a putative functional variant, rs6913578. This SNP is 1,440 bp downstream of rs2046210 and is in high linkage disequilibrium with rs2046210 in Chinese (r(2) = 0.91) and European-ancestry (r² = 0.83) populations, but not in Africans (r² = 0.57). SNP rs6913578 was found to be associated with breast cancer risk in Chinese and European-ancestry American women. After adjusting for rs2046210, the association of rs6913578 with breast cancer risk in African Americans approached borderline significance. Results from this large consortium study confirmed the association of rs2046210 with breast cancer risk among women of Chinese, Japanese, and European ancestry. This association may be explained in part by a putatively functional variant (rs6913578) identified in the region. ©2011 AACR.

  18. Dysport and Botox at a ratio of 2.5:1 units in cervical dystonia: a double-blind, randomized study. (United States)

    Yun, Ji Young; Kim, Jae Woo; Kim, Hee-Tae; Chung, Sun Ju; Kim, Jong-Min; Cho, Jin Whan; Lee, Jee-Young; Lee, Ha Neul; You, Sooyeoun; Oh, Eungseok; Jeong, Heejeong; Kim, Young Eun; Kim, Han-Joon; Lee, Won Yong; Jeon, Beom S


    We aimed to compare Dysport (abobotulinumtoxinA, Ipsen Biopharm, Slough, UK) and Botox (onabotulinumtoxinA, Allergan, Irvine, CA, USA) at a 2.5:1 ratio in the treatment of cervical dystonia (CD). A Dysport/Botox ratio of lower than 3:1 was suggested as a more appropriate conversion ratio, considering its higher efficacy and more frequent incidence of adverse effects not only in the treatment of CD but also in other focal movement disorders. A randomized, double-blind, multicenter, non-inferiority, two-period crossover study was done in CD, with a duration of at least 18 months. Patients were randomly assigned to treatment for the first period with Dysport or Botox, and they were followed up for 16 weeks after the injection. After a 4-week washout period, they were switched to the other formulation and then followed up for 16 weeks. The primary outcome was the changes in the Tsui scale between the baseline value and that at 1 month after each injection. A total of 103 patients were enrolled, and 94 completed the study. Mean changes in the Tsui scale between baseline and 4 weeks after each injection tended to favor Botox; however, this was not statistically significant (4.0 ± 3.9 points for the Dysport treatment vs. 4.8 ± 4.1 points for Botox; 95% confidence interval, -0.1-1.7; P = 0.091). The mean change of the Toronto western spasmodic torticollis rating scale score, the proportion of improvement in clinical global impression and patient global impression, and the incidences of adverse events were not significantly different between the two treatments. With regard to safety and efficacy, Dysport was not inferior to Botox in patients with CD at a conversion factor of 2.5:1. [ NCT00950664] © The Authors. Movement Disorders published by Wiley Periodicals, Inc. on behalf of International Parkinson and Movement Disorder Society.

  19. Low dose rectal inoculation of rhesus macaques by SIV SME660 or SIV MAC251 recapitulates human mucosal infection by HIV-1

    Energy Technology Data Exchange (ETDEWEB)

    Koraber, Bette [Los Alamos National Laboratory; Perelson, Alan [Los Alamos National Laboratory; Hraber, Peter [Los Alamos National Laboratory; Giorgi, E [Los Alamos National Laboratory; Bhattacharya, T [Los Alamos National Laboratory


    Recently, we developed a novel approach to the identification of transmitted or early founder HIV -1 genomes in acutely infected humans based on single genome amplification and sequencing. Here we tested this approach in 18 acutely infected Indian rhesus macaques to determine the molecular features of SIV transmission. Animals were inoculated intrarectally (IR) or intravenously (IV) with stocks of SIVmac251 or SIVsmE660 that exhibited sequence diversity typical of early-chronic HIV -1 infection. 987 full-length SIV env sequences (median of 48 per animal) were determined from plasma virion RNA one to five weeks after infection. IR inoculation was followed by productive infection by one or few viruses (median 1; range 1-5) that diversified randomly with near star-like phylogeny and a Poisson distribution of mutations. Consensus viral sequences from ramp-up and peak viremia were identical to viruses found in the inocula or differed from them by only one or few nuc1eotides, providing direct evidence that early plasma viral sequences coalesce to transmitted/founder virus( es). IV infection was approximately 10,000-fold more efficient than IR infection, and viruses transmitted by either route represented the full genetic spectra of the inocula. These findings identify key similarities in mucosal transmission and early diversification between SIV and HIV -1.

  20. Low-dose rectal inoculation of rhesus macaques by SIVsmE660 or SIVmac251 recapitulates human mucosal infection by HIV-1. (United States)

    Keele, Brandon F; Li, Hui; Learn, Gerald H; Hraber, Peter; Giorgi, Elena E; Grayson, Truman; Sun, Chuanxi; Chen, Yalu; Yeh, Wendy W; Letvin, Norman L; Mascola, John R; Nabel, Gary J; Haynes, Barton F; Bhattacharya, Tanmoy; Perelson, Alan S; Korber, Bette T; Hahn, Beatrice H; Shaw, George M


    We recently developed a novel strategy to identify transmitted HIV-1 genomes in acutely infected humans using single-genome amplification and a model of random virus evolution. Here, we used this approach to determine the molecular features of simian immunodeficiency virus (SIV) transmission in 18 experimentally infected Indian rhesus macaques. Animals were inoculated intrarectally (i.r.) or intravenously (i.v.) with stocks of SIVmac251 or SIVsmE660 that exhibited sequence diversity typical of early-chronic HIV-1 infection. 987 full-length SIV env sequences (median of 48 per animal) were determined from plasma virion RNA 1-5 wk after infection. i.r. inoculation was followed by productive infection by one or a few viruses (median 1; range 1-5) that diversified randomly with near starlike phylogeny and a Poisson distribution of mutations. Consensus viral sequences from ramp-up and peak viremia were identical to viruses found in the inocula or differed from them by only one or a few nucleotides, providing direct evidence that early plasma viral sequences coalesce to transmitted/founder viruses. i.v. infection was >2,000-fold more efficient than i.r. infection, and viruses transmitted by either route represented the full genetic spectra of the inocula. These findings identify key similarities in mucosal transmission and early diversification between SIV and HIV-1, and thus validate the SIV-macaque mucosal infection model for HIV-1 vaccine and microbicide research.

  1. Comment on “Iron isotope fractionation during planetary differentiation” by S. Weyer et al., Earth Planet. Sci. Lett. V240, pages 251 264 (United States)

    Beard, Brian L.; Johnson, Clark M.


    A review of published Fe isotope compositions measured for mantle xenoliths and massif-type peridotites demonstrates that the Fe isotope composition of the "mantle" is highly heterogeneous as compared to the narrow Fe isotope range measured for basaltic rocks. The greatest isotopic heterogeneity exists for samples derived from the lithospheric mantle, whereas basalts largely record the isotopic compositions of the asthenospheric mantle. These published Fe isotope data show that the variability measured in mantle samples is too large to be used to accurately determine a planetary Fe isotope composition, and, contrary to the assertions of Weyer et al. [S. Weyer, A. Anbar, G. Brey, C. Münker, K. Mezger, A. Woodland, Iron isotope fractionation during planetary differentiation. Earth Planet. Sci. Lett. 240 (2005) 251-264], there is no evidence that the bulk terrestrial mantle has a different Fe isotope composition relative to terrestrial basaltic magmas. We contend that similar rock types must be compared (i.e., basalt-basalt) when considering possible inter-planetary Fe isotope differences.

  2. Synthesis, spectral analysis and anti-bacterial study of N-substituted derivatives of 2-(5-(1-(phenylsulfonylpiperidin-4-yl-1,3,4-oxadiazol-2-ylthioacetamide

    Directory of Open Access Journals (Sweden)

    Hira Khalid


    Full Text Available 1,3,4-Oxadiazole bearing compounds are one of the most attractive class for researchers due to their biological activities. In the undertaken research, a number of N-substituted derivatives of 2-(5-(1-(phenylsulfonylpiperidin-4-yl-1,3,4-oxadiazol-2-ylthioacetamide (6a–n were synthesized through a series of steps. The reaction of benzenesulfonyl chloride with ethyl isonipecotate yielded ethyl 1-(phenylsulfonylpiperidin-4-carboxylate (1, which was further converted into 1-(phenylsulfonylpiperidin-4-carbohydrazide (2 and 5-(1-(phenylsulfonylpiperidin-4-yl-1,3,4-oxadiazol-2-thiol (3 respectively. The target compounds 6a–n were synthesized by the reaction of compound 3 with different N-aralkyl/aryl substituted 2-bromoacetamides (5a–n in the presence of a weak base and polar aprotic solvent. The structures of the synthesized compounds were elucidated through 1H-NMR, IR and mass spectral data. The synthesized compounds were screened against Gram-negative and Gram-positive bacteria and exhibited moderate to talented activity.

  3. Gitonga 243-251.pmd

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    vermiculite and glass beads) (SMM). Support matrices (cotton wool, glass beads and vermiculite) were considered as low cost materials (Table 1D). Different sources of water, namely tap, rain and distilled, were used to prepare the media for shoot multiplication. For rooting, MS basal salts was supplemented with 3% sugar ...

  4. Variants located upstream of CHRNB4 on chromosome 15q25.1 are associated with age at onset of daily smoking and habitual smoking.

    Directory of Open Access Journals (Sweden)

    Manav Kapoor

    Full Text Available Several genome-wide association and candidate gene studies have linked chromosome 15q24-q25.1 (a region including the CHRNA5-CHRNA3-CHRNB4 gene cluster with alcohol dependence, nicotine dependence and smoking-related illnesses such as lung cancer and chronic obstructive pulmonary disease. To further examine the impact of these genes on the development of substance use disorders, we tested whether variants within and flanking the CHRNA5-CHRNA3-CHRNB4 gene cluster affect the transition to daily smoking (individuals who smoked cigarettes 4 or more days per week in a cross sectional sample of adolescents and young adults from the COGA (Collaborative Study of the Genetics of Alcoholism families. Subjects were recruited from families affected with alcoholism (either as a first or second degree relative and the comparison families. Participants completed the SSAGA interview, a comprehensive assessment of alcohol and other substance use and related behaviors. Using the Quantitative trait disequilibrium test (QTDT significant association was detected between age at onset of daily smoking and variants located upstream of CHRNB4. Multivariate analysis using a Cox proportional hazards model further revealed that these variants significantly predict the age at onset of habitual smoking among daily smokers. These variants were not in high linkage disequilibrium (0.28

  5. Convergent synthesis of new N -substituted 2-{[5-(1H -indol-3-ylmethyl-1,3,4-oxadiazol-2-yl]sulfanyl}acetamides as suitable therapeutic agents

    Directory of Open Access Journals (Sweden)

    Kaniz Rubab


    Full Text Available abstract A series of N-substituted 2-{[5-(1H-indol-3-ylmethyl-1,3,4-oxadiazol-2-yl]sulfanyl}acetamides (8a-w was synthesized in three steps. The first step involved the sequential conversion of 2-(1H-indol-3-ylacetic acid (1 to ester (2 followed by hydrazide (3 formation and finally cyclization in the presence of CS2 and alcoholic KOH yielded 5-(1H-indole-3-yl-methyl-1,3,4-oxadiazole-2-thiol (4. In the second step, aryl/aralkyl amines (5a-w were reacted with 2-bromoacetyl bromide (6 in basic medium to yield 2-bromo-N-substituted acetamides (7a-w. In the third step, these electrophiles (7a-w were reacted with 4 to afford the target compounds (8a-w. Structural elucidation of all the synthesized derivatives was done by 1H-NMR, IR and EI-MS spectral techniques. Moreover, they were screened for antibacterial and hemolytic activity. Enzyme inhibition activity was well supported by molecular docking results, for example, compound 8q exhibited better inhibitory potential against α-glucosidase, while 8g and 8b exhibited comparatively better inhibition against butyrylcholinesterase and lipoxygenase, respectively. Similarly, compounds 8b and 8c showed very good antibacterial activity against Salmonella typhi, which was very close to that of ciprofloxacin, a standard antibiotic used in this study. 8c and 8l also showed very good antibacterial activity against Staphylococcus aureus as well. Almost all compounds showed very slight hemolytic activity, where 8p exhibited the least. Therefore, the molecules synthesized may have utility as suitable therapeutic agents.

  6. Response of a simian immunodeficiency virus (SIVmac251 to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy

    Directory of Open Access Journals (Sweden)

    Greenhouse Jack


    Full Text Available Abstract Background In this study we successfully created a new approach to ART in SIVmac251 infected nonhuman primates. This drug regimen is entirely based on drugs affecting the pre-integration stages of replication and consists of only two nucleotidic/nucleosidic reverse transcriptase inhibitors (Nt/NRTIs and raltegravir, a promising new drug belonging to the integrase strand transfer inhibitor (INSTI class. Results In acutely infected human lymphoid CD4+ T-cell lines MT-4 and CEMx174, SIVmac251 replication was efficiently inhibited by raltegravir, which showed an EC90 in the low nanomolar range. This result was confirmed in primary macaque PBMCs and enriched CD4+ T cell fractions. In vivo monotherapy with raltegravir for only ten days resulted in reproducible decreases in viral load in two different groups of animals. When emtricitabine (FTC and tenofovir (PMPA were added to treatment, undetectable viral load was reached in two weeks, and a parallel increase in CD4 counts was observed. In contrast, the levels of proviral DNA did not change significantly during the treatment period, thus showing persistence of this lentiviral reservoir during therapy. Conclusions In line with the high conservation of the three main amino acids Y143, Q148 and N155 (responsible for raltegravir binding and molecular docking simulations showing similar binding modes of raltegravir at the SIVmac251 and HIV-1 IN active sites, raltegravir is capable of inhibiting SIVmac251 replication both in tissue culture and in vivo. This finding may help to develop effective ART regimens for the simian AIDS model entirely based on drugs adopted for treatment in humans. This ART-treated AIDS nonhuman primate model could be employed to find possible strategies for virus eradication from the body.

  7. Glucocorticoid Treatment at Moderate Doses of SIVmac251-Infected Rhesus Macaques Decreases the Frequency of Circulating CD14+CD16++ Monocytes But Does Not Alter the Tissue Virus Reservoir (United States)

    Moniuszko, Marcin; Liyanage, Namal P.M.; Doster, Melvin N.; Parks, Robyn Washington; Grubczak, Kamil; Lipinska, Danuta; McKinnon, Katherine; Brown, Charles; Hirsch, Vanessa; Vaccari, Monica; Gordon, Shari; Pegu, Poonam; Fenizia, Claudio; Flisiak, Robert; Grzeszczuk, Anna; Dabrowska, Milena; Robert-Guroff, Marjorie; Silvestri, Guido; Stevenson, Mario; McCune, Joseph


    Abstract Subsets of CD16-positive monocytes produce proinflammatory cytokines and expand during chronic infection with the human immunodeficiency virus type 1 (HIV). HIV-infected macrophage in tissues may be long lived and contribute to the establishment and maintenance of the HIV reservoir. We found that the (intermediate) CD14++CD16+ and (nonclassical) CD14+CD16++ monocyte subsets are significantly expanded during infection of Rhesus macaques with pathogenic SIVmac251 but not during infection of sooty mangabeys with the nonpathogenic isolate SIVSM. In vitro glucocorticoid (GC) treatment of peripheral blood mononuclear cells (PBMCs) from uninfected or SIVmac251-infected Rhesus macaques and HIV-infected patients treated or not with antiretroviral therapy (ART) resulted in a significant decrease in the frequency of both CD16-positive monocyte subsets. Short-term in vivo treatment with high doses of GC of chronically SIVmac251-infected macaques resulted in a significant decrease in the CD14+CD16++ population and, to a lesser extent, in the CD14++CD16+ monocytes, as well as a significant decrease in the number of macrophages in tissues. Surprisingly, treatment of SIVmac251-infected macaques with ART significantly increased the CD14++CD16+ population and the addition of GC resulted in a significant decrease in only the CD14+CD16++ subset. No difference in SIV DNA levels in blood, lymph nodes, gut, and spleen was found between the groups treated with ART or ART plus GC. Thus, it appears that high doses of GC treatment in the absence of ART could affect both CD16-positive populations in vivo. Whether the efficacy of this treatment at higher doses to decrease virus levels outweighs its risks remains to be determined. PMID:24432835

  8. A Pilot Study into the Effects of the CB1 Cannabinoid Receptor Agonist WIN55,212-2 or the Antagonist/Inverse Agonist AM251 on Sleep in Rats

    Directory of Open Access Journals (Sweden)

    Anushka V. Goonawardena


    Full Text Available The plant cannabinoid Δ9-tetrahydrocannabinol and the endocannabinoid anandamide increase the amount of sleep via a CB1 receptor mediated mechanism. Here, we explored the use of a novel electroencephalogram (EEG recording device based on wireless EEG microchip technology (Neurologger in freely-moving rats, and its utility in experiments of cannabinoids-induced alterations of EEG/vigilance stages. EEG was recorded through epidural electrodes placed above pre-frontal and parietal cortex (overlaying the dorsal hippocampus. As cannabinoids, we acutely administered the full synthetic CB1 receptor agonist, WIN55,212-2 (1 mg/kg, and the antagonist/inverse agonist, AM251 (2 mg/kg, either alone or together through the intraperitoneal route. WIN55,212-2 increased the total amount of NREM sleep and the length of each NREM bout, but this was unlikely due to CB1 receptor activation since it was not prevented by AM251. However, WIN55,212-2 also lowered overall EEG spectral power especially in theta and alpha frequency bands during wakefulness and NREM sleep, and this effect was reversed by AM251. The antagonist/inverse agonist caused no sleep alterations by itself and moderately increased spectral power in Theta, alpha and beta frequency bands during NREM sleep when administered on its own. Implications of endocannabinoid modulation of the sleep-wake cycle and its possible interactions with other transmitter systems are considered.

  9. Automated absolute activation analysis with californium-252 sources

    Energy Technology Data Exchange (ETDEWEB)

    MacMurdo, K.W.; Bowman, W.W.


    A 100-mg /sup 252/Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from /sup 17/O. Detection sensitivities of < or = 400 ppB for natural uranium and 8 ppB (< or = 0.5 (nCi/g)) for /sup 239/Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level.

  10. Metastable charge-transfer state of californium(iii) compounds. (United States)

    Liu, Guokui; Cary, Samantha K; Albrecht-Schmitt, Thomas E


    Among a series of anomalous physical and chemical properties of Cf(iii) compounds revealed by recent investigations, the present work addresses the characteristics of the optical spectra of An(HDPA)3·H2O (An = Am, Cm, and Cf), especially the broadband photoluminescence from Cf(HDPA)3·H2O induced by ligand-to-metal charge transfer (CT). As a result of strong ion-ligand interactions and the relative ease of reducing Cf(iii) to Cf(ii), a CT transition occurs at low energy (transfer state undergoes radiative and non-radiative relaxations. Broadening of the CT transition arises from strong vibronic coupling and hole-charge interactions in the valence band. The non-radiative relaxation of the metastable CT state results from a competition between phonon-relaxation and thermal tunneling that populates the excited states of Cf(iii).

  11. Assessment of the toll-like receptor 4 Asp299Gly, Thr399Ile and interleukin-8 -251 polymorphisms in the risk for the development of distal gastric cancer

    Directory of Open Access Journals (Sweden)

    Maldonado-Garza Hector J


    Full Text Available Abstract Background The intensity of the inflammation induced by Helicobacter pylori colonization is associated with the development of distal gastric cancer (GC. The host response to H. pylori has been related to genetic polymorphisms that influence both innate and adaptive immune responses. Our aim was to investigate whether the presence of the TLR4 Asp299Gly, TLR4 Thr399Ile and IL-8-251 A/T polymorphisms had any influence in the development of distal GC in a Mexican population. Methods We studied 337 patients that were divided in two groups: 78 patients with histologically confirmed distal GC and 259 non-cancer controls. The presence of H. pylori in the control population was defined by positive results of at least two of four diagnostic tests: serology, histology, rapid urease test and culture. Human DNA was purified and genotyped for TLR4 Asp299Gly polymorphism by pyrosequencing, for TLR4 Thr399Ile by PCR-RFLP and for IL8-251 by the amplification refractory mutation system (ARMS-PCR. Results The non-cancer control group was found to be in Hardy-Weinberg equilibrium at the polymorphic loci studied (chi-square H-W = 0.58 for IL8-251, 0.42 for TLR4 Asp299Gly and 0.17 for TLR4 Thr399Ile. The frequencies of mutated alleles (homozygous plus heterozygous were compared between cases and controls. We found no significant difference for TLR4- Asp299Gly [the 7.7% of distal GC patients and 7.7 % non-cancer controls (p = 0.82] and for TLR4 Thr399Ile [the 1.3% of GC patients and the 5% of the control population (p = 0.2]. In contrast, for IL-8-251 A/T, 80.77% of the GC patients and 66.4% in the control group age and gender matched had at least one copy of mutated allele (OR = 2.12, 95% CI = 1.1–4.2 (p = 0.023. Conclusion This study showed that the IL8-251*A allele could be related to the development of distal gastric cancer in this Mexican population.

  12. ESR1 is co-expressed with closely adjacent uncharacterised genes spanning a breast cancer susceptibility locus at 6q25.1.

    Directory of Open Access Journals (Sweden)

    Anita K Dunbier


    Full Text Available Approximately 80% of human breast carcinomas present as oestrogen receptor α-positive (ER+ve disease, and ER status is a critical factor in treatment decision-making. Recently, single nucleotide polymorphisms (SNPs in the region immediately upstream of the ER gene (ESR1 on 6q25.1 have been associated with breast cancer risk. Our investigation of factors associated with the level of expression of ESR1 in ER+ve tumours has revealed unexpected associations between genes in this region and ESR1 expression that are important to consider in studies of the genetic causes of breast cancer risk. RNA from tumour biopsies taken from 104 postmenopausal women before and after 2 weeks treatment with an aromatase (oestrogen synthase inhibitor was analyzed on Illumina 48K microarrays. Multiple-testing corrected Spearman correlation revealed that three previously uncharacterized open reading frames (ORFs located immediately upstream of ESR1, C6ORF96, C6ORF97, and C6ORF211 were highly correlated with ESR1 (Rs =  0.67, 0.64, and 0.55 respectively, FDR<1 × 10(-7. Publicly available datasets confirmed this relationship in other groups of ER+ve tumours. DNA copy number changes did not account for the correlations. The correlations were maintained in cultured cells. An ERα antagonist did not affect the ORFs' expression or their correlation with ESR1, suggesting their transcriptional co-activation is not directly mediated by ERα. siRNA inhibition of C6ORF211 suppressed proliferation in MCF7 cells, and C6ORF211 positively correlated with a proliferation metagene in tumours. In contrast, C6ORF97 expression correlated negatively with the metagene and predicted for improved disease-free survival in a tamoxifen-treated published dataset, independently of ESR1. Our observations suggest that some of the biological effects previously attributed to ER could be mediated and/or modified by these co-expressed genes. The co-expression and function of these genes may be

  13. Mucosal B Cells Are Associated with Delayed SIV Acquisition in Vaccinated Female but Not Male Rhesus Macaques Following SIVmac251 Rectal Challenge.

    Directory of Open Access Journals (Sweden)

    Iskra Tuero


    Full Text Available Many viral infections, including HIV, exhibit sex-based pathogenic differences. However, few studies have examined vaccine-related sex differences. We compared immunogenicity and protective efficacy of monomeric SIV gp120 with oligomeric SIV gp140 in a pre-clinical rhesus macaque study and explored a subsequent sex bias in vaccine outcome. Each immunization group (16 females, 8 males was primed twice mucosally with replication-competent Ad-recombinants encoding SIVsmH4env/rev, SIV239gag and SIV239nefΔ1-13 and boosted twice intramuscularly with SIVmac239 monomeric gp120 or oligomeric gp140 in MF59 adjuvant. Controls (7 females, 5 males received empty Ad and MF59. Up to 9 weekly intrarectal challenges with low-dose SIVmac251 were administered until macaques became infected. We assessed vaccine-induced binding, neutralizing, and non-neutralizing antibodies, Env-specific memory B cells and plasmablasts/plasma cells (PB/PC in bone marrow and rectal tissue, mucosal Env-specific antibodies, and Env-specific T-cells. Post-challenge, only one macaque (gp140-immunized remained uninfected. However, SIV acquisition was significantly delayed in vaccinated females but not males, correlated with Env-specific IgA in rectal secretions, rectal Env-specific memory B cells, and PC in rectal tissue. These results extend previous correlations of mucosal antibodies and memory B cells with protective efficacy. The gp140 regimen was more immunogenic, stimulating elevated gp140 and cyclic V2 binding antibodies, ADCC and ADCP activities, bone marrow Env-specific PB/PC, and rectal gp140-specific IgG. However, immunization with gp120, the form of envelope immunogen used in RV144, the only vaccine trial to show some efficacy, provided more significant acquisition delay. Further over 40 weeks of follow-up, no gp120 immunized macaques met euthanasia criteria in contrast to 7 gp140-immunized and 2 control animals. Although males had higher binding antibodies than females, ADCC

  14. Multiple Independent Loci at Chromosome 15q25.1 Affect Smoking Quantity: a Meta-Analysis and Comparison with Lung Cancer and COPD (United States)

    Saccone, Nancy L.; Culverhouse, Robert C.; Schwantes-An, Tae-Hwi; Cannon, Dale S.; Chen, Xiangning; Cichon, Sven; Giegling, Ina; Han, Shizhong; Han, Younghun; Keskitalo-Vuokko, Kaisu; Kong, Xiangyang; Landi, Maria Teresa; Ma, Jennie Z.; Short, Susan E.; Stephens, Sarah H.; Stevens, Victoria L.; Sun, Lingwei; Wang, Yufei; Wenzlaff, Angela S.; Aggen, Steven H.; Breslau, Naomi; Broderick, Peter; Chatterjee, Nilanjan; Chen, Jingchun; Heath, Andrew C.; Heliövaara, Markku; Hoft, Nicole R.; Hunter, David J.; Jensen, Majken K.; Martin, Nicholas G.; Montgomery, Grant W.; Niu, Tianhua; Payne, Thomas J.; Peltonen, Leena; Pergadia, Michele L.; Rice, John P.; Sherva, Richard; Spitz, Margaret R.; Sun, Juzhong; Wang, Jen C.; Weiss, Robert B.; Wheeler, William; Witt, Stephanie H.; Yang, Bao-Zhu; Caporaso, Neil E.; Ehringer, Marissa A.; Eisen, Tim; Gapstur, Susan M.; Gelernter, Joel; Houlston, Richard; Kaprio, Jaakko; Kendler, Kenneth S.; Kraft, Peter; Leppert, Mark F.; Li, Ming D.; Madden, Pamela A. F.; Nöthen, Markus M.; Pillai, Sreekumar; Rietschel, Marcella; Rujescu, Dan; Schwartz, Ann; Amos, Christopher I.; Bierut, Laura J.


    Recently, genetic association findings for nicotine dependence, smoking behavior, and smoking-related diseases converged to implicate the chromosome 15q25.1 region, which includes the CHRNA5-CHRNA3-CHRNB4 cholinergic nicotinic receptor subunit genes. In particular, association with the nonsynonymous CHRNA5 SNP rs16969968 and correlates has been replicated in several independent studies. Extensive genotyping of this region has suggested additional statistically distinct signals for nicotine dependence, tagged by rs578776 and rs588765. One goal of the Consortium for the Genetic Analysis of Smoking Phenotypes (CGASP) is to elucidate the associations among these markers and dichotomous smoking quantity (heavy versus light smoking), lung cancer, and chronic obstructive pulmonary disease (COPD). We performed a meta-analysis across 34 datasets of European-ancestry subjects, including 38,617 smokers who were assessed for cigarettes-per-day, 7,700 lung cancer cases and 5,914 lung-cancer-free controls (all smokers), and 2,614 COPD cases and 3,568 COPD-free controls (all smokers). We demonstrate statistically independent associations of rs16969968 and rs588765 with smoking (mutually adjusted p-values<10−35 and <10−8 respectively). Because the risk alleles at these loci are negatively correlated, their association with smoking is stronger in the joint model than when each SNP is analyzed alone. Rs578776 also demonstrates association with smoking after adjustment for rs16969968 (p<10−6). In models adjusting for cigarettes-per-day, we confirm the association between rs16969968 and lung cancer (p<10−20) and observe a nominally significant association with COPD (p = 0.01); the other loci are not significantly associated with either lung cancer or COPD after adjusting for rs16969968. This study provides strong evidence that multiple statistically distinct loci in this region affect smoking behavior. This study is also the first report of association between rs588765

  15. Multiple independent loci at chromosome 15q25.1 affect smoking quantity: a meta-analysis and comparison with lung cancer and COPD.

    Directory of Open Access Journals (Sweden)

    Nancy L Saccone


    Full Text Available Recently, genetic association findings for nicotine dependence, smoking behavior, and smoking-related diseases converged to implicate the chromosome 15q25.1 region, which includes the CHRNA5-CHRNA3-CHRNB4 cholinergic nicotinic receptor subunit genes. In particular, association with the nonsynonymous CHRNA5 SNP rs16969968 and correlates has been replicated in several independent studies. Extensive genotyping of this region has suggested additional statistically distinct signals for nicotine dependence, tagged by rs578776 and rs588765. One goal of the Consortium for the Genetic Analysis of Smoking Phenotypes (CGASP is to elucidate the associations among these markers and dichotomous smoking quantity (heavy versus light smoking, lung cancer, and chronic obstructive pulmonary disease (COPD. We performed a meta-analysis across 34 datasets of European-ancestry subjects, including 38,617 smokers who were assessed for cigarettes-per-day, 7,700 lung cancer cases and 5,914 lung-cancer-free controls (all smokers, and 2,614 COPD cases and 3,568 COPD-free controls (all smokers. We demonstrate statistically independent associations of rs16969968 and rs588765 with smoking (mutually adjusted p-values<10(-35 and <10(-8 respectively. Because the risk alleles at these loci are negatively correlated, their association with smoking is stronger in the joint model than when each SNP is analyzed alone. Rs578776 also demonstrates association with smoking after adjustment for rs16969968 (p<10(-6. In models adjusting for cigarettes-per-day, we confirm the association between rs16969968 and lung cancer (p<10(-20 and observe a nominally significant association with COPD (p = 0.01; the other loci are not significantly associated with either lung cancer or COPD after adjusting for rs16969968. This study provides strong evidence that multiple statistically distinct loci in this region affect smoking behavior. This study is also the first report of association between rs588765

  16. Multiple independent loci at chromosome 15q25.1 affect smoking quantity: a meta-analysis and comparison with lung cancer and COPD. (United States)

    Saccone, Nancy L; Culverhouse, Robert C; Schwantes-An, Tae-Hwi; Cannon, Dale S; Chen, Xiangning; Cichon, Sven; Giegling, Ina; Han, Shizhong; Han, Younghun; Keskitalo-Vuokko, Kaisu; Kong, Xiangyang; Landi, Maria Teresa; Ma, Jennie Z; Short, Susan E; Stephens, Sarah H; Stevens, Victoria L; Sun, Lingwei; Wang, Yufei; Wenzlaff, Angela S; Aggen, Steven H; Breslau, Naomi; Broderick, Peter; Chatterjee, Nilanjan; Chen, Jingchun; Heath, Andrew C; Heliövaara, Markku; Hoft, Nicole R; Hunter, David J; Jensen, Majken K; Martin, Nicholas G; Montgomery, Grant W; Niu, Tianhua; Payne, Thomas J; Peltonen, Leena; Pergadia, Michele L; Rice, John P; Sherva, Richard; Spitz, Margaret R; Sun, Juzhong; Wang, Jen C; Weiss, Robert B; Wheeler, William; Witt, Stephanie H; Yang, Bao-Zhu; Caporaso, Neil E; Ehringer, Marissa A; Eisen, Tim; Gapstur, Susan M; Gelernter, Joel; Houlston, Richard; Kaprio, Jaakko; Kendler, Kenneth S; Kraft, Peter; Leppert, Mark F; Li, Ming D; Madden, Pamela A F; Nöthen, Markus M; Pillai, Sreekumar; Rietschel, Marcella; Rujescu, Dan; Schwartz, Ann; Amos, Christopher I; Bierut, Laura J


    Recently, genetic association findings for nicotine dependence, smoking behavior, and smoking-related diseases converged to implicate the chromosome 15q25.1 region, which includes the CHRNA5-CHRNA3-CHRNB4 cholinergic nicotinic receptor subunit genes. In particular, association with the nonsynonymous CHRNA5 SNP rs16969968 and correlates has been replicated in several independent studies. Extensive genotyping of this region has suggested additional statistically distinct signals for nicotine dependence, tagged by rs578776 and rs588765. One goal of the Consortium for the Genetic Analysis of Smoking Phenotypes (CGASP) is to elucidate the associations among these markers and dichotomous smoking quantity (heavy versus light smoking), lung cancer, and chronic obstructive pulmonary disease (COPD). We performed a meta-analysis across 34 datasets of European-ancestry subjects, including 38,617 smokers who were assessed for cigarettes-per-day, 7,700 lung cancer cases and 5,914 lung-cancer-free controls (all smokers), and 2,614 COPD cases and 3,568 COPD-free controls (all smokers). We demonstrate statistically independent associations of rs16969968 and rs588765 with smoking (mutually adjusted p-values<10(-35) and <10(-8) respectively). Because the risk alleles at these loci are negatively correlated, their association with smoking is stronger in the joint model than when each SNP is analyzed alone. Rs578776 also demonstrates association with smoking after adjustment for rs16969968 (p<10(-6)). In models adjusting for cigarettes-per-day, we confirm the association between rs16969968 and lung cancer (p<10(-20)) and observe a nominally significant association with COPD (p = 0.01); the other loci are not significantly associated with either lung cancer or COPD after adjusting for rs16969968. This study provides strong evidence that multiple statistically distinct loci in this region affect smoking behavior. This study is also the first report of association between rs588765 (and

  17. Combination of Helicobacter pylori infection and the interleukin 8 -251 T > A polymorphism, but not the mannose-binding lectin 2 codon 54 G > A polymorphism, might be a risk factor of gastric cancer. (United States)

    Chang, Young Woon; Oh, Chi Hyuk; Kim, Jung-Wook; Lee, Jae Won; Park, Mi Ju; Shim, Jae-Jun; Lee, Chang Kyun; Jang, Jae-Young; Dong, Seok Ho; Kim, Hyo Jong; Kim, Sung Soo; Kim, Byung-Ho


    Mannose-binding lectin (MBL) acts in the innate immune response to Helicobacter pylori. Interleukin 8 (IL-8) is a potent cytokine produced by gastric epithelial cells in response to H. pylori. We aimed to investigate whether polymorphisms in MBL2 and IL-8 influence susceptibility to H. pylori infection, and the associations of these polymorphisms with the risk of gastroduodenal diseases in a Korean population. We consecutively enrolled 176 H. pylori-negative control subjects, 221 subjects with H. pylori-positive non-atrophic gastritis, 52 mild atrophic gastritis (AG), 61 severe AG, 175 duodenal ulcer, and 283 gastric cancer (GC). Allele-specific PCR-RFLP was conducted for polymorphisms in MBL2 exon 1 (codon 52, 54, and 57) and IL-8 -251 T > A. IL-8 levels in gastric mucosal tissues and serum MBL levels were measured by enzyme-linked immunosorbent assay. MBL2 exon 1 polymorphic variants were found only in codon 54, and the allele frequencies did not differ significantly between the control and disease groups. Although serum MBL levels in codon 54 A/A mutants were markedly low, it did not influence susceptibility to H. pylori infection or the risk of gastroduodenal diseases. IL-8 levels were significantly different between T/T wild type, T/A heterozygote, and A/A mutant genotypes. IL-8 -251 A allele carriers (A/A + T/A) showed increased IL-8 levels, and were significantly associated with the risk of severe AG and GC. We suggest that a combination of H. pylori infection and the IL-8 -251 T > A polymorphism might increase the risk of severe AG and GC in a Korean population.

  18. NEMO is essential for Kaposi's sarcoma-associated herpesvirus-encoded vFLIP K13-induced gene expression and protection against death receptor-induced cell death, and its N-terminal 251 residues are sufficient for this process. (United States)

    Tolani, Bhairavi; Matta, Hittu; Gopalakrishnan, Ramakrishnan; Punj, Vasu; Chaudhary, Preet M


    Kaposi's sarcoma-associated herpesvirus-encoded viral FLICE inhibitory protein (vFLIP) K13 was originally believed to protect virally infected cells against death receptor-induced apoptosis by interfering with caspase 8/FLICE activation. Subsequent studies revealed that K13 also activates the NF-κB pathway by binding to the NEMO/inhibitor of NF-κB (IκB) kinase gamma (IKKγ) subunit of an IKK complex and uses this pathway to modulate the expression of genes involved in cellular survival, proliferation, and the inflammatory response. However, it is not clear if K13 can also induce gene expression independently of NEMO/IKKγ. The minimum region of NEMO that is sufficient for supporting K13-induced NF-κB has not been delineated. Furthermore, the contribution of NEMO and NF-κB to the protective effect of K13 against death receptor-induced apoptosis remains to be determined. In this study, we used microarray analysis on K13-expressing wild-type and NEMO-deficient cells to demonstrate that NEMO is required for modulation of K13-induced genes. Reconstitution of NEMO-null cells revealed that the N-terminal 251 amino acid residues of NEMO are sufficient for supporting K13-induced NF-κB but fail to support tumor necrosis factor alpha (TNF-α)-induced NF-κB. K13 failed to protect NEMO-null cells against TNF-α-induced cell death but protected those reconstituted with the NEMO mutant truncated to include only the N-terminal 251 amino acid residues [the NEMO(1-251) mutant]. Taken collectively, our results demonstrate that NEMO is required for modulation of K13-induced genes and the N-terminal 251 amino acids of NEMO are sufficient for supporting K13-induced NF-κB. Finally, the ability of K13 to protect against TNF-α-induced cell death is critically dependent on its ability to interact with NEMO and activate NF-κB. Kaposi's sarcoma-associated herpesvirus-encoded vFLIP K13 is believed to protect virally infected cells against death receptor-induced apoptosis and to

  19. Fine-mapping of the 5p15.33, 6p22.1-p21.31, and 15q25.1 regions identifies functional and histology-specific lung cancer susceptibility loci in African-Americans. (United States)

    Walsh, Kyle M; Gorlov, Ivan P; Hansen, Helen M; Wu, Xifeng; Spitz, Margaret R; Zhang, Huifeng; Lu, Emily Y; Wenzlaff, Angela S; Sison, Jennette D; Wei, Chongjuan; Lloyd, Stacy M; Chen, Wei; Frazier, Marsha L; Seldin, Michael F; Bierut, Laura J; Bracci, Paige M; Wrensch, Margaret R; Schwartz, Ann G; Wiencke, John K; Amos, Christopher I


    Genome-wide association studies of European and East Asian populations have identified lung cancer susceptibility loci on chromosomes 5p15.33, 6p22.1-p21.31, and 15q25.1. We investigated whether these regions contain lung cancer susceptibly loci in African-Americans and refined previous association signals by using the reduced linkage disequilibrium observed in African-Americans. 1,308 African-American cases and 1,241 African-American controls from 3 centers were genotyped for 760 single-nucleotide polymorphisms (SNP) spanning 3 regions, and additional SNP imputation was carried out. Associations between polymorphisms and lung cancer risk were estimated using logistic regression, stratified by tumor histology where appropriate. The strongest associations were observed on 15q25.1 in/near CHRNA5, including a missense substitution [rs16969968: OR, 1.57; 95% confidence interval (CI), 1.25-1.97; P, 1.1 × 10(-4)) and variants in the 5'-UTR. Associations on 6p22.1-p21.31 were histology specific and included a missense variant in BAT2 associated with squamous cell carcinoma (rs2736158: OR, 0.64; 95% CI, 0.48-0.85; P, 1.82 × 10(-3)). Associations on 5p15.33 were detected near TERT, the strongest of which was rs2735940 (OR, 0.82; 95% CI, 0.73-0.93; P, 1.1 × 10(-3)). This association was stronger among cases with adenocarcinoma (OR, 0.75; 95% CI, 0.65-0.86; P, 8.1 × 10(-5)). Polymorphisms in 5p15.33, 6p22.1-p21.31, and 15q25.1 are associated with lung cancer in African-Americans. Variants on 5p15.33 are stronger risk factors for adenocarcinoma and variants on 6p21.33 associated only with squamous cell carcinoma. Results implicate the BAT2, TERT, and CHRNA5 genes in the pathogenesis of specific lung cancer histologies.

  20. β-asarone inhibited cell growth and promoted autophagy via P53/Bcl-2/Bclin-1 and P53/AMPK/mTOR pathways in Human Glioma U251 cells. (United States)

    Wang, Nanbu; Zhang, Qinxin; Luo, Laiyu; Ning, Baile; Fang, Yongqi


    Glioma is the most common type of primary brain tumor and has an undesirable prognosis. Autophagy plays an important role in cancer therapy, but it is effect is still not definite. P53 is an important tumor suppressor gene and protein that is closely to autophagy. Our aim was to study the effect of β-asarone on inhibiting cell proliferation in human glioma U251 cells and to detect the effect of the inhibition on autophagy through the P53 signal pathway. For cell growth, the cells were divided into four groups: the model, β-asarone, temozolomide (TMZ), and co-administration groups. For cell autoghapy and the P53 pathway, the cells were divided into six groups: the model, β-asarone, 3MA, Rapa, Pifithrin-µ, and NSC groups. The counting Kit-8 assay and flow cytometry (FCM) were then used to measure the cell proliferation and cycle. Electron microscopy was used to observe autophagosome formation. Cell immunohistochemistry/-immunofluorescence, FCM and Western blot (WB) were used to examine the expression of Beclin-1 and P53. The levels of P53 and GAPDH mRNA were detected by RT-PCR. Using WB, we determined autophagy-related proteins Beclin-1, LC3-II/I, and P62 and those of the P53 pathway-related proteins P53, Bcl-2, mTOR, P-mTOR, AMPK, P-AMPK, and GAPDH. We got the results that β-asarone changed the cellular morphology, inhibited cell proliferation, and enhanced the expression of P53, LC3-II/I, Beclin-1, AMPK, and pAMPK while inhibiting the expression of P62, Bcl-2, mTOR, and pmTOR. All the data suggested that β-asarone could reduce the cell proliferation and promote autophagy possible via the P53 pathway in U251 cells. © 2017 Wiley Periodicals, Inc.

  1. Differences in time of virus appearance in the blood and virus-specific immune responses in intravenous and intrarectal primary SIVmac251 infection of rhesus macaques; a pilot study

    Directory of Open Access Journals (Sweden)

    Washington Parks Robyn


    Full Text Available Abstract Background HIV-I can be transmitted by intravenous inoculation of contaminated blood or blood product or sexually through mucosal surfaces. Here we performed a pilot study in the SIVmac251 macaque model to address whether the route of viral entry influences the kinetics of the appearance and the size of virus-specific immune in different tissue compartments. Methods For this purpose, of 2 genetically defined Mamu-A*01-positive macaques, 1 was exposed intravenously and the other intrarectally to the same SIVmac251 viral stock and virus-specific CD8+ T-cells were measured within the first 12 days of infection in the blood and at day 12 in several tissues following euthanasia. Results Virus-specific CD8+ T-cell responses to Gag, Env, and particularly Tat appeared earlier in the blood of the animal exposed by the mucosal route than in the animal exposed intravenously. The magnitude of these virus-specific responses was consistently higher in the systemic tissues and GALT of the macaque exposed by the intravenous route, suggesting a higher viral burden in the tissues as reflected by the faster appearance of virus in plasma. Differences in the ability of the virus-specific CD8+ T-cells to respond in vitro to specific peptide stimulation were also observed and the greatest proliferative ability was found in the GALT of the animal infected by the intrarectal route. Conclusions These data may suggest that the natural mucosal barrier may delay viral spreading. The consequences of this observation, if confirmed in studies with a larger number of animals, may have implications in vaccine development.

  2. Contributions of Mamu-A*01 status and TRIM5 allele expression, but not CCL3L copy number variation, to the control of SIVmac251 replication in Indian-origin rhesus monkeys.

    Directory of Open Access Journals (Sweden)

    So-Yon Lim


    Full Text Available CCL3 is a ligand for the HIV-1 co-receptor CCR5. There have recently been conflicting reports in the literature concerning whether CCL3-like gene (CCL3L copy number variation (CNV is associated with resistance to HIV-1 acquisition and with both viral load and disease progression following infection with HIV-1. An association has also been reported between CCL3L CNV and clinical sequelae of the simian immunodeficiency virus (SIV infection in vivo in rhesus monkeys. The present study was initiated to explore the possibility of an association of CCL3L CNV with the control of virus replication and AIDS progression in a carefully defined cohort of SIVmac251-infected, Indian-origin rhesus monkeys. Although we demonstrated extensive variation in copy number of CCL3L in this cohort of monkeys, CCL3L CNV was not significantly associated with either peak or set-point plasma SIV RNA levels in these monkeys when MHC class I allele Mamu-A*01 was included in the models or progression to AIDS in these monkeys. With 66 monkeys in the study, there was adequate power for these tests if the correlation of CCL3L and either peak or set-point plasma SIV RNA levels was 0.34 or 0.36, respectively. These findings call into question the premise that CCL3L CNV is important in HIV/SIV pathogenesis.

  3. Contributions of Mamu-A*01 status and TRIM5 allele expression, but not CCL3L copy number variation, to the control of SIVmac251 replication in Indian-origin rhesus monkeys. (United States)

    Lim, So-Yon; Chan, Tiffany; Gelman, Rebecca S; Whitney, James B; O'Brien, Kara L; Barouch, Dan H; Goldstein, David B; Haynes, Barton F; Letvin, Norman L


    CCL3 is a ligand for the HIV-1 co-receptor CCR5. There have recently been conflicting reports in the literature concerning whether CCL3-like gene (CCL3L) copy number variation (CNV) is associated with resistance to HIV-1 acquisition and with both viral load and disease progression following infection with HIV-1. An association has also been reported between CCL3L CNV and clinical sequelae of the simian immunodeficiency virus (SIV) infection in vivo in rhesus monkeys. The present study was initiated to explore the possibility of an association of CCL3L CNV with the control of virus replication and AIDS progression in a carefully defined cohort of SIVmac251-infected, Indian-origin rhesus monkeys. Although we demonstrated extensive variation in copy number of CCL3L in this cohort of monkeys, CCL3L CNV was not significantly associated with either peak or set-point plasma SIV RNA levels in these monkeys when MHC class I allele Mamu-A*01 was included in the models or progression to AIDS in these monkeys. With 66 monkeys in the study, there was adequate power for these tests if the correlation of CCL3L and either peak or set-point plasma SIV RNA levels was 0.34 or 0.36, respectively. These findings call into question the premise that CCL3L CNV is important in HIV/SIV pathogenesis.

  4. Production of {sup 256}Lr in the {sup 249,250,251}Cf + {sup 11}B, {sup 243}Am + {sup 18}O, and {sup 248}Cm + {sup 14}N reactions

    Energy Technology Data Exchange (ETDEWEB)

    Sato, N.; Sato, T.K.; Asai, M. [Japan Atomic Energy Agency, Ibaraki (Japan). Advanced Science Research Center; and others


    Production cross-sections of the isotope {sup 256}Lr in the {sup 249,250,251}Cf + {sup 11}B, {sup 243}Am + {sup 18}O, and {sup 248}Cm + {sup 14}N reactions were measured using a He/KCl gas-jet transport system and a rotating wheel a-particle detection apparatus. The α-particle energy of {sup 256}Lr was distributed from 8.3 to 8.7 MeV and its half-life, T{sub 1/2}, was measured to be 28 ± 1 s. The maximum cross sections in the {sup 249}Cf({sup 11}B, 4n){sup 256}Lr and {sup 243}Am({sup 18}O, 5n){sup 256}Lr reactions were determined to be 122 ± 36 nb at the beam energy of 63 MeV and 26 ± 7 nb at 96 MeV, respectively. In the {sup 248}Cm({sup 14}N, 6n){sup 256}Lr reaction, the cross section was measured to be 27 ± 10 nb at 91 MeV. (orig.)

  5. 36 CFR 251.58 - Cost recovery. (United States)


    ... or mitigate damage to real property, or to mitigate hazards or dangers to public health and safety resulting from an act of God, an act of war, or negligence of the United States; (iv) The application is for...

  6. Publications | Page 251 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Changes in hydrological extremes will have implications on the design of future hydraulic structures, flood plain development, and water resource management. This study assesses the potential impact of climate change on extreme hydrological events in the Akaki River catchment area in and around... Understanding the ...

  7. 37 CFR 251.13 - Closed meetings. (United States)


    ...) Interfere with enforcement proceedings; or (2) Deprive a person of the right to a fair trial or impartial... confidential source or, in the case of a criminal investigation or a national security intelligence... participation in a civil action or proceeding or in an action in a foreign court or international tribunal, or...

  8. 36 CFR 251.53 - Authorities. (United States)


    ... events and distribution of noncommercial printed materials, under the act of June 4, 1897, 30 Stat. 35... transportation and distribution of solid materials, and facilities for the storage of such materials in... U.S.C. 470aa). (n) Operation of nordic and alpine ski areas and facilities for up to 40 years and...

  9. 15 CFR 904.251 - Evidence. (United States)


    ... the agency as an expert body. Where a decision or part thereof rests on official notice of a material... relevant material or source, whether or not submitted by a party. (2) Exhibits in a foreign language must...

  10. 36 CFR 251.51 - Definitions. (United States)


    ... land. Secretary—the Secretary of Agriculture. Ski area—a site and attendant facilities expressly developed to accommodate alpine or nordic skiing and from which the preponderance of revenue is generated by the sale of lift tickets and fees for ski rentals, for skiing instruction and trail passes for the use...

  11. Publications | Page 251 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. ... Dr Peter Daszak and Dr Margot Parkes agree that the International Association for Ecology and Health (EcoHealth) stands to gain tremendously through partnering with other ...

  12. 24 CFR 203.251 - Definitions. (United States)


    ...) Debentures means registered, transferable securities in certificated or book entry form which are valid and binding obligations, issued in the name of the Mutual Mortgage Insurance Fund in accordance with the... to be used within an automated underwriting system (AUS). TOTAL is a tool to assist the mortgagee in...

  13. 251 - 258_Hajara_Mobile exhaust

    African Journals Online (AJOL)


    of stomata, pore length and pore breadth in the polluted sites was low site. Furthermore ... light and C02 concentration (Wood and Kelly, 1995). Atmospheric ... pollution. For comparison, collections were done also from a relatively clean area which is Kano state. Botanical garden located inside the Kano State. Zoological ...

  14. Reference: 251 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ing complexes mediate ATP-dependent alterations of DNA-histone contacts. The minimal functional core of cons...t, and reduced fertility. Plants carrying atswi3d mutations display severe dwarfism, alterations in the numb

  15. Publications | Page 251 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    "We need [the EcoHealth] journal to help articulate what ecohealth is and to encourage the growth of the community," said Dr Bruce Wilcox, the publication's ... Cutting down consumption of non-food items, borrowing from informal markets, and increased dependence on friends and family are common strategies perceived ...

  16. 16 CFR 251.1 - The guide. (United States)


    ... and Labeling Regulation Regarding ‘Cents-Off’ and Guides Against Deceptive Pricing.”) (b) Meaning of... the product or service in the geographic market or trade area in which he is making a “Free” or...

  17. 7 CFR 251.5 - Eligibility determinations. (United States)


    ... funds, must ensure that an organization applying for participation in the program meets the definition... predominantly needy persons. State agencies may establish a higher standard than “predominantly” and may..., however, require organizations to employ a means test to determine that recipients are needy, or to keep...

  18. 40 CFR 60.251 - Definitions. (United States)


    ... instrument that operates on triboelectric, light scattering, light transmittance, or other effect to... PERFORMANCE FOR NEW STATIONARY SOURCES Standards of Performance for Coal Preparation and Processing Plants... reference—see § 60.17), and coal refuse. (e) Coal preparation and processing plant means any facility...

  19. 30 CFR 251.1 - Definitions. (United States)


    ... occurrence means the direct or indirect detection during drilling operations of any liquid or gaseous..., geopressured-geothermal and associated resources, and all other minerals which are authorized by an Act of..., gas, and sulphur mean oil, gas, sulphur, geopressured-geothermal, and associated resources. Outer...

  20. 7 CFR 1951.251 - Purpose. (United States)


    ... need for continued Agency supervision, further credit, and graduation. All loan accounts will be... REGULATIONS (CONTINUED) SERVICING AND COLLECTIONS Analyzing Credit Needs and Graduation of Borrowers § 1951... Development Loan Funds, and Rural Rental Housing loans made to build or acquire new units pursuant to...

  1. 7 CFR 251.3 - Definitions. (United States)


    ... following categories: (i) Emergency feeding organizations (including food banks, food pantries and soup kitchens); (ii) Charitable institutions (including hospitals and retirement homes); (iii) Summer camps for... congregate Nutrition sites and projects that provide home-delivered meals; and (v) Disaster relief programs...

  2. 7 CFR 251.10 - Miscellaneous provisions. (United States)


    ..., disposal, and inventory of commodities received under this part that they, in turn, distribute to eligible... accessible at all times for use during management evaluation reviews, audits or investigations. (b... because of race, color, national origin, sex, age, or handicap. (d) Reports—(1) Submission of Form FNS-667...

  3. 42 CFR 84.251 - Required components. (United States)


    ... Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES OCCUPATIONAL SAFETY AND HEALTH... indicator; (3) Cartridge with end-of-service-life indicator; (4) Harness; (5) Attached blower; and (6) Breathing tube. (b) The components of each vinyl chloride respirator shall meet the minimum construction...

  4. 37 CFR 251.31 - Financial interests. (United States)


    ... or blind trust which might have an interest in a prohibited entity but whose decisions to invest or... own interests: (1) The arbitrator's spouse; (2) The arbitrator's minor child; (3) The arbitrator's...

  5. Serial Cervicovaginal exposures with Replication-deficient SIVsm induce higher Dendritic Cell (pDC) and CD4+ T-Cell Infiltrates not associated with prevention but a More Severe SIVmac251 Infection of Rhesus Macaques (United States)

    ABDULHAQQ, Shaheed A.; MARTINEZ, Melween I.; KANG, Guobin; FOULKES, Andrea S.; RODRIGUEZ, Idia V.; NICHOLS, Stephanie M.; HUNTER, Meredith; SARIOL, Carlos A.; RUIZ, Lynnette A.; ROSS, Brian N.; YIN, Xiangfan; SPEICHER, David W.; HAASE, Ashley T.; MARX, Preston A.; LI, Qinsheng; KRAISELBURD, Edmundo N.; MONTANER, Luis J.


    Objective Intravaginal exposure to SIV acutely recruits IFN-α producing plasmacytoid dendritic cells (pDC) and CD4+ T-lymphocyte targets to the endocervix of nonhuman primates. We tested the impact of repeated cervicovaginal exposures to noninfectious, defective SIV particles over 72 hrs on a subsequent cervicovaginal challenge with replication-competent SIV. Methods 34 Female Indian Rhesus macaques were given a three-day, twice-daily vaginal exposures to either SIVsmB7, a replication-deficient derivative of SIVsmH3 produced by a CEMX174 cell clone (n=16), or to CEM supernatant controls (n=18). On the fourth day, animals were either euthanized to assess cervicovaginal immune cell infiltration or intravaginally challenged with SIVmac251. Challenged animals were tracked for plasma viral load and CD4 counts and euthanized at 42 days post infection. Results At the time of challenge, macaques exposed to SIVsmB7, had higher levels of cervical CD123 pDCs (p=0.032) and CD4+ T-Cells (p=0.036) than those exposed to CEM control. Vaginal tissues showed a significant increase in CD4+ T-Cell infiltrates (p=0.048), and a trend towards increased CD68+ cellular infiltrates. After challenge, 12 SIVsmB7-treated macaques showed 2.5-fold greater daily rate of CD4 decline (p=0.0408), and viral load rise (p=0.0036) as compared to 12 control animals. Conclusions Repeated non-productive exposure to viral particles within a short daily timeframe did not protect against infection in spite of pDC recruitment, resulting instead in an accelerated CD4+ T-Cell loss with an increased rate of viral replication PMID:24226059

  6. H:\\PMKER 25(1)\\PDF 25(1)\\AKOUANGO.xps

    African Journals Online (AJOL)


    L'humanité est en quête de modèles d'exploitation durables des ressources naturelles. C'est dans cette optique que se développe .... dynamique en matière de gestion durable de la faune, avec l'adoption en 2008 d'une loi sur la ... en ressources naturelles et humaines qui, exploitées de bonne manière ne pourraient que.

  7. H:\\PMKER 25(1)\\PDF 25(1)\\ZOBI.xps

    African Journals Online (AJOL)


    diamètre montre que l'éclaircie sélective par dévitalisation chimique a un effet positif sur l'accroissement diamétrique des arbres d'espèces commerciales. Cette technique sylvicole profite essentiellement aux arbres de diamètre 1m. Avec une proportion d'espèces commerciales de 46,8 %, le dispositif de Mopri est.

  8. H:\\PMKER 25(1)\\PDF 25(1)\\EMANFO.xps

    African Journals Online (AJOL)


    permis de relever la présence de quatre genres de moisissure : Aspergillus, Alternaria, Penicillium et. Fusarium. Certaines espèces appartenant à ces genres sont généralement impliquées dans des mycoses chez les animaux et des maladies fongiques chez les végétaux. Ainsi, les genres Aspergillus et Fusarium sont ...

  9. H:\\PMKER 25(1)\\PDF 25(1)\\ZOBI.xps

    African Journals Online (AJOL)


    richness in managed boreal forest ; Effects of stand succession and thinning. For. Ecol. Manage. 257 (5) : 1386 - 1394. Yandell B. S. 1997. Practical data analysis for designed experiments. Chapman and Hall,. New York. 437 p. Zeide B. 1989. Accuracy of equations describing diameter growth. Canadian Journal of. Forest ...

  10. H:\\PMKER 25(1)\\PDF 25(1)\\AMOUKOU.xps

    African Journals Online (AJOL)


    Le sésame (Sesamum indicum L.) est une culture oléagineuse faisant l'objet d'un commerce international en plein essor des graines, de l'huile et du tourteau. Au Niger, un engouement des producteurs vers des cultures moins exigeantes en eau et en intrants s'est vite développé pour augmenter leur revenu et renforcer.

  11. H:\\PMKER 25(1)\\PDF 25(1)\\KIKOUN.xps

    African Journals Online (AJOL)


    CI Ferké 2 sugar factory from. 2007 to 2012. It was to cut, ... 13,30 %, juice purity decreased from 88,15 to 85,88 % when the reduces sugar content increase from. 2,21 to 3,80 %. ... la plus importante teneur en saccharose. Entre la coupe et le ...

  12. H:\\PMKER 25(1)\\PDF 25(1)\\KOTAIX.xps

    African Journals Online (AJOL)


    associées ou non à l'engrais minéral sur, la hauteur des plantes, le diamètre des tiges, le taux de floraison, les dates phénologiques ... The results showed that the treatment T10 (300 Kg ha-1 mineral fertilizer + 3.75 L ha-1 Dragon 1), better improved growth in plant ...... fertilisation : nouveau défi pour l'agriculture moderne.

  13. Neutron Protection Factor Determination and Validation for a Vehicle Surrogate Using a Californium Fission Source (United States)


    a 4 mm x 4 mm (0.157" x 0.157") LiI(Eu) crystal with 96% enrichment of lithium -6. The crystal is connected to a photomultiplier tube (PMT) which...32 Figure 17. Lithium -6 Iodide, Europium Doped Scintillation Detector. Source: [27...Alamos National Laboratory LiI(Eu) Lithium Iodide Europium Doped LLD Low Level Discriminator LLNL Lawrence Livermore National Laboratory MASH Monte

  14. 14 CFR 21.251 - Limits of applicability. (United States)


    ... operation of those aircraft for the purpose of research and development, crew training, market surveys, or... authorizations are subject to any additional limitations prescribed by the Administrator after inspection of the...

  15. 7 CFR 3550.251 - Property management and disposition. (United States)


    ... does not meet cost-effective energy conservation standards, it will disclose the reasons why. The deed... until it is decent, safe, and sanitary and meets the RHS cost-effective energy conservation standards. RHS will also notify any potential purchaser of any known lead-based paint hazards. (3) Property on...

  16. Dicty_cDB: VSK251 [Dicty_cDB

    Lifescience Database Archive (English)


  17. 17 CFR 230.251 - Scope of exemption. (United States)


    ....) immediately before the offering; (3) Is not a development stage company that either has no specific business...) Written offers under § 230.255 may be made; (C) Printed advertisements may be published or radio or... general character and location of its property. (iii) After the Form 1-A offering statement has been...

  18. 36 CFR 251.56 - Terms and conditions. (United States)


    ... Federal Communication Commission license, a Federal Energy Regulatory Commission license, a State water... this section and the relevant requirements of this subpart. (4) A holder retains the right to decline a...

  19. 37 CFR 251.38 - Billing and commitment to standards. (United States)


    ... case of an arbitrator who resides outside the Washington, DC metropolitan area, for travel, lodging... decision-writing. (e) At the time of selection, arbitrators shall sign an agreement stating that they will...

  20. 27 CFR 28.251 - Railway express receipts. (United States)


    ... an export bill of lading if the receipt furnishes all of the information required in an export bill..., DEPARTMENT OF THE TREASURY LIQUORS EXPORTATION OF ALCOHOL Shipment or Delivery for Export Bills of Lading... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Railway express receipts...

  1. Time Warp Operating System, Version 2.5.1 (United States)

    Bellenot, Steven F.; Gieselman, John S.; Hawley, Lawrence R.; Peterson, Judy; Presley, Matthew T.; Reiher, Peter L.; Springer, Paul L.; Tupman, John R.; Wedel, John J., Jr.; Wieland, Frederick P.; hide


    Time Warp Operating System, TWOS, is special purpose computer program designed to support parallel simulation of discrete events. Complete implementation of Time Warp software mechanism, which implements distributed protocol for virtual synchronization based on rollback of processes and annihilation of messages. Supports simulations and other computations in which both virtual time and dynamic load balancing used. Program utilizes underlying resources of operating system. Written in C programming language.

  2. 36 CFR 2.51 - Public assemblies, meetings. (United States)


    ... assemblies, meetings, gatherings, demonstrations, parades and other public expressions of views are allowed... equipment and facilities to be used and any other information required by the permit application form. (c... reasonable limitations on the equipment used and the time and area within which the event is allowed. (g) No...

  3. Dicty_cDB: VFG251 [Dicty_cDB

    Lifescience Database Archive (English)


  4. 29 CFR 1926.251 - Rigging equipment for material handling. (United States)


    ... webbing (nylon, polyester, and polypropylene). (1) The employer shall have each synthetic web sling marked... 6×19 0.49 0.51 0.55 0.37 0.38 0.41 0.99 1.0 1.1 5/16 6×19 0.76 0.79 0.85 0.57 0.59 0.64 1.5 1.6 1.7 3/8 6×19 1.1 1.1 1.2 0.80 0.85 0.91 2.1 2.2 2.4 7/16 6×19 1.4 1.5 1.6 1.1 1.1 1.2 2.9 3.0 3.3 1/2 6...

  5. 37 CFR 251.48 - Rules of evidence. (United States)


    ... included in appendices. For each of the following types of statistical studies the following should be... under consideration, the sampling frame and units, the validity and confidence limits on major estimates...

  6. Inhibition of paclitaxel against neuroglioma cells U251 growth and ...

    African Journals Online (AJOL)

    Background: Glioma is the most common primary tumor of the central nervous system, and accounted for about 70% of primary tumors. Materials and Methods: In the study, antitumour activity and mechanism of paclitaxel was investigated. Different concentrations of paclitaxel (200, 300, 400 μmol/L) was treated in ...

  7. 76 FR 251 - Country of Origin Labeling of Packed Honey (United States)


    ... Service 7 CFR Part 52 RIN 0581-AC89 Country of Origin Labeling of Packed Honey AGENCY: Agricultural..., establishing new regulations addressing country of origin labeling for packed honey bearing any official USDA... service for honey if country of origin labeling requirements are not met for packages of honey containing...

  8. Dicty_cDB: SSI251 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 7e-09 EF446902_1( EF446902 |pid:none) Bos taurus maternal embryonic leuc... 60 5e-08 AK222811_1( AK222811...AK222811 |pid:none) Homo sapiens mRNA for maternal emb... 60 8e-08 AK129076_1( AK129076 |pid:none) Mus musculus

  9. Dicty_cDB: CHI251 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available LVRPRGNNTFLIKGVTKAREVYKHFGRAPGLPGSHARPYVR--- ---lvfsntqwpsinpkds*erpverl*slkihtmhx*snytvs*pveptpsstrls*rd yyxlkpidhqfqsqelpi...s*erpverlxslkihtmhs*snytvs*pveptpsstrls*rdyyklkpi dhqfqsqelpi**rteravrllfvlvpllmm

  10. 7 CFR 251.4 - Availability of commodities. (United States)


    ... Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF... cost or waste, nutrition assistance to individuals in low-income groups. Such transfers will be... distribution of such commodities. Such advisory boards can provide valuable advice on how resources should be...

  11. Dicty_cDB: SHC251 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 98 |DT364098.1 JGI_ANNN9278.rev ANNN Pimephales promelas Whole (L) Pimephales promelas... cDNA clone ANNN9278 3', mRNA sequence. 48 0.24 1 DT347978 |DT347978.1 JGI_CAAX10802.fwd CAAX Pimephales promelas... testis 7-8 month adults, males and females pooled (L) Pimephales promelas cDNA clone CAAX10802 5'..., mRNA sequence. 48 0.24 1 DT309975 |DT309975.1 JGI_CAAX1517.fwd CAAX Pimephales promelas testis 7-8 month a...dults, males and females pooled (L) Pimephales promelas cDNA clone CAAX1517 5', m

  12. Dicty_cDB: CHQ251 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sucrase-isomaltase (a... 83 3e-15 BC116452_1( BC116452 |pid:none) Homo sapiens sucrase-isomaltase (a... 83...Full=Sucrase-isomaltase, intestinal; Contains:... 83 3e-15 M22616_1( M22616 |pid:none) Human sucrase-isomaltase mRNA...sucrase-isomaltase (SI) mRNA, comp... 77 1e-13 ( P23739 ) RecName: Full=Sucrase-isomaltase, intestinal;...AY229886_1( AY229886 |pid:none) Mus musculus soluble maltase-gluco... 77 2e-13 protein update 2009. 4.11 PSORT

  13. A novel splice-site mutation in angiotensin I-converting enzyme (ACE gene, c.3691+1G>A (IVS25+1G>A, causes a dramatic increase in circulating ACE through deletion of the transmembrane anchor.

    Directory of Open Access Journals (Sweden)

    Alexandre Persu

    Full Text Available BACKGROUND: Angiotensin-converting enzyme (ACE (EC 4.15.1 metabolizes many biologically active peptides and plays a key role in blood pressure regulation and vascular remodeling. Elevated ACE levels are associated with different cardiovascular and respiratory diseases. METHODS AND RESULTS: Two Belgian families with a 8-16-fold increase in blood ACE level were incidentally identified. A novel heterozygous splice site mutation of intron 25 - IVS25+1G>A (c.3691+1G>A - cosegregating with elevated plasma ACE was identified in both pedigrees. Messenger RNA analysis revealed that the mutation led to the retention of intron 25 and Premature Termination Codon generation. Subjects harboring the mutation were mostly normotensive, had no left ventricular hypertrophy or cardiovascular disease. The levels of renin-angiotensin-aldosterone system components in the mutated cases and wild-type controls were similar, both at baseline and after 50 mg captopril. Compared with non-affected members, quantification of ACE surface expression and shedding using flow cytometry assay of dendritic cells derived from peripheral blood monocytes of affected members, demonstrated a 50% decrease and 3-fold increase, respectively. Together with a dramatic increase in circulating ACE levels, these findings argue in favor of deletion of transmembrane anchor, leading to direct secretion of ACE out of cells. CONCLUSIONS: We describe a novel mutation of the ACE gene associated with a major familial elevation of circulating ACE, without evidence of activation of the renin-angiotensin system, target organ damage or cardiovascular complications. These data are consistent with the hypothesis that membrane-bound ACE, rather than circulating ACE, is responsible for Angiotensin II generation and its cardiovascular consequences.

  14. AF-Geospace User’s Manual Version 2.5.1 and Version 2.51P (United States)


    satellite is moving southward over equator in the Pacific while the GEO satellite detector is still monitoring a nearby patch of open water . This...on the Open button. After a few moments the Open window will disappear indicating that the Paramesh files have been 304 Approved for public...Dst minimum during this event. The 30 keV electrons remain trapped on magnetic field lines which are fairly dipolar near the Earth, thus the electron

  15. A retrospective study of californium-252 neutron brachytherapy combined with EBRT versus 3D-CRT in the treatment of esophageal squamous cell cancer. (United States)

    Wang, Qifeng; Li, Tao; Lang, Jinyi; Wang, Jie; Wang, Jian; Liu, Huiming; Jia, Xitang; Liu, Bo; Wang, C-K Chris


    We conducted a retrospective analysis on 884 patients who were diagnosed with esophageal squamous cell carcinoma (ESCC) and treated with either the neutron brachytherapy in combination with external beam radiotherapy (NBT + EBRT) or 3-dimensional conformal radiation therapy (3D-CRT) to determine the differences in efficacy and morbidity between the two treatment groups. The 884 ESCC patients treated with either NBT + EBRT or 3D-CRT between 2002 and 2012 were retrospectively reviewed and analyzed. Multivariable Cox regression was used to compare oncologic outcomes of the two groups of patients in the context of other clinically relevant variables. The acute and chronic toxicities associated with the two groups were compared using Fisher exact and log-rank tests, respectively. Among the 884 patients, 545 received NBT + EBRT and 339 received 3D-CRT (i.e. EBRT-only). The age range is 39-95 years (median 66). The follow-up time range is 3-145 months (median 32). The analysis shows that the NBT + EBRT group has higher overall survival rate and local control rate than that of the 3D-CRT group. The acute toxicity effects were acceptable for both groups of patients with the NBT + EBRT group showing higher rates of leukopenia and thrombocytopenia and the 3D-CRT group showing higher rates on fistula and massive bleeding. The patients treated with NBT + EBRT showed better oncologic outcomes than those treated with 3D-CRT. The toxicity effects were acceptable for both groups with the NBT + EBRT group showing higher rates on the acute effects and the 3D-CRT group showing higher rates on the late effects.

  16. Accurate determination of Curium and Californium isotopic ratios by inductively coupled plasma quadrupole mass spectrometry (ICP-QMS) in 248Cm samples for transmutation studies

    Energy Technology Data Exchange (ETDEWEB)

    Gourgiotis, A.; Isnard, H.; Aubert, M.; Dupont, E.; AlMahamid, I.; Cassette, P.; Panebianco, S.; Letourneau, A.; Chartier, F.; Tian, G.; Rao, L.; Lukens, W.


    The French Atomic Energy Commission has carried out several experiments including the mini-INCA (INcineration of Actinides) project for the study of minor-actinide transmutation processes in high intensity thermal neutron fluxes, in view of proposing solutions to reduce the radiotoxicity of long-lived nuclear wastes. In this context, a Cm sample enriched in {sup 248}Cm ({approx}97 %) was irradiated in thermal neutron flux at the High Flux Reactor (HFR) of the Laue-Langevin Institute (ILL). This work describes a quadrupole ICP-MS (ICP-QMS) analytical procedure for precise and accurate isotopic composition determination of Cm before sample irradiation and of Cm and Cf after sample irradiation. The factors that affect the accuracy and reproducibility of isotopic ratio measurements by ICP-QMS, such as peak centre correction, detector dead time, mass bias, abundance sensitivity and hydrides formation, instrumental background, and memory blank were carefully evaluated and corrected. Uncertainties of the isotopic ratios, taking into account internal precision of isotope ratio measurements, peak tailing, and hydrides formations ranged from 0.3% to 1.3%. This uncertainties range is quite acceptable for the nuclear data to be used in transmutation studies.

  17. Radiological Characterization Technical Report on Californium-252 Sealed Source Transuranic Debris Waste for the Off-Site Source Recovery Project at Los Alamos National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.

  18. 251.pdf | mar2007 | jbiosci | | | http: | Indian Academy ...

    Indian Academy of Sciences (India)

    SPEAKER: Prof. Krishnaswamy Ravi-Chandar. VENUE: Faculty Hall, Indian Institute of Science. 23 February 2018 ǀ 1500. Event poster · Introducing: Summer Schools. Posted on 21 December 2017. ASTROPHYSICS: An Observational View of the Universe. Math Art and Design: MAD about Math, Math Education and ...

  19. 30 CFR 251.9 - Temporarily stopping, canceling, or relinquishing activities approved under a permit. (United States)


    ... areas leased or not leased), to the marine, coastal, or human environment, or to an archaeological... Regional Director determines that: (1) Activities pose a threat of serious, irreparable, or immediate harm...

  20. 7 CFR 1710.251 - Construction work plans-distribution borrowers. (United States)


    ... UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE GENERAL AND PRE-LOAN POLICIES AND PROCEDURES COMMON TO ELECTRIC... additional capacity for new consumers; (4) New substation facilities or additions to existing substations; (5) Transmission and substation facilities required to support the distribution system; (6) Distribution equipment...

  1. : tous les projets | Page 251 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    La maladie de Chagas, une maladie grave à transmission vectorielle, impose une lourde charge de morbidité aux populations pauvres de l'Amérique latine et des Caraïbes (région ALC). Date de début : 31 mars 2011. End Date: 31 mars 2014. Sujet: TRYPANOSOMIASIS, ENVIRONMENTAL ENGINEERING, ...

  2. Rational design of cyclodextrin glycosyltransferase from Bacillus circulans strain 251 to increase alpha-cyclodextrin production

    NARCIS (Netherlands)

    Uitdehaag, JCM; Penninga, D; van Alebeek, GJWM; Smith, LM; Dijkstra, BW; Dijkhuizen, L


    Cyclodextrin glycosyltransferases (CGTase) (EC; are extracellular bacterial enzymes that generate cyclodextrins from starch. All known CGTases produce mixtures of alpha, beta, and gamma-cyclodextrins. A maltononaose inhibitor bound to the active site of the CGTase from Bacillus circulans

  3. 30 CFR 251.6 - Obligations and rights under a permit or a Notice. (United States)


    ..., coastal, or human environment; (3) Cause harm or damage to any mineral resource (in areas leased or not leased); (4) Cause pollution; (5) Disturb archaeological resources; (6) Create hazardous or unsafe conditions; or (7) Unreasonably interfere with or cause harm to other uses of the area. (b) You must...

  4. Dynamics of viral replication in blood and lymphoid tissues during SIVmac251 infection of macaques

    Directory of Open Access Journals (Sweden)

    Mannioui Abdelkrim


    Full Text Available Abstract Background Extensive studies of primary infection are crucial to our understanding of the course of HIV disease. In SIV-infected macaques, a model closely mimicking HIV pathogenesis, we used a combination of three markers -- viral RNA, 2LTR circles and viral DNA -- to evaluate viral replication and dissemination simultaneously in blood, secondary lymphoid tissues, and the gut during primary and chronic infections. Subsequent viral compartmentalization in the main target cells of the virus in peripheral blood during the chronic phase of infection was evaluated by cell sorting and viral quantification with the three markers studied. Results The evolutions of viral RNA, 2LTR circles and DNA levels were correlated in a given tissue during primary and early chronic infection. The decrease in plasma viral load principally reflects a large decrease in viral replication in gut-associated lymphoid tissue (GALT, with viral RNA and DNA levels remaining stable in the spleen and peripheral lymph nodes. Later, during chronic infection, a progressive depletion of central memory CD4+ T cells from the peripheral blood was observed, accompanied by high levels of viral replication in the cells of this subtype. The virus was also found to replicate at this point in the infection in naive CD4+ T cells. Viral RNA was frequently detected in monocytes, but no SIV replication appeared to occur in these cells, as no viral DNA or 2LTR circles were detected. Conclusion We demonstrated the persistence of viral replication and dissemination, mostly in secondary lymphoid tissues, during primary and early chronic infection. During chronic infection, the central memory CD4+ T cells were the major site of viral replication in peripheral blood, but viral replication also occurred in naive CD4+ T cells. The role of monocytes seemed to be limited to carrying the virus as a cargo because there was an observed lack of replication in these cells. These data may have important implications for the targeting of HIV treatment to these diverse compartments.

  5. 251. Seno coronario imperforado con clínica de taponamiento cardíaco


    M.T. Conejero Jurado; Moya González, J.; Ávalos Pinto, R.M.; Otero Forero, J.; D. Valencia Núñez; Maiorano Iuliano, P.; Sauchelli Faas, G.; Pernia Oreña, I.; Merino Cejas, C.; Casares Mediavilla, J.; P. Alados Arboledas


    Las alteraciones anatómicas del seno coronario son extraordinariamente raras; presentamos el caso de una paciente con seno coronario imperforado que debutó con clínica de taponamiento cardíaco. Material y métodos: Paciente de 61 años que ingresa en el servicio de urgencias por clínica de dolor torácico atípico y disnea. En la ecocardiografía transtorácica (ETT) se aprecia masa retrocardíaca quística, debajo de ambas aurículas. Tomografía computarizada (TC) coronaria: sospecha de fístula de...

  6. 75 FR 41161 - Information Collection Requirement; Defense Federal Acquisition Regulation Supplement; Part 251... (United States)


    ... Interagency Fleet Management System (IFMS) Vehicles and Related Services; OMB Control Number 0704-0252. Needs... vehicles under the Interagency Fleet Management System (IFMS) and obtain related services. The information... Interagency Fleet Management System Vehicles and Related Services, requires a contractor to submit a request...

  7. 36 CFR 251.54 - Proposal and application requirements and procedures. (United States)


    ... with regulations in § 212.10(c) and (d) of this chapter; and (3) Proposals for oil and gas pipeline... occupancy. (v) The proposed use will not unreasonably conflict or interfere with administrative use by the... guidance and information on the following: (i) Possible land use conflicts as identified by review of...

  8. Wang et al., Afr J Tradit Complement Altern Med. (2013) 10(2):251 ...

    African Journals Online (AJOL)


    Perilla frutescens(L.) is a popular herbaceous plant for its pleasant aroma and taste. Its leaves are delicious ... antibodies were goat anti-mouse-HRP and goat anti-rabbit-HRP (IgG; Pierce, 1:3000). Finally, the PVDF ... buffer(pH 6.0). Sections were cooled at room temperature and incubated in rabbit anti-pAkt Ser473 (1:500, ...

  9. 5 CFR 251.201 - Associations of management officials and/or supervisors. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Associations of management officials and... Associations of management officials and/or supervisors. (a) As part of agency management, supervisors and... associations whose membership is primarily composed of Federal supervisory and/or managerial personnel...

  10. (E-1-Phenyl-2-({5-[(1E-(2-phenylhydrazin-1-ylidenemethyl]-2-thienyl}methylidenehydrazine

    Directory of Open Access Journals (Sweden)

    James L. Wardell


    Full Text Available The title molecule, C18H16N4S, adopts a U-shape with the aromatic groups lying syn and orientated in the same direction as the thiophene S atom. The conformation about each of the C=N bonds is E. Overall, the molecule is curved as seen in the dihedral angle of 30.26 (19° formed between the terminal benzene rings. In the crystal, supramolecular chains along the c axis are formed by a combination of N—H...N hydrogen bonds and N—H...π interactions.

  11. Decree no. 2004-251 from March 19, 2004 relative to public utility obligations in the gas sector; Decret no. 2004-251 du 19 mars 2004 relatif aux obligations de service public dans le secteur du gaz

    Energy Technology Data Exchange (ETDEWEB)



    This decree defines the public utility obligations that gas suppliers and gas facility operators (transportation and distribution networks, underground storage facilities, LNG facilities) have to fulfill in order to ensure without interruption the continuity of gas supplies to their clients. (J.S.)

  12. Intake assessment of the food additives nitrite (E 249 and E 250) and nitrate (E 251 and E 252)

    NARCIS (Netherlands)

    Sprong RC; Niekerk EM; Beukers MH; VVH; V&Z


    Nitrate and nitrite are authorised as preservatives in certain food products, such as salami, ham (nitrite) and cheese (nitrate). They prevent food spoilage and protect the consumer against food-borne pathogens. Next to that, nitrate and nitrite play a role in food colour retention and contribute to

  13. The three transglycosylation reactions catalyzed by cyclodextrin glycosyltransferase from Bacillus circulans (strain 251) proceed via different kinetic mechanisms

    NARCIS (Netherlands)

    Veen, Bart A. van der; Alebeek, Gert-Jan W.M. van; Uitdehaag, Joost C.M.; Dijkstra, Bauke W.; Dijkhuizen, Lubbert

    Cyclodextrin glycosyltransferase (CGTase) catalyzes three transglycosylation reactions via a double displacement mechanism involving a covalent enzyme-intermediate complex (substituted-enzyme intermediate). Characterization of the three transglycosylation reactions, however, revealed that they

  14. 46 CFR 251.1 - Applications for construction-differential subsidy under Title V, Merchant Marine Act, 1936, as... (United States)


    ... standardized ship construction, when the applicant feels that a new design is necessary in exceptional cases... bidding plans and specifications and during the actual ship construction period shall be incorporated in... flights of ships in different yards. 6. Construction-differential subsidy on owner's engineering expenses...

  15. 76 FR 16038 - Proposed Collection; Comment Request for Prepaid Card Marketing Customer Survey, CS-10-251. (United States)


    ..., IRS is hoping to leverage the theory and principles of social marketing. Social marketing principles and practices apply marketing principles to social programs. This data will provide the IRS with... Internal Revenue Service Proposed Collection; Comment Request for Prepaid Card Marketing Customer Survey...

  16. ARL: A Bimonthly Report on Research Library Issues and Actions from ARL, CNI, and SPARC. Number 251 (United States)

    Association of Research Libraries, 2007


    ARL is the bimonthly report on research library issues and actions from ARL (Association of Research Libraries), CNI (Coalition of Networked Information), and SPARC (Scholarly Publishing and Academic Resources Coalition). ARL reports on current issues of interest to academic and research library administrators, staff, and users; higher education…

  17. (E-1-(3-Nitrophenyl-2-({5-[(1E-2-(3-nitrophenylhydrazin-1-ylidenemethyl]-2-thienyl}methylidenehydrazine

    Directory of Open Access Journals (Sweden)

    Geraldo M. de Lima


    Full Text Available The title molecule, C18H14N6O4S, adopts a U-shape with the aromatic groups lying syn and oriented in the same direction as the thiophene S atom. Twists away from planarity are evident with the maximum deviation being found for a terminal nitro group: C/C/N/O = 19.0 (3°. The conformation about each of the C=N bonds is E. In the crystal, centrosymmetrically related molecules are connected via N—H...Onitro hydrogen bonds, forming 14-membered {...HNC3NO}2 synthons. These are linked into layers via C—H...Onitro interactions with the primary interactions between layers being of the type C—H...π, where the π-system is the thiophene ring.

  18. 76 FR 61558 - Airworthiness Directives; Dowty Propellers Type R212/4-30-4/22 and R251/4-30-4/49 Propeller... (United States)


    .... Revision 6 of the ASB had an incorrect Non-Destructive Testing (NDT) reference in Effectivity paragraph 1.D... No. 61-1043, Revision 7, dated March 1, 2011, and NDT Technique NDT 175U (Appendix A of Dowty...

  19. The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix G. Demonstration Projects on Other Streams, Nationwide. Volume 2. (United States)


    the surface. This limestone is used for the manufacture of Portland Cement, as building stone, and for macadam roads. However, in the Wapello area...6 G-60-11 w wV V w w w w w w PHOTO 7. AREA WHERE EROSION CONTROL MAT IS TO BE PLACED. 8 JUNE 1978. ~~PHOTO 8. PUMPING GROUT INTO THE EROSION CONTROL...considered experimental. The three protective measures chosen for use on the slope consisted of: (1) a grout -filled fabric mattress, (2) a revetment of used

  20. The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix H. Evaluation of Existing Projects. Volume 1. (United States)


    to 7 Red River, Fausse , Louisiana......................................... H-4-1 to 6 Red River, Perot, Louisiana...States were selected for limited observation, monitoring, and evaluation using previous field observations and data and information acquired during the...projects evaluated. A detailed report on each of these projects is provided in this appendix; a summary of information on these projects is given in Exhibit

  1. Common variation at 2p13.3, 3q29, 7p13 and 17q25.1 associated with susceptibility to pancreatic cancer

    NARCIS (Netherlands)

    Childs, Erica J; Mocci, Evelina; Campa, Daniele; Bracci, Paige M; Gallinger, Steven; Goggins, Michael; Li, Donghui; Neale, Rachel E; Olson, Sara H; Scelo, Ghislaine; Amundadottir, Laufey T; Bamlet, William R.; Bijlsma, Maarten F; Blackford, Amanda; Borges, Michael; Brennan, Paul; Brenner, Hermann; Bueno-De-Mesquita, H. Bas|info:eu-repo/dai/nl/06929528X; Canzian, Federico; Capurso, Gabriele; Cavestro, Giulia Martina; Chaffee, Kari G.; Chanock, Stephen J.; Cleary, Sean P.; Cotterchio, Michelle; Foretova, Lenka; Fuchs, Charles; Funel, Niccola; Gazouli, Maria; Hassan, Manal; Herman, Joseph M.; Holcatova, Ivana; Holly, Elizabeth A; Hoover, Robert N.; Hung, Rayjean J.; Janout, Vladimir; Key, Timothy J.; Kupcinskas, Juozas; Kurtz, Robert C; Landi, Stefano; Lu, Lingeng; Malecka-Panas, Ewa; Mambrini, Andrea; Mohelnikova-Duchonova, Beatrice; Neoptolemos, John P.; Oberg, Ann L; Orlow, Irene; Pasquali, Claudio; Pezzilli, Raffaele; Rizzato, Cosmeri; Saldia, Amethyst; Scarpa, Aldo; Stolzenberg-Solomon, Rachael Z.; Strobel, Oliver; Tavano, Francesca; Vashist, Yogesh K.; Vodicka, Pavel; Wolpin, Brian M; Yu, Herbert; Petersen, Gloria M; Risch, Harvey A.; Klein, Alison P


    Pancreatic cancer is the fourth leading cause of cancer death in the developed world. Both inherited high-penetrance mutations in BRCA2 (ref. 2), ATM, PALB2 (ref. 4), BRCA1 (ref. 5), STK11 (ref. 6), CDKN2A and mismatch-repair genes and low-penetrance loci are associated with increased risk. To

  2. Common variation at 2p13.3, 3q29, 7p13 and 17q25.1 associated with susceptibility to pancreatic cancer

    Czech Academy of Sciences Publication Activity Database

    Childs, E.J.; Mocci, E.; Campa, D.; Bracci, P. M.; Gallinger, S.; Goggins, M.; Li, D.; Neale, R.E.; Olson, S. H.; Scelo, G.; Amundadottir, L. T.; Bamlet, W.R.; Bijlsma, M.F.; Blackford, A.; Borges, M.; Brennan, P.; Brenner, H.; Bueno-de-Mesquita, H. B.; Canzian, F.; Capurso, G.; Cavestro, G.M.; Chaffee, K.G.; Chanock, S. J.; Cleary, S.P.; Cotterchio, M.; Foretová, L.; Fuchs, Ch.; Funel, N.; Gazouli, M.; Hassan, M.; Herman, J.M.; Holcatová, I.; Holly, E. A.; Hoover, R.N.; Hung, R.J.; Janout, V.; Key, T.J.; Kupcinskas, J.; Kurtz, R. C.; Landi, S.; Lu, S.; Malecka-Panas, E.; Mambrini, A.; Mohelníková-Duchoňová, B.; Neoptolemos, J.P.; Oberg, A. L.; Orlow, I.; Pasquali, C.; Pezzilli, R.; Rizzato, C.; Saldia, A.; Scarpa, A.; Stolzenberg-Solomon, R. S.; Strobel, O.; Tavano, F.; Vashist, Y.K.; Vodička, Pavel; Wolpin, B. M.; Yu, H.; Petersen, G.; Risch, H. A.; Klein, A. P.


    Roč. 47, č. 8 (2015), s. 911-918 ISSN 1061-4036 R&D Projects: GA MZd NR9422; GA ČR GAP301/12/1734 Institutional support: RVO:68378041 Keywords : genome-wide association * genotype imputation * lung adenocarcinoma * cigarette-smoking * genetic-variation * alpha-gene * risk * loci * population * mutations Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 31.616, year: 2015

  3. WITHDRAWN: Dual targeting of glioma U251 cells and neovasculature with a nanoparticle encoding vasohibin and RGD peptides prevents tumor angiogenesis and inhibits tumor growth. (United States)

    Chen, Hongjie; Yuan, Bangqing; Wang, Shousen; Zhen, Zhaocong; Liu, Zheng


    This article has been withdrawn at the request of the author(s) and editor. The Publisher apologizes for any inconvenience this may cause. The full Elsevier Policy on Article Withdrawal can be found at Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  4. SU-E-J-251: Incorporation of Pre-Therapy 18F-FDG Uptake with CT Texture Features in a Predictive Model for Radiation Pneumonitis Development

    Energy Technology Data Exchange (ETDEWEB)

    Anthony, G; Cunliffe, A; Armato, S; Al-Hallaq, H [The University of Chicago, Chicago, IL (United States); Castillo, R [Univ Texas Medical Branch of Galveston, Pearland, TX (United States); Pham, N [Baylor College of Medicine, Houston, TX (United States); Guerrero, T [Beaumont Health System, Royal Oak, MI (United States)


    Purpose: To determine whether the addition of standardized uptake value (SUV) statistical variables to CT lung texture features can improve a predictive model of radiation pneumonitis (RP) development in patients undergoing radiation therapy. Methods: Anonymized data from 96 esophageal cancer patients (18 RP-positive cases of Grade ≥ 2) were retrospectively collected including pre-therapy PET/CT scans, pre-/posttherapy diagnostic CT scans and RP status. Twenty texture features (firstorder, fractal, Laws’ filter and gray-level co-occurrence matrix) were calculated from diagnostic CT scans and compared in anatomically matched regions of the lung. The mean, maximum, standard deviation, and 50th–95th percentiles of the SUV values for all lung voxels in the corresponding PET scans were acquired. For each texture feature, a logistic regression-based classifier consisting of (1) the average change in that texture feature value between the pre- and post-therapy CT scans and (2) the pre-therapy SUV standard deviation (SUV{sub SD}) was created. The RP-classification performance of each logistic regression model was compared to the performance of its texture feature alone by computing areas under the receiver operating characteristic curves (AUCs). T-tests were performed to determine whether the mean AUC across texture features changed significantly when SUV{sub SD} was added to the classifier. Results: The AUC for single-texturefeature classifiers ranged from 0.58–0.81 in high-dose (≥ 30 Gy) regions of the lungs and from 0.53–0.71 in low-dose (< 10 Gy) regions. Adding SUVSD in a logistic regression model using a 50/50 data partition for training and testing significantly increased the mean AUC by 0.08, 0.06 and 0.04 in the low-, medium- and high-dose regions, respectively. Conclusion: Addition of SUVSD from a pre-therapy PET scan to a single CT-based texture feature improves RP-classification performance on average. These findings demonstrate the potential for more accurate prediction of RP using information from multiple imaging modalities. Supported, in part, by the National Institute of Biomedical Imaging and Bioengineering of the National Institutes of Health under grant number T32 EB002103; SGA receives royalties and licensing fees through the University of Chicago for computer-aided diagnosis technology. HA receives royalties through the University of Chicago for computer-aided diagnosis technology.

  5. Association of a single nucleotide polymorphism at 6q25.1, rs2046210 with breast cancer risk among Vietnamese population

    Directory of Open Access Journals (Sweden)

    Lan Thi Tuyet Nguyen


    Full Text Available Introduction: This study aims to confirm the association between SNP rs2046210 and breast cancer in the Vietnamese population. Methods: A case/control study has been performed with the sample size of 300 cases and 325 controls. High Resolution Melting method is optimised for SNP genotyping. Statistic logistic regression analysis was used along with dominant and recessive analysis to analyse the association between alleles and genotypes of the selected SNP and breast cancer risk. Results: With the selection population and the optimal HRM method, genotyping resulted in precise data for association analysis as the HWE test showed the distribution of genotypes in the population is in equilibrium (p > 0.05. The logistic regression association analysis showed SNP rs2046210 strongly associated with breast cancer risk in both allelic (p = 0.0015 and genotypic (p = 0.0064 analysis. The risk allele A, like other previous studies, strongly associated with increasing the risk of breast cancer up to 1.425 folds (OR [95%CI] = 1.425 [1.143- 1.777], p = 0.0015. However, it has shown the recessive effect in the additive analysis. Genotype AA showed stronger effect on the risk of breast cancer while the heterozygous AG genotypes showed weaker effect. Due to the small sample size, statistical power of this study is not high as expected (58.67%. But this case/control study confirms the association between SNP rs2046210 and the risk of breast cancer in the Vietnamese population. Conclusion: SNP rs2046210 is associated with breast cancer risk in the Vietnamese population. The risk allele A plays a role in increasing the risk of breast cancer in Vietnamese women.

  6. Ship Trackline Along Which Continuous Resistivity Profile (CRP) Data was Collected in the Potomac River/Chesapeake Bay on Sept. 8, 2006 (RESGPSLNS_JD251.SHP) (United States)

    U.S. Geological Survey, Department of the Interior — In order to test hypotheses about groundwater flow under and into Chesapeake Bay, geophysical surveys were conducted by U.S. Geological Survey (USGS) scientists on...

  7. The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix A. Literature Survey. (United States)


    head (Figure 48) can provide long service if failures due to cracking or pressure from the fill behind it can be avoided.6𔄁 4 Concrete bulkheads...Bolivian Gas Pipeline") (in Spanish), Petroleo Internacional (reprint). Hold-That-River, Inc. "HTR...The Company that Stabilizes Banks and Pre- vents

  8. The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix D. Ohio River Demonstration Projects. (United States)


    ii Ohio River, Moundsville (Grave Creek), West Virginia ....................... D-1-1 to 54 - Ohio River... Moundsville , West Virginia ..................................... D-2-1 to 64 Ohio River, Powhatan Point, Ohio .......................................... D-3...Division Office. Reports on Demonstration Projects Main Report Pittsburgh District Map No. S Moundsville Grave Creek, West Virginia 1 Moundsville Country

  9. The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix C. Geotechnical Research. (United States)


    market streambank protection products is provided in Appendix B. Appendix C contains a glossary of streazbs.-k protection terminology. A detailed bibli...surrounded by nylon sheath. e. Griff Weave 10 - reinforced plastic laminate consisting of a nonwoven grid of polyethylene ribbons (impervious). 0 f...Griffolyn - reinforced plastic laminate consl ting of a nonwoven grid of polyethylene ribbons (imperv *. g. Sackurity Bag - vinyl-coated polyester. 146. In

  10. The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix G. Demonstration Projects on Other Streams, Nationwide. Volume 1. (United States)


    were placed in a line parallel to the bank of the Iowa River. (5) Fencing. Woven wire fencing, with cut brush fill landward of the fencing, was used on...velocities have been determined for frequently occurring excessive flow events as approximately 5 teet per second within the Kanawha River channel. Waves

  11. The Streambank Erosion Control Evaluation and Demonstration Act of 1974, Section 32, Public Law 93-251. Appendix B. Hydraulic Research. (United States)


    except for the nonwoven , or random mesh, filter fabric that was used in Plan 6. The nonwoven filter fabric was in- " stalled in the same manner as...described in paragraph 18 and Figures 20a and 20b. The nonwoven filter fabric had an EOS of 50. From Equation 8 D85Soil 0.38 mm 1.28 >1.0 EOS 50 and the gradient ratio for the nonwoven filter fabric was 1.4. 21. Plan 6A, Figures 26 and 29, was a protected sand streambank. Plan 6A was


    Directory of Open Access Journals (Sweden)

    Alexandre Costa Quintana


    Full Text Available The process of virtual learning passes for the necessity of the existence of an evaluation process. Normally, this evaluation is integrated by a virtual part and another class attendance. The posting of the task becomes an important communication tool between students, teachers and tutors, as it enables the exchange of information between those involved, besides serving as a component of assessment and therefore reflecting the development of teaching-learning process.In this direction the objective of this work is in the distance to analyze the form of execution of the virtual tasks of the pupil of the course of graduation in Administration at distance. This work was elaborated, by means of a descriptive research, with analysis of content and a qualitative boarding. Concluding that the results of this study show that teachers, tutors and coordination of distance courses have attention on the needs of students in relation to time for implementation, appropriate date for posting and service to academics, that in understanding these will be key to the tasks are actually an important tool in the teaching-learning.

  13. Chronic Δ9-Tetrahydrocannabinol Administration Reduces IgE+B Cells but Unlikely Enhances Pathogenic SIVmac251 Infection in Male Rhesus Macaques of Chinese Origin


    Qin, CHUN-CHUNG; Molina, P; Liu, L; Cong, Z; Wu, X; Wang, H; Chen, Z; Wei, Q


    Delta9-tetrahydrocannabinol (Δ9-THC) is the major psychoactive component of the cannabis plant. Δ9-THC has been used in the active ingredient of Marinol as an appetite stimulant for AIDS patients. Its impact on progression of HIV-1 infection, however, remains debatable. Previous studies indicated that Δ9-THC administration enhanced HIV-1 infection in huPBL-SCID mice but seemingly decreased early mortality in simian immunodeficiency virus (SIV) infected male Indian-derived rhesus macaques. Her...

  14. GIS AND REMOTE SENSING BASEDLAND USE LAND COVER DYNAMICS AT SEMIEN MOUNTAIS NATIONAL PARK Authors name: Gebreanenya Gebru Kidane, Email. University of Gondar Phone.251 920 88 84 62 (United States)

    Kidane, G. G., III; Belay, Y. G.; Kassa, B. A.; Yimam, D. A.


    ABSTRACT The main purpose of this study is to quantify the magnitude and rate of change of major land use/land cover types, and to identify the major drivers of change in SMNP using GIS and remote sensing. To address the pre-stated objective three landsat images of the periods between 1985, 2000 and 2015 with the time series of 15 (fifteen) years for the conceqative of 30 years land use land cover dynamics were classified and analyzed using Erdas Emagine 9.2 and ArcGIS 10 environments. The results depicted that a remarkable expansion was observed in forest cover followed by farmland and settlements between 1985 and 2015 by about 16% (22 ha/y) and 14.7% (21 ha/y) although some portions of their original extent were converted into other LUC classes. Expansion of forest cover was dominantly attributed to conversions of exposed rocks (1334.97 ha) and shrubs (1255.23 ha). These possibly attributed to conversion of some portions of exposed rocks and shrubs which were unsustainably utilized into protected areas by area closure and transformation of shrubs into forest cover. Similarly, farmlands and settlement has been expanded mainly due to area gains from grassland (984.51 ha) and forest cover (1037.25 ha). These largely associated with encroachment of farmlands and settlements into grasslands and original natural forest cover as a result of population pressure. The results also indicated that the reduction of areas under grassland, exposed volcanic rocks and shrubs by about 2.35% (5 ha/y), 18% (32 ha/y) and 11% (14 ha/y) evident because the added areas from other LUC classes could not compensate the losses, respectively. The major drivers identified in study area were civil war between 1984 and 1991 resulted in the agricultural exploitation, deforestation and illegal wildlife hunting, population pressure due to influx of settlers for the last decade. Finally revitalizing the nationally park is not only the duty of the government but also all the concerned individuals specially the communities around the park and different stock holders at different levels should be work in integrative and in synergism manner. Key Words: Dynamics, Land use, GIS, Remo sensing Email address of the authors: *

  15. A t(3;9)(q25.1;q34.3) translocation leading to OLFM1 fusion transcripts in Gilles de la Tourette syndrome, OCD and ADHD

    DEFF Research Database (Denmark)

    Bertelsen, Birgitte; Melchior, Linea; Jensen, Lars Riff


    transcripts. Reverse-transcription PCR identified several fusion transcripts in the carriers, and OLFM1 expression was found to be high in GTS-related human brain regions. As OLFM1 plays a role in neuronal development it is a likely candidate gene for neuropsychiatric disorders and haploinsufficiency of OLFM1...... could be a contributing risk factor to the phenotype of the carriers. In addition, one of the fusion transcripts may exert a dominant-negative or gain-of-function effect. OLFM1 is unlikely to be a major GTS susceptibility gene as no point mutations or copy number variants affecting OLFM1 were identified......Gilles de la Tourette syndrome (GTS) is a neuropsychiatric disorder with a strong genetic etiology; however, finding of candidate genes is hampered by its genetic heterogeneity and the influence of non-genetic factors on disease pathogenesis. We report a case of a male patient with GTS, obsessive...



    Ailton Conde Jussani; Patricia Viveiros de Castro Krakauer; Edison Fernandes Polo


    Within the context of the globalized environment, competitiveness has become a critical issue for business. The use of research to inform strategic decisions is thus important for firms on the path to competitiveness, regardless of their market of operation. This paper provides an overview of four strategies—Kim and Mauborgne’s Blue Ocean Strategy, Ansoff’s Matrix, Porter’s Generic Strategies, and Hax and Wilde’s Delta model—in order to find the similarities and approximations among them. App...

  17. Comment on: ``FT-IR, FT-Raman and UV spectral investigation; computed frequency estimation analysis and electronic structure calculations on 1-nitronaphthalene'' by M. Govindarajan and M. Karabacak [Spectrochim. Acta A 85 (2012) 251-260 (United States)

    Alparone, Andrea; Librando, Vito


    The title paper [1] incorrectly establishes that, in gas phase the global minimum energy structure of 1-nitronaphthalene is planar (Cs symmetry). By contrast, present calculations indicate that the planar Cs form is an unstable structure on the potential energy surface, exhibiting an imaginary vibrational wavenumber value corresponding to the torsional mode of the nitro group around the C-N bond. At the B3LYP/6-311++G(d,p) level of calculation the global minimum energy structure of 1-nitronaphthalene in gas phase has a non-planar geometry, characterized by O-N-C-C dihedral angles of ca. 30° and lying 0.35 kcal/mol below the Cs form.

  18. SU-F-T-251: The Quality Assurance for the Heavy Patient Load Department in the Developing Country: The Primary Experience of An Entire Workflow QA Process Management in Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Xie, J; Wang, J; Peng, J; Chen, J; Hu, W [Fudan University Shanghai Cancer Center, Shanghai, Shanghai (China)


    Purpose: To implement an entire workflow quality assurance (QA) process in the radiotherapy department and to reduce the error rates of radiotherapy based on the entire workflow management in the developing country. Methods: The entire workflow QA process management starts from patient registration to the end of last treatment including all steps through the entire radiotherapy process. Error rate of chartcheck is used to evaluate the the entire workflow QA process. Two to three qualified senior medical physicists checked the documents before the first treatment fraction of every patient. Random check of the treatment history during treatment was also performed. A total of around 6000 patients treatment data before and after implementing the entire workflow QA process were compared from May, 2014 to December, 2015. Results: A systemic checklist was established. It mainly includes patient’s registration, treatment plan QA, information exporting to OIS(Oncology Information System), documents of treatment QAand QA of the treatment history. The error rate derived from the chart check decreases from 1.7% to 0.9% after our the entire workflow QA process. All checked errors before the first treatment fraction were corrected as soon as oncologist re-confirmed them and reinforce staff training was accordingly followed to prevent those errors. Conclusion: The entire workflow QA process improved the safety, quality of radiotherapy in our department and we consider that our QA experience can be applicable for the heavily-loaded radiotherapy departments in developing country.

  19. Navigation, Bathymetry and Temperature Point at the Ship Position During Continuous Resistivity Profile Data Collection in the Potomac River/Chesapeake Bay on Sept. 8, 2006 on USGS Cruise 06018 (RESGPSPNTS_JD251.SHP) (United States)

    U.S. Geological Survey, Department of the Interior — In order to test hypotheses about groundwater flow under and into Chesapeake Bay, geophysical surveys were conducted by U.S. Geological Survey (USGS) scientists on...

  20. Substituição do milho por farelo de trigo ou farelo de glúten de milho na ração de bovinos de corte em terminação - DOI: 10.4025/actascianimsci.v29i1.251 Substitution of corn grain by wheat middlings or corn gluten feed in the finishing bulls diet - DOI: 10.4025/actascianimsci.v29i1.251

    Directory of Open Access Journals (Sweden)

    Térssio Roger Ramalho


    Full Text Available O objetivo do trabalho foi avaliar a substituição do milho moído fino (MM por farelo de trigo (FT ou farelo de glúten de milho (FGM na ração de 36 bovinos não castrados, em terminação (14 meses; peso inicial de 382 kg durante 87 dias. A ração continha 24% de silagem de capim e 76% de concentrado, constituído por polpa cítrica, farelo de soja, uréia, minerais, bicarbonato de sódio e monensina sódica, além de uma das fontes energéticas testadas. A substituição de MM por FT aumentou a ingestão de FDN (pThe objective of this work was to evaluate the substitution of finely ground (GC corn by wheat middlings (WM or dried corn gluten feed (CGF in finishing feedlot diets. Thirty-six yearling bulls (382 kg average initial live weight; 14 months old were fed during 87 days. The diets contained 24% grass silage and 76% concentrate, formulated with dried citrus pulp, soybean meal, urea, mineral-vitamin mix, sodium bicarbonate, sodium monensin, and one of the energy sources tested. The substitution of wheat middlings for corn increased NDF intake (p<0.05. However, no effect was observed on other measured parameters. Substitution of corn gluten feed for ground corn reduced dry matter intake (p<0.05 and average daily gain (p<0.10, increased NDF intake (p<0.05, but had no effect on feed efficiency. These diets showed no differences in the observed values of net energy of maintenance or gain. The ratio observed/expected net energy for the diet differs from the other treatments. For this type of diet, GC may be completely replaced by WM or CGF with no depression on feed efficiency or on diet net energy. NRC (2001 underestimates TDN values and net energy estimates for WM and CGF.

  1. Discovery of isotopes of the transuranium elements with 93≤Z≤98

    Energy Technology Data Exchange (ETDEWEB)

    Fry, C.; Thoennessen, M., E-mail:


    One hundred and five isotopes of the transuranium elements neptunium, plutonium, americium, curium, berkelium, and californium have been observed so far; the discovery of these isotopes is described. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  2. Separation of Transplutonium Elements from Neutron Irradiated Americium-241

    National Research Council Canada - National Science Library

    UENO, Kaoru; WATANABE, Kenju; SAGAWA, Chiaki; ISHIMORI, Tomitaro


    .... The ratios of the amounts present of these isotopes were determined by mass spectrometry. It was not possible to identify 249Bk in the berkelium fraction owing to the interference from other β-ray emitting nuclides. In the californium fraction, both spontaneous fission and a-activities due to 250, 252 were observed.

  3. Neutron-Activated Gamma-Emission: Technology Review (United States)


    flux sources developed for boron neutron capture therapy ( BNCT ), found to be an experimental success in cancer treatment (26). 30 Improved flux on...achievable Am americium API associated particle imaging B boron Be beryllium BNCT boron neutron capture therapy C carbon Cf californium Cl

  4. ORF Alignment: EHA1 [GENIUS II[Archive

    Lifescience Database Archive (English)


  5. ORF Alignment: NC_004547 [GENIUS II[Archive

    Lifescience Database Archive (English)


  6. ORF Alignment: NC_006576 [GENIUS II[Archive

    Lifescience Database Archive (English)


  7. Solid-State Neutron Multiplicity Counting System Using Commercial Off-the-Shelf Semiconductor Detectors

    Energy Technology Data Exchange (ETDEWEB)

    Rozhdestvenskyy, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    This work iterates on the first demonstration of a solid-state neutron multiplicity counting system developed at Lawrence Livermore National Laboratory by using commercial off-the-shelf detectors. The system was demonstrated to determine the mass of a californium-252 neutron source within 20% error requiring only one-hour measurement time with 20 cm2 of active detector area.

  8. Cold valleys in the radioactive decay of 248−254Cf isotopes

    Indian Academy of Sciences (India)

    Geiger–Nuttal plots of log10(T1/2) vs. Q−1/2 for 48−52Ca emitting from various californium isotopes. Acknowledgement. One of the authors (KPS) would like to thank University Grants Commis- sion, Govt. of India for the financial support under project No. MRP(S)-. 352/2005(X Plan)/KLKA 002/UGC-SWRO. References.

  9. Directed evolution of the periodic table: probing the electronic structure of late actinides. (United States)

    Marsh, M L; Albrecht-Schmitt, T E


    Recent investigations of the coordination chemistry and physical properties of berkelium (Z = 97) and californium (Z = 98) have revealed fundamental differences between post-curium elements and lighter members of the actinide series. This review highlights these developments and chronicles key findings and concepts from the last half-century that have helped usher in a new understanding of the evolution of electronic structure in the periodic table.

  10. Open Source: Potential in Latin America for Radiological Weapons (United States)


    terrorist group would need to acquire a radioactive isotope with a relatively short half-life. 36,37 As an aside, the IAEA verified that (accessed March 3, 2010), Useful RDD isotopes include cobalt-60, strontium-90, yttrium-90, iridium-192, cesium-137...plutonium-238, radium -226, americium-241, and californium-252. 37 Hansell and Salama, “Does intent equal capability?,” 640-641. 38 Internation Atomic

  11. Dietary exposure to benzoates (E210-E213), parabens (E214-E219), nitrites (E249-E250), nitrates (E251-E252), BHA (E320), BHT (E321) and aspartame (E951) in children less than 3 years old in France. (United States)

    Mancini, F R; Paul, D; Gauvreau, J; Volatier, J L; Vin, K; Hulin, M


    This study aimed to estimate the exposure to seven additives (benzoates, parabens, nitrites, nitrates, BHA, BHT and aspartame) in children aged less than 3 years old in France. A conservative approach, combining individual consumption data with maximum permitted levels, was carried out for all the additives. More refined estimates using occurrence data obtained from products' labels (collected by the French Observatory of Food Quality) were conducted for those additives that exceeded the acceptable daily intake (ADI). Information on additives' occurrence was obtained from the food labels. When the ADI was still exceeded, the exposure estimate was further refined using measured concentration data, if available. When using the maximum permitted level (MPL), the ADI was exceeded for benzoates (1.94 mg kg(-1) bw day(-1)), nitrites (0.09 mg kg(-1) bw day(-1)) and BHA (0.39 mg kg(-1) bw day(-1)) in 25%, 54% and 20% of the entire study population respectively. The main food contributors identified with this approach were current foods as these additives are not authorised in specific infant food: vegetable soups and broths for both benzoates and BHA, delicatessen and meat for nitrites. The exposure estimate was significantly reduced when using occurrence data, but in the upper-bound scenario the ADI was still exceeded significantly by the age group 13-36 months for benzoates (2%) and BHA (1%), and by the age group 7-12 months (16%) and 13-36 months (58%) for nitrites. Measured concentration data were available exclusively for nitrites and the results obtained using these data showed that the nitrites' intake was below the ADI for all the population considered in this study. These results suggest that refinement of exposure, based on the assessment of food levels, is needed to estimate the exposure of children to BHA and benzoates for which the risk of exceeding the ADI cannot be excluded when using occurrence data.

  12. Physical trajectory profile data from glider unit_251 deployed by Oregon Health & Science University; Center for Coastal Margin Observation & Prediction in the Coastal Waters of Washington/Oregon from 2013-05-08 to 2013-05-31 (NCEI Accession 0145921) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Slocum glider dataset gathered as part of the CMOP observatory SATURN, funded by NOAA and NSF. Glider operations have historically been seasonal (April-September),...

  13. Physical trajectory profile data from glider unit_251 deployed by Oregon Health & Science University; Center for Coastal Margin Observation & Prediction in the Coastal Waters of Washington/Oregon from 2012-07-25 to 2012-08-22 (NCEI Accession 0145920) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Slocum glider dataset gathered as part of the CMOP observatory SATURN, funded by NOAA and NSF. Glider operations have historically been seasonal (April-September),...

  14. Physical trajectory profile data from glider unit_251 deployed by Oregon Health & Science University; Center for Coastal Margin Observation & Prediction in the Coastal Waters of Washington/Oregon from 2013-07-18 to 2013-08-06 (NCEI Accession 0145922) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Slocum glider dataset gathered as part of the CMOP observatory SATURN, funded by NOAA and NSF. Glider operations have historically been seasonal (April-September),...

  15. The Launch of a Joint Library/Writing Centre Online Course on Academic Integrity. A Review of: Greer, K., Swanberg, S., Hristova, M., Switzer, A. T., Daniel, D., & Perdue, S. W. (2012. Beyond the web tutorial: Development and implementation of an online, self-directed academic integrity course at Oakland University. The Journal of Academic Librarianship, 38(5, 251-258.

    Directory of Open Access Journals (Sweden)

    Cari Merkley


    Full Text Available Objective – To outline the collaborative development of an online course addressing academic integrity by a university’s library system and writing centre.Design – Case study.Setting – A public research university in the Midwestern United States.Subjects – 1650 students who completed the online module.Methods – Oakland University (OU Libraries and the Writing Centre began to collaborate on the development of a new online course on academic integrity in 2011. It was felt that an existing online library tutorial on plagiarism no longer met the needs of students and faculty. The development of the course was informed by the Association of College and Research Libraries’ Information Literacy Competency Standards for Higher Education (2000 as well as a research study investigating students’ use of sources in their scholarly writing across several institutions. Moodle, the institution’s learning management system (LMS, was used to develop the learning object.Main Results – OU Libraries and the Writing Centre launched the six-part online course entitled “Using and Citing Sources” in January 2012. They developed modules around learning outcomes in five broad categories: defining academic integrity and plagiarism; the use of sources in academic writing; paraphrasing; quoting; and citation. The final module provided students with an opportunity to practise lessons learned in the first five modules. The use of the LMS to design and host the course limited the tutorial to registered students, but provided developers with access to additional course functionality without labour-intensive coding. It also allowed Writing Centre staff to access students’ performance data on the modules prior to their appointments. Improvements over the previous online tutorial included expanded content on academic ethics and referencing, more active learning elements, video content, and the opportunity for students to choose discipline-specific examples. In the first four months of its availability, 1650 students completed the course, with 3330 attempts overall.Conclusion – The diverse perspectives and expertise that individuals from OU Libraries and the Writing Center brought to their collaboration greatly informed the development of the course. The time and effort saved by using the university’s existing LMS to develop interactive content and the focus on providing students with opportunities for active learning within the course contributed to the project’s success.

  16. A novel splice-site mutation in angiotensin I-converting enzyme (ACE) gene, c.3691+1G>A (IVS25+1G>A), causes a dramatic increase in circulating ace through deletion of the transmembrane anchor

    NARCIS (Netherlands)

    Persu, A.; Lambert, M.; Deinum, J.; Cossu, M.; Visscher, N. de; Irenge, L.; Ambroise, J.; Minon, J.M.; Nesterovitch, A.B.; Churbanov, A.; Popova, I.A.; Danilov, S.M.; Danser, A.H.; Gala, J.L.


    BACKGROUND: Angiotensin-converting enzyme (ACE) (EC 4.15.1) metabolizes many biologically active peptides and plays a key role in blood pressure regulation and vascular remodeling. Elevated ACE levels are associated with different cardiovascular and respiratory diseases. METHODS AND RESULTS: Two

  17. The United States Air Force Academy: A Bibliography - 1983-1989 (United States)


    251 Dicks, Norman D ....................................... ..................... 58 Dining hall...160 see also subject in text Ethics................................................ 118, 137, 264, 266, 267 Etiquette

  18. Mutational analysis of amino acid residues involved in catalytic activity of a family 18 chitinase from tulip bulbs. (United States)

    Suzukawa, Keisuke; Yamagami, Takeshi; Ohnuma, Takayuki; Hirakawa, Hideki; Kuhara, Satoru; Aso, Yoichi; Ishiguro, Masatsune


    We expressed chitinase-1 (TBC-1) from tulip bulbs (Tulipa bakeri) in E. coli cells and used site-directed mutagenesis to identify amino acid residues essential for catalytic activity. Mutations at Glu-125 and Trp-251 completely abolished enzyme activity, and activity decreased with mutations at Asp-123 and Trp-172 when glycolchitin was the substrate. Activity changed with the mutations of Trp-251 to one of several amino acids with side-chains of little hydrophobicity, suggesting that hydrophobic interaction of Trp-251 is important for the activity. Molecular dynamics (MD) simulation analysis with hevamine as the model compound showed that the distance between Asp-123 and Glu-125 was extended by mutation of Trp-251. Kinetic studies of Trp-251-mutated chitinases confirmed these various phenomena. The results suggested that Glu-125 and Trp-251 are essential for enzyme activity and that Trp-251 had a direct role in ligand binding.


    Energy Technology Data Exchange (ETDEWEB)

    Seaborg, Glenn T.; Street Jr., Kenneth; Thompson, Stanley G.; Ghiorso, Albert


    This volume includes the talks given on January 20, 1975, at a symposium in Berkeley on the occasion of the celebration of the 25th anniversary of the discovery of berkelium and californium. Talks were given at this symposium by the four people involved in the discovery of these elements and by a number of people who have made significant contributions in the intervening years to the investigation of their nuclear and chemical properties. The papers are being published here, without editing, in the form in which they were submitted by the authors in the months following the anniversary symposium, and they reflect rather faithfully the remarks made on that occasion.

  20. Composition containing transuranic elements for use in the homeopathic treatment of aids

    Energy Technology Data Exchange (ETDEWEB)

    Lustig, D.


    A homeopathic remedy consisting of a composition containing one or more transuranic elements, particularly plutonium, for preventing and treating acquired immunodeficiency syndrome (AIDS) in humans, as well as seropositivity for human immunodeficiency virus (HIV). Said composition is characterized in that it uses any chemical or isotopic form of one or more transuranic elements (neptunium, plutonium, americium, curium, berkelium, californium or einsteinium), particularly plutonium, said form being diluted and dynamized according to conventional homeopathic methods, particularly the so-called Hahnemann and Korsakov methods, and provided preferably but not exclusively in the form of lactose and/or saccharose globules or granules impregnated with the active principle of said composition. (author).

  1. Advanced development of the spectrum sciences Model 5005-TF, single-event test fixture

    Energy Technology Data Exchange (ETDEWEB)

    Ackermann, M.R.; Browning, J.S. (Sandia National Labs., Albuquerque, NM (USA)); Hughlock, B.W. (Boeing Aerospace and Electronics Co., Seattle, WA (USA)); Lum, G.K. (Lockheed Missiles and Space Co., Sunnyvale, CA (USA)); Tsacoyeanes, W.C. (Draper (Charles Stark) Lab., Inc., Cambridge, MA (USA)); Weeks, M.D. (Spectrum Sciences, Inc., Santa Clara, CA (USA))


    This report summarizes the advanced development of the Spectrum Sciences Model 5005-TF, Single-Event Test Fixture. The Model 5005-TF uses a Californium-252 (Cf-252) fission-fragment source to test integrated circuits and other devices for the effects of single-event phenomena. Particle identification methods commonly used in high-energy physics research and nuclear engineering have been incorporated into the Model 5005-TF for estimating the particle charge, mass, and energy parameters. All single-event phenomena observed in a device under test (DUT) are correlated with an identified fission fragment, and its linear energy transfer (LET) and range in the semiconductor material of the DUT.


    Energy Technology Data Exchange (ETDEWEB)

    Albrecht-Schmitt, Thomas


    This grant supported the exploratory synthesis of new actinide materials with all of the actinides from thorium to californium with the exceptions of protactinium and berkelium. We developed detailed structure-property relationships that allowed for the identification of novel materials with selective ion-exchange, selective oxidation, and long-range magnetic ordering. We found novel bonding motifs and identified periodic trends across the actinide series. We identified structural building units that would lead to desired structural features and novel topologies. We also characterized many different spectroscopic trends across the actinide series. The grant support the preparation of approximately 1200 new compounds all of which were structurally characterized.

  3. Detection of rare earth elements in Powder River Basin sub-bituminous coal ash using laser-induced breakdown spectroscopy (LIBS)

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Phuoc [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State; Mcintyre, Dustin [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State


    We reported our preliminary results on the use of laser-induced breakdown spectroscopy to analyze the rare earth elements contained in ash samples from Powder River Basin sub-bituminous coal (PRB-coal). We have identified many elements in the lanthanide series (cerium, europium, holmium, lanthanum, lutetium, praseodymium, promethium, samarium, terbium, ytterbium) and some elements in the actinide series (actinium, thorium, uranium, plutonium, berkelium, californium) in the ash samples. In addition, various metals were also seen to present in the ash samples

  4. Antimicrobial activity of some actinomycetes from Western Ghats of ...

    African Journals Online (AJOL)

    Pathalam Ganesan


    MTCC-840), Saccharomyces cerevisiae (MTCC-251),. Shigella .... Medium. Characters. Aerial mycelium. Substrate mycelium. Soluble pigment. Colony margin. Growth. Gram stain. ISP-2. Brown. Yellow. –. Filaments. +++. +.

  5. 75 FR 11535 - Notice of Public Information Collection(s) Being Submitted for Review and Approval to the Office... (United States)


    ... authority for this collection of information is contained in 47 U.S.C. section 251 of the Telecommunications Act of 1996. Total Annual Burden: 5,160 hours. Privacy Act Impact Assessment: N/A. Nature and Extent... estimates. Section 251 is designed to accelerate private sector and deployment of telecommunications...

  6. Authors: H McCreath and R Koen DEFENDING THE ABSURD: THE ...

    African Journals Online (AJOL)


    allowed section 25(1) to retain its reclusive status well into our new constitutional dispensation. However, despite its low profile, section 25(1) was also one of the more controversial provisions in the corpus of the South African law of civil procedure. In terms of the 1996 Constitution, the section was an aspect of old order.

  7. Vreden, adoptivbarn, besyng!

    DEFF Research Database (Denmark)

    Haarder, Jon Helt



  8. Dynamics of the proteome in human and farm animal milk

    NARCIS (Netherlands)

    Zhang, L.



    25.1pt;">The milk proteome changes due to many factors, such as lactation, individual, health status, processing, and species differences. The objective of the work described in this thesis was to increase our

  9. Gclust Server: 119743 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available 119743 CEL_K06A5.7_17506269 Cluster Sequences Related Sequences(24) 604 cdc-25.1: Cell Division Cycle...nces Related Sequences(24) Sequence length 604 Representative annotation cdc-25.1: Cell Division Cycle

  10. 76 FR 41075 - Copyright Arbitration Royalty Panel Rules and Procedures (United States)


    ... Copyright Office 37 CFR Part 251 Copyright Arbitration Royalty Panel Rules and Procedures AGENCY: Copyright Office, Library of Congress. ACTION: Final rule; technical amendment. SUMMARY: The Copyright Office is making an amendment to its regulations by removing Part 251 Copyright Arbitration Royalty Panel Rules of...

  11. SINET: Ethiopian Journal of Science: Contact

    African Journals Online (AJOL)

    Principal Contact. Prof. Gezahegn Yirgu Editor-in-Chief Addis Ababa University Addis Ababa University College of Natural Sciences Arat Kilo Campus P.O.Box 1176 Addis Ababa Ethiopia Phone: 251 111 239462. Fax: 251 111 239462. Email: ...

  12. Ethiopian Journal of Environmental Studies and Management: Contact

    African Journals Online (AJOL)

    Principal Contact. O.A. Ajala Dr Department of Geography and Environmenta Department of Geography and Environmental Studies Bahir Dar University Bahir Phone: +251-911572166. Email: Support Contact. Dept.of Geography Bahir Dar University, Phone: +251-911572166

  13. Gclust Server: 108875 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available Sequences Related Sequences(76) 251 reverse transcriptase 1 9.98e-01 0.0 0.0 0.0 0.0 3.23 0.0 Show 108875...length 251 Representative annotation reverse transcriptase Number of Sequences 1 Homologs 1 Clustering threshold

  14. Gclust Server: 45042 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available Sequences Related Sequences(45) 251 reverse transcriptase 2 1.00e-99 0.0 0.0 0.0 0.0 3.23 0.0 Show 45042...length 251 Representative annotation reverse transcriptase Number of Sequences 2 Homologs 2 Clustering threshold

  15. Processes determining seasonality and interannual variability of settling particle fluxes to the deep Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Haake, B.; Rixen, T.; Reemtsma, T.; Ramaswamy, V.; Ittekkot, V.

    stream_size 20 stream_content_type text/plain stream_name Particle_Flux_Ocean_Chapter_14_1996_251.pdf.txt stream_source_info Particle_Flux_Ocean_Chapter_14_1996_251.pdf.txt Content-Encoding ISO-8859-1 Content-Type text...

  16. Make or Buy: A Systematic Approach to Department of Defense Sourcing Decisions (United States)


    Material & Supply General 3151 Audiovisual Equipment 31.0 Equipment Material & Supply General 3152 Photographic Equipment 31.0 Equipment...Cost Element 251H Translation and Interpreting Services. 25.1 Advisory and Assistance Services Overhead Headquarters Management 252Q Safety and...Equipment Overhead Information Technology 252G Audiovisual Production and Services. 25.2 Other Services Overhead Information Technology 252H

  17. Review: Derek Hook, A Critical Psychology of the Postcolonial: The Mind of Apartheid (2012 Buchbesprechung: Derek Hook, A Critical Psychology of the Postcolonial: The Mind of Apartheid (2012

    Directory of Open Access Journals (Sweden)

    Danielle Faye Tran


    Full Text Available Review of the monograph:Derek Hook, A Critical Psychology of the Postcolonial: The Mind of Apartheid, London: Routledge, 2012, ISBN 978-0-415-58757-0, 251 pagesBesprechung der Monographie:Derek Hook, A Critical Psychology of the Postcolonial: The Mind of Apartheid, London: Routledge, 2012, ISBN 978-0-415-58757-0, 251 Seiten

  18. Browse Author Index

    African Journals Online (AJOL)

    Items 251 - 300 of 982 ... Afouda, Léonard A.C. · Afouda, LCA · Afreh-Nuamah, K · Afuh, DT · AG Arya, Moussa · Agadjihouede, H · Agadjihouede, Hyppolite · Agagbe, A · Agassounon Djikpo Tchibozo, M · Agassounon Djikpo Tchibozo, Micheline · Agassounon Tchibozo Djikpo, M · Agbahungba, AG · Agbaka, A 251 - 300 of 982 ...

  19. Intracellular cholesterol level regulates sensitivity of glioblastoma cells against temozolomide-induced cell death by modulation of caspase-8 activation via death receptor 5-accumulation and activation in the plasma membrane lipid raft. (United States)

    Yamamoto, Yutaro; Tomiyama, Arata; Sasaki, Nobuyoshi; Yamaguchi, Hideki; Shirakihara, Takuya; Nakashima, Katsuhiko; Kumagai, Kosuke; Takeuchi, Satoru; Toyooka, Terushige; Otani, Naoki; Wada, Kojiro; Narita, Yoshitaka; Ichimura, Koichi; Sakai, Ryuichi; Namba, Hiroki; Mori, Kentaro


    Development of resistance against temozolomide (TMZ) in glioblastoma (GBM) after continuous treatment with TMZ is one of the critical problems in clinical GBM therapy. Intracellular cholesterol regulates cancer cell biology, but whether intracellular cholesterol is involved in TMZ resistance of GBM cells remains unclear. The involvement of intracellular cholesterol in acquired resistance against TMZ in GBM cells was investigated. Intracellular cholesterol levels were measured in human U251 MG cells with acquired TMZ resistance (U251-R cells) and TMZ-sensitive control U251 MG cells (U251-Con cells), and found that the intracellular cholesterol level was significantly lower in U251-R cells than in U251-Con cells. In addition, treatment by intracellular cholesterol remover, methyl-beta cyclodextrin (MβCD), or intracellular cholesterol inducer, soluble cholesterol (Chol), regulated TMZ-induced U251-Con cell death in line with changes in intracellular cholesterol level. Involvement of death receptor 5 (DR5), a death receptor localized in the plasma membrane, was evaluated. TMZ without or with MβCD and/or Chol caused accumulation of DR5 into the plasma membrane lipid raft and formed a complex with caspase-8, an extrinsic caspase cascade inducer, reflected in the induction of cell death. In addition, treatment with caspase-8 inhibitor or knockdown of DR5 dramatically suppressed U251-Con cell death induced by combination treatment with TMZ, MβCD, and Chol. Combined treatment of Chol with TMZ reversed the TMZ resistance of U251-R cells and another GBM cell model with acquired TMZ resistance, whereas clinical antihypercholesterolemia agents at physiological concentrations suppressed TMZ-induced cell death of U251-Con cells. These findings suggest that intracellular cholesterol level affects TMZ treatment of GBM mediated via a DR5-caspase-8 mechanism. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Carboplatin and taxol resistance develops more rapidly in functional BRCA1 compared to dysfunctional BRCA1 ovarian cancer cells. (United States)

    Busschots, Steven; O'Toole, Sharon; O'Leary, John J; Stordal, Britta


    A major risk factor for ovarian cancer is germline mutations of BRCA1/2. It has been found that (80%) of cellular models with acquired platinum or taxane resistance display an inverse resistance relationship, that is collateral sensitivity to the other agent. We used a clinically relevant comparative selection strategy to develop novel chemoresistant cell lines which aim to investigate the mechanisms of resistance that arise from different exposures of carboplatin and taxol on cells having BRCA1 function (UPN251) or dysfunction (OVCAR8). Resistance to carboplatin and taxol developed quicker and more stably in UPN251 (BRCA1-wildtype) compared to OVCAR8 (BRCA1-methylated). Alternating carboplatin and taxol treatment delayed but did not prevent resistance development when compared to single-agent administration. Interestingly, the sequence of drug exposure influenced the resistance mechanism produced. UPN251-6CALT (carboplatin first) and UPN251-6TALT (taxol first) have different profiles of cross resistance. UPN251-6CALT displays significant resistance to CuSO4 (2.3-fold, p=0.004) while UPN251-6TALT shows significant sensitivity to oxaliplatin (0.6-fold, p=0.01). P-glycoprotein is the main mechanism of taxol resistance found in the UPN251 taxane-resistant sublines. UPN251 cells increase cellular glutathione levels (3.0-fold, p=0.02) in response to carboplatin treatment. However, increased glutathione is not maintained in the carboplatin-resistant sublines. UPN251-7C and UPN251-6CALT are low-level resistant to CuSO4 suggesting alterations in copper metabolism. However, none of the UPN251 sublines have alterations in the protein expression of ATP7A or CTR1. The protein expression of BRCA1 and MRP2 is unchanged in the UPN251 sublines. The UPN251 sublines remain sensitive to parp inhibitors veliparib and CEP8983 suggesting that these agents are candidates for the treatment of platinum/taxane resistant ovarian cancer patients. Copyright © 2014 Elsevier Inc. All rights

  1. Measurements of the neutron capture cross sections and incineration potentials of minor-actinides in high thermal neutron fluxes: Impact on the transmutation of nuclear wastes; Mesures des sections efficaces de capture et potentiels d'incineration des actinides mineurs dans les hauts flux de neutrons: Impact sur la transmutation des dechets

    Energy Technology Data Exchange (ETDEWEB)

    Bringer, O


    This thesis comes within the framework of minor-actinide nuclear transmutation studies. First of all, we have evaluated the impact of minor actinide nuclear data uncertainties within the cases of {sup 241}Am and {sup 237}Np incineration in three different reactor spectra: EFR (fast), GT-MHR (epithermal) and HI-HWR (thermal). The nuclear parameters which give the highest uncertainties were thus highlighted. As a result of fact, we have tried to reduce data uncertainties, in the thermal energy region, for one part of them through experimental campaigns in the moderated high intensity neutron fluxes of ILL reactor (Grenoble). These measurements were focused onto the incineration and transmutation of the americium-241, the curium-244 and the californium-249 isotopes. Finally, the values of 12 different cross sections and the {sup 241}Am isomeric branching ratio were precisely measured at thermal energy point. (author)

  2. A gas secondary electron detector

    CERN Document Server

    Drouart, A; Alamanos, N; Auger, F; Besson, P; Bougamont, E; Bourgeois, P; Lobo, G; Pollacco, E C; Riallot, M


    A new Secondary Electron gas Detector (SED) is under development to be used in conjunction with an emissive foil to detect low energy heavy ions as an alternative to micro-channel plates. It could measure position and time of flight. Secondary electrons are accelerated to 10 keV so that they can cross through the 0.9 mu m Mylar entrance window. The electrons then are multiplied in the isobutane gas of the detector at 4-10 Torr. A time resolution of 150 ps and a spatial resolution of 3 mm have been obtained by using californium fission fragments on a prototype detector of 7x7 cm sup 2. The advantage of the SED against MCP is that its size is not limited. Our final goal is to build a large size detector (15x40 cm sup 2) that will operate at the focal plane of the VAMOS magnetic spectrometer at GANIL.

  3. Environmental assessment of the thermal neutron activation explosive detection system for concourse use at US airports

    Energy Technology Data Exchange (ETDEWEB)

    Jones, C.G.


    This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs.

  4. Chelation and stabilization of berkelium in oxidation state +IV (United States)

    Deblonde, Gauthier J.-P.; Sturzbecher-Hoehne, Manuel; Rupert, Peter B.; An, Dahlia D.; Illy, Marie-Claire; Ralston, Corie Y.; Brabec, Jiri; de Jong, Wibe A.; Strong, Roland K.; Abergel, Rebecca J.


    Berkelium (Bk) has been predicted to be the only transplutonium element able to exhibit both +III and +IV oxidation states in solution, but evidence of a stable oxidized Bk chelate has so far remained elusive. Here we describe the stabilization of the heaviest 4+ ion of the periodic table, under mild aqueous conditions, using a siderophore derivative. The resulting Bk(IV) complex exhibits luminescence via sensitization through an intramolecular antenna effect. This neutral Bk(IV) coordination compound is not sequestered by the protein siderocalin—a mammalian metal transporter—in contrast to the negatively charged species obtained with neighbouring trivalent actinides americium, curium and californium (Cf). The corresponding Cf(III)-ligand-protein ternary adduct was characterized by X-ray diffraction analysis. Combined with theoretical predictions, these data add significant insight to the field of transplutonium chemistry, and may lead to innovative Bk separation and purification processes.

  5. The CARIBU EBIS control and synchronization system (United States)

    Dickerson, Clayton; Peters, Christopher


    The Californium Rare Isotope Breeder Upgrade (CARIBU) Electron Beam Ion Source (EBIS) charge breeder has been built and tested. The bases of the CARIBU EBIS electrical system are four voltage platforms on which both DC and pulsed high voltage outputs are controlled. The high voltage output pulses are created with either a combination of a function generator and a high voltage amplifier, or two high voltage DC power supplies and a high voltage solid state switch. Proper synchronization of the pulsed voltages, fundamental to optimizing the charge breeding performance, is achieved with triggering from a digital delay pulse generator. The control system is based on National Instruments realtime controllers and LabVIEW software implementing Functional Global Variables (FGV) to store and access instrument parameters. Fiber optic converters enable network communication and triggering across the platforms.

  6. Off-line commissioning of EBIS and plans for its integration into ATLAS and CARIBU

    Energy Technology Data Exchange (ETDEWEB)

    Ostroumov, P. N., E-mail:; Barcikowski, A.; Dickerson, C. A.; Mustapha, B.; Perry, A.; Sharamentov, S. I.; Vondrasek, R. C.; Zinkann, G. [Argonne National Laboratory, Argonne, Illinois 60439 (United States)


    An Electron Beam Ion Source Charge Breeder (EBIS-CB) has been developed at Argonne to breed radioactive beams from the CAlifornium Rare Isotope Breeder Upgrade (CARIBU) facility at Argonne Tandem Linac Accelerator System (ATLAS). The EBIS-CB will replace the existing ECR charge breeder to increase the intensity and significantly improve the purity of reaccelerated radioactive ion beams. The CARIBU EBIS-CB has been successfully commissioned offline with an external singly charged cesium ion source. The performance of the EBIS fully meets the specifications to breed rare isotope beams delivered from CARIBU. The EBIS is being relocated and integrated into ATLAS and CARIBU. A long electrostatic beam transport system including two 180° bends in the vertical plane has been designed. The commissioning of the EBIS and the beam transport system in their permanent location will start at the end of this year.

  7. Populations of selected microbial and fungal species growing on the surface of rape seeds following treatment with desiccants or plant growth regulators. (United States)

    Frac, Magdalena; Jezierska-Tys, Stefania; Tys, Jerzy


    The aim of this study was to determine the effects of desiccants and plant growth regulators on selected microbial species affecting rape seeds, with special emphasis on the growth of fungi and identification of the genus and species composition. The experimental material in the study was seeds of winter rape cv. Californium that were collected from the field during combine harvest. The chemical agents applied, both desiccants and growth regulators, generally decreased the populations of bacteria occurring on the surface of rape seeds. The responses of fungi depended upon the type of agent applied and were manifested as either stimulation or inhibition of the growth of the fungal species. The fungi isolated from the surface of rape seeds were characteristic of those found in the field environment (Cladosporium and Penicillium) and typical for those present on the surface of rape seeds (Alternaria).

  8. Reliability of semiconductor and gas-filled diodes for over-voltage protection exposed to ionizing radiation

    Directory of Open Access Journals (Sweden)

    Stanković Koviljka


    Full Text Available The wide-spread use of semiconductor and gas-filled diodes for non-linear over-voltage protection results in a variety of possible working conditions. It is therefore essential to have a thorough insight into their reliability in exploitation environments which imply exposure to ionizing radiation. The aim of this paper is to investigate the influence of irradiation on over-voltage diode characteristics by exposing the diodes to californium-252 combined neutron/gamma radiation field. The irradiation of semiconductor over-voltage diodes causes severe degradation of their protection characteristics. On the other hand, gas-filled over-voltage diodes exhibit a temporal improvement of performance. The results are presented with the accompanying theoretical interpretations of the observed changes in over-voltage diode behaviour, based on the interaction of radiation with materials constituting the diodes.

  9. Triton and alpha-particle contribution from LiF converter for neutron dosimeter

    CERN Document Server

    Camacho, M E; Balcazar, M


    A personnel neutron dosimeter prototype based on chemical and electrochemical etched CR-39 detector, combined with LiF converter, has been calibrated using an ICRP-like phantom, under a heavy-water moderated Californium source neutron spectra; A conversion factor of 1.052+-126 spots cm sup - sup 2 mSv sup - sup 1 was obtained. The sealing properties of the detector holder showed a ten-fold reduction in radon background when it was tested in a high radon atmosphere. A convenient mechanical shock resistance was achieved in LiF converters by sintering to 11 tons pressure LiF powder at 650 deg. C, during one hour.

  10. Microbial ecology of Campylobacter jejuni in a United Kingdom chicken supply chain: intermittent common source, vertical transmission, and amplification by flock propagation.


    Pearson, A. D.; Greenwood, M. H.; Feltham, R K; Healing, T. D.; Donaldson, J; Jones, D M; Colwell, R. R.


    A study of Campylobacter jejuni on a broiler chicken farm between 1989 and 1994 gave an estimated isolation rate of 27% (3,304 of 12,233) from a 0.9% sample of 1.44 million broiler chickens from six to eight sheds over 32 consecutive rearing flocks comprising 251 broiler shed flocks. During the study, C. jejuni was found in 35.5% of the 251 shed flocks but only 9.2% (23 of 251) had Campylobacter isolates in successive flocks, with 9 of those 23 sheds having the same serotype between consecuti...

  11. Dicty_cDB: Contig-U04446-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available M6 microsatellite AG25-1... 46 1.2 1 ( AY446835 ) Morone saxatilis isolate T1 microsatellite AG25-1....IH3 microsatellite AG25-... 46 1.2 1 ( AY446833 ) Morone saxatilis isolate CW15 microsatellite AG25......CH8 microsatellite AG25-... 46 1.2 1 ( AY446831 ) Morone saxatilis isolate MOT4 microsatellite AG25......MOT1 microsatellite AG25... 46 1.2 1 ( AY446829 ) Morone saxatilis isolate JC1 microsatellite AG25-......E4 microsatellite AG25-1... 46 1.2 1 ( AY446827 ) Morone saxatilis isolate HB1 microsatellite AG25-..

  12. AcEST: DK952464 [AcEST

    Lifescience Database Archive (English)

    Full Text Available . 251 2e-65 tr|Q7FZ76|Q7FZ76_ORYSA UMP synthase OS=Oryza sativa GN=UMPS1 PE=... 251 2e-65 tr|B6T8L8|B6T8L8_M...g0951200 protein) (UMP synthase) OS=Oryza sativa subsp. japonica GN=UMPS1 PE=2 SV=1 Length = 477 Score = 251...7FZ76|Q7FZ76_ORYSA UMP synthase OS=Oryza sativa GN=UMPS1 PE=2 SV=1 Length = 477 S

  13. Study of reproducibility of measurements with the spectrometer of Bonner multispheres

    Energy Technology Data Exchange (ETDEWEB)

    Azevedo, G.A.; Pereira, W.W.; Patrao, K.C.S.; Fonseca, E.S., E-mail:, E-mail:, E-mail:, E-mail: [Instituto de Radionprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil)


    This work aims to study the metrological behavior of the Bonner Multisphere Spectrometer (BMS) of the LN / LNMRI / IRD - Laboratorio Metrologia de Neutrons / Laboratorio Nacional de Metrologia e Radiacao Ionizante / Instituto de Radioprotecao e Dosimetria, for measurements in repeatability and reproducibility conditions. Initially, a simulation was done by applying the Monte Carlo method, using the MCNP code and respecting the ISO 8529-1 (2001), using the sources of Californium ({sup 252} Cf), Americium-Beryllium ({sup 241} AmBe) and californium in heavy water (Cf + D{sub 2}O), all located at a distance of 100 cm from the neutron detector ({sup 6}Li (Eu) - crystal scintillator). In this program, the counting of neutrons that are captured by the detector was made. The source is located in the center of a sphere of radius 300 cm. Analyzes the impact of these neutrons in a point of the sphere wall, which in this case acted as a neutron detector and from there, it is estimated the number of neutrons that collide in the whole sphere. The purpose is to obtain the neutron count for different energy bands in a solid field of neutrons, since they have a spectrum ranging from a low to a high energy that can also vary within a particular environment. Wishes to obtain new fields with different sources and moderators materials to be used as new reference fields. Measurements are being conducted for these fields, with the aim of analyzing the variability conditions of the measurement (repeatability and reproducibility) in LEN - Laboratorio de Espectrometria de Neutrons of the LN/LMNRI/IRD. Thus, the spectrometer will be used to improve both the knowledge of the spectrum as the standard of neutrons of the lab, proving that a spectrometry is essential for correct measurement.

  14. Browse Title Index

    African Journals Online (AJOL)

    CC): Racial discrimination laws and the interests of justice* *, Abstract PDF. C Rautenbach. Vol 4, No 1 (2001), Mthembu v Letsela: The non-decision, Abstract PDF. AM Janse van Rensburg. 251 - 300 of 647 Items, >> ...

  15. 19 CFR 142.4 - Bond requirements. (United States)


    ... opinion of the port director based on past experience, a question of redelivery. (R.S. 251, as amended... (i) quota merchandise, (ii) any type of merchandise which, in the opinion of the port director...


    African Journals Online (AJOL)

    , systematics, diagnostic veterinology and control measures. In view of this it has been decided to present .... Beitriige zur biochemischen Mikromethodik. IV. Nephelome- trische Mikrobestirnmung von Pepsin. Z. Physiol. Chem., 227; 251. 56.

  17. 40 CFR 264.254 - Monitoring and inspection. (United States)


    ... liners and covers must be inspected to ensure tight seams and joints and the absence of tears, punctures... detection system under § 264.251(c) must record the amount of liquids removed from each leak detection...

  18. Browse Title Index

    African Journals Online (AJOL)

    Aldershot: Ashgate, 2003), Abstract. Pedro Tabensky. Vol 32, No 2 (2013) .... Vol 25, No 1 (2006), Stoic warriors and stoic torturers: the moral psychology of military torture, Abstract. Jessica Wolfendale. 251 - 300 of 412 ...

  19. Maheshwari, Prof. Satish Chandra

    Indian Academy of Sciences (India)

    Delhi), FNA, FNASc. Date of birth: 4 October 1933. Specialization: Physiology & Biochemistry of Plant Growth & Development and Plant Molecular Biology Address: 251/56, Prathap Enclave, Haldighati Road, Jaipur 302 033, Rajasthan Contact ...

  20. 78 FR 14625 - National Consumer Protection Week, 2013 (United States)


    ... for Fiscal Year 2013 Pursuant to Section 251A of the Balanced Budget and Emergency Deficit Control Act... fraud and investigate the abusive lending and mortgage packaging that led to the housing crisis. We...

  1. (TCF7L2) variations associated with earlier age-onset of type 2 ...

    Indian Academy of Sciences (India)

    onset of type 2 diabetes in Thai patients. Watip Tangjittipokin, Nalinee Chongjarean, Nattachet Plengvidhya, Mayuree Homsanit and Pa-Thai Yenchitsomanus. J. Genet. 91, 251–255. Table 1. Details of primers and PCR reaction condition. SNP.

  2. Healthy living initiative: running/walking club

    National Research Council Canada - National Science Library

    Stylianou, Michalis; Kulinna, Pamela Hodges; Kloeppel, Tiffany


    ...) to gain insights on the teachers' perspectives of the club. Participants were students (N = 251) and teachers (N = 24) from an elementary school in one American Indian community in the southwestern United States...

  3. Varadhan, Prof. Srinivasa S R

    Indian Academy of Sciences (India)

    Varadhan, Prof. Srinivasa S R . Date of birth: 2 January 1940. Address: Department of Mathematics, Courant Institute, New York University, 251, Mercer Street, New York, NY 10012, U.S.A.. Contact: Office: (+1-212) 982 9883

  4. Author Index S¯adhan¯a Vol. 36, 2011

    Indian Academy of Sciences (India)

    . 267. Kovac P see Gostimirovic M. 489. Koyuncu M. An inheritance complexity metric for object- oriented code: A cognitive approach. 317. Kumar N. Melt pool vorticity in deep penetration laser material welding. 251. Kumar R R see Dileep P N.

  5. Wide Output Range Power Processing Unit for Electric Propulsion Project (United States)

    National Aeronautics and Space Administration — A power supply concept capable of operation over 25:1 and 64:1 impedance ranges at full power has been successfully demonstrated in our Phase I effort at...

  6. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    projective only when so is . These claims extend results of such a kind obtained by Benabdallah, Eisenstadt, Irwin and Poluianov, Acta Math. Acad. Sci. Hungaricae (1970) and Khan, Proc. Indian Acad. Sci. Sect. A (1978). pp 235-251.

  7. Gclust Server: 91106 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available NCR_NCU03803 Cluster Sequences Related Sequences(251) 292 sorbitol utilization protein SOU2 (translation) (293 aa);...Sequence length 292 Representative annotation sorbitol utilization protein SOU2 (translation) (293 aa);

  8. Drug: D00096 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available anal organ agents 251 Urinary organ agents 2519 Others D00096 D-Sorbitol (JP16); Sorbitol (NF) 7 Agents not mainly for therapeutic... purpose 79 Other agents not mainly for therapeutic purpose 799 Miscellaneous 7990 Mis

  9. 29 CFR 783.40 - “Documented” vessel. (United States)


    ..., enrolled and licensed, or licensed by the Bureau of Customs under the laws of the United States (46 U.S.C. 11, 193, 251-252, 258, 840). Although Bureau of Customs regulations provide for three types of...

  10. Waterborne Commerce of the United States Calendar Year 1987. Part 2. Waterways and Harbors Gulf Coast, Mississippi River System and Antilles (United States)


    2041 WHEAT FLOUR AND SEMOLINA ........................ .36...........38...584 265 251------------------66........... 2041 AHEAT FLOJR AND SEMOLINA ------ --------------------------------------- ---------- 36...VEG JUICE, 4EC.............................. 17 17 .......... .......... .......... .......... ............. Z042 NHEAt FLOUR AND SEMOLINA

  11. Sensitization of Secondary School Students towards Sustainable ...

    African Journals Online (AJOL)



    Jul 26, 2012 ... Sensitization of Secondary School Students towards. Sustainable Electoral Process in Nigeria: Nigeria. Independent Electoral Commission as a Focus. (Pp. 239-251). Uhunmwuangho, Sunday Okungbowa - Lecturer, Institute of Public. Administration & Extension Services, University of Benin, Benin City,.

  12. Diatoms as indicators of water quality in the Jukskei-Crocodile river ...

    African Journals Online (AJOL)


    Apr 2, 2005 ... provide a reflection of water quality based on the specific pollu- tion tolerances .... modern diatom pollution indices that have been developed and tested over ...... Publishing Company, Houston, Texas. pp 251-281. ZELINKA M ...

  13. ORF Alignment: NC_000913 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available db|1JCL|B Chain ... B, Observation Of Covalent Intermediates In An Enzyme ... Mechanism At In An Enzyme ... Mechanism At Atomic Resolution ... Length = 251 ... Query: 1 ... MTDLKASSLRALKX

  14. ORF Alignment: NC_004431 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available db|1JCL|B Chain ... B, Observation Of Covalent Intermediates In An Enzyme ... Mechanism At In An Enzyme ... Mechanism At Atomic Resolution ... Length = 251 ... Query: 9 ... MTDLKASSLRALKX

  15. Intrinsic defects, nonstoichiometry and aliovalent doping of A.sup.2+./sup. B.sup.4+./sup.O.sub.3./sub. perovskite scintillators

    Czech Academy of Sciences Publication Activity Database

    Casillas-Trujillo, L.; Andersson, D.A.; Dorado, B.; Nikl, Martin; Sickafus, K.E.; McClellan, K.J.; Stanek, C.R.


    Roč. 251, č. 11 (2014), s. 2279-2286 ISSN 0370-1972 Institutional support: RVO:68378271 Keywords : atomistic simulation * defects * nonstoichiometry * perovskites * scintillators Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.489, year: 2014

  16. Defending the absurd: the iconoclast's guide to section 47(1) of the ...

    African Journals Online (AJOL)

    This contribution was intended as a defence of section 25(1) of the Supreme Court Act 59 of 1959. However, the Supreme Court Act was repealed in August 2013 and replaced by the Superior Courts Act 10 of 2013, and in the process section 25(1) of the former gave way to section 47(1) of the latter. Both sections concern ...

  17. EST Table: FS912760 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS912760 E_FL_fufe_27D02_F_0 11/12/09 n.h 10/09/28 56 %/251 aa ref|XP_001810438.1| ...l|Amel|GB19927-PA 10/09/10 56 %/251 aa gi|189242283|ref|XP_001810438.1| PREDICTED: similar to wd-repeat protein [Tribolium castaneum] FS912760 fufe ...

  18. Computational Modeling and High Performance Computing in Advanced Materials Processing, Synthesis, and Design (United States)


    methods Journal of Computational Physics, Volume 200, Issue 2, (2004) 251-266. [17] Andersen C. H., Molecular dynamics simulations at constant pressure...Physics, Volume 200, Issue 2, (2004) 251-266. 47 [22] Andersen C. H., Molecular dynamics simulations at constant pressure and/or temperature...thriving game industry [1, 2, 7]. The differences in CPU and GPU computational power can be traced back to the designs upon which the two are predicated

  19. 76 FR 62694 - Appeal of Decisions Relating to Occupancy or Use of National Forest System Lands and Resources (United States)


    ... Forest Service 36 CFR Parts 212, 214, 215, 218, 222, 228, 241, 251, 254, and 292 RIN 0596--AB45 Appeal of.... 214.10 Dismissal of an appeal. Sec. 251.93 Resolution of issues..... Sec. 214.15 Resolution of issues... noncompliance pursuant to 36 CFR part 228, subpart A or D, or part 292, subpart D, F, or G; (2) Approval or...

  20. Tightly Integrating Optical And Inertial Sensors For Navigation Using The UKF (United States)


    16 2.5 Measurement Model . . . . . . . . . . . . . . . . . . . . 18 2.5.1 Estimating Location of Landmark Using Binocu- lar Stereopsis ... stereopsis with no terrain model is addressed and used in this research to estimate landmark location. 2.5.1 Estimating Location of Landmark Using Binocular... Stereopsis . It is possible to determine the distance of an object within an image utilizing binocular measurements. In order to estimate the landmark

  1. Electrode Placement for Active Tuning of Silicon-on-Insulator (SOI) Ring Resonator Structure Clad in Nematic Liquid Crystals (United States)


    1.573, and its threshold voltage is Vt = 1.61V, and saturation voltage Vsat = 2.51 V. LIXON’s clearing point temperature is 123 °C. Figure 4 depicts...applied potential. The field for most of the sample is 1.68 V/μm, which is above the threshold voltage of LIXON™. Saturation voltage, Vsat = 2.51 V

  2. The effect of transport density and gender on stress indicators and carcass and meat quality in pigs

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, T.L.; Corassa, A.; Komiyama, C. M.; Araújo, C.V.; Kataoka, A.


    A total of 168 finishing pigs were used to investigate the effects of gender (barrows and gilts) and transport densities for slaughter (236, 251, and 275 kg/m²) on stress indicators and carcass and pork quality. The animals transported at 251 kg/m² (T251) presented cortisol values below those at 236 kg/m2 (T236), but no different from those at 275 kg/m2 (T275). The lactate dehydrogenase (LDH) values in pigs transported at T236 were the lowest. The blood components did not differ between T236 and T275. The pH values at 45 min (pH45) and at 24 h (pH24) postmortem were higher for pigs subjected to T236. However, the pH45 was higher at T251 than at T275, but pH24 was lower at T251 than at T275. The lightness values in the muscles of the pigs transported at T236 and T251 were higher than those at T275. Lower drip loss values were observed in the muscle of animals at T251. Carcasses of pigs at T236 contained more 1–5 cm lesions while those at T275 contained more 5–10 cmlesions in sections of loin. No significant effects of gender were found on the stress indicators, blood components, pH45, pH24, color, drip loss or carcass lesions in general. These results indicate that the pre-slaughter transport of pigs at densities of 251 kg/m² generates less physiological damage and smaller losses on carcass and pork quality irrespective of gender. (Author)

  3. Directory of Federal Contacts on Environmental Protection, (United States)


    Stevens 09F 3942 Special Asssistant for Ecology Mr. S. D. Hami Iton, Jr. 09FA 3942 EIA/EIS Mr. H. Nishimura 111 3213 BTU Program Mr. Stephen Surface 111:SS...Robert C. Coffin , Jr. 251A 4182 Information Coordination George D. Wandrocke 258 4984 Legislation Coordination Wait Richardson 251C 4067 Ships Program...Shale Derived Fuels Lt Col C. Harrah THE 3364 Ecological Standards & Cr i teri a 61 U. S. AIR FORCE ACTIVITY TELEPHONE Aerospace Medical Division AREA

  4. Survey Software Evaluation (United States)


    authentication via secure Lightweight Directory Access Protocol ( LDAP ) directory services, publishing updates to the technical mechanism used for directory...Access Protocol ( LDAP ) or a waiver must be granted. AR 25-1 6–4 n. Secure Sockets Layer (SSL) must be enabled using DoD public key infrastructure (PKI...certificates for server authentication and client/server authentication . AR 25-1 6–4 n. The minimum security provided for sensitive by

  5. Sterile alpha motif containing domain 9 is involved in death signaling of malignant glioma treated with inactivated Sendai virus particle (HVJ-E) or type I interferon. (United States)

    Tanaka, Masahiko; Shimbo, Takashi; Kikuchi, Yasushi; Matsuda, Masahide; Kaneda, Yasufumi


    Malignant glioma is one of the most aggressive cancers. For the development of effective therapeutic strategies against such malignant diseases, elucidation of molecular targets is necessary. We found that inactivated Sendai virus particle (HVJ-E) induced extensive cell death in the human glioblastoma cell line U251MG. Intradermal U251MG tumors were more effectively suppressed by HVJ-E than interferon (IFN)-beta. From microarray analysis of gene expression in U251MG cells treated with HVJ-E, we focused on the up-regulation of sterile alpha motif containing domain 9 (SAMD9) gene. The expression of the SAMD9 gene was induced by administration of recombinant human IFN-alpha, -beta or -gamma. The up-regulation of the SAMD9 gene by HVJ-E treatment was abrogated by IFN receptor blocking antibody or JAK inhibitor treatment. When SAMD9 expression was knocked down by RNA interference, apoptotic cell death induced by HVJ-E was blocked in U251MG cells. Suppression of SAMD9 using SAMD9 siRNA also inhibited IFN-beta-induced death in U251MG cells with a small, but significant, difference to control groups. However, overexpression of the SAMD9 gene failed to induce significant cell death in U251MG cells. Thus, SAMD9 could be a key molecule to control cancer cell death by HVJ-E or IFN-beta treatment.

  6. Clinically palpable breast abnormalities with normal imaging: Is clinically guided biopsy still required?

    Energy Technology Data Exchange (ETDEWEB)

    Gumus, H., E-mail: [Department of Radiology, Dicle University, Medical School, Diyarbak Latin-Small-Letter-Dotless-I r (Turkey); Gumus, M. [Department of General Surgery, Dicle University, Medical School, Diyarbak Latin-Small-Letter-Dotless-I r (Turkey); Mills, P. [Department of Radiology, Maidstone Hospital, Maidstone, Kent (United Kingdom); Fish, D. [Department of Pathology, Maidstone Hospital, Maidstone, Kent (United Kingdom); Devalia, H.; Jones, S.E.; Jones, P.A. [Department of Surgery, Maidstone Hospital, Maidstone, Kent (United Kingdom); Sever, Ali R. [Department of Radiology, Maidstone Hospital, Maidstone, Kent (United Kingdom)


    Aim: To determine the need for a fine-needle or core biopsy in patients with clinically palpable breast abnormalities who have negative mammographic and sonographic findings. Method and materials: Over a 12-year period, 251 patients with a palpable abnormality at presentation and who had a negative ultrasound and mammogram underwent clinically guided biopsy (CGB) by breast surgeons. This was 2.7% (251/9313) of all breast biopsies performed from January 1999 to December 2010. Physical findings were qualitatively categorized into five groups as clinically 'normal', 'benign', 'probably benign', 'suspicious', and 'malignant' at the time of initial assessment. The number of biopsies for each category and biopsy results were analysed retrospectively. Results: Three (1.2%) of the 251 CGBs were reported as malignant; two (0.8%) of which were invasive. Forty-six (18.3%) of the 251 cases were regarded as clinically suspicious or malignant while the remaining 215 examinations were categorized as benign or probably benign. All three malignancies were in the clinically suspicious or malignant group. Conclusion: A negative ultrasound and mammogram in patients with a palpable abnormality does not exclude breast cancer; however, the likelihood is very low (1.2%). In this study, 81.7% of biopsies (205/251) could have been avoided if CGB was reserved for the clinically suspicious or malignant group only without missing any malignancies.

  7. Conditioned Media from Human Adipose Tissue-Derived Mesenchymal Stem Cells and Umbilical Cord-Derived Mesenchymal Stem Cells Efficiently Induced the Apoptosis and Differentiation in Human Glioma Cell Lines In Vitro

    Directory of Open Access Journals (Sweden)

    Chao Yang


    Full Text Available Human mesenchymal stem cells (MSCs have an intrinsic property for homing towards tumor sites and can be used as tumor-tropic vectors for tumor therapy. But very limited studies investigated the antitumor properties of MSCs themselves. In this study we investigated the antiglioma properties of two easily accessible MSCs, namely, human adipose tissue-derived mesenchymal stem cells (ASCs and umbilical cord-derived mesenchymal stem cells (UC-MSCs. We found (1 MSC conditioned media can significantly inhibit the growth of human U251 glioma cell line; (2 MSC conditioned media can significantly induce apoptosis in human U251 cell line; (3 real-time PCR experiments showed significant upregulation of apoptotic genes of both caspase-3 and caspase-9 and significant downregulation of antiapoptotic genes such as survivin and XIAP after MSC conditioned media induction in U 251 cells; (4 furthermore, MSCs conditioned media culture induced rapid and complete differentiation in U251 cells. These results indicate MSCs can efficiently induce both apoptosis and differentiation in U251 human glioma cell line. Whereas UC-MSCs are more efficient for apoptosis induction than ASCs, their capability of differentiation induction is not distinguishable from each other. Our findings suggest MSCs themselves have favorable antitumor characteristics and should be further explored in future glioma therapy.

  8. Serenoa Repens Induces Growth Arrest, Apoptosis and Inactivation of STAT3 Signaling in Human Glioma Cells. (United States)

    Zhou, Tiezhu; Yang, Yang; Zhang, Hongyan; Che, Yuqin; Wang, Wei; Lv, Hui; Li, Jie; Wang, Yuanyuan; Hou, Shuai


    Serenoa repens, the extract of berry in Southeastern United States, is one of several phytotherapeutic agents available for the treatment of Benign prostatic hyperplasia (BPH). In this study, we found for the first time that Serenoa repens effectively inhibited the growth of human U87 and U251 glioma cells. Flow cytometry assay showed that Serenoa repens induced apoptosis of U87 and U251 glioma cells in a dose-dependent manner. Also, Serenoa repens increased the expression of cleaved-PARP, Caspase-3 or p27 protein in these two cell lines, respectively. In addition, we found that Serenoa repens down-regulated basal level of phosphorylated form of signal transducer and activator of transcription 3 (STAT 3) in both U87 and U251 glioma cells. Furthermore, it was discovered that a Janus family of tyrosine kinase (JAK) inhibitor AG490 inhibit the growth of human U87 and U251 glioma cells and AG490 enhanced the ability of Serenoa repens to inhibit the growth of U87 and U251 glioma cells as measured by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. These results indicate that Serenoa repens reduces the growth, causes apoptosis of Glioma cells and inhibits STAT 3 signaling. In addition, it might also be useful for the treatment of individuals with glioma. © The Author(s) 2014.

  9. Dicty_cDB: VHB675 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available library) VHB675 (Link to dictyBase) - - - Contig-U16597-1 VHB675P (Link to Original site) VHB675F 617 VHB675Z...VHB675Z 719 VHB675P 1316 - - Show VHB675 Library VH (Link to library) Clone ID VHB675 (Link to dictyBase) Representative seq. ID VHB675P (Link to Original site) Representative DNA sequence >VHB675 (VHB675Q) /CSM/VH/VHB6-D/VHB675Q.Seq.d/ TTTATTTTTTTTTTGATCGTTC...Value VHB675 (VHB675Q) /CSM/VH/VHB6-D/VHB675Q.Seq.d/ 2339 0.0 VHB251 (VHB251Q) /CSM/VH/VHB2-C/VHB251Q.Seq

  10. Chryseobacterium chengduensis sp. nov. isolated from the air of captive giant panda enclosures in Chengdu, China. (United States)

    Wen, Cai-Fang; Xi, Li-Xin; Zhao, Shan; Hao, Zhong-Xiang; Luo, Lu; Liao, Hong; Chen, Zhen-Rong; She, Rong; Han, Guo-Quan; Cao, San-Jie; Wu, Rui; Yan, Qi-Gui; Hou, Rong


    A Gram-negative, aerobic, non-motile, rod-shaped bacterial strain, designated 25-1(T), was isolated from the air inside giant panda enclosures at the Chengdu Research Base of Giant Panda Breeding, China. Strain 25-1(T) grew optimally at pH 7.0-8.0, at 28-30 °C and in the presence of NaCl concentrations from 0.0% to 0.5 %. 16S rRNA gene sequence analysis indicated that strain 25-1(T) belongs to the genus Chryseobacterium within the family Flavobacteriaceae and is related most closely to C. carnis G81(T) (96.4% similarity), C. lathyri RBA2-6(T) (95.8% similarity), and C. zeae JM1085(T) (95.8% similarity). Its genomic DNA G+C molar composition was 36.2%. The major cellular fatty acids were iso-C15:0 (44.0%), iso-C17:0 3OH (19.8%) and C16:1 ω7c/16:1 ω6c (12.7%). The only isoprenoid quinone was menaquinone 6 (MK-6). The major polar lipids were phosphatidylethanolamine, two unidentified amino lipids and two unidentified lipids. The DNA-DNA relatedness between strain 25-1(T) and C. lathyri RBA2-6(T) was 38%. Phenotypic, genotypic, and phylogenetic characteristics indicated that strain 25-1(T) is a novel member of the genus Chryseobacterium, for which the name C. chengduensis sp. nov. is proposed. The type strain is 25-1(T) (CCTCC AB2015133(T)=DSM 100396(T)).

  11. Chryseobacterium chengduensis sp. nov. isolated from the air of captive giant panda enclosures in Chengdu, China* # (United States)

    Wen, Cai-fang; Xi, Li-xin; Zhao, Shan; Hao, Zhong-xiang; Luo, Lu; Liao, Hong; Chen, Zhen-rong; She, Rong; Han, Guo-quan; Cao, San-jie; Wu, Rui; Yan, Qi-gui; Hou, Rong


    A Gram-negative, aerobic, non-motile, rod-shaped bacterial strain, designated 25-1T, was isolated from the air inside giant panda enclosures at the Chengdu Research Base of Giant Panda Breeding, China. Strain 25-1T grew optimally at pH 7.0–8.0, at 28–30 °C and in the presence of NaCl concentrations from 0.0% to 0.5 %. 16S rRNA gene sequence analysis indicated that strain 25-1T belongs to the genus Chryseobacterium within the family Flavobacteriaceae and is related most closely to C. carnis G81T (96.4% similarity), C. lathyri RBA2-6T (95.8% similarity), and C. zeae JM1085T (95.8% similarity). Its genomic DNA G+C molar composition was 36.2%. The major cellular fatty acids were iso-C15:0 (44.0%), iso-C17:0 3OH (19.8%) and C16:1 ω7c/16:1 ω6c (12.7%). The only isoprenoid quinone was menaquinone 6 (MK-6). The major polar lipids were phosphatidylethanolamine, two unidentified amino lipids and two unidentified lipids. The DNA–DNA relatedness between strain 25-1T and C. lathyri RBA2-6T was 38%. Phenotypic, genotypic, and phylogenetic characteristics indicated that strain 25-1T is a novel member of the genus Chryseobacterium, for which the name C. chengduensis sp. nov. is proposed. The type strain is 25-1T (CCTCC AB2015133T=DSM 100396T). PMID:27487806

  12. Gclust Server: 90952 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available Minization of XX and XO animals family member (fem-2) Number of Sequences 1 Homologs 1 Clustering threshold ...90952 CEL_T19C3.8_17553792 Cluster Sequences Related Sequences(251) 449 fem-2: FEMinization of XX and XO ani...mals family member (fem-2) 1 1.00e-28 0.0 0.0 0.0 0.0 0.0 12.5 Show 90952 Cluster Related Sequences(251) Sequence length 449 Representative annotation fem-2: FE



    Cengiz ARSLAN; Mehmet GÜLLÜ; Varol TUTAL


    The purpose of this study is to analyse the depression states of elementary school students who are in the second grade at school and do sports or not according to some variables.There are 251 students who do sports (amateur athletes,play in school teams etc.) at city center elementary schools of Malatya and there are 251 students who do not sports in the analysing group so totally there are 502 students in the analysing group.Kolmogorov-Smirnov test has been applied to research datas and it ...

  14. Atomistic determinants of co-enzyme Q reduction at the Qi-site of the cytochrome bc1 complex

    DEFF Research Database (Denmark)

    Postila, Pekka A.; Kaszuba, Karol; Kuleta, Patryk


    into the Q i-site to facilitate binding of half-protonated semiquinone-a reaction intermediate that is potentially formed during substrate reduction. At this bent pose, the Lys251 forms a salt bridge with the Asp252, thus making direct proton transfer possible. In the neutral state, the lysine side chain...... stays close to the conserved binding location of cardiolipin (CL). This back-and-forth motion between the CL and Asp252 indicates that Lys251 functions as a proton shuttle controlled by pH-dependent negative feedback. The CL/K/D switching, which represents a refinement to the previously described CL...

  15. Cannabinoid Receptors CB1 and CB2 Modulate the Electroretinographic Waves in Vervet Monkeys

    DEFF Research Database (Denmark)

    Bouskila, Joseph; Harrar, Vanessa; Javadi, Pasha


    2R by the intravitreal administration of their antagonists (AM251 and AM630, resp.) in photopic and scotopic conditions. Our results show that AM251 increases the photopic a-wave amplitude at high flash intensities, whereas AM630 increases the amplitude of both the photopic a- and b-waves....... In scotopic conditions, both blockers increased the b-wave amplitude but did not change the a-wave amplitude. These findings suggest an important role of CB1R and CB2R in primate retinal function....

  16. Polymorphism of inflammatory genes and arsenic methylation capacity are associated with urothelial carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Chia-Chang [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei, Taiwan (China); Department of Urology, Taipei Medical University—Shuang Ho Hospital, Taipei, Taiwan (China); Huang, Yung-Kai [School of Oral Hygiene, College of Oral Medicine, Taipei Medical University, Taipei, Taiwan (China); Chung, Chi-Jung [Department of Health Risk Management, College of Public Health, China Medical University and Hospital, Taichung, Taiwan (China); Department of Medical Research, China Medical University Hospital, Taichung, Taiwan (China); Huang, Chao-Yuan; Pu, Yeong-Shiau [Department of Urology, National Taiwan University Hospital, College of Medicine National Taiwan University, Taipei, Taiwan (China); Shiue, Horng-Sheng [Department of Chinese Medicine, Chang Gung Memorial Hospital, Taipei, Taiwan (China); Lai, Li-An [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei, Taiwan (China); Lin, Ying-Chin [Department of Family Medicine, Shung Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Department of Health Examination, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)


    Chronic exposure to arsenic can generate reactive oxidative species, which can induce certain proinflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-6 (IL-6) and interleukin-8 (IL-8). TNF-α, IL-6 and IL-8 have been shown to be involved in the development and progression of various cancers, including bladder cancer. This study aimed to investigate the joint effect of the polymorphism of TNF-α − 308 G/A, IL-6 − 174 G/C, IL-8 − 251 T/A and urinary arsenic profiles on urothelial carcinoma (UC) risk. This study evaluated 300 pathologically-confirmed cases of UC and 594 cancer-free controls. Urinary arsenic species were detected using high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphism of TNF-α − 308 G/A, IL-6 − 174 G/C and IL-8 − 251 T/A was determined using polymerase chain reaction-restriction fragment length polymorphism. The joint effects on UC risk were estimated by odds ratios and 95% confidence intervals using unconditional logistic regression. We found that the TNF-α − 308 A/A and IL-8 − 251 T/T polymorphisms were significantly associated with UC. Moreover, significant dose–response joint effect of TNF-α − 308 A/A or IL-8 − 251 T/T genotypes and arsenic methylation indices were seen to affect UC risk. The present results also showed a significant increase in UC risk in subjects with the IL-8 − 251 T/T genotype for each SD increase in urinary total arsenic and MMA%. In contrast, a significant decrease in UC risk was found in subjects who carried the IL-8 − 251 T/T genotype for each SD increase in DMA%. - Highlights: • Joint effect of the TNF-α -308 A/A genotype and urinary total arsenic affected UC. • Joint effect of the IL-8 -251 T/T genotype and urinary total arsenic affected UC. • Urinary total arsenic level, TNF-α -308 A/A and IL-8 -251 T/T genotype affected UC.

  17. Compensated bismuth-loaded plastic scintillators for neutron detection using low-energy pseudo-spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Dumazert, Jonathan, E-mail: [CEA, LIST, Laboratoire Capteurs Architectures Electroniques, 91191 Gif-sur-Yvette (France); Coulon, Romain; Bertrand, Guillaume H.V.; Normand, Stéphane [CEA, LIST, Laboratoire Capteurs Architectures Electroniques, 91191 Gif-sur-Yvette (France); Méchin, Laurence [CNRS, UCBN, Groupe de Recherche en Informatique, Image, Automatique et Instrumentation de Caen, 14050 Caen (France); Hamel, Matthieu [CEA, LIST, Laboratoire Capteurs Architectures Electroniques, 91191 Gif-sur-Yvette (France)


    Gadolinium-covered modified plastic scintillators show a high potential for the deployment of cost-effective neutron detectors. Taking advantage of the low-energy photon and electron signature of thermal neutron captures in gadolinium-155 and gadolinium-157 however requires a background correction. In order to display a trustable rate, dual compensation schemes appear as an alternative to Pulse Shape Discrimination. This paper presents the application of such a compensation scheme to a two-bismuth loaded plastic scintillator system. A detection scintillator interacts with incident photon and fast neutron radiations and is covered with a gadolinium converter to become thermal neutron-sensitive as well. In the meantime, an identical compensation scintillator, covered with terbium, solely interacts with the photon and fast neutron part of incident radiations. After the acquisition and the treatment of the counting signals from both sensors, a hypothesis test determines whether the resulting count rate after subtraction falls into statistical fluctuations or provides a robust image of neutron activity. A laboratory prototype is tested under both photon and neutron radiations, allowing us to investigate the performance of the overall compensation system. The study reveals satisfactory results in terms of robustness to a cesium-137 background and in terms of sensitivity in presence of a californium-252 source.

  18. Systematic studies of the fundamental chemistry of pyrochlore oxides. An{sub 2}Zr{sub 2}O{sub 7} [An=Pu, Am, Cm, Bk and Cf

    Energy Technology Data Exchange (ETDEWEB)

    Haire, R.G.; Assefa, Z. [Oak Ridge National Laboratory, Oak Ridge, TN (United States); Raison, P.E. [Commissariat a l' Energie Atomique, CEA-Cadarache DRN/DEC/SPUA/LACA (France)


    Our efforts to pursue the fundamental science of actinide pyrochlore oxides, An{sub 2}Zr{sub 2}O{sub 7}, (An=plutonium through californium), are presented. We have addressed their structural and chemical behavior via X-ray diffraction, Raman spectroscopy and by considering the pseudo-oxidation potentials of the actinides. The structure, fundamental chemistry, ionic radii and the electronic configuration of the specific actinide involved in these oxide systems all have a significant impact on their science. We are also exploring a calculational approach based on valence-bond relationships to assess the position of the oxygen atoms located at the general crystallographic position. The oxygen position is important regarding the chemical behavior and thermal stability of these materials. Also considered is the structural stability of the materials regarding self-irradiation, and with some compounds, their resistance towards oxidation. These aspects will be discussed using a systematic evaluation of the five-actinide systems together with comparable lanthanide systems studied. (author)

  19. 1982 US-CEC neutron personnel dosimetry intercomparison study

    Energy Technology Data Exchange (ETDEWEB)

    Swaja, R.E.; Sims, C.S.; Greene, R.T.; Schraube, H.; Burger, G.


    A neutron personnel dosimetry intercomparison study was conducted during April 19-23, 1982, as a joint effort between the United States and the Commission of European Communities. Dosimeters from 48 participating agencies were mounted on cylindrical phantoms and exposed to a range of low-level dose equivalents (0.48-13.91 mSv neutron and 0.02-1.32 mSv gamma) in nine different radiation fields. Exposure conditions considered in this study included four mixed-field spectra produced using the Health Physics Research Reactor, four monoenergetic neutron fields generated by accelerators, and one 15-cm D/sub 2/O-moderated californium source spectrum. In general, neutron results reported by the participating agencies were consistent with expected dosimeter performance based on energy response characteristics of the detection systems. Albedo dosimeters, which were the most popular neutron monitoring systems used in this study, provided the best overall accuracy for all exposure conditions. Film, Cr-39 recoil track, and Th-232 fission track systems generally underestimated dose equivalents relative to reference values. Associated gamma measurements showed that TLD monitors produced more accurate results than film dosimeters although both systems overestimated gamma dose equivalents in mixed radiation fields. 24 references, 10 figures, 19 tables.

  20. Application of the backward extrapolation method to pulsed neutron sources

    Energy Technology Data Exchange (ETDEWEB)

    Talamo, Alberto; Gohar, Yousry


    Particle detectors operated in pulse mode are subjected to the dead-time effect. When the average of the detector counts is constant over time, correcting for the dead-time effect is simple and can be accomplished by analytical formulas. However, when the average of the detector counts changes over time it is more difficult to take into account the dead-time effect. When a subcritical nuclear assembly is driven by a pulsed neutron source, simple analytical formulas cannot be applied to the measured detector counts to correct for the dead-time effect because of the sharp change of the detector counts over time. This work addresses this issue by using the backward extrapolation method. The latter can be applied not only to a continuous (e.g. californium) external neutron source but also to a pulsed external neutron source (e.g. by a particle accelerator) driving a subcritical nuclear assembly. The backward extrapolation method allows to obtain from the measured detector counts both the dead-time value and the real detector counts.

  1. The cross sections of fusion-evaporation reactions: the most promising route to superheavy elements beyond Z=118 (United States)

    Jadambaa, Khuyagbaatar


    The synthesis of superheavy elements beyond oganesson (Og), which has atomic number Z = 118, is currently one of the main topics in nuclear physics. An absence of sufficient amounts of target material with atomic numbers heavier than californium (Z = 98) forces the use of projectiles heavier than 48Ca (Z = 20), which has been successfully used for the discoveries of elements with Z = 114 - 118 in complete fusion reactions. Experimental cross sections of 48Ca with actinide targets behave very differently to "cold" and "hot" fusion-evaporation reactions, where doubly-magic lead and deformed actinides are used as targets, respectively. The known cross sections of these reactions have been analysed compared to calculated fission barriers. It has been suggested that observed discrepancies between the cross sections of 48Ca-induced and other fusionevaporation reactions originate from the shell structure of the compound nucleus, which lies in the island of the stability. Besides scarcely known data on other reactions involving heavier projectiles, the most promising projectile for the synthesis of the elements beyond Og seems to be 50Ti. However, detailed studies of 50Ti, 54Cr, 58Fe and 64Ni-induced reactions are necessary to be performed in order to fully understand the complexities of superheavy element formation.


    Energy Technology Data Exchange (ETDEWEB)

    Struble, G.L.; Haight, R.C.


    Topics covered include: studies of (n, charged particle) reactions with 14 to 15 MeV neutrons; photoneutron cross sections for /sup 15/N; neutron radiative capture; Lane-model analysis of (p,p) and (n,n) scattering on the even tin isotopes; neutron scattering cross sections for /sup 181/Ta, /sup 197/Au, /sup 209/Bi, /sup 232/Th, and /sup 238/U inferred from proton scattering and charge exchange cross sections; neutron-induced fission cross sections of /sup 245/Cm and /sup 242/Am; fission neutron multiplicities for /sup 245/Cm and /sup 242/Am; the transport of 14 MeV neutrons through heavy materials 150 < A < 208; /sup 249/Cm energy levels from measurement of thermal neutron capture gamma rays; /sup 231/Th energy levels from neutron capture gamma ray and conversion electron spectroscopy; new measurements of conversion electron binding energies in berkelium and californium; nuclear level densities; relative importance of statistical vs. valence neutron capture in the mass-90 region; determination of properties of short-lived fission products; fission yield of /sup 87/Br and /sup 137/I from 15 nuclei ranging from /sup 232/Th to /sup 249/Cf; evaluation of charged particle data for the ECPL library; evaluation of secondary charged-particle energy and angular distributions for ENDL; and evaluated nuclear structure libraries derived from the table of isotopes. (GHT)

  3. Activation analysis of ITER blanket first wall

    Energy Technology Data Exchange (ETDEWEB)

    Lopatkin, A.; Muratov, V. [RDIPE (NIKIET), Moscow (Russian Federation)


    To analyze the activation of ITER blanket structural components, the authors have prepared the AUCDAS code that calculates changes in nuclide concentrations and radioactivity characteristics during neutron irradiation and during cooling. UCDAS takes into account all neutron reactions and decay types, the prepared library of constants contains nuclear data of nuclides from hydrogen to californium. A comparative analysis of the results as obtained using UCDAS code and the widely known FISPACT code is given. The analysis of decay heat, gas generation and activity of ITER blanket first wall`s structural components was carried out. The beryllium coating, copper alloy and stainless steel were analysed. Calculations were performed for the first plasma burning pulse, 6 months and 1 year of operation in accordance with the ITER scenario. The materials recommended by ITER central team and their Russian analogs were considered: TGR and B1 (beryllium coating), GlidCop AL-25 Ds and Br-MKX (copper alloy), 316LN-IG and 12Cr18Ni10Ti (stainless steel). It has been demonstrated that there is a difference in all of the considered characteristics between the above materials. It is caused by impurities which are present in the materials. The report also considers the accumulation of gases (H, D, T, He{sup 3}, He{sup 4}) in the above materials. Besides, the change in the activity of irradiated materials during the cooling of up to 10{sup 7} years was calculated. (orig.) 7 refs.

  4. Toward achieving flexible and high sensitivity hexagonal boron nitride neutron detectors (United States)

    Maity, A.; Grenadier, S. J.; Li, J.; Lin, J. Y.; Jiang, H. X.


    Hexagonal boron nitride (h-BN) detectors have demonstrated the highest thermal neutron detection efficiency to date among solid-state neutron detectors at about 51%. We report here the realization of h-BN neutron detectors possessing one order of magnitude enhancement in the detection area but maintaining an equal level of detection efficiency of previous achievement. These 3 mm × 3 mm detectors were fabricated from 50 μm thick freestanding and flexible 10B enriched h-BN (h-10BN) films, grown by metal organic chemical vapor deposition followed by mechanical separation from sapphire substrates. Mobility-lifetime results suggested that holes are the majority carriers in unintentionally doped h-BN. The detectors were tested under thermal neutron irradiation from californium-252 (252Cf) moderated by a high density polyethylene moderator. A thermal neutron detection efficiency of ˜53% was achieved at a bias voltage of 200 V. Conforming to traditional solid-state detectors, the realization of h-BN epilayers with enhanced electrical transport properties is the key to enable scaling up the device sizes. More specifically, the present results revealed that achieving an electrical resistivity of greater than 1014 Ωṡcm and a leakage current density of below 3 × 10-10 A/cm2 is needed to fabricate large area h-BN detectors and provided guidance for achieving high sensitivity solid state neutron detectors based on h-BN.

  5. Design of the low energy beam transport line between CARIBU and the EBIS charge breeder

    Energy Technology Data Exchange (ETDEWEB)

    Perry, A., E-mail: [Argonne National Laboratory, Argonne, IL 60439, USA and Illinois Institute of Technology, Chicago, IL 60616 (United States); Ostroumov, P. N.; Barcikowski, A.; Dickerson, C.; Kondrashev, S. A.; Mustapha, B.; Savard, G. [Argonne National Laboratory, Argonne, IL 60439 (United States)


    An Electron Beam Ion Source Charge Breeder (EBIS-CB) has been developed to breed radioactive beams from the CAlifornium Rare Isotope Breeder Upgrade (CARIBU) facility at ATLAS. The EBIS-CB will replace the existing ECR charge breeder to increase the intensity and improve the purity of reaccelerated radioactive ion beams. The EBIS-CB is in the final stage of off-line commissioning. Currently, we are developing a low energy beam transport (LEBT) system to transfer CARIBU beams to the EBIS-CB. As was originally planned, an RFQ cooler-buncher will precede the EBIS-CB. Recently, it was decided to include a multi-reflection time-of-flight (MR-TOF) mass-spectrometer following the RFQ. MR-TOF is a relatively new technology used to purify beams with a mass-resolving power up to 3×10{sup 5} as was demonstrated in experiments at CERN/ISOLDE. Very high purity singly-charged radioactive ion beams will be injected into the EBIS for charge breeding and due to its inherent properties, the EBIS-CB will maintain the purity of the charge bred beams. Possible contamination of residual gas ions will be greatly suppressed by achieving ultra-high vacuum in the EBIS trap. This paper will present and discuss the design of the LEBT and the overall integration of the EBIS-CB into ATLAS.

  6. Analysis of patents on mining technology

    Energy Technology Data Exchange (ETDEWEB)

    Menyailo, N.I.; Grishchenko, A.N.; Ratner, M.V.; Kobylyanskii, A.Ya.; Tyshlek, E.G.


    Analyses the current work being carried out with the aim of developing and perfecting coal mining technology with regard to improving safety and working conditions (equipment is currently responsible for 6.3% of all hazards in coal mines) by examining patents of class ES 21 S produced in the USSR, USA, UK, FRG, Japan and France between 1970-1984. By far the majority of patents is concerned with improving technology and productivity and a disappointing number deals with safety matters (only 7.2% of the patents for new cutter loader designs deal with dust suppression systems and most of these come from the FRG; no patents for powered mining complexes deal with the problem of noise and vibration reduction). The patents with the most direct relevance to health and safety concern remote control devices for mining equipment, in particular, devices based on radioactive isotopes (e.g. cesium-137, americum-241, selenium-75, californium-252) but measures for monitoring them and protecting against them are not found.

  7. MinT: Middleware for Cooperative Interaction of Things

    Directory of Open Access Journals (Sweden)

    Soobin Jeon


    Full Text Available This paper proposes an Internet of Things (IoT middleware called Middleware for Cooperative Interaction of Things (MinT. MinT supports a fully distributed IoT environment in which IoT devices directly connect to peripheral devices easily construct a local or global network, and share their data in an energy efficient manner. MinT provides a sensor abstract layer, a system layer and an interaction layer. These enable integrated sensing device operations, efficient resource management, and active interconnection between peripheral IoT devices. In addition, MinT provides a high-level API to develop IoT devices easily for IoT device developers. We aim to enhance the energy efficiency and performance of IoT devices through the performance improvements offered by MinT resource management and request processing. The experimental results show that the average request rate increased by 25% compared to Californium, which is a middleware for efficient interaction in IoT environments with powerful performance, an average response time decrease of 90% when resource management was used, and power consumption decreased by up to 68%. Finally, the proposed platform can reduce the latency and power consumption of IoT devices.

  8. MinT: Middleware for Cooperative Interaction of Things (United States)

    Jeon, Soobin; Jung, Inbum


    This paper proposes an Internet of Things (IoT) middleware called Middleware for Cooperative Interaction of Things (MinT). MinT supports a fully distributed IoT environment in which IoT devices directly connect to peripheral devices easily construct a local or global network, and share their data in an energy efficient manner. MinT provides a sensor abstract layer, a system layer and an interaction layer. These enable integrated sensing device operations, efficient resource management, and active interconnection between peripheral IoT devices. In addition, MinT provides a high-level API to develop IoT devices easily for IoT device developers. We aim to enhance the energy efficiency and performance of IoT devices through the performance improvements offered by MinT resource management and request processing. The experimental results show that the average request rate increased by 25% compared to Californium, which is a middleware for efficient interaction in IoT environments with powerful performance, an average response time decrease of 90% when resource management was used, and power consumption decreased by up to 68%. Finally, the proposed platform can reduce the latency and power consumption of IoT devices. PMID:28632182

  9. An Account of Oak Ridge National Laboratory's Thirteen Research Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, Murray Wilford [ORNL


    The Oak Ridge National Laboratory has built and operated 13 nuclear reactors in its 66-year history. The first was the graphite reactor, the world's first operational nuclear reactor, which served as a plutonium production pilot plant during World War II. It was followed by two aqueous-homogeneous reactors and two red-hot molten-salt reactors that were parts of power-reactor development programs and by eight others designed for research and radioisotope production. One of the eight was an all-metal fast burst reactor used for health physics studies. All of the others were light-water cooled and moderated, including the famous swimming-pool reactor that was copied dozens of times around the world. Two of the reactors were hoisted 200 feet into the air to study the shielding needs of proposed nuclear-powered aircraft. The final reactor, and the only one still operating today, is the High Flux Isotope Reactor (HFIR) that was built particularly for the production of californium and other heavy elements. With the world's highest flux and recent upgrades that include the addition of a cold neutron source, the 44-year-old HFIR continues to be a valuable tool for research and isotope production, attracting some 500 scientific visitors and guests to Oak Ridge each year. This report describes all of the reactors and their histories.

  10. Neutron Detector Signal Processing to Calculate the Effective Neutron Multiplication Factor of Subcritical Assemblies

    Energy Technology Data Exchange (ETDEWEB)

    Talamo, Alberto [Argonne National Lab. (ANL), Argonne, IL (United States). Nuclear Engineering Division; Gohar, Yousry [Argonne National Lab. (ANL), Argonne, IL (United States). Nuclear Engineering Division


    This report describes different methodologies to calculate the effective neutron multiplication factor of subcritical assemblies by processing the neutron detector signals using MATLAB scripts. The subcritical assembly can be driven either by a spontaneous fission neutron source (e.g. californium) or by a neutron source generated from the interactions of accelerated particles with target materials. In the latter case, when the particle accelerator operates in a pulsed mode, the signals are typically stored into two files. One file contains the time when neutron reactions occur and the other contains the times when the neutron pulses start. In both files, the time is given by an integer representing the number of time bins since the start of the counting. These signal files are used to construct the neutron count distribution from a single neutron pulse. The built-in functions of MATLAB are used to calculate the effective neutron multiplication factor through the application of the prompt decay fitting or the area method to the neutron count distribution. If the subcritical assembly is driven by a spontaneous fission neutron source, then the effective multiplication factor can be evaluated either using the prompt neutron decay constant obtained from Rossi or Feynman distributions or the Modified Source Multiplication (MSM) method.

  11. Fast neutron tomography with real-time pulse-shape discrimination in organic scintillation detectors

    Energy Technology Data Exchange (ETDEWEB)

    Joyce, Malcolm J., E-mail: [Department of Engineering, Lancaster University, Lancaster, Lancashire LA1 4YW (United Kingdom); Agar, Stewart [Department of Engineering, Lancaster University, Lancaster, Lancashire LA1 4YW (United Kingdom); Aspinall, Michael D. [Hybrid Instruments Ltd., Gordon Manley Building, Lancaster Environment Centre, Lancaster University, Lancaster LA1 4YW (United Kingdom); Beaumont, Jonathan S.; Colley, Edmund; Colling, Miriam; Dykes, Joseph; Kardasopoulos, Phoevos; Mitton, Katie [Department of Engineering, Lancaster University, Lancaster, Lancashire LA1 4YW (United Kingdom)


    A fast neutron tomography system based on the use of real-time pulse-shape discrimination in 7 organic liquid scintillation detectors is described. The system has been tested with a californium-252 source of dose rate 163 μSv/h at 1 m and neutron emission rate of 1.5×10{sup 7} per second into 4π and a maximum acquisition time of 2 h, to characterize two 100×100×100 mm{sup 3} concrete samples. The first of these was a solid sample and the second has a vertical, cylindrical void. The experimental data, supported by simulations with both Monte Carlo methods and MATLAB®, indicate that the presence of the internal cylindrical void, corners and inhomogeneities in the samples can be discerned. The potential for fast neutron assay of this type with the capability to probe hydrogenous features in large low-Z samples is discussed. Neutron tomography of bulk porous samples is achieved that combines effective penetration not possible with thermal neutrons in the absence of beam hardening.

  12. Report on the workshop "Decay spectroscopy at CARIBU: advanced fuel cycle applications, nuclear structure and astrophysics". 14-16 April 2011, Argonne National Laboratory, USA.

    Energy Technology Data Exchange (ETDEWEB)

    Kondev, F.; Carpenter, M.P.; Chowdhury, P.; Clark, J.A.; Lister, C.J.; Nichols, A.L.; Swewryniak, D. (Nuclear Engineering Division); (Univ. of Massachusetts); (Univ. of Surrey)


    A workshop on 'Decay Spectroscopy at CARIBU: Advanced Fuel Cycle Applications, Nuclear Structure and Astrophysics' will be held at Argonne National Laboratory on April 14-16, 2011. The aim of the workshop is to discuss opportunities for decay studies at the Californium Rare Isotope Breeder Upgrade (CARIBU) of the ATLAS facility with emphasis on advanced fuel cycle (AFC) applications, nuclear structure and astrophysics research. The workshop will consist of review and contributed talks. Presentations by members of the local groups, outlining the status of relevant in-house projects and availabile equipment, will also be organized. time will also be set aside to discuss and develop working collaborations for future decay studies at CARIBU. Topics of interest include: (1) Decay data of relevance to AFC applications with emphasis on reactor decay heat; (2) Discrete high-resolution gamma-ray spectroscopy following radioactive decya and related topics; (3) Calorimetric studies of neutron-rich fission framgents using Total ABsorption Gamma-Ray Spectrometry (TAGS) technique; (4) Beta-delayed neutron emissions and related topics; and (5) Decay data needs for nuclear astrophysics.

  13. The cross sections of fusion-evaporation reactions: the most promising route to superheavy elements beyond Z=118

    Directory of Open Access Journals (Sweden)

    Jadambaa Khuyagbaatar


    Full Text Available The synthesis of superheavy elements beyond oganesson (Og, which has atomic number Z = 118, is currently one of the main topics in nuclear physics. An absence of sufficient amounts of target material with atomic numbers heavier than californium (Z = 98 forces the use of projectiles heavier than 48Ca (Z = 20, which has been successfully used for the discoveries of elements with Z = 114 - 118 in complete fusion reactions. Experimental cross sections of 48Ca with actinide targets behave very differently to “cold” and “hot” fusion-evaporation reactions, where doubly-magic lead and deformed actinides are used as targets, respectively. The known cross sections of these reactions have been analysed compared to calculated fission barriers. It has been suggested that observed discrepancies between the cross sections of 48Ca-induced and other fusionevaporation reactions originate from the shell structure of the compound nucleus, which lies in the island of the stability. Besides scarcely known data on other reactions involving heavier projectiles, the most promising projectile for the synthesis of the elements beyond Og seems to be 50Ti. However, detailed studies of 50Ti, 54Cr, 58Fe and 64Ni-induced reactions are necessary to be performed in order to fully understand the complexities of superheavy element formation.

  14. Intracavitary moderator balloon combined with (252)Cf brachytherapy and boron neutron capture therapy, improving dosimetry in brain tumour and infiltrations. (United States)

    Brandão, S F; Campos, T P R


    This article proposes a combination of californium-252 ((252)Cf) brachytherapy, boron neutron capture therapy (BNCT) and an intracavitary moderator balloon catheter applied to brain tumour and infiltrations. Dosimetric evaluations were performed on three protocol set-ups: (252)Cf brachytherapy combined with BNCT (Cf-BNCT); Cf-BNCT with a balloon catheter filled with light water (LWB) and the same set-up with heavy water (HWB). Cf-BNCT-HWB has presented dosimetric advantages to Cf-BNCT-LWB and Cf-BNCT in infiltrations at 2.0-5.0 cm from the balloon surface. However, Cf-BNCT-LWB has shown superior dosimetry up to 2.0 cm from the balloon surface. Cf-BNCT-HWB and Cf-BNCT-LWB protocols provide a selective dose distribution for brain tumour and infiltrations, mainly further from the (252)Cf source, sparing the normal brain tissue. Malignant brain tumours grow rapidly and often spread to adjacent brain tissues, leading to death. Improvements in brain radiation protocols have been continuously achieved; however, brain tumour recurrence is observed in most cases. Cf-BNCT-LWB and Cf-BNCT-HWB represent new modalities for selectively combating brain tumour infiltrations and metastasis.

  15. Intracavitary moderator balloon combined with 252Cf brachytherapy and boron neutron capture therapy, improving dosimetry in brain tumour and infiltrations (United States)

    Brandão, S F


    Objective: This article proposes a combination of californium-252 (252Cf) brachytherapy, boron neutron capture therapy (BNCT) and an intracavitary moderator balloon catheter applied to brain tumour and infiltrations. Methods: Dosimetric evaluations were performed on three protocol set-ups: 252Cf brachytherapy combined with BNCT (Cf-BNCT); Cf-BNCT with a balloon catheter filled with light water (LWB) and the same set-up with heavy water (HWB). Results: Cf-BNCT-HWB has presented dosimetric advantages to Cf-BNCT-LWB and Cf-BNCT in infiltrations at 2.0–5.0 cm from the balloon surface. However, Cf-BNCT-LWB has shown superior dosimetry up to 2.0 cm from the balloon surface. Conclusion: Cf-BNCT-HWB and Cf-BNCT-LWB protocols provide a selective dose distribution for brain tumour and infiltrations, mainly further from the 252Cf source, sparing the normal brain tissue. Advances in knowledge: Malignant brain tumours grow rapidly and often spread to adjacent brain tissues, leading to death. Improvements in brain radiation protocols have been continuously achieved; however, brain tumour recurrence is observed in most cases. Cf-BNCT-LWB and Cf-BNCT-HWB represent new modalities for selectively combating brain tumour infiltrations and metastasis. PMID:25927876

  16. Investigation of Workplace-like Calibration Fields via a Deuterium-Tritium (D-T) Neutron Generator. (United States)

    Mozhayev, Andrey V; Piper, Roman K; Rathbone, Bruce A; McDonald, Joseph C


    Radiation survey meters and personal dosimeters are typically calibrated in reference neutron fields based on conventional radionuclide sources, such as americium-beryllium (Am-Be) or californium-252 (Cf), either unmodified or heavy-water moderated. However, these calibration neutron fields differ significantly from the workplace fields in which most of these survey meters and dosimeters are being used. Although some detectors are designed to yield an approximately dose-equivalent response over a particular neutron energy range, the response of other detectors is highly dependent upon neutron energy. This, in turn, can result in significant over- or underestimation of the intensity of neutron radiation and/or personal dose equivalent determined in the work environment. The use of simulated workplace neutron calibration fields that more closely match those present at the workplace could improve the accuracy of worker, and workplace, neutron dose assessment. This work provides an overview of the neutron fields found around nuclear power reactors and interim spent fuel storage installations based on available data. The feasibility of producing workplace-like calibration fields in an existing calibration facility has been investigated via Monte Carlo simulations. Several moderating assembly configurations, paired with a neutron generator using the deuterium tritium (D-T) fusion reaction, were explored.

  17. Production of medical radioisotopes in the ORNL High Flux Isotope Reactor (HFIR) for cancer treatment and arterial restenosis therapy after PTCA

    Energy Technology Data Exchange (ETDEWEB)

    Knapp, F.F. Jr.; Beets, A.L.; Mirzadeh, S.; Alexander, C.W.; Hobbs, R.L.


    The High Flux Isotope Reactor (HFIR) at the Oak Ridge National Laboratory (ORNL) represents an important resource for the production of a wide variety of medical radioisotopes. In addition to serving as a key production site for californium-252 and other transuranic elements, important examples of therapeutic radioisotopes which are currently routinely produced in the HFIR for distribution include dysprosium-166 (parent of holmium-166), rhenium-186, tin-117m and tungsten-188 (parent of rhenium-188). The nine hydraulic tube (HT) positions in the central high flux region permit the insertion and removal of targets at any time during the operating cycle and have traditionally represented a major site for production of medical radioisotopes. To increase the irradiation capabilities of the HFIR, special target holders have recently been designed and fabricated which will be installed in the six Peripheral Target Positions (PTP), which are also located in the high flux region. These positions are only accessible during reactor refueling and will be used for long-term irradiations, such as required for the production of tin-117m and tungsten-188. Each of the PTP tubes will be capable of housing a maximum of eight HT targets, thus increasing the total maximum number of HT targets from the current nine, to a total of 57. In this paper the therapeutic use of reactor-produced radioisotopes for bone pain palliation and vascular brachytherapy and the therapeutic medical radioisotope production capabilities of the ORNL HFIR are briefly discussed.

  18. Intestinal volvulus at St Francis Hospital, Kampala.

    African Journals Online (AJOL)

    53 males and seven females. The ages of sigmoid volvulus ... parietes or to the female pelvic organs. The objective of this study was ... Others (1 per tribe) 15. 25.1. TOTAL. 60. 100. Peasant / farmer. Business. Builder. Driver. Policeman. Butcher. Student. Engineer. Teacher. Technician. Pastor. Others. Not recorded. TOTAL ...

  19. Dual-Use Telemedicine Support System for Pathology. (United States)


    51 CDRH Center for Devices and Radiological Health 52 CEA Carcino-Embroyonic Antigen 53 CEN European Standards Group 54 CEN/TC 251 Working on spec...Telemedicine and Hospital Information Related Systems Acronyms; 12/10/98 197 MDL MD Lookup 198 MDR MD Retrieval 199 MEDIX MEDical Data InterX (X stands for

  20. Download this PDF file

    African Journals Online (AJOL)

    vCJD))nr new valiant Creutzfeldt Jakob Dianne. (WCW) is a me and fatal. 'like- ..... BSE crisis Science 278:245-251. Gee, 110996). Molecular evolution of prions. Nature 9 (3); 278-282. Levy, AI., Conrat, HF, Owens, RA. (1997). virology 3f“ edition ...

  1. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Keyhole depth instability in case of CW CO2 laser beam welding of mild steel · N Kumar S Dash A K ... April 2011 pp 251-265. Melt pool vorticity in deep penetration laser material welding ... April 2013 pp 235-246. Study of dimensionless quantities to analyse front and rear wall of keyhole formed during laser beam welding.

  2. Gclust Server: 90871 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available Sequences(251) 225 Binding-protein-dependent transport systems inner membrane component 1 1.00e-40 0.0 0.0 0.0...annotation Binding-protein-dependent transport systems inner membrane component Number of Sequences 1

  3. Longitudinal Predictors of Chinese Word Reading and Spelling among Elementary Grade Students (United States)

    Yeung, Pui-Sze; Ho, Connie Suk-Han; Wong, Yau-Kai; Chung, Kevin Kien-Hoa; Lo, Lap-Yan


    The longitudinal predictive power of four important reading-related skills (phonological skills, rapid naming, orthographic skills, and morphological awareness) to Chinese word reading and writing to dictation (i.e., spelling) was examined in a 3-year longitudinal study among 251 Chinese elementary students. Rapid naming, orthographic skills, and…

  4. 50 CFR 635.20 - Size limits. (United States)


    ... take, retain or possess a blue marlin taken from its management unit that is less than 99 inches (251 cm), LJFL. (2) No person shall take, retain or possess a white marlin taken from its management unit... (160 cm), LJFL. (4) The Atlantic blue and white marlin minimum size limits, specified in paragraphs (d...

  5. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 879 ... Vol 14, No 3 (2000), Effects of the instrumental enrichment and CoRT thinkink skills programmes on the creativity of pre-service teachers, Abstract ... Vol 22, No 1 (2008), Establishing a preliminary framework for effective blended learning practices in the undergraduate classroom: A South African ...

  6. Seasonal changes of free amino acids and thermal hysteresis in overwintering heteropteran insect, Pyrrhocoris apterus

    Czech Academy of Sciences Publication Activity Database

    Košťál, Vladimír; Renault, D.; Rozsypal, Jan


    Roč. 160, č. 2 (2011), s. 245-251 ISSN 1095-6433 R&D Projects: GA ČR GA206/07/0269 Institutional research plan: CEZ:AV0Z50070508 Keywords : diapause * cold tolerance * ice nucleation Subject RIV: ED - Physiology Impact factor: 2.235, year: 2011

  7. Preschoolers' Sexual Behavior at Daycare Centers: An Epidemiological Study. (United States)

    Lindblad, Frank; And Others


    The frequency of sexual behaviors among 251 preschoolers attending Swedish day-care centers was evaluated. Some behaviors were frequently occurring (like clinging body contact) whereas others were very uncommon (touching an adult's genitals). Correlations between age and single behaviors were seen as manifestations of the socialization process.…

  8. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 814 ... Vol 9, No 1 (2004), Experience of thoracic surgery performed under difficult conditions in Somalia, Abstract PDF. MY Hassan, AM Elmi, Marco Baldan. Vol 6, No 2 (2001), Experience with day-care surgery in a Private Surgical Clinic in Nakuru, Kenya, Abstract PDF. N Masiira-Mukasa. Vol 2, No 1 (1996) ...

  9. Experience with day-care surgery in a Private Surgical Clinic in ...

    African Journals Online (AJOL)

    A retrospective study of 251 operations carried out in a private surgical consultation clinic in Nakuru, Kenya was undertaken. A review was carried out of the clinical notes of patients who had surgery at this clinic between Jan. 1993 and June 1998 and who were regularly followed up to their formal discharge from the clinic.

  10. Experience with day-care surgery in a Private Surgical Clinic in ...

    African Journals Online (AJOL)

    Key words: Day-care surgery, private consultation, surgical, clinic. A retrospective study of 251 operations carried out in a private surgical consultation clinic in Nakuru, Kenya was undertaken. A review was carried out of the clinical notes of patients who had surgery at this clinic between Jan. 1993 and June 1998 and who.

  11. Crystal structure of Pseudomonas aeruginosa lipase in the open conformation - The prototype for family I.1 of bacterial lipases

    NARCIS (Netherlands)

    Nardini, M; Lang, DA; Liebeton, K; Jaeger, KE; Dijkstra, BM


    The x-ray structure of the lipase from Pseudomonas aeruginosa PAO1 has been determined at 2.54 Angstrom resolution. It is the first structure of a member of homology family I.1 of bacterial lipases. The structure shows a variant of the alpha/beta hydrolase fold, with Ser(82), Asp(229), and His(251)

  12. Tidally Induced Variations of PMC Altitudes and Ice Water Content Using a Data Assimilation System (United States)


    69° N ( Andenes , Norway) and 85 235 km geometric altitude in Figure 5. In addition, we performed five short term integrations of the 236 forecast...intercomparison between two approaches to calculating winds and the Andenes data. 251 252 2.2 Ice Particle Trajectories and CARMA 253 254 As noted

  13. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 423 ... Vol 4, No 2 (2015), Political Protest Songs and Actual Protest Values: Analysis of Fela's “Sorrow, Tears & Blood” and Bob Marley's “Stand up, Get up”, Abstract PDF. OS Eesuola. Vol 4, No 2 (2015), Politics of Resistance and Emancipation in Obari Gomba's The Ascent Stone, Abstract PDF. JN Akani.

  14. New cryptic species of the 'revolutum' group of Echinostoma (Digenea: Echinostomatidae) revealed by molecular and morphological data

    Czech Academy of Sciences Publication Activity Database

    Georgieva, Simona; Selbach, C.; Faltýnková, Anna; Soldánová, Miroslava; Sures, B.; Skirnisson, K.; Kostadinova, Aneta


    Roč. 6, č. 64 (2013) ISSN 1756-3305 R&D Projects: GA ČR GAP505/10/1562 Institutional support: RVO:60077344 Keywords : Radix auricularia * Radix peregra * Stagnicola palustris * Echinostoma * Cryptic species * Europe Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.251, year: 2013

  15. The Effect of Fatigue Cracks on Fastener Flexibility, Load Distribution and Fatigue Crack Growth (United States)


    Vorst, L. A., Giessler, F. J., Moritz , T., “Stress Analysis Manual”, AFFDL-TR-69-42, Air Force Flight Dynamics Laboratory, August 1969 251. Bruhn, E...Newman, J. C., “An Improved Method of Collocation for the Stress Analysis of Cracked Plates With Various Shaped Boundaries”, NASA TN D-6376, August

  16. Aging driver and pedestrian safety : parking lot hazards study [summary]. (United States)


    In 2009, Florida reported the highest rate of pedestrian fatalities in the nation. At 2.51 deaths per 100,000 residents, Floridas rate was nearly twice the national average. These deaths occurred in all age groups, but compared to other age groups...

  17. Aging driver and pedestrian safety : parking lot hazards study. (United States)


    In 2009, Florida reported the highest rate of : pedestrian fatalities in the nation. At 2.51 : deaths per 100,000 residents, Floridas rate was : nearly twice the national average. These deaths : occurred in all age groups, but compared to : other ...

  18. 78 FR 79447 - Notice of Public Information Collection(s) Being Reviewed by the Federal Communications... (United States)


    ... Telecommunications Act of 1996, CC Docket No. 96-98, Second Report and Order and Memorandum Opinion and Order; Second... 251. Total Annual Burden: 574,448 hours. Total Annual Cost: No cost. Privacy Impact Assessment: No impact(s). Nature and Extent of Confidentiality: The Commission is not requesting respondents to submit...

  19. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. Pratima Sharma. Articles written in Journal of Biosciences. Volume 38 Issue 2 June 2013 pp 251-258 Articles. Bioluminescent bioreporter for assessment of arsenic contamination in water samples of India · Pratima Sharma Shahzada Asad Arif Ali · More Details Abstract Fulltext PDF.

  20. Caesarean section: the perspectives of women in Port Harcourt ...

    African Journals Online (AJOL)

    The aversion of the respondents for caesarean section stem from its stigma factor (52.7%) its ability to limit the number of children a woman could have (68.0%), its cost (63.7%), and the likelihood of morbidity and mortality (51.0%). Some (25.1%) of the respondents felt doctors sometimes recommend the procedure for their ...

  1. GIS-based Geotechnical Microzonation Mapping using Analytic ...

    African Journals Online (AJOL)


    Engineering Geology, 61: 257–271. Dearman, W.R. 1991. Engineering geological mapping. Butterworth-Heinemann Ltd. Oxford,. 387 p. Jankowski, P. 1995. Integrating Geographical Information Systems and multiple criteria decision making methods. International Journal of Geographical Information Systems, 9(3): 251–.

  2. Invariant measures and error bounds for random walks in the quarter-plane based on sums of geometric terms

    NARCIS (Netherlands)

    Chen, Y.; Boucherie, Richardus J.; Goseling, Jasper


    We consider homogeneous random walks in the quarter-plane. The necessary conditions which characterize random walks of which the invariant measure is a sum of geometric terms are provided in Chen et al. (arXiv:1304.3316, 2013, Probab Eng Informational Sci 29(02):233–251, 2015). Based on these

  3. Host genotype is an important determinant of the cereal phyllosphere mycobiome

    DEFF Research Database (Denmark)

    Sapkota, Rumakanta; Knorr, Kamilla; Jørgensen, Lise Nistrup


    ) and a smaller number of samples from oat (Avena sativa), rye (Secale cereale) and triticale (Triticum × Secale) was studied using next-generation sequencing. The effects of host genotype, fungicide treatment and location on fungal communities were explored. In total, 635 251 fungal internal transcribed spacer...

  4. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 289 of 289 ... Vol 8, No 2-3 (2009), Volcanic Ash from the 1999 Eruption of Mount Cameroon Volcano: Characterization and Implications to Health Hazards, Abstract PDF. MBS Atanga, AS Van der Meerve, EM Shemamg, CE Suh, W Kruger, MS Njome, NE Asobo. Vol 12, No 2 (2015), Vulnérabilité des systèmes ...

  5. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 356 ... Vol 12, No 3 (2013), Physical properties of seeds of African walnut (Plukenetia conophorum Muell Arg.) From South eastern Nigeria, and the effect of boiling on the proximate qualities, Abstract. OA Udeonyia, FD Ugese, SC Aba, KP Baiyeri. Vol 5, No 2 (2006), Poultry manure application and varietal ...

  6. Download

    African Journals Online (AJOL)


    Functional diversity of nematodes. Appl.Soil Ecol. 10: 239–251. Bridge J. and Gowen S. R. (1993). Visual assessment of plant parasitic nematode and weevil damage on bananas and plantain. In Biological and Integrated Control of Highland Banana and Plantain Pests and Diseases. (C. C. Gold and. B. Gemmill, ed.), pp.

  7. EST Table: DC551726 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ecursor dbj|BAA06160.1| humoral lectin prepropeptide [Bombyx mori] prf||2106140A hemocytin 10/09/02 31 %/251...cursor [Bombyx mori] sp|P98092.1|HMCT_BOMMO RecName: Full=Hemocytin; AltName: Full=Humoral lectin; Flags: Pr

  8. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 721 ... Vol 22, No 3 (2016), Feasibility and outcome of emergency ureteroscopic removal of lower ureteral stone under intravenous sedation: A prospective study, Abstract PDF. W. Shabana, M. Teleb, T. Dawod, E. Elsayed, E. Desoky. Vol 20, No 2 (2014), Female circumcision in non-Muslim females in Africa ...

  9. Publications | Page 26 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 251 - 260 of 6378 ... With a prolonged legacy of centralized rule, Arab regimes rest on two pillars: patronage and control. And while the Middle East has... Gender and violence in urban Pakistan (restricted access). The experience of violence is pervasive in Pakistan; while residents of Rawalpindi-Islamabad face ...


    African Journals Online (AJOL)

    Mafia: a zoogeographical study. Proc. zool. Soc. Lond. 110 : 97 -128. POCOCK, R.1. 1910. On the specialized cutaneous glands of ruminants. Proc. zool Soc. Lond. 1910: 840-986. ROBERTS, A. 1936. Report upon a survey of the higher Vertebrates of north-eastern Zululand. Ann. Tvl. Mus. 18: 163-251. ROBERTS, A. 1951.

  11. EST Table: FY737608 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FY737608 E_FL_famL_03C10_F_0 11/11/04 99 %/251 aa ref|NP_001036933.1| molting fluid... carboxypeptidase A [Bombyx mori] dbj|BAD60916.1| molting fluid carboxypeptidase A [Bombyx mori] 11/11/04 45

  12. 78 FR 54274 - Certain Laundry and Household Cleaning Products and Related Packaging; Institution of... (United States)


    ... by reason of infringement of U.S. Trademark Registration Nos. 251,292 (``the '292 trademark''); 290,449 (``the '449 trademark''); 1,391,304 (``the '304 trademark''); 1,877,353 (``the '353 trademark''); 2,072,730 (``the '730 trademark''); 2,290,310 (``the '310 trademark''); 2,358,705 (``the '705...

  13. A comparative study of multiple regression analysis and back ...

    Indian Academy of Sciences (India)

    Abhijit Sarkar

    prediction for robotic GMAW-based rapid manufacturing through a neural network and a second-order regression analysis. J. Intell. Manuf. 25(1): 157–163. [32] Kim I-S, Lee S-H and Yarlagadda P K 2003 Comparison of multiple regression and back propagation neural network approaches in modelling top bead height of ...

  14. Windstorms and forest disturbances in the Czech Lands: 1801–2015

    Czech Academy of Sciences Publication Activity Database

    Brázdil, Rudolf; Stucki, P.; Szabó, Péter; Řezníčková, Ladislava; Dolák, Lukáš; Dobrovolný, Petr; Tolasz, R.; Kotyza, O.; Chromá, Kateřina; Suchánková, Silvie

    250-251, MAR (2018), s. 47-63 ISSN 0168-1923 R&D Projects: GA MŠk(CZ) LO1415; GA ČR(CZ) GA15-11805S Institutional support: RVO:86652079 ; RVO:67985939 Keywords : windstorm * documentary data * forest disturbance * forest damage * Czech Land Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 3.887, year: 2016

  15. Cosmological Parameter Constraints from the Dark Energy Survey Supernova Program Three Year Spectroscopic Sample. (United States)

    Brout, Dillon


    We present cosmological parameter constraints from 251 spectroscopically confirmed Type Ia Supernovae (0.02 Dark Energy Survey Supernova Program (DESSN). The photometric calibration, scene modeling photometric pipeline, additional low-z supernovae samples (z<.1), as well as the final cosmological results and systematics analysis are discussed.

  16. Notulae ad Floram agaricinam neerlandicam — XIV. A noemnclatural note on Rhodocybe truncata

    NARCIS (Netherlands)

    Noordeloos, Machiel E.; Kuyper, Thomas W.


    Agaricus truncatus Schaeff. (Fungi Bavariae, pl. 251. 1763) is variously interpreted as a species of Hebeloma and Rhodocybe. Although the type-plate is not so easy to interpret, the adnate, sinuate lamellae, sordid spore print, and red-brown, truncate pileus give way to the idea that Fries (1838)

  17. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. MODI DEEPAK. Articles written in Journal of Biosciences. Volume 42 Issue 2 June 2017 pp 251-263 Article. Estrogen is essential but not sufficient to induce endometriosis · MOSAMI GALVANKAR NEHA SINGH MODI DEEPAK · More Details Abstract Fulltext PDF. Endometriosis is a ...

  18. Comparative analyses of genetic risk prediction methods reveal ...

    Indian Academy of Sciences (India)

    Author Affiliations. Ankita Chatterjee1 Analabha Basu1 Abhijit Chowdhury2 3 Kausik Das2 Neeta Sarkar-Roy1 Partha P. Majumder1 Priyadarshi Basu1 3. National Institute of Biomedical Genomics, Netaji Subhas Sanatorium (T. B. Hospital), Kalyani 741 251, India; Institute of Post Graduate Medical Education and Research, ...

  19. Investigations in West Syndrome: Which, When and Why

    Directory of Open Access Journals (Sweden)

    Richard E Appleton


    Full Text Available Investigators from the National Infantile Spasms Consortium (NISC in the USA studied the etiology of new-onset infantile spasms (IS in 251 infants (mean age at onset, 7.1, range, 0.1-22.7 months.

  20. Use of the Motivation and Engagement Scale-University/College as a Means of Identifying Student Typologies (United States)

    Elphinstone, Brad; Tinker, Sean


    The Motivation and Engagement Scale-University/College (MES-UC) was used to identify student typologies on the basis of adaptive and maladaptive academic cognitions and behaviours. The sample comprised first-year (n = 390), second-year (n = 300), and third-year (n = 251) undergraduate students with 4 student typologies identified: high…

  1. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 677 ... Vol 20 (2010), H.a. Welker and Pedagogical Lexicography, Abstract PDF. S Tarp. Vol 16 (2006), HAT veertig jaar ... Vol 17 (2007), Issues in the planning and design of a bilingual (English–northern Sotho) explanatory dictionary for industrial electronics, Abstract PDF. E Taljard, R Gauton, L Gauton.

  2. Download this PDF file

    African Journals Online (AJOL)

    in captive Royal python at the university of Ibadan. Zoological garden. Materials and Methods ... In captive snake, such as those in the zoological gardens, the immunological status may be easily affected due to .... 2.5.1 Use only the MS Word table tool (no columns, tabs or spaces). Tables should be numbered (using.

  3. Evaluation of the predictive capacity of DNA variants associated with straight hair in Europeans

    DEFF Research Database (Denmark)

    Pośpiech, Ewelina; Karłowska-Pik, Joanna; Marcińska, Magdalena


    pattern baldness revealed a suggestive association with hair morphology for rs4679955 on 3q25.1. The study results reported provide the starting point for the development of a predictive test for hair morphology in Europeans. More studies are now needed to discover additional determinants of hair...

  4. Chorology of the European Hypogeous Ascomycetes. II.Tuberales

    Directory of Open Access Journals (Sweden)

    Maria Ławrynowicz


    Full Text Available In this pan of the paper, chorology of the Tuberales in Poland with regard to their areals in Europe is discussed. 11 is a continuation of the previous pa per by Ławrynowicz, published in the Acta Mycol. vol. 25(1.

  5. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 317 ... Vol 11, No 3 (2017), The views and knowledge of parents of children with autism spectrum disorder on a range of treatments, Abstract PDF. V Wetherston, S Gangat, N Shange, K Wheeler, S.B. Sayed Karrim, J Pahl. Vol 5, No 2 (2011), Thoraco-abdominal neuroenteric cyst: A case report and review of ...

  6. Health-Related Quality of Life in Children Attending Special and Typical Education Greek Schools (United States)

    Papadopoulou, D.; Malliou, P.; Kofotolis, N.; Vlachopoulos, S. P.; Kellis, E.


    The purpose of this study was to examine parental perceptions about Health Related Quality of Life (HRQoL) of typical education and special education students in Greece. The Pediatric Quality of Life Inventory (PedsQL) was administered to the parents of 251 children from typical schools, 46 students attending integration classes (IC) within a…

  7. A Psychometric Analysis of a Three-Dimensional Spatial Task. (United States)


    Service/Bejar Dr. Kazuo Shigemasu Mr. Brad Sympson 7-9-24 Kugenuma-Kaiga Navy Personnel R&D Center Fujusawa 251 San Diego, CA 92152-6800 JAPAN Dr...93940 NPS, Code 54Wz Monterey, CA 92152-6800 Major John Welsh AFHRL/MOAN Brooks AFB, TX 78223 Dr. Rand R. Wilcox University of Southern California

  8. Full-Information Item Factor Analysis. (United States)


    Kazuo Shigemasu Amherst, MA 01003 7-9-24 Kugenuma-Kaigan Fujusawa 251 Mr. Brad Sympson JAPAN Navy Personnel R&D Center San Diego, CA 92152 Dr. William...Monterey, CA 92152 Major John Welsh AFHRL/MOAN Brooks AFB, TX 78223 Dr. Rand R. Wilcox University of Southern -" California Department of Psychology Los

  9. Initiation of Cigarette Smoking: Is It Related to Parental Smoking Behavior? (United States)

    Wohlford, Paul


    The smoking behavior and family stability of 251 undergraduate men and women and their parents were studied. The results support the identification interpretation of the father/son smoking pattern. The variable of family intactness was a relevant moderator of the parent/son smoking pattern. The mother and daughter smoking patterns remained…

  10. Gclust Server: 192941 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available 192941 TET_109.m00136 Cluster Sequences - 251 hypothetical protein chr_0_8254820_10...9; no annotation 1 1.00e-99 0.0 11.11 0.0 0.0 0.0 0.0 Show 192941 Cluster ID 192941 Sequence ID TET_109.m001

  11. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 346 ... Vol 19, No 1 (2006), Socio-economic and hygiene features of street food ... the International Olympic Committee and the International Society for ... Vol 24, No 2 (2011), The impact of a nutrition programme on the dietary ...

  12. Use of the Collegial Leadership Model of Emancipation to transform ...

    African Journals Online (AJOL)

    Use of the Collegial Leadership Model of Emancipation to transform traditional management practices in secondary schools. P Singh. Abstract. No Abstract Available South African Journal of Education Vol.25(1) 2005: 11-18. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT ...

  13. Experiment list: SRX392736 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available SRX392736 mm9 TFs and others Cebpb Blood HAFTL NA 14730983,43.8,9.4,251 GSM1290088: C/EBPb-0hours...cells || time after induction=0 hours || chip antibody=C/EBPb (sc-150, Santa Cruz) http://dbarchive.bioscien

  14. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 513 ... Issue, Title. Vol 37, No 2 (2016), Microbial analysis of meat and meat products sold in fast food restaurants in Aba, Abia State, Nigeria, Abstract .... of community ownership and sustainability of community directed treatment with ivermectin for onchocerciasis control in Cross River State, Nigeria, Abstract.

  15. Browse Author Index

    African Journals Online (AJOL)

    Items 251 - 300 of 2495 ... Mahmoud, Karima Gh M · Mahmoud, Karima Ghonaimy M. Mahmoud, KE · Mahmoud, KMA · Mahmoud, MA · Mahmoud, ME · Mahmoud, MH · Mahmoud, Mona AM · Mahmoud, YAG · Mahmoudi, H · Mahmoudi, Hela · Mahmoudi, M · Mahmoudi, Razzaqh · Mahmout, Y · Mahmout, Yaya · Mahmud, MTM

  16. 77 FR 63358 - Proposed Collection; Comment Request (United States)


    ... the following two forms. RRB Form G-251a, Employer Job Information--Job Description, is released to an....) It is accompanied by a ``generic job description'' for that particular railroad job. The generic job... opportunity to comment on whether the job description matches the employee's actual duties. If the employer...

  17. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 333 ... Vol 15, No 1 (2016), Profitability of groundnut-based cropping systems among farmers in Hong local government area of Adamawa state, Nigeria, Abstract. A. H. Bathon, D. C. Maurice, A. A. U. Jongur, J. F. Shehu. Vol 6, No 2 (2007), Proximate and phytochemical composition of garcinia kola and ...

  18. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 251 ... Vol 16, No 1 (2014), Estimation of stature from facial parameters in adult Abakaliki people of South – Eastern Nigeria, Abstract. E O Ewunonu. Vol 10, No 1-2 (2008), Estrogenic activity of some poly cyclic-aromatic-hydrocarbons, Abstract. NU Solomon. Vol 10, No 1-2 (2008), Estrogenic potencies of ...

  19. ORF Alignment: NC_005810 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_005810 gi|45441793 >1u07A 1 89 164 251 4e-26 ... ref|NP_669352.1| energy transduce...] ... ref|NP_993332.1| TonB protein [Yersinia pestis biovar ... Medievalis str. 91001] gb|AAM85603.1| energy

  20. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 483 ... B N Tagbo, C Onwuasigwe. Vol 28, No 1 (2001), Morbidity and Mortality among Infants with Normal Birth Weight in a New Born Baby Unit. Abstract PDF ... Vol 30, No 4 (2003), Morbidity Pattern among Under-five Children of Market Women in Ibadan, Abstract PDF. FO Omokhodion, A Oyemade, MKC ...

  1. Knowledge and perception of breast cancer and its treatment among ...

    African Journals Online (AJOL)

    Pharmacotherapy Group, Faculty of Pharmacy, University of Benin, Benin City, 300001 Nigeria. All rights .... (College/University). None. 11 (2.9). 116 (30.2). 251 (65.4). 6 (1.6). Employment status. Government. Private. Unemployed. Retiree. Self-employed. Student. 49 (12.8) .... improved emotional states such as happiness,.

  2. Article

    African Journals Online (AJOL)

    standard deviation (SD) 10.9). The mean empathy score was higher in 95 female students than in 63 male students (109 SD 9.8 v. 104 SD 12) (t=2.51; p<0.013). The inter-item score correlations were positive and statistically significant. Cronbach's ...

  3. Preparation of Mn-Zn ferrite nanoparticles and their silica-coated clusters: magnetic properties and transverse relaxivity

    Czech Academy of Sciences Publication Activity Database

    Kaman, Ondřej; Kuličková, Jarmila; Herynek, Vít; Koktan, Jakub; Maryško, Miroslav; Dědourková, T.; Knížek, Karel; Jirák, Zdeněk


    Roč. 427, Apr (2017), s. 251-257 ISSN 0304-8853 Institutional support: RVO:68378271 ; RVO:68378041 Keywords : magnetic nanoparticles * Mn-Zn ferrite * hydrothermal synthesis * magnetic resonance imaging * transverse relaxivity Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.630, year: 2016

  4. Lay Theories of Suicide: An Examination of Culturally Relevant Suicide Beliefs and Attributions Among African Americans and European Americans


    Walker, Rheeda L.; Lester, David; Joe, Sean


    The purpose of this study was to examine African Americans’ lay beliefs and attributions toward suicide. The Attitudes Toward Suicide Scale, Life Ownership Orientation Questionnaire, Stigma Questionnaire, and Suicide Ideation Questionnaire were administered to 251 undergraduate college students. Beliefs about stigma associated with suicide were comparable across ethnic groups. However, African American college students were significantly less likely than European American college students wer...

  5. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 316 ... Vol 8 (2004), Pharmacological Studies On Root Extract Of Vernonia amygdalina, Abstract. Jude E Okokon, Michael I Onah .... Vol 12 (2008), The Effect Of Cucumis Metuliferus E Meye (Cucurbitaceae) On Rat Gastric Functions And Mucosa Intergrity, Abstract. NN Wannang, SS Gyang, S Omale, ML ...

  6. Effectiveness of manual vacuum aspiration (MVA) in the ...

    African Journals Online (AJOL)

    Effectiveness of manual vacuum aspiration (MVA) in the management of first trimester miscarriage: Experience in a specialist centre in North-Eastern Nigeria. ... period, out of which 251 were MVA procedures performed for various first trimester miscarriages, accounting for 13.2 % of the total gynaecological admissions.

  7. Development of an electronic measurement circuit for cardiac ...

    African Journals Online (AJOL)

    In this work a simple version of human ECG isolation and measurement system has been designed and implemented. The method employed a simple instrumentation amplifier, boosted inverting and non-inverting amplifiers and a constructed chart plotter. Random tests on four persons gave 1.8mV 2.51mV and 1.80mV ...

  8. Comparison of Three Models for Predicting Altruistic Behavior (United States)

    Zuckerman, Miron; Reis, Harry T.


    This study compared three models for predicting altruistic behavior. The helping behavior (donating blood) of 251 undergraduate students was examined as a function of intention (model I), norms and ascription of responsibility (model II), and attitudes and self-monitoring (model III). (CM)

  9. 76 FR 81998 - Methodology for Low Power/Shutdown Fire PRA (United States)


    ...) 492-3446. FOR FURTHER INFORMATION CONTACT: Felix E. Gonzalez, Division of Risk Analysis, Office of...: (301) 251- 7596, email: [email protected] or Hugh W. Woods, Division of Risk Analysis, Office of... quantitative risk analyses of both internal events and fires. The NRC developed this LPSD fire quantitative...

  10. Browse Author Index

    African Journals Online (AJOL)

    Items 251 - 300 of 1337 ... Bibi, Nousheen · Bidmeshkipour, A · Boehles, H · Bolz, H · Bouayed, Nouha Abdemoula · Brousseau, T · Brown, Nick · Buchan, Rachel · Burlaka, IS ... Choudhry, AR · Chouery, Eliane · Chowdri, Nissar A. Christobher, S. Christopoulos, G · Cook, Stuart A. Corbani, Sandra · Costa, Cláudia Amorim ...

  11. 75 FR 47808 - Verde Hydro, LLC; Notice of Preliminary Permit Application Accepted for Filing and Soliciting... (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Verde Hydro, LLC; Notice of Preliminary Permit Application Accepted for... with an 823-ft length at crest and hydraulic head of 251-ft; (2) two existing 72-inch diameter steel...

  12. Ischaemic heart disease in Aminu Kano Teaching Hospital, Kano ...

    African Journals Online (AJOL)

    Forty six patients were diagnosed to have IHD giving it a prevalence of 0.9% of medical conditions and 3.4% of all cardiovascular cases. There were 33 males and 13 females (M: F = 2.5:1). Twenty two patients (47.8%) had myocardial infarction, 14(30.4%) had ischemic cardiomyopathy and 10 (21.7%) had angina.

  13. Implementing Case-Based Instruction in Higher Education through Technology: What Works Best? (United States)

    Fitzgerald, Gail; Koury, Kevin; Mitchem, Katherine; Hollingsead, Candice; Miller, Kevin; Park, Meeaeng Ko; Tsai, Hui-Hsien


    This paper reports findings from a two-year multi-site, multi-method naturalistic research project on the use of multimedia case instruction to prepare teachers for teaching students with emotional/behavioral disorders. Participants were 251 teacher education students across five universities. Independent variables included testing condition (pre…

  14. Constitutional Law--Equal Protection Does Not Protect Nonimmigrant Iranian Students from Selective Deportation--Narenji v. Civiletti. (United States)

    Fortunato, Joseph A.


    Constitutional protections must not yield to the political passions of the moment. As a result of Narenji, in international crises foreign citizens temporarily in the United States are in jeopardy of being singled out to prove their individual blamelessness. (Journal availability: Dennis & Company, 251 Main St., Buffalo, NY 14203.) (MSE)

  15. Rose Atoll Site 27P 3/9/2006 33-34M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Rose Atoll, site 27P (14 33.038S, 168 09.251W), between 33 and 34 meters along a permanent transect.

  16. Rose Atoll Site 27P 3/9/2006 16-17M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Rose Atoll, site 27P (14 33.038S, 168 09.251W), between 16 and 17 meters along a permanent transect.

  17. Rose Atoll Site 27P 3/9/2006 0-1M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Rose Atoll, site 27P (14 33.038S, 168 09.251W), between 0 and 1 meters along a permanent transect.

  18. Rose Atoll Site 27P 3/9/2006 40-41M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Rose Atoll, site 27P (14 33.038S, 168 09.251W), between 40 and 41 meters along a permanent transect.

  19. Rose Atoll Site 27P 3/9/2006 3-4M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Rose Atoll, site 27P (14 33.038S, 168 09.251W), between 3 and 4 meters along a permanent transect.

  20. Rose Atoll Site 27P 3/9/2006 18-19M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Rose Atoll, site 27P (14 33.038S, 168 09.251W), between 18 and 19 meters along a permanent transect.

  1. 33 CFR 127.003 - Incorporation by reference. (United States)


    ... NFPA 70, National Electrical Code, 1993 127.107; 127.201; 127.1107 NFPA 251, Fire Tests of Building..., (CG-543), 2100 2nd St., SW., Stop 7581, Washington, DC 20593-7581, and at the National Archives and...-6030, or go to:

  2. Download this PDF file

    African Journals Online (AJOL)


    Serazetdinova G. Hensel D. Becker H. and Lorz H. (2006). Genetic transformation of barley (Hordeum vulgare L.) via of androgenetic pollen cultures with. Agrobacterium tumefaciens. Plant Biotech. J. 4: 251-. 261. Manickam VS. Mathavan ER. and. Antonysamy R. (2000). Regeneration of Indian Ginseng plantlets from stem.

  3. Publications | Page 26 | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 251 - 260 of 6381 ... Migrants in and from cities in Southern Africa play a critical role in the informal economy, yet the importance of that role is often underestimated and even invisible to researchers and policy-makers. ... Thiamin-fortified fish sauce is an efficacious means of improving dietary thiamin intake and.

  4. The clinical utility of non-invasive prenatal testing in pregnancies with ultrasound anomalies

    NARCIS (Netherlands)

    Beulen, L; Faas, B; Feenstra, I; van Vugt, J M; Bekker, M N

    ObjectivesThis study aims to evaluate the application of non-invasive prenatal testing (NIPT) as an alternative to invasive diagnostic testing in pregnancies with abnormal ultrasound findings.MethodsA retrospective analysis was performed of 251 single and multiple pregnancies at high risk for fetal

  5. Clinical utility of non-invasive prenatal testing in pregnancies with ultrasound anomalies

    NARCIS (Netherlands)

    Beulen, L.; Faas, B.H.W.; Feenstra, I.; Vugt, J.M.G. van; Bekker, M.N.


    OBJECTIVE: To evaluate the application of non-invasive prenatal testing (NIPT) as an alternative to invasive diagnostic prenatal testing in pregnancies with abnormal ultrasound findings. METHODS: This was a retrospective analysis of 251 singleton and multiple pregnancies at high risk for fetal

  6. Trans-ancestry genome-wide association study identifies 12 genetic loci influencing blood pressure and implicates a role for DNA methylation

    NARCIS (Netherlands)

    Kato, Norihiro; Loh, Marie; Takeuchi, Fumihiko; Verweij, Niek; Wang, Xu; Zhang, Weihua; Kelly, Tanika N.; Saleheen, Danish; Lehne, Benjamin; Leach, Irene Mateo; Drong, Alexander W.; Abbott, James; Wahl, Simone; Tan, Sian-Tsung; Scott, William R.; Campanella, Gianluca; Chadeau-Hyam, Marc; Afzal, Uzma; Ahluwalia, Tarunveer S.; Bonder, Marc Jan; Chen, Peng; Dehghan, Abbas; Edwards, Todd L.; Esko, Tonu; Go, Min Jin; Harris, Sarah E.; Hartiala, Jaana; Kasela, Silva; Kasturiratne, Anuradhani; Khor, Chiea-Chuen; Kleber, Marcus E.; Li, Huaixing; Mok, Zuan Yu; Nakatochi, Masahiro; Sapari, Nur Sabrina; Saxena, Richa; Stewart, Alexandre F. R.; Stolk, Lisette; Tabara, Yasuharu; Teh, Ai Ling; Wu, Ying; Wu, Jer-Yuarn; Zhang, Yi; Aits, Imke; Alves, Alexessander Da Silva Couto; Das, Shikta; Dorajoo, Rajkumar; Hopewell, Jemma C.; Kim, Yun Kyoung; Koivula, Robert W.; Luan, Jian'an; Lyytikainen, Leo-Pekka; Nguyen, Quang N.; Pereira, Mark A.; Postmus, Iris; Raitakari, Olli T.; Bryan, Molly Scannell; Scott, Robert A.; Sorice, Rossella; Tragante, Vinicius; Traglia, Michela; White, Jon; Yamamoto, Ken; Zhang, Yonghong; Adair, Linda S.; Ahmed, Alauddin; Akiyama, Koichi; Asif, Rasheed; Aung, Tin; Barroso, Ines; Bjonnes, Andrew; Braun, Timothy R.; Cai, Hui; Chang, Li-Ching; Chen, Chien-Hsiun; Cheng, Ching-Yu; Chong, Yap-Seng; Collins, Rory; Courtney, Regina; Davies, Gail; Delgado, Graciela; Do, Loi D.; Doevendans, Pieter A.; Gansevoort, Ron T.; Gao, Yu-Tang; Grammer, Tanja B.; Grarup, Niels; Grewal, Jagvir; Gu, Dongfeng; Wander, Gurpreet S.; Hartikainen, Anna-Liisa; Hazen, Stanley L.; He, Jing; Heng, Chew-Kiat; Hixson, James E.; Hofman, Albert; Hsu, Chris; Huang, Wei; Husemoen, Lise L. N.; Hwang, Joo-Yeon; Ichihara, Sahoko; Igase, Michiya; Isono, Masato; Justesen, Johanne M.; Katsuy, Tomohiro; Kibriya, Muhammad G.; Kim, Young Jin; Kishimoto, Miyako; Koh, Woon-Puay; Kohara, Katsuhiko; Kumari, Meena; Kwek, Kenneth; Lee, Nanette R.; Lee, Jeannette; Liao, Jiemin; Lieb, Wolfgang; Liewald, David C. M.; Matsubara, Tatsuaki; Matsushita, Yumi; Meitinger, Thomas; Mihailov, Evelin; Milani, Lili; Mills, Rebecca; Mononen, Nina; Mueller-Nurasyid, Martina; Nabika, Toru; Nakashima, Eitaro; Ng, Hong Kiat; Nikus, Kjell; Nutile, Teresa; Ohkubo, Takayoshi; Ohnaka, Keizo; Parish, Sarah; Paternoster, Lavinia; Peng, Hao; Peters, Annette; Pham, Son T.; Pinidiyapathirage, Mohitha J.; Rahman, Mahfuzar; Rakugi, Hiromi; Rolandsson, Olov; Rozario, Michelle Ann; Ruggiero, Daniela; Sala, Cinzia F.; Sarju, Ralhan; Shimokawa, Kazuro; Snieder, Harold; Sparso, Thomas; Spiering, Wilko; Starr, John M.; Stott, David J.; Stram, Daniel O.; Sugiyama, Takao; Szymczak, Silke; Tang, W. H. Wilson; Tong, Lin; Trompet, Stella; Turjanmaa, Vaino; Ueshima, Hirotsugu; Uitterlinden, Andre G.; Umemura, Satoshi; Vaarasmaki, Marja; van Dam, Rob M.; van Gilst, Wiek H.; van Veldhuisen, Dirk J.; Viikari, Jorma S.; Waldenberger, Melanie; Wang, Yiqin; Wang, Aili; Wilson, Rory; Wong, Tien-Yin; Xiang, Yong-Bing; Yamaguchi, Shuhei; Ye, Xingwang; Young, Robin D.; Young, Terri L.; Yuan, Jian-Min; Zhou, Xueya; Asselbergs, Folkert W.; Ciullo, Marina; Clarke, Robert; Deloukas, Panos; Franke, Andre; Franks, Paul W.; Franks, Steve; Friedlander, Yechiel; Gross, Myron D.; Guo, Zhirong; Hansen, Torben; Jarvelin, Marjo-Riitta; Jorgensen, Torben; Jukema, J. Wouter; Kahonen, Mika; Kajio, Hiroshi; Kivimaki, Mika; Lee, Jong-Young; Lehtimaki, Terho; Linneberg, Allan; Miki, Tetsuro; Pedersen, Oluf; Samani, Nilesh J.; Sorensen, Thorkild I. A.; Takayanagi, Ryoichi; Toniolo, Daniela; Ahsan, Habibul; Allayee, Hooman; Chen, Yuan-Tsong; Danesh, John; Deary, Ian J.; Franco, Oscar H.; Franke, Lude; Heijman, Bastiaan T.; Holbrook, Joanna D.; Isaacs, Aaron; Kim, Bong-Jo; Lin, Xu; Liu, Jianjun; Maerz, Winfried; Metspalu, Andres; Mohlke, Karen L.; Sanghera, Dharambir K.; Shu, Xiao-Ou; van Meurs, Joyce B. J.; Vithana, Eranga; Wickremasinghe, Ananda R.; Wijmenga, Cisca; Wolffenbuttel, Bruce H. W.; Yokota, Mitsuhiro; Zheng, Wei; Zhu, Dingliang; Vineis, Paolo; Kyrtopoulos, Soterios A.; Kleinjans, Jos C. S.; McCarthy, Mark I.; Soong, Richie; Gieger, Christian; Scott, James; Teo, Yik-Ying; He, Jiang; Elliott, Paul; Tai, E. Shyong; van der Harst, Pim; Kooner, Jaspal S.; Chambers, John C.


    We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 x 10(-11) to 5.0 x

  7. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 448 ... Tropical Journal of Animal Science. ... Vol 3, No 1 (2000), Influence of housing conditions and type of finishing feeds on the oxidative stability of broiler-chicken muscles, Abstract. GE Onibi, EAO Laseinde, S Akinyandenu. Vol 18, No 2 (2016), Influence of Human Chorionic Gonadotropin on the Fertility ...

  8. Anxiety, depression, and perception of early parenting: A meta-analysis. Erratum

    NARCIS (Netherlands)

    Gerlsma, C.; Emmelkamp, P.M.G.; Arrindell, W.A.


    Reports an error in the original article by C. Gerlsma et al (Clinical Psychology Review, 1990, Vol 10[3], 251-277). Corrections are made to the 1st and 3rd formulas on page 257 and to Table 1, page 258, and Table 1, page 261."

  9. Disease: H01033 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available s (CF) that is characterized by progressive lung disease, pancreatic dysfunction, elevated sweat electrolytes, and male infertility... polymorphisms in male infertility. ... JOURNAL ... Int J Androl 27:251-6 (2004) DOI:10.1111/j.1365-2605.2004.00...ription , gene) ... AUTHORS ... Cuppens H, Cassiman JJ ... TITLE ... CFTR mutations and

  10. 75 FR 77859 - Notice of Intent To Prepare a Programmatic Environmental Impact Statement for the Hawai‘i... (United States)


    ... improvements to the existing electric transmission infrastructure in Hawai`i. This EIS is the first phase of a... State Library, 478 South King Street, Honolulu HI 96813. L na`i Public and School Library, 555 Fraser Ave, L na`i City, HI 96763. Wailuku Public Library, 251 High Street, Wailuku, HI 96793. Moloka`i...

  11. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 650 ... Vol 9, No 2 (2016), Evaluation of antiulcer activity of aqueous ethanol extract of Thesium viride on ethanol and aspirin induced models in rats, Abstract PDF .... Vol 3, No 1 (2010), First-principle calculation of electrons charge density in the diamond–structure semiconductor crystals, Abstract PDF.

  12. 782-IJBCS-Article-Rose Masalu

    African Journals Online (AJOL)


    penicillin (PS) was added at a concentration of. 1 µg/ml. The flasks were properly labeled and ..... Process. Biochem., 42: 1449-1453. Lam KS. 2006. Discovery of novel metabolites from marine actinomycetes. Curr. Opin. Microbiol, 9: 245-251. Masoko P, Eloff JN. 2007. Screening of twenty-four South African Combretum and.

  13. The Impact of Trade Openness on Poverty via Agricultural TFP in ...

    African Journals Online (AJOL)

    preferred customer

    Agricultural TFP in Ethiopia: A Sequential Dynamic. Computable ... Ethiopia. Tel: +251 913317493; E-mail:, .... between Morocco and EU, and those of Egypt and EU. They found that trade induced TFP contributes a lot in the reduction of poverty in Morocco and. Egypt.

  14. Management and use of dairy cattle feed resources on smallholder certified organic pineapple farms in Central Uganda

    DEFF Research Database (Denmark)

    Kiggundu, Muhammad; Kabi, Fred; Vaarst, Mette


    as major dairy cattle feed resources while only 19% reported using elephant grass. Banana peels (25.1%) and sweet potato vines (24.7%) were the most important crop residues fed to cattle. Farmers reported high cost of concentrates and scarcity of feeds as their biggest challenges in dairy cattle production...

  15. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 1027 ... Vol 28, No 3-4 (2006), Comparison of assemblages and some life-history traits of seabirds in the Humboldt and Benguela systems, Abstract. RJM Crawford, E ... Vol 21 (1999), Comparison of trends in abundance of guano-producing seabirds in Peru and Southern Africa, Abstract PDF. RJM Crawford ...

  16. 78 FR 33705 - Postdecisional Administrative Review Process for Occupancy or Use of National Forest System Lands... (United States)


    ..., 222, 228, 241, 251, 254, and 292 RIN 0596-AB45 Postdecisional Administrative Review Process for... encourages informal dispute resolution. Section 214.6(b) in the final rule requires the Responsible Official... informal resolution and appeal rights in an appealable decision. This respondent believed that Responsible...

  17. Science, Technology and Arts Research Journal - Vol 4, No 2 (2015)

    African Journals Online (AJOL)

    Treatment of Sugar Industry Effluent using Microbial Fuel Cells · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. MPD Prasad, V Sridevi, N Aswini, A Vamsi Krishna Reddy, PA Satyanarayana, 247-251. ...

  18. Data of evolutionary structure change: 1CERA-1VSVC [Confc[Archive

    Lifescience Database Archive (English)


  19. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 437 ... Vol 7, No 1 (2010), Piracy Of Some Copyrighted Information Materials Among Students Of Olabisi Onabanjo University, Ago Iwoye, Ogun State, Nigeria, Abstract. OM Bankole. Vol 6, No 2 (2009), Potentials of fee-based library services in Nigeria: with a case report of a fee-based service in a medical ...

  20. Author Index

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    see Navathe C P. 213. Sampath S see Wang Guo-Xiang. 35. Sawhney K J S see Sinha A K. 591. Seetharamu K N. Finite element modelling of solidification phenomena. 103. Seetharamu K N see Patnaik V S Varaprasad. 251. Sekhar M see Hari Prasad K S. 517. Sengupta P R. Surface waves in fibre-reinforced anisotropic.

  1. Modeling HIV Risk in Highly Vulnerable Youth (United States)

    Huba, G. J.; Panter, A. T.; Melchior, Lisa A.; Trevithick, Lee; Woods, Elizabeth R.; Wright, Eric; Feudo, Rudy; Tierney, Steven; Schneir, Arlene; Tenner, Adam; Remafedi, Gary; Greenberg, Brian; Sturdevant, Marsha; Goodman, Elizabeth; Hodgins, Antigone; Wallace, Michael; Brady, Russell E.; Singer, Barney; Marconi, Katherine


    This article examines the structure of several HIV risk behaviors in an ethnically and geographically diverse sample of 8,251 clients from 10 innovative demonstration projects intended for adolescents living with, or at risk for, HIV. Exploratory and confirmatory factor analyses identified 2 risk factors for men (sexual intercourse with men and a…

  2. The psychological coping, learning potential and career preferences profiles of operational force military candidates

    CSIR Research Space (South Africa)

    De Beer, M


    Full Text Available The aim of this study was to profile the psychological coping, learning potential and career-related interests of 251 candidates for operational force military selection for the South African National Defence Force (SANDF) – 26 of whom were...

  3. 41 CFR 101-25.108 - Multiyear subscriptions for publications. (United States)


    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Multiyear subscriptions...-GENERAL 25.1-General Policies § 101-25.108 Multiyear subscriptions for publications. Subscriptions for... the purpose of economy or otherwise. Where various bureaus or offices in the same agency are...

  4. Inventarisatie van de landslakken van Noord-Brabant (Mollusca: Gastropoda).

    NARCIS (Netherlands)

    Boesveld, A


    The distribution of the land snails of the province of Noord-Brabant (Mollusca: Gastropoda) In 2003 and 2004 the landsnail fauna of the province of Noord-Brabant (in the south of the Netherlands) was mapped. In total 251 soil and litter samples were taken and on 272 localities records were gathered

  5. 41 CFR 101-25.103-3 - Trading stamps or bonus goods received from contractors. (United States)


    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Trading stamps or bonus... PROCUREMENT 25-GENERAL 25.1-General Policies § 101-25.103-3 Trading stamps or bonus goods received from contractors. When contracts contain a price reduction clause, any method (such as trading stamps or bonus...

  6. Skin malignancies in Ibadan: a comparative study | Gana | Nigerian ...

    African Journals Online (AJOL)

    This was followed by malignant melanoma (25.1%), dermatofibrosarcoma protuberance (9.5%), Kaposi's sarcoma 8.3% and basal cell carcinoma (6.7%). Less common histological types included adenocarcinoma, undifferentiated carcinoma, mucoepidermoid carcinoma, adenoid cystic carcinoma, fibrosarcoma and ...

  7. Reporting of Inpatient Data (United States)


    ISLANDS (OBSOLETE - SEE JA) YQ YEMEN ( ADEN ) YS ZA ZAMBIA ZI ZIMBABWE 2 2-2-6 • • • •• • • Apr 6, 886040.39 (Encl 2) TRI-SERVICE BENEFICIARY CATEGORIES...n.e.c ............. .................... .. 093 cervical ............ .................... .. 093 2-5-1 4 I =- ~ mmm lm’ m RESIDUAL DISABILITIES

  8. 49 CFR 193.2517 - Purging. (United States)


    ... 49 Transportation 3 2010-10-01 2010-10-01 false Purging. 193.2517 Section 193.2517 Transportation Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) PIPELINE SAFETY LIQUEFIED NATURAL GAS FACILITIES: FEDERAL SAFETY STANDARDS Operations § 193.251...

  9. Dicty_cDB: SHF189 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available s of Diseases Associated with Cell Cycle. 46 2e-04 3 BD452918 |BD452918.1 Diagnosis of Diseases Associated of Diseases Associated with Cell Cycle. 46 2e-04 3 AX795908 |AX795908.1 Sequence 251 from Patent WO030521

  10. Medication Administration Errors Involving Paediatric In-Patients in a ...

    African Journals Online (AJOL)


    gentamicin, ampicillin, cloxacillin and crystalline penicillin. Keywords: Medication administration error, Omission error, Wrong dose, Wrong administration technique, Unauthorized drug. Received: 29 June 2009. Revised accepted: 22 May 2010. *Corresponding author: E-mail:; Tel: +251- 913- ...

  11. Exploring Academic Motivation, Academic Self-Efficacy and Attitudes toward Teaching in Pre-Service Early Childhood Education Teachers (United States)

    Bedel, Emine Ferda


    This study is designed to explore academic motivation, academic self-efficacy and attitudes toward teaching in pre-service early childhood education teachers and to investigate the relationships among those variables. Data were gathered through questionnaires administered to 251 pre-service early childhood education teachers. Results indicated…

  12. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 985 ... Vol 30 (2015), Design and Construction of a Home Automation System Using a Smart Phone, Abstract. Patrick Oshevire, Raphael Akanuoh, ... Vol 19 (2011), Determination of utilizable wind energy for indoor ventilation in buildings across selected locations in Nigeria, Abstract. M Ocholi, EE Iheonu.


    African Journals Online (AJOL)

    genome (Puterka et al., 2006). In South Africa, RWASA-1 resistant cultivars have only been developed for wheat (Triticum aestivum. L.). By 2007 ..... (citrus Sinensis Osbeck) Stored at Ambient Tropical Condition. 251. Ogungbesan G.O. and Akaegbobi I.M.. Petrography and Geochemistry of Turonian Eze-aku. Sandstone ...

  14. The Budding SV3: Estimating the Cost of Architectural Growth Early in the Life Cycle (United States)


    Year 2013 Pursuant to Section 251A of the Balanced Budget and Emergency Deficit Control Act, as Amended , 78:44 Federal Register 14633 (March 6, 2013...implicit connections from v2.02 manual AV CV DIV OV - all (2 models) - capability (7 models) - data and information (3 models) - operational (9 models) PV

  15. Browse Author Index

    African Journals Online (AJOL)

    Chakour, K · Chaouchi, I 251 - 300 of 1298 Items >>. ISSN: 1015-8618. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL · News. OTHER RESOURCES.

  16. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 1427 ... Vol 12, No 1 (2012), Changes in plasma IL4, TNFá and CRP in response to regular passive smoking at home among healthy school children in Khartoum, Sudan, Abstract PDF. TH Merghani, A Saeed, A Alawad. Vol 13, No 4 (2013), Changes in platelet functional parameters and CD62 P expression ...

  17. 77 FR 56067 - Changes To Implement Derivation Proceedings (United States)


    ... offering written comments from intellectual property organizations, businesses, law firms, patent... publication by the USPTO of an application for patent or by the World Intellectual Property Organization (WIPO.... Response to Comments The Office received 251 written submissions of comments from intellectual property...

  18. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 635 ... Vol 6, No 6 (2013): Supplement, Effects of Project-Related Factors on Construction Labour Productivity in Bayelsa State of Nigeria, Abstract PDF. IA Odesola, M Otali, DI Ikediashi. Vol 7, No 6 (2014), Effects of treated poultry litter on potential greenhouse gas emission and field agronomic performance ...

  19. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 683 ... Colleen T Downs. Vol 88, No 1 (2017), Gill Memorial Medal Address 2014: Reviewing the Red Bishop: The bird that introduced me to ornithology, Abstract ... Anthony Cizek. Vol 87, No 2 (2016), Habitat selection of the Black-shouldered Kite Elanus caeruleus in agroecosystems of Swaziland, Abstract.

  20. Browse Title Index

    African Journals Online (AJOL)

    Items 251 - 300 of 390 ... CO Ifeadike, OC Ironkwe, POU Adogu, CC Nnebue, OF Emelumadu, SA Nwabueze, CF Ubajaka. Vol 55, No 1 (2014), Prevalence and predictors of obstructive sleep apnea syndrome in a sample of patients with type 2 Diabetes Mellitus in Nigeria, Abstract. D O Obaseki, B A Kolawole, S S Gomerep, ...